Science.gov

Sample records for achieving target bp

  1. Comparing Science Achievement Constructs: Targeted and Achieved

    ERIC Educational Resources Information Center

    Ferrara, Steve; Duncan, Teresa

    2011-01-01

    This article illustrates how test specifications based solely on academic content standards, without attention to other cognitive skills and item response demands, can fall short of their targeted constructs. First, the authors inductively describe the science achievement construct represented by a statewide sixth-grade science proficiency test.…

  2. JS ISH-ISN-3 OPTIMAL TARGETS FOR BP CONTROL IN CKD.

    PubMed

    Wheeler, David

    2016-09-01

    Hypertension is the most prevalent complication of chronic kidney disease (CKD). Lowering high blood pressure slows progressive loss of kidney function and may also reduce the associated risk of cardiovascular complications, a common cause of premature death in CKD patients.Current International Guidelines produced by Kidney Disease: Improving Global Outcomes (KDIGO) acknowledges that no single BP target is optimal for all CKD patients, and encourages individualization of treatment depending on age, the severity of albuminuria and comorbidities. When published in 2012, the available evidence indicated that in CKD patients without albuminuria, the target BP should be ≤140 mmHg systolic and ≤90 mmHg diastolic. However, in most patients with an albumin excretion rate of ≥30 mg/24 h (i.e., those with both micro- and macroalbuminuria), a lower target of ≤130 mmHg systolic and ≤80 mmHg diastolic was suggested. In achieving BP control, the value of lifestyle changes and the need for multiple pharmacological agents was acknowledged. Use of agents that block the renin-angiotensin-aldosterone system was recommended or suggested in all patients with an albumin excretion rate of ≥30 mg/24 h. Recommendations are almost identical in CKD patients with and without diabetes.Recent data from SPRINT (which included CKD patients) and other clinical trials has led nephrologists to ask whether targets lower than those recommend by KDIGO are appropriate and the guidelines are currently undergoing an update. Controversies remain around discontinuation of ACE/ARB in patients with stage 4-5 CKD and dual renin-angiotensin-aldosterone system blockade. PMID:27642915

  3. RNA-binding protein IGF2BP3 targeting of oncogenic transcripts promotes hematopoietic progenitor proliferation

    PubMed Central

    Palanichamy, Jayanth Kumar; Tran, Tiffany M.; Howard, Jonathan M.; Contreras, Jorge R.; Fernando, Thilini R.; Sterne-Weiler, Timothy; Katzman, Sol; Toloue, Masoud; Yan, Weihong; Sanford, Jeremy R.; Rao, Dinesh S.

    2016-01-01

    Posttranscriptional control of gene expression is important for defining both normal and pathological cellular phenotypes. In vitro, RNA-binding proteins (RBPs) have recently been shown to play important roles in posttranscriptional regulation; however, the contribution of RBPs to cell specification is not well understood. Here, we determined that the RBP insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) is specifically overexpressed in mixed lineage leukemia–rearranged (MLL-rearranged) B-acute lymphoblastic leukemia (B-ALL), which constitutes a subtype of this malignancy associated with poor prognosis and high risk of relapse. IGF2BP3 was required for the survival of B-ALL cell lines, as knockdown led to decreased proliferation and increased apoptosis. Enforced expression of IGF2BP3 provided murine BM cells with a strong survival advantage, led to proliferation of hematopoietic stem and progenitor cells, and skewed hematopoietic development to the B cell/myeloid lineage. Cross-link immunoprecipitation and high throughput sequencing uncovered the IGF2BP3-regulated transcriptome, which includes oncogenes MYC and CDK6 as direct targets. IGF2BP3 regulated transcripts via targeting elements within 3′ untranslated regions (3′UTR), and enforced IGF2BP3 expression in mice resulted in enhanced expression of Myc and Cdk6 in BM. Together, our data suggest that IGF2BP3-mediated targeting of oncogenic transcripts may represent a critical pathogenetic mechanism in MLL-rearranged B-ALL and support IGF2BP3 and its cognate RNA-binding partners as potential therapeutic targets in this disease. PMID:26974154

  4. RNA-binding protein IGF2BP3 targeting of oncogenic transcripts promotes hematopoietic progenitor proliferation.

    PubMed

    Palanichamy, Jayanth Kumar; Tran, Tiffany M; Howard, Jonathan M; Contreras, Jorge R; Fernando, Thilini R; Sterne-Weiler, Timothy; Katzman, Sol; Toloue, Masoud; Yan, Weihong; Basso, Giuseppe; Pigazzi, Martina; Sanford, Jeremy R; Rao, Dinesh S

    2016-04-01

    Posttranscriptional control of gene expression is important for defining both normal and pathological cellular phenotypes. In vitro, RNA-binding proteins (RBPs) have recently been shown to play important roles in posttranscriptional regulation; however, the contribution of RBPs to cell specification is not well understood. Here, we determined that the RBP insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) is specifically overexpressed in mixed lineage leukemia-rearranged (MLL-rearranged) B-acute lymphoblastic leukemia (B-ALL), which constitutes a subtype of this malignancy associated with poor prognosis and high risk of relapse. IGF2BP3 was required for the survival of B-ALL cell lines, as knockdown led to decreased proliferation and increased apoptosis. Enforced expression of IGF2BP3 provided murine BM cells with a strong survival advantage, led to proliferation of hematopoietic stem and progenitor cells, and skewed hematopoietic development to the B cell/myeloid lineage. Cross-link immunoprecipitation and high throughput sequencing uncovered the IGF2BP3-regulated transcriptome, which includes oncogenes MYC and CDK6 as direct targets. IGF2BP3 regulated transcripts via targeting elements within 3' untranslated regions (3'UTR), and enforced IGF2BP3 expression in mice resulted in enhanced expression of Myc and Cdk6 in BM. Together, our data suggest that IGF2BP3-mediated targeting of oncogenic transcripts may represent a critical pathogenetic mechanism in MLL-rearranged B-ALL and support IGF2BP3 and its cognate RNA-binding partners as potential therapeutic targets in this disease.

  5. A DNA target of 30 bp is sufficient for RNA-directed DNA methylation.

    PubMed

    Pélissier, T; Wassenegger, M

    2000-01-01

    In higher plants, RNA-DNA interactions can trigger de novo methylation of genomic sequences via a process that is termed RNA-directed DNA methylation (RdDM). In potato spindle tuber viroid (PSTVd)-infected tobacco plants, this process can potentially lead to methylation of all C residues at symmetrical and nonsymmetrical sites within chromosomal inserts that consist of multimers of the 359-bp-long PSTVd cDNA. Using PSTVd cDNA subfragments, we found that genomic targets with as few as 30 nt of sequence complementarity to the viroid RNA are detected and methylated. Genomic sequencing analyses of genome-integrated 30- and 60-bp-long PSTVd subfragments demonstrated that de novo cytosine methylation is not limited to the canonical CpG, CpNpG sites. Sixty-base-pair-long PSTVd cDNA constructs appeared to be densely methylated in nearly all tobacco leaf cells. With the 30-bp-long PSTVd-specific construct, the proportion of cells displaying dense transgene methylation was significantly reduced, suggesting that a minimal target size of about 30 bp is necessary for RdDM. The methylation patterns observed for two different 60-bp constructs further suggested that the sequence identity of the target may influence the methylation mechanism. Finally, a link between viroid pathogenicity and PSTVd RNA-directed methylation of host sequences is proposed. PMID:10668798

  6. Based on momentum method BP neural network in the target recognition research and application

    NASA Astrophysics Data System (ADS)

    Zhang, Xue-feng; Gao, Yu-bin

    2011-08-01

    Target recognition is measured by treating target existing knowledge to judge, analyze, and thus the process of target identification. Using anti-vibration lateral shearing interferometer to get the interference fringe for the spectrum information of measurement target, and the system can get the target by spectrum identification algorithm. By the condition that interferometer's length isn't changed, the system was optimized by momentum BP Neural Network algorithm in the separating mixed spectrum process, therefore it could improve the probability of camouflage target recognition. The spectrum information was calculated by the fringes, to getting the mixed spectrum data. The absorption spectrum was in the hidden layer, and the system obtained every kinds of characteristic spectrum from mixed spectrum by the momentum BP Neural Network. Experiments showed that it collected mixed spectrum of background form different distances and different surface, and made them to the initial spectrum information. The test target was a board that it's surface was made to four kinds, and there was no paint (A), brushing camouflage paint of military green (B), brushing camouflage paint of irregular shape (C) and brushing camouflage paint of irregular box (D). The mixed spectrum was obtained from the anti-vibration lateral shearing interferometer, while the recognition probability for non-camouflage target were above 90.0% by the traditional algorithm and the momentum BP neural network algorithm, but the recognition probability for camouflage target was 85.6% by momentum BP neural network algorithm, better than 41.5% by the traditional algorithm, so it proved that the algorithm could improve the recognition probability for camouflage target effectively.

  7. BP Targets in Hypertension: What Should We Do Now That SPRINT Is Out?

    PubMed

    Bhatt, Hemal; Ghazi, Lama; Calhoun, David; Oparil, Suzanne

    2016-10-01

    Systolic blood pressure (SBP) is an important predictor of cardiovascular disease (CVD) outcomes. Lowering SBP has been shown to reduce CVD morbidity and mortality, but the optimal SBP target continues to be a topic of intense debate. The Systolic Blood Pressure Intervention Trial (SPRINT) reported a significantly lower risk for CVD outcomes and all-cause mortality by targeting SBP <120 mmHg compared with <140 mmHg in a population of hypertensive persons at high CV risk. In this review, we discuss the strengths, limitations, and generalizability of SPRINT findings to other hypertensive populations that were excluded from the trial, including those with diabetes or prior stroke, <50 years old, and at lower CVD risk. We will focus on the implications of SPRINT findings for appropriate BP targets in high-risk groups of hypertensive persons, including the elderly and those with chronic kidney disease (CKD). We will also address the cost-effectiveness of intensive BP treatment as implemented in SPRINT and the implications of SPRINT for health care policy and future BP guidelines.

  8. SY 07-3 WHICH BP LEVELS ARE ADEQUATE TARGETS FOR THE MANAGEMENT OF DIABETIC HYPERTENSIVE PATIENTS IN ASIA?

    PubMed

    Eguchi, Kazuo

    2016-09-01

    In patients with type 2 diabetes, prevention of future cardiovascular disease is an ultimate goal in the management. Coexistence of diabetes and hypertension enhances cardiovascular risk, and antihypertensive therapy has been shown to be very effective method in reducing micro- and macrovascular complications of type 2 diabetes. However, the optimal target BP levels are still under debate. Most of the international guidelines have raised the target clinic BP from 130/80 mmHg to 140/90 mmHg, but the Japanese Society of Hypertension 2014 guideline kept the target BP level as below 130/80 mmHg. However, individualized BP-lowering treatment should be considered in patients with type 2 diabetes: in high-risk individuals such as those with a history of stroke or retinopathy, aggressive antihypertensive therapy targeting below 130 mmHg should be applied even when the initial SBP level is <140 mmHg. Recently, we performed studies concerning the BP target levels of clinic and home BP in patients with type 2 diabetes. In this session, we will show the preliminary results of these target levels and discuss how we should manage hypertension in patients with type 2 diabetes. PMID:27642961

  9. Synergies and trade-offs in achieving global biodiversity targets.

    PubMed

    Di Marco, Moreno; Butchart, Stuart H M; Visconti, Piero; Buchanan, Graeme M; Ficetola, Gentile F; Rondinini, Carlo

    2016-02-01

    After their failure to achieve a significant reduction in the global rate of biodiversity loss by 2010, world governments adopted 20 new ambitious Aichi biodiversity targets to be met by 2020. Efforts to achieve one particular target can contribute to achieving others, but different targets may sometimes require conflicting solutions. Consequently, lack of strategic thinking might result, once again, in a failure to achieve global commitments to biodiversity conservation. We illustrate this dilemma by focusing on Aichi Target 11. This target requires an expansion of terrestrial protected area coverage, which could also contribute to reducing the loss of natural habitats (Target 5), reducing human-induced species decline and extinction (Target 12), and maintaining global carbon stocks (Target 15). We considered the potential impact of expanding protected areas to mitigate global deforestation and the consequences for the distribution of suitable habitat for >10,000 species of forest vertebrates (amphibians, birds, and mammals). We first identified places where deforestation might have the highest impact on remaining forests and then identified places where deforestation might have the highest impact on forest vertebrates (considering aggregate suitable habitat for species). Expanding protected areas toward locations with the highest deforestation rates (Target 5) or the highest potential loss of aggregate species' suitable habitat (Target 12) resulted in partially different protected area network configurations (overlapping with each other by about 73%). Moreover, the latter approach contributed to safeguarding about 30% more global carbon stocks than the former. Further investigation of synergies and trade-offs between targets would shed light on these and other complex interactions, such as the interaction between reducing overexploitation of natural resources (Targets 6, 7), controlling invasive alien species (Target 9), and preventing extinctions of native

  10. VprBP Has Intrinsic Kinase Activity Targeting Histone H2A and Represses Gene Transcription

    PubMed Central

    Kim, Kyunghwan; Kim, Jin-Man; Kim, Joong-Sun; Choi, Jongkyu; Lee, Yong Suk; Neamati, Nouri; Song, Jin Sook; Heo, Kyu; An, Woojin

    2013-01-01

    SUMMARY Histone modifications play important roles in the regulation of gene expression and chromatin organization. VprBP has been implicated in transcriptionally silent chromatin formation and cell cycle regulation, but the molecular basis underlying such effects remains unclear. Here we report that VprBP possesses an intrinsic protein kinase activity and is capable of phosphorylating histone H2A on threonine 120 (H2AT120p) in a nucleosomal context. VprBP is localized to a large set of tumor suppressor genes and blocks their transcription, in a manner that is dependent on its kinase activity toward H2AT120. The functional significance of VprBP-mediated H2AT120p is further underscored by the fact that RNAi knockdown and small-molecule inhibition of VprBP reactivate growth regulatory genes and impede tumor growth. Our findings establish VprBP as a major kinase responsible for H2AT120p in cancer cells and suggest that VprBP inhibition could be a new strategy for the development of anticancer therapeutics. PMID:24140421

  11. CtBP1 associates metabolic syndrome and breast carcinogenesis targeting multiple miRNAs.

    PubMed

    De Luca, Paola; Dalton, Guillermo N; Scalise, Georgina D; Moiola, Cristian P; Porretti, Juliana; Massillo, Cintia; Kordon, Edith; Gardner, Kevin; Zalazar, Florencia; Flumian, Carolina; Todaro, Laura; Vazquez, Elba S; Meiss, Roberto; De Siervi, Adriana

    2016-04-01

    Metabolic syndrome (MeS) has been identified as a risk factor for breast cancer. C-terminal binding protein 1 (CtBP1) is a co-repressor of tumor suppressor genes that is activated by low NAD+/NADH ratio. High fat diet (HFD) increases intracellular NADH. We investigated the effect of CtBP1 hyperactivation by HFD intake on mouse breast carcinogenesis. We generated a MeS-like disease in female mice by chronically feeding animals with HFD. MeS increased postnatal mammary gland development and generated prominent duct patterns with markedly increased CtBP1 and Cyclin D1 expression. CtBP1 induced breast cancer cells proliferation. Serum from animals with MeS enriched the stem-like/progenitor cell population from breast cancer cells. CtBP1 increased breast tumor growth in MeS mice modulating multiple genes and miRNA expression implicated in cell proliferation, progenitor cells phenotype, epithelial to mesenchymal transition, mammary development and cell communication in the xenografts. These results define a novel function for CtBP1 in breast carcinogenesis.

  12. CtBP1 associates metabolic syndrome and breast carcinogenesis targeting multiple miRNAs

    PubMed Central

    De Luca, Paola; Dalton, Guillermo N.; Scalise, Georgina D.; Moiola, Cristian P.; Porretti, Juliana; Massillo, Cintia; Kordon, Edith; Gardner, Kevin; Zalazar, Florencia; Flumian, Carolina; Todaro, Laura; Vazquez, Elba S.; Meiss, Roberto; De Siervi, Adriana

    2016-01-01

    Metabolic syndrome (MeS) has been identified as a risk factor for breast cancer. C-terminal binding protein 1 (CtBP1) is a co-repressor of tumor suppressor genes that is activated by low NAD+/NADH ratio. High fat diet (HFD) increases intracellular NADH. We investigated the effect of CtBP1 hyperactivation by HFD intake on mouse breast carcinogenesis. We generated a MeS-like disease in female mice by chronically feeding animals with HFD. MeS increased postnatal mammary gland development and generated prominent duct patterns with markedly increased CtBP1 and Cyclin D1 expression. CtBP1 induced breast cancer cells proliferation. Serum from animals with MeS enriched the stem-like/progenitor cell population from breast cancer cells. CtBP1 increased breast tumor growth in MeS mice modulating multiple genes and miRNA expression implicated in cell proliferation, progenitor cells phenotype, epithelial to mesenchymal transition, mammary development and cell communication in the xenografts. These results define a novel function for CtBP1 in breast carcinogenesis. PMID:26933806

  13. miR-506 inhibits the proliferation and invasion by targeting IGF2BP1 in glioblastoma

    PubMed Central

    Luo, Yonggang; Sun, Ranran; Zhang, Jun; Sun, Tongwen; Liu, Xianzhi; Yang, Bo

    2015-01-01

    Increasing evidence has indicated that microRNAs (miRNAs) play an essential role in cancers. Deregulation of miR-506 was reported in several cancers. However, the expression and function of miR-506 in glioblastoma remain unclear. Our data showed that the level of miR-506 was downregulated in glioblastoma tissues and cell lines. Overexpression of miR-506 repressed cell growth, blocked G1/S transition, and suppressed cell invasion in glioblastoma cell. Moreover, IGF2BP1 was a direct target of miR-506 in glioblastoma cells. Knockdown of IGF2BP1 recapitulated the anti-proliferative and anti-invasive effects of miR-506, whereas IGF2BP1 overexpression antagonized the tumor-suppressive function of miR-506. Our data showed that miRNA-506 played a tumor suppressor gene role in human glioblastoma by regulating IGF2BP1 gene and might be a new therapeutic target of human glioblastoma. PMID:26692944

  14. What would it take to achieve the Paris temperature targets?

    NASA Astrophysics Data System (ADS)

    Sanderson, Benjamin M.; O'Neill, Brian C.; Tebaldi, Claudia

    2016-07-01

    The 2015 Paris Agreement aims to limit warming to 2 or 1.5°C above preindustrial level, although combined Intended Nationally Determined Contributions (INDCs) are likely insufficient to achieve these targets. We propose a set of idealized emission pathways consistent with the targets. If countries reduce emissions in line with their INDCs, the 2°C threshold could be avoided only if net zero greenhouse gas emissions (GHGEs) are achieved by 2085 and late century negative emissions are considerably in excess of those assumed in Representative Concentration Pathway (RCP) 2.6 (net -5 Gt CO2/yr, compared with -1.5 Gt CO2/yr in RCP2.6). More aggressive near-term reductions would allow 2°C to be avoided with less end-of-century carbon removal capacity. A 10% cut in GHGEs by 2030 (relative to 2015) could likely achieve 2°C with RCP2.6 level negative emissions. The 1.5°C target requires GHGEs to be reduced by almost a third by 2030 and net zero by 2050, while a 50 year overshoot of 1.5°C allows net zero GHGEs by 2060.

  15. Comprehensive profiling of novel microRNA-9 targets and a tumor suppressor role of microRNA-9 via targeting IGF2BP1 in hepatocellular carcinoma

    PubMed Central

    Wang, Yongfeng; Li, Xiaojun; Xie, Qing; Jia, Junqiao; Yan, Ying; Guo, Zhengyang; Gao, Jian; Yao, Mingjie; Chen, Xiangmei; Lu, Fengmin

    2015-01-01

    MicroRNA-9 (miR-9) dysregulation is implicated in a variety of human malignancies including hepatocellular carcinoma (HCC), but its role remains contradictory. In this study, we explored the expression and methylation status of miR-9 in HCC samples, as well as the tumor-related functions of miR-9 in vitro. Bioinformatics analysis, array-based RNA expression profile, and literature retrieval were used to identify miR-9 targets in HCC. The potential downstream candidates were then validated by luciferase reporter assay, real-time quantitative PCR, and western blot or enzyme linked immunosorbent assay (ELISA). The expression status and clinicopathologic significances of miR-9 target genes in clinical samples were further explored. The results showed that miR-9 was frequently downregulated in primary HCC. Its silencing was largely contributed by a high frequency (42.5%) of mir-9-1 hypermethylation, which was correlated with bigger tumor size (P = 0.0234). In vitro functional studies revealed that miR-9 restoration retarded HCC cell proliferation and migration. IL-6, AP3B1, TC10, ONECUT2, IGF2BP1, MYO1D, and ANXA2 were confirmed to be miR-9 targets in HCC. Among them, ONECUT2, IGF2BP1, and ANXA2 were confirmed to be aberrantly upregulated in HCC. Moreover, upregulation of ONECUT2, IGF2BP1, and IL-6 were significantly associated with poor post-surgery prognosis (P = 0.0458, P = 0.0037 and P = 0.0461, respectively). Mechanically, miR-9 plays a tumor suppressive role partially through a functional miR-9/IGF2BP1/AKT&ERK axis. Our study suggests that miR-9 functions as a tumor suppressor in HCC progression by inhibiting a series of target genes, including the newly validated miR-9/IGF2BP1/AKT&ERK axis, thus providing potential therapeutic targets and novel prognostic biomarkers for HCC patients. PMID:26547929

  16. Likelihood of achieving air quality targets under model uncertainties.

    PubMed

    Digar, Antara; Cohan, Daniel S; Cox, Dennis D; Kim, Byeong-Uk; Boylan, James W

    2011-01-01

    Regulatory attainment demonstrations in the United States typically apply a bright-line test to predict whether a control strategy is sufficient to attain an air quality standard. Photochemical models are the best tools available to project future pollutant levels and are a critical part of regulatory attainment demonstrations. However, because photochemical models are uncertain and future meteorology is unknowable, future pollutant levels cannot be predicted perfectly and attainment cannot be guaranteed. This paper introduces a computationally efficient methodology for estimating the likelihood that an emission control strategy will achieve an air quality objective in light of uncertainties in photochemical model input parameters (e.g., uncertain emission and reaction rates, deposition velocities, and boundary conditions). The method incorporates Monte Carlo simulations of a reduced form model representing pollutant-precursor response under parametric uncertainty to probabilistically predict the improvement in air quality due to emission control. The method is applied to recent 8-h ozone attainment modeling for Atlanta, Georgia, to assess the likelihood that additional controls would achieve fixed (well-defined) or flexible (due to meteorological variability and uncertain emission trends) targets of air pollution reduction. The results show that in certain instances ranking of the predicted effectiveness of control strategies may differ between probabilistic and deterministic analyses. PMID:21138291

  17. Likelihood of achieving air quality targets under model uncertainties.

    PubMed

    Digar, Antara; Cohan, Daniel S; Cox, Dennis D; Kim, Byeong-Uk; Boylan, James W

    2011-01-01

    Regulatory attainment demonstrations in the United States typically apply a bright-line test to predict whether a control strategy is sufficient to attain an air quality standard. Photochemical models are the best tools available to project future pollutant levels and are a critical part of regulatory attainment demonstrations. However, because photochemical models are uncertain and future meteorology is unknowable, future pollutant levels cannot be predicted perfectly and attainment cannot be guaranteed. This paper introduces a computationally efficient methodology for estimating the likelihood that an emission control strategy will achieve an air quality objective in light of uncertainties in photochemical model input parameters (e.g., uncertain emission and reaction rates, deposition velocities, and boundary conditions). The method incorporates Monte Carlo simulations of a reduced form model representing pollutant-precursor response under parametric uncertainty to probabilistically predict the improvement in air quality due to emission control. The method is applied to recent 8-h ozone attainment modeling for Atlanta, Georgia, to assess the likelihood that additional controls would achieve fixed (well-defined) or flexible (due to meteorological variability and uncertain emission trends) targets of air pollution reduction. The results show that in certain instances ranking of the predicted effectiveness of control strategies may differ between probabilistic and deterministic analyses.

  18. Resveratrol induces apoptosis by directly targeting Ras-GTPase activating protein SH3 domain binding protein 1 (G3BP1)

    PubMed Central

    Oi, Naomi; Yuan, Jian; Malakhova, Margarita; Luo, Kuntian; Li, Yunhui; Ryu, Joohyun; Zhang, Lei; Bode, Ann M.; Xu, Zengguang; Li, Yan; Lou, Zhenkun; Dong, Zigang

    2014-01-01

    Resveratrol possesses a strong anticancer activity exhibited as the induction of apoptosis through p53 activation. However, the molecular mechanism and direct target(s) of resveratrol-induced p53 activation remain elusive. Here, the Ras-GTPase activating protein SH3 domain binding protein 1 (G3BP1) was identified as a potential target of resveratrol, and in vitro binding assay results using resveratrol (RSVL)-conjugated Sepharose 4B beads confirmed their direct binding. Depletion of G3BP1 significantly diminishes resveratrol-induced p53 expression and apoptosis. We also found that G3BP1 negatively regulates p53 expression by interacting with ubiquitin-specific protease 10 (USP10), a deubiquitinating enzyme of p53. Disruption of the interaction of p53 with USP10 by G3BP1 interference leads to suppression of p53 deubiquitination. Resveratrol, on the other hand, directly binds to G3BP1 and prevents the G3BP1/USP10 interaction, resulting in enhanced USP10-mediated deubiquitination of p53 and consequently increased p53 expression. These findings disclose a novel mechanism of resveratrol-induced p53 activation and resveratrol-induced apoptosis by direct targeting of G3BP1. PMID:24998844

  19. GHG emission reductions and costs to achieve Kyoto target.

    PubMed

    Chen, Wen-ying

    2003-07-01

    Emission projection and marginal abatement cost curves (MACs) are the central components of any assessment of future carbon market, such as CDM (clean development mechanism) potentials, carbon quota price etc. However, they are products of very complex, dynamic systems driven by forces like population growth, economic development, resource endowments, technology progress and so on. The modeling approaches for emission projection and MACs evaluation were summarized, and some major models and their results were compared. Accordingly, reduction and cost requirements to achieve the Kyoto target were estimated. It is concluded that Annex I Parties' total reduction requirements range from 503-1304 MtC with USA participation and decrease significantly to 140-612 MtC after USA's withdrawal. Total costs vary from 21-77 BUSD with USA and from 5-36 BUSD without USA if only domestic reduction actions are taken. The costs would sharply reduce while considering the three flexible mechanisms defined in the Kyoto Protocol with domestic actions' share in the all mitigation strategies drops to only 0-16% .

  20. Structural Insights into Membrane Targeting by the Flagellar Calcium-binding Protein (FCaBP) a Myristoylated and Palmitoylated Calcium Sensor in Trypanosoma cruzi

    SciTech Connect

    J Wingard; J Ladner; M Vanarotti; A Fisher; H Robinson; K Buchanan; D Engman; J Ames

    2011-12-31

    The flagellar calcium-binding protein (FCaBP) of the protozoan Trypanosoma cruzi is targeted to the flagellar membrane where it regulates flagellar function and assembly. As a first step toward understanding the Ca{sup 2+}-induced conformational changes important for membrane-targeting, we report here the x-ray crystal structure of FCaBP in the Ca{sup 2+}-free state determined at 2.2{angstrom} resolution. The first 17 residues from the N terminus appear unstructured and solvent-exposed. Residues implicated in membrane targeting (Lys-19, Lys-22, and Lys-25) are flanked by an exposed N-terminal helix (residues 26-37), forming a patch of positive charge on the protein surface that may interact electrostatically with flagellar membrane targets. The four EF-hands in FCaBP each adopt a 'closed conformation' similar to that seen in Ca{sup 2+}-free calmodulin. The overall fold of FCaBP is closest to that of grancalcin and other members of the penta EF-hand superfamily. Unlike the dimeric penta EF-hand proteins, FCaBP lacks a fifth EF-hand and is monomeric. The unstructured N-terminal region of FCaBP suggests that its covalently attached myristoyl group at the N terminus may be solvent-exposed, in contrast to the highly sequestered myristoyl group seen in recoverin and GCAP1. NMR analysis demonstrates that the myristoyl group attached to FCaBP is indeed solvent-exposed in both the Ca{sup 2+}-free and Ca{sup 2+}-bound states, and myristoylation has no effect on protein structure and folding stability. We propose that exposed acyl groups at the N terminus may anchor FCaBP to the flagellar membrane and that Ca{sup 2+}-induced conformational changes may control its binding to membrane-bound protein targets..

  1. Missing the target: Characterization of bullous pemphigoid patients who are negative using the BP180 enzyme-linked immunosorbant assay

    PubMed Central

    Fairley, Janet A.; Bream, Matthew; Fullenkamp, Colleen; Syrbu, Sergei; Chen, Mei; Messingham, Kelly N.

    2016-01-01

    Background Bullous pemphigoid (BP) is an autoimmune blistering disease characterized by autoanti-bodies specific for the 180-kd BP antigen-2 (BP180) (also termed “type XVII collagen”) protein. The BP180 enzyme-linked immunosorbent assay (ELISA) is specific for the immunodominant NC16A domain of the protein. However, we and others have observed patients whose reactivity to BP180 is exclusive of the NC16A domain (referred to henceforth as non-NC16A BP). Objective We sought to determine the incidence of non-NC16A BP and identify regions of reactivity within the BP180 protein. Methods Sera from 51 patients who met the clinical and histologic criteria for BP were screened for NC16A reactivity by ELISA. Sera that were negative by ELISA were screened for IgG reactivity to an epidermal extract, recombinant BP180 protein, and subregions of BP180, by immunoblot. Demographic and clinical data were also collected on all patients. Results Four sera (7.8%) were negative using the BP180 ELISA but positive for IgG reactivity to the extracellular domain of BP180. Further mapping identified 4 regions outside of NC16A recognized by these sera: amino acid (AA) 1280 to 1315, AA 1080 to 1107, AA 1331 to 1404, and AA 1365 to 1413. One of these sera also had IgE specific for NC16A. One patient had an atypical presentation with lesions limited to the lower aspect of the legs and scarring of the nail beds. Limitations The small total number of patients with non-NC16A BP limits the identification of demographic or clinical correlates. Conclusion It is significant that 7.8% of sera from patients with new BP react to regions of BP180 exclusively outside of NC16A and, thus, would not be identified using the currently available BP180 ELISA. PMID:23083837

  2. Healthy latrine development model to achieve MDGs target

    NASA Astrophysics Data System (ADS)

    Soedjono, Eddy S.; Arumsari, Nurvita

    2014-03-01

    A case happened in Pungging sub-district was one example of low level healthy habits of East Java inhabitants. According to the data of Mojokerto district Health Service until the end of 2010, there are 219 families (or about 8% of total families in Pungging sub-district) which do not have their own latrine. Moreover, if we observe closely to their prosperity level, the percentage of disadvantaged families and prosperous level I is still adequately high about 29,54% of the total number of families in Pungging sub-district. Accordingly, comprehensive studies related to basic sanitation requirement need to be done, not only in the matter of quantity but also in the matter of quality. Furthermore, further studies on people's knowledge and understanding on healthy sanitation also needed in the effort to understand people's demand to own latrine (willingness to pay) and ability to pay. Consequently, the design of healthy latrine which agrees with people's demand and ability is needed in order to achieve the target of Open Defecation Free (ODF) in 2015. The research methodology includes literary study, data collection, data analysis, and healthy latrine design. Out of 75 respondents, only 32% of them who attended counselling program on healthy latrine and only 48% of them who have knowledge on healthy latrine, but in reality 96% of respondents stated that healthy latrine is important. Healthy latrine, according to the respondents, is a place of defecation (BAB) which has components like latrine bowl or septic tank. Estimation on WTP distribution which is divided in two categories; low category with range of willingness to pay from IDR 0 to IDR 200,000 is IDR 90,048,000. On the other hand, high category with range of willingness to pay more than IDR 1,000,000 is IDR 749,964,768. Estimation on respondents' ATP in the area of study on the sanitation maintenance service is from IDR 7,000 to IDR 30,000.

  3. Inhibition of GLI1 Expression by Targeting the CRD-BP-GLI1 mRNA Interaction Using a Specific Oligonucleotide.

    PubMed

    Mehmood, Kashif; Akhtar, Daud; Mackedenski, Sebastian; Wang, Chuyi; Lee, Chow H

    2016-06-01

    The stabilization of glioma-associated oncogene 1 (GLI1) mRNA by coding region determinant binding protein (CRD-BP) through the Wnt/β-catenin signaling pathway is implicated in the proliferation of colorectal cancer and basal cell carcinoma. Here, we set out to characterize the physical interaction between CRD-BP and GLI1 mRNA so as to find inhibitors for such interaction. Studies using CRD-BP variants with a point mutation in the GXXG motif at each KH domain showed that KH1 and KH2 domain are critical for the binding of GLI1 RNA. The smallest region of GLI1 RNA binding to CRD-BP was mapped to nucleotides (nts) 320-380. A 37-nt S1 RNA sense oligonucleotide, containing two distinct stem-loops present in nts 320-380 of GLI1 RNA, was found to be effective in blocking CRD-BP-GLI1 RNA interaction. Studies using various competitor RNAs with modifications to S1 RNA oligonucleotide further displayed that both the sequences and the structure of the two stem-loops are important for CRD-BP-GLI1 RNA binding. The role of the two-stem-loop motif in influencing CRD-BP-RNA interaction was further investigated in cells. The 2'-O-methyl derivative of the S1 RNA oligonucleotide significantly decreased GLI1, c-myc, and CD44 mRNA levels, in a panel of colon and breast cancer cells. The results from this study demonstrate the potential importance of the two-stem-loop motif as a target region for the inhibition of the CRD-BP-GLI1 RNA interaction and Hedgehog signaling pathway. Such results pave the way for the development of novel inhibitors that act by destabilizing the CRD-BP-GLI1 mRNA interaction. PMID:27036131

  4. Identification of Targets of CUG-BP, Elav-Like Family Member 1 (CELF1) Regulation in Embryonic Heart Muscle.

    PubMed

    Blech-Hermoni, Yotam; Dasgupta, Twishasri; Coram, Ryan J; Ladd, Andrea N

    2016-01-01

    CUG-BP, Elav-like family member 1 (CELF1) is a highly conserved RNA binding protein that regulates pre-mRNA alternative splicing, polyadenylation, mRNA stability, and translation. In the heart, CELF1 is expressed in the myocardium, where its levels are tightly regulated during development. CELF1 levels peak in the heart during embryogenesis, and aberrant up-regulation of CELF1 in the adult heart has been implicated in cardiac pathogenesis in myotonic dystrophy type 1, as well as in diabetic cardiomyopathy. Either inhibition of CELF activity or over-expression of CELF1 in heart muscle causes cardiomyopathy in transgenic mice. Nonetheless, many of the cardiac targets of CELF1 regulation remain unknown. In this study, to identify cardiac targets of CELF1 we performed cross-linking immunoprecipitation (CLIP) for CELF1 from embryonic day 8 chicken hearts. We identified a previously unannotated exon in MYH7B as a novel target of CELF1-mediated regulation. We demonstrated that knockdown of CELF1 in primary chicken embryonic cardiomyocytes leads to increased inclusion of this exon and decreased MYH7B levels. We also investigated global changes in the transcriptome of primary embryonic cardiomyocytes following CELF1 knockdown in a published RNA-seq dataset. Pathway and network analyses identified strong associations between CELF1 and regulation of cell cycle and translation. Important regulatory proteins, including both RNA binding proteins and a cardiac transcription factor, were affected by loss of CELF1. Together, these data suggest that CELF1 is a key regulator of cardiomyocyte gene expression.

  5. Identification of Targets of CUG-BP, Elav-Like Family Member 1 (CELF1) Regulation in Embryonic Heart Muscle.

    PubMed

    Blech-Hermoni, Yotam; Dasgupta, Twishasri; Coram, Ryan J; Ladd, Andrea N

    2016-01-01

    CUG-BP, Elav-like family member 1 (CELF1) is a highly conserved RNA binding protein that regulates pre-mRNA alternative splicing, polyadenylation, mRNA stability, and translation. In the heart, CELF1 is expressed in the myocardium, where its levels are tightly regulated during development. CELF1 levels peak in the heart during embryogenesis, and aberrant up-regulation of CELF1 in the adult heart has been implicated in cardiac pathogenesis in myotonic dystrophy type 1, as well as in diabetic cardiomyopathy. Either inhibition of CELF activity or over-expression of CELF1 in heart muscle causes cardiomyopathy in transgenic mice. Nonetheless, many of the cardiac targets of CELF1 regulation remain unknown. In this study, to identify cardiac targets of CELF1 we performed cross-linking immunoprecipitation (CLIP) for CELF1 from embryonic day 8 chicken hearts. We identified a previously unannotated exon in MYH7B as a novel target of CELF1-mediated regulation. We demonstrated that knockdown of CELF1 in primary chicken embryonic cardiomyocytes leads to increased inclusion of this exon and decreased MYH7B levels. We also investigated global changes in the transcriptome of primary embryonic cardiomyocytes following CELF1 knockdown in a published RNA-seq dataset. Pathway and network analyses identified strong associations between CELF1 and regulation of cell cycle and translation. Important regulatory proteins, including both RNA binding proteins and a cardiac transcription factor, were affected by loss of CELF1. Together, these data suggest that CELF1 is a key regulator of cardiomyocyte gene expression. PMID:26866591

  6. Targeting the latent reservoir to achieve functional HIV cure

    PubMed Central

    Cary, Daniele C.; Peterlin, B. Matija

    2016-01-01

    While highly active anti-retroviral therapy has greatly improved the lives of HIV-infected individuals, current treatments are unable to completely eradicate the virus. This is due to the presence of HIV latently infected cells which harbor transcriptionally silent HIV. Latent HIV does not replicate or produce viral proteins, thereby preventing efficient targeting by anti-retroviral drugs. Strategies to target the HIV latent reservoir include viral reactivation, enhancing host defense mechanisms, keeping latent HIV silent, and using gene therapy techniques to knock out or reactivate latent HIV. While research into each of these areas has yielded promising results, currently no one mechanism eradicates latent HIV. Instead, combinations of these approaches should be considered for a potential HIV functional cure. PMID:27303638

  7. Targeting of the Plant Vacuolar Sorting Receptor BP80 Is Dependent on Multiple Sorting Signals in the Cytosolic Tail[W

    PubMed Central

    daSilva, Luis L.P.; Foresti, Ombretta; Denecke, Jurgen

    2006-01-01

    Although signals for vacuolar sorting of soluble proteins are well described, we have yet to learn how the plant vacuolar sorting receptor BP80 reaches its correct destination and recycles. To shed light on receptor targeting, we used an in vivo competition assay in which a truncated receptor (green fluorescent protein-BP80) specifically competes with sorting machinery and causes hypersecretion of BP80-ligands from tobacco (Nicotiana tabacum) leaf protoplasts. We show that both the transmembrane domain and the cytosolic tail of BP80 contain information necessary for efficient progress to the prevacuolar compartment (PVC). Furthermore, the tail must be exposed on the correct membrane surface to compete with sorting machinery. Mutational analysis of conserved residues revealed that multiple sequence motifs are necessary for competition, one of which is a typical Tyr-based motif (YXXΦ). Substitution of Tyr-612 for Ala causes partial retention in the Golgi apparatus, mistargeting to the plasma membrane (PM), and slower progress to the PVC. A role in Golgi-to-PVC transport was confirmed by generating the corresponding mutation on full-length BP80. The mutant receptor was partially mistargeted to the PM and induced the secretion of a coexpressed BP80-ligand. Further mutants indicate that the cytosolic tail is likely to contain other information besides the YXXΦ motif, possibly for endoplasmic reticulum export, endocytosis from the PM, and PVC-to-Golgi recycling. PMID:16714388

  8. NF-κBp65 and Expression of Its Pro-Inflammatory Target Genes Are Upregulated in the Subcutaneous Adipose Tissue of Cachectic Cancer Patients

    PubMed Central

    Gonzalez Camargo, Rodolfo; Mendes dos Reis Riccardi, Daniela; Quintas Teixeira Ribeiro, Henrique; Carlos Carnevali, Luiz; Marques de Matos-Neto, Emidio; Enjiu, Lucas; Xavier Neves, Rodrigo; Darck Carola Correia Lima, Joanna; Galvão Figuerêdo, Raquel; Sérgio Martins de Alcântara, Paulo; Maximiano, Linda; Otoch, José; Batista, Miguel Luiz; Püschel, Gerhard; Seelaender, Marilia

    2015-01-01

    Cancer cachexia, of which the most notable symptom is severe and rapid weight loss, is present in the majority of patients with advanced cancer. Inflammatory mediators play an important role in the development of cachexia, envisaged as a chronic inflammatory syndrome. The white adipose tissue (WAT) is one of the first compartments affected in cancer cachexia and suffers a high rate of lipolysis. It secretes several cytokines capable of directly regulating intermediate metabolism. A common pathway in the regulation of the expression of pro-inflammatory cytokines in WAT is the activation of the nuclear transcription factor kappa-B (NF-κB). We have examined the gene expression of the subunits NF-κBp65 and NF-κBp50, as well as NF-κBp65 and NF-κBp50 binding, the gene expression of pro-inflammatory mediators under NF-κB control (IL-1β, IL-6, INF-γ, TNF-α, MCP-1), and its inhibitory protein, nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IκB-α). The observational study involved 35 patients (control group, n = 12 and cancer group, n = 23, further divided into cachectic and non-cachectic). NF-κBp65 and its target genes expression (TNF-α, IL-1β, MCP-1 and IκB-α) were significantly higher in cachectic cancer patients. Moreover, NF-κBp65 gene expression correlated positively with the expression of its target genes. The results strongly suggest that the NF-κB pathway plays a role in the promotion of WAT inflammation during cachexia. PMID:26053616

  9. Dissection of the C-terminal region of E1A redefines the roles of CtBP and other cellular targets in oncogenic transformation.

    PubMed

    Cohen, M J; Yousef, A F; Massimi, P; Fonseca, G J; Todorovic, B; Pelka, P; Turnell, A S; Banks, L; Mymryk, J S

    2013-09-01

    Human adenovirus E1A makes extensive connections with the cellular protein interaction network. By doing so, E1A can manipulate many cellular programs, including cell cycle progression. Through these reprogramming events, E1A functions as a growth-promoting oncogene and has been used extensively to investigate mechanisms contributing to oncogenesis. Nevertheless, it remains unclear how the C-terminal region of E1A contributes to oncogenic transformation. Although this region is required for transformation in cooperation with E1B, it paradoxically suppresses transformation in cooperation with activated Ras. Previous analysis has suggested that the interaction of E1A with CtBP plays a pivotal role in both activities. However, some C-terminal mutants of E1A retain CtBP binding and yet exhibit defects in transformation, suggesting that other targets of this region are also necessary. To explore the roles of these additional factors, we performed an extensive mutational analysis of the C terminus of E1A. We identified key residues that are specifically required for binding all known targets of the C terminus of E1A. We further tested each mutant for the ability to both localize to the nucleus and transform primary rat cells in cooperation with E1B-55K or Ras. Interaction of E1A with importin α3/Qip1, dual-specificity tyrosine-regulated kinase 1A (DYRK1A), HAN11, and CtBP influenced transformation with E1B-55K. Interestingly, the interaction of E1A with DYRK1A and HAN11 appeared to play a role in suppression of transformation by activated Ras whereas interaction with CtBP was not necessary. This unexpected result suggests a need for revision of current models and provides new insight into transformation by the C terminus of E1A. PMID:23864635

  10. A report on the Zimbabwe Antiretroviral Therapy (ART) programme progress towards achieving MGD6 target 6B: achievement and challenges.

    PubMed

    Apollo, T; Takarinda, K; Mugurungi, O; Chakanyuka, C; Simbini, T; Harries, A D

    2010-01-01

    Zimbabwe's target to achieve Universal Access to treatment for HIV and AIDS, was severely affected by a decade long economic recession that threatened to reverse all the country's social and economic indicators. Despite these challenges, by September 2010, 282,916 adults and children (47.7% of those in need of treatment) were on treatment at 509 sites countrywide since national scale up started. ART services are predominantly offered through the public sector, with the private sector being an untapped potential resource for ART services for the future. Challenges of skilled and adequately trained human resources have hindered progress towards service availability. Providing access to children in particular has been constrained by lack of clinical mentorship for health workers, weak systems for support supervision, and inadequate HIV diagnostic services especially for children under 18 months and challenges with follow up of the HIV-exposed infants. Though the country has not met its target of Universal Access by 2010, significant progress has been made with over a 30-fold increase in service availability. PMID:23457867

  11. A method to achieve rapid localised deep heating in a laser irradiated solid density target

    NASA Astrophysics Data System (ADS)

    Schmitz, H.; Robinson, A. P. L.

    2016-09-01

    Rapid heating of small buried regions by laser generated fast electrons may be useful for applications such as extreme ultraviolet (XUV) radiation sources or as drivers for shock experiments. In non-structured targets, the heating profile possesses a global maximum near the front surface. This paper presents a new target design that uses resistive guiding to concentrate the fast electron current density at a finite depth inside the target. The choice of geometry uses principles of non-imaging optics. A global temperature maximum at depths up to 50 μ m into the target is achieved. Although theoretical calculations suggest that small source sizes should perform better than large ones, simulations show that a large angular spread at high intensities results in significant losses of the fast electrons to the sides. A systematic parameter scan suggests an optimal laser intensity. A ratio of 1.6 is demonstrated between the maximum ion temperature and the ion temperature at the front surface.

  12. Pharmacological targeting of the protein synthesis mTOR/4E-BP1 pathway in cancer-associated fibroblasts abrogates pancreatic tumour chemoresistance

    PubMed Central

    Duluc, Camille; Moatassim-Billah, Siham; Chalabi-Dchar, Mounira; Perraud, Aurélie; Samain, Rémi; Breibach, Florence; Gayral, Marion; Cordelier, Pierre; Delisle, Marie-Bernadette; Bousquet-Dubouch, Marie-Pierre; Tomasini, Richard; Schmid, Herbert; Mathonnet, Muriel; Pyronnet, Stéphane; Martineau, Yvan; Bousquet, Corinne

    2015-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is extremely stroma-rich. Cancer-associated fibroblasts (CAFs) secrete proteins that activate survival and promote chemoresistance of cancer cells. Our results demonstrate that CAF secretome-triggered chemoresistance is abolished upon inhibition of the protein synthesis mTOR/4E-BP1 regulatory pathway which we found highly activated in primary cultures of α-SMA-positive CAFs, isolated from human PDAC resections. CAFs selectively express the sst1 somatostatin receptor. The SOM230 analogue (Pasireotide) activates the sst1 receptor and inhibits the mTOR/4E-BP1 pathway and the resultant synthesis of secreted proteins including IL-6. Consequently, tumour growth and chemoresistance in nude mice xenografted with pancreatic cancer cells and CAFs, or with pieces of resected human PDACs, are reduced when chemotherapy (gemcitabine) is combined with SOM230 treatment. While gemcitabine alone has marginal effects, SOM230 is permissive to gemcitabine-induced cancer cell apoptosis and acts as an antifibrotic agent. We propose that selective inhibition of CAF protein synthesis with sst1-directed pharmacological compounds represents an anti-stromal-targeted therapy with promising chemosensitization potential. PMID:25834145

  13. Real-time imaging systems' combination of methods to achieve automatic target recognition

    NASA Astrophysics Data System (ADS)

    Maraviglia, Carlos G.; Williams, Elmer F.; Pezzulich, Alan Z.

    1998-03-01

    Using a combination of strategies real time imaging weapons systems are achieving their goals of detecting their intended targets. The demands of acquiring a target in a cluttered environment in a timely manner with a high degree of confidence demands compromise be made as to having a truly automatic system. A combination of techniques such as dedicated image processing hardware, real time operating systems, mixes of algorithmic methods, and multi-sensor detectors are a forbearance of the unleashed potential of future weapons system and their incorporation in truly autonomous target acquisition. Elements such as position information, sensor gain controls, way marks for mid course correction, and augmentation with different imaging spectrums as well as future capabilities such as neural net expert systems and decision processors over seeing a fusion matrix architecture may be considered tools for a weapon system's achievement of its ultimate goal. Currently, acquiring a target in a cluttered environment in a timely manner with a high degree of confidence demands compromises be made as to having a truly automatic system. It is now necessary to include a human in the track decision loop, a system feature that may be long lived. Automatic Track Recognition will still be the desired goal in future systems due to the variability of military missions and desirability of an expendable asset. Furthermore, with the increasing incorporation of multi-sensor information into the track decision the human element's real time contribution must be carefully engineered.

  14. Quantitative Guidance for Stove Usage and Performance to Achieve Health and Environmental Targets

    PubMed Central

    Chiang, Ranyee A.

    2015-01-01

    Background Displacing the use of polluting and inefficient cookstoves in developing countries is necessary to achieve the potential health and environmental benefits sought through clean cooking solutions. Yet little quantitative context has been provided on how much displacement of traditional technologies is needed to achieve targets for household air pollutant concentrations or fuel savings. Objectives This paper provides instructive guidance on the usage of cooking technologies required to achieve health and environmental improvements. Methods We evaluated different scenarios of displacement of traditional stoves with use of higher performing technologies. The air quality and fuel consumption impacts were estimated for these scenarios using a single-zone box model of indoor air quality and ratios of thermal efficiency. Results Stove performance and usage should be considered together, as lower performing stoves can result in similar or greater benefits than a higher performing stove if the lower performing stove has considerably higher displacement of the baseline stove. Based on the indoor air quality model, there are multiple performance–usage scenarios for achieving modest indoor air quality improvements. To meet World Health Organization guidance levels, however, three-stone fire and basic charcoal stove usage must be nearly eliminated to achieve the particulate matter target (< 1–3 hr/week), and substantially limited to meet the carbon monoxide guideline (< 7–9 hr/week). Conclusions Moderate health gains may be achieved with various performance–usage scenarios. The greatest benefits are estimated to be achieved by near-complete displacement of traditional stoves with clean technologies, emphasizing the need to shift in the long term to near exclusive use of clean fuels and stoves. The performance–usage scenarios are also provided as a tool to guide technology selection and prioritize behavior change opportunities to maximize impact. Citation

  15. Achieving CO2 reductions in Colombia: Effects of carbon taxes and abatement targets

    DOE PAGES

    Calderón, Silvia; Alvarez, Andres Camilo; Loboguerrero, Ana Maria; Arango, Santiago; Calvin, Katherine; Kober, Tom; Daenzer, Kathryn; Fisher-Vanden, Karen

    2015-06-03

    In this paper we investigate CO2 emission scenarios for Colombia and the effects of implementing carbon taxes and abatement targets on the energy system. By comparing baseline and policy scenario results from two integrated assessment partial equilibrium models TIAM-ECN and GCAM and two general equilibrium models Phoenix and MEG4C, we provide an indication of future developments and dynamics in the Colombian energy system. Currently, the carbon intensity of the energy system in Colombia is low compared to other countries in Latin America. However, this trend may change given the projected rapid growth of the economy and the potential increase inmore » the use of carbon-based technologies. Climate policy in Colombia is under development and has yet to consider economic instruments such as taxes and abatement targets. This paper shows how taxes or abatement targets can achieve significant CO2 reductions in Colombia. Though abatement may be achieved through different pathways, taxes and targets promote the entry of cleaner energy sources into the market and reduce final energy demand through energy efficiency improvements and other demand-side responses. The electric power sector plays an important role in achieving CO2 emission reductions in Colombia, through the increase of hydropower, the introduction of wind technologies, and the deployment of biomass, coal and natural gas with CO2 capture and storage (CCS). Uncertainty over the prevailing mitigation pathway reinforces the importance of climate policy to guide sectors toward low-carbon technologies. This paper also assesses the economy-wide implications of mitigation policies such as potential losses in GDP and consumption. As a result, an assessment of the legal, institutional, social and environmental barriers to economy-wide mitigation policies is critical yet beyond the scope of this paper.« less

  16. Achieving CO2 reductions in Colombia: Effects of carbon taxes and abatement targets

    SciTech Connect

    Calderón, Silvia; Alvarez, Andres Camilo; Loboguerrero, Ana Maria; Arango, Santiago; Calvin, Katherine; Kober, Tom; Daenzer, Kathryn; Fisher-Vanden, Karen

    2015-06-03

    In this paper we investigate CO2 emission scenarios for Colombia and the effects of implementing carbon taxes and abatement targets on the energy system. By comparing baseline and policy scenario results from two integrated assessment partial equilibrium models TIAM-ECN and GCAM and two general equilibrium models Phoenix and MEG4C, we provide an indication of future developments and dynamics in the Colombian energy system. Currently, the carbon intensity of the energy system in Colombia is low compared to other countries in Latin America. However, this trend may change given the projected rapid growth of the economy and the potential increase in the use of carbon-based technologies. Climate policy in Colombia is under development and has yet to consider economic instruments such as taxes and abatement targets. This paper shows how taxes or abatement targets can achieve significant CO2 reductions in Colombia. Though abatement may be achieved through different pathways, taxes and targets promote the entry of cleaner energy sources into the market and reduce final energy demand through energy efficiency improvements and other demand-side responses. The electric power sector plays an important role in achieving CO2 emission reductions in Colombia, through the increase of hydropower, the introduction of wind technologies, and the deployment of biomass, coal and natural gas with CO2 capture and storage (CCS). Uncertainty over the prevailing mitigation pathway reinforces the importance of climate policy to guide sectors toward low-carbon technologies. This paper also assesses the economy-wide implications of mitigation policies such as potential losses in GDP and consumption. As a result, an assessment of the legal, institutional, social and environmental barriers to economy-wide mitigation policies is critical yet beyond the scope of this paper.

  17. Achieving targeted and quantifiable alteration of mRNA splicing with Morpholino oligos

    SciTech Connect

    Morcos, Paul A. . E-mail: pmorcos@gene-tools.com

    2007-06-29

    This work represents the first guide for using steric-block antisense oligos as tools for effective and targeted modification of RNA splicing. Comparison of several steric-block oligo types shows the properties of Morpholinos provide significant advantages over other potential splice-blocking oligos. The procedures and complications of designing effective splice-blocking Morpholino oligos are described. The design process requires complete pre-mRNA sequence for defining suitable targets, which usually generate specific predictable messengers. To validate the targeting procedure, the level and nature of transcript alteration is characterized by RT-PCR analysis of splice modification in a {beta}-globin splice model system. An oligo-walking study reveals that while U1 and U2 small nuclear RiboNucleoProtein (snRNP) binding sites are the most effective targets for blocking splicing, inclusion of these sites is not required to achieve effective splice modifications. The most effective targeting strategy employs simultaneously blocking snRNP binding sites and splice-junctions. The work presented here continues to be the basis for most of the successful Morpholino oligos designed for the worldwide research community to block RNA splicing.

  18. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene.

    PubMed

    Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin

    2016-06-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.

  19. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    PubMed Central

    Thyssen, Gregory N.; Fang, David D.; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D.; Condon, Tracy L.; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  20. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene.

    PubMed

    Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  1. Achieving Target Pressures with Combined Surgery: Primary Patchless Ahmed Valve Combined with Phacoemulsification vs Primary Phacotrabeculectomy

    PubMed Central

    Sánchez-Noguera, Carmen C; Cárdenas-Gómez, Lorena; Castañeda-Diez, Rafael; Thomas, Ravi; Gil-Carrasco, Félix

    2015-01-01

    ABSTRACT Purpose: To evaluate the ability of phacoemulsification combined with either primary trabeculectomy (PT) or primary Ahmed glaucoma valve implantation (PAVI) to achieve target intraocular pressures (TIOP) in adults with primary open angle glaucoma. Materials and methods: Chart review of 214 adult patients operated between January 2002 and June 2008 with a minimum follow-up of 6 months. Group 1 comprised 181 eyes of 166 patients undergoing PT while group 2 included 50 eyes of 49 patients in combination with primary AVI. Target lOPs were pre-determined for each patient and success was defined as an IOP at or lower than target with or without medications. An IOP above target, loss of light perception or need for additional procedures to lower IOP were considered a failure. Results: Mean preoperative IOP was 17.2 mm Hg in group 1 and 17.3 in group 2. Mean postoperative IOPs were 10.2 and 9.2 on day 1, 12.2 and 11.6 at year 1, and 10.7 in both groups at year 5. Survival rates in groups 1 and 2 were 96.7 vs 96% at 6 months, 89 vs 96% at 12 months, 83.5 vs 96% at 24 months and 79.4 vs 89.1% at 36, 48 and 72 months. Transient bleb leaks were more frequent in group 1 (26 eyes, 14.4 vs 0%, p = 0.001) and transient choroidal detachments were more frequent in group 2 (7 eyes, 3.9 vs 6 eyes, 12%, p = 0.038). Conclusion: Midterm results for achieving target pressures using combined phacoemulsification with either PT or PAVI are comparable. The profile of complications is different for the two procedures. How to cite this article: Albis-Donado O, Sánchez-Noguera CC, Cárdenas-Gómez L, Castañeda-Diez R, Thomas R, Gil-Carrasco F. Achieving Target Pressures with Combined Surgery: Primary Patchless Ahmed Valve Combined with Phacoemulsification vs Primary Phacotrabeculectomy. J Curr Glaucoma Pract 2015;9(1):6-11. PMID:26997825

  2. ACHIEVING LIPID TARGETS IN ADULTS WITH TYPE 2 DIABETES--THE SANDS STUDY

    PubMed Central

    Russell, Marie; Silverman, Angela; Fleg, Jerome L.; Lee, Elisa T.; Mete, Mihriye; Weir, Matthew; Wilson, Charlton; Yeh, Fawn; Howard, Barbara V.; Howard, Wm. James

    2010-01-01

    Background Although lipid management in diabetes is standard practice, goals often are neither met nor maintained. Strategies for achieving lower targets have not been explored. The Stop Atherosclerosis in Native Diabetics Study (SANDS) randomized patients with diabetes to standard versus aggressive lipid and blood pressure goals for 36 months. Objective To report strategies used to achieve and maintain lipid goals and to report adverse events (AEs). Methods Adults with type 2 diabetes and no history of cardiovascular disease (N=499) were randomized to standard (low-density lipoprotein cholesterol [LDL-C]≤100 mg/dL, non-high-density lipoprotein cholesterol [non-HDL-C]≤130 mg/dL) or aggressive (LDL-C≤70 mg/dL, non-HDL-C≤100 mg/dL) targets. An algorithm started with statin monotherapy, adding intestinally acting agents as required to reach LDL-C targets. Triglyceride [TG]-lowering agents were next used to reach non-HDL-C goals. Lipid management was performed by mid-level practitioners, with physician consultation, using point-of-care lipid determinations. Results On average, both groups achieved the LDL-C and non-HDL-C goals within 12 months and maintained them throughout the study. At 36 months, mean (SD) LDL-C and non-HDL-C were 72 (24) and 102 (29) mg/dL in the aggressive group (AGG) and 104 (20) and 138 (26) mg/dL, respectively, in the standard group (STD); systolic blood pressure targets were 115 and 130 mmHg, respectively. 68% of participants reached target LDL-C for >50% of the visits and 46% for >75% of visits. At 36 months, the AGG averaged 1.5 lipid lowering medications and the STD 1.2. Statins were used in 91% and 68% of the AGG and STD; ezetimibe by 31% and 10%; fibrates by 8% and 18%. No serious adverse events (SAEs) were observed; AEs occurred in 18% of the AGG and 14% of the STD. Conclusion Standard and aggressive lipid targets can be safely maintained in diabetic patients. Standardized algorithms, point-of-care lipid testing, and non

  3. Empirically establishing blood glucose targets to achieve HbA1c goals.

    PubMed

    Wei, Nancy; Zheng, Hui; Nathan, David M

    2014-04-01

    OBJECTIVE To determine the average fasting, postprandial, and bedtime self-monitored blood glucose (SMBG) concentrations associated with specified HbA1c levels using data from the A1c-Derived Average Glucose (ADAG) study. RESEARCH DESIGN AND METHODS The ADAG study was a multicenter observational study that used continuous glucose monitoring and SMBG testing to determine the relationship between mean average glucose and HbA1c. We used the SMBG data from 470 of the ADAG study participants (237 with type 1 diabetes and 147 with type 2 diabetes) to determine the average fasting, premeal, 90-min postmeal, and bedtime blood glucose (BG) for predefined target HbA1c groups between 5.5 and 8.5% (37-69 mmol/mol). t Tests were used to compare mean BG values between type 1 and type 2 diabetes groups. RESULTS The average fasting BG needed to achieve predefined HbA1c target levels of 5.5-6.49% (37-47 mmol/mol), 6.5-6.99% (48-52 mmol/mol), 7.0-7.49% (52-58 mmol/mol), 7.5-7.99% (58-64 mmol/mol), and 8.0-8.5% (64-69 mmol/mol) were 122 mg/dL with 95% CI 117-127, 142 mg/dL (135-150), 152 mg/dL (143-162), 167 mg/dL (157-177), and 178 mg/dL (164-192), respectively. Postmeal BG to achieve the HbA1c level of 6.5-6.99% (48-52 mmol/mol) and 7.0-7.49% (52-58 mmol/mol) were 139 mg/dL (134-144) and 152 mg/dL (147-157), respectively. Bedtime BG was 153 mg/dL (145-161) and 177 mg/dL (166-188), respectively. CONCLUSIONS We have determined the average BG at premeal, postmeal, and bedtime to achieve a variety of HbA1c targets. These results, based on empirical data, will help patients and providers set realistic day-to-day SMBG targets to achieve individualized HbA1c goals.

  4. IKKβ/NFκBp65 activated by interleukin-13 targets the autophagy-related genes LC3B and beclin 1 in fibroblasts co-cultured with breast cancer cells

    PubMed Central

    LI, WEN-LIN; XIONG, LI-XIA; SHI, XIAO-YU; XIAO, LIANG; QI, GUAN-YUN; MENG, CHUANG

    2016-01-01

    Interleukin-13 (IL-13), a Th2 cytokine, plays an important role in fibrosis, inflammation, tissue hyperresponsiveness and tumor development. Although studies have demonstrated that IL-13 exerts its roles through signal transducer and activator of transcription 6 (STAT6) signaling pathway, recent studies have revealed that I kappa B kinase (IKK)/nuclear factor kappa B (NFκB) pathway may also be involved in. The aim of this study was to investigate whether IL-13 delivers signals to IKKβ/NFκBp65 and whether autophagy genes are IL-13-induced the activation of NFκBp65 transcriptional targets in fibroblasts of breast tumor stroma. We examined the phosphorylation of IKKβ, the activation of NFκBp65 and NFκBp65-targeted autophagy genes in fibroblasts co-cultured with breast cancer cells under the condition of IL-13 stimulation. Results of this study showed that IL-13 induced IKKβ phosphorylation in the fibroblast line ESF co-cultured with breast cancer cell line BT474, and subsequently NFκBp65 was activated and aimed at beclin 1 and microtubule-associated protein 1 light chain 3 B (MAP1LC3B or LC3B) in these ESF cells. BMS345541, an inhibitor of IKK/NFκB pathway, significantly inhibited the IL-13-induced the activation of NFκB and also inhibited NFκB-targeted beclin 1 and LC3B expression. Our results suggest that IL-13 regulates beclin 1 and LC3B expression through IKKβ/NFκBp65 in fibroblasts co-cultured with breast cancer cells, and IL-13 plays role in activating IKKβ/NFκBp65. PMID:27073433

  5. Risk factors that affect reproductive target achievement in fertile dairy cows.

    PubMed

    Aungier, S P M; Roche, J F; Diskin, M G; Crowe, M A

    2014-01-01

    The aims of the present study were to investigate (1) the risk factors that influence the achievement of reproductive targets postpartum (pp) and (2) the key factors that influence pregnancy rate following first artificial insemination (AI) in dairy cows. Ninety-eight Holstein-Friesian pp cows were blood sampled from wk 1 to 4 pp for hematology and biochemistry. Reproductive tract health was assessed weekly by ultrasonography and vaginal mucus scoring. Body condition score (BCS), lameness score, and milk yield were assessed every 2 wk. Milk samples for progesterone assay were collected twice weekly and on d 4, 5, and 7 after AI. Risk factors associated with achieving reproductive targets depended on (1) increased metabolic activity of the liver (increased glutamate dehydrogenase at calving and increased γ-glutamyl transpeptidase in wk 4), (2) a competent immune system (increased neutrophils in wk 1; decreased α1-acid glycoprotein in wk 1, 2, and 3), (3) an endocrine system that was capable of responding by producing sufficient triiodothyronine in wk 2 and increased insulin-like growth factor I in wk 3 and 4, (4) a lower negative energy balance status (decreased nonesterified fatty acid concentration in wk 1; decreased β-hydroxybutyrate concentration in wk 2; BCS loss between calving and d 28 pp <0.5), (5) good reproductive tract health [normal uterine scan at d 45 pp; clear vaginal mucus discharge at first ovulation and at d 45 pp; resumed ovarian cyclicity by the end of the voluntary waiting period (≥ d 35 pp)], and (6) adequate diet (to ensure increased glutathione peroxidase in wk 2 and 3 and increased magnesium in wk 4). Risk factors that increased the odds of a successful first AI were previous ovulation(s) (odds ratio=3.17 per ovulation), BCS >2.5 at AI (odds ratio=3.01), and clear vaginal mucus (score=0) compared with purulent mucus (score >0) 4 d after first AI (odds ratio=2.99). In conclusion, this study identified key risk factors in the early pp

  6. Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1

    PubMed Central

    Phatak, Pornima; Byrnes, Kimberly A.; Mansour, Daniel; Liu, Lan; Cao, Shan; Li, Ruiyun; Rao, Jaladanki N.; Turner, Douglas J.; Wang, Jian-Ying; Donahue, James M.

    2015-01-01

    Based on its marked overexpression in multiple malignancies and its roles in promoting cell survival and proliferation, survivin is an attractive candidate for targeted therapy. Towards this end, a detailed understanding of the mechanisms regulating survivin expression in different cancer cells will be critical. We have previously shown that the RNA-binding protein (RBP) CUG-BP1 is overexpressed in esophageal cancer cells and post-transcriptionally regulates survivin in these cells. The objective of this study was to investigate the role of microRNAs (miRs) in regulating survivin expression in esophageal cancer cells. Using miR expression profiling analysis, we found that miR-214-3p is one of the most markedly downregulated miRs in two esophageal squamous cancer cell lines compared to esophageal epithelial cells. Interestingly, using miR target prediction programs, both survivin and CUG-BP1 mRNA were found to contain potential binding sites for miR-214-3p. Forced expression of miR-214-3p in esophageal cancer cells leads to a decrease in the mRNA and protein levels of both survivin and CUG-BP1. This effect is due to decreased mRNA stability of both targets. By contrast, silencing miR-214-3p in esophageal epithelial cells leads to an increase in both survivin and CUG-BP1 mRNA and protein. To determine whether the observed effect of miR-214-3p on survivin expression was direct, mediated through CUG-BP1, or both, binding studies utilizing biotin pull-down assays and heterologous luciferase reporter constructs were performed. These demonstrated that the mRNA of survivin and CUG-BP1 each contain two functional miR-214-3p binding sites as confirmed by mutational analysis. Finally, forced expression of miR-214-3p enhances the sensitivity of esophageal cancer cells to Cisplatin-induced apoptosis. This effect is abrogated with rescue expression of survivin or CUG-BP1. These findings suggest that miR-214-3p acts as a tumor suppressor and that its downregulation contributes to

  7. Lipid target achievement among patients with very high and high cardiovascular risk in a lipid clinic.

    PubMed

    Barkas, Fotios; Liberopoulos, Evangelos N; Kostapanos, Michael S; Liamis, George; Tziallas, Dimitrios; Elisaf, Moses

    2015-04-01

    This was a retrospective study that assessed achievement of lipid-lowering treatment targets in the setting of a University Hospital Lipid Clinic. Low-density lipoprotein cholesterol (LDL-C) goal attainment according to National Cholesterol Education Program-Adult Treatment Panel III (NCEP ATP III) and European Society of Cardiology/European Atherosclerosis Society (ESC/EAS) guidelines was recorded in 1000 consecutive adult patients followed for ≥3 years (mean 8 years). The LDL-C targets according to the NCEP ATP III were attained by 66% and 86% of patients with "very high" (n = 477) and "high" (n = 408) cardiovascular risk, respectively. Fewer patients were within LDL-C goals according to the ESC/EAS guidelines: 25% and 42%. Overall, 92% of the patients were on statins: 67% were on statin monotherapy, while 33% were on combinations with ezetimibe (25%), ω-3 fatty acids (5%), fibrates (4%), or colesevelam (2%). Even in a specialist lipid clinic, a large proportion of patients are not at goal according to the recent ESC/EAS guidelines. PMID:24830420

  8. HDAC4 as a potential therapeutic target in neurodegenerative diseases: a summary of recent achievements

    PubMed Central

    Mielcarek, Michal; Zielonka, Daniel; Carnemolla, Alisia; Marcinkowski, Jerzy T.; Guidez, Fabien

    2015-01-01

    For the past decade protein acetylation has been shown to be a crucial post-transcriptional modification involved in the regulation of protein functions. Histone acetyltransferases (HATs) mediate acetylation of histones which results in the nucleosomal relaxation associated with gene expression. The reverse reaction, histone deacetylation, is mediated by histone deacetylases (HDACs) leading to chromatin condensation followed by transcriptional repression. HDACs are divided into distinct classes: I, IIa, IIb, III, and IV, on the basis of size and sequence homology, as well as formation of distinct repressor complexes. Implications of HDACs in many diseases, such as cancer, heart failure, and neurodegeneration, have identified these molecules as unique and attractive therapeutic targets. The emergence of HDAC4 among the members of class IIa family as a major player in synaptic plasticity raises important questions about its functions in the brain. The characterization of HDAC4 specific substrates and molecular partners in the brain will not only provide a better understanding of HDAC4 biological functions but also might help to develop new therapeutic strategies to target numerous malignancies. In this review we highlight and summarize recent achievements in understanding the biological role of HDAC4 in neurodegenerative processes. PMID:25759639

  9. Peaking profiles for achieving long-term temperature targets with more likelihood at lower costs

    PubMed Central

    den Elzen, Michel G. J.; van Vuuren, Detlef P.

    2007-01-01

    How can dangerous interference with the climate system be avoided? Science can help decision-makers answer this political question. Earlier publications have focused on the probability of keeping global mean temperature change below certain thresholds by stabilizing greenhouse gas concentrations at particular levels. We compare the results of such “stabilization profiles” with a set of “peaking profiles” that reduce emissions further after stabilization and thus result in a concentration peak. Given the inertia in the climate system, stabilization profiles lead to ongoing warming beyond 2100 until the temperature reaches equilibrium. This warming partly can be prevented for peaking profiles. In this way, these profiles can increase the likelihood of achieving temperature thresholds by 10–20% compared with the likelihood for the associated stabilization profiles. Because the additional mitigation efforts and thus costs for peaking profiles lie mainly beyond 2100, peaking profiles achieving temperature thresholds with the same likelihood as the original stabilization profile, but at considerably lower cost (up to 40%), can be identified. The magnitude of the cost reductions depends on the assumptions on discounting. Peaking profiles and overshoot profiles with a limited overshoot may, in particular, play an important role in making more ambitious climate targets feasible. PMID:17989238

  10. Targeting zinc finger domains with small molecules: solution structure and binding studies of the RanBP2-type zinc finger of RBM5

    PubMed Central

    Farina, Biancamaria; Fattorusso, Roberto

    2012-01-01

    The RNA Binding Motif protein 5 (RBM5), also known as Luca15 or H37, is a component of prespliceosomal complexes, that regulates the alternative splicing of several mRNAs, such as Fas and caspase-2. The rbm5 gene is located at the 2p21.3 chromosomal region, which is strongly associated with lung cancer and many other cancers. Both increased and decreased levels of RBM5 can play a role in tumor progression. In particular, down-regulation of rbm5 is involved in lung cancer and other cancers upon Ras activation, and, also, represents a molecular signature associated with metastasis in various solid tumors. On the other hand, up-regulation of rbm5 occurs in breast and ovarian cancer. Moreover, RBM5 was also found to be involved in the early stage of the HIV-1 viral cycle, representing a potential target for the treatment of the HIV-1 infection. While the molecular basis for RNA recognition and ubiquitin interaction have been structurally characterized, small molecules binding this ZF domain that may contribute to characterize their activity and to develop potential therapeutic agents have not been yet reported. Via an NMR screening of a fragment library we identified several binders and the complex of the most promising one, named compound 1, with the RBM5 ZF1 was structurally characterized in solution. Interestingly, the binding mechanism reveals that compound 1 occupies the RNA binding pocket and is therefore able to compete with the RNA to bind RBM5 RanBP2-type ZF domain, as indicated by NMR studies. PMID:22162216

  11. Achieving cholesterol targets by individualizing starting doses of statin according to baseline low-density lipoprotein cholesterol and coronary artery disease risk category: The CANadians Achieve Cholesterol Targets Fast with Atorvastatin Stratified Titration (CanACTFAST) study

    PubMed Central

    Ur, Ehud; Langer, Anatoly; Rabkin, Simon W; Calciu, Cristina-Dana; Leiter, Lawrence A

    2010-01-01

    BACKGROUND: Despite an increasing body of evidence on the benefit of lowering elevated levels of low-density lipoprotein cholesterol (LDL-C), there is still considerable concern that patients are not achieving target LDL-C levels. OBJECTIVE: The CANadians Achieve Cholesterol Targets Fast with Atorvastatin Stratified Titration (CanACTFAST) trial tested whether an algorithm-based statin dosing approach would enable patients to achieve LDL-C and total cholesterol/high-density lipoprotein cholesterol (TC/HDL-C) ratio targets quickly. METHODS: Subjects requiring statin therapy, but with an LDL-C level of 5.7 mmol/L or lower, and triglycerides of 6.8 mmol/L or lower at screening participated in the 12-week study, which had two open-label, six-week phases: a treatment period during which patients received 10 mg, 20 mg, 40 mg or 80 mg of atorvastatin based on an algorithm incorporating baseline LDL-C value and cardiovascular risk; and patients who achieved both LDL-C and TC/HDL-C ratio targets at six weeks continued on the same atorvastatin dose. Patients who did not achieve both targets received dose uptitration using a single-step titration regimen. The primary efficacy outcome was the proportion of patients achieving target LDL-C levels after 12 weeks. RESULTS: Of 2016 subjects screened at 88 Canadian sites, 1258 were assigned to a study drug (1101 were statin-free and 157 were statin-treated at baseline). The proportion of subjects who achieved LDL-C targets after 12 weeks of treatment was 86% (95% CI 84% to 88%) for statin-free patients and 54% (95% CI 46% to 61%) for statin-treated patients. Overall, 1003 subjects (80%; 95% CI 78% to 82%) achieved both lipid targets. CONCLUSIONS: Algorithm-based statin dosing enables patients to achieve LDL-C and TC/HDL-C ratio targets quickly, with either no titration or a single titration. PMID:20151053

  12. On achieving the state's household recycling target: a case study of Northern New Jersey, USA.

    PubMed

    Otegbeye, M; Abdel-Malek, L; Hsieh, H N; Meegoda, J N

    2009-02-01

    In recent times, the State of New Jersey (USA) has been making attempts at promoting recycling as an environmentally friendly means of attaining self-sufficiency at waste disposal, and the state has put in place a 50% recycling target for its municipal solid waste stream. While the environmental benefits of recycling are obvious, a recycling program must be cost effective to ensure its long-term sustainability. In this paper, a linear programming model is developed to examine the current state of recycling in selected counties in Northern New Jersey and assess the needs to achieve the state's recycling goal in these areas. The optimum quantities of waste to be sent to the different waste facilities, which include landfills, incinerators, transfer stations, recycling and composting plants, are determined by the model. The study shows that for these counties, the gap between the current waste practices where the recycling rate stands at 32% and the state's goal can be bridged by more efficient utilization of existing facilities and reasonable investment in expanding those for recycling activities. PMID:18835150

  13. Determination of contrast media administration to achieve a targeted contrast enhancement in CT

    NASA Astrophysics Data System (ADS)

    Sahbaee, Pooyan; Li, Yuan; Segars, Paul; Marin, Daniele; Nelson, Rendon; Samei, Ehsan

    2015-03-01

    Contrast enhancement is a key component of CT imaging and offer opportunities for optimization. The design and optimization of new techniques however requires orchestration with the scan parameters and further a methodology to relate contrast enhancement and injection function. In this study, we used such a methodology to develop a method, analytical inverse method, to predict the required injection function to achieve a desired contrast enhancement in a given organ by incorporation of a physiologically based compartmental model. The method was evaluated across 32 different target contrast enhancement functions for aorta, kidney, stomach, small intestine, and liver. The results exhibited that the analytical inverse method offers accurate performance with error in the range of 10% deviation between the predicted and desired organ enhancement curves. However, this method is incapable of predicting the injection function based on the liver enhancement. The findings of this study can be useful in optimizing contrast medium injection function as well as the scan timing to provide more consistency in the way that the contrast enhanced CT examinations are performed. To our knowledge, this work is one of the first attempts to predict the contrast material injection function for a desired organ enhancement curve.

  14. On achieving the state's household recycling target: A case study of Northern New Jersey, USA

    SciTech Connect

    Otegbeye, M.; Abdel-Malek, L.; Hsieh, H.N.; Meegoda, J.N.

    2009-02-15

    In recent times, the State of New Jersey (USA) has been making attempts at promoting recycling as an environmentally friendly means of attaining self-sufficiency at waste disposal, and the state has put in place a 50% recycling target for its municipal solid waste stream. While the environmental benefits of recycling are obvious, a recycling program must be cost effective to ensure its long-term sustainability. In this paper, a linear programming model is developed to examine the current state of recycling in selected counties in Northern New Jersey and assess the needs to achieve the state's recycling goal in these areas. The optimum quantities of waste to be sent to the different waste facilities, which include landfills, incinerators, transfer stations, recycling and composting plants, are determined by the model. The study shows that for these counties, the gap between the current waste practices where the recycling rate stands at 32% and the state's goal can be bridged by more efficient utilization of existing facilities and reasonable investment in expanding those for recycling activities.

  15. On achieving the state's household recycling target: a case study of Northern New Jersey, USA.

    PubMed

    Otegbeye, M; Abdel-Malek, L; Hsieh, H N; Meegoda, J N

    2009-02-01

    In recent times, the State of New Jersey (USA) has been making attempts at promoting recycling as an environmentally friendly means of attaining self-sufficiency at waste disposal, and the state has put in place a 50% recycling target for its municipal solid waste stream. While the environmental benefits of recycling are obvious, a recycling program must be cost effective to ensure its long-term sustainability. In this paper, a linear programming model is developed to examine the current state of recycling in selected counties in Northern New Jersey and assess the needs to achieve the state's recycling goal in these areas. The optimum quantities of waste to be sent to the different waste facilities, which include landfills, incinerators, transfer stations, recycling and composting plants, are determined by the model. The study shows that for these counties, the gap between the current waste practices where the recycling rate stands at 32% and the state's goal can be bridged by more efficient utilization of existing facilities and reasonable investment in expanding those for recycling activities.

  16. GADIS: Algorithm for designing sequences to achieve target secondary structure profiles of intrinsically disordered proteins.

    PubMed

    Harmon, Tyler S; Crabtree, Michael D; Shammas, Sarah L; Posey, Ammon E; Clarke, Jane; Pappu, Rohit V

    2016-09-01

    Many intrinsically disordered proteins (IDPs) participate in coupled folding and binding reactions and form alpha helical structures in their bound complexes. Alanine, glycine, or proline scanning mutagenesis approaches are often used to dissect the contributions of intrinsic helicities to coupled folding and binding. These experiments can yield confounding results because the mutagenesis strategy changes the amino acid compositions of IDPs. Therefore, an important next step in mutagenesis-based approaches to mechanistic studies of coupled folding and binding is the design of sequences that satisfy three major constraints. These are (i) achieving a target intrinsic alpha helicity profile; (ii) fixing the positions of residues corresponding to the binding interface; and (iii) maintaining the native amino acid composition. Here, we report the development of a G: enetic A: lgorithm for D: esign of I: ntrinsic secondary S: tructure (GADIS) for designing sequences that satisfy the specified constraints. We describe the algorithm and present results to demonstrate the applicability of GADIS by designing sequence variants of the intrinsically disordered PUMA system that undergoes coupled folding and binding to Mcl-1. Our sequence designs span a range of intrinsic helicity profiles. The predicted variations in sequence-encoded mean helicities are tested against experimental measurements. PMID:27503953

  17. ED 03-2 HOME BLOOD PRESSURE MONITORING IS BETTER THAN OFFICE BP AND AMBULATORY BP: UPDATE.

    PubMed

    Kario, Kazuomi

    2016-09-01

    Out-of-office blood pressure (BP) measured by home BP monitoring (HBPM) or ambulatory BP monitoring (ABPM) was demonstrated to be superior to office BP for the prediction of cardiovascular events. The ABPM is superior to HBPM for detecting the all the BP-related risks throughout 24-hr, and the self-measured HBPM underestimates the risk of daytime stress hypertension and nocturnal hypertension. However, ABPM cannot always be provided in clinical practice, and home BP monitoring can be superior to ABPM as part of a home BP-guided antihypertension strategy in clinical practice. In clinical practice, we should use both ABPM and HBPM considering these device properties. We have developed the new ABPM device which is alternatively used as self-measure HBPM (Kario. Prog Cardiovasc Dis 2016, in press).The importance of on-treatment HBPM for the cardiovascular prognosis of hypertensive individuals was recently revealed in the largest real-world prospective study held to date, the Home blood pressure measurement with Olmesartan Naive patients to Establish Standard Target blood pressure (HONEST) study. That study of more than 21 000 hypertensive patients used HBPM, and the results demonstrated that when morning home systolic BP was well-controlled during the 2-year follow-up at < 125 mmHg, there was no increase in cardiovascular events even among the patients whose office systolic BP was ≥150 mmHg, compared with those with office systolic BP < 130 mmHg and morning home systolic BP < 125 mmHg. On the other hand, even when the office systolic BP of the HONEST study's hypertensive patients was well controlled at < 130 mmHg, the hazard ratio of cardiovascular events was 2.5 in the masked uncontrolled hypertension patients with morning systolic BP ≥145 mmHg compared with the well-controlled patients with morning systolic BP < 125 mmHg (Kario, et al. Hypertension 2014;64:989-996). The threshold of on-treatment morning BP for a significant increase in

  18. Functional screen for secreted proteins by monoclonal antibody library and identification of Mac-2 Binding protein (Mac-2BP) as a potential therapeutic target and biomarker for lung cancer.

    PubMed

    Sun, Lichao; Chen, Lizhao; Sun, Lixin; Pan, Jian; Yu, Long; Han, LuLu; Yang, Zhihua; Luo, Yuanming; Ran, Yuliang

    2013-02-01

    Identification of secreted proteins of lung cancer could provide new candidates of serum biomarkers for cancer diagnosis or targets for therapeutic intervention. In this study, we developed a novel strategy that combined functional monoclonal antibody library screening technique and mass spectrometry to identify functional secreted proteins. BALB/c mice were immunized with cancer cells isolated from fresh human lung cancer tissues. The monoclonal antibody library containing 1160 mAbs was established with the mouse spleen cells, whose serum had most anti-proliferative effect on lung cancer cells. Monoclonal antibodies were subjected to an immunoreactive and functional screen and monoclonal antibodies that reacted strongly with secreted proteins in condition medium and lung cancer tissues with high inhibotion of cell proliferation were selected. Antigens that recognized by antibodies were obtained by immunoprecipitation and then identified by mass spectrometry. Mac-2-binding protein (Mac-2BP), the antigen of 13H3 antibody, was identified using this approach. Functional studies demonstrated that the 13H3 antibody suppressed lung cancer cell lines ANIP-973 and A549 proliferation in vitro and inhibit ANIP973 xenograft tumors growth in vivo by inducing cell-cycle arrest at G1 phase, with up-regulation of p27 and down-regulation of cyclin D1. Moreover, the serum level of Mac-2BP was significantly higher in lung cancer patients than healthy controls. At a cutoff value of 6 μg/ml, Mac-2BP might be a diagnostic biomarker of lung cancer, especially for SCLC. Mac-2BP concentrations of 6 μg/ml or higher was associated with poor overall survival in univariate analysis, and was an independent predictor in the multivariate COX analysis. Together, these results firstly demonstrated that Mac-2BP can be used as a therapeutic target and potential biomarker for lung cancer. Our strategy is feasible, which may facilitate the identification of novel secreted biomarkers of lung cancer.

  19. Functional Screen for Secreted Proteins by Monoclonal Antibody Library and Identification of Mac-2 Binding Protein (Mac-2BP) as a Potential Therapeutic Target and Biomarker for Lung Cancer*

    PubMed Central

    Sun, Lichao; Chen, Lizhao; Sun, Lixin; Pan, Jian; Yu, Long; Han, LuLu; Yang, Zhihua; Luo, Yuanming; Ran, Yuliang

    2013-01-01

    Identification of secreted proteins of lung cancer could provide new candidates of serum biomarkers for cancer diagnosis or targets for therapeutic intervention. In this study, we developed a novel strategy that combined functional monoclonal antibody library screening technique and mass spectrometry to identify functional secreted proteins. BALB/c mice were immunized with cancer cells isolated from fresh human lung cancer tissues. The monoclonal antibody library containing 1160 mAbs was established with the mouse spleen cells, whose serum had most anti-proliferative effect on lung cancer cells. Monoclonal antibodies were subjected to an immunoreactive and functional screen and monoclonal antibodies that reacted strongly with secreted proteins in condition medium and lung cancer tissues with high inhibotion of cell proliferation were selected. Antigens that recognized by antibodies were obtained by immunoprecipitation and then identified by mass spectrometry. Mac-2-binding protein (Mac-2BP), the antigen of 13H3 antibody, was identified using this approach. Functional studies demonstrated that the 13H3 antibody suppressed lung cancer cell lines ANIP-973 and A549 proliferation in vitro and inhibit ANIP973 xenograft tumors growth in vivo by inducing cell-cycle arrest at G1 phase, with up-regulation of p27 and down-regulation of cyclin D1. Moreover, the serum level of Mac-2BP was significantly higher in lung cancer patients than healthy controls. At a cutoff value of 6 μg/ml, Mac-2BP might be a diagnostic biomarker of lung cancer, especially for SCLC. Mac-2BP concentrations of 6 μg/ml or higher was associated with poor overall survival in univariate analysis, and was an independent predictor in the multivariate COX analysis. Together, these results firstly demonstrated that Mac-2BP can be used as a therapeutic target and potential biomarker for lung cancer. Our strategy is feasible, which may facilitate the identification of novel secreted biomarkers of lung cancer

  20. Prenatal Transmission of Syphilis and Human Immunodeficiency Virus in Brazil: Achieving Regional Targets for Elimination

    PubMed Central

    Cerda, Rodrigo; Perez, Freddy; Domingues, Rosa Maria S.M.; Luz, Paula M.; Grinsztejn, Beatriz; Veloso, Valdilea G.; Caffe, Sonja; Francke, Jordan A.; Freedberg, Kenneth A.; Ciaranello, Andrea L.

    2015-01-01

    Background. The Pan-American Health Organization has called for reducing (1) human immunodeficiency virus (HIV) mother-to-child transmission (MTCT) to ≤0.30 infections/1000 live births (LB), (2) HIV MTCT risk to ≤2.0%, and (3) congenital syphilis (CS) incidence to ≤0.50/1000 LB in the Americas by 2015. Methods. Using published Brazilian data in a mathematical model, we simulated a cohort of pregnant women from antenatal care (ANC) through birth. We investigated 2 scenarios: “current access” (89.1% receive one ANC syphilis test and 41.1% receive 2; 81.7% receive one ANC HIV test and 18.9% receive birth testing; if diagnosed, 81.0% are treated for syphilis and 87.5% are treated for HIV) and “ideal access” (95% of women undergo 2 HIV and syphilis screenings; 95% receive appropriate treatment). We conducted univariate and multivariate sensitivity analyses on key inputs. Results. With current access, we projected 2.95 CS cases/1000 LB, 0.29 HIV infections/1000 LB, 7.1% HIV MTCT risk, and 11.11 intrauterine fetal demises (IUFD)/1000 pregnancies, with significant regional variation. With ideal access, we projected improved outcomes: 1.00 CS cases/1000 LB, 0.10 HIV infections/1000 LB, HIV MTCT risk of 2.4%, and 10.65 IUFD/1000 pregnancies. Increased testing drove the greatest improvements. Even with ideal access, only HIV infections/1000 LB met elimination goals. Achieving all targets required testing and treatment >95% and reductions in prevalence and incidence of HIV and syphilis. Conclusions. Increasing access to care and HIV and syphilis antenatal testing will substantially reduce HIV and syphilis MTCT in Brazil. In addition, regionally tailored interventions reducing syphilis incidence and prevalence and supporting HIV treatment adherence are necessary to completely meet elimination goals. PMID:26180825

  1. Prenatal Transmission of Syphilis and Human Immunodeficiency Virus in Brazil: Achieving Regional Targets for Elimination.

    PubMed

    Cerda, Rodrigo; Perez, Freddy; Domingues, Rosa Maria S M; Luz, Paula M; Grinsztejn, Beatriz; Veloso, Valdilea G; Caffe, Sonja; Francke, Jordan A; Freedberg, Kenneth A; Ciaranello, Andrea L

    2015-04-01

    Background.  The Pan-American Health Organization has called for reducing (1) human immunodeficiency virus (HIV) mother-to-child transmission (MTCT) to ≤0.30 infections/1000 live births (LB), (2) HIV MTCT risk to ≤2.0%, and (3) congenital syphilis (CS) incidence to ≤0.50/1000 LB in the Americas by 2015. Methods.  Using published Brazilian data in a mathematical model, we simulated a cohort of pregnant women from antenatal care (ANC) through birth. We investigated 2 scenarios: "current access" (89.1% receive one ANC syphilis test and 41.1% receive 2; 81.7% receive one ANC HIV test and 18.9% receive birth testing; if diagnosed, 81.0% are treated for syphilis and 87.5% are treated for HIV) and "ideal access" (95% of women undergo 2 HIV and syphilis screenings; 95% receive appropriate treatment). We conducted univariate and multivariate sensitivity analyses on key inputs. Results.  With current access, we projected 2.95 CS cases/1000 LB, 0.29 HIV infections/1000 LB, 7.1% HIV MTCT risk, and 11.11 intrauterine fetal demises (IUFD)/1000 pregnancies, with significant regional variation. With ideal access, we projected improved outcomes: 1.00 CS cases/1000 LB, 0.10 HIV infections/1000 LB, HIV MTCT risk of 2.4%, and 10.65 IUFD/1000 pregnancies. Increased testing drove the greatest improvements. Even with ideal access, only HIV infections/1000 LB met elimination goals. Achieving all targets required testing and treatment >95% and reductions in prevalence and incidence of HIV and syphilis. Conclusions.  Increasing access to care and HIV and syphilis antenatal testing will substantially reduce HIV and syphilis MTCT in Brazil. In addition, regionally tailored interventions reducing syphilis incidence and prevalence and supporting HIV treatment adherence are necessary to completely meet elimination goals. PMID:26180825

  2. Potential for reducing air-pollutants while achieving 2 °C global temperature change limit target.

    PubMed

    Hanaoka, Tatsuya; Akashi, Osamu; Fujiwara, Kazuya; Motoki, Yuko; Hibino, Go

    2014-12-01

    This study analyzes the potential to reduce air pollutants while achieving the 2 °C global temperature change limit target above pre-industrial levels, by using the bottom-up optimization model, AIM/Enduse[Global]. This study focuses on; 1) estimating mitigation potentials and costs for achieving 2 °C, 2.5 °C, and 3 °C target scenarios, 2) assessing co-benefits of reducing air pollutants such as NOx, SO2, BC, PM, and 3) analyzing features of sectoral attributions in Annex I and Non-Annex I groups of countries. The carbon tax scenario at 50 US$/tCO2-eq in 2050 can reduce GHG emissions more than the 3 °C target scenario, but a higher carbon price around 400 US$/tCO2-eq in 2050 is required to achieve the 2 °C target scenario. However, there is also a co-benefit of large reduction potential of air pollutants, in the range of 60-80% reductions in 2050 from the reference scenario while achieving the 2 °C target. PMID:25028265

  3. Potential for reducing air-pollutants while achieving 2 °C global temperature change limit target.

    PubMed

    Hanaoka, Tatsuya; Akashi, Osamu; Fujiwara, Kazuya; Motoki, Yuko; Hibino, Go

    2014-12-01

    This study analyzes the potential to reduce air pollutants while achieving the 2 °C global temperature change limit target above pre-industrial levels, by using the bottom-up optimization model, AIM/Enduse[Global]. This study focuses on; 1) estimating mitigation potentials and costs for achieving 2 °C, 2.5 °C, and 3 °C target scenarios, 2) assessing co-benefits of reducing air pollutants such as NOx, SO2, BC, PM, and 3) analyzing features of sectoral attributions in Annex I and Non-Annex I groups of countries. The carbon tax scenario at 50 US$/tCO2-eq in 2050 can reduce GHG emissions more than the 3 °C target scenario, but a higher carbon price around 400 US$/tCO2-eq in 2050 is required to achieve the 2 °C target scenario. However, there is also a co-benefit of large reduction potential of air pollutants, in the range of 60-80% reductions in 2050 from the reference scenario while achieving the 2 °C target.

  4. Epidemiological impact of achieving UNAIDS 90-90-90 targets for HIV care in India: a modelling study

    PubMed Central

    Maddali, Manoj V; Gupta, Amita; Shah, Maunank

    2016-01-01

    Objective Recent UNAIDS ‘90-90-90’ targets propose that to end the HIV epidemic by 2030, 90% of persons living with HIV (PLWH) worldwide should know their diagnosis, 90% of diagnosed PLWH should be on antiretroviral therapy (ART) and 90% of PLWH on ART should be virally suppressed by 2020. We sought to quantify the epidemiological impact of achieving these targets in India. Methods We constructed a dynamic-transmission model of the Indian HIV epidemic to project HIV infections and AIDS-related deaths that would occur in India over 15 years. We considered several scenarios: continuation of current care engagement (with early ART initiation), achieving 90-90-90 targets on time and delaying achievement by 5 or 10 years. Results In the base case, assuming continuation of current care engagement, we project 794 000 (95% uncertainty range (UR) 571 000–1 104 000) HIV infections and 689 000 (95% UR 468 000–976 000) AIDS-related deaths in India over 15 years. In this scenario, nearly half of PLWH diagnosed would fail to achieve viral suppression by 2030. With achievement of 90-90-90 targets, India could avert 392 000 (95% UR 248 000–559 000) transmissions (48% reduction) and 414 000 (95% UR 260 000–598 000) AIDS-related deaths (59% reduction) compared to the base-case scenario. Furthermore, fewer than 20 000 (95% UR 12 000–30 000) HIV infections would occur in 2030. Delaying achievement of targets resulted in a similar reduction in HIV incidence by 2030 but at the cost of excess overall infections and mortality. Conclusions India can halve the epidemiological burden of HIV over 15 years with achievement of the UNAIDS 90-90-90 targets. Reaching the targets on time will require comprehensive healthcare strengthening, especially in early diagnosis and treatment, expanded access to second-line and third-line ART and long-term retention in care. PMID:27388363

  5. Communicating Non-Targeted Effects of Ionizing Radiation to Achieve Adaptive Homeostasis in Tissues

    SciTech Connect

    Morgan, William F.

    2011-06-04

    Non-targeted effects, i.e., those responses in cells or tissues that were not subject to energy deposition events after localized exposure to ionizing radiaton, are well-established. While they are not universal phenotype, when they do occur they can be associated with subsequent tissue or whole body responses. Here it is argued that non-targeted effects are a tissue level response to restore equilibrium within an organ system, and thus restores tissue homeostasis. This "adaptive homeostasis" has evolved in response to a variety of environmental and other such stresses an individual is exposed to in their lifetime. These non-targeted effects are not likely to impact significantly on estimates of potential risks associated with radiation exposure because they are presumably "built into" current risk estimates. However, they could have implications for radiation carcinogenesis, by driving processes in targeted and non-targeted cells that could eliminate transformed cells or transform cells from a normal phenotype to a phenotype associated with malignancy within a tissue.

  6. High-Throughput Profiling of Alpha Interferon- and Interleukin-28B-Regulated MicroRNAs and Identification of let-7s with Anti-Hepatitis C Virus Activity by Targeting IGF2BP1

    PubMed Central

    Cheng, Min; Si, Youhui; Niu, Yuqiang; Liu, Xiuying; Li, Xiang; Zhao, Jin

    2013-01-01

    Hepatitis C virus (HCV) infection is a major cause of severe liver disease. Interferon (IFN)/ribavirin treatment remains the standard therapeutic regimen for HCV infection in most countries. IFN-stimulated genes are believed to contribute to antiviral effects. However, emerging evidence suggests that microRNAs (miRNAs), a class of noncoding small RNAs, are involved in the control of viral infection. Here, we systematically profiled the hepatocyte expression of a set of 750 miRNAs in response to alpha interferon (IFN-α) and interleukin-28B (IL-28B) treatments. The anti-HCV activity of differentially expressed miRNAs was evaluated using cell culture-derived HCV in vitro. The results demonstrate that let-7b had a significant anti-HCV effect by inhibiting HCV replication and viral protein translation in human hepatoma cells. In particular, we show that the inhibition of let-7b attenuated the anti-HCV effects of IFN-α and IL-28B. Furthermore, we show that the host factor insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) is a target of let-7b. IGF2BP1 was required for HCV replication, and its expression was downregulated by IFN-α and IL-28B. Deletion of the wild-type seed region of let-7b abolished its antiviral activity. Finally, we demonstrate that other let-7 family miRNAs were able to inhibit HCV and to suppress IGF2BP1 expression. In conclusion, we provide an example of a host miRNA regulated by type I and type III IFNs that inhibits HCV replication and infectivity by targeting host targets. These results highlight the important role of miRNAs in the host antiviral immune response and provide a novel candidate for anti-HCV therapy. PMID:23824794

  7. Modulation of specific protein expression levels by PTEN: identification of AKAP121, DHFR, G3BP, Rap1, and RCC1 as potential targets of PTEN.

    PubMed

    Huang, Yanping; Wernyj, Roman P; Norton, Darrell D; Precht, Patricia; Seminario, Maria-Cristina; Wange, Ronald L

    2005-05-26

    The tumor suppressor PTEN is mutated in a high percentage of human cancers, and is implicated in pathways regulating cell growth, proliferation, survival, and migration. Despite significant advances, our understanding of its mechanisms of action remains incomplete. We have used a high-throughput proteomic immunoblotting approach to identify proteins whose expression levels are modulated by PTEN. Out of over 800 proteins screened, 22 proteins showed significant changes in expression. Five proteins that exhibited two-fold or greater changes in expression level were further characterized. AKAP121 and G3BP expression was reduced, while dihydrofolate reductase (DHFR), Rap1 and RCC1 expression was elevated in response to PTEN expression in a PTEN-null T-cell leukemia line. The phosphatase activity of PTEN was required for these effects. However, direct inhibition of PI-3 Kinase could mimic PTEN in modulating expression of DHFR, G3BP, Rap1 and RCC1, but not AKAP121. Real-time PCR showed that the effects of PTEN were primarily post-transcriptional, and would not have been revealed by mRNA-based screens. We conclude from these data that PTEN can modulate the expression level of a number of different proteins. The identified proteins have the potential to serve as previously unrecognized effectors of PTEN, and suggest the existence of additional complexity in the modes by which PTEN can regulate cellular biology.

  8. [Update of planning tables of cholesterol-lowering therapy orientated to achieve LDL therapeutic targets].

    PubMed

    Masana, Luis; Plana, Núria

    2015-01-01

    This is the third update of a planning-table for use in cholesterol-lowering therapy, so as to obtain LDLc objectives. This is an easy to use laptop tool to help choose the best statin or combination therapy (statin plus ezetimibe) depending on the current LDL concentration of the patient, and the LDLc objective to achieve. It is based on a colour code that indicates the drugs that are efficient enough to help patients to achieve their LDL goal. Along with the table, recommendations are given for the best strategy in order to implement the optimal therapy in a maximum of two clinical encounters. PMID:25865752

  9. [Update of planning tables of cholesterol-lowering therapy orientated to achieve LDL therapeutic targets].

    PubMed

    Masana, Luis; Plana, Núria

    2015-01-01

    This is the third update of a planning-table for use in cholesterol-lowering therapy, so as to obtain LDLc objectives. This is an easy to use laptop tool to help choose the best statin or combination therapy (statin plus ezetimibe) depending on the current LDL concentration of the patient, and the LDLc objective to achieve. It is based on a colour code that indicates the drugs that are efficient enough to help patients to achieve their LDL goal. Along with the table, recommendations are given for the best strategy in order to implement the optimal therapy in a maximum of two clinical encounters.

  10. Narrowing the Field: Achieve Engagement Outcomes Faster by Targeting Potential Alumni Leaders

    ERIC Educational Resources Information Center

    Coolman, Jason

    2013-01-01

    Traditional alumni relations programs are about prompting graduates to do something--anything--for or with the institution. In this article, the author proposes something different: an outcome-oriented alumni relations programming model, which the author calls "strategic advancement," that focuses on smaller, targeted sets of graduates…

  11. Nutritionists in industry can play a key role in helping to achieve Health of the Nation targets for nutrition.

    PubMed

    Kirk, T R; de Looy, A; Fletcher, R; Ruxton, C H

    2007-06-01

    Nutritionists working in food manufacturing and retailing are potentially in a more powerful position than any other professional group to contribute towards achieving the national targets for nutrition and the reduction of nutrition-related diseases, set out in The Health of the Nation (DoH, 1992) and in Scotland's Health, A Challenge to Us All (Scottish Office, 1993). The present paper sets out the details of this argument. First, a review is given of the functions and types of activities carried out by nutritionists in industry. Then a number of key practical ways in which nutritionists, through their activities and functions, can help towards achieving national targets for nutrition and nutrition-related diseases are described. Finally, suggestions are made about the knowledge, skills, and personal attributes needed by nutritionists who intend making successful careers in industry and who wish, at the same time, to contribute towards improving the health of the nation. PMID:17539871

  12. Down-Regulation of miR-129-5p and the let-7 Family in Neuroendocrine Tumors and Metastases Leads to Up-Regulation of Their Targets Egr1, G3bp1, Hmga2 and Bach1

    PubMed Central

    Døssing, Kristina B. V.; Binderup, Tina; Kaczkowski, Bogumil; Jacobsen, Anders; Rossing, Maria; Winther, Ole; Federspiel, Birgitte; Knigge, Ulrich; Kjær, Andreas; Friis-Hansen, Lennart

    2014-01-01

    Expression of miRNAs in Neuroendocrine Neoplasms (NEN) is poorly characterized. We therefore wanted to examine the miRNA expression in Neuroendocrine Tumors (NETs), and identify their targets and importance in NET carcinogenesis. miRNA expression in six NEN primary tumors, six NEN metastases and four normal intestinal tissues was characterized using miRNA arrays, and validated by in-situ hybridization and qPCR. Among the down-regulated miRNAs miR-129-5p and the let-7f/let-7 family, were selected for further characterization. Transfection of miR-129-5p inhibited growth of a pulmonary and an intestinal carcinoid cell line. Analysis of mRNA expression changes identified EGR1 and G3BP1 as miR-129-5p targets. They were validated by luciferase assay and western blotting, and found robustly expressed in NETs by immunohistochemistry. Knockdown of EGR1 and G3BP1 mimicked the growth inhibition induced by miR-129-5p. let-7 overexpression inhibited growth of carcinoid cell lines, and let-7 inhibition increased protein content of the transcription factor BACH1 and its targets MMP1 and HMGA2, all known to promote bone metastases. Immunohistochemistry analysis revealed that let-7 targets are highly expressed in NETs and metastases. We found down-regulation of miR-129-5p and the let-7 family, and identified new neuroendocrine specific targets for these miRNAs, which contributes to the growth and metastatic potential of these tumors. PMID:25546138

  13. Can China achieve the WHO global targets for TB control by 2035?

    PubMed

    Huynh, Grace H

    2016-03-01

    To reach the ambitious WHO TB global targets by 2035, it is likely that China will need a comprehensive strategy that builds on its existing high-quality directly observed treatment, short-course program. This will require optimizing the use of existing tools within a changing health system landscape. In addition, new tools are needed to identify and treat TB in high-risk groups and in older people, who are a growing driver of disease incidence. Lastly, strategies are needed to address the proximate risk factors and social determinants that underlie trends in TB burden.

  14. Dobutamine stress echo is superior to exercise stress testing in achieving target heart rate among patients on beta blockers.

    PubMed

    Sabbath, Adam; Pack, Michael; Markiewicz, Richard; John, Jooby; Gaballa, Mohamed; Goldman, Steven; Thai, Hoang

    2005-01-01

    Published guidelines recommend continuing beta-adrenergic receptor blockade in patients undergoing stress testing. We evaluated the role of pharmacological versus exercise stress testing in achieving target heart rate (THR) among patients on beta-adrenergic blockade. We compared data from 140 patients who underwent dobutamine stress echo (DSE) and 143 patients who underwent exercise treadmill testing (ETT). In both groups, beta-adrenergic blocker was continued at the time of stress testing. Overall, patients undergoing DSE achieved THR more frequently than ETT. With beta-adrenergic blockade, DSE patients met THR more frequently than ETT patients (p < 0.001). Without beta-adrenergic blockade, there was no difference between either modality in achieving THR. In both DSE and ETT patients, absence of beta-adrenergic blockade increased the odds of achieving THR [odds ratio (OR): 2.46, p = 0.042 and OR: 7.44, p < 0.001, respectively]. Atropine use with DSE increased the odds of achieving THR (OR: 3.76, p = 0.006). In conclusion, pharmacological stress testing appears to be superior to exercise stress testing in achieving THR among patients on beta-adrenergic blockade.

  15. Gamma-Retroviral Vectors Enveloped with an Antibody and an Engineered Fusogenic Protein Achieved Antigen-Specific Targeting

    PubMed Central

    Yang, Haiguang; Zeigler, Leslie; Joo, Kye-Il; Cho, Taehoon; Lei, Yuning; Wang, Pin

    2008-01-01

    Development of methods to engineer gamma-retroviral vectors capable of transducing target cells in a cell-specific manner could impact the future of the clinical application of gene therapy as well as the understanding of the biology of transfer gene vectors. Two molecular events are critical for controlling the entry of gamma-retroviral vectors to target cells: binding to cell-surface receptors and the subsequent fusion of viral vector membrane and cellular membrane. In this report, we evaluated a method to incorporate a membrane-bound antibody and a fusogenic molecule to provide binding and fusion functions respectively, into gamma-retroviral vectors for targeted gene delivery. An anti-CD20 antibody and a fusogenic protein derived from Sindbis virus glycoprotein could be efficiently co-displayed on the surface of viral vectors. Vectors bearing anti-CD20 antibody conferred their binding specificity to cells expressing CD20. Enhanced in vitro transduction towards CD20-expressing cells was observed for gamma-retroviral vectors displaying both an antibody and a fusogen. We found that the biological activity of the fusogen played an important role on the efficiency of such a targeting strategy and were able to engineer several mutant forms of the fusogen exhibiting elevated fusion function to improve the overall efficiency of targeted transduction. We devised an animal model to show that subcutaneous injection of such engineered vectors to the areas xenografted with target cells could achieve targeted gene delivery in vivo. Taken together, we demonstrated as proof-of-principle a flexible and modular two-molecule strategy for engineering targeting gamma-retroviral vectors. PMID:18435481

  16. Trade-offs of different land and bioenergy policies on the path to achieving climate targets

    SciTech Connect

    Calvin, Katherine V.; Wise, Marshall A.; Kyle, G. Page; Patel, Pralit L.; Clarke, Leon E.; Edmonds, James A.

    2013-10-16

    Many papers have shown that bioenergy and land-use are potentially important elements in a strategy to limit anthropogenic climate change. But, significant expansion of bioenergy production can have a large terrestrial footprint. In this paper, we test the implications for land use, the global energy system, carbon cycle, and carbon prices of meeting a specific climate target, using a single fossil fuel and industrial sector policy instrument—the carbon tax, but with five alternative bioenergy and land-use policy architectures. We find that the policies we examined have differing effects on the different segments of the economy. Comprehensive land policies can reduce land-use change emissions, increasing allowable emissions in the energy system, but have implications for the cost of food. Bioenergy taxes and constraints, on the other hand, have little effect on food prices, but can result in increased carbon and energy prices.

  17. Functional Antagonism of Human CD40 Achieved by Targeting a Unique Species-Specific Epitope.

    PubMed

    Yamniuk, Aaron P; Suri, Anish; Krystek, Stanley R; Tamura, James; Ramamurthy, Vidhyashankar; Kuhn, Robert; Carroll, Karen; Fleener, Catherine; Ryseck, Rolf; Cheng, Lin; An, Yongmi; Drew, Philip; Grant, Steven; Suchard, Suzanne J; Nadler, Steven G; Bryson, James W; Sheriff, Steven

    2016-07-17

    Current clinical anti-CD40 biologic agents include both antagonist molecules for the treatment of autoimmune diseases and agonist molecules for immuno-oncology, yet the relationship between CD40 epitope and these opposing biological outcomes is not well defined. This report describes the identification of potent antagonist domain antibodies (dAbs) that bind to a novel human CD40-specific epitope that is divergent in the CD40 of nonhuman primates. A similarly selected anti-cynomolgus CD40 dAb recognizing the homologous epitope is also a potent antagonist. Mutagenesis, biochemical, and X-ray crystallography studies demonstrate that the epitope is distinct from that of CD40 agonists. Both the human-specific and cynomolgus-specific molecules remain pure antagonists even when formatted as bivalent Fc-fusion proteins, making this an attractive therapeutic format for targeting hCD40 in autoimmune indications. PMID:27216500

  18. O-GlcNAc transferase and O-GlcNAcase: achieving target substrate specificity

    PubMed Central

    Nagel, Alexis K.

    2015-01-01

    O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) catalyze the dynamic cycling of intracellular, post-translational O-GlcNAc modification on thousands of Ser/Thr residues of cytosolic, nuclear, and mitochondrial signaling proteins. The identification of O-GlcNAc modified substrates has revealed a functionally diverse set of proteins, and the extent of O-GlcNAcylation fluctuates in response to nutrients and cellular stress. As a result, OGT and OGA are implicated in widespread, nutrient-responsive regulation of numerous signaling pathways and transcriptional programs. These enzymes are required for normal embryonic development and are dysregulated in metabolic and age-related disease states. While a recent surge of interest in the field has contributed to understanding the functional impacts of protein O-GlcNAcylation, little is known about the upstream mechanisms which modulate OGT and OGA substrate targeting. This review focuses on elements of enzyme structure among splice variants, post-translational modification, localization, and regulatory protein interactions which drive the specificity of OGT and OGA toward different subsets of the cellular proteome. Ongoing efforts in this rapidly advancing field are aimed at revealing mechanisms of OGT and OGA regulation to harness the potential therapeutic benefit of manipulating these enzymes’ activities. PMID:25173736

  19. The Knowledge Base for Achieving the Sustainable Development Goal Targets on Water Supply, Sanitation and Hygiene.

    PubMed

    Hutton, Guy; Chase, Claire

    2016-01-01

    Safe drinking water, sanitation, and hygiene (WASH) are fundamental to an improved standard of living. Globally, 91% of households used improved drinking water sources in 2015, while for improved sanitation it is 68%. Wealth disparities are stark, with rural populations, slum dwellers and marginalized groups lagging significantly behind. Service coverage is significantly lower when considering the new water and sanitation targets under the sustainable development goals (SDGs) which aspire to a higher standard of 'safely managed' water and sanitation. Lack of access to WASH can have an economic impact as much as 7% of Gross Domestic Product, not including the social and environmental consequences. Research points to significant health and socio-economic consequences of poor nutritional status, child growth and school performance caused by inadequate WASH. Groundwater over-extraction and pollution of surface water bodies have serious impacts on water resource availability and biodiversity, while climate change exacerbates the health risks of water insecurity. A significant literature documents the beneficial impacts of WASH interventions, and a growing number of impact evaluation studies assess how interventions are optimally financed, implemented and sustained. Many innovations in behavior change and service delivery offer potential for scaling up services to meet the SDGs. PMID:27240389

  20. The Knowledge Base for Achieving the Sustainable Development Goal Targets on Water Supply, Sanitation and Hygiene.

    PubMed

    Hutton, Guy; Chase, Claire

    2016-05-27

    Safe drinking water, sanitation, and hygiene (WASH) are fundamental to an improved standard of living. Globally, 91% of households used improved drinking water sources in 2015, while for improved sanitation it is 68%. Wealth disparities are stark, with rural populations, slum dwellers and marginalized groups lagging significantly behind. Service coverage is significantly lower when considering the new water and sanitation targets under the sustainable development goals (SDGs) which aspire to a higher standard of 'safely managed' water and sanitation. Lack of access to WASH can have an economic impact as much as 7% of Gross Domestic Product, not including the social and environmental consequences. Research points to significant health and socio-economic consequences of poor nutritional status, child growth and school performance caused by inadequate WASH. Groundwater over-extraction and pollution of surface water bodies have serious impacts on water resource availability and biodiversity, while climate change exacerbates the health risks of water insecurity. A significant literature documents the beneficial impacts of WASH interventions, and a growing number of impact evaluation studies assess how interventions are optimally financed, implemented and sustained. Many innovations in behavior change and service delivery offer potential for scaling up services to meet the SDGs.

  1. The Knowledge Base for Achieving the Sustainable Development Goal Targets on Water Supply, Sanitation and Hygiene

    PubMed Central

    Hutton, Guy; Chase, Claire

    2016-01-01

    Safe drinking water, sanitation, and hygiene (WASH) are fundamental to an improved standard of living. Globally, 91% of households used improved drinking water sources in 2015, while for improved sanitation it is 68%. Wealth disparities are stark, with rural populations, slum dwellers and marginalized groups lagging significantly behind. Service coverage is significantly lower when considering the new water and sanitation targets under the sustainable development goals (SDGs) which aspire to a higher standard of ‘safely managed’ water and sanitation. Lack of access to WASH can have an economic impact as much as 7% of Gross Domestic Product, not including the social and environmental consequences. Research points to significant health and socio-economic consequences of poor nutritional status, child growth and school performance caused by inadequate WASH. Groundwater over-extraction and pollution of surface water bodies have serious impacts on water resource availability and biodiversity, while climate change exacerbates the health risks of water insecurity. A significant literature documents the beneficial impacts of WASH interventions, and a growing number of impact evaluation studies assess how interventions are optimally financed, implemented and sustained. Many innovations in behavior change and service delivery offer potential for scaling up services to meet the SDGs. PMID:27240389

  2. How much does it cost to achieve coverage targets for primary healthcare services? A costing model from Aceh, Indonesia.

    PubMed

    Abdullah, Asnawi; Hort, Krishna; Abidin, Azwar Zaenal; Amin, Fadilah M

    2012-01-01

    Despite significant investment in improving service infrastructure and training of staff, public primary healthcare services in low-income and middle-income countries tend to perform poorly in reaching coverage targets. One of the factors identified in Aceh, Indonesia was the lack of operational funds for service provision. The objective of this study was to develop a simple and transparent costing tool that enables health planners to calculate the unit costs of providing basic health services to estimate additional budgets required to deliver services in accordance with national targets. The tool was developed using a standard economic approach that linked the input activities to achieving six national priority programs at primary healthcare level: health promotion, sanitation and environment health, maternal and child health and family planning, nutrition, immunization and communicable diseases control, and treatment of common illness. Costing was focused on costs of delivery of the programs that need to be funded by local government budgets. The costing tool consisting of 16 linked Microsoft Excel worksheets was developed and tested in several districts enabled the calculation of the unit costs of delivering of the six national priority programs per coverage target of each program (such as unit costs of delivering of maternal and child health program per pregnant mother). This costing tool can be used by health planners to estimate additional money required to achieve a certain level of coverage of programs, and it can be adjusted for different costs and program delivery parameters in different settings.

  3. GLOBIN-5-Dependent O2 Responses Are Regulated by PDL-1/PrBP That Targets Prenylated Soluble Guanylate Cyclases to Dendritic Endings

    PubMed Central

    Soltesz, Zoltan; Oda, Shigekazu; Zelmanovich, Veronica; Abergel, Zohar

    2014-01-01

    Aerobic animals constantly monitor and adapt to changes in O2 levels. The molecular mechanisms involved in sensing O2 are, however, incompletely understood. Previous studies showed that a hexacoordinated globin called GLB-5 tunes the dynamic range of O2-sensing neurons in natural C. elegans isolates, but is defective in the N2 lab reference strain (McGrath et al., 2009; Persson et al., 2009). GLB-5 enables a sharp behavioral switch when O2 changes between 21 and 17%. Here, we show that GLB-5 also confers rapid behavioral and cellular recovery from exposure to hypoxia. Hypoxia reconfigures O2-evoked Ca2+ responses in the URX O2 sensors, and GLB-5 enables rapid recovery of these responses upon re-oxygenation. Forward genetic screens indicate that GLB-5's effects on O2 sensing require PDL-1, the C. elegans ortholog of mammalian PrBP/PDE6δ protein. In mammals, PDE6δ regulates the traffic and activity of prenylated proteins (Zhang et al., 2004; Norton et al., 2005). PDL-1 promotes localization of GCY-33 and GCY-35, atypical soluble guanylate cyclases that act as O2 sensors, to the dendritic endings of URX and BAG neurons, where they colocalize with GLB-5. Both GCY-33 and GCY-35 are predicted to be prenylated. Dendritic localization is not essential for GCY-35 to function as an O2 sensor, but disrupting pdl-1 alters the URX neuron's O2 response properties. Functional GLB-5 can restore dendritic localization of GCY-33 in pdl-1 mutants, suggesting GCY-33 and GLB-5 are in a complex. Our data suggest GLB-5 and the soluble guanylate cyclases operate in close proximity to sculpt O2 responses. PMID:25505325

  4. Physiological geroscience: targeting function to increase healthspan and achieve optimal longevity.

    PubMed

    Seals, Douglas R; Justice, Jamie N; LaRocca, Thomas J

    2016-04-15

    Most nations of the world are undergoing rapid and dramatic population ageing, which presents great socio-economic challenges, as well as opportunities, for individuals, families, governments and societies. The prevailing biomedical strategy for reducing the healthcare impact of population ageing has been 'compression of morbidity' and, more recently, to increase healthspan, both of which seek to extend the healthy period of life and delay the development of chronic diseases and disability until a brief period at the end of life. Indeed, a recently established field within biological ageing research, 'geroscience', is focused on healthspan extension. Superimposed on this background are new attitudes and demand for 'optimal longevity' - living long, but with good health and quality of life. A key obstacle to achieving optimal longevity is the progressive decline in physiological function that occurs with ageing, which causes functional limitations (e.g. reduced mobility) and increases the risk of chronic diseases, disability and mortality. Current efforts to increase healthspan centre on slowing the fundamental biological processes of ageing such as inflammation/oxidative stress, increased senescence, mitochondrial dysfunction, impaired proteostasis and reduced stress resistance. We propose that optimization of physiological function throughout the lifespan should be a major emphasis of any contemporary biomedical policy addressing global ageing. Effective strategies should delay, reduce in magnitude or abolish reductions in function with ageing (primary prevention) and/or improve function or slow further declines in older adults with already impaired function (secondary prevention). Healthy lifestyle practices featuring regular physical activity and ideal energy intake/diet composition represent first-line function-preserving strategies, with pharmacological agents, including existing and new pharmaceuticals and novel 'nutraceutical' compounds, serving as potential

  5. Is the Target of 1 Day of Stay per 1% Total Body Surface Area Burned Achieved in Chemical Burns?

    PubMed

    Tan, Teresa; Wong, David S Y

    2016-02-01

    The length of hospital stay (LOS) is a standard parameter used to reflect quality and evaluate outcomes in acute burn care. This study aims to assess whether the target of 1 day of stay per 1% total body surface area (TBSA) burned was achieved in acute chemical burns management and factors affecting the LOS. A retrospective analysis of the records of patients who suffered from chemical burn injuries admitted to a university burn center over a continuous 14-year period was performed.A total of 118 patients were admitted over the period for chemical burns. Only 14% of cases achieved the target stated. Factors associated with lengthening of the hospital stay included TBSA, ocular involvement, the cause of injury, and the need for surgery during the same admission.The LOS in chemical burns frequently exceeds 1 day of stay per 1% TBSA burned. Many factors can contribute to a patient's LOS and are worth exploring in order to see if the impact of these factors could be minimized. Early surgical intervention should help to reduce the LOS if reliable methods of burn wound depth assessment are available.

  6. A Pharmacist-Staffed, Virtual Gout Management Clinic for Achieving Target Serum Uric Acid Levels: A Randomized Clinical Trial

    PubMed Central

    Goldfien, Robert; Pressman, Alice; Jacobson, Alice; Ng, Michele; Avins, Andrew

    2016-01-01

    Context: Relatively few patients with gout receive appropriate treatment. Objective: To determine whether a pharmacist-staffed gout management program is more effective than usual care in achieving target serum uric acid (sUA) levels in gout patients. Design: A parallel-group, randomized controlled trial of a pharmacist-staffed, telephone-based program for managing hyperuricemia vs usual care. Trial duration was 26 weeks. Main Outcome Measures: Primary outcome measure was achieving sUA levels at or below 6 mg/dL at the 26-week visit. Secondary outcome was mean change in sUA levels in the control and intervention groups. Participants were adults with recurrent gout and sUA levels above 6.0 mg/dL. Participants were randomly assigned to management by a clinical pharmacist following protocol or to monitoring of sUA levels but management of their gout by their usual treating physician. Results: Of 102 patients who met eligibility criteria, 77 subjects obtained a baseline sUA measurement and were entered into the trial. Among 37 participants in the intervention group, 13 (35%) had sUA levels at or below 6.0 mg/dL at 26 weeks, compared with 5 (13%) of 40 participants in the control group (risk ratio = 2.8, 95% confidence interval [CI] = 1.1 to 7.1, p = 0.03). The mean change in sUA levels among controls was +0.1 mg/dL compared with −1.5 mg/dL in the intervention group (sUA difference = −1.6, 95% CI = −0.9 to −2.4, p < 0.001). Conclusions: A structured pharmacist-staffed program was more effective than usual care for achieving target sUA levels. These results suggest a structured program could greatly improve gout management. PMID:27352414

  7. Efficacy of a liquid low-energy formula diet in achieving preoperative target weight loss before bariatric surgery.

    PubMed

    Nielsen, Lone V; Nielsen, Mette S; Schmidt, Julie B; Pedersen, Sue D; Sjödin, Anders

    2016-01-01

    A preoperative weight loss of 8 % is a prerequisite to undergo bariatric surgery (BS) in Denmark. The aim of the present study was to evaluate the efficacy of a 7- or an 11-week low-energy diet (LCD) for achieving preoperative target weight before BS. A total of thirty obese patients (BMI 46·0 (sd 4·4) kg/m(2)) followed an LCD (Cambridge Weight Plan(®), 4184 kJ/d (1000 kcal/d)) for 7 or 11 weeks as preparation for BS. Anthropometric measurements including body composition (dual-energy X-ray absorptiometry), blood parameters and blood pressure were assessed at weeks 0, 7 and 11. At week 7, the majority of patients (77 %) had reached their target weight, and this was achieved after 5·4 (sem 0·3) weeks. Mean weight loss was 9·3 (sem 0·5) % (P < 0·01) and consisted of 41·6 % fat-free mass (FFM) and 58·4 % fat mass. The weight loss was accompanied by a decrease in systolic and diastolic blood pressure (7·1 (sem 2·3) and 7·3 (sem 1·8) mmHg, respectively, all P < 0·01) as well as an improved metabolic profile (8·2 (sem 1·8) % decrease in fasting glucose (P < 0·01), 28·6 (sem 6·4) % decrease in fasting insulin (P < 0·01), 23·1 (sem 2·2) % decrease in LDL (P < 0·01), and 9·7 (sem 4·7) % decrease in TAG (P < 0·05)). Weight, FFM and fat mass continued to decrease from week 7 to 11 (all P < 0·01), whereas no additional improvements was observed in the metabolic parameters. Severely obese patients can safely achieve preoperative target weight on an LCD within 7 weeks as part of preparation for BS. However, the considerable reduction in FFM in severely obese subjects needs further investigation. PMID:27293559

  8. Efficacy of a liquid low-energy formula diet in achieving preoperative target weight loss before bariatric surgery.

    PubMed

    Nielsen, Lone V; Nielsen, Mette S; Schmidt, Julie B; Pedersen, Sue D; Sjödin, Anders

    2016-01-01

    A preoperative weight loss of 8 % is a prerequisite to undergo bariatric surgery (BS) in Denmark. The aim of the present study was to evaluate the efficacy of a 7- or an 11-week low-energy diet (LCD) for achieving preoperative target weight before BS. A total of thirty obese patients (BMI 46·0 (sd 4·4) kg/m(2)) followed an LCD (Cambridge Weight Plan(®), 4184 kJ/d (1000 kcal/d)) for 7 or 11 weeks as preparation for BS. Anthropometric measurements including body composition (dual-energy X-ray absorptiometry), blood parameters and blood pressure were assessed at weeks 0, 7 and 11. At week 7, the majority of patients (77 %) had reached their target weight, and this was achieved after 5·4 (sem 0·3) weeks. Mean weight loss was 9·3 (sem 0·5) % (P < 0·01) and consisted of 41·6 % fat-free mass (FFM) and 58·4 % fat mass. The weight loss was accompanied by a decrease in systolic and diastolic blood pressure (7·1 (sem 2·3) and 7·3 (sem 1·8) mmHg, respectively, all P < 0·01) as well as an improved metabolic profile (8·2 (sem 1·8) % decrease in fasting glucose (P < 0·01), 28·6 (sem 6·4) % decrease in fasting insulin (P < 0·01), 23·1 (sem 2·2) % decrease in LDL (P < 0·01), and 9·7 (sem 4·7) % decrease in TAG (P < 0·05)). Weight, FFM and fat mass continued to decrease from week 7 to 11 (all P < 0·01), whereas no additional improvements was observed in the metabolic parameters. Severely obese patients can safely achieve preoperative target weight on an LCD within 7 weeks as part of preparation for BS. However, the considerable reduction in FFM in severely obese subjects needs further investigation.

  9. Association of achieved dialysis dose with mortality in the hemodialysis study: an example of "dose-targeting bias".

    PubMed

    Greene, Tom; Daugirdas, John; Depner, Thomas; Allon, Michael; Beck, Gerald; Chumlea, Cameron; Delmez, James; Gotch, Frank; Kusek, John W; Levin, Nathan; Owen, William; Schulman, Gerald; Star, Robert; Toto, Robert; Eknoyan, Garabed

    2005-11-01

    In the intention-to-treat analysis of the Hemodialysis Study, all-cause mortality did not differ significantly between the high versus standard hemodialysis dose groups. The association of mortality with delivered dose within each of the two randomized treatment groups was examined, and implications for observational studies were considered. Time-dependent Cox regression was used to relate the relative risk (RR) for mortality to the running mean of the achieved equilibrated Kt/V (eKt/V) over the preceding 4 mo. eKt/V was categorized by quintiles within each dose group. Analyses were controlled for case-mix factors and baseline anthropometric volume. Within each randomized dose group, mortality was elevated markedly when achieved eKt/V was in the lowest quintile (RR, 1.93; 95% confidence interval [CI], 1.40 to 2.66; P < 0.0001 in the standard-dose group; RR, 2.04; 95% CI, 1.50 to 2.76; P < 0.0001 in the high-dose group; RR relative to the middle quintiles). The mortality rate in the lowest eKt/V quintile of the high-dose group was higher than in the full standard-dose group (RR, 1.59; 95% CI, 1.29 to 1.96; P < 0.0001). Each 0.1 eKt/V unit below the group median was associated with a 58% higher mortality in the standard-dose group (P < 0.001) and a 37% higher mortality in the high-dose group (P < 0.001). The magnitude of these dose-mortality effects was seven- to 12-fold higher than the upper limit of the 95% CI from the intention-to-treat analysis. The effects were attenuated in lagged analyses but did not disappear. When dialysis dose is targeted closely, as under the controlled conditions of the Hemodialysis Study, patients with the lowest achieved dose relative to their target dose experience markedly increased mortality, to a degree that is not compatible with a biologic effect of dose. The possibility of similar (albeit smaller) biases should be considered when analyzing observational data sets relating mortality to achieved dose of dialysis. PMID:16192421

  10. Target Achievement Control Test: evaluating real-time myoelectric pattern-recognition control of multifunctional upper-limb prostheses.

    PubMed

    Simon, Ann M; Hargrove, Levi J; Lock, Blair A; Kuiken, Todd A

    2011-01-01

    Despite high classification accuracies (~95%) of myoelectric control systems based on pattern recognition, how well offline measures translate to real-time closed-loop control is unclear. Recently, a real-time virtual test analyzed how well subjects completed arm motions using a multiple-degree of freedom (DOF) classifier. Although this test provided real-time performance metrics, the required task was oversimplified: motion speeds were normalized and unintended movements were ignored. We included these considerations in a new, more challenging virtual test called the Target Achievement Control Test (TAC Test). Five subjects with transradial amputation attempted to move a virtual arm into a target posture using myoelectric pattern recognition, performing the test with various classifier (1- vs 3-DOF) and task complexities (one vs three required motions per posture). We found no significant difference in classification accuracy between the 1- and 3-DOF classifiers (97.2% +/- 2.0% and 94.1% +/- 3.1%, respectively; p = 0.14). Subjects completed 31% fewer trials in significantly more time using the 3-DOF classifier and took 3.6 +/- 0.8 times longer to reach a three-motion posture compared with a one-motion posture. These results highlight the need for closed-loop performance measures and demonstrate that the TAC Test is a useful and more challenging tool to test real-time pattern-recognition performance.

  11. Primary care of patients with high cardiovascular risk : Blood pressure, lipid and diabetic target levels and their achievement in Hungary.

    PubMed

    Szigethy, Endre; Jancsó, Zoltán; Móczár, Csaba; Ilyés, István; Kovács, Eszter; Róbert Kolozsvári, László; Rurik, Imre

    2013-07-01

    Cardiovascular diseases are responsible for the majority of premature deaths in Hungary as well. Most of them could be prevented with healthy lifestyle of patients and adequate drug prescription of primary care physicians. Earlier European surveys found wide differences between the practices and achievements of different countries in this field. The study was based on and designed according to the framework of previous European Action on Secondary and Primary Prevention by Intervention to Reduce Events (EUROASPIRE) studies and aimed presenting Hungarian results and comparing with the achievements of other countries and previous Hungarian surveys. Among rural and urban settings, 679 patients under continuous care (236 diabetics, 218 with dyslipidaemia, and 225 with hypertension) were consecutively selected by 20 experienced general practitioners. The mean age of patients was 60.3 years (men) and 64.0 years (women). Among diabetics, less than 7 % of glycated hemoglobin (HbA1c) values were found in 42.5 % patients, while only 11.4 % patients had fasting plasma sugar less than 6.0 mmol/L. Of the patients treated for dyslipidaemia, the target level of triglyceride was reached by 40.6 %, recommended total cholesterol by 14.2 % and the HDL-cholesterol by 71.8 %. The therapeutic control of total and HDL-cholesterol was better in men, although women had better triglyceride values. The achievement among patients with hypertension was 42.0 %. Significantly higher blood pressure was measured by patients who were treated with not recommended combinations of antihypertensive medication. A remarkable improvement could be observed in Hungary in the field of secondary prevention. It was greater among patients with hypertension and dyslipidaemia and smaller in diabetes care. Compared to the results of published European surveys, Hungary occupies a good position, but further improvement is still required.

  12. 78 FR 60270 - BP America Inc., BP Corporation North America Inc., BP America Production Company, and BP Energy...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-01

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission BP America Inc., BP Corporation North America Inc., BP America Production Company, and BP Energy Company; Notice of Designation of Commission Staff as Non-Decisional With respect to an order issued by the Commission...

  13. Population Pharmacokinetics of Colistin Methanesulfonate in Rats: Achieving Sustained Lung Concentrations of Colistin for Targeting Respiratory Infections

    PubMed Central

    W. S. Yapa, Shalini; Li, Jian; Porter, Christopher J. H.; Nation, Roger L.

    2013-01-01

    Colistin methanesulfonate (CMS), the inactive prodrug of colistin, is administered by inhalation for the management of respiratory infections. However, limited pharmacokinetic data are available for CMS and colistin following pulmonary delivery. This study investigates the pharmacokinetics of CMS and colistin following intravenous (i.v.) and intratracheal (i.t.) administration in rats and determines the targeting advantage after direct delivery into the lungs. In addition to plasma, bronchoalveolar lavage (BAL) fluid was collected to quantify drug concentrations in lung epithelial lining fluid (ELF). The resulting data were analyzed using a population modeling approach in S-ADAPT. A three-compartment model described the disposition of both compounds in plasma following i.v. administration. The estimated mean clearance from the central compartment was 0.122 liters/h for CMS and 0.0657 liters/h for colistin. Conversion of CMS to colistin from all three compartments was required to fit the plasma data. The fraction of the i.v. dose converted to colistin in the systemic circulation was 0.0255. Two BAL fluid compartments were required to reflect drug kinetics in the ELF after i.t. dosing. A slow conversion of CMS (mean conversion time [MCTCMS] = 3.48 h) in the lungs contributed to high and sustained concentrations of colistin in ELF. The fraction of the CMS dose converted to colistin in ELF (fm,ELF = 0.226) was higher than the corresponding fractional conversion in plasma after i.v. administration. In conclusion, pulmonary administration of CMS achieves high and sustained exposures of colistin in lungs for targeting respiratory infections. PMID:23917323

  14. Can we bet on negative emissions to achieve the 2°C target even under strong carbon cycle feedbacks?

    NASA Astrophysics Data System (ADS)

    Tanaka, K.; Yamagata, Y.; Yokohata, T.; Emori, S.; Hanaoka, T.

    2015-12-01

    tentative results point to a key policy message: do not rely on negative emissions to achieve the 2°C target. It would make more sense to gear climate mitigation actions toward the stabilization target without betting on negative emissions because negative emissions might create large overshoot in case of strong feedbacks.

  15. Analysis of the first therapeutic-target-achieving time of warfarin therapy and associated factors in patients with pulmonary embolism

    PubMed Central

    Gong, Xiaowei; Wang, Haiyan; Yuan, Yadong

    2016-01-01

    The present study aimed to investigate the factors affecting the first therapeutic-target-achieving (TTA) time of warfarin therapy in patients with acute pulmonary embolism (PTE). Between January 2008 and June 2013, patients with PTE confirmed by transpulmonary arterial enhanced computed tomographic pulmonary angiography or pulmonary ventilation perfusion scanning were included in the present study. Data collected included demographic information, history of tobacco and alcohol intake, basic diseases (stable and unstable hypertension, diabetes, heart failure, cancer/cerebral infarction, old myocardial infarction and atrial fibrillation), liver and kidney function, the haemoglobin and platelet count of the blood, international normalized ratio monitoring, warfarin dosage adjustment and medication combinations. Dynamic changes in international normalized ratio, anticoagulant efficacy, and adverse events within 90 days were monitored and analyzed. Univariate analysis demonstrated that the following factors affect the first TTA time: Initial dose, body mass index (BMI), liver function, heart failure, and the administration of levofloxacin, cephalosporins, and blood circulation-activating drugs. Logistic regression analysis revealed that the following were independent factors of the first TTA time: Initial dose, BMI, liver function, heart failure and levofloxacin. Therefore, the results of the present study demonstrated that various factors may affect the first TTA time of warfarin therapy, including the initial dose, BMI, liver function, heart function and concomitant medication. PMID:27698722

  16. Analysis of the first therapeutic-target-achieving time of warfarin therapy and associated factors in patients with pulmonary embolism

    PubMed Central

    Gong, Xiaowei; Wang, Haiyan; Yuan, Yadong

    2016-01-01

    The present study aimed to investigate the factors affecting the first therapeutic-target-achieving (TTA) time of warfarin therapy in patients with acute pulmonary embolism (PTE). Between January 2008 and June 2013, patients with PTE confirmed by transpulmonary arterial enhanced computed tomographic pulmonary angiography or pulmonary ventilation perfusion scanning were included in the present study. Data collected included demographic information, history of tobacco and alcohol intake, basic diseases (stable and unstable hypertension, diabetes, heart failure, cancer/cerebral infarction, old myocardial infarction and atrial fibrillation), liver and kidney function, the haemoglobin and platelet count of the blood, international normalized ratio monitoring, warfarin dosage adjustment and medication combinations. Dynamic changes in international normalized ratio, anticoagulant efficacy, and adverse events within 90 days were monitored and analyzed. Univariate analysis demonstrated that the following factors affect the first TTA time: Initial dose, body mass index (BMI), liver function, heart failure, and the administration of levofloxacin, cephalosporins, and blood circulation-activating drugs. Logistic regression analysis revealed that the following were independent factors of the first TTA time: Initial dose, BMI, liver function, heart failure and levofloxacin. Therefore, the results of the present study demonstrated that various factors may affect the first TTA time of warfarin therapy, including the initial dose, BMI, liver function, heart function and concomitant medication.

  17. Vitamin K antagonist use: evidence of the difficulty of achieving and maintaining target INR range and subsequent consequences.

    PubMed

    Schein, Jeff R; White, C Michael; Nelson, Winnie W; Kluger, Jeffrey; Mearns, Elizabeth S; Coleman, Craig I

    2016-01-01

    Vitamin K antagonists (VKAs) are effective oral anticoagulants that are titrated to a narrow therapeutic international normalized ratio (INR) range. We reviewed published literature assessing the impact of INR stability - getting into and staying in target INR range - on outcomes including thrombotic events, major bleeding, and treatment costs, as well as key factors that impact INR stability. A time in therapeutic range (TTR) of ≥65 % is commonly accepted as the definition of INR stability. In the real-world setting, this is seldom achieved with standard-of-care management, thus increasing the patients' risks of thrombotic or major bleeding events. There are many factors associated with poor INR control. Being treated in community settings, newly initiated on a VKA, younger in age, or nonadherent to therapy, as well as having polymorphisms of CYP2C9 or VKORC1, or multiple physical or mental co-morbid disease states have been associated with lower TTR. Clinical prediction tools are available, though they can only explain <10 % of the variance behind poor INR control. Clinicians caring for patients who require anticoagulation are encouraged to intensify diligence in INR management when using VKAs and to consider appropriate use of newer anticoagulants as a therapeutic option. PMID:27303213

  18. Gracilaria lemaneiformis polysaccharide as integrin-targeting surface decorator of selenium nanoparticles to achieve enhanced anticancer efficacy.

    PubMed

    Jiang, Wenting; Fu, Yuanting; Yang, Fang; Yang, Yufeng; Liu, Ting; Zheng, Wenjie; Zeng, Lilan; Chen, Tianfeng

    2014-08-27

    The poor permeability of glioma parenchyma represents a major limit for antiglioblastoma drug delivery. Gracilaria lemaneiformis polysaccharide (GLP), which has a high binding affinity to αvβ3 integrin overexpressed in glioma cells, was employed in the present study to functionalize selenium nanoparticles (SeNPs) to achieve antiglioblastoma efficacy. GLP-SeNPs showed satisfactory size distribution, high stability, and selectivity between cancer and normal cells. In U87 glioma cell membrane, which has a high integrin expression level, GLP-SeNPs exhibited significantly higher cellular uptake than unmodified SeNPs. As expected, U87 cells exhibited a greater uptake of GLP-SeNPs than C6 cells with low integrin expression level. Furthermore, the internalization of GLP-SeNPs was inhibited by cyclo-(Arg-Gly-Asp-Phe-Lys) peptides, suggesting that cellular uptake into U87 cells and C6 cells occurred via αvβ3 integrin-mediated endocytosis. For U87 cells, the cytotoxicity of SeNPs decorated by GLP was enhanced significantly because of the induction of various apoptosis signaling pathways. Internalized GLP-SeNPs triggered intracellular reactive oxygen species downregulation. Therefore, p53, MAPKs, and AKT pathways were activated to advance cell apoptosis. These findings suggest that surface decoration of nanomaterials with GLP could be an efficient strategy for design and preparation of glioblastoma targeting nanodrugs.

  19. Large-scale survey of rates of achieving targets for blood glucose, blood pressure, and lipids and prevalence of complications in type 2 diabetes (JDDM 40)

    PubMed Central

    Yokoyama, Hiroki; Oishi, Mariko; Takamura, Hiroshi; Yamasaki, Katsuya; Shirabe, Shin-ichiro; Uchida, Daigaku; Sugimoto, Hidekatsu; Kurihara, Yoshio; Araki, Shin-ichi; Maegawa, Hiroshi

    2016-01-01

    Objective The fact that population with type 2 diabetes mellitus and bodyweight of patients are increasing but diabetes care is improving makes it important to explore the up-to-date rates of achieving treatment targets and prevalence of complications. We investigated the prevalence of microvascular/macrovascular complications and rates of achieving treatment targets through a large-scale multicenter-based cohort. Research design and methods A cross-sectional nationwide survey was performed on 9956 subjects with type 2 diabetes mellitus who consecutively attended primary care clinics. The prevalence of nephropathy, retinopathy, neuropathy, and macrovascular complications and rates of achieving targets of glycated hemoglobin (HbA1c) <7.0%, blood pressure <130/80 mm Hg, and lipids of low-density/high-density lipoprotein cholesterol <3.1/≥1.0 mmol/L and non-high-density lipoprotein cholesterol <3.8 mmol/L were investigated. Results The rates of achieving targets for HbA1c, blood pressure, and lipids were 52.9%, 46.8% and 65.5%, respectively. The prevalence of microvascular complications was ∼28% each, 6.4% of which had all microvascular complications, while that of macrovascular complications was 12.6%. With an increasing duration of diabetes, the rate of achieving target HbA1c decreased and the prevalence of each complication increased despite increased use of diabetes medication. The prevalence of each complication decreased according to the number achieving the 3 treatment targets and was lower in subjects without macrovascular complications than those with. Adjustments for considerable covariates exhibited that each complication was closely inter-related, and the achievement of each target was significantly associated with being free of each complication. Conclusions Almost half of the subjects examined did not meet the recommended targets. The risk of each complication was significantly affected by 1 on-target treatment (inversely) and the

  20. Both Patient and Facility Contribute to Achieving the Centers for Medicare and Medicaid Services' Pay-for-Performance Target for Dialysis Adequacy

    PubMed Central

    Tighiouart, Hocine; Meyer, Klemens B.; Miskulin, Dana C.

    2011-01-01

    The Centers for Medicare and Medicaid Services (CMS) designated the achieved urea reduction ratio (URR) as a pay-for-performance measure, but to what extent this measure reflects patient characteristics and adherence instead of its intent to reflect facility performance is unknown. Here, we quantified the contributions of patient case-mix and adherence to the variability in achieving URR targets across dialysis facilities. We found that 92% of 10,069 hemodialysis patients treated at 173 facilities during the last quarter of 2004 achieved the target URR ≥65%. Mixed-effect models with random intercept for dialysis facility revealed a significant facility effect: 11.5% of the variation in achievement of target URR was attributable to the facility level. Adjusting for patient case-mix reduced the proportion of variation attributable to the facility level to 6.7%. Patient gender, body surface area, dialysis access, and adherence with treatment strongly associated with achievement of the URR target. We could not identify specific facility characteristics that explained the remaining variation between facilities. These data suggest that if adherence is not a modifiable patient characteristic, providers could be unfairly penalized for caring for these patients under current CMS policy. These penalties may have unintended consequences. PMID:22025629

  1. Both patient and facility contribute to achieving the Centers for Medicare and Medicaid Services' pay-for-performance target for dialysis adequacy.

    PubMed

    Tangri, Navdeep; Tighiouart, Hocine; Meyer, Klemens B; Miskulin, Dana C

    2011-12-01

    The Centers for Medicare and Medicaid Services (CMS) designated the achieved urea reduction ratio (URR) as a pay-for-performance measure, but to what extent this measure reflects patient characteristics and adherence instead of its intent to reflect facility performance is unknown. Here, we quantified the contributions of patient case-mix and adherence to the variability in achieving URR targets across dialysis facilities. We found that 92% of 10,069 hemodialysis patients treated at 173 facilities during the last quarter of 2004 achieved the target URR ≥65%. Mixed-effect models with random intercept for dialysis facility revealed a significant facility effect: 11.5% of the variation in achievement of target URR was attributable to the facility level. Adjusting for patient case-mix reduced the proportion of variation attributable to the facility level to 6.7%. Patient gender, body surface area, dialysis access, and adherence with treatment strongly associated with achievement of the URR target. We could not identify specific facility characteristics that explained the remaining variation between facilities. These data suggest that if adherence is not a modifiable patient characteristic, providers could be unfairly penalized for caring for these patients under current CMS policy. These penalties may have unintended consequences.

  2. A waveform detector that targets template–decorrelated signals and achieves its predicted performance, Part I: Demonstration with IMS data

    DOE PAGES

    Carmichael, Joshua Daniel

    2016-01-01

    Here, waveform correlation detectors used in seismic monitoring scan multichannel data to test two competing hypotheses: that data contain (1) a noisy, amplitude-scaled version of a template waveform, or, (2) only noise. In reality, seismic wavefields include signals triggered by non-target sources (background seismicity) and targets signals that are only partially correlated with the waveform template.

  3. Evaluation of the Specificity of BP3385 for Bordetella pertussis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BP3385 has been proposed as a diagnostic PCR target for discriminating between Bordetella pertussis and other Bordetella species that also infect humans. Our results demonstrate this gene is also present in some strains of Bordetella hinzii and Bordetella bronchiseptica....

  4. [Achievement of therapeutic target in subjects on statin treatment in clinical practice. Results of the STAR (Statins Target Assessment in Real practice) study].

    PubMed

    Degli Esposti, Luca; Sangiorgi, Diego; Arca, Marcello; Vigna, Giovanni B; Budal, Stefano; Degli Esposti, Ezio

    2011-12-01

    The primary aim of the STAR Study (Statins Target Assessment in Real practice) was to determine the LDL-cholesterol reduction and to analyse patient's and therapeutic factors associated to LDL-cholesterol target attainment in newly treated subjects with statins in an unselected population in clinical practice setting. Administrative databases (including pharmaceutical prescriptions and hospital admissions) and laboratory test databases (including LDL-cholesterol values) of five local health units, distributed in Emilia Romagna, Toscana and Umbria, were linked. A retrospective cohort study was conducted and all subjects aged > or =18 years with a first prescription for statins (newly treated subjects) between January 1st, 2007 and June 30th, 2008 were included. All statin prescriptions over a 12 months follow-up period were considered and used to calculate adherence to treatment. Baseline and follow-up LDL-cholesterol, respectively, were defined according to the nearest determination to the first prescription for statins and to the end of the follow-up period. A total of 3.232 subjects was included, 1.516 males (47%) and 1.716 females (53%), with an average age equal to 65.9 +/- 11.3 years. Among included subjects, 22.,6% had a gap to LDL-cholesterol target <10%, 30.0% between 10 and 29%, 20.7% between 30 and 49%, and 26.7% . or =50%. Among those with a gap to target > or =50%, 30-49%, and 10-29%, respectively, LDL-cholesterol target was attained by 7.1%, 41.8%, and 62.% of subjects. LDL-cholesterol target attainment was associated to gap to target, adherence with treatment, and type of statin. PMID:22567731

  5. Achieving blood pressure goals: why aren't we?

    PubMed

    Cushman, William C; Basile, Jan

    2006-12-01

    The Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC 7) recommends a blood pressure (BP) goal of <140/90 mm Hg in patients with hypertension and <130/80 mm Hg in those with diabetes or chronic kidney disease. Achievement of BP goals is associated with significant benefits in cardiovascular morbidity and mortality. Although evidence suggests these goals are attainable, only about one third of patients are meeting them. There is a significant gap between treatment guideline recommendations and their implementation in clinical practice. Many clinicians appear satisfied with modest BP reductions and do not make the necessary treatment adjustments to achieve BP goals. Patient nonadherence is another important reason for lack of BP control. For the success of clinical trials to be reproduced in clinical practice, clinicians must recognize the importance of treating BP to goal, emphasize to patients the need to adhere to treatments, and provide persistent, goal-targeted therapy. PMID:17170612

  6. The coordination chemistry of "[BP3]NiX" platforms: targeting low-valent nickel sources as promising candidates to L3Ni=E and L3Ni(triple bond)E linkages.

    PubMed

    MacBeth, Cora E; Thomas, J Christopher; Betley, Theodore A; Peters, Jonas C

    2004-07-26

    A series of divalent, monovalent, and zerovalent nickel complexes supported by the electron-releasing, monoanionic tris(phosphino)borate ligands [PhBP3] and [PhBPiPr3] ([PhBP3] = [PhB(CH2PPh2)3]-, [PhBPiPr3] = [PhB(CH2PiPr2)3]-) have been synthesized to explore fundamental aspects of their coordination chemistry. The pseudotetrahedral, divalent halide complexes [PhBP3]NiCl (1), [PhBP3]NiI (2), and [PhBPiPr3]NiCl (3) were prepared by the metalation of [PhBP3]Tl or [PhBPiPr3]Tl with (Ph3P)2NiCl2, NiI2, and (DME)NiCl2 (DME = 1,2-dimethoxyethane), respectively. Complex 1 is a versatile precursor to a series of complexes accessible via substitution reactions including [PhBP3]Ni(N3) (4), [PhBP3]Ni(OSiPh3) (5), [PhBP3]Ni(O-p-tBu-Ph) (6), and [PhBP3]Ni(S-p-tBu-Ph) (7). Complexes 2-5 and 7 have been characterized by X-ray diffraction (XRD) and are pseudotetrahedral monomers in the solid state. Complex 1 reacts readily with oxygen to form the four-electron-oxidation product, [[PhB(CH2POPh2)2(CH2PPh2)]NiCl] (8A or 8B), which features a solid-state structure that is dependent on its method of crystallization. Chemical reduction of 1 using Na/Hg or other potential 1-electron reductants generates a product that arises from partial ligand degradation, [PhBP3]Ni(eta2-CH2PPh2) (9). The more sterically hindered chloride 3 reacts with Li(dbabh) (Hdbabh = 2,3:5,6-dibenzo-7-azabicyclo[2.2.1]hepta-2,5-diene) to provide the three-coordinate complex [kappa2-PhBPiPr3]Ni(dbabh) (11), also characterized by XRD. Chemical reduction of complex 1 in the presence of L-type donors produces the tetrahedral Ni(I) complexes [PhBP3]Ni(PPh3) (12) and [PhBP3]Ni(CNtBu) (13). Reduction of 3 following the addition of PMe3 or tert-butyl isocyanide affords the Ni(I) complexes [PhBPiPr3]Ni(PMe3) (14) and [PhBPiPr3]Ni(CNtBu) (15), respectively. The reactivity of these [PhBP3]NiIL and [PhBPiPr3]NiIL complexes with respect to oxidative group transfer reactions from organic azides and diazoalkanes is discussed

  7. Effects of Achieving Target Measures in Rheumatoid Arthritis on Functional Status, Quality of Life, and Resource Utilization: Analysis of Clinical Practice Data

    PubMed Central

    Joo, Seongjung; Kawabata, Hugh; Al, Maiwenn J.; Allison, Paul D.; Rutten‐van Mölken, Maureen P. M. H.; Frits, Michelle L.; Iannaccone, Christine K.; Shadick, Nancy A.; Weinblatt, Michael E.

    2016-01-01

    Objective To evaluate associations between achieving guideline‐recommended targets of disease activity, defined by the Disease Activity Score in 28 joints using C‐reactive protein level (DAS28‐CRP) <2.6, the Simplified Disease Activity Index (SDAI) ≤3.3, or the Clinical Disease Activity Index (CDAI) ≤2.8, and other health outcomes in a longitudinal observational study. Methods Other defined thresholds included low disease activity (LDA), moderate (MDA), or severe disease activity (SDA). To control for intraclass correlation and estimate effects of independent variables on outcomes of the modified Health Assessment Questionnaire (M‐HAQ), the EuroQol 5‐domain (EQ‐5D; a quality‐of‐life measure), hospitalization, and durable medical equipment (DME) use, we employed mixed models for continuous outcomes and generalized estimating equations for binary outcomes. Results Among 1,297 subjects, achievement (versus nonachievement) of recommended disease targets was associated with enhanced physical functioning and lower health resource utilization. After controlling for baseline covariates, achievement of disease targets (versus LDA) was associated with significantly enhanced physical functioning based on SDAI ≤3.3 (ΔM‐HAQ −0.047; P = 0.0100) and CDAI ≤2.8 (−0.073; P = 0.0003) but not DAS28‐CRP <2.6 (−0.022; P = 0.1735). Target attainment was associated with significantly improved EQ‐5D (0.022–0.096; P < 0.0030 versus LDA, MDA, or SDA). Patients achieving guideline‐recommended disease targets were 36–45% less likely to be hospitalized (P < 0.0500) and 23–45% less likely to utilize DME (P < 0.0100). Conclusion Attaining recommended target disease‐activity measures was associated with enhanced physical functioning and health‐related quality of life. Some health outcomes were similar in subjects attaining guideline targets versus LDA. Achieving LDA is a worthy clinical objective in some patients. PMID:26238974

  8. The Potential for School-Based Interventions That Target Executive Function to Improve Academic Achievement: A Review

    ERIC Educational Resources Information Center

    Jacob, Robin; Parkinson, Julia

    2015-01-01

    This article systematically reviews what is known empirically about the association between executive function and student achievement in both reading and math and critically assesses the evidence for a causal association between the two. Using meta-analytic techniques, the review finds that there is a moderate unconditional association between…

  9. Autophagosome formation can be achieved in the absence of Atg18 by expressing engineered PAS-targeted Atg2.

    PubMed

    Kobayashi, Takafumi; Suzuki, Kuninori; Ohsumi, Yoshinori

    2012-07-30

    The Atg2-Atg18 complex is essential for autophagosome formation in Saccharomyces cerevisiae. In this paper, we show that partial induction of autophagy can proceed in cells expressing engineered variants of Atg2 capable of localizing to the pre-autophagosomal structure (PAS) in the absence of Atg18. Specifically, through the construction of fusion proteins, we show that the fusion to Atg2 of either the phosphatidylinositol 3-phosphate-binding FYVE domain or the core autophagy protein Atg8 allowed limited Atg18-independent recovery of autophagosome formation. These results indicate that effective targeting of Atg2 to the PAS can compensate for loss of Atg18 function in autophagy.

  10. Small molecule, NSC95397, inhibits the CtBP1-protein partner interaction and CtBP1-mediated transcriptional repression

    PubMed Central

    Blevins, Melanie A.; Kouznetsova, Jennifer; Krueger, Aaron B.; King, Rebecca; Griner, Lesley Mathews; Hu, Xin; Southall, Noel; Marugan, Juan J.; Ferrer, Marc

    2015-01-01

    Carboxyl-terminal binding protein (CtBP) is a transcriptional co-repressor that suppresses multiple pro-apoptotic and epithelial genes. CtBP is overexpressed in many human cancers and its overexpression increases stem cell-like features, epithelial-mesenchymal transition, and cancer cell survival. Knockdown of CtBP increases apoptosis independent of p53 and dramatically inhibits tumorigenesis in mouse models. Therefore, targeting CtBP with small molecules that disrupt its interaction with transcription factor partners may be an effective cancer therapy. To elicit its co-repressing effect, CtBP binds to a conserved peptide motif in each transcription factor partner. We developed an AlphaScreen high throughput screening assay to monitor the interaction between CtBP and E1A (which mimics the interaction between CtBP and its transcriptional partners). We screened the LOPAC library of 1280 bioactive compounds and identified NSC95397, which inhibits the CtBP-E1A interaction (IC50 = 2.9 μM). The inhibitory activity of NSC95397 was confirmed using two secondary assays and a counterscreen. NSC95397 also behaved as a weak substrate of CtBP dehydrogenase activity and did not inhibit another dehydrogenase, LDH. Finally, NSC95397 was able to disrupt CtBP-mediated transcriptional repression of a target gene. These studies present a new possibility for the development of a therapeutic agent targeting tumors through disrupting the CtBP transcriptional complex. PMID:25477201

  11. Should Blood Pressure Targets After Lacunar Stroke Vary by Body Size? The SPS3 Trial

    PubMed Central

    McClure, Leslie A.; White, Carole L.; Pergola, Pablo E.; Hart, Robert G.; Benavente, Oscar R.; Hill, Michael D.

    2015-01-01

    BACKGROUND It is unknown whether the physiological impact of a given blood pressure (BP) varies by body size. We explored interactions between higher vs. lower systolic BP (SBP) targets and anthropometric measures (body mass index (BMI), body surface area (BSA), height, weight) and recurrent stroke and death in the Secondary Prevention of Small Subcortical Strokes (SPS3) Trial. METHODS Patients with recent magnetic resonance imaging-proven lacunar infarcts were randomized to 2 BP targets (130–149mm Hg vs. <130) in a prospective, open-label, blinded end-point design. Time to outcome was evaluated with Cox proportional hazard models and compared between targets. We examined multiplicative interactions between each anthropometric measure and target and mean difference in achieved BP 1 year after randomization between BP groups by quartile. We also computed rates of recurrent stroke and death by quartiles of anthropometrics. RESULTS Three thousand and twenty patients were followed over a mean of 3.7 (SD 2.0) years. Mean age was 63; 63% were male. Mean height was 167 (SD 11) cm, weight 81 (18) kg, BMI 29 (5.9) kg/m2, and BSA 1.9 (0.25) m2. Achieved BP at 1 year was comparable between quartiles for each anthropometric measurement. We found no consistent interactions between BP target and anthropometrics for either outcome, nor were there any significant associations between hazard of stroke or death when assessed by BMI, BSA, height, or weight. CONCLUSIONS We found no interactions between BP target groups and quartiles of anthropometrics for rates of stroke and death in SPS3. There is no evidence at this time supporting body size-based modifications to current BP targets for secondary prevention after lacunar stroke. CLINICAL TRIALS REGISTRATION Trial Number NCT00059306 PMID:25452300

  12. Nonspecific targeting of iron oxide nanoparticles to the liver, kidney and spleen: A novel approach to achieving specificity

    NASA Astrophysics Data System (ADS)

    Palihawadana Arachchige, Maheshika; Flack, Amanda; Chen, Xuequn; Li, Jing; Oupicky, David; Cheng, Y.-C. Norman; Shen, Yimin; Jena, Bhanu; Lawes, Gavin

    2013-03-01

    Recently, there has been significant interest in developing Fe3O4 nanoparticles for biomedical applications including targeted drug delivery and magnetic resonance imaging. One of the major problems in these applications is the undesirable filtration of these materials by the mononuclear phagocyte system. Preliminary magnetic resonance imaging and magnetization studies on hyaluronic acid coated nanoparticles injected intravenously into mice confirm that the nanoparticles accumulate in the liver, spleen, and kidneys. To identify whether certain specific proteins are responsible for nanoparticle accumulation in these organs, we exposed hyaluronic acid coated nanoparticles to proteins extracted from the liver, spleen, and kidneys, together with blood plasma proteins, then subsequently used gel electrophoresis and mass spectroscopy to identify the proteins binding to the nanoparticles. We find that the unwanted accumulation of nanoparticles in these organs can potentially be attributed to specific binding by a small number of proteins. By appropriately functionalizing the iron oxide nanoparticles, we expect that the nanoparticles uptake in the liver, spleen, and kidneys will be reduced.

  13. Nonspecific targeting of iron oxide nanoparticles to the liver, kidney and spleen: A novel approach to achieving specificity

    NASA Astrophysics Data System (ADS)

    Palihawadana Arachchige, Maheshika; Flack, Amanda; Chen, Xuequn; Li, Jing; Oupicky, David; Cheng, Y.-C. Norman; Shen, Yimin; Jena, Bhanu; Lawes, Gavin

    2012-10-01

    Recently there has been significant interest in developing Fe3O4 nanoparticles for biomedical applications including targeted drug delivery and magnetic resonance imaging. One of the major problems in applying these nanoparticles clinically is to minimize the undesirable filtration of these materials by the mononuclear phagocyte system. Preliminary MRI and magnetization studies on hyaluronic acid coated nanoparticles injected intravenously into mice confirm that the nanoparticles accumulate in the liver, spleen, and kidneys. To identify whether this nanoparticle accumulation are due to some certain specific proteins, we exposed hyaluronic acid coated nanoparticles to proteins extracted from these organs, together with blood plasma proteins, then used gel electrophoresis together with mass spectroscopy to identify the proteins binding to the nanoparticles. We find that the accumulation of nanoparticles in these organs can be due to specific binding by a small number of proteins. By appropriately functionalizing the Fe3O4 nanoparticles, possibly by blocking the binding sites of these specific proteins, we expect that the nanoparticles uptake in the liver, spleen, and kidneys will be reduced, which, in turn, could increase the concentration of nanoparticles at tumor sites.

  14. Trends and implications for achieving VISION 2020 human resources for eye health targets in 16 countries of sub-Saharan Africa by the year 2020

    PubMed Central

    2014-01-01

    Background Development of human resources for eye health (HReH) is a major global eye health strategy to reduce the prevalence of avoidable visual impairment by the year 2020. Building on our previous analysis of current progress towards key HReH indicators and cataract surgery rates (CSRs), we predicted future indicator achievement among 16 countries of sub-Saharan Africa by 2020. Methods Surgical and HReH data were collected from national eye care programme coordinators on six practitioner cadres: ophthalmologists, cataract surgeons, ophthalmic clinical officers, ophthalmic nurses, optometrists and ‘mid-level refractionists’ and combined them with publicly available population data to calculate practitioner-to-population ratios and CSRs. Data on workforce entry and exit (2008 to 2010) was used to project practitioner population and CSR growth between 2011 and 2020 in relation to projected growth in the general population. Associations between indicator progress and the presence of a non-physician cataract surgeon cadre were also explored using Wilcoxon rank sum tests and Spearman rank correlations. Results In our 16-country sample, practitioner per million population ratios are predicted to increase slightly for surgeons (ophthalmologists/cataract surgeons, from 3.1 in 2011 to 3.4 in 2020) and ophthalmic nurses/clinical officers (5.8 to 6.8) but remain low for refractionists (including optometrists, at 3.6 in 2011 and 2020). Among countries that have not already achieved target indicators, however, practitioner growth will be insufficient for any additional countries to reach the surgeon and refractionist targets by year 2020. Without further strategy change and investment, even after 2020, surgeon growth is only expected to sufficiently outpace general population growth to reach the target in one country. For nurses, two additional countries will achieve the target while one will fall below it. In 2011, high surgeon practitioner ratios were associated with

  15. Coated minispheres of salmon calcitonin target rat intestinal regions to achieve systemic bioavailability: Comparison between intestinal instillation and oral gavage.

    PubMed

    Aguirre, Tanira A S; Aversa, Vincenzo; Rosa, Mónica; Guterres, Sílvia S; Pohlmann, Adriana R; Coulter, Ivan; Brayden, David J

    2016-09-28

    Achieving oral peptide delivery is an elusive challenge. Emulsion-based minispheres of salmon calcitonin (sCT) were synthesized using single multiple pill (SmPill®) technology incorporating the permeation enhancers (PEs): sodium taurodeoxycholate (NaTDC), sodium caprate (C10), or coco-glucoside (CG), or the pH acidifier, citric acid (CA). Minispheres were coated with an outer layer of Eudragit® L30 D-55 (designed for jejunal release) or Surelease®/Pectin (designed for colonic release). The process was mild and in vitro biological activity of sCT was retained upon release from minispheres stored up to 4months. In vitro release profiles suggested that sCT was released from minispheres by diffusion through coatings due to swelling of gelatin and the polymeric matrix upon contact with PBS at pH6.8. X-ray analysis confirmed that coated minispheres dissolved at the intended intestinal region of rats following oral gavage. Uncoated minispheres at a dose of ~2000I.U.sCT/kg were administered to rats by intra-jejunal (i.j.) or intra-colonic (i.c.) instillation and caused hypocalcaemia. Notable sCT absolute bioavailability (F) values were: 5.5% from minispheres containing NaTDC (i.j), 17.3% with CG (i.c.) and 18.2% with C10 (i.c.). Coated minispheres administered by oral gavage at threefold higher doses also induced hypocalcaemia. A highly competitive F value of 2.7% was obtained for orally-administered sCT-minispheres containing CG (45μmol/kg) and coated with Eudragit®. In conclusion, the SmPill® technology is a potential dosage form for several peptides when formulated with PEs and coated for regional delivery. PK data from instillations over-estimates oral bioavailability and poorly predicts rank ordering of formulations. PMID:27480451

  16. Achievement of recommended glucose and blood pressure targets in patients with type 2 diabetes and hypertension in clinical practice – study rationale and protocol of DIALOGUE

    PubMed Central

    2012-01-01

    Background Patients with type 2 diabetes have 2–4 times greater risk for cardiovascular morbidity and mortality than those without, and this is even further aggravated if they also suffer from hypertension. Unfortunately, less than one third of hypertensive diabetic patients meet blood pressure targets, and more than half fail to achieve target HbA1c values. Thus, appropriate blood pressure and glucose control are of utmost importance. Since treatment sometimes fails in clinical practice while clinical trials generally suggest good efficacy, data from daily clinical practice, especially with regard to the use of newly developed anti-diabetic and anti-hypertensive compounds in unselected patient populations, are essential. The DIALOGUE registry aims to close this important gap by evaluating different treatment approaches in hypertensive type 2 diabetic patients with respect to their effectiveness and tolerability and their impact on outcomes. In addition, DIALOGUE is the first registry to determine treatment success based on the new individualized treatment targets recommended by the ADA and the EASD. Methods DIALOGUE is a prospective observational German multicentre registry and will enrol 10,000 patients with both diabetes and hypertension in up to 700 sites. After a baseline visit, further documentations are scheduled at 6, 12 and 24 months. There are two co-primary objectives referring to the most recent guidelines for the treatment of diabetes and hypertension: 1) individual HbA1c goal achievement with respect to anti-diabetic pharmacotherapy and 2) individual blood pressure goal achievement with different antihypertensive treatments. Among the secondary objectives the rate of major cardio-vascular and cerebro-vascular events (MACCE) and the rate of hospitalizations are the most important. Conclusion The registry will be able to gain insights into the reasons for the obvious gap between the demonstrated efficacy and safety of anti-diabetic and anti

  17. NREL 2012 Achievement of Ethanol Cost Targets: Biochemical Ethanol Fermentation via Dilute-Acid Pretreatment and Enzymatic Hydrolysis of Corn Stover

    SciTech Connect

    Tao, L.; Schell, D.; Davis, R.; Tan, E.; Elander, R.; Bratis, A.

    2014-04-01

    For the DOE Bioenergy Technologies Office, the annual State of Technology (SOT) assessment is an essential activity for quantifying the benefits of biochemical platform research. This assessment has historically allowed the impact of research progress achieved through targeted Bioenergy Technologies Office funding to be quantified in terms of economic improvements within the context of a fully integrated cellulosic ethanol production process. As such, progress toward the ultimate 2012 goal of demonstrating cost-competitive cellulosic ethanol technology can be tracked. With an assumed feedstock cost for corn stover of $58.50/ton this target has historically been set at $1.41/gal ethanol for conversion costs only (exclusive of feedstock) and $2.15/gal total production cost (inclusive of feedstock) or minimum ethanol selling price (MESP). This year, fully integrated cellulosic ethanol production data generated by National Renewable Energy Laboratory (NREL) researchers in their Integrated Biorefinery Research Facility (IBRF) successfully demonstrated performance commensurate with both the FY 2012 SOT MESP target of $2.15/gal (2007$, $58.50/ton feedstock cost) and the conversion target of $1.41/gal through core research and process improvements in pretreatment, enzymatic hydrolysis, and fermentation.

  18. IGF2BP3 Modulates the Interaction of Invasion-Associated Transcripts with RISC.

    PubMed

    Ennajdaoui, Hanane; Howard, Jonathan M; Sterne-Weiler, Timothy; Jahanbani, Fereshteh; Coyne, Doyle J; Uren, Philip J; Dargyte, Marija; Katzman, Sol; Draper, Jolene M; Wallace, Andrew; Cazarez, Oscar; Burns, Suzanne C; Qiao, Mei; Hinck, Lindsay; Smith, Andrew D; Toloue, Masoud M; Blencowe, Benjamin J; Penalva, Luiz O F; Sanford, Jeremy R

    2016-05-31

    Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) expression correlates with malignancy, but its role(s) in pathogenesis remains enigmatic. We interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC) cells. Using a combination of genome-wide approaches, we have identified 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation, and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual nucleotide resolution crosslinking immunoprecipitation (iCLIP) revealed significant overlap of IGF2BP3 and microRNA (miRNA) binding sites. IGF2BP3 promotes association of the RNA-induced silencing complex (RISC) with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions. PMID:27210763

  19. IGF2BP3 modulates the interaction of invasion-associated transcripts with RISC

    PubMed Central

    Ennajdaoui, Hanane; Howard, Jonathan M.; Sterne-Weiler, Timothy; Jahanbani, Fereshteh; Coyne, Doyle J.; Uren, Philip J.; Dargyte, Marija; Katzman, Sol; Draper, Jolene M.; Wallace, Andrew; Cazarez, Oscar; Burns, Suzanne C.; Qiao, Mei; Hinck, Lindsay; Smith, Andrew D.; Toloue, Masoud M.; Blencowe, Benjamin J.; Penalva, Luiz O.F.; Sanford, Jeremy R.

    2016-01-01

    Summary Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) expression correlates with malignancy. But its role(s) in pathogenesis remain enigmatic. Here, we interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC) cells. Using a combination of genome-wide approaches we identify 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual-nucleotide resolution crosslinking immunoprecipitation (iCLIP) revealed significant overlap of IGF2BP3 and miRNA binding sites. IGF2BP3 promotes association of the RNA induced silencing complex (RISC) with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions. PMID:27210763

  20. Close-spaced crystal growth and characterization of BP crystals

    NASA Astrophysics Data System (ADS)

    Schmitt, J. O.; Edgar, L. J. H.; Liu, L.; Nagarajan, R.; Szyszko, T.; Podsiadlo, S.; Wojciech, G.

    2005-02-01

    The present study was undertaken to determine if boron phosphide (BP) crystals could be produced by a simple technique, close-spaced vapor transport (CVST). This technique has proven very successful in achieving very high growth rates for a wide variety of materials including ZnSe, AlN, and SiC. Both silicon (100) and sapphire substrates were used for the CSVT growth. The resulting films were characterized by Raman spectroscopy. Sublimation of BP powder from 1050 to 1450 °C in an argon atmosphere produced a range of deep orange colour, single and polycrystalline BP crystals. The crystal size increased and the crystal density decreased with increasing temperature. Well-faceted crystals were produced at an intermediate temperature of 1200 °C. At temperatures higher then 1450 °C no BP crystals were grown. Only a fibrous mass of fine whiskers, loosely attached to the substrate were produced. The peak position of the Raman LO mode of the BP crystals was shifted to higher wavenumbers than the BP powder source, suggesting that the crystals were compressively strained.

  1. Attainment of Canadian Diabetes Association recommended targets in patients with type 2 diabetes

    PubMed Central

    McCrate, Farah; Godwin, Marshall; Murphy, Laura

    2010-01-01

    OBJECTIVE To examine the degree to which targets for diabetes (blood pressure [BP], glycated hemoglobin [HbA1c], and low-density lipoprotein cholesterol [LDL-C]) are achieved in family practices and how these results compare with family physicians’ perceptions of how well targets are being achieved. DESIGN Chart audit and physician survey. SETTING Newfoundland and Labrador. PARTICIPANTS Patients with type 2 diabetes and their family physicians. INTERVENTIONS The charts of 20 patients with type 2 diabetes were randomly chosen from each of 8 family physician practices in St John’s, Nfld, and data were abstracted. All family physicians in the province were surveyed using a modified Dillman method. MAIN OUTCOME MEASURES The most recent HbA1c, LDL-C, and BP measurements listed in each audited chart; surveyed family physicians’ knowledge of the recommended targets for HbA1c, LDL-C, and BP and their estimates of what percentage of their patients were at those recommended targets. RESULTS The chart audit revealed that 20.6% of patients were at the recommended target for BP, 48.1% were at the recommended target for HbA1c, and 17.5% were at the recommended target for LDL-C. When targets were examined collectively, only 2.5% of patients were achieving targets in all 3 areas. The survey found that most family physicians were aware of the recommended targets for BP, LDL-C, and HbA1c. However, their estimates of the percentages of patients in their practices achieving these targets appeared high (59.3% for BP, 58.2% for HbA1c, and 48.4% for LDL-C) compared with the results of the chart audit. CONCLUSION The findings of the chart audit are consistent with other published reports, which have illustrated that a large majority of patients with diabetes fall short of reaching recommended targets for BP, blood glucose, and lipid levels. Although family physicians are knowledgeable about recommended targets, there is a gap between knowledge and clinical outcomes. The reasons for

  2. Split vector systems for ultra-targeted gene delivery: a contrivance to achieve ethical assurance of somatic gene therapy in vivo.

    PubMed

    Tolmachov, Oleg E

    2014-08-01

    Tightly controlled spatial localisation of therapeutic gene delivery is essential to maximize the benefits of somatic gene therapy in vivo and to reduce its undesired effects on the 'bystander' cell populations, most importantly germline cells. Indeed, complete ethical assurance of somatic gene therapy can only be achieved with ultra-targeted gene delivery, which excludes the risk of inadvertent germline gene transfer. Thus, it is desired to supplement existing strategies of physical focusing and biological (cell-specific) targeting of gene delivery with an additional principle for the rigid control over spread of gene transfer within the body. In this paper I advance the concept of 'combinatorial' targeting of therapeutic gene transfer in vivo. I hypothesize that it is possible to engineer complex gene delivery vector systems consisting of several components, each one of them capable of independent spread within the human body but incapable of independent facilitation of gene transfer. As the gene delivery augmented by such split vector systems would be reliant on the simultaneous availability of all the vector system components at a predetermined body site, it is envisaged that higher order reaction kinetics required for the assembly of the functional gene transfer configuration would sharpen spatial localisation of gene transfer via curtailing the blurring effect of the vector spread within the body. A particular implementation of such split vector system could be obtained through supplementing a viral therapeutic gene vector with a separate auxiliary vector carrying a non-integrative and non-replicative form of a gene (e.g., mRNA) coding for a cellular receptor of the therapeutic vector component. Gene-transfer-enabling components of the vector system, which would be delivered separately from the vector component loaded with the therapeutic gene cargo, could also be cell-membrane-insertion-proficient receptors, elements of artificial transmembrane channels

  3. Statin Discontinuation after Achieving a Target Low Density Lipoprotein Cholesterol Level in Type 2 Diabetic Patients without Cardiovascular Disease: A Randomized Controlled Study

    PubMed Central

    Lee, Seung-Hwan; Kwon, Hyuk-Sang; Park, Yong-Moon; Ko, Seung-Hyun; Choi, Yoon-Hee; Yoon, Kun-Ho

    2014-01-01

    Background This study investigated the rate of relapse of dyslipidemia and the factors which could predict relapse following a short-term statin discontinuation after achieving a target low density lipoprotein cholesterol (LDL-C) level in type 2 diabetic patients without cardiovascular disease (CVD). Methods Ninety-nine subjects on rosuvastatin treatment and whose LDL-C level was lower than 100 mg/dL were randomly assigned to discontinue or maintain statin treatment at a 2:1 ratio. The subjects were followed-up after 10 weeks. A relapse of dyslipidemia was defined as a reascent of LDL-C level to greater than 100 mg/dL. Results The statin discontinuation group had a significant rate of relapse compared to the maintenance group (79% vs. 3%, respectively). Pretreatment and baseline lipid levels, their ratios, and hemoglobin A1c level were significantly different between the relapse and nonrelapse groups. The pretreatment and baseline lipid profiles and their ratios were independently associated with relapse. The pretreatment LDL-C level was the most useful parameter for predicting a relapse, with a cutoff of 123 mg/dL. During the follow-up period, no CVD event was noted. Conclusion The relapse rate of dyslipidemia was high when statins were discontinued in type 2 diabetic patients without CVD. Statin discontinuation should be considered carefully based on the pretreatment lipid profiles of patients. PMID:24627830

  4. Variability in protein binding of teicoplanin and achievement of therapeutic drug monitoring targets in critically ill patients: lessons from the DALI Study.

    PubMed

    Roberts, J A; Stove, V; De Waele, J J; Sipinkoski, B; McWhinney, B; Ungerer, J P J; Akova, M; Bassetti, M; Dimopoulos, G; Kaukonen, K-M; Koulenti, D; Martin, C; Montravers, P; Rello, J; Rhodes, A; Starr, T; Wallis, S C; Lipman, J

    2014-05-01

    The aims of this study were to describe the variability in protein binding of teicoplanin in critically ill patients as well as the number of patients achieving therapeutic target concentrations. This report is part of the multinational pharmacokinetic DALI Study. Patients were sampled on a single day, with blood samples taken both at the midpoint and the end of the dosing interval. Total and unbound teicoplanin concentrations were assayed using validated chromatographic methods. The lower therapeutic range of teicoplanin was defined as total trough concentrations from 10 to 20 mg/L and the higher range as 10-30 mg/L. Thirteen critically ill patients were available for analysis. The following are the median (interquartile range) total and free concentrations (mg/L): midpoint, total 13.6 (11.2-26.0) and free 1.5 (0.7-2.5); trough, total 11.9 (10.2-22.7) and free 1.8 (0.6-2.6). The percentage free teicoplanin for the mid-dose and trough time points was 6.9% (4.5-15.6%) and 8.2% (5.5-16.4%), respectively. The correlation between total and free antibiotic concentrations was moderate for both the midpoint (ρ = 0.79, P = 0.0021) and trough (ρ = 0.63, P = 0.027). Only 42% and 58% of patients were in the lower and higher therapeutic ranges, respectively. In conclusion, use of standard dosing for teicoplanin leads to inappropriate concentrations in a high proportion of critically ill patients. Variability in teicoplanin protein binding is very high, placing significant doubt on the validity of total concentrations for therapeutic drug monitoring in critically ill patients. PMID:24630304

  5. Variability in protein binding of teicoplanin and achievement of therapeutic drug monitoring targets in critically ill patients: lessons from the DALI Study.

    PubMed

    Roberts, J A; Stove, V; De Waele, J J; Sipinkoski, B; McWhinney, B; Ungerer, J P J; Akova, M; Bassetti, M; Dimopoulos, G; Kaukonen, K-M; Koulenti, D; Martin, C; Montravers, P; Rello, J; Rhodes, A; Starr, T; Wallis, S C; Lipman, J

    2014-05-01

    The aims of this study were to describe the variability in protein binding of teicoplanin in critically ill patients as well as the number of patients achieving therapeutic target concentrations. This report is part of the multinational pharmacokinetic DALI Study. Patients were sampled on a single day, with blood samples taken both at the midpoint and the end of the dosing interval. Total and unbound teicoplanin concentrations were assayed using validated chromatographic methods. The lower therapeutic range of teicoplanin was defined as total trough concentrations from 10 to 20 mg/L and the higher range as 10-30 mg/L. Thirteen critically ill patients were available for analysis. The following are the median (interquartile range) total and free concentrations (mg/L): midpoint, total 13.6 (11.2-26.0) and free 1.5 (0.7-2.5); trough, total 11.9 (10.2-22.7) and free 1.8 (0.6-2.6). The percentage free teicoplanin for the mid-dose and trough time points was 6.9% (4.5-15.6%) and 8.2% (5.5-16.4%), respectively. The correlation between total and free antibiotic concentrations was moderate for both the midpoint (ρ = 0.79, P = 0.0021) and trough (ρ = 0.63, P = 0.027). Only 42% and 58% of patients were in the lower and higher therapeutic ranges, respectively. In conclusion, use of standard dosing for teicoplanin leads to inappropriate concentrations in a high proportion of critically ill patients. Variability in teicoplanin protein binding is very high, placing significant doubt on the validity of total concentrations for therapeutic drug monitoring in critically ill patients.

  6. Critical appraisal of amlodipine and olmesartan medoxomil fixed-dose combination in achieving blood pressure goals.

    PubMed

    Basile, Jan

    2010-01-01

    Hypertension remains a significant health burden in the United States, with almost one in three adults affected, and is an independent risk factor for cardiovascular and renal disease. The goal of antihypertensive treatment is to reduce cardiovascular and renal morbidity and mortality by reducing blood pressure (BP). Guidelines recommend a target BP of <140/90 mmHg, with a more stringent goal of <130/80 mmHg for patients with diabetes and chronic renal disease. However, BP goal attainment rates remain low and most patients require therapy with two or more antihypertensive agents. Combination antihypertensive therapy usually employs agents from different classes, thus benefitting from complementary mechanisms of action to achieve greater BP control with fewer side effects. Patient adherence to therapy is enhanced by formulating treatments as fixed-dose (single-pill) combinations. One example is the combination of amlodipine, a dihydropyridine calcium channel blocker (CCB), with olmesartan medoxomil, an angiotensin receptor blocker (ARB). Here, the rationale for the use of CCB/ARB combination therapy is discussed, as well as the pharmacology and tolerability of the amlodipine/olmesartan medoxomil combination and its efficacy in terms of achieving BP goal in patients with hypertension. Advantages of its use from the patient's perspective are also discussed.

  7. Critical appraisal of amlodipine and olmesartan medoxomil fixed-dose combination in achieving blood pressure goals

    PubMed Central

    Basile, Jan

    2010-01-01

    Hypertension remains a significant health burden in the United States, with almost one in three adults affected, and is an independent risk factor for cardiovascular and renal disease. The goal of antihypertensive treatment is to reduce cardiovascular and renal morbidity and mortality by reducing blood pressure (BP). Guidelines recommend a target BP of <140/90 mmHg, with a more stringent goal of <130/80 mmHg for patients with diabetes and chronic renal disease. However, BP goal attainment rates remain low and most patients require therapy with two or more antihypertensive agents. Combination antihypertensive therapy usually employs agents from different classes, thus benefitting from complementary mechanisms of action to achieve greater BP control with fewer side effects. Patient adherence to therapy is enhanced by formulating treatments as fixed-dose (single-pill) combinations. One example is the combination of amlodipine, a dihydropyridine calcium channel blocker (CCB), with olmesartan medoxomil, an angiotensin receptor blocker (ARB). Here, the rationale for the use of CCB/ARB combination therapy is discussed, as well as the pharmacology and tolerability of the amlodipine/olmesartan medoxomil combination and its efficacy in terms of achieving BP goal in patients with hypertension. Advantages of its use from the patient’s perspective are also discussed. PMID:21949625

  8. Achievement of a target dose of bisoprolol may not be a preferred option for attenuating pressure overload-induced cardiac hypertrophy and fibrosis

    PubMed Central

    Xiang, Shizhao; Zhang, Ning; Yang, Zheng; Bian, Zhouyan; Yuan, Yuan; Tang, Qizhu

    2016-01-01

    Bisoprolol is a drug that acts via the mechanism of specifically and selectively inhibiting the β1-adrenoreceptor in cardiac myocytes, and provides a pure reduction of heart rate without changing other cardiac parameters. It has long been clinically used to treat cerebrovascular and cardiovascular illnesses. However, there is little information available on whether the role of bisoprolol in the attenuation of ventricular remodeling is dependent upon the achievement of a target dose, and whether it must be used as a preferred option. The aim of the present study was to clarify the underlying benefits of bisoprolol in the attenuation of pressure overload-induced cardiac hypertrophy and fibrosis at different doses. C57BL/6J male mice, aged 6–8 weeks, were treated with saline or one of three different doses of bisoprolol (Biso: 2.5, 5 or 10 mg/kg/day) for 8 weeks from day 1 after aortic banding (AB). A number of mice underwent sham surgery and were treated with saline or bisoprolol. The mice were randomly assigned into the sham (n=24) and AB (n=62) groups. The results revealed that bisoprolol had a protective role against the cardiac hypertrophy, fibrosis and dysfunction caused by AB. This was determined on the basis of heart/body and lung/body weight ratios and heart weight/tibia length ratios, as well as echocardiographic and hemodynamic parameters, histological analysis, and the gene expression levels of hypertrophic and fibrotic markers. The present study revealed that administration of bisoprolol for a long time period may enhance its role in the prevention of cardiac hypertrophy and fibrosis induced by AB, whereas no statistically significant difference was observed between the middle- and high-doses. These observations indicated that the function of bisoprolol in protecting against cardiac hypertrophy, fibrosis and dysfunction is time-dependent. Furthermore, it is proposed that a middle dose of bisoprolol may be a better option for patients with

  9. Achievement of a target dose of bisoprolol may not be a preferred option for attenuating pressure overload-induced cardiac hypertrophy and fibrosis

    PubMed Central

    Xiang, Shizhao; Zhang, Ning; Yang, Zheng; Bian, Zhouyan; Yuan, Yuan; Tang, Qizhu

    2016-01-01

    Bisoprolol is a drug that acts via the mechanism of specifically and selectively inhibiting the β1-adrenoreceptor in cardiac myocytes, and provides a pure reduction of heart rate without changing other cardiac parameters. It has long been clinically used to treat cerebrovascular and cardiovascular illnesses. However, there is little information available on whether the role of bisoprolol in the attenuation of ventricular remodeling is dependent upon the achievement of a target dose, and whether it must be used as a preferred option. The aim of the present study was to clarify the underlying benefits of bisoprolol in the attenuation of pressure overload-induced cardiac hypertrophy and fibrosis at different doses. C57BL/6J male mice, aged 6–8 weeks, were treated with saline or one of three different doses of bisoprolol (Biso: 2.5, 5 or 10 mg/kg/day) for 8 weeks from day 1 after aortic banding (AB). A number of mice underwent sham surgery and were treated with saline or bisoprolol. The mice were randomly assigned into the sham (n=24) and AB (n=62) groups. The results revealed that bisoprolol had a protective role against the cardiac hypertrophy, fibrosis and dysfunction caused by AB. This was determined on the basis of heart/body and lung/body weight ratios and heart weight/tibia length ratios, as well as echocardiographic and hemodynamic parameters, histological analysis, and the gene expression levels of hypertrophic and fibrotic markers. The present study revealed that administration of bisoprolol for a long time period may enhance its role in the prevention of cardiac hypertrophy and fibrosis induced by AB, whereas no statistically significant difference was observed between the middle- and high-doses. These observations indicated that the function of bisoprolol in protecting against cardiac hypertrophy, fibrosis and dysfunction is time-dependent. Furthermore, it is proposed that a middle dose of bisoprolol may be a better option for patients with

  10. Achieving national influenza vaccine targets--an investigation of the factors affecting influenza vaccine uptake in older people and people with diabetes.

    PubMed

    Lewis-Parmar, H; McCann, R

    2002-06-01

    A survey by postal questionnaire of a random sample of community residents with diabetes mellitus and those aged 75 years was undertaken in one Health Authority area to examine the factors associated with influenza vaccine uptake in these groups. The questionnaire sought: information on vaccine uptake and non-uptake over the previous three winter periods; patient attitudes to and knowledge about influenza and influenza vaccine; sources of patients' information; and patients' views on improving vaccine uptake. Self-reported vaccine uptake had increased in people with diabetes from 53.9% in 1997-98 to 67.6% in 1999-2000, and in people aged 75 years and over from 63.5% in 1997-98 to 70.2% in 1999-2000. Factors significantly associated with vaccine uptake in people with diabetes included a history of previous vaccination OR 40 (95% confidence interval 9,206), recommendation by a health professional OR 14 (2.9, 90) and belief that the vaccine protects against flu OR 5.6 (1.8, 18.9). Factors significantly associated with vaccine uptake in older people included the belief that the vaccine protects against flu OR 23 (8.4, 69.4), a history of previous vaccination OR 10 (3.9, 28.3) and not being concerned about side-effects OR 4 (2.1, 7.9). Information given by a health professional was the only source of information found to significantly influence vaccine uptake. Interventions suggested to increase uptake include provision of more information and better access to influenza vaccination. It is concluded that uptake rates for influenza vaccine have increased over the last three years to 67.4% in people with diabetes and 70.2% in people aged 75 and over. Professionals play a key role in influencing the decision to have influenza vaccine. Information about influenza and its vaccine needs to be combined with improvements in service provision if overall target uptake rates of 70% (65% in those aged 65 years and over) are to be achieved.

  11. Viral and Cellular Proteins Containing FGDF Motifs Bind G3BP to Block Stress Granule Formation

    PubMed Central

    Panas, Marc D.; Schulte, Tim; Thaa, Bastian; Sandalova, Tatiana; Kedersha, Nancy; Achour, Adnane; McInerney, Gerald M.

    2015-01-01

    The Ras-GAP SH3 domain–binding proteins (G3BP) are essential regulators of the formation of stress granules (SG), cytosolic aggregates of proteins and RNA that are induced upon cellular stress, such as virus infection. Many viruses, including Semliki Forest virus (SFV), block SG induction by targeting G3BP. In this work, we demonstrate that the G3BP-binding motif of SFV nsP3 consists of two FGDF motifs, in which both phenylalanine and the glycine residue are essential for binding. In addition, we show that binding of the cellular G3BP-binding partner USP10 is also mediated by an FGDF motif. Overexpression of wt USP10, but not a mutant lacking the FGDF-motif, blocks SG assembly. Further, we identified FGDF-mediated G3BP binding site in herpes simplex virus (HSV) protein ICP8, and show that ICP8 binding to G3BP also inhibits SG formation, which is a novel function of HSV ICP8. We present a model of the three-dimensional structure of G3BP bound to an FGDF-containing peptide, likely representing a binding mode shared by many proteins to target G3BP. PMID:25658430

  12. Viral and cellular proteins containing FGDF motifs bind G3BP to block stress granule formation.

    PubMed

    Panas, Marc D; Schulte, Tim; Thaa, Bastian; Sandalova, Tatiana; Kedersha, Nancy; Achour, Adnane; McInerney, Gerald M

    2015-02-01

    The Ras-GAP SH3 domain-binding proteins (G3BP) are essential regulators of the formation of stress granules (SG), cytosolic aggregates of proteins and RNA that are induced upon cellular stress, such as virus infection. Many viruses, including Semliki Forest virus (SFV), block SG induction by targeting G3BP. In this work, we demonstrate that the G3BP-binding motif of SFV nsP3 consists of two FGDF motifs, in which both phenylalanine and the glycine residue are essential for binding. In addition, we show that binding of the cellular G3BP-binding partner USP10 is also mediated by an FGDF motif. Overexpression of wt USP10, but not a mutant lacking the FGDF-motif, blocks SG assembly. Further, we identified FGDF-mediated G3BP binding site in herpes simplex virus (HSV) protein ICP8, and show that ICP8 binding to G3BP also inhibits SG formation, which is a novel function of HSV ICP8. We present a model of the three-dimensional structure of G3BP bound to an FGDF-containing peptide, likely representing a binding mode shared by many proteins to target G3BP.

  13. PL 01-1 CARDIOVASCULAR PROTECTION IN HYPERTENSION. WHICH TARGETS FOR TREATMENT.

    PubMed

    Mancia, Giuseppe

    2016-09-01

    A huge amount of evidence is available that antihypertensive treatment is accompanied by a reduction in the risk of cardiovascular (CV) and renal outcomes as well as that a major portion of the beneficial effect is due to blood pressure (BP) lowering per se, regardless how it is obtained. Despite decades of research, however, information is still not conclusive on which might be the BP values to achieve with treatment in order to maximize CV and renal protection. This presentation will address this issue by reviewing the current target BP values recommended by guidelines in the general and elderly hypertensive population with a description of the related evidence. It will then show the modifications that may be supported by recent meta-analyses of randomized trials as well as by post-hoc analysis of some large scale trials. It will finally focus on the results of the SPRINT trial that much lower BP target may increase the benefits at all ages., thereby challenging the conservative attitude of current guidelines. The point will be made that, although potentially very important the SPRINT trials presents with several aspects that are difficult to interpret, as well as with inconveniences (marked increases of serious side effects in the intensively treated patients) that in real life may favour discontinuation and low adherence to treatment with a resulting increase of CV risk that may attenuate, if not offset, any theoretical benefit. The conclusion will be drawn that further evidence on this issue is needed and that future trials should explore, in particular, possible differences in optimal BP target according to demographic characteristics (including ethnicity) and clinical phenotypes (presence or absence of organ damage, duration of disease, type of event protected, etc). Attention will be directed also on the need to establish optimal target also for out-of-office BP and other BP effects of treatment, such as long-term BP variability. PMID:27642873

  14. Electronic states of BP, BP +, BP -, B 2P 2, B2P2- and B2P2+

    NASA Astrophysics Data System (ADS)

    Linguerri, Roberto; Komiha, Najia; Oswald, Rainer; Mitrushchenkov, Alexander; Rosmus, Pavel

    2008-05-01

    Using augmented sextuple zeta basis sets and internally contracted multireference configuration interaction (MRCI) wavefunctions, potential energy, electric dipole and transition moments have been computed for the X 3Π, a 1Σ +, b 1Π and A 3Σ - states of BP, X 2Σ + and A 2Π states of BP - and X 4Σ - and A 4Π states of BP +. From these data spectroscopic constants, radiative transition probabilities and photoelectron spectra of BP - and BP have been evaluated. The non-vanishing spin-orbit coupling elements between the four low lying triplet and singlet states of the neutral BP have also been calculated from MRCI wavefunctions. The treatment of the corresponding perturbations in the manifold of dense rovibrational states in the three lowest states would require a precise knowledge of the electronic excitation energies. Our best singlet-triplet separations (X-a) are calculated to be 2412 cm -1 (MRCI) and 2482 cm -1 (restricted coupled cluster with perturbative triples (RCCSD(T))) with an estimated error bound of about ±200 cm -1. All three states have long radiative lifetimes with cascading among the rovibrational levels of different states. The ionization energy IE e of BP is calculated to be 9.22 eV (MRCI) and 9.48 eV (RCCSD(T)), the electron affinity EA e 2.51 eV (MRCI) and 2.74 eV (RCCSD(T)). The photoelectron spectra of BP and BP - have been obtained from the Franck-Condon factors of the MRCI potentials. For the UV spectroscopy the dipole allowed radiative transition probabilities are given for A 3Σ - ↔ X 3Π, b 1Π ↔ a 1Σ + of BP, A 2Π ↔ X 2Σ + of BP - and A 4Π ↔ X 4Σ - of BP +. The ionization energy IE e of B 2P 2 of 8.71 eV and the electron affinity EA e of 2.34 eV have been calculated by the RCCSD(T)/aVQZ approach. Also the harmonic vibrational wavenumbers for the electronic ground states of the ions B2P2+ and B2P2- are given.

  15. Both G3BP1 and G3BP2 contribute to stress granule formation.

    PubMed

    Matsuki, Hideaki; Takahashi, Masahiko; Higuchi, Masaya; Makokha, Grace N; Oie, Masayasu; Fujii, Masahiro

    2013-02-01

    Upon exposure to various environmental stresses such as arsenite, hypoxia, and heat shock, cells inhibit their translation and apoptosis and then repair stress-induced alterations, such as DNA damage and the accumulation of misfolded proteins. These types of stresses induce the formation of cytoplasmic RNA granules called stress granules (SGs). SGs are storage sites for the many mRNAs released from disassembled polysomes under these stress conditions and are essential for the selective translation of stress-inducible genes. Ras-GTPase-activating protein SH3 domain-binding protein 1 (G3BP1) is a component of SGs that initiates the assembly of SGs by forming a multimer. In this study, we examined the role of G3BP2, a close relative of G3BP1, in SG formation. Although single knockdown of either G3BP1 or G3BP2 in 293T cells partially reduced the number of SG-positive cells induced by arsenite, the knockdowns of both genes significantly reduced the number. G3BP2 formed a homo-multimer and a hetero-multimer with G3BP1. Moreover, like G3BP1, the overexpression of G3BP2 induced SGs even without stress stimuli. Collectively, these results suggest that both G3BP1 and G3BP2 play a role in the formation of SGs in various human cells and thereby recovery from these cellular stresses.

  16. BP1, an Isoform of DLX4 Homeoprotein, Negatively Regulates BRCA1 in Sporadic Breast Cancer

    PubMed Central

    Kluk, Brian J.; Fu, Yebo; Formolo, Trina A.; Zhang, Lei; Hindle, Anne K.; Man, Yan-gao; Siegel, Robert S.; Berg, Patricia E.; Deng, Chuxia; McCaffrey, Timothy A.; Fu, Sidney W.

    2010-01-01

    Introduction: Several lines of evidence point to an important role for BP1, an isoform of DLX4 homeobox gene, in breast carcinogenesis and progression. BRCA1 is a well-known player in the etiology of breast cancer. While familial breast cancer is often marked by BRCA1 mutation and subsequent loss of heterozygosity, sporadic breast cancers exhibit reduced expression of wild type BRCA1, and loss of BRCA1 expression may result in tumor development and progression. Methods: The Cister algorithm and Genomatix program were used to identify potential BP1 binding sites in BRCA1 gene. Real-time PCR, Western blot and immunohistochemistry analysis were performed to verify the expression of BRCA1 and BP1 in cell lines and breast cancer tissues. Double-stranded siRNA transfection was carried out for silencing BP1 expression. ChIP and EMSA were used to confirm that BP1 specifically binds to BRCA1. Results: A putative BP1 binding site was identified in the first intron of BRCA1, which was confirmed by chromatin immunoprecipiation and electrophoresis mobility shift assay. BP1 and BRCA1 expression were inversely correlated in breast cancer cell lines and tissues, suggesting that BP1 may suppress BRCA1 transcription through consensus sequence binding. Conclusions: BP1 homeoprotein represses BRCA1 expression through direct binding to its first intron, which is consistent with a previous study which identified a novel transcriptional repressor element located more than 500 base pairs into the first intron of BRCA1, suggesting that the first intron plays an important role in the negative regulation of BRCA1. Although further functional studies are necessary to confirm its repressor activity towards BRCA1, the elucidation of the role of BP1 in breast tumorigenesis holds great promise in establishing BP1 as a novel target for drug therapy. PMID:20877436

  17. The GYF domain protein CD2BP2 is critical for embryogenesis and podocyte function.

    PubMed

    Albert, Gesa I; Schell, Christoph; Kirschner, Karin M; Schäfer, Sebastian; Naumann, Ronald; Müller, Alexandra; Kretz, Oliver; Kuropka, Benno; Girbig, Mathias; Hübner, Norbert; Krause, Eberhard; Scholz, Holger; Huber, Tobias B; Knobeloch, Klaus-Peter; Freund, Christian

    2015-10-01

    Scaffolding proteins play pivotal roles in the assembly of macromolecular machines such as the spliceosome. The adaptor protein CD2BP2, originally identified as a binding partner of the adhesion molecule CD2, is a pre-spliceosomal assembly factor that utilizes its glycine-tyrosine-phenylalanine (GYF) domain to co-localize with spliceosomal proteins. So far, its function in vertebrates is unknown. Using conditional gene targeting in mice, we show that CD2BP2 is crucial for embryogenesis, leading to growth retardation, defects in vascularization, and premature death at embryonic day 10.5 when absent. Ablation of the protein in bone marrow-derived macrophages indicates that CD2BP2 is involved in the alternative splicing of mRNA transcripts from diverse origins. At the molecular level, we identified the phosphatase PP1 to be recruited to the spliceosome via the N-terminus of CD2BP2. Given the strong expression of CD2BP2 in podocytes of the kidney, we use selective depletion of CD2BP2, in combination with next-generation sequencing, to monitor changes in exon usage of genes critical for podocyte functions, including VEGF and actin regulators. CD2BP2-depleted podocytes display foot process effacement, and cause proteinuria and ultimately lethal kidney failure in mice. Collectively, our study defines CD2BP2 as a non-redundant splicing factor essential for embryonic development and podocyte integrity.

  18. Differential Spatial Expression and Subcellular Localization of CtBP Family Members in Rodent Brain

    PubMed Central

    Richter, Karin; Lazarevic, Vesna; Altrock, Wilko D.; Fischer, Klaus-Dieter; Gundelfinger, Eckart D.; Fejtova, Anna

    2012-01-01

    C-terminal binding proteins (CtBPs) are well-characterized nuclear transcriptional co-regulators. In addition, cytoplasmic functions were discovered for these ubiquitously expressed proteins. These include the involvement of the isoform CtBP1-S/BARS50 in cellular membrane-trafficking processes and a role of the isoform RIBEYE as molecular scaffolds in ribbons, the presynaptic specializations of sensory synapses. CtBPs were suggested to regulate neuronal differentiation and they were implied in the control of gene expression during epileptogenesis. However, the expression patterns of CtBP family members in specific brain areas and their subcellular localizations in neurons in situ are largely unknown. Here, we performed comprehensive assessment of the expression of CtBP1 and CtBP2 in mouse brain at the microscopic and the ultra-structural levels using specific antibodies. We quantified and compared expression levels of both CtBPs in biochemically isolated brain fractions containing cellular nuclei or synaptic compartment. Our study demonstrates differential regional and subcellular expression patterns for the two CtBP family members in brain and reveals a previously unknown synaptic localization for CtBP2 in particular brain regions. Finally, we propose a mechanism of differential synapto-nuclear targeting of its splice variants CtBP2-S and CtBP2-L in neurons. PMID:22745816

  19. Differential spatial expression and subcellular localization of CtBP family members in rodent brain.

    PubMed

    Hübler, Diana; Rankovic, Marija; Richter, Karin; Lazarevic, Vesna; Altrock, Wilko D; Fischer, Klaus-Dieter; Gundelfinger, Eckart D; Fejtova, Anna

    2012-01-01

    C-terminal binding proteins (CtBPs) are well-characterized nuclear transcriptional co-regulators. In addition, cytoplasmic functions were discovered for these ubiquitously expressed proteins. These include the involvement of the isoform CtBP1-S/BARS50 in cellular membrane-trafficking processes and a role of the isoform RIBEYE as molecular scaffolds in ribbons, the presynaptic specializations of sensory synapses. CtBPs were suggested to regulate neuronal differentiation and they were implied in the control of gene expression during epileptogenesis. However, the expression patterns of CtBP family members in specific brain areas and their subcellular localizations in neurons in situ are largely unknown. Here, we performed comprehensive assessment of the expression of CtBP1 and CtBP2 in mouse brain at the microscopic and the ultra-structural levels using specific antibodies. We quantified and compared expression levels of both CtBPs in biochemically isolated brain fractions containing cellular nuclei or synaptic compartment. Our study demonstrates differential regional and subcellular expression patterns for the two CtBP family members in brain and reveals a previously unknown synaptic localization for CtBP2 in particular brain regions. Finally, we propose a mechanism of differential synapto-nuclear targeting of its splice variants CtBP2-S and CtBP2-L in neurons.

  20. Overexpressed CacyBP/SIP leads to the suppression of growth in renal cell carcinoma

    SciTech Connect

    Sun, Shiren; Ning, Xiaoxuan; Liu, Jie; Liu, Lili; Chen, Yu; Han, Shuang; Zhang, Yanqi; Liang, Jie; Wu, Kaichun; Fan, Daiming . E-mail: fandaim@fmmu.edu.cn

    2007-05-18

    Calcyclin-binding protein/Siah-1-interacting protein (CacyBP/SIP), a target protein of S100, has been identified as a component of a novel ubiquitinylation complex leading to {beta}-catenin degradation, which was found to be related to the malignant phenotypes of gastric cancer. However, the roles of CacyBP/SIP in renal cell carcinoma still remain unclear. In the present study, we had analyzed the expression of the CacyBP/SIP protein in human renal cancer cells and clinical tissue samples. The possible roles of CacyBP/SIP in regulating the malignant phenotype of renal cancer cells were also investigated. The results demonstrated that the expression of CacyBP/SIP was markedly down-regulated in renal cell carcinoma tissues and cell lines. Ectopic overexpression of CacyBP/SIP in A498 cells inhibited the proliferation of this cell and delayed cell cycle progression significantly, which might be related to the down-regulation of Cyclin D1 through reducing {beta}-catenin protein. CacyBP/SIP also suppressed colony formation in soft agar and its tumorigenicity in nude mice. Taken together, our work showed that CacyBP/SIP, as a novel down-regulated gene in renal cell carcinoma, suppressed proliferation and tumorigenesis of renal cancer cells.

  1. Spectroscopic observations of ASASSN-15bp

    NASA Astrophysics Data System (ADS)

    Williams, S. C.; Darnley, M. J.; Bode, M. F.; Copperwheat, C. M.

    2015-01-01

    We report spectroscopic observations of the optical transient ASASSN-15bp (ATel #6981) taken on 2015 January 25.31 UT using the FRODOSpec spectrograph (Barnsley et al. 2012) on the Liverpool Telescope (Steele et al. 2004).

  2. BP: synthesis and properties of boron phosphide

    NASA Astrophysics Data System (ADS)

    Woo, Katherine; Lee, Kathleen; Kovnir, Kirill

    2016-07-01

    Cubic boron phosphide, BP, is notorious for its difficult synthesis, thus preventing it from being a widely used material in spite of having numerous favorable technological properties. In the current work, three different methods of synthesis are developed and compared: from the high temperature reaction of elements, Sn flux assisted synthesis, and a solid state metathesis reaction. Structural and optical properties of the products synthesized from the three methods were thoroughly characterized. Solid state metathesis is shown to be the cleanest and most efficient method in terms of reaction temperature and time. Synthesis by Sn flux resulted in a novel Sn-doped BP compound. Undoped BP samples exhibit an optical bandgap of ∼2.2 eV while Sn-doped BP exhibits a significantly smaller bandgap of 1.74 eV. All synthesized samples show high stability in concentrated hydrochloric acid, saturated sodium hydroxide solutions, and fresh aqua regia.

  3. Reaching Grid Parity Using BP Solar Crystalline Silicon Technology: A Systems Class Application

    SciTech Connect

    Cunningham, Daniel W; Wohlgemuth, John; Carlson, David E; Clark, Roger F; Gleaton, Mark; Posbic, John P; Zahler, James

    2010-12-06

    The primary target market for this program was the residential and commercial PV markets, drawing on BP Solar's premium product and service offerings, brand and marketing strength, and unique routes to market. These two markets were chosen because: (1) in 2005 they represented more than 50% of the overall US PV market; (2) they are the two markets that will likely meet grid parity first; and (3) they are the two market segments in which product development can lead to the added value necessary to generate market growth before reaching grid parity. Federal investment in this program resulted in substantial progress toward the DOE TPP target, providing significant advancements in the following areas: (1) Lower component costs particularly the modules and inverters. (2) Increased availability and lower cost of silicon feedstock. (3) Product specifically developed for residential and commercial applications. (4) Reducing the cost of installation through optimization of the products. (5) Increased value of electricity in mid-term to drive volume increases, via the green grid technology. (6) Large scale manufacture of PV products in the US, generating increased US employment in manufacturing and installation. To achieve these goals BP Solar assembled a team that included suppliers of critical materials, automated equipment developers/manufacturers, inverter and other BOS manufacturers, a utility company, and University research groups. The program addressed all aspects of the crystalline silicon PV business from raw materials (particularly silicon feedstock) through installation of the system on the customers site. By involving the material and equipment vendors, we ensured that supplies of silicon feedstock and other PV specific materials like encapsulation materials (EVA and cover glass) will be available in the quantities required to meet the DOE goals of 5 to 10 GW of installed US PV by 2015 and at the prices necessary for PV systems to reach grid parity in 2015

  4. Translation control during prolonged mTORC1 inhibition mediated by 4E-BP3

    PubMed Central

    Tsukumo, Yoshinori; Alain, Tommy; Fonseca, Bruno D.; Nadon, Robert; Sonenberg, Nahum

    2016-01-01

    Targeting mTORC1 is a highly promising strategy in cancer therapy. Suppression of mTORC1 activity leads to rapid dephosphorylation of eIF4E-binding proteins (4E-BP1–3) and subsequent inhibition of mRNA translation. However, how the different 4E-BPs affect translation during prolonged use of mTOR inhibitors is not known. Here we show that the expression of 4E-BP3, but not that of 4E-BP1 or 4E-BP2, is transcriptionally induced during prolonged mTORC1 inhibition in vitro and in vivo. Mechanistically, our data reveal that 4E-BP3 expression is controlled by the transcription factor TFE3 through a cis-regulatory element in the EIF4EBP3 gene promoter. CRISPR/Cas9-mediated EIF4EBP3 gene disruption in human cancer cells mitigated the inhibition of translation and proliferation caused by prolonged treatment with mTOR inhibitors. Our findings show that 4E-BP3 is an important effector of mTORC1 and a robust predictive biomarker of therapeutic response to prolonged treatment with mTOR-targeting drugs in cancer. PMID:27319316

  5. Lysine methylation-dependent binding of 53BP1 to the pRb tumor suppressor.

    PubMed

    Carr, Simon M; Munro, Shonagh; Zalmas, Lykourgos-Panagiotis; Fedorov, Oleg; Johansson, Catrine; Krojer, Tobias; Sagum, Cari A; Bedford, Mark T; Oppermann, Udo; La Thangue, Nicholas B

    2014-08-01

    The retinoblastoma tumor suppressor protein pRb is a key regulator of cell cycle progression and mediator of the DNA damage response. Lysine methylation at K810, which occurs within a critical Cdk phosphorylation motif, holds pRb in the hypophosphorylated growth-suppressing state. We show here that methyl K810 is read by the tandem tudor domain containing tumor protein p53 binding protein 1 (53BP1). Structural elucidation of 53BP1 in complex with a methylated K810 pRb peptide emphasized the role of the 53BP1 tandem tudor domain in recognition of the methylated lysine and surrounding residues. Significantly, binding of 53BP1 to methyl K810 occurs on E2 promoter binding factor target genes and allows pRb activity to be effectively integrated with the DNA damage response. Our results widen the repertoire of cellular targets for 53BP1 and suggest a previously unidentified role for 53BP1 in regulating pRb tumor suppressor activity.

  6. Fuel and vehicle technology choices for passenger vehicles in achieving stringent CO2 targets: connections between transportation and other energy sectors.

    PubMed

    Grahn, M; Azar, C; Williander, M I; Anderson, J E; Mueller, S A; Wallington, T J

    2009-05-01

    The regionalized Global Energy Transition (GET-R 6.0) model has been modified to include a detailed description of light-duty vehicle options and used to investigate the potential impact of carbon capture and storage (CCS) and concentrating solar power (CSP) on cost-effective fuel/vehicle technologies in a carbon-constrained world. Total CO2 emissions were constrained to achieve stabilization at 400-550 ppm, by 2100, at lowesttotal system cost The dominantfuel/vehicle technologies varied significantly depending on CO2 constraint future cost of vehicle technologies, and availability of CCS and CSP. For many cases, no one technology dominated on a global scale. CCS provides relatively inexpensive low-CO2 electricity and heatwhich prolongs the use of traditional ICEVs. CSP displaces fossil fuel derived electricity, prolongs the use of traditional ICEVs, and promotes electrification of passenger vehicles. In all cases considered, CCS and CSP availability had a major impact on the lowest cost fuel/vehicle technologies, and alternative fuels are needed in response to expected dwindling oil and natural gas supply potential by the end of the century.

  7. Survey of the bp/tee genes from clinical group A streptococcus isolates in New Zealand - implications for vaccine development.

    PubMed

    Steemson, John D; Moreland, Nicole J; Williamson, Deborah; Morgan, Julie; Carter, Philip E; Proft, Thomas

    2014-12-01

    Group A streptococcus (GAS) is responsible for a wide range of diseases ranging from superficial infections, such as pharyngitis and impetigo, to life-threatening diseases, such as toxic shock syndrome and acute rheumatic fever (ARF). GAS pili are hair-like extensions protruding from the cell surface and consist of highly immunogenic structural proteins: the backbone pilin (BP) and one or two accessory pilins (AP1 and AP2). The protease-resistant BP builds the pilus shaft and has been recognized as the T-antigen, which forms the basis of a major serological typing scheme that is often used as a supplement to M typing. A previous sequence analysis of the bp gene (tee gene) in 39 GAS isolates revealed 15 different bp/tee types. In this study, we sequenced the bp/tee gene from 100 GAS isolates obtained from patients with pharyngitis, ARF or invasive disease in New Zealand. We found 20 new bp/tee alleles and four new bp/tee types/subtypes. No association between bp/tee type and clinical outcome was observed. We confirmed earlier reports that the emm type and tee type are associated strongly, but we also found exceptions, where multiple tee types could be found in certain M/emm type strains, such as M/emm89. We also reported, for the first time, the existence of a chimeric bp/tee allele, which was assigned into a new subclade (bp/tee3.1). A strong sequence conservation of the bp/tee gene was observed within the individual bp/tee types/subtypes (>97 % sequence identity), as well as between historical and contemporary New Zealand and international GAS strains. This temporal and geographical sequence stability provided further evidence for the potential use of the BP/T-antigen as a vaccine target. PMID:25190737

  8. Sleep-time blood pressure: prognostic value and relevance as a therapeutic target for cardiovascular risk reduction.

    PubMed

    Hermida, Ramón C; Ayala, Diana E; Fernández, José R; Mojón, Artemio

    2013-03-01

    showed that the asleep systolic BP mean was the most significant predictor of both total CVD events and major CVD events (a composite of CVD death, myocardial infarction, and stroke). Moreover, when the asleep BP mean was adjusted by the awake mean, only the former was a significant independent predictor of outcome in a Cox proportional-hazard model adjusted for sex, age, diabetes, anemia, and chronic kidney disease. Analyses of changes in ambulatory BP during follow-up revealed 17% reduction in CVD risk for each 5 mm Hg decrease in the asleep systolic BP mean (p < .001), independent of changes in any other clinic or ambulatory BP parameter. The increased event-free survival associated with the progressive reduction in the asleep systolic BP mean during follow-up was significant for subjects with either normal or elevated BP at baseline. The ABPM-derived asleep BP mean was the most significant prognostic marker of CVD morbidity and mortality. Most important, the progressive decrease in asleep BP mean, a novel therapeutic target that requires proper patient evaluation by ABPM and best achieved by ingestion of at least one hypertension medication at bedtime, was the most significant predictor of event-free survival.

  9. Towards achieving Abuja targets: identifying and addressing barriers to access and use of insecticides treated nets among the poorest populations in Kenya

    PubMed Central

    2010-01-01

    towards addressing affordability barriers through providing free ITNs to vulnerable groups, but the success of these interventions depends largely on the degree to which other barriers to access are addressed. Only if additional efforts are directed towards addressing non-financial barriers to access, will high coverage levels be achieved and sustained. PMID:20233413

  10. Target Blood Pressure in Patients with Diabetes: Asian Perspective.

    PubMed

    Park, Sungha; Kario, Kazuomi; Park, Chang Gyu; Huang, Qi Fang; Cheng, Hao Min; Hoshide, Satoshi; Wang, Ji Guang; Chen, Chen Huan

    2016-11-01

    Recently, the Action to Control Cardiovascular Risk in Diabetes (ACCORD) blood pressure (BP) trial enrolled 4733 participants with type 2 diabetes and randomized them to a target systolic blood pressure (SBP) of less than 120 mm Hg or 140 mm Hg. Despite the significant difference in the achieved SBP, there was no significant difference in the incidence of primary outcomes. Based on this evidence, the target SBP for diabetics has been revised in the majority of major guidelines. However, there is a steeper association between SBP and stroke in Asians than other ethnicities, with stroke being the leading cause of cardiovascular mortality. This suggests that target BP in the Asian region should be tailored towards prevention of stroke. In the ACCORD study, the intensive BP treatment was associated with significant reductions in both total stroke and non-fatal stroke. The results from the ACCORD study are supported by a subgroup analysis from the ONgoing Telmisartan Alone and in combination with Ramipril Global Endpoint Trial (ONTARGET) study, which showed that, in diabetic patients, the risk of stroke continues to decrease to a SBP value of 115 mm Hg with no evidence of J curve. As diabetes is highly associated with underlying coronary artery disease, there is a justified concern for adverse effects resulting from too much lowering of BP. In a post hoc analysis of 6400 diabetic subjects enrolled in the International Verapamil SR-Trandolapril (INVEST) study, subjects with SBP of less than 110 mm Hg were associated with a significant increase in all-cause mortality. In the ONTARGET study, at any levels of achieved SBP, diastolic blood pressure (DBP) below 67 mm Hg was associated with increased risk for cardiovascular outcomes. As such, a prudent approach would be to target a SBP of 130-140 mm Hg and DBP of above 60 mm Hg in diabetics with coronary artery disease. In conclusion, hypertension, in association with diabetes, has been found to be significantly correlated

  11. MST's Programmable Power Supplies: Bt Update, Bp Prototype

    NASA Astrophysics Data System (ADS)

    Holly, D. J.; Chapman, B. E.; McCollam, K. J.; Morin, J. C.; Thomas, M. A.

    2013-10-01

    MST's toroidal field programmable power supply (Bt PPS) has now been in operation for several years and has provided important new capabilities. One of the primary goals for the Bt PPS is the partial optimization of inductive current profile control, involving control of the poloidal electric field. The Bt PPS has achieved fluctuation reduction over MST's entire range of Ip. At the largest Ip, the Bt PPS achieves fluctuation reduction with a smaller poloidal electric field than the previous passive system, implying that substantially longer periods of current profile control may be possible. The Bt PPS has also been used to produce Ohmic tokamak plasmas in MST. With an applied toroidal field of 0.135 T, and q(a) > 2, the estimated energy confinement time is roughly consistent with neo-Alcator scaling. Driving q(a) < 2 with larger Ip, the confinement time degrades, but the discharge duration does not terminate prematurely. To fully optimize current profile control and to test MST operational limits, a PPS is also needed for the Bp circuit. Currently in prototype stage, the Bp PPS will feature a number of innovations to increase its flexibility and performance. Isolated charging, control, and monitor systems will eliminate charging relays, reduce coupling between modules, and minimize capacitor heating. Seven-level pulse width modulation will reduce output ripple and switching losses. Solid state shorting bars will eliminate shorting relays and minimize wiring. A balanced switching algorithm will minimize capacitive noise generation. Work supported by U. S. D. o. E.

  12. Identification of a Fragment-like Small Molecule Ligand for the Methyl-lysine Binding Protein, 53BP1

    PubMed Central

    Perfetti, Michael T.; Baughma, Brandi M.; Dickson, Bradley M.; Mu, Yunxiang; Cui, Gaofeng; Mader, Pavel; Dong, Aiping; Norris, Jacqueline L.; Rothbart, Scott B.; Strahl, Brian D.; Brown, Peter J.; Janzen, William P.; Arrowsmith, Cheryl H.; Mer, Georges; McBride, Kevin M.

    2015-01-01

    Improving our understanding of the role of chromatin regulators in the initiation, development, and suppression of cancer and other devastating diseases is critical, as they are integral players in regulating DNA integrity and gene expression. Developing small molecule inhibitors for this target class with cellular activity is a crucial step toward elucidating their specific functions. We specifically targeted the DNA damage response protein, 53BP1, which uses its tandem tudor domain to recognize histone H4 dimethylated on lysine 20 (H4K20me2), a modification induced by double-strand DNA breaks. Through a cross-screening approach we identified UNC2170 (1) as a micromolar ligand of 53BP1, which demonstrates at least 17-fold selectivity for 53BP1 as compared to other methyl-lysine (Kme) binding proteins tested. Structural studies revealed that the tert-butyl amine of UNC2170 anchors the compound in the methyl-lysine (Kme) binding pocket of 53BP1, making it competitive with endogenous Kme substrates. X-ray crystallography also demonstrated that UNC2170 binds at the interface of two tudor domains of a 53BP1 dimer. Importantly, this compound functions as a 53BP1 antagonist in cellular lysates and shows cellular activity by suppressing class switch recombination, a process which requires a functional 53BP1 tudor domain. These results demonstrate that UNC2170 is a functionally active, fragment-like ligand for 53BP1. PMID:25590533

  13. Systolic BP and Mortality in Older Adults with CKD

    PubMed Central

    Peters, Dawn; Yang, Xiuhai; Petrik, Amanda; Smith, David H.; Johnson, Eric S.; Thorp, Micah L.; Morris, Cynthia; O’Hare, Ann M.

    2015-01-01

    Background and objectives Optimal BP targets for older adults with CKD are unclear. This study sought to determine whether a nonlinear relationship between BP and mortality—as described for the broader CKD population and for older adults in the general population—is present for older adults with CKD. Design, setting, participants, & measurements A cohort of 21,015 adults age 65–105 years with a moderate or severe reduction in eGFR (<60 ml/min per 1.73 m2) were identified within the Kaiser Permanente Northwest Health Maintenance Organization population. The relationship between baseline systolic BP (SBP; ≤120, 121–130, 131–140, 141–150, >150 mmHg; referent, 131–140 mmHg) and all-cause mortality across age groups (65–70, 71–80, and >80 years) was examined; patients were followed for up to 11 years after cohort entry. Results The median times at risk were 3.15 years, 3.53 years, and 2.76 years for adults age 65–70, 71–80, and >80 years, respectively. Mortality during follow-up was 19.6% for those age 65–70 years, 33.4% for those age 71–80 years, and 55.7% for those age >80 years. The relationship between SBP and mortality varied as a function of age. The risk of death was highest for patients with the lowest SBP in all age groups. Only among adults age 65–70 years was an SBP>140 mmHg associated with a higher risk of death compared with the referent category. Patterns of age modification of the relationship between SBP and mortality were consistent in all sensitivity analyses. Conclusions In a cohort of older adults, the relationship between SBP and mortality varied systematically with age. A relationship between higher SBP and mortality was present only for younger members of this cohort and not for those older than 70. These results raise the question of whether the relative benefits and harms of lowering BP to recommended targets for older adults with CKD may vary as a function of age. PMID:26276142

  14. RanBP9 at the intersection between cofilin and Aβ pathologies: rescue of neurodegenerative changes by RanBP9 reduction

    PubMed Central

    Woo, J A; Boggess, T; Uhlar, C; Wang, X; Khan, H; Cappos, G; Joly-Amado, A; De Narvaez, E; Majid, S; Minamide, L S; Bamburg, J R; Morgan, D; Weeber, E; Kang, D E

    2015-01-01

    Molecular pathways underlying the neurotoxicity and production of amyloid β protein (Aβ) represent potentially promising therapeutic targets for Alzheimer's disease (AD). We recently found that overexpression of the scaffolding protein RanBP9 increases Aβ production in cell lines and in transgenic mice while promoting cofilin activation and mitochondrial dysfunction. Translocation of cofilin to mitochondria and induction of cofilin–actin pathology require the activation/dephosphorylation of cofilin by Slingshot homolog 1 (SSH1) and cysteine oxidation of cofilin. In this study, we found that endogenous RanBP9 positively regulates SSH1 levels and mediates Aβ-induced translocation of cofilin to mitochondria and induction of cofilin–actin pathology in cultured cells, primary neurons, and in vivo. Endogenous level of RanBP9 was also required for Aβ-induced collapse of growth cones in immature neurons (days in vitro 9 (DIV9)) and depletion of synaptic proteins in mature neurons (DIV21). In vivo, amyloid precursor protein (APP)/presenilin-1 (PS1) mice exhibited 3.5-fold increased RanBP9 levels, and RanBP9 reduction protected against cofilin–actin pathology, synaptic damage, gliosis, and Aβ accumulation associated with APP/PS1 mice. Brains slices derived from APP/PS1 mice showed significantly impaired long-term potentiation (LTP), and RanBP9 reduction significantly enhanced paired pulse facilitation and LTP, as well as partially rescued contextual memory deficits associated with APP/PS1 mice. Therefore, these results underscore the critical importance of endogenous RanBP9 not only in Aβ accumulation but also in mediating the neurotoxic actions of Aβ at the level of synaptic plasticity, mitochondria, and cofilin–actin pathology via control of the SSH1-cofilin pathway in vivo. PMID:25741591

  15. "Kill" the messenger: Targeting of cell-derived microparticles in lupus nephritis.

    PubMed

    Nielsen, Christoffer T; Rasmussen, Niclas S; Heegaard, Niels H H; Jacobsen, Søren

    2016-07-01

    Immune complex (IC) deposition in the glomerular basement membrane (GBM) is a key early pathogenic event in lupus nephritis (LN). The clarification of the mechanisms behind IC deposition will enable targeted therapy in the future. Circulating cell-derived microparticles (MPs) have been proposed as major sources of extracellular autoantigens and ICs and triggers of autoimmunity in LN. The overabundance of galectin-3-binding protein (G3BP) along with immunoglobulins and a few other proteins specifically distinguish circulating MPs in patients with systemic lupus erythematosus (SLE), and this is most pronounced in patients with active LN. G3BP co-localizes with deposited ICs in renal biopsies from LN patients supporting a significant presence of MPs in the IC deposits. G3BP binds strongly to glomerular basement membrane proteins and integrins. Accordingly, MP surface proteins, especially G3BP, may be essential for the deposition of ICs in kidneys and thus for the ensuing formation of MP-derived electron dense structures in the GBM, and immune activation in LN. This review focuses on the notion of targeting surface molecules on MPs as an entirely novel treatment strategy in LN. By targeting MPs, a double hit may be achieved by attenuating both the autoantigenic fueling of immune complexes and the triggering of the adaptive immune system. Thereby, early pathogenic events may be blocked in contrast to current treatment strategies that primarily target and modulate later events in the cellular and humoral immune response.

  16. Characterization of a cancer cell line that expresses a splicing variant form of 53BP1: Separation of checkpoint and repair functions in 53BP1

    SciTech Connect

    Iwabuchi, Kuniyoshi Matsui, Tadashi; Hashimoto, Mitsumasa; Matsumoto, Yoshihisa; Kurihara, Takayuki; Date, Takayasu

    2008-11-21

    53BP1 plays important roles in checkpoint signaling and repair for DNA double-strand breaks. We found that a colon cancer cell line, SW48, expressed a splicing variant form of 53BP1, which lacks the residues corresponding to exons 10 and 11. Activation of ATM and phosphorylation of ATM and ATR targets occurred in SW48 cells in response to X-irradiation, and these X-ray-induced responses were not enhanced by expression of full-length 53BP1 in SW48 cells, indicating that this splicing variant fully activates the major checkpoint signaling in SW48 cells. In contrast, the expression of full-length 53BP1 in SW48 cells promoted the repair of X-ray-induced DNA damage, evidenced by faster disappearance of X-ray-induced {gamma}-H2AX foci, a marker for DNA damage, and less residual chromosomal aberrations after X-irradiation. We conclude that the two major roles of 53BP1, the checkpoint signaling and repair for DNA damage, can be functionally separated.

  17. NiCoBP-doped carbon nanotube hybrid: a novel oxidase mimetic system for highly efficient electrochemical immunoassay.

    PubMed

    Zhang, Bing; He, Yu; Liu, Bingqian; Tang, Dianping

    2014-12-01

    NiCoBP-doped multi-walled carbon nanotube (NiCoBP-MWCNT) was first synthesized by using induced electroless-plating method and functionalized with the biomolecules for highly efficient electrochemical immunoassay of prostate-specific antigen (PSA, used as a model analyte). We discovered that the as-synthesized NiCoBP-MWCNT had the ability to catalyze the glucose oxidization with a stable and well-defined redox peak. The catalytic current increased with the increment of the immobilized NiCoBP-MWCNT on the electrode. Transmission electron microscope (TEM) and energy dispersive X-ray spectrometry (EDX) were employed to characterize the as-prepared NiCoBP-MWCNT. Using the NiCoBP-MWCNT-conjugated anti-PSA antibody as the signal-transduction tag, a new enzyme-free electrochemical immunoassay protocol could be designed for the detection of target PSA on the capture antibody-functionalized immunosensing interface. Experimental results revealed that the designed immunoassay system could exhibit good electrochemical responses toward target PSA, and allowed the detection of PSA at a concentration as low as 0.035ngmL(-1). More importantly, the NiCoBP-MWCNT-based oxidase mimetic system could be further extended for the monitoring of other low-abundance proteins or disease-related biomarkers by tuning the target antibody.

  18. Benzo[a]pyrene (BP) DNA adduct formation in DNA repair–deficient p53 haploinsufficient [Xpa(−/−)p53(+/−)] and wild-type mice fed BP and BP plus chlorophyllin for 28 days

    PubMed Central

    Poirier, Miriam C.

    2012-01-01

    We have evaluated DNA damage (DNA adduct formation) after feeding benzo[a]pyrene (BP) to wild-type (WT) and cancer-susceptible Xpa(−/−)p53(+/−) mice deficient in nucleotide excision repair and haploinsufficient for the tumor suppressor p53. DNA damage was evaluated by high-performance liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC/ES-MS/MS), which measures r7,t8,t9-trihydroxy-c-10-(N 2-deoxyguanosyl)-7,8,9,10-tetrahydrobenzo[a]pyrene (BPdG), and a chemiluminescence immunoassay (CIA), using anti-r7,t8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE)–DNA antiserum, which measures both BPdG and the other stable BP-DNA adducts. When mice were fed 100 ppm BP for 28 days, BP-induced DNA damage measured in esophagus, liver and lung was typically higher in Xpa(−/−)p53(+/−) mice, compared with WT mice. This result is consistent with the previously observed tumor susceptibility of Xpa(−/−)p53(+/−) mice. BPdG, the major DNA adduct associated with tumorigenicity, was the primary DNA adduct formed in esophagus (a target tissue in the mouse), whereas total BP-DNA adducts predominated in higher levels in the liver (a non-target tissue in the mouse). In an attempt to lower BP-induced DNA damage, we fed the WT and Xpa(−/−)p53(+/−) mice 0.3% chlorophyllin (CHL) in the BP-containing diet for 28 days. The addition of CHL resulted in an increase of BP–DNA adducts in esophagus, liver and lung of WT mice, a lowering of BPdG in esophagi of WT mice and livers of Xpa(−/−)p53(+/−) mice and an increase of BPdG in livers of WT mice. Therefore, the addition of CHL to a BP-containing diet showed a lack of consistent chemoprotective effect, indicating that oral CHL administration may not reduce PAH–DNA adduct levels consistently in human organs. PMID:22828138

  19. DB 01-3 TREATMENT TARGET OF SYSTOLIC BLOOD PRESSURE IN DIABETES MAY DIFFER ACCORDING TO ETHNICITY (PRO).

    PubMed

    Kario, Kazuomi

    2016-09-01

    Asians have specific characteristics of hypertension and related cardiovascular disease. Stroke is more common than coronary artery disease in Eastern Asian countries, while the coronary artery disease is more common than stroke in Western countries. The association slope between higher blood pressure (BP) and the risk of cardiovascular events is steeper in Asians than in Caucasians. This may partly explained by the recent result demonstrating that the morning BP surge in Asians is more extended (Hoshide, Kario, Parati et al. Hypertension 2016;68:54-61). Thus, 24-hr BP control including night-time and morning periods is especially important for Asian hypertensive patients (Kario. Essential manual of 24 hour blood pressure management. Wiley, UK, pp.1-158.2016).The existing direct evidence from Asian studies are limited than the accumulated evidence from Western countries. In the ACCORD BP trial which enrolled 4733 participants with type 2 diabetes and randomized them to a target systolic BP <120mmHg (intensive BP control) or <140mmHg (standard BP control). Despite the significant difference in the achieved systolic BP, there was no significant difference in the incidence of primary cardiovascular outcomes. Based on this evidence, the target systolic BP for diabetics has been revised from 130 mmHg to 140 mmHg in the majority of Western guidelines. However, in the ACCORD study, the intensive BP control was associated with significant reduction in both total stroke and nonfatal stroke. In addition, the ONTARGET study, which showed that in diabetic patients, the risk of stroke continued to decrease down to achieved SBP <115mmHg with no evidence of J curve.The new guidelines of the Japanese Society of Hypertension regarding the management of hypertension (JSH2014) were published in 2014 (Hypertens Res 2014;37:253-390). The JSH2014 guidelines use the systolic BP value 130 mmHg, a lower target clinic BP compared to the Western guidelines (140 mmHg), for hypertensive

  20. RanBP3 Regulates Melanoma Cell Proliferation via Selective Control of Nuclear Export.

    PubMed

    Pathria, Gaurav; Garg, Bhavuk; Wagner, Christine; Garg, Kanika; Gschaider, Melanie; Jalili, Ahmad; Wagner, Stephan N

    2016-01-01

    Chromosome region maintenance 1-mediated nucleocytoplasmic transport has been shown as a potential anticancer target in various malignancies. However, the role of the most characterized chromosome region maintenance 1 cofactor ran binding protein 3 (RanBP3) in cancer cell biology has never been investigated. Utilizing a loss-of-function experimental setting in a vast collection of genetically varied melanoma cell lines, we observed the requirement of RanBP3 in melanoma cell proliferation and survival. Mechanistically, we suggest the reinstatement of transforming growth factor-β (TGF-β)-Smad2/3-p21(Cip1) tumor-suppressor axis as part of the RanBP3 silencing-associated antiproliferative program. Employing extensive nuclear export sequence analyses and immunofluorescence-based protein localization studies, we further present evidence suggesting the requirement of RanBP3 function for the nuclear exit of the weak nuclear export sequence-harboring extracellular signal-regulated kinase protein, although it is dispensable for general CRM1-mediated nuclear export of strong nuclear export sequence-harboring cargoes. Rendering mechanistic support to RanBP3 silencing-mediated apoptosis, consequent to extracellular signal-regulated kinase nuclear entrapment, we observed increased levels of cytoplasmically restricted nonphosphorylated/active proapoptotic Bcl-2-antagonist of cell death (BAD) protein. Last, we present evidence suggesting the frequently activated mitogen-activated protein kinase signaling in melanoma as a potential founding basis for a deregulated post-translational control of RanBP3 activity. Collectively, the presented data suggest RanBP3 as a potential target for therapeutic intervention in human melanoma.

  1. Systems genetics identifies Hp1bp3 as a novel modulator of cognitive aging.

    PubMed

    Neuner, Sarah M; Garfinkel, Benjamin P; Wilmott, Lynda A; Ignatowska-Jankowska, Bogna M; Citri, Ami; Orly, Joseph; Lu, Lu; Overall, Rupert W; Mulligan, Megan K; Kempermann, Gerd; Williams, Robert W; O'Connell, Kristen M S; Kaczorowski, Catherine C

    2016-10-01

    An individual's genetic makeup plays an important role in determining susceptibility to cognitive aging. Identifying the specific genes that contribute to cognitive aging may aid in early diagnosis of at-risk patients, as well as identify novel therapeutics targets to treat or prevent development of symptoms. Challenges to identifying these specific genes in human studies include complex genetics, difficulty in controlling environmental factors, and limited access to human brain tissue. Here, we identify Hp1bp3 as a novel modulator of cognitive aging using a genetically diverse population of mice and confirm that HP1BP3 protein levels are significantly reduced in the hippocampi of cognitively impaired elderly humans relative to cognitively intact controls. Deletion of functional Hp1bp3 in mice recapitulates memory deficits characteristic of aged impaired mice and humans, further supporting the idea that Hp1bp3 and associated molecular networks are modulators of cognitive aging. Overall, our results suggest Hp1bp3 may serve as a potential target against cognitive aging and demonstrate the utility of genetically diverse animal models for the study of complex human disease. PMID:27460150

  2. Systems genetics identifies Hp1bp3 as a novel modulator of cognitive aging.

    PubMed

    Neuner, Sarah M; Garfinkel, Benjamin P; Wilmott, Lynda A; Ignatowska-Jankowska, Bogna M; Citri, Ami; Orly, Joseph; Lu, Lu; Overall, Rupert W; Mulligan, Megan K; Kempermann, Gerd; Williams, Robert W; O'Connell, Kristen M S; Kaczorowski, Catherine C

    2016-10-01

    An individual's genetic makeup plays an important role in determining susceptibility to cognitive aging. Identifying the specific genes that contribute to cognitive aging may aid in early diagnosis of at-risk patients, as well as identify novel therapeutics targets to treat or prevent development of symptoms. Challenges to identifying these specific genes in human studies include complex genetics, difficulty in controlling environmental factors, and limited access to human brain tissue. Here, we identify Hp1bp3 as a novel modulator of cognitive aging using a genetically diverse population of mice and confirm that HP1BP3 protein levels are significantly reduced in the hippocampi of cognitively impaired elderly humans relative to cognitively intact controls. Deletion of functional Hp1bp3 in mice recapitulates memory deficits characteristic of aged impaired mice and humans, further supporting the idea that Hp1bp3 and associated molecular networks are modulators of cognitive aging. Overall, our results suggest Hp1bp3 may serve as a potential target against cognitive aging and demonstrate the utility of genetically diverse animal models for the study of complex human disease.

  3. Arginine methylation of G3BP1 in response to Wnt3a regulates β-catenin mRNA

    PubMed Central

    Bikkavilli, Rama Kamesh; Malbon, Craig C.

    2011-01-01

    Wnt/β-catenin signaling is essential for normal mammalian development. Wnt3a activates the Wnt/β-catenin pathway through stabilization of β-catenin; a process in which the phosphoprotein Dishevelled figures prominently. Protein arginine methylation in signaling complexes containing Dishevelled was investigated. Mass spectrometry of a prominent arginine-methylated, Dishevelled-associated protein identified the Ras GTPase activating protein-binding protein 1 G3BP1. Stimulation of totipotent mouse embryonic F9 cells with Wnt3a provoked increased methylation of G3BP1. We show that G3BP1 is a novel Ctnnb1 mRNA binding protein. Methylation of G3BP1 constitutes a molecular switch that regulates Ctnnb1 mRNA in response to Wnt3a. Thus, the protein arginine methylation that targets G3BP1 acts as a novel regulator of Ctnnb1 mRNA. PMID:21652632

  4. Asiago spectroscopic classification of ASASSN-16bp

    NASA Astrophysics Data System (ADS)

    Tomasella, L.; Pastorello, A.; Benetti, S.; Cappellaro, E.; Elias-Rosa, N.; Ochner, P.; Tartaglia, L.; Terreran, G.; Turatto, M.

    2016-02-01

    The Asiago Transient Classification Program (Tomasella et al. 2014, AN, 335, 841) reports the spectroscopic classification of ASASSN-16bp ( = AT 2016adq), discovered by All Sky Automated Survey for SuperNovae ASAS-SN (see Shappee et al. 2014, ApJ, 788, 48 and http://www.astronomy.ohio-state.edu/~assassin/index.shtml ), in CGCG 336-041 (Atel #8666) The observation was performed with the Asiago 1.82 m Copernico Telescope (+AFOSC; range 340-820 nm; resolution 1.4 nm). Name | Discovery UT | Obs. Date UT |z | Type | Phase |Notes ASASSN-16bp | 20160209.61 | 20160211.11 |0.034194 | Ia | ~10d | (1) (1) Also known as SN2016adq in CGCG 336-041 (z=0.034194, d=145 Mpc, via NED).

  5. PEP-1-FK506BP inhibits alkali burn-induced corneal inflammation on the rat model of corneal alkali injury

    PubMed Central

    Kim, Dae Won; Lee, Sung Ho; Shin, Min Jea; Kim, Kibom; Ku, Sae Kwang; Youn, Jong Kyu; Cho, Su Bin; Park, Jung Hwan; Lee, Chi Hern; Son, Ora; Sohn, Eun Jeong; Cho, Sung-Woo; Park, Jong Hoon; Kim, Hyun Ah; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

    2015-01-01

    FK506 binding protein 12 (FK506BP) is a small peptide with a single FK506BP domain that is involved in suppression of immune response and reactive oxygen species. FK506BP has emerged as a potential drug target for several inflammatory diseases. Here, we examined the protective effects of directly applied cell permeable FK506BP (PEP-1-FK506BP) on corneal alkali burn injury (CAI). In the cornea, there was a significant decrease in the number of cells expressing pro-inflammation, apoptotic, and angiogenic factors such as TNF-α, COX-2, and VEGF. Both corneal opacity and corneal neovascularization (CNV) were significantly decreased in the PEP-1-FK506BP treated group. Our results showed that PEP-1-FK506BP can significantly inhibit alkali burn-induced corneal inflammation in rats, possibly by accelerating corneal wound healing and by reducing the production of angiogenic factors and inflammatory cytokines. These results suggest that PEP-1-FK506BP may be a potential therapeutic agent for CAI. [BMB Reports 2015; 48(11): 618-623] PMID:25817214

  6. Pivotal role of the RanBP9-cofilin pathway in Aβ-induced apoptosis and neurodegeneration

    PubMed Central

    Woo, J A; Jung, A R; Lakshmana, M K; Bedrossian, A; Lim, Y; Bu, J H; Park, S A; Koo, E H; Mook-Jung, I; Kang, D E

    2012-01-01

    Neurodegeneration associated with amyloid β (Aβ) peptide accumulation, synaptic loss, neuroinflammation, tauopathy, and memory impairments encompass the pathophysiological features of Alzheimer's disease (AD). We previously reported that the scaffolding protein RanBP9, which is overall increased in brains of AD patients, simultaneously promotes Aβ generation and focal adhesion disruption by accelerating the endocytosis of amyloid precursor protein (APP) and β1-integrin, respectively. Here, we show that RanBP9 protein levels are increased by fourfold in FAD mutant APP transgenic mice. Accordingly, RanBP9 transgenic mice demonstrate significantly increased synapse loss, neurodegeneration, gliosis, and spatial memory deficits. RanBP9 overexpression promotes apoptosis and potentiates Aβ-induced neurotoxicity independent of its capacity to promote Aβ generation. Conversely, RanBP9 reduction by siRNA or gene dosage mitigates Aβ-induced neurotoxicity. Importantly, RanBP9 activates/dephosphorylates cofilin, a key regulator of actin dynamics and mitochondria-mediated apoptosis, and siRNA knockdown of cofilin abolishes both Aβ and RanBP9-induced apoptosis. These findings implicate the RanBP9–cofilin pathway as critical therapeutic targets not only for stemming Aβ generation but also antagonizing Aβ-induced neurotoxicity. PMID:22361682

  7. [EFFICACY OF STANDARD TWO-YEAR COMPREHENSIVE THERAPY TO ACHIEVE TARGET BLOOD PRESSURE AND REGRESSION DEGREES OF REMODELING OF THE LEFT VENTRICULAR HYPERTROPHY IN PATIENTS AFTER ACUTE MYOCARDIAL INFARCTION WITH COMORBID HYPERTENSION].

    PubMed

    Denesiuk, E V

    2015-01-01

    The study involved 23 men after acute myocardial infarction (AMI) with comorbid arterial hypertension (AH). Mean age of patients was 56.7 years. Recurrent myocardial infarction was determined in 38.4%, cardiac failure I-III functional classes--100% of the cases. All patients underwent clinical examination, electrocardiography and echocardiography, blood lipid profile. Standard comprehensive treatment for two years included an perindopril 5-10 mg/day, beta-blocker bisoprolol--5-10 mg/day, antisclerotic drug atorvastatin--20 mg/day and aspirin--75 mg/day. The patients after treatment was determined by a gradual increase towards the target of AT at 3, 6 and 12 to 24 months. Concentric left ventricular hypertrophy (LVH) before treatment was determined in 47.8%, eccentric--in 52.2% of patients. In the study of degrees of LVH I (initial) the extent to treatment was determined by 4.3%, II (moderate)--26.1%, III (large)--at 69.6%, indicating the development of cardiac remodeling. After the treatment was determined by marked reduction III (large) degree and transfer it in the II (moderate) and I (small) degree of left ventricular hypertrophy due to more or less pronounced changes remodeling left ventricular. The obtained data allow a more detailed and adequately assess the structural and functional outcome variables and determine the regression of myocardial hypertrophy in the background to achieve target blood pressure, which is important in practical cardiology. PMID:27491146

  8. [EFFICACY OF STANDARD TWO-YEAR COMPREHENSIVE THERAPY TO ACHIEVE TARGET BLOOD PRESSURE AND REGRESSION DEGREES OF REMODELING OF THE LEFT VENTRICULAR HYPERTROPHY IN PATIENTS AFTER ACUTE MYOCARDIAL INFARCTION WITH COMORBID HYPERTENSION].

    PubMed

    Denesiuk, E V

    2015-01-01

    The study involved 23 men after acute myocardial infarction (AMI) with comorbid arterial hypertension (AH). Mean age of patients was 56.7 years. Recurrent myocardial infarction was determined in 38.4%, cardiac failure I-III functional classes--100% of the cases. All patients underwent clinical examination, electrocardiography and echocardiography, blood lipid profile. Standard comprehensive treatment for two years included an perindopril 5-10 mg/day, beta-blocker bisoprolol--5-10 mg/day, antisclerotic drug atorvastatin--20 mg/day and aspirin--75 mg/day. The patients after treatment was determined by a gradual increase towards the target of AT at 3, 6 and 12 to 24 months. Concentric left ventricular hypertrophy (LVH) before treatment was determined in 47.8%, eccentric--in 52.2% of patients. In the study of degrees of LVH I (initial) the extent to treatment was determined by 4.3%, II (moderate)--26.1%, III (large)--at 69.6%, indicating the development of cardiac remodeling. After the treatment was determined by marked reduction III (large) degree and transfer it in the II (moderate) and I (small) degree of left ventricular hypertrophy due to more or less pronounced changes remodeling left ventricular. The obtained data allow a more detailed and adequately assess the structural and functional outcome variables and determine the regression of myocardial hypertrophy in the background to achieve target blood pressure, which is important in practical cardiology.

  9. The Stress Granule Protein G3BP1 Recruits Protein Kinase R To Promote Multiple Innate Immune Antiviral Responses

    PubMed Central

    Reineke, Lucas C.

    2014-01-01

    ABSTRACT Stress granules (SGs) are cytoplasmic storage sites containing translationally silenced mRNPs that can be released to resume translation after stress subsides. We previously showed that poliovirus 3C proteinase cleaves the SG-nucleating protein G3BP1, blocking the ability of cells to form SGs late in infection. Many other viruses also target G3BP1 and inhibit SG formation, but the reasons why these functions evolved are unclear. Previously, we also showed a link between G3BP1-induced SGs and protein kinase R (PKR)-mediated translational control, but the mechanism of PKR interplay with SG and the antiviral consequences are unknown. Here, we show that G3BP1 exhibits antiviral activity against several enteroviruses, whereas truncated G3BP1 that cannot form SGs does not. G3BP1-induced SGs are linked to activation of innate immune transcriptional responses through NF-κB and JNK. The G3BP1-induced SGs also recruit PKR and other antiviral proteins. We show that the PXXP domain within G3BP1 is essential for the recruitment of PKR to SGs, for eIF2α phosphorylation driven by PKR, and for nucleating SGs of normal composition. We also show that deletion of the PXXP domain in G3BP1 compromises its antiviral activity. These findings tie PKR activation to its recruitment to SGs by G3BP1 and indicate that G3BP1 promotes innate immune responses at both the transcriptional and translational levels and integrates cellular stress responses and innate immunity. IMPORTANCE Stress granules appear during virus infection, and their importance is not well understood. Previously, it was assumed that they were nonfunctional artifacts associated with cellular stress. PKR is a well-known antiviral protein; however, its regulation in cells is not well understood. Our work links cellular stress granules with activation of PKR and other innate immune pathways through the activity of G3BP1, a critical stress granule component. The ability of stress granules and G3BP1 to activate PKR and

  10. Nephrotoxicity of selectively deuterated and methylated analogues of Tris-BP and Bis-BP in the rat.

    PubMed

    Søderlund, E J; Omichinski, J G; Dahl, J E; Nelson, S D; Dybing, E

    1988-03-01

    Selectively deuterated and methylated analogues of the flame retardant tris(2,3-dibromopropyl)phosphate (Tris-BP) and its nephrotoxic metabolite bis(2,3-dibromopropyl)phosphate (Bis-BP) were compared to Tris-BP and Bis-BP in inducing acute renal damage in rats. None of the deuterated Tris-BP or Bis-BP analogues significantly altered morphological evidence of nephrotoxicity compared to the protio compounds. On the other hand, some of the selectively methylated analogues were much less nephrotoxic. Although the C1-methyl analogues of both Tris-BP and Bis-BP were as potent nephrotoxicants as Tris-BP and Bis-BP, respectively, neither the C2-methyl nor the C3-methyl analogues were significantly nephrotoxic. Interestingly, whereas the 3,4-dibromobutyl homologue of Tris-BP was not nephrotoxic, the corresponding 3,4-dibromobutyl-Bis homologue was as nephrotoxic as Bis-BP. Additional investigations with treatments that are known to decrease nephrotoxicity caused by several halogenated alkenes, showed that L-(alpha S,5S)-alpha-amino-3-chloro-4,5-dihydro-5-isoxazoleacetic acid (AT-125) and aminooxyacetic acid were without effects on Tris-BP induced renal damage. Probenecid pretreatment led to a reduction in Tris-BP and Bis-BP tubular necrosis, these effects may be related to inhibition of Bis-BP uptake in the kidney. It appears that the cysteine conjugate beta-lyase pathway is not involved in the generation of nephrotoxic metabolites of Tris-BP. PMID:3375186

  11. Study on adaptive BTT reentry speed depletion guidance law based on BP neural network

    NASA Astrophysics Data System (ADS)

    Zheng, Zongzhun; Wang, Yongji; Wu, Hao

    2007-11-01

    Reentry guidance is one of the key technologies in hypersonic vehicle research field. In addition to the constraints on its final position coordinates, the vehicle must also impact the target from a specified direction with high precision. And therefore the adaptability of guidance law is critical to control the velocity of hypersonic vehicle and firing accuracy properly in different surroundings of large airspace. In this paper, a new adaptive guidance strategy based on Back Propagation (BP) neural network for the reentry mission of a generic hypersonic vehicle is presented. Depending on the nicer self-learn ability of BP neural network, the guidance law considers the influence of biggish mis-modeling of aerodynamics, structure error and other initial disturbances on the flight capability of vehicle. Consequently, terminal position accuracy and velocity are guaranteed, while many constraints are satisfied. Numerical simulation results clearly bring out the fact that the proposed reentry guidance law based on BP neural network is rational and effective.

  12. 2014 Eighth Joint National Committee Panel Recommendation for Blood Pressure Targets Revisited

    PubMed Central

    Bangalore, Sripal; Gong, Yan; Cooper-DeHoff, Rhonda M.; Pepine, Carl J.; Messerli, Franz H.

    2014-01-01

    BACKGROUND The 2014 Eighth Joint National Committee panel recommendations for management of high blood pressure (BP) recommend a systolic BP threshold for initiation of drug therapy and a therapeutic target of <150 mm Hg in those ≥60 years of age, a departure from prior recommendations of <140 mm Hg. However, it is not known whether this is an optimal choice, especially for the large population with coronary artery disease (CAD). OBJECTIVES This study sought to evaluate optimal BP in patients ≥60 years of age. METHODS Patients 60 years of age or older with CAD and baseline systolic BP >150 mm Hg randomized to a treatment strategy on the basis of either atenolol/hydrochlorothiazide or verapamil-SR (sustained release)/trandolapril in INVEST (INternational VErapamil SR Trandolapril STudy) were categorized into 3 groups on the basis of achieved on-treatment systolic BP: group 1, <140 mm Hg; group 2, 140 to <150 mm Hg; and group 3, ≥150 mm Hg. Primary outcome was first occurrence of all-cause death, nonfatal myocardial infarction (MI), or nonfatal stroke. Secondary outcomes were all-cause mortality, cardiovascular mortality, total MI, nonfatal MI, total stroke, nonfatal stroke, heart failure, or revascularization, tabulated separately. Outcomes for each group were compared in unadjusted and multiple propensity score–adjusted models. RESULTS Among 8,354 patients included in this analysis with an accumulated 22,308 patient-years of follow-up, 4,787 (57%) achieved systolic BP of <140 mm Hg (group 1), 1,747 (21%) achieved systolic BP of 140 to <150 mm Hg (group 2), and 1,820 (22%) achieved systolic BP of ≥150 mm Hg (group 3). In unadjusted models, group 1 had the lowest rates of the primary outcome (9.36% vs. 12.71% vs. 21.32%; p < 0.0001), all-cause mortality (7.92% vs. 10.07% vs. 16.81%; p < 0.0001), cardiovascular mortality (3.26% vs. 4.58% vs. 7.80%; p < 0.0001), MI (1.07% vs. 1.03% vs. 2.91%; p < 0.0001), total stroke (1.19% vs. 2.63% vs. 3.85%; p <0

  13. HP1BP3 expression determines maternal behavior and offspring survival.

    PubMed

    Garfinkel, B P; Arad, S; Neuner, S M; Netser, S; Wagner, S; Kaczorowski, C C; Rosen, C J; Gal, M; Soreq, H; Orly, J

    2016-09-01

    Maternal care is an indispensable behavioral component necessary for survival and reproductive success in mammals, and postpartum maternal behavior is mediated by an incompletely understood complex interplay of signals including effects of epigenetic regulation. We approached this issue using our recently established mice with targeted deletion of heterochromatin protein 1 binding protein 3 (HP1BP3), which we found to be a novel epigenetic repressor with critical roles in postnatal growth. Here, we report a dramatic reduction in the survival of pups born to Hp1bp3(-/-) deficient mouse dams, which could be rescued by co-fostering with wild-type dams. Hp1bp3(-/-) females failed to retrieve both their own pups and foster pups in a pup retrieval test, and showed reduced anxiety-like behavior in the open-field and elevated-plus-maze tests. In contrast, Hp1bp3(-/-) females showed no deficits in behaviors often associated with impaired maternal care, including social behavior, depression, motor coordination and olfactory capability; and maintained unchanged anxiety-associated hallmarks such as cholinergic status and brain miRNA profiles. Collectively, our results suggest a novel role for HP1BP3 in regulating maternal and anxiety-related behavior in mice and call for exploring ways to manipulate this epigenetic process. PMID:27470444

  14. Subversion of CtBP1-controlled macropinocytosis by human adenovirus serotype 3

    PubMed Central

    Amstutz, Beat; Gastaldelli, Michele; Kälin, Stefan; Imelli, Nicola; Boucke, Karin; Wandeler, Eliane; Mercer, Jason; Hemmi, Silvio; Greber, Urs F

    2008-01-01

    Endocytosis supports cell communication, growth, and pathogen infection. The species B human adenovirus serotype 3 (Ad3) is associated with epidemic conjunctivitis, and fatal respiratory and systemic disease. Here we show that Ad3 uses dynamin-independent endocytosis for rapid infectious entry into epithelial and haematopoietic cells. Unlike Ad5, which uses dynamin-dependent endocytosis, Ad3 endocytosis spatially and temporally coincided with enhanced fluid-phase uptake. It was sensitive to macropinocytosis inhibitors targeting F-actin, protein kinase C, the sodium–proton exchanger, and Rac1 but not Cdc42. Infectious Ad3 macropinocytosis required viral activation of p21-activated kinase 1 (PAK1) and the C-terminal binding protein 1 of E1A (CtBP1), recruited to macropinosomes. These macropinosomes also contained the Ad3 receptors CD46 and αv integrins. CtBP1 is a phosphorylation target of PAK1, and is bifunctionally involved in membrane traffic and transcriptional repression of cell cycle, cancer, and innate immunity pathways. Phosphorylation-defective S147A-CtBP1 blocked Ad3 but not Ad5 infection, providing a direct link between PAK1 and CtBP1. The data show that viruses induce macropinocytosis for infectious entry, a pathway used in antigen presentation and cell migration. PMID:18323776

  15. Solution NMR structure of the Ca2+-bound N-terminal domain of CaBP7: a regulator of golgi trafficking.

    PubMed

    McCue, Hannah V; Patel, Pryank; Herbert, Andrew P; Lian, Lu-Yun; Burgoyne, Robert D; Haynes, Lee P

    2012-11-01

    Calcium-binding protein 7 (CaBP7) is a member of the calmodulin (CaM) superfamily that harbors two high affinity EF-hand motifs and a C-terminal transmembrane domain. CaBP7 has been previously shown to interact with and modulate phosphatidylinositol 4-kinase III-β (PI4KIIIβ) activity in in vitro assays and affects vesicle transport in neurons when overexpressed. Here we show that the N-terminal domain (NTD) of CaBP7 is sufficient to mediate the interaction of CaBP7 with PI4KIIIβ. CaBP7 NTD encompasses the two high affinity Ca(2+) binding sites, and structural characterization through multiangle light scattering, circular dichroism, and NMR reveals unique properties for this domain. CaBP7 NTD binds specifically to Ca(2+) but not Mg(2+) and undergoes significant conformational changes in both secondary and tertiary structure upon Ca(2+) binding. The Ca(2+)-bound form of CaBP7 NTD is monomeric and exhibits an open conformation similar to that of CaM. Ca(2+)-bound CaBP7 NTD has a solvent-exposed hydrophobic surface that is more expansive than observed in CaM or CaBP1. Within this hydrophobic pocket, there is a significant reduction in the number of methionine residues that are conserved in CaM and CaBP1 and shown to be important for target recognition. In CaBP7 NTD, these residues are replaced with isoleucine and leucine residues with branched side chains that are intrinsically more rigid than the flexible methionine side chain. We propose that these differences in surface hydrophobicity, charge, and methionine content may be important in determining highly specific interactions of CaBP7 with target proteins, such as PI4KIIIβ. PMID:22989873

  16. Tackling Targets.

    ERIC Educational Resources Information Center

    Further Education Unit, London (England).

    This document is designed to help British training and enterprise councils (TECs) and further education (FE) colleges develop and implement strategies for achieving the National Targets for Education and Training (NTET), which were developed by the Confederation of British Industry in 1992 and endorsed by the British government. The findings from…

  17. Targets and targeting.

    PubMed

    Will, E

    2001-08-01

    Using the vocabulary of ballistics in medicine for emphasis can result in misleading exaggeration and semantic confusion. The dual meaning of target as either aiming point (aim at) or outcome (aim to achieve) creates a muddle in the efforts to comply with quality assurance initiatives. Disentangling the two meanings allows new approaches to the clinical technology required in a modern health care environment. An example can be shown in new strategies for the management of renal anemia with iron and erythropoietin. The potential to shape outcome distributions through validated, preemptive intervention thresholds offers the predictable results required by patients and payers. Using the management of patient cohorts as a platform for outcomes creates no necessary conflict with individualized clinical care. Future guideline statements should include the likely characteristics of compliant outcome populations, as a prompt to clinical goals and as an indication of the necessary cost and effort of compliance with treatment standards. Overemphasis in language is no substitute for considered clinical methodology.

  18. ME 02-2 BLOOD PRESSURE TARGETS IN CHRONIC KIDNEY DISEASES AFTER THE SPRINT TRIAL.

    PubMed

    Zanchetti, Alberto

    2016-09-01

    The question of BP targets of antihypertensive treatment has been debated in recent guidelines, and reopened by publication of SPRINT. Although interpretation of SPRINT is made difficult by a preferential effect of more intense BP lowering on heart failure rather than stroke and myocardial infarction, and by a different method of BP measurement, recent meta-analyses by my group have shown SBP reduction <130 mmHg can reduce risk of cardiovascular (CV) outcomes further, but absolute benefit is smaller than that achieved across the 140 mmHg cutoff, and treatment discontinuations for adverse events become greater.Even more difficult is answering the question of BP targets in CKD. In this condition risks of CV events and renal failure are both particularly elevated. Unfortunately, evidence available from trials is rather confusing. SPRINT has included a consistent number of hypertensive patients with CKD, and found a trend, albeit non-significant, toward a reduction of CV events and no effect on risk of renal failure by more intense BP lowering. When SPRINT results are analyzed together with those of other trials on CKV, it appears that the benefits of BP lowering on the risk of CV mortality and morbidity are, at best, lesser than in patients with normal renal function, and the response of renal function is quite variable from trial to trial, possibly depending on the nature of CKD (diabetic or non-diabetic, with or without proteinuria) and on the type of antihypertensive drugs used (renin-angiotensin system blockers or other classes). The issue of antihypertensive treatment in CKD needs to be investigated in greater depth and with precise questions. PMID:27642924

  19. CtBP maintains cancer cell growth and metabolic homeostasis via regulating SIRT4

    PubMed Central

    Wang, L; Zhou, H; Wang, Y; Cui, G; Di, L-j

    2015-01-01

    Cancer cells rely on glycolysis to maintain high levels of anabolism. However, the metabolism of glucose via glycolysis in cancer cells is frequently incomplete and results in the accumulation of acidic metabolites such as pyruvate and lactate. Thus, the cells have to develop strategies to alleviate the intracellular acidification and maintain the pH stability. We report here that glutamine consumption by cancer cells has an important role in releasing the acidification pressure associated with cancer cell growth. We found that the ammonia produced during glutaminolysis, a dominant glutamine metabolism pathway, is critical to resist the cytoplasmic acidification brought by the incomplete glycolysis. In addition, C-terminal-binding protein (CtBP) was found to have an essential role in promoting glutaminolysis by directly repressing the expression of SIRT4, a repressor of glutaminolysis by enzymatically modifying glutamate dehydrogenase in mitochondria, in cancer cells. The loss of CtBP in cancer cells resulted in the increased apoptosis due to intracellular acidification and the ablation of cancer cell metabolic homeostasis represented by decreased glutamine consumption, oxidative phosphorylation and ATP synthesis. Importantly, the immunohistochemistry staining showed that there was excessive expression of CtBP in tumor samples from breast cancer patients compared with surrounding non-tumor tissues, whereas SIRT4 expression in tumor tissues was abolished compared with the non-tumor tissues, suggesting CtBP-repressed SIRT4 expression contributes to the tumor growth. Therefore, our data suggest that the synergistically metabolism of glucose and glutamine in cancer cells contributes to both pH homeostasis and cell growth. At last, application of CtBP inhibitor induced the acidification and apoptosis of breast cancer cells and inhibited glutaminolysis in engrafted tumors, suggesting that CtBP can be potential therapeutic target of cancer treatment. PMID:25633289

  20. CtBP maintains cancer cell growth and metabolic homeostasis via regulating SIRT4.

    PubMed

    Wang, L; Zhou, H; Wang, Y; Cui, G; Di, L-J

    2015-01-29

    Cancer cells rely on glycolysis to maintain high levels of anabolism. However, the metabolism of glucose via glycolysis in cancer cells is frequently incomplete and results in the accumulation of acidic metabolites such as pyruvate and lactate. Thus, the cells have to develop strategies to alleviate the intracellular acidification and maintain the pH stability. We report here that glutamine consumption by cancer cells has an important role in releasing the acidification pressure associated with cancer cell growth. We found that the ammonia produced during glutaminolysis, a dominant glutamine metabolism pathway, is critical to resist the cytoplasmic acidification brought by the incomplete glycolysis. In addition, C-terminal-binding protein (CtBP) was found to have an essential role in promoting glutaminolysis by directly repressing the expression of SIRT4, a repressor of glutaminolysis by enzymatically modifying glutamate dehydrogenase in mitochondria, in cancer cells. The loss of CtBP in cancer cells resulted in the increased apoptosis due to intracellular acidification and the ablation of cancer cell metabolic homeostasis represented by decreased glutamine consumption, oxidative phosphorylation and ATP synthesis. Importantly, the immunohistochemistry staining showed that there was excessive expression of CtBP in tumor samples from breast cancer patients compared with surrounding non-tumor tissues, whereas SIRT4 expression in tumor tissues was abolished compared with the non-tumor tissues, suggesting CtBP-repressed SIRT4 expression contributes to the tumor growth. Therefore, our data suggest that the synergistically metabolism of glucose and glutamine in cancer cells contributes to both pH homeostasis and cell growth. At last, application of CtBP inhibitor induced the acidification and apoptosis of breast cancer cells and inhibited glutaminolysis in engrafted tumors, suggesting that CtBP can be potential therapeutic target of cancer treatment.

  1. Structural basis for the sequence-specific RNA-recognition mechanism of human CUG-BP1 RRM3

    PubMed Central

    Tsuda, Kengo; Kuwasako, Kanako; Takahashi, Mari; Someya, Tatsuhiko; Inoue, Makoto; Terada, Takaho; Kobayashi, Naohiro; Shirouzu, Mikako; Kigawa, Takanori; Tanaka, Akiko; Sugano, Sumio; Güntert, Peter; Muto, Yutaka; Yokoyama, Shigeyuki

    2009-01-01

    The CUG-binding protein 1 (CUG-BP1) is a member of the CUG-BP1 and ETR-like factors (CELF) family or the Bruno-like family and is involved in the control of splicing, translation and mRNA degradation. Several target RNA sequences of CUG-BP1 have been predicted, such as the CUG triplet repeat, the GU-rich sequences and the AU-rich element of nuclear pre-mRNAs and/or cytoplasmic mRNA. CUG-BP1 has three RNA-recognition motifs (RRMs), among which the third RRM (RRM3) can bind to the target RNAs on its own. In this study, we solved the solution structure of the CUG-BP1 RRM3 by hetero-nuclear NMR spectroscopy. The CUG-BP1 RRM3 exhibited a noncanonical RRM fold, with the four-stranded β-sheet surface tightly associated with the N-terminal extension. Furthermore, we determined the solution structure of the CUG-BP1 RRM3 in the complex with (UG)3 RNA, and discovered that the UGU trinucleotide is specifically recognized through extensive stacking interactions and hydrogen bonds within the pocket formed by the β-sheet surface and the N-terminal extension. This study revealed the unique mechanism that enables the CUG-BP1 RRM3 to discriminate the short RNA segment from other sequences, thus providing the molecular basis for the comprehension of the role of the RRM3s in the CELF/Bruno-like family. PMID:19553194

  2. Inhibition of 4E-BP1 Sensitizes U87 Glioblastoma Xenograft Tumors to Irradiation by Decreasing Hypoxia Tolerance

    SciTech Connect

    Dubois, Ludwig; Magagnin, Michael G.; Cleven, Arjen H.G.; Weppler, Sherry A.; Grenacher, Beat; Landuyt, Willy; Lieuwes, Natasja; Lambin, Philippe; Gorr, Thomas A.; Koritzinsky, Marianne

    2009-03-15

    Purpose: Eukaryotic initiation factor 4E (eIF4E) is an essential rate-limiting factor for cap-dependent translation in eukaryotic cells. Elevated eIF4E activity is common in many human tumors and is associated with disease progression. The growth-promoting effects of eIF4E are in turn negatively regulated by 4E-BP1. However, although 4E-BP1 harbors anti-growth activity, its expression is paradoxically elevated in some tumors. The aim of this study was to investigate the functional role of 4E-BP1 in the context of solid tumors. Methods and Materials: In vitro and in vivo growth properties, hypoxia tolerance, and response to radiation were assessed for HeLa and U87 cells, after stable expression of shRNA specific for 4E-BP1. Results: We found that loss of 4E-BP1 expression did not significantly alter in vitro growth but did accelerate the growth of U87 tumor xenografts, consistent with the growth-promoting function of deregulated eIF4E. However, cells lacking 4E-BP1 were significantly more sensitive to hypoxia-induced cell death in vitro. Furthermore, 4E-BP1 knockdown cells produced tumors more sensitive to radiation because of a reduction in the viable fraction of radioresistant hypoxic cells. Decreased hypoxia tolerance in the 4E-BP1 knockdown tumors was evident by increased cleaved caspase-3 levels and was associated with a reduction in adenosine triphosphate (ATP). Conclusions: Our results suggest that although tumors often demonstrate increases in cap-dependent translation, regulation of this activity is required to facilitate energy conservation, hypoxia tolerance, and tumor radioresistance. Furthermore, we suggest that targeting translational control may be an effective way to target hypoxic cells and radioresistance in metabolically hyperactive tumors.

  3. Recruitment of histone methyltransferase G9a mediates transcriptional repression of Fgf21 gene by E4BP4 protein.

    PubMed

    Tong, Xin; Zhang, Deqiang; Buelow, Katie; Guha, Anirvan; Arthurs, Blake; Brady, Hugh J M; Yin, Lei

    2013-02-22

    The liver responds to fasting-refeeding cycles by reprogramming expression of metabolic genes. Fasting potently induces one of the key hepatic hormones, fibroblast growth factor 21 (FGF21), to promote lipolysis, fatty acid oxidation, and ketogenesis, whereas refeeding suppresses its expression. We previously reported that the basic leucine zipper transcription factor E4BP4 (E4 binding protein 4) represses Fgf21 expression and disrupts its circadian oscillations in cultured hepatocytes. However, the epigenetic mechanism for E4BP4-dependent suppression of Fgf21 has not yet been addressed. Here we present evidence that histone methyltransferase G9a mediates E4BP4-dependent repression of Fgf21 during refeeding by promoting repressive histone modification. We find that Fgf21 expression is up-regulated in E4bp4 knock-out mouse liver. We demonstrate that the G9a-specific inhibitor BIX01294 abolishes suppression of the Fgf21 promoter activity by E4BP4, whereas overexpression of E4bp4 leads to increased levels of dimethylation of histone 3 lysine 9 (H3K9me2) around the Fgf21 promoter region. Furthermore, we also show that E4BP4 interacts with G9a, and knockdown of G9a blocks repression of Fgf21 promoter activity and expression in cells overexpressing E4bp4. A G9a mutant lacking catalytic activity, due to deletion of the SET domain, fails to inhibit the Fgf21 promoter activity. Importantly, acute hepatic knockdown by adenoviral shRNA targeting G9a abolishes Fgf21 repression by refeeding, concomitant with decreased levels of H3K9me2 around the Fgf21 promoter region. In summary, we show that G9a mediates E4BP4-dependent suppression of hepatic Fgf21 by enhancing histone methylation (H3K9me2) of the Fgf21 promoter. PMID:23283977

  4. Volume-associated ambulatory BP patterns in hemodialysis patients

    PubMed Central

    Agarwal, Rajiv

    2009-01-01

    Although volume excess causes hypertension whether it also affects circadian patterns of arterial pressures among hemodialysis patients remains unknown. To test the notion whether volume overload is associated with a unique BP “signature” a post-hoc analysis was performed among 145 patients participating in the dry-weight reduction in hypertensive hemodialysis patients (DRIP) randomized controlled trial. Using 400 ambulatory BP recordings over 8 weeks comprising 35,302 measurements the trended cosinor model was found to be the best descriptor of BP chronobiology. The trended cosinor model may be described as a pattern of sinusoidal oscillation around a straight line with an upward trend during the interdialytic period and which has an intercept at the postdialysis time. Augmented volume removal therapy (AVRT) reduced the intercept systolic BP and increased the rate of rise in systolic BP over the interdialytic interval but had no effect on the systolic BP fluctuation (amplitude). Thus an elevated intercept and blunted slope pattern characterizes the “volume overload BP pattern” on ambulatory BP monitoring. Similar changes were seen for diastolic BP. AVRT neither restored dipping nor was associated with a lag-phenomenon for either the wake or sleep systolic BP. Lowering of systolic BP was greater than diastolic BP such that pulse pressure was reduced. An observational cohort of 37 patients followed for 6 months confirmed these findings. Randomized trials are now needed to evaluate the clinical impact of AVRT on hard outcomes since reduction of pulse pressure with this simple expedient has the potential to improve survival in hemodialysis patients. PMID:19528362

  5. Blood pressure telemonitoring is useful to achieve blood pressure control in inadequately treated patients with arterial hypertension.

    PubMed

    Neumann, C L; Menne, J; Rieken, E M; Fischer, N; Weber, M H; Haller, H; Schulz, E G

    2011-12-01

    Failing to reach blood pressure (BP) goals is one of the main problems in hypertension management. Especially in high-risk patients, intensive monitoring including frequently office visits or new techniques to monitor home BP is required. A total of 60 patients with uncontrolled hypertension were included and randomized into a group with telemetric BP monitoring (TBPM) (n=30) and a control group receiving standard care (n=30). During the 3-month study period, patients received in addition to their antihypertensive pre-treatment up to 2 × 300 mg irbesartan to achieve the required target BP. All patients were instructed to measure their BP once daily in the morning. In the TBPM group automatic alerts were generated by the central database server using pre-defined algorithms and patients were subsequently contacted by the physician. At baseline mean 24-h ambulant BP monitoring (ABPM) was 143.3±11.1/82.6±9.9 mm Hg in the TBPM group and 141.4±12.6/82.1±6.5 mm Hg in the standard care group. During treatment mean systolic BP showed a more intensive decrease in the TBPM vs control group (-17.0±11.1 mm Hg vs -9.8±13.7 mm Hg; P=0.032). Patients in the TBPM group had a more pronounced night dipping and a higher reduction of mean pulse pressure than controls (-8.1±5.9 mm Hg vs -2.8±7.4 mm Hg, P=0.004). After 3 months, TBPM-treated patients were given a higher mean daily dose of irbesartan (375±187 mg vs 222±147 mg in controls; P=<0.001). We demonstrated that with TBPM a more effective and faster titration of the antihypertensive agent is possible. The alarm criteria chosen were useful to improve BP control. PMID:21228822

  6. Trailer siting issues: BP Texas City.

    PubMed

    Kaszniak, Mark; Holmstrom, Donald

    2008-11-15

    On 23 March, 2005, a series of explosions and fires occurred at the BP Texas City refinery during the startup of an isomerization (ISOM) process unit. Fifteen workers were killed and about 180 others were injured. All of the fatalities were contract workers; the deaths and most of the serious injuries occurred in and around temporary office trailers that had been sited near a blowdown drum and stack open to the atmosphere as part of ongoing turnaround activities in an adjacent unit. Due to problems that developed during the ISOM startup, flammable hydrocarbon liquid overfilled the blowdown drum and stack which resulted in a geyser-like release out the top into the atmosphere. The flammable hydrocarbons fell to the ground releasing vapors that were likely ignited from a nearby idling diesel pickup truck. A total of 44 trailers were damaged by the blast pressure wave that propagated through the refinery when the vapor cloud exploded. Thirteen trailers were totally destroyed and workers were injured in trailers as far as 479ft away from the release. The focus of this paper will be on trailer siting issues, including: need for work/office trailers within process units, adequacy of risk analysis methods in API RP 752, and minimum safe distance requirements

  7. Trailer siting issues: BP Texas City.

    PubMed

    Kaszniak, Mark; Holmstrom, Donald

    2008-11-15

    On 23 March, 2005, a series of explosions and fires occurred at the BP Texas City refinery during the startup of an isomerization (ISOM) process unit. Fifteen workers were killed and about 180 others were injured. All of the fatalities were contract workers; the deaths and most of the serious injuries occurred in and around temporary office trailers that had been sited near a blowdown drum and stack open to the atmosphere as part of ongoing turnaround activities in an adjacent unit. Due to problems that developed during the ISOM startup, flammable hydrocarbon liquid overfilled the blowdown drum and stack which resulted in a geyser-like release out the top into the atmosphere. The flammable hydrocarbons fell to the ground releasing vapors that were likely ignited from a nearby idling diesel pickup truck. A total of 44 trailers were damaged by the blast pressure wave that propagated through the refinery when the vapor cloud exploded. Thirteen trailers were totally destroyed and workers were injured in trailers as far as 479ft away from the release. The focus of this paper will be on trailer siting issues, including: need for work/office trailers within process units, adequacy of risk analysis methods in API RP 752, and minimum safe distance requirements PMID:18294765

  8. Inhibition of HIF-1{alpha} activity by BP-1 ameliorates adjuvant induced arthritis in rats

    SciTech Connect

    Shankar, J.; Thippegowda, P.B.; Kanum, S.A.

    2009-09-18

    Rheumatoid arthritis (RA) is a chronic inflammatory, angiogenic disease. Inflamed synovitis is a hallmark of RA which is hypoxic in nature. Vascular endothelial growth factor (VEGF), one of the key regulators of angiogenesis, is overexpressed in the pathogenesis of RA. VEGF expression is regulated by hypoxia-inducible factor-1{alpha} (HIF-1{alpha}), a master regulator of homeostasis which plays a pivotal role in hypoxia-induced angiogenesis. In this study we show that synthetic benzophenone analogue, 2-benzoyl-phenoxy acetamide (BP-1) can act as a novel anti-arthritic agent in an experimental adjuvant induced arthritis (AIA) rat model by targeting VEGF and HIF-1{alpha}. BP-1 administered hypoxic endothelial cells and arthritic animals clearly showed down regulation of VEGF expression. Further, BP-1 inhibits nuclear translocation of HIF-1{alpha}, which in turn suppresses transcription of the VEGF gene. These results suggest a further possible clinical application of the BP-1 derivative as an anti-arthritic agent in association with conventional chemotherapeutic agents.

  9. Hypertension, Blood Pressure Variability, and Target Organ Lesion.

    PubMed

    Irigoyen, Maria-Cláudia; De Angelis, Kátia; Dos Santos, Fernando; Dartora, Daniela R; Rodrigues, Bruno; Consolim-Colombo, Fernanda Marciano

    2016-04-01

    Hypertensive patients have a higher risk of developing health complications, particularly cardiovascular (CV) events, than individuals with normal blood pressure (BP). Severity of complications depends on the magnitude of BP elevation and other CV risk factors associated with the target organ damage. Therefore, BP control and management of organ damage may contribute to reduce this risk. BP variability (BPV) has been considered a physiological marker of autonomic nervous system control and may be implicated in increased CV risk in hypertension. This review will present some evidence relating BPV and target organ damage in hypertension in clinical and experimental settings.

  10. Yarn Quality Prediction Based on Improved BP Neural Network

    NASA Astrophysics Data System (ADS)

    Yang, Jian-Guo; Xiong, Jing-Wei; Xun, Lan

    Aiming at the key quality indexes xbt in spinning processing is caused by many complex and interactions factors. A xbt prediction model is put forward based on the PSO-BP neural network, which adjusts weights of BP neural network using particle swarm optimization (PSO) rather than the traditional gradient descent method, is used to improve the convergence speed of neural network and the ability of getting the global optimal solution. As the object of a large number of field detection data in a spinning workshop, the results show that, compared with the traditional BP algorithm and GA-BP algorithm, the PSO-BP neural network can obvious improve yarn quality prediction model precision and stability.

  11. Polarized internal target apparatus

    DOEpatents

    Holt, Roy J.

    1986-01-01

    A polarized internal target apparatus with a polarized gas target of improved polarization and density achieved by mixing target gas atoms with a small amount of alkali metal gas atoms, and passing a high intensity polarized light source into the mixture to cause the alkali metal gas atoms to become polarized which interact in spin exchange collisions with target gas atoms yielding polarized target gas atoms.

  12. Polarized internal target apparatus

    DOEpatents

    Holt, R.J.

    1984-10-10

    A polarized internal target apparatus with a polarized gas target of improved polarization and density (achieved by mixing target gas atoms with a small amount of alkali metal gas atoms, and passing a high intensity polarized light source into the mixture to cause the alkali metal gas atoms to become polarized which interact in spin exchange collisions with target gas atoms yielding polarized target gas atoms) is described.

  13. Paroxysmal nocturnal hemoglobinuria. Enhanced stimulation of platelets by the terminal complement components is related to the lack of C8bp in the membrane.

    PubMed

    Blaas, P; Berger, B; Weber, S; Peter, H H; Hänsch, G M

    1988-05-01

    Recently, a protein isolated from the membrane of human E, the so-called C8 binding protein (C8bp), has been described. C8bp is characterized as a 65-kDa protein that binds to C8 and inhibits the C5b-9-mediated lysis in a homologous system. In the present study, membranes of peripheral blood cells were tested for the presence of C8bp by SDS-PAGE and immunoblotting. In all cells a protein band reacting with anti-C8bp was seen, the Mr, however, was only about 50 kDa. To further analyze the 50-kDa protein, we isolated the protein by phenol-water extraction and isoelectric focusing from papain-treated platelets. The isolated protein behaved similar to the E-derived C8bp: it inhibited the lysis of model target cells by C5b-9. To examine the function of C8bp in platelets, we tested platelets from patients suffering from paroxysmal nocturnal hemoglobinuria (PNH). These platelets were deficient in C8bp, being in accordance with their higher lytic susceptibility in vitro. In response to sublytic C5b-9 doses, the PNH platelets released considerably more serotonin and thromboxane B2 than normal platelets. By addition of purified C8bp, the thromboxane B2 release was suppressed, indicating that C8bp not only restricts the lytic complement attack, but also regulates the C5b-9-mediated stimulation of target cells. Thus, lack of C8bp might not only result in enhanced hemolysis, but also in enhanced stimulation of platelets, which in turn might contribute to the thrombotic complications seen in some PNH-type III patients.

  14. BpTRUth: do automated blood pressure monitors outperform mercury?

    PubMed

    Edwards, Cedric; Hiremath, Swapnil; Gupta, Ankur; McCormick, Brendan B; Ruzicka, Marcel

    2013-01-01

    Manual measurement of blood pressure (BP) in the office (MOBP) is inferior in accuracy when compared with ambulatory BP measurements (ABPM) since it misses white coat and masked effects on BP. BpTRU, an automated office BP device (AOBP), has been reported to reduce white coat effect. We performed a retrospective review of the diagnostic accuracy of MOBP (taken by a trained nurse in clinical hypertension) and AOBP using the Bland-Altman method in hypertensive patients referred to a Renal Hypertension Clinic. In 329 hypertensive patients, the 95% limits of agreement between systolic AOBP and ABPM were -31 mm Hg to 33 mm Hg and for MOBP and ABPM were -27.8 mm Hg to 37.4 mm Hg. The bias between systolic MOBP and systolic ABPM was 4.9 mm Hg (95% confidence interval, 3.0-6.6 mm Hg) whereas the bias between the systolic AOBP and the systolic ABPM was -3.2 (95% confidence interval, -1.3 to -5.0). AOBP did not improve treatment relevant classification errors compared with MOBP (28% vs. 23%; P = .052). Our data support findings by others showing that AOBP improves, but does not eliminate, white coat effect. The increased detection of white coat effect appears related to systematic downward bias by BpTRU. As a result, detection of masked effect is undermined by BpTRU. PMID:23969286

  15. Graded Achievement, Tested Achievement, and Validity

    ERIC Educational Resources Information Center

    Brookhart, Susan M.

    2015-01-01

    Twenty-eight studies of grades, over a century, were reviewed using the argument-based approach to validity suggested by Kane as a theoretical framework. The review draws conclusions about the meaning of graded achievement, its relation to tested achievement, and changes in the construct of graded achievement over time. "Graded…

  16. A BP-MF-EP Based Iterative Receiver for Joint Phase Noise Estimation, Equalization, and Decoding

    NASA Astrophysics Data System (ADS)

    Wang, Wei; Wang, Zhongyong; Zhang, Chuanzong; Guo, Qinghua; Sun, Peng; Wang, Xingye

    2016-10-01

    In this work, with combined belief propagation (BP), mean field (MF) and expectation propagation (EP), an iterative receiver is designed for joint phase noise (PN) estimation, equalization and decoding in a coded communication system. The presence of the PN results in a nonlinear observation model. Conventionally, the nonlinear model is directly linearized by using the first-order Taylor approximation, e.g., in the state-of-the-art soft-input extended Kalman smoothing approach (soft-in EKS). In this work, MF is used to handle the factor due to the nonlinear model, and a second-order Taylor approximation is used to achieve Gaussian approximation to the MF messages, which is crucial to the low-complexity implementation of the receiver with BP and EP. It turns out that our approximation is more effective than the direct linearization in the soft-in EKS with similar complexity, leading to significant performance improvement as demonstrated by simulation results.

  17. Ran Binding Protein 9 (RanBP9) is a novel mediator of cellular DNA damage response in lung cancer cells

    PubMed Central

    Palmieri, Dario; Scarpa, Mario; Tessari, Anna; Uka, Rexhep; Amari, Foued; Lee, Cindy; Richmond, Timothy; Foray, Claudia; Sheetz, Tyler; Braddom, Ashley; Burd, Christin E.; Parvin, Jeffrey D.; Ludwig, Thomas; Croce, Carlo M.; Coppola, Vincenzo

    2016-01-01

    Ran Binding Protein 9 (RanBP9, also known as RanBPM) is an evolutionary conserved scaffold protein present both in the nucleus and the cytoplasm of cells whose biological functions remain elusive. We show that active ATM phosphorylates RanBP9 on at least two different residues (S181 and S603). In response to IR, RanBP9 rapidly accumulates into the nucleus of lung cancer cells, but this nuclear accumulation is prevented by ATM inhibition. RanBP9 stable silencing in three different lung cancer cell lines significantly affects the DNA Damage Response (DDR), resulting in delayed activation of key components of the cellular response to IR such as ATM itself, Chk2, γH2AX, and p53. Accordingly, abrogation of RanBP9 expression reduces homologous recombination-dependent DNA repair efficiency, causing an abnormal activation of IR-induced senescence and apoptosis. In summary, here we report that RanBP9 is a novel mediator of the cellular DDR, whose accumulation into the nucleus upon IR is dependent on ATM kinase activity. RanBP9 absence hampers the molecular mechanisms leading to efficient repair of damaged DNA, resulting in enhanced sensitivity to genotoxic stress. These findings suggest that targeting RanBP9 might enhance lung cancer cell sensitivity to genotoxic anti-neoplastic treatment. PMID:26943034

  18. Dufulin Activates HrBP1 to Produce Antiviral Responses in Tobacco

    PubMed Central

    Chen, Zhuo; Zeng, Mengjiao; Song, Baoan; Hou, Chengrui; Hu, Deyu; Li, Xiangyang; Wang, Zhenchao; Fan, Huitao; Bi, Liang; Liu, Jiaju; Yu, Dandan; Jin, Linhong; Yang, Song

    2012-01-01

    Background Dufulin is a new antiviral agent that is highly effective against plant viruses and acts by activating systemic acquired resistance (SAR) in plants. In recent years, it has been used widely to prevent and control tobacco and rice viral diseases in China. However, its targets and mechanism of action are still poorly understood. Methodology/Principal Findings Here, differential in-gel electrophoresis (DIGE) and classical two-dimensional electrophoresis (2-DE) techniques were combined with mass spectrometry (MS) to identify the target of Dufulin. More than 40 proteins were found to be differentially expressed (≥1.5 fold or ≤1.5 fold) upon Dufulin treatment in Nicotiana tabacum K326. Based on annotations in the Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) databases, these proteins were found to be related to disease resistance. Directed acyclic graph (DAG) analysis of the various pathways demonstrated harpin binding protein-1 (HrBP1) as the target of action of Dufulin. Additionally, western blotting, semi-quantitative reverse transcription polymerase chain reaction (RT-PCR), and real time PCR analyses were also conducted to identify the specific mechanism of action of Dufulin. Our results show that activation of HrBP1 triggers the salicylic acid (SA) signaling pathway and thereby produces antiviral responses in the plant host. A protective assay based on lesion counting further confirmed the antiviral activity of Dufulin. Conclusion This study identified HrBP1 as a target protein of Dufulin and that Dufulin can activate the SA signaling pathway to induce host plants to generate antiviral responses. PMID:22662252

  19. Black Phosphorus (BP) Nanodots for Potential Biomedical Applications.

    PubMed

    Lee, Hyun Uk; Park, So Young; Lee, Soon Chang; Choi, Saehae; Seo, Soonjoo; Kim, Hyeran; Won, Jonghan; Choi, Kyuseok; Kang, Kyoung Suk; Park, Hyun Gyu; Kim, Hee-Sik; An, Ha Rim; Jeong, Kwang-Hun; Lee, Young-Chul; Lee, Jouhahn

    2016-01-13

    Recently, the appeal of 2D black phosphorus (BP) has been rising due to its unique optical and electronic properties with a tunable band gap (≈0.3-1.5 eV). While numerous research efforts have recently been devoted to nano- and optoelectronic applications of BP, no attention has been paid to promising medical applications. In this article, the preparation of BP-nanodots of a few nm to <20 nm with an average diameter of ≈10 nm and height of ≈8.7 nm is reported by a modified ultrasonication-assisted solution method. Stable formation of nontoxic phosphates and phosphonates from BP crystals with exposure in water or air is observed. As for the BP-nanodot crystals' stability (ionization and persistence of fluorescent intensity) in aqueous solution, after 10 d, ≈80% at 1.5 mg mL(-1) are degraded (i.e., ionized) in phosphate buffered saline. They showed no or little cytotoxic cell-viability effects in vitro involving blue- and green-fluorescence cell imaging. Thus, BP-nanodots can be considered a promising agent for drug delivery or cellular tracking systems.

  20. The oncogenic triangle of HMGA2, LIN28B and IGF2BP1 antagonizes tumor-suppressive actions of the let-7 family

    PubMed Central

    Busch, Bianca; Bley, Nadine; Müller, Simon; Glaß, Markus; Misiak, Danny; Lederer, Marcell; Vetter, Martina; Strauß, Hans-Georg; Thomssen, Christoph; Hüttelmaier, Stefan

    2016-01-01

    The tumor-suppressive let-7 microRNA family targets various oncogene-encoding mRNAs. We identify the let-7 targets HMGA2, LIN28B and IGF2BP1 to form a let-7 antagonizing self-promoting oncogenic triangle. Surprisingly, 3′-end processing of IGF2BP1 mRNAs is unaltered in aggressive cancers and tumor-derived cells although IGF2BP1 synthesis was proposed to escape let-7 attack by APA-dependent (alternative polyadenylation) 3′ UTR shortening. However, the expression of the triangle factors is inversely correlated with let-7 levels and promoted by LIN28B impairing let-7 biogenesis. Moreover, IGF2BP1 enhances the expression of all triangle factors by recruiting the respective mRNAs in mRNPs lacking AGO proteins and let-7 miRNAs. This indicates that the downregulation of let-7, largely facilitated by LIN28B upregulation, and the protection of let-7 target mRNAs by IGF2BP1-directed shielding in mRNPs synergize in enhancing the expression of triangle factors. The oncogenic potential of this triangle was confirmed in ovarian cancer (OC)-derived ES-2 cells transduced with let-7 targeting decoys. In these, the depletion of HMGA2 only diminishes tumor cell growth under permissive conditions. The depletion of LIN28B and more prominently IGF2BP1 severely impairs tumor cell viability, self-renewal and 2D as well as 3D migration. In conclusion, this suggests the targeting of the HMGA2-LIN28B-IGF2BP1 triangle as a promising strategy in cancer treatment. PMID:26917013

  1. Multi-Functional Regulation of 4E-BP Gene Expression by the Ccr4-Not Complex

    PubMed Central

    Okada, Hirokazu; Schittenhelm, Ralf B.; Straessle, Anna; Hafen, Ernst

    2015-01-01

    The mechanistic target of rapamycin (mTOR) signaling pathway is highly conserved from yeast to humans. It senses various environmental cues to regulate cellular growth and homeostasis. Deregulation of the pathway has been implicated in many pathological conditions including cancer. Phosphorylation cascades through the pathway have been extensively studied but not much is known about the regulation of gene expression of the pathway components. Here, we report that the mRNA level of eukaryotic translation initiation factor (eIF) subunit 4E-binding protein (4E-BP) gene, one of the key mTOR signaling components, is regulated by the highly conserved Ccr4-Not complex. RNAi knockdown of Not1, a putative scaffold protein of this protein complex, increases the mRNA level of 4E-BP in Drosophila Kc cells. Examination of the gene expression mechanism using reporter swap constructs reveals that Not1 depletion increases reporter mRNAs with the 3’UTR of 4E-BP gene, but decreases the ones with the 4E-BP promoter region, suggesting that Ccr4-Not complex regulates both degradation and transcription of 4E-BP mRNA. These results indicate that the Ccr4-Not complex controls expression of a single gene at multiple levels and adjusts the magnitude of the total effect. Thus, our study reveals a novel regulatory mechanism of a key component of the mTOR signaling pathway at the level of gene expression. PMID:25793896

  2. Synaptic activity controls localization and function of CtBP1 via binding to Bassoon and Piccolo

    PubMed Central

    Ivanova, Daniela; Dirks, Anika; Montenegro-Venegas, Carolina; Schöne, Cornelia; Altrock, Wilko D; Marini, Claudia; Frischknecht, Renato; Schanze, Denny; Zenker, Martin; Gundelfinger, Eckart D; Fejtova, Anna

    2015-01-01

    Persistent experience-driven adaptation of brain function is associated with alterations in gene expression patterns, resulting in structural and functional neuronal remodeling. How synaptic activity—in particular presynaptic performance—is coupled to gene expression in nucleus remains incompletely understood. Here, we report on a role of CtBP1, a transcriptional co-repressor enriched in presynapses and nuclei, in the activity-driven reconfiguration of gene expression in neurons. We demonstrate that presynaptic and nuclear pools of CtBP1 are interconnected and that both synaptic retention and shuttling of CtBP1 between cytoplasm and nucleus are co-regulated by neuronal activity. Finally, we show that CtBP1 is targeted and/or anchored to presynapses by direct interaction with the active zone scaffolding proteins Bassoon and Piccolo. This association is regulated by neuronal activity via modulation of cellular NAD/NADH levels and restrains the size of the CtBP1 pool available for nuclear import, thus contributing to the control of activity-dependent gene expression. Our combined results reveal a mechanism for coupling activity-induced molecular rearrangements in the presynapse with reconfiguration of neuronal gene expression. PMID:25652077

  3. Crystal Structures of the Human G3BP1 NTF2-Like Domain Visualize FxFG Nup Repeat Specificity

    PubMed Central

    Vognsen, Tina; Møller, Ingvar Runár; Kristensen, Ole

    2013-01-01

    Ras GTPase Activating Protein SH3 Domain Binding Protein (G3BP) is a potential anti-cancer drug target implicated in several cellular functions. We have used protein crystallography to solve crystal structures of the human G3BP1 NTF2-like domain both alone and in complex with an FxFG Nup repeat peptide. Despite high structural similarity, the FxFG binding site is located between two alpha helices in the G3BP1 NTF2-like domain and not at the dimer interface as observed for nuclear transport factor 2. ITC studies showed specificity towards the FxFG motif but not FG and GLFG motifs. The unliganded form of the G3BP1 NTF2-like domain was solved in two crystal forms to resolutions of 1.6 and 3.3 Å in space groups P212121 and P6322 based on two different constructs, residues 1–139 and 11–139, respectively. Crystal packing of the N-terminal residues against a symmetry related molecule in the P212121 crystal form might indicate a novel ligand binding site that, however, remains to be validated. The crystal structures give insight into the nuclear transportation mechanisms of G3BP and provide a basis for future structure based drug design. PMID:24324649

  4. Synaptic activity controls localization and function of CtBP1 via binding to Bassoon and Piccolo.

    PubMed

    Ivanova, Daniela; Dirks, Anika; Montenegro-Venegas, Carolina; Schöne, Cornelia; Altrock, Wilko D; Marini, Claudia; Frischknecht, Renato; Schanze, Denny; Zenker, Martin; Gundelfinger, Eckart D; Fejtova, Anna

    2015-04-15

    Persistent experience-driven adaptation of brain function is associated with alterations in gene expression patterns, resulting in structural and functional neuronal remodeling. How synaptic activity-in particular presynaptic performance-is coupled to gene expression in nucleus remains incompletely understood. Here, we report on a role of CtBP1, a transcriptional co-repressor enriched in presynapses and nuclei, in the activity-driven reconfiguration of gene expression in neurons. We demonstrate that presynaptic and nuclear pools of CtBP1 are interconnected and that both synaptic retention and shuttling of CtBP1 between cytoplasm and nucleus are co-regulated by neuronal activity. Finally, we show that CtBP1 is targeted and/or anchored to presynapses by direct interaction with the active zone scaffolding proteins Bassoon and Piccolo. This association is regulated by neuronal activity via modulation of cellular NAD/NADH levels and restrains the size of the CtBP1 pool available for nuclear import, thus contributing to the control of activity-dependent gene expression. Our combined results reveal a mechanism for coupling activity-induced molecular rearrangements in the presynapse with reconfiguration of neuronal gene expression.

  5. Randomized trial of guiding hypertension management using central aortic blood pressure compared with best-practice care: principal findings of the BP GUIDE study.

    PubMed

    Sharman, James E; Marwick, Thomas H; Gilroy, Deborah; Otahal, Petr; Abhayaratna, Walter P; Stowasser, Michael

    2013-12-01

    Arm cuff blood pressure (BP) may overestimate cardiovascular risk. Central aortic BP predicts mortality and could be a better method for patient management. We sought to determine the usefulness of central BP to guide hypertension management. This was a prospective, open-label, blinded-end point study in 286 patients with hypertension randomized to treatment decisions guided by best-practice usual care (n=142; using office, home, and 24-hour ambulatory BP) or, in addition, by central BP intervention (n=144; using SphygmoCor). Therapy was reviewed every 3 months for 12 months, and recommendations were provided to each patient and his/her doctor on antihypertensive medication titration. Outcome measures were as follows: medication quantity (daily defined dose), quality of life, and left ventricular mass (3-dimensional echocardiography). There was 92% compliance with recommendations on medication titration, and quality of life improved in both groups (post hoc P<0.05). For usual care, there was no change in daily defined dose (all P>0.10), but with intervention there was a significant stepwise decrease in daily defined dose from baseline to 3 months (P=0.008) and each subsequent visit (all P<0.001). Intervention was associated with cessation of medication in 23 (16%) patients versus 3 (2%) in usual care (P<0.001). Despite this, there were no differences between groups in left ventricular mass index, 24-hour ambulatory BP, home systolic BP, or aortic stiffness (all P>0.05). We conclude that guidance of hypertension management with central BP results in a significantly different therapeutic pathway than conventional cuff BP, with less use of medication to achieve BP control and no adverse effects on left ventricular mass, aortic stiffness, or quality of life.

  6. Production of a Dominant-Negative Fragment Due to G3BP1 Cleavage Contributes to the Disruption of Mitochondria-Associated Protective Stress Granules during CVB3 Infection

    PubMed Central

    Fung, Gabriel; Ng, Chen Seng; Zhang, Jingchun; Shi, Junyan; Wong, Jerry; Piesik, Paulina; Han, Lillian; Chu, Fanny; Jagdeo, Julienne; Jan, Eric; Fujita, Takashi; Luo, Honglin

    2013-01-01

    Stress granules (SGs) are dynamic cytosolic aggregates containing messenger ribonucleoproteins and target poly-adenylated (A)-mRNA. A key component of SGs is Ras-GAP SH3 domain binding protein-1 (G3BP1), which in part mediates protein-protein and protein-RNA interactions. SGs are modulated during infection by several viruses, however, the function and significance of this process remains poorly understood. In this study, we investigated the interplay between SGs and Coxsackievirus type B3 (CVB3), a member of the Picornaviridae family. Our studies demonstrated that SGs were formed early during CVB3 infection; however, G3BP1-positive SGs were actively disassembled at 5 hrs post-infection, while poly(A)-positive RNA granules persisted. Furthermore, we confirmed G3BP1 cleavage by 3Cpro at Q325. We also demonstrated that overexpression of G3BP1-SGs negatively impacted viral replication at the RNA, protein, and viral progeny levels. Using electron microscopy techniques, we showed that G3BP1-positive SGs localized near mitochondrial surfaces. Finally, we provided evidence that the C-terminal cleavage product of G3BP1 inhibited SG formation and promoted CVB3 replication. Taken together, we conclude that CVB3 infection selectively targets G3BP1-SGs by cleaving G3BP1 to produce a dominant-negative fragment that further inhibits G3BP1-SG formation and facilitates viral replication. PMID:24260247

  7. Magnetically attached sputter targets

    DOEpatents

    Makowiecki, D.M.; McKernan, M.A.

    1994-02-15

    An improved method and assembly for attaching sputtering targets to cathode assemblies of sputtering systems which includes a magnetically permeable material is described. The magnetically permeable material is imbedded in a target base that is brazed, welded, or soldered to the sputter target, or is mechanically retained in the target material. Target attachment to the cathode is achieved by virtue of the permanent magnets and/or the pole pieces in the cathode assembly that create magnetic flux lines adjacent to the backing plate, which strongly attract the magnetically permeable material in the target assembly. 11 figures.

  8. Magnetically attached sputter targets

    DOEpatents

    Makowiecki, Daniel M.; McKernan, Mark A.

    1994-01-01

    An improved method and assembly for attaching sputtering targets to cathode assemblies of sputtering systems which includes a magnetically permeable material. The magnetically permeable material is imbedded in a target base that is brazed, welded, or soldered to the sputter target, or is mechanically retained in the target material. Target attachment to the cathode is achieved by virtue of the permanent magnets and/or the pole pieces in the cathode assembly that create magnetic flux lines adjacent to the backing plate, which strongly attract the magnetically permeable material in the target assembly.

  9. Mitotic protein kinase CDK1 phosphorylation of mRNA translation regulator 4E-BP1 Ser83 may contribute to cell transformation

    PubMed Central

    Velásquez, Celestino; Cheng, Erdong; Shuda, Masahiro; Lee-Oesterreich, Paula J.; Pogge von Strandmann, Lisa; Gritsenko, Marina A.; Jacobs, Jon M.; Moore, Patrick S.; Chang, Yuan

    2016-01-01

    Mammalian target of rapamycin (mTOR)-directed eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) phosphorylation promotes cap-dependent translation and tumorigenesis. During mitosis, cyclin-dependent kinase 1 (CDK1) substitutes for mTOR and fully phosphorylates 4E-BP1 at canonical sites (T37, T46, S65, and T70) and the noncanonical S83 site, resulting in a mitosis-specific hyperphosphorylated δ isoform. Colocalization studies with a phospho-S83 specific antibody indicate that 4E-BP1 S83 phosphorylation accumulates at centrosomes during prophase, peaks at metaphase, and decreases through telophase. Although S83 phosphorylation of 4E-BP1 does not affect general cap-dependent translation, expression of an alanine substitution mutant 4E-BP1.S83A partially reverses rodent cell transformation induced by Merkel cell polyomavirus small T antigen viral oncoprotein. In contrast to inhibitory mTOR 4E-BP1 phosphorylation, these findings suggest that mitotic CDK1-directed phosphorylation of δ-4E-BP1 may yield a gain of function, distinct from translation regulation, that may be important in tumorigenesis and mitotic centrosome function. PMID:27402756

  10. Marine04 Marine radiocarbon age calibration, 26 ? 0 ka BP

    SciTech Connect

    Hughen, K; Baille, M; Bard, E; Beck, J; Bertrand, C; Blackwell, P; Buck, C; Burr, G; Cutler, K; Damon, P; Edwards, R; Fairbanks, R; Friedrich, M; Guilderson, T; Kromer, B; McCormac, F; Manning, S; Bronk-Ramsey, C; Reimer, P; Reimer, R; Remmele, S; Southon, J; Stuiver, M; Talamo, S; Taylor, F; der Plicht, J v; Weyhenmeyer, C

    2004-11-01

    New radiocarbon calibration curves, IntCal04 and Marine04, have been constructed and internationally ratified to replace the terrestrial and marine components of IntCal98. The new calibration datasets extend an additional 2000 years, from 0-26 ka cal BP (Before Present, 0 cal BP = AD 1950), and provide much higher resolution, greater precision and more detailed structure than IntCal98. For the Marine04 curve, dendrochronologically dated tree-ring samples, converted with a box-diffusion model to marine mixed-layer ages, cover the period from 0-10.5 ka cal BP. Beyond 10.5 ka cal BP, high-resolution marine data become available from foraminifera in varved sediments and U/Th-dated corals. The marine records are corrected with site-specific {sup 14}C reservoir age information to provide a single global marine mixed-layer calibration from 10.5-26.0 ka cal BP. A substantial enhancement relative to IntCal98 is the introduction of a random walk model, which takes into account the uncertainty in both the calendar age and the radiocarbon age to calculate the underlying calibration curve. The marine datasets and calibration curve for marine samples from the surface mixed layer (Marine04) are discussed here. The tree-ring datasets, sources of uncertainty, and regional offsets are presented in detail in a companion paper by Reimer et al.

  11. Preliminary Geological Findings on the BP-1 Simulant

    NASA Technical Reports Server (NTRS)

    Rickman, D. L.

    2010-01-01

    The following is a summation of information and discussion between Doug Stoeser of the USGS and Doug Rickman of NASA in February and March, 2010 pertaining to the BP-1 simulant. The analytical results and the bulk of the text are from communications from Dr. Stoeser. The BP-1 simulant is made from Black Point Basalt Flow, San Francisco Volcanic Field, northern Arizona. There is an aggregate (road metal) quarry on the northern margin of the flow towards the west end that was used as a Desert Research and Technology Studies (Desert RATS) analog test site. Silty material from this site was also used in laboratory tests and found to have geotechnical properties similar to the LHT-2M and Chenobi regolith simulants and is being proposed as a possible simulant for geotechnical use. It currently has the designation of BP-1 (Black Point 1). Figure

  12. Preliminary Geological Findings on the BP-1 Simulant

    NASA Technical Reports Server (NTRS)

    Stoeser, D. B.; Rickman, D. L.; Wilson, S.

    2010-01-01

    A waste material from an aggregate producing quarry has been used to make an inexpensive lunar simulant called BP-1. The feedstock is the Black Point lava flow in northern Arizona. Although this is part of the San Francisco volcanic field, which is also the source of the JSC-1 series feedstock, BP-1 and JSC-1 are distinct. Chemically, the Black Point flow is an amygdaloidal nepheline-bearing basalt. The amygdules are filled with secondary minerals containing opaline silica, calcium carbonate, and ferric iron minerals. X-ray diffraction (XRD) detected approximately 3% quartz, which is in line with tests done by the Kennedy Space Center Industrial Hygiene Office. Users of this material should use appropriate protective equipment. XRD also showed the presence of significant halite and some bassanite. Both are interpreted to be evaporative residues due to recycling of wash water at the quarry. The size distribution of BP-1 may be superior to some other simulants for some applications.

  13. 200-BP-5 operable unit treatability test report

    SciTech Connect

    1996-04-01

    The 200-BP-5 Operable Unit was established in response to recommendations presented in the 200 East Groundwater Aggregate Area Management Study Report (AAMSR) (DOE-RL 1993a). Recognizing different approaches to remediation, the groundwater AAMSR recommended separating groundwater from source and vadose zone operable units and subdividing 200 East Area groundwater into two operable units. The division between the 200-BP-5 and 200-PO-1 Operable Units was based principally on source operable unit boundaries and distribution of groundwater plumes derived from either B Plant or Plutonium/Uranium Extraction (PUREX) Plant liquid waste disposal sites.

  14. Muscle-specific 4E-BP1 signaling activation improves metabolic parameters during aging and obesity

    PubMed Central

    Tsai, Shihyin; Sitzmann, Joanna M.; Dastidar, Somasish G.; Rodriguez, Ariana A.; Vu, Stephanie L.; McDonald, Circe E.; Academia, Emmeline C.; O’Leary, Monique N.; Ashe, Travis D.; La Spada, Albert R.; Kennedy, Brian K.

    2015-01-01

    Eukaryotic translation initiation factor 4E–binding protein 1 (4E-BP1) is a key downstream effector of mTOR complex 1 (mTORC1) that represses cap-dependent mRNA translation initiation by sequestering the translation initiation factor eIF4E. Reduced mTORC1 signaling is associated with life span extension and improved metabolic homeostasis, yet the downstream targets that mediate these benefits are unclear. Here, we demonstrated that enhanced 4E-BP1 activity in mouse skeletal muscle protects against age- and diet-induced insulin resistance and metabolic rate decline. Transgenic animals displayed increased energy expenditure; altered adipose tissue distribution, including reduced white adipose accumulation and preserved brown adipose mass; and were protected from hepatic steatosis. Skeletal muscle–specific 4E-BP1 mediated metabolic protection directly through increased translation of peroxisome proliferator–activated receptor γ coactivator-1α (PGC-1α) and enhanced respiratory function. Non–cell autonomous protection was through preservation of brown adipose tissue metabolism, which was increased in 4E-BP1 transgenic animals during normal aging and in a response to diet-induced type 2 diabetes. Adipose phenotypes may derive from enhanced skeletal muscle expression and secretion of the known myokine FGF21. Unlike skeletal muscle, enhanced adipose-specific 4E-BP1 activity was not protective but instead was deleterious in response to the same challenges. These findings indicate that regulation of 4E-BP1 in skeletal muscle may serve as an important conduit through which mTORC1 controls metabolism. PMID:26121750

  15. In situ SUMOylation analysis reveals a modulatory role of RanBP2 in the nuclear rim and PML bodies

    SciTech Connect

    Saitoh, Noriko . E-mail: hisa@gpo.kumamoto-u.ac.jp; Uchimura, Yasuhiro; Tachibana, Taro; Sugahara, Satoko; Saitoh, Hisato; Nakao, Mitsuyoshi . E-mail: mnakao@gpo.kumamoto-u.ac.jp

    2006-05-01

    SUMO modification plays a critical role in a number of cellular functions including nucleocytoplasmic transport, gene expression, cell cycle and formation of subnuclear structures such as promyelocytic leukemia (PML) bodies. In order to identify the sites where SUMOylation takes place in the cell, we developed an in situ SUMOylation assay using a semi-intact cell system and subsequently combined it with siRNA-based knockdown of nucleoporin RanBP2, also known as Nup358, which is one of the known SUMO E3 proteins. With the in situ SUMOylation assay, we found that both nuclear rim and PML bodies, besides mitotic apparatuses, are major targets for active SUMOylation. The ability to analyze possible SUMO conjugation sites would be a valuable tool to investigate where SUMO E3-like activities and/or SUMO substrates exist in the cell. Specific knockdown of RanBP2 completely abolished SUMOylation along the nuclear rim and dislocated RanGAP1 from the nuclear pore complexes. Interestingly, the loss of RanBP2 markedly reduced the number of PML bodies, in contrast to other, normal-appearing nuclear compartments including the nuclear lamina, nucleolus and chromatin, suggesting a novel link between RanBP2 and PML bodies. SUMOylation facilitated by RanBP2 at the nuclear rim may be a key step for the formation of a particular subnuclear organization. Our data imply that SUMO E3 proteins like RanBP2 facilitate spatio-temporal SUMOylation for certain nuclear structure and function.

  16. The translational repressor eIF4E-binding protein 2 (4E-BP2) correlates with selective delayed neuronal death after ischemia

    PubMed Central

    Ayuso, María Irene; Martínez-Alonso, Emma; Cid, Cristina; de Leciñana, Maria Alonso; Alcázar, Alberto

    2013-01-01

    Transient brain ischemia induces an inhibition of translational rates and causes delayed neuronal death in selective regions and cognitive deficits, whereas these effects do not occur in resistant areas. The translational repressor eukaryotic initiation factor (eIF) 4E-binding protein-2 (4E-BP2) specifically binds to eIF4E and is critical in the control of protein synthesis. To link neuronal death to translation inhibition, we study the eIF4E association with 4E-BP2 under ischemia reperfusion in a rat model of transient forebrain ischemia. Upon reperfusion, a selective neuronal apoptosis in the hippocampal cornu ammonis 1 (CA1) region was induced, while it did not occur in the cerebral cortex. Confocal microscopy analysis showed a decrease in 4E-BP2/eIF4E colocalization in resistant cortical neurons after reperfusion. In contrast, in vulnerable CA1 neurons, 4E-BP2 remains associated to eIF4E with a higher degree of 4E-BP2/eIF4E colocalization and translation inhibition. Furthermore, the binding of a 4E-BP2 peptide to eIF4E induced neuronal apoptosis in the CA1 region. Finally, pharmacological-induced protection of CA1 neurons inhibited neuronal apoptosis, decreased 4E-BP2/eIF4E association, and recovered translation. These findings documented specific changes in 4E-BP2/eIF4E association during ischemic reperfusion, linking the translation inhibition to selective neuronal death, and identifying 4E-BP2 as a novel target for protection of vulnerable neurons in ischemic injury. PMID:23591646

  17. Detection of anti-BP180NC16a and anti-BP230 autoantibodies in blister fluid of patients with bullous pemphigoid: the first survey in Greece.

    PubMed

    Patsatsi, A; Vyzantiadis, T-A; Devliotou-Panagiotidou, D; Chrysomallis, F; Sotiriadis, D

    2008-03-01

    Bullous pemphigoid (BP) is an acquired bullous disease with an increasing prevalence among elderly people worldwide, including in Greece. Blister formation in most patients with BP is caused by autoantibodies against structural components of the basement membrane zone of the skin, predominantly BP180NC16a and BP230 antigens on the hemidesmosome adhesion complex. Routine diagnostic methods such as histological examination and direct and indirect immunofluorescence are combined to determine diagnosis. In this study, an ELISA was used to measure levels of both anti-BP180NC16A and anti-BP230 autoantibodies in the blister fluid of 13 patients with newly diagnosed BP, before starting treatment. The aim of the study was to evaluate this method as a diagnostic tool in BP. Our results indicate that blister-fluid examination by ELISA can be a useful tool to diagnose bullous pemphigoid, especially in elderly patients who refuse biopsy or have poor venous access.

  18. Feline Calicivirus Infection Disrupts Assembly of Cytoplasmic Stress Granules and Induces G3BP1 Cleavage

    PubMed Central

    Humoud, Majid N.; Doyle, Nicole; Royall, Elizabeth; Willcocks, Margaret M.; Sorgeloos, Frederic; van Kuppeveld, Frank; Roberts, Lisa O.; Goodfellow, Ian G.; Langereis, Martijn A.

    2016-01-01

    models to understand norovirus biology. Recent studies have suggested that the assembly of stress granules is central in orchestrating stress and antiviral responses to restrict viral replication. Overall, our study provides the first insight on how caliciviruses impair stress granule assembly by targeting the nucleating factor G3BP1 via the viral proteinase NS6Pro. This work provides new insights into host-pathogen interactions that regulate stress pathways during FCV infection. PMID:27147742

  19. BP-Broker use-cases in the UncertWeb framework

    NASA Astrophysics Data System (ADS)

    Roncella, Roberto; Bigagli, Lorenzo; Schulz, Michael; Stasch, Christoph; Proß, Benjamin; Jones, Richard; Santoro, Mattia

    2013-04-01

    The UncertWeb framework is a distributed, Web-based Information and Communication Technology (ICT) system to support scientific data modeling in presence of uncertainty. We designed and prototyped a core component of the UncertWeb framework: the Business Process Broker. The BP-Broker implements several functionalities, such as: discovery of available processes/BPs, preprocessing of a BP into its executable form (EBP), publication of EBPs and their execution through a workflow-engine. According to the Composition-as-a-Service (CaaS) approach, the BP-Broker supports discovery and chaining of modeling resources (and processing resources in general), providing the necessary interoperability services for creating, validating, editing, storing, publishing, and executing scientific workflows. The UncertWeb project targeted several scenarios, which were used to evaluate and test the BP-Broker. The scenarios cover the following environmental application domains: biodiversity and habitat change, land use and policy modeling, local air quality forecasting, and individual activity in the environment. This work reports on the study of a number of use-cases, by means of the BP-Broker, namely: - eHabitat use-case: implements a Monte Carlo simulation performed on a deterministic ecological model; an extended use-case supports inter-comparison of model outputs; - FERA use-case: is composed of a set of models for predicting land-use and crop yield response to climatic and economic change; - NILU use-case: is composed of a Probabilistic Air Quality Forecasting model for predicting concentrations of air pollutants; - Albatross use-case: includes two model services for simulating activity-travel patterns of individuals in time and space; - Overlay use-case: integrates the NILU scenario with the Albatross scenario to calculate the exposure to air pollutants of individuals. Our aim was to prove the feasibility of describing composite modeling processes with a high-level, abstract

  20. Reading Achievement in an Urban School District

    ERIC Educational Resources Information Center

    Lindsey, Kathleen W.

    2010-01-01

    The purpose of this study was to determine if differences in elementary reading comprehension achievement existed as a result of statewide implementation of the Alabama Reading Initiative post No Child Left Behind (NCLB). Research supports the premise that targeted instruction in reading comprehension yields increases in reading achievement for…

  1. Immunohistochemical analysis of the Akt/mTOR/4E-BP1 signalling pathway in canine haemangiomas and haemangiosarcomas.

    PubMed

    Murai, A; Abou Asa, S; Kodama, A; Sakai, H; Hirata, A; Yanai, T

    2012-11-01

    The specific signalling pathways that are deregulated in canine endothelial tumours have not yet fully elucidated. Therefore, the aim of the present study was to examine activation of the Akt/mammalian target of rapamycin (mTOR)/eukaryotic initiation factor 4E-binding protein 1 (4E-BP1) signalling pathway in spontaneously arising canine haemangiomas (HAs) and haemangiosarcomas (HSAs) in order to identify novel molecular targets for treatment. Surgically-resected samples of HA (n = 27), HSA (n = 37), granulation tissue (n = 4) and normal skin (n = 4) were investigated by immunohistochemistry. Approximately 80% of the HSA samples had moderate to intense expression of phosphorylated Akt at Ser473 (p-Akt Ser473), p-Akt Thr308, p-4E-BP1 Thr37/46 and eukaryotic initiation factor 4E, which was significantly higher than in the HAs and was similar to the expression in activated endothelial cells (ECs). Although p-mTOR complex1 (p-mTORC1) Ser2448 was expressed by most of the activated ECs, only 35% of the HSA samples had weak to moderate expression. Because mTORC2 and phosphorylates Akt Ser473 was activated in HSA samples, the present findings suggest that the mTORC2/Akt/4E-BP1 pathway, regulated independently of mTORC1, may be important for targeting therapy in canine HSAs. PMID:22789858

  2. BP chief scientist nominated for senior energy role

    NASA Astrophysics Data System (ADS)

    Gwynne, Peter

    2014-01-01

    The Obama administration has nominated BP's chief scientist Ellen Williams to be director of the Advanced Research Projects Agency-Energy (ARPA-E), which was created in 2007 to fund "high-risk, high-reward" research into novel energy technologies that are too early for investment by the private sector.

  3. TopBP1-mediated DNA processing during mitosis.

    PubMed

    Gallina, Irene; Christiansen, Signe Korbo; Pedersen, Rune Troelsgaard; Lisby, Michael; Oestergaard, Vibe H

    2016-01-01

    Maintenance of genome integrity is crucial to avoid cancer and other genetic diseases. Thus faced with DNA damage, cells mount a DNA damage response to avoid genome instability. The DNA damage response is partially inhibited during mitosis presumably to avoid erroneous processing of the segregating chromosomes. Yet our recent study shows that TopBP1-mediated DNA processing during mitosis is highly important to reduce transmission of DNA damage to daughter cells. (1) Here we provide an overview of the DNA damage response and DNA repair during mitosis. One role of TopBP1 during mitosis is to stimulate unscheduled DNA synthesis at underreplicated regions. We speculated that such genomic regions are likely to hold stalled replication forks or post-replicative gaps, which become the substrate for DNA synthesis upon entry into mitosis. Thus, we addressed whether the translesion pathways for fork restart or post-replicative gap filling are required for unscheduled DNA synthesis in mitosis. Using genetics in the avian DT40 cell line, we provide evidence that unscheduled DNA synthesis in mitosis does not require the translesion synthesis scaffold factor Rev1 or PCNA ubiquitylation at K164, which serve to recruit translesion polymerases to stalled forks. In line with this finding, translesion polymerase η foci do not colocalize with TopBP1 or FANCD2 in mitosis. Taken together, we conclude that TopBP1 promotes unscheduled DNA synthesis in mitosis independently of the examined translesion polymerases.

  4. Mobility and Reading Achievement.

    ERIC Educational Resources Information Center

    Waters, Theresa Z.

    A study examined the effect of geographic mobility on elementary school students' achievement. Although such mobility, which requires students to make multiple moves among schools, can have a negative impact on academic achievement, the hypothesis for the study was that it was not a determining factor in reading achievement test scores. Subjects…

  5. Interaction of the eukaryotic initiation factor 4E with 4E-BP2 at a dynamic bipartite interface.

    PubMed

    Lukhele, Sabelo; Bah, Alaji; Lin, Hong; Sonenberg, Nahum; Forman-Kay, Julie D

    2013-12-01

    Cap-dependent translation initiation is regulated by the interaction of eukaryotic initiation factor 4E (eIF4E) with eIF4E binding proteins (4E-BPs). Whereas the binding of 4E-BP peptides containing the eIF4E-binding ⁵⁴YXXXXLΦ⁶⁰ motif has been studied, atomic-level characterization of the interaction of eIF4E with full-length 4E-BPs has been lacking. Here, we use isothermal titration calorimetry and nuclear magnetic resonance spectroscopy to characterize the dynamic, structural and binding properties of 4E-BP2. Although disordered, 4E-BP2 contains significant fluctuating secondary structure and binds eIF4E at an extensive bipartite interface including the canonical ⁵⁴YXXXXLΦ⁶⁰ and ⁷⁸IPGVT⁸² sites. Each of the two binding elements individually has submicromolar affinity and exchange on and off of the eIF4E surface within the context of the overall nanomolar complex. This dynamic interaction facilitates exposure of regulatory phosphorylation sites within the complex. The 4E-BP2 interface on eIF4E overlaps yet is more extensive than the eIF4G:eIF4E interface, suggesting that these key interactions may be differentially targeted for therapeutics.

  6. Residues Responsible for the Selectivity of α-Conotoxins for Ac-AChBP or nAChRs

    PubMed Central

    Lin, Bo; Xiang, Shihua; Li, Mengsen

    2016-01-01

    Nicotinic acetylcholine receptors (nAChRs) are targets for developing new drugs to treat severe pain, nicotine addiction, Alzheimer disease, epilepsy, etc. α-Conotoxins are biologically and chemically diverse. With 12–19 residues and two disulfides, they can be specifically selected for different nAChRs. Acetylcholine-binding proteins from Aplysia californica (Ac-AChBP) are homologous to the ligand-binding domains of nAChRs and pharmacologically similar. X-ray structures of the α-conotoxin in complex with Ac-AChBP in addition to computer modeling have helped to determine the binding site of the important residues of α-conotoxin and its affinity for nAChR subtypes. Here, we present the various α-conotoxin residues that are selective for Ac-AChBP or nAChRs by comparing the structures of α-conotoxins in complex with Ac-AChBP and by modeling α-conotoxins in complex with nAChRs. The knowledge of these binding sites will assist in the discovery and design of more potent and selective α-conotoxins as drug leads. PMID:27727162

  7. A review of glycemic efficacy of liraglutide once daily in achieving glycated hemoglobin targets compared with exenatide twice daily, or sitagliptin once daily in the treatment of type 2 diabetes

    PubMed Central

    Alshali, Khalid Z.; Karawagh, Abdullah M.

    2016-01-01

    Incretin-based therapies such as glucagon-like peptide-1 (GLP-1) receptor agonists (RA) and dipeptidyl peptidase-4 (DPP-4) inhibitors have gained prominence in recent years for the treatment of type 2 diabetes (T2D). Such therapies offer the potential to stimulate endogenous insulin activity in proportion to circulating glucose levels; thereby, lowering the risk of hypoglycemic episodes. The synthetic GLP-1 RA exenatide, the human GLP-1 RA liraglutide, and the DPP-4 inhibitor sitagliptin are the first agents in their respective classes to be approved for the treatment of T2D and their efficacy and safety has been studied extensively in clinical trials. This article reviewed the efficacy of liraglutide once daily in achieving clinical guidelines-recommended glycated hemoglobin A1c levels in patients with T2D compared with exenatide twice daily, or sitagliptin once daily, based on published literature, with an aim to elucidate the preferred choice of incretin-related therapy in treating uncontrolled T2D. PMID:27464858

  8. A review of glycemic efficacy of liraglutide once daily in achieving glycated hemoglobin targets compared with exenatide twice daily, or sitagliptin once daily in the treatment of type 2 diabetes.

    PubMed

    Alshali, Khalid Z; Karawagh, Abdullah M

    2016-08-01

    Incretin-based therapies such as glucagon-like peptide-1 (GLP-1) receptor agonists (RA) and dipeptidyl peptidase-4 (DPP-4) inhibitors have gained prominence in recent years for the treatment of type 2 diabetes (T2D). Such therapies offer the potential to stimulate endogenous insulin activity in proportion to circulating glucose levels; thereby, lowering the risk of hypoglycemic episodes. The synthetic GLP-1 RA exenatide, the human GLP-1 RA liraglutide, and the DPP-4 inhibitor sitagliptin are the first agents in their respective classes to be approved for the treatment of T2D and their efficacy and safety has been studied extensively in clinical trials. This article reviewed the efficacy of liraglutide once daily in achieving clinical guidelines-recommended glycated hemoglobin A1c levels in patients with T2D compared with exenatide twice daily, or sitagliptin once daily, based on published literature, with an aim to elucidate the preferred choice of incretin-related therapy in treating uncontrolled T2D. PMID:27464858

  9. The Autophagy Receptor TAX1BP1 and the Molecular Motor Myosin VI Are Required for Clearance of Salmonella Typhimurium by Autophagy.

    PubMed

    Tumbarello, David A; Manna, Paul T; Allen, Mark; Bycroft, Mark; Arden, Susan D; Kendrick-Jones, John; Buss, Folma

    2015-10-01

    Autophagy plays a key role during Salmonella infection, by eliminating these pathogens following escape into the cytosol. In this process, selective autophagy receptors, including the myosin VI adaptor proteins optineurin and NDP52, have been shown to recognize cytosolic pathogens. Here, we demonstrate that myosin VI and TAX1BP1 are recruited to ubiquitylated Salmonella and play a key role in xenophagy. The absence of TAX1BP1 causes an accumulation of ubiquitin-positive Salmonella, whereas loss of myosin VI leads to an increase in ubiquitylated and LC3-positive bacteria. Our structural studies demonstrate that the ubiquitin-binding site of TAX1BP1 overlaps with the myosin VI binding site and point mutations in the TAX1BP1 zinc finger domains that affect ubiquitin binding also ablate binding to myosin VI. This mutually exclusive binding and the association of TAX1BP1 with LC3 on the outer limiting membrane of autophagosomes may suggest a molecular mechanism for recruitment of this motor to autophagosomes. The predominant role of TAX1BP1, a paralogue of NDP52, in xenophagy is supported by our evolutionary analysis, which demonstrates that functionally intact NDP52 is missing in Xenopus and mice, whereas TAX1BP1 is expressed in all vertebrates analysed. In summary, this work highlights the importance of TAX1BP1 as a novel autophagy receptor in myosin VI-mediated xenophagy. Our study identifies essential new machinery for the autophagy-dependent clearance of Salmonella typhimurium and suggests modulation of myosin VI motor activity as a potential therapeutic target in cellular immunity.

  10. Targeting blood pressure in people with diabetes mellitus.

    PubMed

    Brimble, K Scott

    2016-06-29

    Hypertension is a strong risk factor for cardiovascular (CV)-related morbidity and mortality, and its treatment has been shown to be beneficial. Hypertension is common in people with diabetes mellitus, and the combination of these conditions markedly increases CV risk in comparison with individuals with neither condition. Although there is increasing clarity as to blood pressure (BP) targets in numerous conditions, the target in people with diabetes remains unclear, and, as a result, many clinical practice guidelines differ on the optimal BP goal. The ACCORD (Action to Control Cardiovascular Risk in Diabetes) trial did not demonstrate benefit when systolic BP (SBP) was lowered to less than 120 mmHg compared with a target of less than 140 mmHg. This was in contrast to the recent SPRINT trial (Systolic Blood Pressure Intervention Trial), which demonstrated the superiority of a target SBP of less than 120 mmHg in reducing CV events. However, people with diabetes mellitus were excluded. Recent meta-analyses have suggested that lowering BP in patients with diabetes mellitus should be reserved for a baseline SBP greater than 140 mmHg, targeting an SBP of between 130 and 140 mmHg. Lower targets may reduce the risk of stroke but may also be harmful with respect to other important CV outcomes. The methodological limitations of these meta-analyses highlight the need for a large randomized controlled trial comparing lower and standard BP targets in people with diabetes mellitus.

  11. Comparison of effectiveness of rosuvastatin versus atorvastatin on the achievement of combined C-reactive protein (<2 mg/L) and low-density lipoprotein cholesterol (< 70 mg/dl) targets in patients with type 2 diabetes mellitus (from the ANDROMEDA study).

    PubMed

    Betteridge, D John; Gibson, J Martin; Sager, Philip T

    2007-10-15

    Decreasing C-reactive protein (CRP) in addition to decreasing low-density lipoprotein (LDL) cholesterol may further decrease coronary heart disease risk. The effects of rosuvastatin compared with atorvastatin in achieving a combined target of LDL cholesterol <70 mg/dl and CRP <2 mg/L in 509 patients with type 2 diabetes mellitus was evaluated. CRP decreased significantly versus baseline in both treatment groups. Significantly more patients treated with rosuvastatin achieved the combined end point of LDL cholesterol <70 mg/dl and CRP <2 mg/L compared with atorvastatin by the end of the study period (58% vs 37%; p <0.001 vs atorvastatin). In conclusion, CRP was effectively decreased in patients with type 2 diabetes receiving rosuvastatin or atorvastatin, whereas rosuvastatin decreased LDL cholesterol significantly more than atorvastatin.

  12. Calibration of the radiocarbon time scale at 37ka BP

    SciTech Connect

    Southon, J.R.; Deino, A.L.; Orsi, G.

    1995-12-01

    Results from radiocarbon and U-Th measurements on corals have provided a radiocarbon calibration beyond the range covered by tree ring series, but the uncertainties in the measurements beyond 20ka BP are very large. We have obtained new calibration data from radiocarbon dates on material associated with the catastrophic Campanian Ignimbrite eruption from the Phlegrean Fields near Naples. The eruption has been well dated by {sup 40}Ar/{sup 39}Ar to 37ka BP. Radiocarbon measurements were carried out on charcoal from a carbonized branch exposed within the ignimbrite tuff on the wall of an active quarry. The sample was split and analyzed at both the Naples and Lawrence Livermore AMS facilities. The offset between the Ar-Ar data and the radiocarbon results (recalculated using the true 5730-year half life for {sup 14}C) is consistent with predictions from paleomagnetic data and carbon cycle modeling.

  13. Magnetospheric accretion on the T Tauri star BP Tauri

    NASA Astrophysics Data System (ADS)

    Donati, J.-F.; Jardine, M. M.; Gregory, S. G.; Petit, P.; Paletou, F.; Bouvier, J.; Dougados, C.; Ménard, F.; Collier Cameron, A.; Harries, T. J.; Hussain, G. A. J.; Unruh, Y.; Morin, J.; Marsden, S. C.; Manset, N.; Aurière, M.; Catala, C.; Alecian, E.

    2008-05-01

    From observations collected with the ESPaDOnS and NARVAL spectropolarimeters, we report the detection of Zeeman signatures on the classical T Tauri star (cTTS) BP Tau. Circular polarization signatures in photospheric lines and in narrow emission lines tracing magnetospheric accretion are monitored throughout most of the rotation cycle of BP Tau at two different epochs in 2006. We observe that rotational modulation dominates the temporal variations of both unpolarized and circularly polarized spectral proxies tracing the photosphere and the footpoints of accretion funnels. From the complete data sets at each epoch, we reconstruct the large-scale magnetic topology and the location of accretion spots at the surface of BP Tau using tomographic imaging. We find that the field of BP Tau involves a 1.2 kG dipole and 1.6 kG octupole, both slightly tilted with respect to the rotation axis. Accretion spots coincide with the two main magnetic poles at high latitudes and overlap with dark photospheric spots; they cover about 2 per cent of the stellar surface. The strong mainly axisymmetric poloidal field of BP Tau is very reminiscent of magnetic topologies of fully convective dwarfs. It suggests that magnetic fields of fully convective cTTSs such as BP Tau are likely not fossil remants, but rather result from vigorous dynamo action operating within the bulk of their convective zones. Preliminary modelling suggests that the magnetosphere of BP Tau extends to distances of at least 4R* to ensure that accretion spots are located at high latitudes, and is not blown open close to the surface by a putative stellar wind. It apparently succeeds in coupling to the accretion disc as far out as the corotation radius, and could possibly explain the slow rotation of BP Tau. Based on observations obtained at the Canada-France-Hawaii Telescope (CFHT) and at the Télescope Bernard Lyot (TBL). CFHT is operated by the National Research Council of Canada, the Institut National des Sciences de l

  14. Variability of Balmer Profiles in Magnetic Ap/Bp Stars

    NASA Astrophysics Data System (ADS)

    Valyavin, G.; Lee, B.-C.; Shulyak, D.; Han, I.; Kochukhov, O.; Khang, D.-I.; Kim, K.-M.

    2007-06-01

    A set of high precision measurements of weak variations of hydrogen lines in spectra of seven magnetic Ap/Bp stars was carried out using the BOES echelle spectrograph of the Bohuynsan Optical Astronomy Observatory (South Korea). A weak (1-2 %) periodic variability of the Balmer line wings has been detected in the spectra of 2 program stars. Upper limits of possible variations are presented for the remaining 5 objects. We discuss the discovered variability in the framework of model atmospheres with magnetic force terms included. The periodic changes in the Balmer profiles are caused by perturbations in atmospheres of Ap/Bp stars due to their rotationally modulated non-force-free magnetic fields.

  15. Diffusion and Settling in Ap/Bp Stars

    SciTech Connect

    Turcotte, S

    2003-04-09

    Ap/Bp stars are magnetic chemically peculiar early A and late B type stars of the main sequence. They exhibit peculiar surface abundance anomalies that are thought to be the result of gravitational settling and radiative levitation. The physics of diffusion in these stars are reviewed briefly and some model predictions are discussed. While models reproduce some observations reasonably well, more work is needed before the behavior of diffusing elements in a complex magnetic field is fully understood.

  16. X-rays from magnetic intermediate mass Ap/Bp stars

    NASA Astrophysics Data System (ADS)

    Robrade, Jan

    2016-09-01

    The X-ray emission of magnetic intermediate mass Ap/Bp stars is reviewed and put into context of intrinsic as well as extrinsic hypotheses for its origin. New X-ray observations of Ap/Bp stars are presented and combined with an updated analysis of the available datasets, providing the largest sample of its type that is currently available. In the studied stars the X-ray detections are found predominantly among the more massive, hotter and more luminous targets. Their X-ray properties are quite diverse and beside strong soft X-ray emission significant magnetic activity is frequently present. While a connection between more powerful winds and brighter X-ray emission is expected in intrinsic models, the scatter in X-ray luminosity at given bolometric luminosity is so far unexplained and several observational features like X-ray light curves and flaring, luminosity distributions and spectral properties are often similar to those of low-mass stars. It remains to be seen if these features can be fully reproduced by magnetospheres of intermediate mass stars. The article discusses implications for magnetically confined wind-shock models (MCWS) and stellar magnetospheres under the assumption that the intrinsic model is applicable, but also examines the role of possible companions. Further, related magnetospheric phenomena are presented and an outlook on future perspectives is given.

  17. BP-Dock: A Flexible Docking Scheme for Exploring Protein–Ligand Interactions Based on Unbound Structures

    PubMed Central

    Bolia, Ashini; Gerek, Z. Nevin; Ozkan, S. Banu

    2016-01-01

    Molecular docking serves as an important tool in modeling protein–ligand interactions. However, it is still challenging to incorporate overall receptor flexibility, especially backbone flexibility, in docking due to the large conformational space that needs to be sampled. To overcome this problem, we developed a novel flexible docking approach, BP-Dock (Backbone Perturbation-Dock) that can integrate both backbone and side chain conformational changes induced by ligand binding through a multi-scale approach. In the BP-Dock method, we mimic the nature of binding-induced events as a first-order approximation by perturbing the residues along the protein chain with a small Brownian kick one at a time. The response fluctuation profile of the chain upon these perturbations is computed using the perturbation response scanning method. These response fluctuation profiles are then used to generate binding-induced multiple receptor conformations for ensemble docking. To evaluate the performance of BP-Dock, we applied our approach on a large and diverse data set using unbound structures as receptors. We also compared the BP-Dock results with bound and unbound docking, where overall receptor flexibility was not taken into account. Our results highlight the importance of modeling backbone flexibility in docking for recapitulating the experimental binding affinities, especially when an unbound structure is used. With BP-Dock, we can generate a wide range of binding site conformations realized in nature even in the absence of a ligand that can help us to improve the accuracy of unbound docking. We expect that our fast and efficient flexible docking approach may further aid in our understanding of protein–ligand interactions as well as virtual screening of novel targets for rational drug design. PMID:24380381

  18. Functional Interaction between Type III-Secreted Protein IncA of Chlamydophila psittaci and Human G3BP1

    PubMed Central

    Borth, Nicole; Litsche, Katrin; Franke, Claudia; Sachse, Konrad; Saluz, Hans Peter; Hänel, Frank

    2011-01-01

    Chlamydophila (Cp.) psittaci, the causative agent of psittacosis in birds and humans, is the most important zoonotic pathogen of the family Chlamydiaceae. These obligate intracellular bacteria are distinguished by a unique biphasic developmental cycle, which includes proliferation in a membrane-bound compartment termed inclusion. All Chlamydiaceae spp. possess a coding capacity for core components of a Type III secretion apparatus, which mediates specific delivery of anti-host effector proteins either into the chlamydial inclusion membrane or into the cytoplasm of target eukaryotic cells. Here we describe the interaction between Type III-secreted protein IncA of Cp. psittaci and host protein G3BP1 in a yeast two-hybrid system. In GST-pull down and co-immunoprecipitation experiments both in vitro and in vivo interaction between full-length IncA and G3BP1 were shown. Using fluorescence microscopy, the localization of G3BP1 near the inclusion membrane of Cp. psittaci-infected Hep-2 cells was demonstrated. Notably, infection of Hep-2 cells with Cp. psittaci and overexpression of IncA in HEK293 cells led to a decrease in c-Myc protein concentration. This effect could be ascribed to the interaction between IncA and G3BP1 since overexpression of an IncA mutant construct disabled to interact with G3BP1 failed to reduce c-Myc concentration. We hypothesize that lowering the host cell c-Myc protein concentration may be part of a strategy employed by Cp. psittaci to avoid apoptosis and scale down host cell proliferation. PMID:21304914

  19. General Achievement Trends: Oklahoma

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  20. General Achievement Trends: Georgia

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  1. General Achievement Trends: Nebraska

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  2. General Achievement Trends: Arkansas

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  3. General Achievement Trends: Maryland

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  4. General Achievement Trends: Maine

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  5. General Achievement Trends: Iowa

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  6. General Achievement Trends: Texas

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  7. General Achievement Trends: Hawaii

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  8. General Achievement Trends: Kansas

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  9. General Achievement Trends: Florida

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  10. General Achievement Trends: Massachusetts

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  11. General Achievement Trends: Tennessee

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  12. General Achievement Trends: Alabama

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  13. General Achievement Trends: Virginia

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  14. General Achievement Trends: Michigan

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  15. General Achievement Trends: Colorado

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  16. Inverting the Achievement Pyramid

    ERIC Educational Resources Information Center

    White-Hood, Marian; Shindel, Melissa

    2006-01-01

    Attempting to invert the pyramid to improve student achievement and increase all students' chances for success is not a new endeavor. For decades, educators have strategized, formed think tanks, and developed school improvement teams to find better ways to improve the achievement of all students. Currently, the No Child Left Behind Act (NCLB) is…

  17. Achievement Test Program.

    ERIC Educational Resources Information Center

    Ohio State Dept. of Education, Columbus. Trade and Industrial Education Service.

    The Ohio Trade and Industrial Education Achievement Test battery is comprised of seven basic achievement tests: Machine Trades, Automotive Mechanics, Basic Electricity, Basic Electronics, Mechanical Drafting, Printing, and Sheet Metal. The tests were developed by subject matter committees and specialists in testing and research. The Ohio Trade and…

  18. School Effects on Achievement.

    ERIC Educational Resources Information Center

    Nichols, Robert C.

    The New York State Education Department conducts a Pupil Evaluation Program (PEP) in which each year all third, sixth, and ninth grade students in the state are given a series of achievement tests in reading and mathematics. The data accumulated by the department includes achievement test scores, teacher characteristics, building and curriculum…

  19. Heritability of Creative Achievement

    ERIC Educational Resources Information Center

    Piffer, Davide; Hur, Yoon-Mi

    2014-01-01

    Although creative achievement is a subject of much attention to lay people, the origin of individual differences in creative accomplishments remain poorly understood. This study examined genetic and environmental influences on creative achievement in an adult sample of 338 twins (mean age = 26.3 years; SD = 6.6 years). Twins completed the Creative…

  20. Confronting the Achievement Gap

    ERIC Educational Resources Information Center

    Gardner, David

    2007-01-01

    This article talks about the large achievement gap between children of color and their white peers. The reasons for the achievement gap are varied. First, many urban minorities come from a background of poverty. One of the detrimental effects of growing up in poverty is receiving inadequate nourishment at a time when bodies and brains are rapidly…

  1. Achieving Public Schools

    ERIC Educational Resources Information Center

    Abowitz, Kathleen Knight

    2011-01-01

    Public schools are functionally provided through structural arrangements such as government funding, but public schools are achieved in substance, in part, through local governance. In this essay, Kathleen Knight Abowitz explains the bifocal nature of achieving public schools; that is, that schools are both subject to the unitary Public compact of…

  2. dRAGging Amino Acid-mTORC1 Signaling by SH3BP4

    PubMed Central

    Kim, Young-Mi; Kim, Do-Hyung

    2013-01-01

    Mammalian target of rapamycin complex 1 (mTORC1) is a master regulator of cell growth and autophagy. Its activity is regulated by the availability of amino acids and growth factors. The activation of mTORC1 by growth factors, such as insulin and insulin-like growth factor-1 (IGF-1), is mediated by tuberous sclerosis complex (TSC) 1 and 2 and Rheb GTPase. Relative to the growth factor-regulated mTORC1 pathway, the evolutionarily ancient amino acid-mTORC1 pathway remains not yet clearly defined. The amino acid-mTORC1 pathway is mediated by Rag GTPase heterodimers. Several binding proteins of Rag GTPases were discovered in recent studies. Here, we discuss the functions and mechanisms of the newly-identified binders of Rag GTPases. In particular, this review focuses on SH3 binding protein 4 (SH3BP4), the protein recently identifed as a negative regulator of Rag GTPases. PMID:23274731

  3. Insulin signaling controls neurotransmission via the 4eBP-dependent modification of the exocytotic machinery.

    PubMed

    Mahoney, Rebekah Elizabeth; Azpurua, Jorge; Eaton, Benjamin A

    2016-01-01

    Altered insulin signaling has been linked to widespread nervous system dysfunction including cognitive dysfunction, neuropathy and susceptibility to neurodegenerative disease. However, knowledge of the cellular mechanisms underlying the effects of insulin on neuronal function is incomplete. Here, we show that cell autonomous insulin signaling within the Drosophila CM9 motor neuron regulates the release of neurotransmitter via alteration of the synaptic vesicle fusion machinery. This effect of insulin utilizes the FOXO-dependent regulation of the thor gene, which encodes the Drosophila homologue of the eif-4e binding protein (4eBP). A critical target of this regulatory mechanism is Complexin, a synaptic protein known to regulate synaptic vesicle exocytosis. We find that the amounts of Complexin protein observed at the synapse is regulated by insulin and genetic manipulations of Complexin levels support the model that increased synaptic Complexin reduces neurotransmission in response to insulin signaling. PMID:27525480

  4. Microbial Consumption of Natural Gases Released from the BP Deepwater Horizon Oil Spill

    NASA Astrophysics Data System (ADS)

    Mendes, S. D.; Valentine, D. L.; Farwell, C.

    2010-12-01

    The BP Deepwater Horizon disaster caused the release of natural gas, which dissolved in the water column to form gas plumes. Containing methane, ethane, and propane, these gas plumes fuel microbial respiration. This work targeted the water column to quantify the maximum rate of microbial respiration in the natural gas plume. A novel method using uniformly 13C-labeled substrates as tracers was applied to determine the rate of microbial consumption of these gases in water surrounding the impacted area. Consumption rate experiments were performed on board the R/V Cape Hatteras (July 12-20, 2010) and analyzed using an isotope ratio mass spectrometer (IRMS). The kinetic order and maximum consumption rate of the microbial community were determined by experimental controls using the 13C-labeled tracers in temperature, time, and concentration series. Ongoing sampling efforts allow changes in the response of the microbial community to be monitored over time.

  5. Student Achievement and Motivation

    ERIC Educational Resources Information Center

    Flammer, Gordon H.; Mecham, Robert C.

    1974-01-01

    Compares the lecture and self-paced methods of instruction on the basis of student motivation and achieveme nt, comparing motivating and demotivating factors in each, and their potential for motivation and achievement. (Authors/JR)

  6. Alternative bisphosphonate targets and mechanisms of action.

    PubMed

    Bukowski, Jack F; Dascher, Christopher C; Das, Hiranmoy

    2005-03-18

    As the number of bisphosphonates continues to increase, they have found widespread use in an increasing number of clinical conditions. Ongoing examination of their targets and mechanisms of action has revealed that this surprisingly diverse class of drugs has effects beyond those first described for osteoclasts. These additional targets include osteoblasts, osteocytes, angiogenesis, and gammadelta T lymphocytes of the human immune system. The immune system effects are specifically targeted to gammadelta T cells and are reminiscent of the effects seen after ingestion of tea beverage. BP effects on such alternate targets may explain not only their antiresorptive effect, but also their effect on bone quality, tumors, and microbes.

  7. What Should Be the Target Blood Pressure in Elderly Patients With Diabetes?

    PubMed

    Solini, Anna; Grossman, Ehud

    2016-08-01

    Hypertension is very common in elderly subjects with type 2 diabetes. The coexistence of hypertension and diabetes can be devastating to the cardiovascular system, and in these patients, tight blood pressure (BP) control is particularly beneficial. Little information is available regarding the target BP levels in elderly hypertensive patients with type 2 diabetes, and therefore extrapolation from data in the general population should be done. However, it is difficult to extrapolate from the general population to these frail individuals, who usually have isolated systolic hypertension, comorbidities, organ damage, cardiovascular disease, and renal failure and have a high rate of orthostatic and postprandial hypotension. On the basis of the available evidence, we provide arguments supporting the individualized approach in these patients. Target BP should be based on concomitant diseases, orthostatic BP changes, and the general condition of the patients. It is recommended to lower BP in the elderly patient with diabetes to <140-150/90 mmHg, providing the patient is in good condition. In patients with isolated systolic hypertension, the same target is reasonable providing the diastolic BP is >60 mmHg. In patients with coronary artery disease and in patients with orthostatic hypotension, excessive BP lowering should be avoided. In elderly hypertensive patients with diabetes, BP levels should be monitored closely in the sitting and the standing position, and the treatment should be tailored to prevent excessive fall in BP. PMID:27440838

  8. Modification over time of pulse wave velocity parallel to changes in aortic BP, as well as in 24-h ambulatory brachial BP.

    PubMed

    Oliveras, A; Segura, J; Suarez, C; García-Ortiz, L; Abad-Cardiel, M; Vigil, L; Gómez-Marcos, M A; Sans Atxer, L; Martell-Claros, N; Ruilope, L M; de la Sierra, A

    2016-03-01

    Arterial stiffness as assessed by carotid-femoral pulse wave velocity (cfPWV) is a marker of preclinical organ damage and a predictor of cardiovascular outcomes, independently of blood pressure (BP). However, limited evidence exists on the association between long-term variation (Δ) on aortic BP (aoBP) and ΔcfPWV. We aimed to evaluate the relationship of ΔBP with ΔcfPWV over time, as assessed by office and 24-h ambulatory peripheral BP, and aoBP. AoBP and cfPWV were evaluated in 209 hypertensive patients with either diabetes or metabolic syndrome by applanation tonometry (Sphygmocor) at baseline(b) and at 12 months of follow-up(fu). Peripheral BP was also determined by using validated oscillometric devices (office(o)-BP) and on an outpatient basis by using a validated (Spacelabs-90207) device (24-h ambulatory BP). ΔcfPWV over time was calculated as follows: ΔcfPWV=[(cfPWVfu-cfPWVb)/cfPWVb] × 100. ΔBP over time resulted from the same formula applied to BP values obtained with the three different measurement techniques. Correlations (Spearman 'Rho') between ΔBP and ΔcfPWV were calculated. Mean age was 62 years, 39% were female and 80% had type 2 diabetes. Baseline office brachial BP (mm Hg) was 143±20/82±12. Follow-up (12 months later) office brachial BP (mm Hg) was 136±20/79±12. ΔcfPWV correlated with ΔoSBP (Rho=0.212; P=0.002), Δ24-h SBP (Rho=0.254; P<0.001), Δdaytime SBP (Rho=0.232; P=0.001), Δnighttime SBP (Rho=0.320; P<0.001) and ΔaoSBP (Rho=0.320; P<0.001). A multiple linear regression analysis included the following independent variables: ΔoSBP, Δ24-h SBP, Δdaytime SBP, Δnighttime SBP and ΔaoSBP. ΔcfPWV was independently associated with Δ24-h SBP (β-coefficient=0.195; P=0.012) and ΔaoSBP (β-coefficient= 0.185; P=0.018). We conclude that changes in both 24-h SBP and aoSBP more accurately reflect changes in arterial stiffness than do office BP measurements. PMID:26108366

  9. Feasibility study report for the 200-BP-1 operable unit

    SciTech Connect

    Not Available

    1993-06-01

    This feasibility study examines a range of alternatives and provides recommendations for selecting a preferred alternative for remediating contamination at the 200-BP-1 operable unit. The 200-BP-1 operable unit is located in the center of the Hanford Site along the northern boundary of the 200 East Area. The 241-BY Tank Farm is located immediately to the south of the operable unit. 200-BP-1 is a source operable unit with contaminated soils associated primarily with nine inactive cribs (known as the 216-B cribs). These cribs were used for disposal of low-level radioactive liquid waste from U Plant uranium recovery operations, and waste storage tank condensate from the adjacent 241-BY Tank Farm. The cribs used for disposal of U Plant waste were in operation from 1955--1965, and the cribs used for disposal of tank condensate were in operation from 1965--1975. In addition to the cribs, four unplanned releases of radioactive materials have occurred within the operable unit. Contaminated surface soils associated with the unplanned releases have been consolidated over the cribs and covered with clean soil to reduce contaminant migration and exposure. Discharge of wastes to the cribs has resulted in soil and groundwater contamination. The groundwater is being addressed as part of the 200 East Aggregate Area, groundwater operable unit. Contaminated soils at the site can be categorized by the types of contaminants, their distribution in the soil column, and the risk posed by the various potential exposure pathways. Below the clean soil cover, the near surface soils contain low-levels of contamination with cesium-137, radium-226, strontium-90, thorium-228, and uranium. The lifetime incremental cancer risk associated with these soils if they were exposed at the surface is 9{times}10{sup {minus}5}.

  10. Heritability of HR and BP Response To Exercise Training in the HERITAGE Family Study.

    ERIC Educational Resources Information Center

    Rice, Treva; Gagnon, Jacques; Leon, Arthur S.; Skinner, James S.; Wilmore, Jack H.; Bouchard, Claude; Rao, D. C.

    2002-01-01

    Assessed the heritability of response to exercise training in resting blood pressure (BP) and heart rate (HR) among sedentary Caucasians comprising 98 families who completed an exercise training program. Results indicated that the trainability of systolic BP and HR in families with elevated BP was partially determined by genetic factors. Diastolic…

  11. Levels of the E2 interacting protein TopBP1 modulate papillomavirus maintenance stage replication

    SciTech Connect

    Kanginakudru, Sriramana; DeSmet, Marsha; Thomas, Yanique; Morgan, Iain M.; Androphy, Elliot J.

    2015-04-15

    The evolutionarily conserved DNA topoisomerase II beta-binding protein 1 (TopBP1) functions in DNA replication, DNA damage response, and cell survival. We analyzed the role of TopBP1 in human and bovine papillomavirus genome replication. Consistent with prior reports, TopBP1 co-localized in discrete nuclear foci and was in complex with papillomavirus E2 protein. Similar to E2, TopBP1 is recruited to the region of the viral origin of replication during G1/S and early S phase. TopBP1 knockdown increased, while over-expression decreased transient virus replication, without affecting cell cycle. Similarly, using cell lines harboring HPV-16 or HPV-31 genome, TopBP1 knockdown increased while over-expression reduced viral copy number relative to genomic DNA. We propose a model in which TopBP1 serves dual roles in viral replication: it is essential for initiation of replication yet it restricts viral copy number. - Highlights: • Protein interaction study confirmed In-situ interaction between TopBP1 and E2. • TopBP1 present at papillomavirus ori in G1/S and early S phase of cell cycle. • TopBP1 knockdown increased, over-expression reduced virus replication. • TopBP1 protein level change did not influence cell survival or cell cycle. • TopBP1 displaced from papillomavirus ori after initiation of replication.

  12. Risk assessment of logistics outsourcing based on BP neural network

    NASA Astrophysics Data System (ADS)

    Liu, Xiaofeng; Tian, Zi-you

    The purpose of this article is to evaluate the risk of the enterprises logistics outsourcing. To get this goal, the paper first analysed he main risks existing in the logistics outsourcing, and then set up a risk evaluation index system of the logistics outsourcing; second applied BP neural network into the logistics outsourcing risk evaluation and used MATLAB to the simulation. It proved that the network error is small and has strong practicability. And this method can be used by enterprises to evaluate the risks of logistics outsourcing.

  13. Features extraction of flotation froth images and BP neural network soft-sensor model of concentrate grade optimized by shuffled cuckoo searching algorithm.

    PubMed

    Wang, Jie-sheng; Han, Shuang; Shen, Na-na; Li, Shu-xia

    2014-01-01

    For meeting the forecasting target of key technology indicators in the flotation process, a BP neural network soft-sensor model based on features extraction of flotation froth images and optimized by shuffled cuckoo search algorithm is proposed. Based on the digital image processing technique, the color features in HSI color space, the visual features based on the gray level cooccurrence matrix, and the shape characteristics based on the geometric theory of flotation froth images are extracted, respectively, as the input variables of the proposed soft-sensor model. Then the isometric mapping method is used to reduce the input dimension, the network size, and learning time of BP neural network. Finally, a shuffled cuckoo search algorithm is adopted to optimize the BP neural network soft-sensor model. Simulation results show that the model has better generalization results and prediction accuracy. PMID:25133210

  14. Features extraction of flotation froth images and BP neural network soft-sensor model of concentrate grade optimized by shuffled cuckoo searching algorithm.

    PubMed

    Wang, Jie-sheng; Han, Shuang; Shen, Na-na; Li, Shu-xia

    2014-01-01

    For meeting the forecasting target of key technology indicators in the flotation process, a BP neural network soft-sensor model based on features extraction of flotation froth images and optimized by shuffled cuckoo search algorithm is proposed. Based on the digital image processing technique, the color features in HSI color space, the visual features based on the gray level cooccurrence matrix, and the shape characteristics based on the geometric theory of flotation froth images are extracted, respectively, as the input variables of the proposed soft-sensor model. Then the isometric mapping method is used to reduce the input dimension, the network size, and learning time of BP neural network. Finally, a shuffled cuckoo search algorithm is adopted to optimize the BP neural network soft-sensor model. Simulation results show that the model has better generalization results and prediction accuracy.

  15. Features Extraction of Flotation Froth Images and BP Neural Network Soft-Sensor Model of Concentrate Grade Optimized by Shuffled Cuckoo Searching Algorithm

    PubMed Central

    Wang, Jie-sheng; Han, Shuang; Shen, Na-na; Li, Shu-xia

    2014-01-01

    For meeting the forecasting target of key technology indicators in the flotation process, a BP neural network soft-sensor model based on features extraction of flotation froth images and optimized by shuffled cuckoo search algorithm is proposed. Based on the digital image processing technique, the color features in HSI color space, the visual features based on the gray level cooccurrence matrix, and the shape characteristics based on the geometric theory of flotation froth images are extracted, respectively, as the input variables of the proposed soft-sensor model. Then the isometric mapping method is used to reduce the input dimension, the network size, and learning time of BP neural network. Finally, a shuffled cuckoo search algorithm is adopted to optimize the BP neural network soft-sensor model. Simulation results show that the model has better generalization results and prediction accuracy. PMID:25133210

  16. Achieving therapeutic targets in renal anaemia: considering cost-efficacy.

    PubMed

    Deray, Gilbert

    2004-07-01

    Erythropoietin treatment for anaemia in chronic kidney disease (CKD) brings important clinical benefits, but restricted healthcare budgets necessitate value-for-money therapies, requiring economic considerations also to be taken into account when selecting a treatment regimen. Subcutaneous (s.c.) administration of epoetin is effective at a lower dose than intravenous (i.v.) administration, offering the potential for substantial reductions in costs of treatment. Unlike epoetin alfa, which is contra-indicated by the s.c. route in Europe in patients with CKD, epoetin beta (NeoRecormon) can be safely and effectively given by either route. The multidose presentations of epoetin beta (Reco-Pen, multidose vials) may provide further opportunity for dose reduction. The tolerability of s.c. epoetin beta is excellent and superior compared with epoetin alfa or darbepoetin alfa. Epoetin beta given once weekly is as effective as two- or three-times weekly, and the dosing frequency can be further reduced to once every 2 weeks in patients who are stable on once-weekly dosing. Reduced dosing frequency is more convenient for the patient and may save nursing time in dialysis units. Overall, s.c. epoetin beta, compared with alternative treatments, may represent a cost-effective treatment option for anaemia management as it combines a well-established safety and efficacy record, favourable local tolerability, and the convenience of once-weekly dosing with the potential to reduce treatment costs by up to 30%. PMID:15265254

  17. P-2 Years Targeted to Achieve Grade 3 Reading Proficiency

    ERIC Educational Resources Information Center

    Gewertz, Catherine

    2011-01-01

    In a bid to help more students read proficiently in 3rd grade--a skill considered critical to their future educational success--new laws and initiatives springing up around the country require educators to step up their efforts to identify and help struggling readers even before they enter kindergarten. It's not unusual for states or school…

  18. Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants.

    PubMed

    Luo, Ming; Gilbert, Brian; Ayliffe, Michael

    2016-07-01

    Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described. PMID:27146973

  19. Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants.

    PubMed

    Luo, Ming; Gilbert, Brian; Ayliffe, Michael

    2016-07-01

    Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described.

  20. SPECTROPOLARIMETRY OF THE CLASSICAL T TAURI STAR BP TAU

    SciTech Connect

    Chen, Wei; Johns-Krull, Christopher M. E-mail: cmj@rice.edu

    2013-10-20

    We implement a least-squares deconvolution (LSD) code to study magnetic fields on cool stars. We first apply our code to high-resolution optical echelle spectra of 53 Cam (a magnetic Ap star) and three well-studied cool stars (Arcturus, 61 Cyg A, and ξ Boo A) as well as the Sun (by observing the asteroid Vesta) as tests of the code and the instrumentation. Our analysis is based on several hundred photospheric lines spanning the wavelength range 5000 Å to 9000 Å. We then apply our LSD code to six nights of data on the Classical T Tauri Star BP Tau. A maximum longitudinal field of 370 ± 80 G is detected from the photospheric lines on BP Tau. A 1.8 kG dipole tilted at 129° with respect to the rotation axis and a 1.4 kG octupole tilted at 104° with respect to the rotation axis, both with a filling factor of 0.25, best fit our LSD Stokes V profiles. Measurements of several emission lines (He I 5876 Å, Ca II 8498 Å, and 8542 Å) show the presence of strong magnetic fields in the line formation regions of these lines, which are believed to be the base of the accretion footpoints. The field strength measured from these lines shows night-to-night variability consistent with rotation of the star.

  1. Redetermination of Fe(2)[BP(3)O(12)].

    PubMed

    Li, Fei Fei; Zhang, Hui Ju; Zhang, Li Na

    2010-01-01

    Explorations of phases in the quaternary Fe(III)-B(III)-P(V)-O system prepared by the high temperature solution growth (HTSG) method led to single-crystal growth of anhydrous diiron(III) borotriphosphate, Fe(2)[BP(3)O(12)]. This phase has been synthesized previously as a microcrystalline material and its structure refined in space group P3 from powder X-ray diffraction data using the Rietveld method [Chen et al. (2004 ▶). J. Inorg. Mater.19, 429-432]. In the current single-crystal study, it was shown that the correct space group is P6(3)/m. The three-dimensional structure of the title compound is built up from FeO(6) octa-hedra (3.. symmetry), trigonal-planar BO(3) groups ( symmetry) and PO(4) tetra-hedra (m.. symmetry). Two FeO(6) octa-hedra form Fe(2)O(9) dimers via face-sharing, while the anionic BO(3) and PO(4) groups are connected via corner-sharing to build up the [BP(3)O(12)](6-) anion. Both units are inter-connected via corner-sharing.

  2. Spectropolarimetry of the Classical T Tauri Star BP Tau

    NASA Astrophysics Data System (ADS)

    Chen, Wei; Johns-Krull, Christopher M.

    2013-10-01

    We implement a least-squares deconvolution (LSD) code to study magnetic fields on cool stars. We first apply our code to high-resolution optical echelle spectra of 53 Cam (a magnetic Ap star) and three well-studied cool stars (Arcturus, 61 Cyg A, and ξ Boo A) as well as the Sun (by observing the asteroid Vesta) as tests of the code and the instrumentation. Our analysis is based on several hundred photospheric lines spanning the wavelength range 5000 Å to 9000 Å. We then apply our LSD code to six nights of data on the Classical T Tauri Star BP Tau. A maximum longitudinal field of 370 ± 80 G is detected from the photospheric lines on BP Tau. A 1.8 kG dipole tilted at 129° with respect to the rotation axis and a 1.4 kG octupole tilted at 104° with respect to the rotation axis, both with a filling factor of 0.25, best fit our LSD Stokes V profiles. Measurements of several emission lines (He I 5876 Å, Ca II 8498 Å, and 8542 Å) show the presence of strong magnetic fields in the line formation regions of these lines, which are believed to be the base of the accretion footpoints. The field strength measured from these lines shows night-to-night variability consistent with rotation of the star.

  3. Characterization of solid hydrogen targets

    SciTech Connect

    Fujiwara, M.C.; Bailey, J.M.; Beer, G.A.

    1995-12-01

    In experiments using the TRIUMF solid hydrogen target systems, knowledge of target thickness and uniformity is often essential in order to extract physical parameters from the data. We have characterized the thickness and uniformity of frozen targets using the energy loss of alpha particles. An accuracy of about 5% was achieved, a limit imposed by the uncertainty in the stopping powers. Details of the method are described and the thickness calibration of the target is presented.

  4. Expression and Localization of CaBP Ca2+ Binding Proteins in the Mouse Cochlea.

    PubMed

    Yang, Tian; Scholl, Elizabeth S; Pan, Ning; Fritzsch, Bernd; Haeseleer, Françoise; Lee, Amy

    2016-01-01

    CaBPs are a family of EF-hand Ca2+ binding proteins that are structurally similar to calmodulin. CaBPs can interact with, and yet differentially modulate, effectors that are regulated by calmodulin, such as Cav1 voltage-gated Ca2+ channels. Immunolabeling studies suggest that multiple CaBP family members (CaBP1, 2, 4, and 5) are expressed in the cochlea. To gain insights into the respective auditory functions of these CaBPs, we characterized the expression and cellular localization of CaBPs in the mouse cochlea. By quantitative reverse transcription PCR, we show that CaBP1 and CaBP2 are the major CaBPs expressed in mouse cochlea both before and after hearing onset. Of the three alternatively spliced variants of CaBP1 (caldendrin, CaBP1-L, and CaBP1-S) and CaBP2 (CaBP2-alt, CaBP2-L, CaBP2-S), caldendrin and CaBP2-alt are the most abundant. By in situ hybridization, probes recognizing caldendrin strongly label the spiral ganglion, while probes designed to recognize all three isoforms of CaBP1 weakly label both the inner and outer hair cells as well as the spiral ganglion. Within the spiral ganglion, caldendrin/CaBP1 labeling is associated with cells resembling satellite glial cells. CaBP2-alt is strongly expressed in inner hair cells both before and after hearing onset. Probes designed to recognize all three variants of CaBP2 strongly label inner hair cells before hearing onset and outer hair cells after the onset of hearing. Thus, CaBP1 and CaBP2 may have overlapping roles in regulating Ca2+ signaling in the hair cells, and CaBP1 may have an additional function in the spiral ganglion. Our findings provide a framework for understanding the role of CaBP family members in the auditory periphery. PMID:26809054

  5. RanBP2/Nup358 Potentiates the Translation of a Subset of mRNAs Encoding Secretory Proteins

    PubMed Central

    Akef, Abdalla; Cui, Xianying A.; Gueroussov, Serge; Cenik, Can; Roth, Frederick P.; Palazzo, Alexander F.

    2013-01-01

    In higher eukaryotes, most mRNAs that encode secreted or membrane-bound proteins contain elements that promote an alternative mRNA nuclear export (ALREX) pathway. Here we report that ALREX-promoting elements also potentiate translation in the presence of upstream nuclear factors. These RNA elements interact directly with, and likely co-evolved with, the zinc finger repeats of RanBP2/Nup358, which is present on the cytoplasmic face of the nuclear pore. Finally we show that RanBP2/Nup358 is not only required for the stimulation of translation by ALREX-promoting elements, but is also required for the efficient global synthesis of proteins targeted to the endoplasmic reticulum (ER) and likely the mitochondria. Thus upon the completion of export, mRNAs containing ALREX-elements likely interact with RanBP2/Nup358, and this step is required for the efficient translation of these mRNAs in the cytoplasm. ALREX-elements thus act as nucleotide platforms to coordinate various steps of post-transcriptional regulation for the majority of mRNAs that encode secreted proteins. PMID:23630457

  6. USGS aerial resolution targets.

    USGS Publications Warehouse

    Salamonowicz, P.H.

    1982-01-01

    It is necessary to measure the achievable resolution of any airborne sensor that is to be used for metric purposes. Laboratory calibration facilities may be inadequate or inappropriate for determining the resolution of non-photographic sensors such as optical-mechanical scanners, television imaging tubes, and linear arrays. However, large target arrays imaged in the field can be used in testing such systems. The USGS has constructed an array of resolution targets in order to permit field testing of a variety of airborne sensing systems. The target array permits any interested organization with an airborne sensing system to accurately determine the operational resolution of its system. -from Author

  7. Iowa Women of Achievement.

    ERIC Educational Resources Information Center

    Ohrn, Deborah Gore, Ed.

    1993-01-01

    This issue of the Goldfinch highlights some of Iowa's 20th century women of achievement. These women have devoted their lives to working for human rights, education, equality, and individual rights. They come from the worlds of politics, art, music, education, sports, business, entertainment, and social work. They represent Native Americans,…

  8. Achieving Peace through Education.

    ERIC Educational Resources Information Center

    Clarken, Rodney H.

    While it is generally agreed that peace is desirable, there are barriers to achieving a peaceful world. These barriers are classified into three major areas: (1) an erroneous view of human nature; (2) injustice; and (3) fear of world unity. In a discussion of these barriers, it is noted that although the consciousness and conscience of the world…

  9. Increasing Male Academic Achievement

    ERIC Educational Resources Information Center

    Jackson, Barbara Talbert

    2008-01-01

    The No Child Left Behind legislation has brought greater attention to the academic performance of American youth. Its emphasis on student achievement requires a closer analysis of assessment data by school districts. To address the findings, educators must seek strategies to remedy failing results. In a mid-Atlantic district of the Unites States,…

  10. Leadership Issues: Raising Achievement.

    ERIC Educational Resources Information Center

    Horsfall, Chris, Ed.

    This document contains five papers examining the meaning and operation of leadership as a variable affecting student achievement in further education colleges in the United Kingdom. "Introduction" (Chris Horsfall) discusses school effectiveness studies' findings regarding the relationship between leadership and effective schools, distinguishes…

  11. Achievements or Disasters?

    ERIC Educational Resources Information Center

    Goodwin, MacArthur

    2000-01-01

    Focuses on policy issues that have affected arts education in the twentieth century, such as: interest in discipline-based arts education, influence of national arts associations, and national standards and coordinated assessment. States that whether the policy decisions are viewed as achievements or disasters are for future determination. (CMK)

  12. Achieving True Consensus.

    ERIC Educational Resources Information Center

    Napier, Rod; Sanaghan, Patrick

    2002-01-01

    Uses the example of Vermont's Middlebury College to explore the challenges and possibilities of achieving consensus about institutional change. Discusses why, unlike in this example, consensus usually fails, and presents four demands of an effective consensus process. Includes a list of "test" questions on successful collaboration. (EV)

  13. School Students' Science Achievement

    ERIC Educational Resources Information Center

    Shymansky, James; Wang, Tzu-Ling; Annetta, Leonard; Everett, Susan; Yore, Larry D.

    2013-01-01

    This paper is a report of the impact of an externally funded, multiyear systemic reform project on students' science achievement on a modified version of the Third International Mathematics and Science Study (TIMSS) test in 33 small, rural school districts in two Midwest states. The systemic reform effort utilized a cascading leadership strategy…

  14. Essays on Educational Achievement

    ERIC Educational Resources Information Center

    Ampaabeng, Samuel Kofi

    2013-01-01

    This dissertation examines the determinants of student outcomes--achievement, attainment, occupational choices and earnings--in three different contexts. The first two chapters focus on Ghana while the final chapter focuses on the US state of Massachusetts. In the first chapter, I exploit the incidence of famine and malnutrition that resulted to…

  15. Assessing Handwriting Achievement.

    ERIC Educational Resources Information Center

    Ediger, Marlow

    Teachers in the school setting need to emphasize quality handwriting across the curriculum. Quality handwriting means that the written content is easy to read in either manuscript or cursive form. Handwriting achievement can be assessed, but not compared to the precision of assessing basic addition, subtraction, multiplication, and division facts.…

  16. Intelligence and Educational Achievement

    ERIC Educational Resources Information Center

    Deary, Ian J.; Strand, Steve; Smith, Pauline; Fernandes, Cres

    2007-01-01

    This 5-year prospective longitudinal study of 70,000+ English children examined the association between psychometric intelligence at age 11 years and educational achievement in national examinations in 25 academic subjects at age 16. The correlation between a latent intelligence trait (Spearman's "g"from CAT2E) and a latent trait of educational…

  17. Explorations in achievement motivation

    NASA Technical Reports Server (NTRS)

    Helmreich, Robert L.

    1982-01-01

    Recent research on the nature of achievement motivation is reviewed. A three-factor model of intrinsic motives is presented and related to various criteria of performance, job satisfaction and leisure activities. The relationships between intrinsic and extrinsic motives are discussed. Needed areas for future research are described.

  18. NCLB: Achievement Robin Hood?

    ERIC Educational Resources Information Center

    Bracey, Gerald W.

    2008-01-01

    In his "Wall Street Journal" op-ed on the 25th of anniversary of "A Nation At Risk", former assistant secretary of education Chester E. Finn Jr. applauded the report for turning U.S. education away from equality and toward achievement. It was not surprising, then, that in mid-2008, Finn arranged a conference to examine the potential "Robin Hood…

  19. Achieving All Our Ambitions

    ERIC Educational Resources Information Center

    Hartley, Tricia

    2009-01-01

    National learning and skills policy aims both to build economic prosperity and to achieve social justice. Participation in higher education (HE) has the potential to contribute substantially to both aims. That is why the Campaign for Learning has supported the ambition to increase the proportion of the working-age population with a Level 4…

  20. INTELLIGENCE, PERSONALITY AND ACHIEVEMENT.

    ERIC Educational Resources Information Center

    MUIR, R.C.; AND OTHERS

    A LONGITUDINAL DEVELOPMENTAL STUDY OF A GROUP OF MIDDLE CLASS CHILDREN IS DESCRIBED, WITH EMPHASIS ON A SEGMENT OF THE RESEARCH INVESTIGATING THE RELATIONSHIP OF ACHIEVEMENT, INTELLIGENCE, AND EMOTIONAL DISTURBANCE. THE SUBJECTS WERE 105 CHILDREN AGED FIVE TO 6.3 ATTENDING TWO SCHOOLS IN MONTREAL. EACH CHILD WAS ASSESSED IN THE AREAS OF…

  1. SALT and Spelling Achievement.

    ERIC Educational Resources Information Center

    Nelson, Joan

    A study investigated the effects of suggestopedic accelerative learning and teaching (SALT) on the spelling achievement, attitudes toward school, and memory skills of fourth-grade students. Subjects were 20 male and 28 female students from two self-contained classrooms at Kennedy Elementary School in Rexburg, Idaho. The control classroom and the…

  2. Appraising Reading Achievement.

    ERIC Educational Resources Information Center

    Ediger, Marlow

    To determine quality sequence in pupil progress, evaluation approaches need to be used which guide the teacher to assist learners to attain optimally. Teachers must use a variety of procedures to appraise student achievement in reading, because no one approach is adequate. Appraisal approaches might include: (1) observation and subsequent…

  3. Quantitative contributions of CtBP-dependent and -independent repression activities of Knirps.

    PubMed

    Struffi, Paolo; Corado, Maria; Kulkarni, Meghana; Arnosti, David N

    2004-05-01

    The Drosophila Knirps protein is a short-range transcriptional repressor that locally inhibits activators by recruiting the CtBP co-repressor. Knirps also possesses CtBP-independent repression activity. The functional importance of multiple repression activities is not well understood, but the finding that Knirps does not repress some cis-regulatory elements in the absence of CtBP suggested that the co-factor may supply a unique function essential to repress certain types of activators. We assayed CtBP-dependent and -independent repression domains of Knirps in Drosophila embryos, and found that the CtBP-independent activity, when provided at higher than normal levels, can repress an eve regulatory element that normally requires CtBP. Dose response analysis revealed that the activity of Knirps containing both CtBP-dependent and -independent repression activities is higher than that of the CtBP-independent domain alone. The requirement for CtBP at certain enhancers appears to reflect the need for overall higher levels of repression, rather than a requirement for an activity unique to CtBP. Thus, CtBP contributes quantitatively, rather than qualitatively, to overall repression function. The finding that both repression activities are simultaneously deployed suggests that the multiple repression activities do not function as cryptic 'backup' systems, but that each contributes quantitatively to total repressor output.

  4. Phosphorylation and Rapid Relocalization of 53BP1 to Nuclear Foci upon DNA Damage

    PubMed Central

    Anderson, Lindsay; Henderson, Catherine; Adachi, Yasuhisa

    2001-01-01

    53BP1 is a human BRCT protein that was originally identified as a p53-interacting protein by the Saccharomyces cerevisiae two-hybrid screen. Although the carboxyl-terminal BRCT domain shows similarity to Crb2, a DNA damage checkpoint protein in fission yeast, there is no evidence so far that implicates 53BP1 in the checkpoint. We have identified a Xenopus homologue of 53BP1 (XL53BP1). XL53BP1 is associated with chromatin and, in some cells, localized to a few large foci under normal conditions. Gamma-ray irradiation induces increased numbers of the nuclear foci in a dose-dependent manner. The damage-induced 53BP1 foci appear rapidly (in 30 min) after irradiation, and de novo protein synthesis is not required for this response. In human cells, 53BP1 foci colocalize with Mrel1 foci at later stages of the postirradiation period. XL53BP1 is hyperphosphorylated after X-ray irradiation, and inhibitors of ATM-related kinases delay the relocalization and reduce the phosphorylation of XL53BP1 in response to X-irradiation. In AT cells, which lack ATM kinase, the irradiation-induced responses of 53BP1 are similarly affected. These results suggest a role for 53BP1 in the DNA damage response and/or checkpoint control which may involve signaling of damage to p53. PMID:11238909

  5. A Structure-Adaptive Hybrid RBF-BP Classifier with an Optimized Learning Strategy

    PubMed Central

    Wen, Hui; Xie, Weixin; Pei, Jihong

    2016-01-01

    This paper presents a structure-adaptive hybrid RBF-BP (SAHRBF-BP) classifier with an optimized learning strategy. SAHRBF-BP is composed of a structure-adaptive RBF network and a BP network of cascade, where the number of RBF hidden nodes is adjusted adaptively according to the distribution of sample space, the adaptive RBF network is used for nonlinear kernel mapping and the BP network is used for nonlinear classification. The optimized learning strategy is as follows: firstly, a potential function is introduced into training sample space to adaptively determine the number of initial RBF hidden nodes and node parameters, and a form of heterogeneous samples repulsive force is designed to further optimize each generated RBF hidden node parameters, the optimized structure-adaptive RBF network is used for adaptively nonlinear mapping the sample space; then, according to the number of adaptively generated RBF hidden nodes, the number of subsequent BP input nodes can be determined, and the overall SAHRBF-BP classifier is built up; finally, different training sample sets are used to train the BP network parameters in SAHRBF-BP. Compared with other algorithms applied to different data sets, experiments show the superiority of SAHRBF-BP. Especially on most low dimensional and large number of data sets, the classification performance of SAHRBF-BP outperforms other training SLFNs algorithms. PMID:27792737

  6. Sputter target

    DOEpatents

    Gates, Willard G.; Hale, Gerald J.

    1980-01-01

    The disclosure relates to an improved sputter target for use in the deposition of hard coatings. An exemplary target is given wherein titanium diboride is brazed to a tantalum backing plate using a gold-palladium-nickel braze alloy.

  7. Increasing Math Achievement through Use of Music.

    ERIC Educational Resources Information Center

    Bryant-Jones, Marian; Shimmins, Kymberley J.; Vega, Jill D.

    This report describes a program for increasing math achievement through the use of musical interventions including repeated exposure to Mozart classical music and School House Rock, and introduction to teacher-made songs that introduce mathematical concepts in the music classroom. The students of the targeted second and fourth grade classes…

  8. Genome-wide target profiling of piggyBac and Tol2 in HEK 293: pros and cons for gene discovery and gene therapy

    PubMed Central

    2011-01-01

    Background DNA transposons have emerged as indispensible tools for manipulating vertebrate genomes with applications ranging from insertional mutagenesis and transgenesis to gene therapy. To fully explore the potential of two highly active DNA transposons, piggyBac and Tol2, as mammalian genetic tools, we have conducted a side-by-side comparison of the two transposon systems in the same setting to evaluate their advantages and disadvantages for use in gene therapy and gene discovery. Results We have observed that (1) the Tol2 transposase (but not piggyBac) is highly sensitive to molecular engineering; (2) the piggyBac donor with only the 40 bp 3'-and 67 bp 5'-terminal repeat domain is sufficient for effective transposition; and (3) a small amount of piggyBac transposases results in robust transposition suggesting the piggyBac transpospase is highly active. Performing genome-wide target profiling on data sets obtained by retrieving chromosomal targeting sequences from individual clones, we have identified several piggyBac and Tol2 hotspots and observed that (4) piggyBac and Tol2 display a clear difference in targeting preferences in the human genome. Finally, we have observed that (5) only sites with a particular sequence context can be targeted by either piggyBac or Tol2. Conclusions The non-overlapping targeting preference of piggyBac and Tol2 makes them complementary research tools for manipulating mammalian genomes. PiggyBac is the most promising transposon-based vector system for achieving site-specific targeting of therapeutic genes due to the flexibility of its transposase for being molecularly engineered. Insights from this study will provide a basis for engineering piggyBac transposases to achieve site-specific therapeutic gene targeting. PMID:21447194

  9. Regulation of Mac-2BP secretion is mediated by its N-glycan binding to ERGIC-53.

    PubMed

    Chen, Yang; Hojo, Sanae; Matsumoto, Naoki; Yamamoto, Kazuo

    2013-07-01

    The leguminous-type (L-type) lectin ER-Golgi intermediate compartment (ERGIC)-53, a homo-oligomeric endoplasmic reticulum (ER)-Golgi recycling protein, functions as a transport receptor for newly synthesized glycoproteins in the early secretory pathway. Although a limited subset of cargo glycoproteins transported by ERGIC-53, such as the coagulation factors V and VIII, cathepsin C and Z and α1-antitrypsin, has been identified, the exact role of the N-glycan binding of ERGIC-53 in the transport of secretory glycoproteins for ER exit has yet to be clarified. By screening a cDNA library isolated from HepG2 cells via a green fluorescent protein fragment complementation assay, we assessed several candidate luminal ERGIC-53-interacting partners and identified Mac-2 binding protein (Mac-2BP) as a novel ERGIC-53-transported cargo glycoprotein. Using an N-glycan-binding-deficient mutant of ERGIC-53 (N156A) or treatment with N-glycosylation processing inhibitors, as well as the introduction of the ER-mis-targeting mutant (KKAA), we demonstrated that the high-mannose-type N-glycan binding of ERGIC-53 contributes to its interaction with Mac-2BP, which is essential for the ERGIC-53-mediated ER-Golgi transport of nascent proteins during early secretion. Furthermore, we also provide evidence that MCFD2 is involved in the secretion of Mac-2BP. These observations reveal a distinct role for the N-glycan binding of ERGIC-53 in the receptor-mediated ER exit of newly synthesized Mac-2BP in the early secretion pathway.

  10. Effects of 4E-BP1 expression on hypoxic cell cycle inhibition and tumor cell proliferation and survival

    PubMed Central

    Barnhart, Bryan C.; Lam, Jennifer C.; Young, Regina M.; Houghton, Peter J.; Keith, Brian; Simon, M. Celeste

    2008-01-01

    Elevated activity of the eIF4F complex, which controls initiation of cap-dependent mRNA translation, has been linked to cancer progression. eIF4E recruitment to eIF4F is the rate limiting step of complex assembly and is regulated by eIF4E-Binding Proteins (4E-BPs). When stimulated, the mammalian Target of Rapamycin complex 1 (mTORC1) phosphorylates 4E-BP1, which then releases eIF4E. Hypoxia inhibits mTORC1 activity and therefore cap-dependent protein synthesis. To establish a novel genetic test of the role of eIF4F activity in regulating cell division and viability within hypoxic tumor microenvironments, we generated shRNA mediated 4E-BP1 knock-down in Rh30 rhabdomyosarcoma cells. 4E-BP1 knock-down relieved hypoxia-mediated inhibition of cycle progression in vitro and was correlated with increased expression of cyclin D1 and c-Myc. Xenograft tumors derived from these cells also displayed enhanced expression of cyclin D1 and c-Myc along with antiapoptotic genes encoding Bcl-xL, and XIAP, and failed to develop the extensive necrotic zones and edema observed in control tumors. Surprisingly, 4E-BP1 knock-down also leads to a dramatic increase in aberrant mitoses in vivo and enhanced expression of Mad2 and securin. Thus, reduced expression of the negative regulator of eIF4E has significant effects on tumor development, and is associated with enhanced cell proliferation and survival. PMID:18708753

  11. An Analysis of the Rapidly Rotating Bp star HD 133880

    NASA Technical Reports Server (NTRS)

    Bailey, J. D.; Grunhut, J.; Shultz, M.; Wade, G.; Landstreet, J. D.; Bohlender, D.; Lim, J.; Wong, K.; Drake, S.; Linsky, J.

    2012-01-01

    HD 133880 is a rapidly rotating chemically peculiar B-type (Bp) star (nu sin i approx = 103km/s) and is host to one of the strongest magnetic fields of any Ap/Bp star. A member of the Upper Centaurus Lupus association, it is a star with a well-determined age of 16 Myr. 12 new spectra, four of which are polarimetric, obtained from the FEROS, ESPaDOnS and HARPS instruments, provide sufficient material from which to re-evaluate the magnetic field and obtain a first approximation to the atmospheric abundance distributions of He, O, Mg, Si, Ti. Cr, Fe, Ni, Pr and Nd. An abundance analysis was carried out using ZEEMAN, a program which synthesizes spectral line profiles for stars with permeating magnetic fields. The magnetic field structure was characterized by a colinear multipole expansion from the observed variations of the longitudinal and surface fields with rotational phase. Both magnetic hemispheres are clearly visible during the stellar rotation, and thus a three-ring abundance distribution model encompassing both magnetic poles and magnetic equator with equal spans in colatitude was adopted. Using the new magnetic field measurements and optical photometry together with previously published data, we refine the period of HD 133880 to P = 0.877 476 +/- 0.000009 d. Our simple axisymmetric magnetic field model is based on a predominantly quadrupolar component that roughly describes the field variations. Using spectrum synthesis, we derived mean abundances for O, Mg, Si, Ti, Cr, Fe and Pr. All elements; except Mg, are overabundant compared to the Son. Mg appears to be approximately uniform over the stellar surface, while all other elements are more abundant in the negative magnetic hemisphere than in the positive magnetic hemisphere. In contrast to most Ap/Bp stars which show an underabundance in 0, in HD 133880 this element is clearly overabundant compared to the solar abundance ratio. In studying the Ha and Paschen lines in the optical spectra, we could not

  12. Project ACHIEVE final report

    SciTech Connect

    1997-06-13

    Project ACHIEVE was a math/science academic enhancement program aimed at first year high school Hispanic American students. Four high schools -- two in El Paso, Texas and two in Bakersfield, California -- participated in this Department of Energy-funded program during the spring and summer of 1996. Over 50 students, many of whom felt they were facing a nightmare future, were given the opportunity to work closely with personal computers and software, sophisticated calculators, and computer-based laboratories -- an experience which their regular academic curriculum did not provide. Math and science projects, exercises, and experiments were completed that emphasized independent and creative applications of scientific and mathematical theories to real world problems. The most important outcome was the exposure Project ACHIEVE provided to students concerning the college and technical-field career possibilities available to them.

  13. Polycomb silencing of the Drosophila 4E-BP gene regulates imaginal disc cell growth.

    PubMed

    Mason-Suares, Heather; Tie, Feng; Yan, Christopher M; Harte, Peter J

    2013-08-01

    Polycomb group (PcG) proteins are best known for their role in maintaining stable, mitotically heritable silencing of the homeotic (HOX) genes during development. In addition to loss of homeotic gene silencing, some PcG mutants also have small imaginal discs. These include mutations in E(z), Su(z)12, esc and escl, which encode Polycomb repressive complex 2 (PRC2) subunits. The cause of this phenotype is not known, but the human homologs of PRC2 subunits have been shown to play a role in cell proliferation, are over-expressed in many tumors, and appear to be required for tumor proliferation. Here we show that the small imaginal disc phenotype arises, at least in part, from a cell growth defect. In homozygous E(z) mutants, imaginal disc cells are smaller than cells in normally proliferating discs. We show that the Thor gene, which encodes eIF4E-binding protein (4E-BP), the evolutionarily conserved inhibitor of cap-dependent translation and potent inhibitor of cell growth, is involved in the development of this phenotype. The Thor promoter region contains DNA binding motifs for transcription factors found in well-characterized Polycomb response elements (PREs), including PHO/PHOL, GAGA factor, and others, suggesting that Thor may be a direct target of Polycomb silencing. We present chromatin immunoprecipitation evidence that PcG proteins are bound to the Thor 5' region in vivo. The Thor gene is normally repressed in imaginal discs, but Thor mRNA and 4E-BP protein levels are elevated in imaginal discs of PRC2 subunit mutant larvae. Deletion of the Thor gene in E(z) mutants partially restores imaginal disc size toward wild-type and results in an increase in the fraction of larvae that pupariate. These results thus suggest that PcG proteins can directly modulate cell growth in Drosophila, in part by regulating Thor expression.

  14. Dihydrochalcomycin Production and Glycosyltransferase from Streptomyces SP. KCTC 0041BP

    PubMed Central

    Thuy, Ta Thi Thu; Sohng, Jae Kyung; Pfeifer, Blaine

    2010-01-01

    The dihydrochalcomycin (GERI) synthetic gene cluster from Streptomyces sp. KCTC 0041BP has been isolated. Two open reading frames (ORFs), designated gerT1 and gerT2 as glycosyltransferase genes, has been identified by sequence analysis. GerT1 encodes for the protein function as dTDP-deoxyallosyltransferase and it is responsible to the attachment of dTDP-allose to the macrolide ring. Similarly, gerT2 encodes for peptide named as dTDP-chacosyltransferase which can transfers the dTDP-4,6-dideoxyglucose to macrolactone core. During process of compound isolation, a new compound has been isolated with molecular weight m/z 755 [M+Na+]. This compound could be the dihydrochalcomycin derivative. The compound has been shown the same antibacterial activity as GERI compound.

  15. BP Cherry Point Cogeneration Project, Draft Environmental Impact Statement

    SciTech Connect

    N /A

    2003-09-19

    BP West Coast Products, LLC (BP or the Applicant) proposes to construct and operate a nominal 720-megawatt (MW), natural-gas-fired, combined-cycle cogeneration facility next to the existing BP Cherry Point Refinery in Whatcom County, Washington. The Applicant also owns and operates the refinery, but the cogeneration facility and the refinery would be operated as separate business units. The cogeneration facility and its ancillary infrastructure would provide steam and 85 MW of electricity to meet the operating needs of the refinery and 635 MW of electrical power for local and regional consumption. The proposed cogeneration facility would be located between Ferndale and Blaine in northwestern Whatcom County, Washington. The Canadian border is approximately 8 miles north of the proposed project site. The Washington State Energy Facility Site Evaluation Council (EFSEC) has jurisdiction over the evaluation of major energy facilities including the proposed project. As such, EFSEC will recommend approval or denial of the proposed cogeneration facility to the governor of Washington after an environmental review. On June 3, 2002, the Applicant filed an Application for Site Certification (ASC No. 2002-01) with EFSEC in accordance with Washington Administrative Code (WAC) 463-42. On April 22, 2003, the Applicant submitted an amended ASC that included, among other things, a change from air to water cooling. With the submission of the ASC and in accordance with the State Environmental Policy Act (SEPA) (WAC 463-47), EFSEC is evaluating the siting of the proposed project and conducting an environmental review with this Environmental Impact Statement (EIS). Because the proposed project requires federal agency approvals and permits, this EIS is intended to meet the requirements under both SEPA and the National Environmental Policy Act (NEPA). The Bonneville Power Administration (Bonneville) and U.S. Army Corps of Engineers (Corps) also will use this EIS as part of their

  16. Does achievement motivation mediate the semantic achievement priming effect?

    PubMed

    Engeser, Stefan; Baumann, Nicola

    2014-10-01

    The aim of our research was to understand the processes of the prime-to-behavior effects with semantic achievement primes. We extended existing models with a perspective from achievement motivation theory and additionally used achievement primes embedded in the running text of excerpts of school textbooks to simulate a more natural priming condition. Specifically, we proposed that achievement primes affect implicit achievement motivation and conducted pilot experiments and 3 main experiments to explore this proposition. We found no reliable positive effect of achievement primes on implicit achievement motivation. In light of these findings, we tested whether explicit (instead of implicit) achievement motivation is affected by achievement primes and found this to be the case. In the final experiment, we found support for the assumption that higher explicit achievement motivation implies that achievement priming affects the outcome expectations. The implications of the results are discussed, and we conclude that primes affect achievement behavior by heightening explicit achievement motivation and outcome expectancies. PMID:24820250

  17. 4E-BP1 regulates the differentiation of white adipose tissue.

    PubMed

    Tsukiyama-Kohara, Kyoko; Katsume, Asao; Kimura, Kazuhiro; Saito, Masayuki; Kohara, Michinori

    2013-07-01

    4E Binding protein 1 (4E-BP1) suppresses translation initiation. The absence of 4E-BP1 drastically reduces the amount of adipose tissue in mice. To address the role of 4E-BP1 in adipocyte differentiation, we characterized 4E-BP1(-/-) mice in this study. The lack of 4E-BP1 decreased the amount of white adipose tissue and increased the amount of brown adipose tissue. In 4E-BP1(-/-) MEF cells, PPARγ coactivator 1 alpha (PGC-1α) expression increased and exogenous 4E-BP1 expression suppressed PGC-1α expression. The level of 4E-BP1 expression was higher in white adipocytes than in brown adipocytes and showed significantly greater up-regulation in white adipocytes than in brown adipocytes during preadipocyte differentiation into mature adipocytes. The amount of PGC-1α was consistently higher in HB cells (a brown preadipocyte cell line) than in HW cells (a white preadipocyte cell line) during differentiation. Moreover, the ectopic over-expression of 4E-BP1 suppressed PGC-1α expression in white adipocytes, but not in brown adipocytes. Thus, the results of our study indicate that 4E-BP1 may suppress brown adipocyte differentiation and PGC-1α expression in white adipose tissues.

  18. Identify Melatonin as a Novel Therapeutic Reagent in the Treatment of 1-Bromopropane(1-BP) Intoxication.

    PubMed

    Xu, Yongpeng; Wang, Shuo; Jiang, Lulu; Wang, Hui; Yang, Yilin; Li, Ming; Wang, Xujing; Zhao, Xiulan; Xie, Keqin

    2016-01-01

    1-Bromopropane (1-BP) has been used as an alternative for fluoride compounds and 1-BP intoxication may involve lung, liver, and central neural system (CNS). Our previous studies showed that 1-BP impaired memory ability by compromising antioxidant cellular defenses. Melatonin is a powerful endogenousantioxidant, and the objective of this study was to explore the therapeutic role of melatonin in the treatment of 1-BP intoxication. Rats were intragastrically treated with 1-BP with or without melatonin, and then sacrificed on 27th day after 1-BP administration. The Morris water maze (MWM) test was used to evaluate the spatial learning and memory ability of the experimental animals, and NeuN staining was performed to assess neuron loss in hippocampus. We found that rats treated with 1-BP spent more time and swam longer distance before landing on the hidden platform with a comparable swimming speed, which was markedly mitigated by the pretreatment with melatonin in a concentration-dependent manner. In addition, 1-BP-induced notable decrease in neuron population in hippocampus by promoting apoptosis, and melatonin pretreatment attenuated those changes in brain. The GSH/GSSG ratio was proportionately decreased and heme oxygenase 1 was increased in the rats exposed to 1-BP (Figure 6), and administration of melatonin restored them. Meanwhile, MDA, the level of lipid peroxidation product, was significantly increased upon exposed to 1-BP, which was significantly attenuated by melatonin pretreatment, indicating that administration of 1-BP could interfere with redox homeostasis of brain in rat, and such 1-BP-induced biomedical changes were reversed by treatment with melatonin.We conclude that treatment with melatonin attenuates 1-BP-induced CNS toxicity through its ROS scavenging effect. PMID:26817862

  19. Identify Melatonin as a Novel Therapeutic Reagent in the Treatment of 1-Bromopropane(1-BP) Intoxication

    PubMed Central

    Xu, Yongpeng; Wang, Shuo; Jiang, Lulu; Wang, Hui; Yang, Yilin; Li, Ming; Wang, Xujing; Zhao, Xiulan; Xie, Keqin

    2016-01-01

    Abstract 1-Bromopropane (1-BP) has been used as an alternative for fluoride compounds and 1-BP intoxication may involve lung, liver, and central neural system (CNS). Our previous studies showed that 1-BP impaired memory ability by compromising antioxidant cellular defenses. Melatonin is a powerful endogenous antioxidant, and the objective of this study was to explore the therapeutic role of melatonin in the treatment of 1-BP intoxication. Rats were intragastrically treated with 1-BP with or without melatonin, and then sacrificed on 27th day after 1-BP administration. The Morris water maze (MWM) test was used to evaluate the spatial learning and memory ability of the experimental animals, and NeuN staining was performed to assess neuron loss in hippocampus. We found that rats treated with 1-BP spent more time and swam longer distance before landing on the hidden platform with a comparable swimming speed, which was markedly mitigated by the pretreatment with melatonin in a concentration-dependent manner. In addition, 1-BP-induced notable decrease in neuron population in hippocampus by promoting apoptosis, and melatonin pretreatment attenuated those changes in brain. The GSH/GSSG ratio was proportionately decreased and heme oxygenase 1 was increased in the rats exposed to 1-BP (Figure 6), and administration of melatonin restored them. Meanwhile, MDA, the level of lipid peroxidation product, was significantly increased upon exposed to 1-BP, which was significantly attenuated by melatonin pretreatment, indicating that administration of 1-BP could interfere with redox homeostasis of brain in rat, and such 1-BP-induced biomedical changes were reversed by treatment with melatonin. We conclude that treatment with melatonin attenuates 1-BP-induced CNS toxicity through its ROS scavenging effect. PMID:26817862

  20. The Translational Repressor 4E-BP1 Contributes to Diabetes-Induced Visual Dysfunction

    PubMed Central

    Miller, William P.; Mihailescu, Maria L.; Yang, Chen; Barber, Alistair J.; Kimball, Scot R.; Jefferson, Leonard S.; Dennis, Michael D.

    2016-01-01

    Purpose The translational repressor 4E-BP1 interacts with the mRNA cap-binding protein eIF4E and thereby promotes cap-independent translation of mRNAs encoding proteins that contribute to diabetic retinopathy. Interaction of 4E-BP1 with eIF4E is enhanced in the retina of diabetic rodents, at least in part, as a result of elevated 4E-BP1 protein expression. In the present study, we examined the role of 4E-BP1 in diabetes-induced visual dysfunction, as well as the mechanism whereby hyperglycemia promotes 4E-BP1 expression. Methods Nondiabetic and diabetic wild-type and 4E-BP1/2 knockout mice were evaluated for visual function using a virtual optomotor test (Optomotry). Retinas were harvested from nondiabetic and type 1 diabetic mice and analyzed for protein abundance and posttranslational modifications. Similar analyses were performed on cells in culture exposed to hyperglycemic conditions or an O-GlcNAcase inhibitor (Thiamet G [TMG]). Results Diabetes-induced visual dysfunction was delayed in mice deficient of 4E-BP1/2 as compared to controls. 4E-BP1 protein expression was enhanced by hyperglycemia in the retina of diabetic rodents and by hyperglycemic conditions in retinal cells in culture. A similar elevation in 4E-BP1 expression was observed with TMG. The rate of 4E-BP1 degradation was significantly prolonged by either hyperglycemic conditions or TMG. A PEST motif in the C-terminus of 4E-BP1 regulated polyubiquitination, turnover, and binding of an E3 ubiquitin ligase complex containing CUL3. Conclusions The findings support a model whereby elevated 4E-BP1 expression observed in the retina of diabetic rodents is the result of O-GlcNAcylation of 4E-BP1 within its PEST motif. PMID:26998719

  1. CacyBP/SIP nuclear translocation induced by gastrin promotes gastric cancer cell proliferation

    PubMed Central

    Zhai, Hui-Hong; Meng, Juan; Wang, Jing-Bo; Liu, Zhen-Xiong; Li, Yuan-Fei; Feng, Shan-Shan

    2014-01-01

    AIM: To investigate the role of nuclear translocation of calcyclin binding protein, also called Siah-1 interacting protein (CacyBP/SIP), in gastric carcinogenesis. METHODS: The expression of CacyBP/SIP protein in gastric cancer cell lines was detected by Western blot. Immunofluorescence experiments were performed on gastric cancer cell lines that had been either unstimulated or stimulated with gastrin. To confirm the immunofluorescence findings, the relative abundance of CacyBP/SIP in nuclear and cytoplasmic compartments was assessed by Western blot. The effect of nuclear translocation of CacyBP/SIP on cell proliferation was examined using MTT assay. The colony formation assay was used to measure clonogenic cell survival. The effect of CacyBP/SIP nuclear translocation on cell cycle progression was investigated. Two CacyBP/SIP-specific siRNA vectors were designed and constructed to inhibit CacyBP/SIP expression in order to reduce the nuclear translocation of CacyBP/SIP, and the expression of CacyBP/SIP in stably transfected cells was determined by Western blot. The effect of inhibiting CacyBP/SIP nuclear translocation on cell proliferation was then assessed. RESULTS: CacyBP/SIP protein was present in most of gastric cancer cell lines. In unstimulated cells, CacyBP/SIP was distributed throughout the cytoplasm; while in stimulated cells, CacyBP/SIP was found mainly in the perinuclear region. CacyBP/SIP nuclear translocation generated a growth-stimulatory effect on cells. The number of colonies in the CacyBP/SIP nuclear translocation group was significantly higher than that in the control group. The percentage of stimulated cells in G1 phase was significantly lower than that of control cells (69.70% ± 0.46% and 65.80% ± 0.60%, control cells and gastrin-treated SGC7901 cells, P = 0.008; 72.99% ± 0.46% and 69.36% ± 0.51%, control cells and gastrin-treated MKN45 cells, P = 0.022). CacyBP/SIPsi1 effectively down-regulated the expression of CacyBP/SIP, and cells stably

  2. An analysis of the rapidly rotating Bp star HD 133880

    NASA Astrophysics Data System (ADS)

    Bailey, J. D.; Grunhut, J.; Shultz, M.; Wade, G.; Landstreet, J. D.; Bohlender, D.; Lim, J.; Wong, K.; Drake, S.; Linsky, J.

    2012-06-01

    HD 133880 is a rapidly rotating chemically peculiar B-type (Bp) star (v sin i≃ 103 km s-1) and is host to one of the strongest magnetic fields of any Ap/Bp star. A member of the Upper Centaurus Lupus association, it is a star with a well-determined age of 16 Myr. 12 new spectra, four of which are polarimetric, obtained from the FEROS, ESPaDOnS and HARPS instruments, provide sufficient material from which to re-evaluate the magnetic field and obtain a first approximation to the atmospheric abundance distributions of He, O, Mg, Si, Ti, Cr, Fe, Ni, Pr and Nd. An abundance analysis was carried out using ZEEMAN, a program which synthesizes spectral line profiles for stars with permeating magnetic fields. The magnetic field structure was characterized by a colinear multipole expansion from the observed variations of the longitudinal and surface fields with rotational phase. Both magnetic hemispheres are clearly visible during the stellar rotation, and thus a three-ring abundance distribution model encompassing both magnetic poles and magnetic equator with equal spans in colatitude was adopted. Using the new magnetic field measurements and optical photometry together with previously published data, we refine the period of HD 133880 to P= 0.877 476 ± 0.000 009 d. Our simple axisymmetric magnetic field model is based on a predominantly quadrupolar component that roughly describes the field variations. Using spectrum synthesis, we derived mean abundances for O, Mg, Si, Ti, Cr, Fe and Pr. All elements, except Mg, are overabundant compared to the Sun. Mg appears to be approximately uniform over the stellar surface, while all other elements are more abundant in the negative magnetic hemisphere than in the positive magnetic hemisphere. In contrast to most Ap/Bp stars which show an underabundance in O, in HD 133880 this element is clearly overabundant compared to the solar abundance ratio. In studying the Hα and Paschen lines in the optical spectra, we could not unambiguously

  3. Complete genome sequence of Bp7, an Escherichia coli bacteriophage with a wide host range.

    PubMed

    Zhang, Can; Liu, Wenhua; Ren, Huiying

    2012-12-01

    Chicken colibacillosis is caused by some pathogenic Escherichia coli strains. Thirty-five pathogenic antibiotic-resistant E. coli strains were used in the host range detection of bacteriophage Bp7. The phage showed a wide range of E. coli hosts (46%). The complete genome of bacteriophage Bp7 was sequenced, assembled, and analyzed. The results revealed a linear double-stranded DNA sequence of 168,066 bp harboring 791 open reading frames. The major findings from its annotation are described.

  4. Using L-M BP Algorithm Forecase the 305 Days Production of First-Breed Dairy

    NASA Astrophysics Data System (ADS)

    Wei, Xiaoli; Qi, Guoqiang; Shen, Weizheng; Jian, Sun

    Aiming at the shortage of conventional BP algorithm, a BP neural net works improved by L-M algorithm is put forward. On the basis of the network, a Prediction model for 305 day's milk productions was set up. Traditional methods finish these data must spend at least 305 days, But this model can forecast first-breed dairy's 305 days milk production ahead of 215 days. The validity of the improved BP neural network predictive model was validated through the experiments.

  5. Achieving closure at Fernald

    SciTech Connect

    Bradburne, John; Patton, Tisha C.

    2001-02-25

    When Fluor Fernald took over the management of the Fernald Environmental Management Project in 1992, the estimated closure date of the site was more than 25 years into the future. Fluor Fernald, in conjunction with DOE-Fernald, introduced the Accelerated Cleanup Plan, which was designed to substantially shorten that schedule and save taxpayers more than $3 billion. The management of Fluor Fernald believes there are three fundamental concerns that must be addressed by any contractor hoping to achieve closure of a site within the DOE complex. They are relationship management, resource management and contract management. Relationship management refers to the interaction between the site and local residents, regulators, union leadership, the workforce at large, the media, and any other interested stakeholder groups. Resource management is of course related to the effective administration of the site knowledge base and the skills of the workforce, the attraction and retention of qualified a nd competent technical personnel, and the best recognition and use of appropriate new technologies. Perhaps most importantly, resource management must also include a plan for survival in a flat-funding environment. Lastly, creative and disciplined contract management will be essential to effecting the closure of any DOE site. Fluor Fernald, together with DOE-Fernald, is breaking new ground in the closure arena, and ''business as usual'' has become a thing of the past. How Fluor Fernald has managed its work at the site over the last eight years, and how it will manage the new site closure contract in the future, will be an integral part of achieving successful closure at Fernald.

  6. CtBP and associated LSD1 are required for transcriptional activation by NeuroD1 in gastrointestinal endocrine cells.

    PubMed

    Ray, Subir K; Li, H Joyce; Metzger, Eric; Schüle, Roland; Leiter, Andrew B

    2014-06-01

    Gene expression programs required for differentiation depend on both DNA-bound transcription factors and surrounding histone modifications. Expression of the basic helix-loop-helix (bHLH) protein NeuroD1 is restricted to endocrine cells in the gastrointestinal (GI) tract, where it is important for endocrine differentiation. RREB1 (RAS-responsive element binding protein 1), identified as a component of the CtBP corepressor complex, binds to nearby DNA elements to associate with NeuroD and potentiate transcription of a NeuroD1 target gene. Transcriptional activation by RREB1 depends on recruitment of CtBP with its associated proteins, including LSD1, through its PXDLS motifs. The mechanism of transcriptional activation by CtBP has not been previously characterized. Here we found that activation was dependent on the histone H3 lysine 9 (H3K9) demethylase activity of LSD1, which removes repressive methyl marks from dimethylated H3K9 (H3K9Me2), to facilitate subsequent H3K9 acetylation by the NeuroD1-associated histone acetyltransferase, P300/CBP-associated factor (PCAF). The secretin, β-glucokinase, insulin I, and insulin II genes, four known direct targets of NeuroD1 in intestinal and pancreatic endocrine cells, all show similar promoter occupancy by CtBP-associated proteins and PCAF, with acetylation of H3K9. This work may indicate a mechanism for selective regulation of transcription by CtBP and LSD1 involving their association with specific transcription factors and cofactors to drive tissue-specific transcription.

  7. Association of BP with Death, Cardiovascular Events, and Progression to Chronic Dialysis in Patients with Advanced Kidney Disease

    PubMed Central

    Palit, Shyamal; Chonchol, Michel; Cheung, Alfred K.; Kaufman, James; Smits, Gerard

    2015-01-01

    Background and objective The optimal BP target to reduce adverse clinical outcomes in patients with CKD is unclear. This study examined the relationship between BP and death, cardiovascular events (CVEs), and kidney disease progression in patients with advanced kidney disease. Design, setting, participants, & measurements The relationship of systolic BP (SBP), diastolic BP (DBP), and pulse pressure (PP) with death, CVE, and progression to long-term dialysis was examined in 1099 patients with advanced CKD (eGFR≤30 ml/min per 1.7 3m2; not receiving dialysis) who participated in the Homocysteine in Kidney and ESRD study. That study enrolled participants from 2001 to 2003. Cox proportional hazard models were used to examine the association between BP and adverse outcomes. Results The mean±SD baseline eGFR was 18±7 ml/min per 1.73 m2. During a median follow-up of 2.9 years, 453 patients died, 215 had a CVE, and 615 initiated long-term dialysis. After adjustment for demographic characteristics and confounders, SBP, DBP, and PP were not associated with a higher risk of death. SBP and DBP were also not associated with CVE. The highest quartile of PP was associated with a substantial higher risk of CVE compared with the lowest quartile (hazard ratio [HR], 1.67; 95% confidence interval [95% CI], 1.10 to 2.52). The highest quartiles of SBP (HR, 1.28; 95% CI, 1.01 to 1.61) and DBP (HR, 1.36; 95% CI, 1.07 to 1.73), but not PP, were associated with a higher risk of progression to long-term dialysis compared with the lowest quartile. Conclusions In patients with advanced kidney disease not undergoing dialysis, higher PP was strongly associated with CVE whereas higher SBP and DBP were associated with progression to long-term dialysis. These results suggest that SBP and DBP should not be the only factors considered in determining antihypertensive therapy; elevated PP should also be considered. PMID:25979975

  8. The relationship between prenatal exposure to BP-3 and Hirschsprung's disease.

    PubMed

    Huo, Weiwei; Cai, Peng; Chen, Minjian; Li, Hongxing; Tang, Junwei; Xu, Chao; Zhu, Dongmei; Tang, Weibing; Xia, Yankai

    2016-02-01

    Hirschsprung's disease (HSCR) is neonatal intestinal abnormality which derived from the faliure of enteric neural crest cells migration to hindgut during embryogenesis from 5 to 12 weeks. Currenly, the knowledge of environmental factors contributing to HSCR is still scarce. Benzophenone-3 (BP-3) is one of the most widely used UV filters, and has weak estrogen and strong anti-androgenic effects. In order to examine the effect of maternal BP-3 exposure on development of offspring and explore the potential mechanism, we conducted case and control study and in vitro study. In this work, BP-3 concertrations in maternal urine was detected by ultra-high performance liquid chromatography. Besides, we investigated the cytotoxicity and receptor tyrosine kinase (RET) expression in cells exposed to BP-3. The results showed that maternal BP-3 exposure was associated with offspring's HSCR in the population as well as inhibited migration of 293T and SH-SY5Y cells. What's more, we discovered dose-response relationship between RET expression and BP-3 exposure dose, and miR-218 and some other genes involved in SLIT2/ROBO1-miR-218-RET/PLAG1 pathway were also related to BP-3 exposure. Therefore, we deduced that BP-3 influenced cell migration via SLIT2/ROBO1-miR-218-RET/PLAG1 pathway. Our study firstly revealed the relationship between maternal BP-3 exposure and HSCR as well as its potential mechanism.

  9. Icariside II, a natural mTOR inhibitor, disrupts aberrant energy homeostasis via suppressing mTORC1-4E-BP1 axis in sarcoma cells.

    PubMed

    Zhang, Chao; Yang, Lei; Geng, Ya-di; An, Fa-Liang; Xia, Yuan-Zheng; Guo, Chao; Luo, Jian-Guang; Zhang, Lu-Yong; Guo, Qing-Long; Kong, Ling-Yi

    2016-05-10

    The aberrant energy homeostasis that characterized by high rate of energy production (glycolysis) and energy consumption (mRNA translation) is associated with the development of cancer. As mammalian target of rapamycin (mTOR) is a critical regulator of aberrant energy homeostasis, it is an attractive target for anti-tumor intervention. The flavonoid compound Icariside II (IS) is a natural mTOR inhibitor derived from Epimedium. Koreanum. Herein, we evaluate the effect of IS on aberrant energy homeostasis. The reduction of glycolysis and mRNA translation in U2OS (osteosarcoma), S180 (fibrosarcoma) and SW1535 (chondrosarcoma) cells observed in our study, indicate that, IS inhibits aberrant energy homeostasis. This inhibition is found to be due to suppression of mammalian target of rapamycin complex 1 (mTORC1)-eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) axis through blocking the assembly of mTORC1. Furthermore, IS inhibits the cap-dependent translation of c-myc through mTORC1-4E-BP1 axis which links the relationship between mRNA translation and glycolysis. Inhibition of aberrant energy homeostasis by IS, contributes to its in vitro and in vivo anti-proliferation activity. These data indicate that IS disrupts aberrant energy homeostasis of sarcoma cells through suppression of mTORC1-4E-BP1 axis, providing a novel mechanism of IS to inhibit cell proliferation in sarcoma cells.

  10. Icariside II, a natural mTOR inhibitor, disrupts aberrant energy homeostasis via suppressing mTORC1-4E-BP1 axis in sarcoma cells.

    PubMed

    Zhang, Chao; Yang, Lei; Geng, Ya-di; An, Fa-Liang; Xia, Yuan-Zheng; Guo, Chao; Luo, Jian-Guang; Zhang, Lu-Yong; Guo, Qing-Long; Kong, Ling-Yi

    2016-05-10

    The aberrant energy homeostasis that characterized by high rate of energy production (glycolysis) and energy consumption (mRNA translation) is associated with the development of cancer. As mammalian target of rapamycin (mTOR) is a critical regulator of aberrant energy homeostasis, it is an attractive target for anti-tumor intervention. The flavonoid compound Icariside II (IS) is a natural mTOR inhibitor derived from Epimedium. Koreanum. Herein, we evaluate the effect of IS on aberrant energy homeostasis. The reduction of glycolysis and mRNA translation in U2OS (osteosarcoma), S180 (fibrosarcoma) and SW1535 (chondrosarcoma) cells observed in our study, indicate that, IS inhibits aberrant energy homeostasis. This inhibition is found to be due to suppression of mammalian target of rapamycin complex 1 (mTORC1)-eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) axis through blocking the assembly of mTORC1. Furthermore, IS inhibits the cap-dependent translation of c-myc through mTORC1-4E-BP1 axis which links the relationship between mRNA translation and glycolysis. Inhibition of aberrant energy homeostasis by IS, contributes to its in vitro and in vivo anti-proliferation activity. These data indicate that IS disrupts aberrant energy homeostasis of sarcoma cells through suppression of mTORC1-4E-BP1 axis, providing a novel mechanism of IS to inhibit cell proliferation in sarcoma cells. PMID:27056897

  11. Icariside II, a natural mTOR inhibitor, disrupts aberrant energy homeostasis via suppressing mTORC1-4E-BP1 axis in sarcoma cells

    PubMed Central

    Zhang, Chao; Yang, Lei; Geng, Ya-di; An, Fa-liang; Xia, Yuan-zheng; Guo, Chao; Luo, Jian-guang; Zhang, Lu-yong; Guo, Qing-long; Kong, Ling-yi

    2016-01-01

    The aberrant energy homeostasis that characterized by high rate of energy production (glycolysis) and energy consumption (mRNA translation) is associated with the development of cancer. As mammalian target of rapamycin (mTOR) is a critical regulator of aberrant energy homeostasis, it is an attractive target for anti-tumor intervention. The flavonoid compound Icariside II (IS) is a natural mTOR inhibitor derived from Epimedium. Koreanum. Herein, we evaluate the effect of IS on aberrant energy homeostasis. The reduction of glycolysis and mRNA translation in U2OS (osteosarcoma), S180 (fibrosarcoma) and SW1535 (chondrosarcoma) cells observed in our study, indicate that, IS inhibits aberrant energy homeostasis. This inhibition is found to be due to suppression of mammalian target of rapamycin complex 1 (mTORC1)-eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) axis through blocking the assembly of mTORC1. Furthermore, IS inhibits the cap-dependent translation of c-myc through mTORC1-4E-BP1 axis which links the relationship between mRNA translation and glycolysis. Inhibition of aberrant energy homeostasis by IS, contributes to its in vitro and in vivo anti-proliferation activity. These data indicate that IS disrupts aberrant energy homeostasis of sarcoma cells through suppression of mTORC1-4E-BP1 axis, providing a novel mechanism of IS to inhibit cell proliferation in sarcoma cells. PMID:27056897

  12. LIQUID TARGET

    DOEpatents

    Martin, M.D.; Salsig, W.W. Jr.

    1959-01-13

    A liquid handling apparatus is presented for a liquid material which is to be irradiated. The apparatus consists essentially of a reservoir for the liquid, a target element, a drain tank and a drain lock chamber. The target is in the form of a looped tube, the upper end of which is adapted to be disposed in a beam of atomic particles. The lower end of the target tube is in communication with the liquid in the reservoir and a means is provided to continuously circulate the liquid material to be irradiated through the target tube. Means to heat the reservoir tank is provided in the event that a metal is to be used as the target material. The apparatus is provided with suitable valves and shielding to provide maximum safety in operation.

  13. [Target organ effects in untreated hypertension].

    PubMed

    Babici, D; M'Pio, I; Hadj-Aïssa, A; Ducher, M; Laville, M; Fauvel, J P

    2003-01-01

    The parallel investigation of the renal and cardiac complications of recent and never treated systemic hypertension has only rarely been undertaken. The aim of this study was to define the renal function of never treated hypertensive subjects, separated into white coat hypertensives (HTbb: n = 19, BP at consultation 153/97 mmHg) or permanent hypertensives (HT: n = 49, BP at consultation 169/104 mmHg) as a function of their 24 hour BP. Their renal functions were then compared with those of normotensive subjects (NT: n = 10). The 68 hypertensive subjects seen consecutively underwent renal function investigation (DFG: glomerular filtration rate, DPR: renal plasmatic debit, and muAlb: microalbuminuria over 24 hours), and myocardial echography (measurement of the left ventricular mass index, IMVG). The white coat hypertensives had a normal renal function, while the permanent hypertensives had a significant decrease in DPR and a significantly higher muAlb compared to the normotensives. Compared to the white coat hypertensives, the permanent hypertensives had a significantly lower DFG and DPR, as well as a higher muAlb and IMVG. In all the hypertensives (white coat and permanent) the 24 hour systolic BP was significantly correlated with muAlb (r = 0.51, p < 0.001), filtration fraction (r = 0.30, p < 0.05), and IMVG (r = 0.52, p < 0.001). The renal and myocardial parameters were not significantly correlated. In conclusion, there seems to be a continuum between the level of ambulatory BP and the effect on target organs without a parallel progression of the renal and myocardial effects. From a practical point of view, only ambulatory BP measurement allows differentiation of permanent hypertensives who have a very early renal and/or myocardial effect, while white coat hypertensives are spared.

  14. Achievement Goals and Achievement Emotions: A Meta-Analysis

    ERIC Educational Resources Information Center

    Huang, Chiungjung

    2011-01-01

    This meta-analysis synthesized 93 independent samples (N = 30,003) in 77 studies that reported in 78 articles examining correlations between achievement goals and achievement emotions. Achievement goals were meaningfully associated with different achievement emotions. The correlations of mastery and mastery approach goals with positive achievement…

  15. Targeted Support

    ERIC Educational Resources Information Center

    Simon, Gabe

    2011-01-01

    Heritage Oak Elementary School (Placer County, CA) has continuously achieved a high level of academic success as measured by the California Standards Test. However, after examining student testing data in depth, staff discovered a large achievement gap between the overall school population, socio-economically disadvantaged students, and students…

  16. Multiple target laser ablation system

    DOEpatents

    Mashburn, Douglas N.

    1996-01-01

    A laser ablation apparatus and method are provided in which multiple targets consisting of material to be ablated are mounted on a movable support. The material transfer rate is determined for each target material, and these rates are stored in a controller. A position detector determines which target material is in a position to be ablated, and then the controller controls the beam trigger timing and energy level to achieve a desired proportion of each constituent material in the resulting film.

  17. Multiple target laser ablation system

    DOEpatents

    Mashburn, D.N.

    1996-01-09

    A laser ablation apparatus and method are provided in which multiple targets consisting of material to be ablated are mounted on a movable support. The material transfer rate is determined for each target material, and these rates are stored in a controller. A position detector determines which target material is in a position to be ablated, and then the controller controls the beam trigger timing and energy level to achieve a desired proportion of each constituent material in the resulting film. 3 figs.

  18. The BP oil spill and the bounty of Plaquemines Parish.

    PubMed

    Fertel, Randy

    2011-01-01

    The source of 25 to 30 percent of America's seafood, the Mississippi River Delta's cornucopian world is now uncertain. And yet, even if shrimp, oysters, and finfish are unaffected by the BP Oil Spill - a big if - one can already reflect on the passing of the culture once built upon gathering them. For almost three centuries, levees made life possible along the riverbanks and in the wetlands beyond. Those same levees also ensured the wetlands would eventually melt away into the Gulf. Cutting off the silt left behind during annual river inundations subjected the fragile land to erosion. Sulfur, natural gas, and oil production companies dug twenty thousand miles of canals to gain more direct routes to their fields and to pump out their mineral wealth. This caused salt-water intrusion that killed off plant life and caused more erosion. The world that sustained my Plaquemines ancestors was less subject to collapse following disasters not only because the ecosystem before the wetlands' ongoing loss was then more vibrant, complex, and robust; but also because their lives, especially their culinary lives, were more vibrant, complex, and robust. Life was hard, but when it came to putting food on the table, life followed the seasons. PMID:21591308

  19. The BP oil spill and the bounty of Plaquemines Parish.

    PubMed

    Fertel, Randy

    2011-01-01

    The source of 25 to 30 percent of America's seafood, the Mississippi River Delta's cornucopian world is now uncertain. And yet, even if shrimp, oysters, and finfish are unaffected by the BP Oil Spill - a big if - one can already reflect on the passing of the culture once built upon gathering them. For almost three centuries, levees made life possible along the riverbanks and in the wetlands beyond. Those same levees also ensured the wetlands would eventually melt away into the Gulf. Cutting off the silt left behind during annual river inundations subjected the fragile land to erosion. Sulfur, natural gas, and oil production companies dug twenty thousand miles of canals to gain more direct routes to their fields and to pump out their mineral wealth. This caused salt-water intrusion that killed off plant life and caused more erosion. The world that sustained my Plaquemines ancestors was less subject to collapse following disasters not only because the ecosystem before the wetlands' ongoing loss was then more vibrant, complex, and robust; but also because their lives, especially their culinary lives, were more vibrant, complex, and robust. Life was hard, but when it came to putting food on the table, life followed the seasons.

  20. Entrepreneur achievement. Liaoning province.

    PubMed

    Zhao, R

    1994-03-01

    This paper reports the successful entrepreneurial endeavors of members of a 20-person women's group in Liaoning Province, China. Jing Yuhong, a member of the Family Planning Association at Shileizi Village, Dalian City, provided the basis for their achievements by first building an entertainment/study room in her home to encourage married women to learn family planning. Once stocked with books, magazines, pamphlets, and other materials on family planning and agricultural technology, dozens of married women in the neighborhood flocked voluntarily to the room. Yuhong also set out to give these women a way to earn their own income as a means of helping then gain greater equality with their husbands and exert greater control over their personal reproductive and social lives. She gave a section of her farming land to the women's group, loaned approximately US$5200 to group members to help them generate income from small business initiatives, built a livestock shed in her garden for the group to raise marmots, and erected an awning behind her house under which mushrooms could be grown. The investment yielded $12,000 in the first year, allowing each woman to keep more than $520 in dividends. Members then soon began going to fairs in the capital and other places to learn about the outside world, and have successfully ventured out on their own to generate individual incomes. Ten out of twenty women engaged in these income-generating activities asked for and got the one-child certificate.

  1. BRCA1 promoter hypermethylation, 53BP1 protein expression and PARP-1 activity as biomarkers of DNA repair deficit in breast cancer

    PubMed Central

    2013-01-01

    Background Poly(adenosine diphosphate–ribose) polymerase 1 (PARP-1) and the balance between BRCA1 and 53BP1 play a key role in the DNA repair and cell stress response. PARP inhibitors show promising clinical activity in metastatic triple negative (TN) or BRCA-mutated breast cancer. However, a comprehensive analysis of PARP-1 activity, BRCA1 promoter methylation and 53BP1 expression in tumours without known BRCA1 mutation has not yet been carried out. Methods We investigated cytosolic PARP-1 activity, 53BP1 protein levels and BRCA1 promoter methylation in 155 surgical breast tumour samples from patients without familial breast cancer history or known BRCA1 mutations who were treated between January 2006 and November 2009 and evaluated their statistical association with classical predictive and prognostic factors. Results The mitotic count score was the only parameter clearly associated with PARP-1 activity. BRCA1 promoter hypermethylation (15.4% of all cancers) was significantly associated with uPA and PAI-1 levels, tumour grade, mitotic count score, hormone receptor and HER2 negative status and TN profile (29% of TN tumours showed BRCA1 promoter hypermethylation compared to 5% of grade II-III hormone receptor-positive/HER2-negative and 2% of HER2-positive tumours). No statistical association was found between BRCA1 promoter hypermethylation and PARP-1 activity. High 53BP1 protein levels correlated with lymph node positivity, hormone receptor positivity, molecular grouping, unmethylated BRCA1 promoter and PARP-1 activity. In TN tumours, BRCA1 promoter methylation was only marginally associated with age, PARP-1 activity was not associated with any of the tested clinico-pathological factors and high 53BP1 protein levels were significantly associated with lymph node positivity. Only 3 of the 14 TN tumours with BRCA1 promoter hypermethylation presented high 53BP1 protein levels. Conclusions Breast cancers that harbour simultaneously high 53BP1 protein level and BRCA1

  2. Design and characterization of novel antimicrobial peptides, R-BP100 and RW-BP100, with activity against Gram-negative and Gram-positive bacteria.

    PubMed

    Torcato, Inês M; Huang, Yen-Hua; Franquelim, Henri G; Gaspar, Diana; Craik, David J; Castanho, Miguel A R B; Troeira Henriques, Sónia

    2013-03-01

    BP100 is a short cationic antimicrobial peptide with a mechanism of action dependent on peptide-lipid interactions and microbial surface charge neutralization. Although active against Gram-negative bacteria, BP100 is inactive against Gram-positive bacteria. In this study we report two newly designed BP100 analogues, RW-BP100 and R-BP100 that have the Tyr residue replaced with a Trp and/or the Lys residues replaced with an Arg. The new analogues in addition to being active against Gram-negative bacteria, possess activity against all tested Gram-positive bacteria. Mechanistic studies using atomic force microscopy, surface plasmon resonance and fluorescence methodologies reveal that the antibacterial efficiency follows the affinity for bacterial membrane. The studies suggest that the activity of BP100 and its analogues against Gram-negative bacteria is mainly driven by electrostatic interactions with the lipopolysaccharide layer and is followed by binding to and disruption of the inner membrane, whereas activity against Gram-positive bacteria, in addition to electrostatic attraction to the exposed lipoteichoic acids, requires an ability to more deeply insert in the membrane environment, which is favoured with Arg residues and is facilitated in the presence of a Trp residue. Knowledge on the mechanism of action of these antimicrobial peptides provides information that assists in the design of antimicrobials with higher efficacy and broader spectra of action, but also on the design of peptides with higher specificity if required. PMID:23246973

  3. S1219 residue of 53BP1 is phosphorylated by ATM kinase upon DNA damage and required for proper execution of DNA damage response

    SciTech Connect

    Lee, Haemi; Kwak, Hee-Jin; Cho, Il-taeg; Park, Seok Hee; Lee, Chang-Hun

    2009-01-02

    53BP1 is phosphorylated by the protein kinase ATM upon DNA damage. Even though several ATM phosphorylation sites in 53BP1 have been reported, those sites have little functional implications in the DNA damage response. Here, we show that ATM phosphorylates the S1219 residue of 53BP1 in vitro and that the residue is phosphorylated in cells exposed to ionizing radiation (IR). Transfection with siRNA targeting ATM abolished IR-induced phosphorylation at this residue, supporting the theory that this process is mediated by the kinase. To determine the functional relevance of this phosphorylation event, a U2OS cell line expressing S1219A mutant 53BP1 was established. IR-induced foci formation of MDC1 and {gamma}H2AX, DNA damage signaling molecules, was reduced in this cell line, implying that S1219 phosphorylation is required for recruitment of these molecules to DNA damage sites. Furthermore, overexpression of the mutant protein impeded IR-induced G2 arrest. In conclusion, we have shown that S1219 phosphorylation by ATM is required for proper execution of DNA damage response.

  4. BP, Cardiovascular Disease, and Death in the Folic Acid for Vascular Outcome Reduction in Transplantation Trial

    PubMed Central

    John, Alin; Weir, Matthew R.; Smith, Stephen R.; Hunsicker, Lawrence; Kasiske, Bertram L.; Kusek, John W.; Bostom, Andrew; Ivanova, Anastasia; Levey, Andrew S.; Solomon, Scott; Pesavento, Todd; Weiner, Daniel E.

    2014-01-01

    The optimal BP level in kidney transplant recipients remains uncertain. This post hoc analysis of the Folic Acid for Vascular Outcome Reduction in Transplantation (FAVORIT) trial cohort assessed associations of BP with a pooled cardiovascular disease (CVD) outcome and with all-cause mortality. In 3474 prevalent kidney transplant patients, mean age was 52±9 years, 63% were men, 76% were white, 20% had a history of CVD, 40% had a history of diabetes mellitus, and the median time since transplant was 4.1 years (25th to 75th percentiles, 1.7–7.4); mean systolic BP was 136±20 mmHg and mean diastolic BP was 79±12 mmHg. There were 497 CVD events and 406 deaths. After adjustment for demographic and transplant characteristics and CVD risk factors, each 20-mmHg increase in baseline systolic BP associated with a 32% increase in subsequent CVD risk (hazard ratio [HR], 1.32; 95% confidence interval [95% CI], 1.19 to 1.46) and a 13% increase in mortality risk (HR, 1.13; 95% CI, 1.01 to 1.27). Similarly, after adjustment, at diastolic BP levels<70 mmHg, each 10-mmHg decrease in diastolic BP level associated with a 31% increase in CVD risk (HR, 1.31; 95% CI, 1.06 to 1.62) and a 31% increase in mortality risk (HR, 1.31; 95% CI, 1.03 to 1.66). However, at diastolic BP levels>70 mmHg, there was no significant relationship between diastolic BP and outcomes. Higher systolic BP strongly and independently associated with increased risk of CVD and all-cause mortality, without evidence of a J shape, whereas only lower levels of diastolic BP associated with increased risk of CVD and death in this trial. PMID:24627349

  5. Epitope mapping of the Brucella melitensis BP26 immunogenic protein: usefulness for diagnosis of sheep brucellosis.

    PubMed

    Seco-Mediavilla, Patricia; Verger, Jean-Michel; Grayon, Maggy; Cloeckaert, Axel; Marín, Clara M; Zygmunt, Michel S; Fernández-Lago, Luis; Vizcaíno, Nieves

    2003-07-01

    Sequencing of bp26, the gene encoding the Brucella sp. immunogenic BP26 periplasmic protein, was performed in the reference strains of Brucella abortus, B. suis, and B. ovis. The three bp26 sequences were almost identical to that published for B. melitensis 16M bp26, and only minor nucleotide substitutions, without modifying the amino acid sequence, were observed between species. The bp26 genes of the seven B. abortus biovar reference strains and B. abortus S19 and RB51 vaccine strains were also sequenced. Again, only minor differences were found. Surprisingly, the bp26 nucleotide sequence for B. abortus S19 was almost identical to that found for B. melitensis 16M and differed from the sequence described previously by others (O. L. Rossetti, A. I. Arese, M. L. Boschiroli, and S. L. Cravero, J. Clin. Microbiol. 34:165-169, 1996) for the same B. abortus strain. The epitope mapping of BP26, performed by using a panel of monoclonal antibodies and recombinant DNA techniques, allowed the identification of an immunodominant region of the protein interesting for the diagnosis of B. melitensis and B. ovis infection in sheep. A recombinant fusion protein containing this region of BP26 reacted indeed, in Western blotting, as the entire recombinant BP26 against sera from B. melitensis- or B. ovis-infected sheep while it avoided false-positive reactions observed with sera from Brucella-free sheep when using the entire recombinant BP26. Thus, use of this recombinant fusion protein instead the entire recombinant BP26 could improve the specific serological diagnosis of B. melitensis or B. ovis infection in sheep.

  6. Achieving strategic cost reduction in the OR.

    PubMed

    Buchler, Richard

    2014-10-01

    Hospitals should be proactive insearching for ways to control operating room supply chain costs. A hospital can identify an overall supply cost savings goal by analyzing patient-encounter data for its 15 most costly procedures and identifying the dollar figure under which 25 percent of cases fall for each procedure. After establishing savings targets, the hospital can achieve its goals through a range of approaches. PMID:25647904

  7. HEPEX - achievements and challenges!

    NASA Astrophysics Data System (ADS)

    Pappenberger, Florian; Ramos, Maria-Helena; Thielen, Jutta; Wood, Andy; Wang, Qj; Duan, Qingyun; Collischonn, Walter; Verkade, Jan; Voisin, Nathalie; Wetterhall, Fredrik; Vuillaume, Jean-Francois Emmanuel; Lucatero Villasenor, Diana; Cloke, Hannah L.; Schaake, John; van Andel, Schalk-Jan

    2014-05-01

    HEPEX is an international initiative bringing together hydrologists, meteorologists, researchers and end-users to develop advanced probabilistic hydrological forecast techniques for improved flood, drought and water management. HEPEX was launched in 2004 as an independent, cooperative international scientific activity. During the first meeting, the overarching goal was defined as: "to develop and test procedures to produce reliable hydrological ensemble forecasts, and to demonstrate their utility in decision making related to the water, environmental and emergency management sectors." The applications of hydrological ensemble predictions span across large spatio-temporal scales, ranging from short-term and localized predictions to global climate change and regional modeling. Within the HEPEX community, information is shared through its blog (www.hepex.org), meetings, testbeds and intercompaison experiments, as well as project reportings. Key questions of HEPEX are: * What adaptations are required for meteorological ensemble systems to be coupled with hydrological ensemble systems? * How should the existing hydrological ensemble prediction systems be modified to account for all sources of uncertainty within a forecast? * What is the best way for the user community to take advantage of ensemble forecasts and to make better decisions based on them? This year HEPEX celebrates its 10th year anniversary and this poster will present a review of the main operational and research achievements and challenges prepared by Hepex contributors on data assimilation, post-processing of hydrologic predictions, forecast verification, communication and use of probabilistic forecasts in decision-making. Additionally, we will present the most recent activities implemented by Hepex and illustrate how everyone can join the community and participate to the development of new approaches in hydrologic ensemble prediction.

  8. The Homogeneity of School Achievement.

    ERIC Educational Resources Information Center

    Cahan, Sorel

    Since the measurement of school achievement involves the administration of achievement tests to various grades on various subjects, both grade level and subject matter contribute to within-school achievement variations. To determine whether achievement test scores vary most among different fields within a grade level, or within fields among…

  9. BP Neural Network Could Help Improve Pre-miRNA Identification in Various Species

    PubMed Central

    Jiang, Limin; Zhang, Jingjun

    2016-01-01

    MicroRNAs (miRNAs) are a set of short (21–24 nt) noncoding RNAs that play significant regulatory roles in cells. In the past few years, research on miRNA-related problems has become a hot field of bioinformatics because of miRNAs' essential biological function. miRNA-related bioinformatics analysis is beneficial in several aspects, including the functions of miRNAs and other genes, the regulatory network between miRNAs and their target mRNAs, and even biological evolution. Distinguishing miRNA precursors from other hairpin-like sequences is important and is an essential procedure in detecting novel microRNAs. In this study, we employed backpropagation (BP) neural network together with 98-dimensional novel features for microRNA precursor identification. Results show that the precision and recall of our method are 95.53% and 96.67%, respectively. Results further demonstrate that the total prediction accuracy of our method is nearly 13.17% greater than the state-of-the-art microRNA precursor prediction software tools. PMID:27635401

  10. BP Neural Network Could Help Improve Pre-miRNA Identification in Various Species

    PubMed Central

    Jiang, Limin; Zhang, Jingjun

    2016-01-01

    MicroRNAs (miRNAs) are a set of short (21–24 nt) noncoding RNAs that play significant regulatory roles in cells. In the past few years, research on miRNA-related problems has become a hot field of bioinformatics because of miRNAs' essential biological function. miRNA-related bioinformatics analysis is beneficial in several aspects, including the functions of miRNAs and other genes, the regulatory network between miRNAs and their target mRNAs, and even biological evolution. Distinguishing miRNA precursors from other hairpin-like sequences is important and is an essential procedure in detecting novel microRNAs. In this study, we employed backpropagation (BP) neural network together with 98-dimensional novel features for microRNA precursor identification. Results show that the precision and recall of our method are 95.53% and 96.67%, respectively. Results further demonstrate that the total prediction accuracy of our method is nearly 13.17% greater than the state-of-the-art microRNA precursor prediction software tools.

  11. Insulin signaling controls neurotransmission via the 4eBP-dependent modification of the exocytotic machinery

    PubMed Central

    Mahoney, Rebekah Elizabeth; Azpurua, Jorge; Eaton, Benjamin A

    2016-01-01

    Altered insulin signaling has been linked to widespread nervous system dysfunction including cognitive dysfunction, neuropathy and susceptibility to neurodegenerative disease. However, knowledge of the cellular mechanisms underlying the effects of insulin on neuronal function is incomplete. Here, we show that cell autonomous insulin signaling within the Drosophila CM9 motor neuron regulates the release of neurotransmitter via alteration of the synaptic vesicle fusion machinery. This effect of insulin utilizes the FOXO-dependent regulation of the thor gene, which encodes the Drosophila homologue of the eif-4e binding protein (4eBP). A critical target of this regulatory mechanism is Complexin, a synaptic protein known to regulate synaptic vesicle exocytosis. We find that the amounts of Complexin protein observed at the synapse is regulated by insulin and genetic manipulations of Complexin levels support the model that increased synaptic Complexin reduces neurotransmission in response to insulin signaling. DOI: http://dx.doi.org/10.7554/eLife.16807.001 PMID:27525480

  12. Role of 14-Bp HLA-G, INDEL Polymorphism in Recurrent Miscarriage.

    PubMed

    Afkhami, Fateme; Yazdani, Neda; Khaniani, Mahmoud Shekari; Derakhshan, Sima Mansoori

    2016-01-01

    Mothers and their fetuses are hereditarily unlike. Surprisingly, no less than 50% human pregnancies reach full term despite the tendency of the immune system to eliminate of non-self units. Reduction of adaptive maternal immune answer, which is planned to reject strange factors, is essential for a pregnancy to reach full term. However, approximately 5% couples trying to conceive experience 2 recurrent miscarriages (RMs).HLA-G, which is produced by the external trophectoderm layer and has unique biological features, is involved in the implantation and maintenance of fetus. Serum HLA-G levels are correlated with the risk of RM. Recent studies indicate that a 14-bp HLA-G, INDEL polymorphism decreases the level of HLA-G mRNA, which in turn decreases the amount of HLA-G produced. An understanding of gene parameter and the function of polymorphic sites in the functioning of HLA-G products may enable the development of approaches targeting HLA-G for more detail of causes of RM. PMID:27357874

  13. Direct measurement of 11B(p ,γ )12C astrophysical S factors at low energies

    NASA Astrophysics Data System (ADS)

    He, J. J.; Jia, B. L.; Xu, S. W.; Chen, S. Z.; Ma, S. B.; Hou, S. Q.; Hu, J.; Zhang, L. Y.; Yu, X. Q.

    2016-05-01

    We directly measure the absolute cross section of 11B(p ,γ )12C in the energy region of Ec .m .=130 -257 keV by using a thin target for the first time. This work is performed on a 320-kV platform at the Institute of Modern Physics in Lanzhou. The astrophysical S factors of this reaction are obtained for capture to the ground and first excited states of 12C. The properties of the known resonance at ˜150 keV are derived and agree with the previous results. However, in the energy region of 170-240 keV, our S factors are about 15%-50% larger than the adopted values in NACRE II and are also larger than the upper limits of NACRE II by up to ˜20 % . This indicates that our new reaction rate is enhanced by about 15%-50% compared to the NACRE II adopted rate in the temperature region 0.32-0.62 GK.

  14. BP Neural Network Could Help Improve Pre-miRNA Identification in Various Species.

    PubMed

    Jiang, Limin; Zhang, Jingjun; Xuan, Ping; Zou, Quan

    2016-01-01

    MicroRNAs (miRNAs) are a set of short (21-24 nt) noncoding RNAs that play significant regulatory roles in cells. In the past few years, research on miRNA-related problems has become a hot field of bioinformatics because of miRNAs' essential biological function. miRNA-related bioinformatics analysis is beneficial in several aspects, including the functions of miRNAs and other genes, the regulatory network between miRNAs and their target mRNAs, and even biological evolution. Distinguishing miRNA precursors from other hairpin-like sequences is important and is an essential procedure in detecting novel microRNAs. In this study, we employed backpropagation (BP) neural network together with 98-dimensional novel features for microRNA precursor identification. Results show that the precision and recall of our method are 95.53% and 96.67%, respectively. Results further demonstrate that the total prediction accuracy of our method is nearly 13.17% greater than the state-of-the-art microRNA precursor prediction software tools. PMID:27635401

  15. Calcium modulates promoter occupancy by the Entamoeba histolytica Ca2+-binding transcription factor URE3-BP.

    PubMed

    Gilchrist, Carol A; Leo, Megan; Line, C Genghis; Mann, Barbara J; Petri, William A

    2003-02-14

    The Entamoeba histolytica upstream regulatory element 3-binding protein (URE3-BP) binds to the URE3 sequence of the Gal/GalNAc-inhibitable lectin hgl5 and ferredoxin 1 (fdx) gene promoters. This binding can be inhibited in vitro by addition of calcium. Two EF-hand motifs, which are associated with the ability to bind calcium, are present in the amino acid sequence of URE3-BP. Mutation of the second EF-hand motif in URE3-BP resulted in the loss of calcium inhibition of DNA binding as monitored by electrophoretic mobility shift assay. Chromatin immunoprecipitation assays revealed that URE3-BP was physically bound to the hgl5 and fdx promoters in vivo. Parasite intracellular calcium concentrations were altered by changes in extracellular calcium. Promoter occupancy was lost when intracellular calcium levels were increased by coordinate increases in extracellular calcium. Increased intracellular calcium also resulted in decreased levels of URE3-BP mRNA. Together these results demonstrate that changes in extracellular calcium result in changes in URE3-BP mRNA and in the ability of URE3-BP to bind to URE3-containing promoters. Modulation of URE3-BP by calcium may represent an important mechanism of control of gene expression in E. histolytica.

  16. Inactivation of arf-bp1 induces p53 activation and diabetic phenotypes in mice.

    PubMed

    Kon, Ning; Zhong, Jiayun; Qiang, Li; Accili, Domenico; Gu, Wei

    2012-02-10

    It is well accepted that the Mdm2 ubiquitin ligase acts as a major factor in controlling p53 stability and activity in vivo. Although several E3 ligases have been reported to be involved in Mdm2-independent p53 degradation, the roles of these ligases in p53 regulation in vivo remain largely unknown. To elucidate the physiological role of the ubiquitin ligase ARF-BP1, we generated arf-bp1 mutant mice. We found that inactivation of arf-bp1 during embryonic development in mice resulted in p53 activation and embryonic lethality, but the mice with arf-bp1 deletion specifically in the pancreatic β-cells (arf-bp1(FL/Y)/RIP-cre) were viable and displayed no obvious abnormality after birth. Interestingly, these mice showed dramatic loss of β-cells as mice aged, and >50% of these mice died of severe diabetic symptoms before reaching 1 year of age. Notably, the diabetic phenotype of these mice was largely reversed by concomitant deletion of p53, and the life span of the mice was significantly extended (p53(LFL/FL)/arf-bp1(FL/Y)/RIP-cre). These findings underscore an important role of ARF-BP1 in maintaining β-cell homeostasis in aging mice and reveal that the stability of p53 is critically regulated by ARF-BP1 in vivo.

  17. 76 FR 69713 - Application To Export Electric Energy; BP Energy Company

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-09

    ... Application To Export Electric Energy; BP Energy Company AGENCY: Office of Electricity Delivery and Energy... its authority to transmit electric energy from the United States to Mexico pursuant to section 202(e... Order No. EA-314, which authorized BP Energy to transmit electric energy from the United States...

  18. 76 FR 69712 - Application To Export Electric Energy; BP Energy Company

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-09

    ... Application To Export Electric Energy; BP Energy Company AGENCY: Office of Electricity Delivery and Energy... its authority to transmit electric energy from the United States to Canada pursuant to section 202(e... (DOE) issued Order No. EA-315, which authorized BP Energy to transmit electric energy from the...

  19. 53BP1 foci as a marker of tumor cell radiosensitivity.

    PubMed

    Markova, E; Vasilyev, S; Belyaev, I

    2015-01-01

    Predicting tumor radiosensitivity has yet to be routinely integrated into radiotherapy. We analyzed the possibility to assess radiosensitivity of tumor cells based on endogenous and radiation-induced 53BP1 foci which are molecular markers of DNA double strand breaks (DSB). In eleven tumor cell lines of different origin, radiosensitivity was assessed by surviving cell fraction following irradiation with 2 Gy (SF2). 53BP1 foci were measured at 4 and 12 h post-irradiation by confocal laser microscopy and dedicated software. The correlation of 53BP1 foci and their post-irradiation kinetics with SF2 was assessed using Spearman rank test. The SF2 correlated with both excess of radiation-induced 53BP1 foci per cell at 4 h after irradiation and decay in number of 53BP1 foci from 4 to 12 h post-irradiation. The fraction of cells with multiple endogenous 53BP1 foci also correlated with SF2 of tumor cells. We conclude that the radiosensitivity of tumor cells can be predicted by kinetics of formation and decay of 53BP1 foci after irradiation. For the first time we report that the fraction of cells with multiple endogenous 53BP1 foci can be used as a marker of tumor cell radiosensitivity. PMID:26278144

  20. 75 FR 68607 - BP Canada Energy Marketing Corp. Apache Corporation; Notice for Temporary Waivers

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-08

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission BP Canada Energy Marketing Corp. Apache Corporation; Notice for Temporary Waivers November 1, 2010. Take notice that on October 29, 2010, BP Canada Energy Marketing Corp....

  1. 75 FR 69652 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-15

    ... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling AGENCY: Department of... meeting of the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling (the... associated with offshore drilling in the future. The Commission is composed of seven members appointed by...

  2. 75 FR 60097 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-29

    ... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling AGENCY: Department of... meeting of the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling (the... associated with offshore drilling in the future. The Commission is composed of seven members appointed by...

  3. 75 FR 39518 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling; Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-09

    ..., 2010, of the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling, (75 FR... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling; Correction AGENCY: Office...: Christopher A. Smith, (202) 586-0716. Corrections In the Federal Register of June 30, 2010, in FR Doc....

  4. 75 FR 65309 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-22

    ... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling AGENCY: Department of... meeting of the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling (the..., and mitigate the impact of, any oil spills associated with offshore drilling in the future....

  5. 75 FR 37783 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-30

    ... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling AGENCY: Department of... meeting of the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling (the... offshore drilling in the future. The Commission is composed of seven members appointed by the President...

  6. 75 FR 56526 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-16

    ... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling AGENCY: Department of... meeting of the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling (the... with offshore drilling in the future. The Commission is composed of seven members appointed by...

  7. 75 FR 47584 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-06

    ... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling AGENCY: Department of... meeting for the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling (the..., and mitigate the impact of, any oil spills associated with offshore drilling in the future....

  8. Preparation of PLLA/bpV(pic) microspheres and their effect on nerve cells.

    PubMed

    Lin, Qiang; Chen, Hai-yun; Li, Hao-shen; Cai, Yang-ting

    2014-02-01

    In this study, we prepared PLLA/bpV(pic) microspheres, a bpV(pic) controlled release system and examined their ability to protect nerve cells and promote axonal growth. PLLA microspheres were prepared by employing the o/w single emulsification-evaporation technique. Neural stem cells and dorsal root ganglia were divided into 3 groups in terms of the treatment they received: a routine medium group (cultured in DMEM), a PLLA microsphere group (DMEM containing PLLA microspheres alone) and a PLLA/bpV(pic) group [DMEM containing PLLA/bpV(pic) microspheres]. The effects of PLLA/bpV(pic) microspheres were evaluated by the live-dead test and measurement of axonal length. Our results showed that PLLA/bpV(pic) granulation rate was (88.2±5.6)%; particle size was (16.8±3.1)%, drug loading was (4.05±0.3)%; encapsulation efficiency was (48.5±1.8)%. The release time lasted for 30 days. In PLLA/bpV(pic) microsphere group, the cell survival rate was (95.2 ±4.77)%, and the length of dorsal root ganglion (DRG) was 718±95 μm, which were all significantly greater than those in ordinary routine medium group and PLLA microsphere group. This preliminary test results showed the PLLA/bpV(pic) microspheres were successfully prepared and they could promote the survival and growth of neural cells in DRG.

  9. Human recognition based on head-shoulder contour extraction and BP neural network

    NASA Astrophysics Data System (ADS)

    Kong, Xiao-fang; Wang, Xiu-qin; Gu, Guohua; Chen, Qian; Qian, Wei-xian

    2014-11-01

    In practical application scenarios like video surveillance and human-computer interaction, human body movements are uncertain because the human body is a non-rigid object. Based on the fact that the head-shoulder part of human body can be less affected by the movement, and will seldom be obscured by other objects, in human detection and recognition, a head-shoulder model with its stable characteristics can be applied as a detection feature to describe the human body. In order to extract the head-shoulder contour accurately, a head-shoulder model establish method with combination of edge detection and the mean-shift algorithm in image clustering has been proposed in this paper. First, an adaptive method of mixture Gaussian background update has been used to extract targets from the video sequence. Second, edge detection has been used to extract the contour of moving objects, and the mean-shift algorithm has been combined to cluster parts of target's contour. Third, the head-shoulder model can be established, according to the width and height ratio of human head-shoulder combined with the projection histogram of the binary image, and the eigenvectors of the head-shoulder contour can be acquired. Finally, the relationship between head-shoulder contour eigenvectors and the moving objects will be formed by the training of back-propagation (BP) neural network classifier, and the human head-shoulder model can be clustered for human detection and recognition. Experiments have shown that the method combined with edge detection and mean-shift algorithm proposed in this paper can extract the complete head-shoulder contour, with low calculating complexity and high efficiency.

  10. Centennial and millennial-scale hydroclimate changes in northwestern Patagonia since 16,000 yr BP

    NASA Astrophysics Data System (ADS)

    Moreno, Patricio I.; Videla, Javiera

    2016-10-01

    We examine hydroclimate changes at centennial/millennial timescales since 16,000 yr BP in northwestern Patagonia based on the pollen and charcoal record from Lago El Salto, a small closed-basin lake located in the Chilean Lake District (41°38‧48.02″S, 73° 5‧48.42″W). We observe cold/wet conditions between 14,500-16,000 yr BP, followed by further cooling with increased precipitation until 13,000 yr BP, enhanced precipitation seasonality and/or variability between 11,600-13,000 yr BP, and an extended warm-and-dry interval between 7600 and 11,300 yr BP with peak paleofire activity. Colder-and-wetter than present conditions and muted paleofire activity prevail between 5300 and 7600 yr BP, followed by alternating cold/wet and centennial-scale warm/dry phases starting at 5300 yr BP with three conspicuous megadroughts since 2500 yr BP. The most recent megadrought occurred during the Medieval Climate Anomaly. We identify a cold reversal that spans the Antarctic Cold Reversal (ACR) and the Younger Dryas (YD) chrons with stronger-than-present westerly influence during the former and enhanced variability during the latter. These results extend the northern limit of strong cooling and increase in precipitation during the ACR and the southern limit of influence of strong hydrologic variations during the YD in terrestrial environments, suggesting an overlap in the spheres of influence of processes originating from southern and northern polar latitudes. An extended warm southern westerly wind (SWW)-minimum interval is evident between 7600 and 11,300 yr BP, followed by a rapid shift to cool-moist conditions between 5300 and 7600 yr BP brought by a mid-Holocene SWW maximum. Since then we observe centennial-scale hydroclimate variability, which has driven biodiversity and fire-regime shifts of evergreen temperate rainforests.

  11. Bedtime versus at awakening administration of BP lowering drugs--is it the way to success?

    PubMed

    Bălan, H

    2009-01-01

    The "manometric" way of considering the complex management of high blood pressure (HBP) must remain ancient history. The huge therapeutical armamentarium existing nowadays allows us to select the drug/s most appropriate for the comorbidities/particularities of each case. The BP level target, unanimously considered a very important element of HBP management, must not be the only one. The so-called pleiotropic effects of the different classes of antihypertensive drugs must always influence our way of thinking. Another important possibility to improve the therapeutical efficacy of the antihypertensive treatment is chronotherapy. The aim of the present study is to demonstrate the possibility of some benefic effects by imposing, by chronotherapy, a "normal" "dipping" status of the BP values. Among the surrogate end-points that can be used to demonstrate the benefits of this kind of HBP management we chose the structural and functional cardiac parameters, echocardiographically determined--using the criteria of the American Society of Echocardiography. We studied the evolution of these parameters of the left ventricle (LV) and we have evaluated them after 3 months of once-a-day morning (at awakening) administration, and respectively after 3 months of once-a-day administration in the evening (at bedtime) of: Prestarium (perindopril) cp 10 mg Tarka (cp 180 mg verapamil hydrochloride/2 mg trandolapril) Norvasc (amlodipine besilat) cp 10 mg as monotherapy, in 60 patients. We studied the anatomical parameters of the left ventricle (dimensions measured enddiastolically: the thickness of the interventricular septum, the thickness of the posterior wall, the internal diameter of the LV), the LV mass (which has a cutedge value for hypertrophy of the LV-LVH--of 134 g/m2 for men and 110 g/m2 for women) and the functional parameters, systolic as diastolic of the LV. We noticed a statistically significant reduction (p < 0.05) in all the 3 subgroups, of the functional parameters, these

  12. Attitude Towards Physics and Additional Mathematics Achievement Towards Physics Achievement

    ERIC Educational Resources Information Center

    Veloo, Arsaythamby; Nor, Rahimah; Khalid, Rozalina

    2015-01-01

    The purpose of this research is to identify the difference in students' attitude towards Physics and Additional Mathematics achievement based on gender and relationship between attitudinal variables towards Physics and Additional Mathematics achievement with achievement in Physics. This research focused on six variables, which is attitude towards…

  13. The Impact of Reading Achievement on Overall Academic Achievement

    ERIC Educational Resources Information Center

    Churchwell, Dawn Earheart

    2009-01-01

    This study examined the relationship between reading achievement and achievement in other subject areas. The purpose of this study was to determine if there was a correlation between reading scores as measured by the Standardized Test for the Assessment of Reading (STAR) and academic achievement in language arts, math, science, and social studies…

  14. miR-548d-3p/TP53BP2 axis regulates the proliferation and apoptosis of breast cancer cells.

    PubMed

    Song, Qiong; Song, Jiangqiang; Wang, Qimin; Ma, Yanling; Sun, Nai; Ma, Jieyu; Chen, Qiu; Xia, Guishan; Huo, Yanping; Yang, Longqiu; Li, Baolin

    2016-02-01

    Fast growth and hardly any apoptosis are important characteristics of breast cancer, which assure the spread via invasion and metastasis of breast cancer cells. Inhibition of fast proliferation and induction of apoptosis are critical way to cure this cancer. microRNAs (miRNAs) had been increasingly reported to be the critical regulator of tumorigenesis. In our study, we found that increasing copy number of miR-548d-2-3p is critically involved poor prognosis. We overexpressed miR-548d-3p in MDA-MB-231cells and found that the proliferation was promoted significantly, whereas the inhibition of miR-548d-3p repressed the proliferation of MDA-MB-231 cells and also induced the increase in apoptosis. Additionally, we found that miR-548d-3p downregulated the expression of TP53BP2 by directly targeting the 3'UTR. We also found that knockdown of TP53BP2 significantly resorted the proliferation and apoptosis regulated by miR-548d-3p inhibitor. Our study showed that miR-548d-3p/TP53BP2 pathway is critically involved in the proliferation and apoptosis of breast cancer cells and may be new therapeutic target of breast cancer cells. PMID:26663100

  15. Improving Secondary School Students' Achievement using Intrinsic Motivation

    ERIC Educational Resources Information Center

    Albrecht, Erik; Haapanen, Rebecca; Hall, Erin; Mantonya, Michelle

    2009-01-01

    This report describes a program for increasing students' intrinsic motivation in an effort to increase academic achievement. The targeted population consisted of secondary level students in a middle to upper-middle class suburban area. The students of the targeted secondary level classes appeared to be disengaged from learning due to a lack of…

  16. An Action Plan for Improving Mediocre or Stagnant Student Achievement

    ERIC Educational Resources Information Center

    Redmond, Kimberley B.

    2013-01-01

    Although all of the schools in the target school system adhere to a school improvement process, achievement scores remain mediocre or stagnant within the overseas school in Italy that serves children of United States armed service members. To address this problem, this study explored the target school's improvement process to discover how…

  17. The mTORC1/4E-BP pathway coordinates hemoglobin production with L-leucine availability.

    PubMed

    Chung, Jacky; Bauer, Daniel E; Ghamari, Alireza; Nizzi, Christopher P; Deck, Kathryn M; Kingsley, Paul D; Yien, Yvette Y; Huston, Nicholas C; Chen, Caiyong; Schultz, Iman J; Dalton, Arthur J; Wittig, Johannes G; Palis, James; Orkin, Stuart H; Lodish, Harvey F; Eisenstein, Richard S; Cantor, Alan B; Paw, Barry H

    2015-01-01

    In multicellular organisms, the mechanisms by which diverse cell types acquire distinct amino acids and how cellular function adapts to their availability are fundamental questions in biology. We found that increased neutral essential amino acid (NEAA) uptake was a critical component of erythropoiesis. As red blood cells matured, expression of the amino acid transporter gene Lat3 increased, which increased NEAA import. Inadequate NEAA uptake by pharmacologic inhibition or RNAi-mediated knockdown of LAT3 triggered a specific reduction in hemoglobin production in zebrafish embryos and murine erythroid cells through the mTORC1 (mammalian target of rapamycin complex 1)/4E-BP (eukaryotic translation initiation factor 4E-binding protein) pathway. CRISPR-mediated deletion of members of the 4E-BP family in murine erythroid cells rendered them resistant to mTORC1 and LAT3 inhibition and restored hemoglobin production. These results identify a developmental role for LAT3 in red blood cells and demonstrate that mTORC1 serves as a homeostatic sensor that couples hemoglobin production at the translational level to sufficient uptake of NEAAs, particularly L-leucine. PMID:25872869

  18. The mTORC1/4E-BP pathway coordinates hemoglobin production with L-leucine availability.

    PubMed

    Chung, Jacky; Bauer, Daniel E; Ghamari, Alireza; Nizzi, Christopher P; Deck, Kathryn M; Kingsley, Paul D; Yien, Yvette Y; Huston, Nicholas C; Chen, Caiyong; Schultz, Iman J; Dalton, Arthur J; Wittig, Johannes G; Palis, James; Orkin, Stuart H; Lodish, Harvey F; Eisenstein, Richard S; Cantor, Alan B; Paw, Barry H

    2015-04-14

    In multicellular organisms, the mechanisms by which diverse cell types acquire distinct amino acids and how cellular function adapts to their availability are fundamental questions in biology. We found that increased neutral essential amino acid (NEAA) uptake was a critical component of erythropoiesis. As red blood cells matured, expression of the amino acid transporter gene Lat3 increased, which increased NEAA import. Inadequate NEAA uptake by pharmacologic inhibition or RNAi-mediated knockdown of LAT3 triggered a specific reduction in hemoglobin production in zebrafish embryos and murine erythroid cells through the mTORC1 (mammalian target of rapamycin complex 1)/4E-BP (eukaryotic translation initiation factor 4E-binding protein) pathway. CRISPR-mediated deletion of members of the 4E-BP family in murine erythroid cells rendered them resistant to mTORC1 and LAT3 inhibition and restored hemoglobin production. These results identify a developmental role for LAT3 in red blood cells and demonstrate that mTORC1 serves as a homeostatic sensor that couples hemoglobin production at the translational level to sufficient uptake of NEAAs, particularly L-leucine.

  19. Chemical proteomics reveals a γH2AX-53BP1 interaction in the DNA damage response.

    PubMed

    Kleiner, Ralph E; Verma, Priyanka; Molloy, Kelly R; Chait, Brian T; Kapoor, Tarun M

    2015-10-01

    DNA double-strand break repair involves phosphorylation of histone variant H2AX ('γH2AX'), which accumulates in foci at sites of DNA damage. In current models, the recruitment of multiple DNA repair proteins to γH2AX foci depends mainly on recognition of this 'mark' by a single protein, MDC1. However, DNA repair proteins accumulate at γH2AX sites without MDC1, suggesting that other 'readers' of this mark exist. Here, we use a quantitative chemical proteomics approach to profile direct, phospho-selective γH2AX binders in native proteomes. We identify γH2AX binders, including the DNA repair mediator 53BP1, which we show recognizes γH2AX through its BRCT domains. Furthermore, we investigate the targeting of wild-type 53BP1, or a mutant form deficient in γH2AX binding, to chromosomal breaks resulting from endogenous and exogenous DNA damage. Our results show how direct recognition of γH2AX modulates protein localization at DNA damage sites, and suggest how specific chromatin mark-reader interactions contribute to essential mechanisms ensuring genome stability.

  20. The mTORC1/4E-BP pathway coordinates hemoglobin production with L-leucine availability

    PubMed Central

    Chung, Jacky; Bauer, Daniel E.; Ghamari, Alireza; Nizzi, Christopher P.; Deck, Kathryn M.; Kingsley, Paul D.; Yien, Yvette Y.; Huston, Nicholas C.; Chen, Caiyong; Schultz, Iman J.; Dalton, Arthur J.; Wittig, Johannes G.; Palis, James; Orkin, Stuart H.; Lodish, Harvey F.; Eisenstein, Richard S.; Cantor, Alan B.; Paw, Barry H.

    2015-01-01

    In multicellular organisms, the mechanisms by which diverse cell types acquire distinct amino acids and how cellular function adapts to their availability are fundamental questions in biology. Here, we found that increased neutral essential amino acid (NEAA) uptake was a critical component of erythropoiesis. As red blood cells matured, expression of the amino acid transporter gene Lat3 increased, which increased NEAA import. Inadequate NEAA uptake by pharmacologic inhibition or RNAi-mediated knockdown of LAT3 triggered a specific reduction in hemoglobin production in zebrafish embryos and murine erythroid cells through the mTORC1 (mechanistic target of rapamycin complex 1)/4E-BP (eukaryotic translation initiation factor 4E-binding protein) pathway. CRISPR-mediated deletion of members of the 4E-BP family in murine erythroid cells rendered them resistant to mTORC1 and LAT3 inhibition and restored hemoglobin production. These results identify a developmental role for LAT3 in red blood cells and demonstrate that mTORC1 serves as a homeostatic sensor that couples hemoglobin production at the translational level to sufficient uptake of NEAAs, particularly L-leucine. PMID:25872869

  1. Chemical proteomics reveals a γH2AX-53BP1 interaction in the DNA damage response

    PubMed Central

    Kleiner, Ralph E.; Verma, Priyanka; Molloy, Kelly R.; Chait, Brian T.; Kapoor, Tarun M.

    2015-01-01

    DNA double-strand break repair involves phosphorylation of histone variant H2AX (‘γH2AX’), which accumulates in foci at sites of damage. In current models, the recruitment of multiple DNA repair proteins to γH2AX foci depends mainly on recognition of this ‘mark’ by a single protein, MDC1. However, DNA repair proteins accumulate at γH2AX sites without MDC1, suggesting that other ‘readers’ exist. Here, we use a quantitative chemical proteomics approach to profile direct, phospho-selective γH2AX binders in native proteomes. We identify γH2AX binders, including the DNA repair mediator, 53BP1, which we show recognizes γH2AX through its BRCT domains. Furthermore, we investigate targeting of wild-type 53BP1 or a mutant form deficient in γH2AX binding, to chromosomal breaks resulting from endogenous and exogenous DNA damage. Our results show how direct recognition of γH2AX modulates protein localization at DNA damage sites, and suggest how specific chromatin ‘mark’-‘reader’ interactions contribute to essential mechanisms ensuring genome stability. PMID:26344695

  2. Commentary on the 2014 BP guidelines from the panel appointed to the Eighth Joint National Committee (JNC 8).

    PubMed

    Reisin, Efrain; Harris, Raymond C; Rahman, Mahboob

    2014-11-01

    The recently published article "2014 Evidence-based guideline for the management of high blood pressure in adults: Report from the panel members appointed to the Eighth Joint National Committee (JNC 8)" (James et al., JAMA 311: 507-520, 2014) has generated considerable controversy. In this commentary, we evaluate the document and compare the recommendations contained within it with those of the JNC 7 and other national and international guidelines. The evidence quality rating approach followed by the article "2014 Evidence-based guideline for the management of high blood pressure in adults: Report from the panel members appointed to the Eighth Joint National Committee (JNC 8)" (James et al., JAMA 311: 507-520, 2014) disqualified nearly 98% of previous studies from review; as a result, some of the key recommendations were on the basis of expert opinion alone. We are especially concerned that the recommendation to raise the systolic/diastolic BP levels at which treatment is initiated to ≥150/≥90 mmHg in adults≥60 years old may affect cardiovascular and renal health in these patients. Additionally, we recommend that hypertension guidelines should be updated every 3-4 years with a fresh approach to the definition of target BP levels, the use of modern technology in the diagnosis of hypertension, and the treatment of hypertension in special populations not addressed in earlier guidelines. PMID:25114277

  3. Improving Reading Achievement through the Implementation of Reading Strategies.

    ERIC Educational Resources Information Center

    Cramer, Cynthia; Fate, Joan; Lueders, Kristin

    This study describes a program designed to increase student achievement in reading. The targeted population consisted of first and fourth grade elementary students in a Midwest community. Evidence for the existence of the problem included standardized tests and alternative assessments to measure reading achievement, and teacher observations with…

  4. Relationships between Student, Teacher, and School Characteristics and Mathematics Achievement

    ERIC Educational Resources Information Center

    Petty, Teresa; Wang, Chuang; Harbaugh, Adam P.

    2013-01-01

    A variety of factors contributes to student achievement in mathematics, including but not limited to student behaviors and student, teacher, and school characteristics. The purpose of this study was to explore which of these factors have an impact on student mathematics achievement. The target population for this study was North Carolina Algebra…

  5. Improving Primary Student Motivation and Achievement in Mathematics.

    ERIC Educational Resources Information Center

    Adami-Bunyard, Eppy; Gummow, Mary; Milazzo-Licklider, Nicole

    This report describes a program for increasing student readiness for and achievement in mathematics. The targeted population consists of third grade students in an expanding suburban community and kindergarten students in a culturally diverse urban community, both located in Northern Illinois. The problems of achievement in and attitudes towards…

  6. Validation of Microlife BP W100 wrist device assessed according to the European Society of Hypertension and the British Hypertension Society protocols.

    PubMed

    Palatini, Paolo; Dorigatti, Francesca; Bonso, Elisa; Ragazzo, Fabio

    2009-02-01

    The objective of this study was to determine the accuracy of the Microlife BP W100 device for blood pressure measurement. The device evaluations were performed in 85 participants, by using both the protocol of the European Society of Hypertension (ESH) and the protocol of the British Hypertension Society (BHS). Initially, the data from 33 participants were examined according to the ESH protocol. Furthermore, 52 participants were then enrolled to fulfill the BHS protocol requirements. In all participants, sequential same arm measurements were made by two trained observers. The device passed all three phases of the ESH protocol for systolic blood pressure (SBP) and diastolic blood pressure (DBP) and was graded A according to the criteria of the BHS protocol for both SBP and DBP. The A/A grade was achieved in low (<130/80 mmHg), medium (130-160/80-100 mmHg) and high (>160/100 mmHg) blood pressure categories. Mean blood pressure difference between BP W100 and observers in the 85 participants was 0.1+/-5.3 mmHg for SBP and 1.1+/-3.4 mmHg for DBP, and thus, the device also met the requirements of the Association for the Advancement of Medical Instrumentation. In conclusion, these data show that the Microlife BP W100 wrist monitor satisfied the recommended ESH accuracy levels and achieved A/A grade of the BHS protocol across a wide range of blood pressure. PMID:19252436

  7. Adjusting mobility scales of ion mobility spectrometers using 2,6-DtBP as a reference compound.

    PubMed

    Viitanen, A-K; Mauriala, T; Mattila, T; Adamov, A; Pedersen, C S; Mäkelä, J M; Marjamäki, M; Sysoev, A; Keskinen, J; Kotiaho, T

    2008-09-15

    Performance of several time-of-flight (TOF) type ion mobility spectrometers (IMS) was compared in a joint measurement campaign and their mobility scales were adjusted based on the measurements. A standard reference compound 2,6-di-tert butylpyridine (2,6-DtBP) was used to create a single peak ion mobility distribution with a known mobility value. The effective length of the drift tube of each device, considered here as an instrument constant, was determined based on the measurements. Sequentially, two multi-peaked test compounds, DMMP and DIMP, were used to verify the performance of the adjustment procedure in a wider mobility scale. By determining the effective drift tube lengths using 2,6-DtBP, agreement between the devices was achieved. The determination of effective drift tube lengths according to standard reference compound was found to be a good method for instrument inter-comparison. The comparison procedure, its benefits and shortcomings as well as dependency on accuracy of literature value are discussed along with the results.

  8. Cherokee Culture and School Achievement.

    ERIC Educational Resources Information Center

    Brown, Anthony D.

    1980-01-01

    Compares the effect of cooperative and competitive behaviors of Cherokee and Anglo American elementary school students on academic achievement. Suggests changes in teaching techniques and lesson organization that might raise academic achievement while taking into consideration tribal traditions that limit scholastic achievement in an…

  9. IL-22BP is regulated by the inflammasome and modulates tumorigenesis in the intestine.

    PubMed

    Huber, Samuel; Gagliani, Nicola; Zenewicz, Lauren A; Huber, Francis J; Bosurgi, Lidia; Hu, Bo; Hedl, Matija; Zhang, Wei; O'Connor, William; Murphy, Andrew J; Valenzuela, David M; Yancopoulos, George D; Booth, Carmen J; Cho, Judy H; Ouyang, Wenjun; Abraham, Clara; Flavell, Richard A

    2012-11-01

    Chronic mucosal inflammation and tissue damage predisposes patients to the development of colorectal cancer. This association could be explained by the hypothesis that the same factors and pathways important for wound healing also promote tumorigenesis. A sensor of tissue damage should induce these factors to promote tissue repair and regulate their action to prevent development of cancer. Interleukin 22 (IL-22), a cytokine of the IL-10 superfamily, has an important role in colonic epithelial cell repair, and its levels are increased in the blood and intestine of inflammatory bowel disease patients. This cytokine can be neutralized by the soluble IL-22 receptor, known as the IL-22 binding protein (IL-22BP, also known as IL22RA2); however, the significance of endogenous IL-22BP in vivo and the pathways that regulate this receptor are unknown. Here we describe that IL-22BP has a crucial role in controlling tumorigenesis and epithelial cell proliferation in the colon. IL-22BP is highly expressed by dendritic cells in the colon in steady-state conditions. Sensing of intestinal tissue damage via the NLRP3 or NLRP6 inflammasomes led to an IL-18-dependent downregulation of IL-22BP, thereby increasing the ratio of IL-22/IL-22BP. IL-22, which is induced during intestinal tissue damage, exerted protective properties during the peak of damage, but promoted tumour development if uncontrolled during the recovery phase. Thus, the IL-22-IL-22BP axis critically regulates intestinal tissue repair and tumorigenesis in the colon.

  10. M2BP inhibits HIV-1 virion production in a vimentin filaments-dependent manner

    PubMed Central

    Wang, Qin; Zhang, Xiaolin; Han, Yuling; Wang, Xinlu; Gao, Guangxia

    2016-01-01

    M2BP (also called 90K) is an interferon-stimulated gene product that is upregulated in HIV-1 infection. A recent study revealed that M2BP reduces the infectivity of HIV-1 by inhibiting the processing of the viral envelope protein. Here we report that in addition to reducing viral infectivity, M2BP inhibits HIV-1 virion production. We provide evidence showing that M2BP inhibits HIV-1 Gag trafficking to the plasma membrane in a vimentin-dependent manner. When vimentin filaments were collapsed by treating cells with acrylamide or by overexpression of a dominant-negative mutant of vimentin, M2BP inhibition of HIV-1 virion production was significantly relieved. We further show that M2BP interacts with both HIV-1 Gag and vimentin and thereby mediates their interactions. We propose that M2BP traps HIV-1 Gag to vimentin filaments to inhibit the transportation of HIV-1 Gag to the plasma membrane. These findings uncover a novel mechanism by which a host antiviral factor inhibits HIV-1 virion production. PMID:27604950

  11. M2BP inhibits HIV-1 virion production in a vimentin filaments-dependent manner.

    PubMed

    Wang, Qin; Zhang, Xiaolin; Han, Yuling; Wang, Xinlu; Gao, Guangxia

    2016-01-01

    M2BP (also called 90K) is an interferon-stimulated gene product that is upregulated in HIV-1 infection. A recent study revealed that M2BP reduces the infectivity of HIV-1 by inhibiting the processing of the viral envelope protein. Here we report that in addition to reducing viral infectivity, M2BP inhibits HIV-1 virion production. We provide evidence showing that M2BP inhibits HIV-1 Gag trafficking to the plasma membrane in a vimentin-dependent manner. When vimentin filaments were collapsed by treating cells with acrylamide or by overexpression of a dominant-negative mutant of vimentin, M2BP inhibition of HIV-1 virion production was significantly relieved. We further show that M2BP interacts with both HIV-1 Gag and vimentin and thereby mediates their interactions. We propose that M2BP traps HIV-1 Gag to vimentin filaments to inhibit the transportation of HIV-1 Gag to the plasma membrane. These findings uncover a novel mechanism by which a host antiviral factor inhibits HIV-1 virion production. PMID:27604950

  12. nArgBP2 as a hub molecule in the etiology of various neuropsychiatric disorders.

    PubMed

    Lee, Sang-Eun; Chang, Sunghoe

    2016-09-01

    Recent studies have strongly implicated postsynaptic scaffolding proteins such as SAPAP3 or Shank3 in the pathogenesis of various mood disorders, including autism spectrum disorder, bipolar disorder (BD), and obsessive-compulsive disorders. Neural Abelson-related gene-binding protein 2 (nArgBP2) was originally identified as a protein that interacts with SAPAP3 and Shank3. Recent study shows that the genetic deletion of nArgBP2 in mice leads to manic/bipolar-like behavior resembling symptoms of BD. However, the function of nArgBP2 at synapse, or its connection with the synaptic dysfunctions, is completely unknown. This study provides compelling evidence that nArgBP2 regulates the spine morphogenesis through the activation of Rac1/WAVE/PAK/cofilin pathway, and that its ablation causes a robust and selective inhibition of excitatory synapse formation, by controlling actin dynamics. Our results revealed the underlying mechanism for the synaptic dysfunction caused by nArgBP2 downregulation that associates with analogous human BD. Moreover, since nArgBP2 interacts with key proteins involved in various neuropsychiatric disorders, our finding implies that nArgBP2 could function as a hub linking various etiological factors of different mood disorders. [BMB Reports 2016; 49(9): 457-458]. PMID:27530683

  13. Role of CtBP2 in the Apoptosis of Retinal Ganglion Cells.

    PubMed

    Wang, Wenwen; Zhang, Guowei; Gu, Hui; Liu, Ye; Lao, Jifeng; Li, Kuifang; Guan, Huaijin

    2015-07-01

    Glaucoma damages the optic nerve and is a leading cause of irreversible blindness, and its pathogenesis remains unclear. C-terminal-binding protein 2 (CtBP2) is a transcriptional repressor which plays an important role in central nervous system injury and repair. Using the glaucoma model of DBA/2J mouse whose retina ganglion cells (RGCs) were degenerating with the process of glaucoma, we demonstrated for the first time the special relationship between CtBP2 protein and RGCs. Our research indicated that the expression of CtBP2 was gradually decreased with aging by the means of Western blotting. The CtBP2 immunoreactivity-positive cells were present in the various retinal layers, and CtBP2-positive cells were dramatically decreased in ganglion cell layer. Our research also found ectopic expression of CtBP2 can protect the apoptosis of primary mouse RGC cells induced by L-glutamate. These results suggest that CtBP2 may have a potential therapeutic effect in protecting RGC.

  14. Divergent homologs of the predicted small RNA BpCand697 in Burkholderia spp.

    NASA Astrophysics Data System (ADS)

    Damiri, Nadzirah; Mohd-Padil, Hirzahida; Firdaus-Raih, Mohd

    2015-09-01

    The small RNA (sRNA) gene candidate, BpCand697 was previously reported to be unique to Burkholderia spp. and is encoded at 3' non-coding region of a putative AraC family transcription regulator gene. This study demonstrates the conservation of BpCand697 sequence across 32 Burkholderia spp. including B. pseudomallei, B. mallei, B. thailandensis and Burkholderia sp. by integrating both sequence homology and secondary structural analyses of BpCand697 within the dataset. The divergent sequence of BpCand697 was also used as a discriminatory power in clustering the dataset according to the potential virulence of Burkholderia spp., showing that B. thailandensis was clearly secluded from the virulent cluster of B. pseudomallei and B. mallei. Finally, the differential co-transcript expression of BpCand697 and its flanking gene, bpsl2391 was detected in Burkholderia pseudomallei D286 after grown under two different culture conditions using nutrient-rich and minimal media. It is hypothesized that the differential expression of BpCand697-bpsl2391 co-transcript between the two standard prepared media might correlate with nutrient availability in the culture media, suggesting that the physical co-localization of BpCand697 in B. pseudomallei D286 might be directly or indirectly involved with the transcript regulation of bpsl2391 under the selected in vitro culture conditions.

  15. Establishing a Dynamic Self-Adaptation Learning Algorithm of the BP Neural Network and Its Applications

    NASA Astrophysics Data System (ADS)

    Li, Xiaofeng; Xiang, Suying; Zhu, Pengfei; Wu, Min

    2015-12-01

    In order to avoid the inherent deficiencies of the traditional BP neural network, such as slow convergence speed, that easily leading to local minima, poor generalization ability and difficulty in determining the network structure, the dynamic self-adaptive learning algorithm of the BP neural network is put forward to improve the function of the BP neural network. The new algorithm combines the merit of principal component analysis, particle swarm optimization, correlation analysis and self-adaptive model, hence can effectively solve the problems of selecting structural parameters, initial connection weights and thresholds and learning rates of the BP neural network. This new algorithm not only reduces the human intervention, optimizes the topological structures of BP neural networks and improves the network generalization ability, but also accelerates the convergence speed of a network, avoids trapping into local minima, and enhances network adaptation ability and prediction ability. The dynamic self-adaptive learning algorithm of the BP neural network is used to forecast the total retail sale of consumer goods of Sichuan Province, China. Empirical results indicate that the new algorithm is superior to the traditional BP network algorithm in predicting accuracy and time consumption, which shows the feasibility and effectiveness of the new algorithm.

  16. YB-1 regulates stress granule formation and tumor progression by translationally activating G3BP1

    PubMed Central

    Somasekharan, Syam Prakash; El-Naggar, Amal; Leprivier, Gabriel; Cheng, Hongwei; Hajee, Shamil; Grunewald, Thomas G.P.; Zhang, Fan; Ng, Tony; Delattre, Olivier; Evdokimova, Valentina; Wang, Yuzhuo; Gleave, Martin

    2015-01-01

    Under cell stress, global protein synthesis is inhibited to preserve energy. One mechanism is to sequester and silence mRNAs in ribonucleoprotein complexes known as stress granules (SGs), which contain translationally silent mRNAs, preinitiation factors, and RNA-binding proteins. Y-box binding protein 1 (YB-1) localizes to SGs, but its role in SG biology is unknown. We now report that YB-1 directly binds to and translationally activates the 5′ untranslated region (UTR) of G3BP1 mRNAs, thereby controlling the availability of the G3BP1 SG nucleator for SG assembly. YB-1 inactivation in human sarcoma cells dramatically reduces G3BP1 and SG formation in vitro. YB-1 and G3BP1 expression are highly correlated in human sarcomas, and elevated G3BP1 expression correlates with poor survival. Finally, G3BP1 down-regulation in sarcoma xenografts prevents in vivo SG formation and tumor invasion, and completely blocks lung metastasis in mouse models. Together, these findings demonstrate a critical role for YB-1 in SG formation through translational activation of G3BP1, and highlight novel functions for SGs in tumor progression. PMID:25800057

  17. Southwest Scandinavia, 40-15 kyr BP: palaeogeography and environmental change

    NASA Astrophysics Data System (ADS)

    Houmark-Nielsen, Michael; Kjær, Kurt Henrik

    2003-12-01

    Twelve palaeogeographical reconstructions illustrate environmental changes at the southwest rim of the Scandinavian Ice Sheet 40-15 kyr BP. Synchronised land, sea and glacier configurations are based on the lithostratigraphy of tills and intertill sediments. Dating is provided by optically stimulated luminescence and calibrated accelerator mass spectrometry radiocarbon.An interstadial sequence ca. 40-30 kyr BP with boreo-arctic proglacial fjords and subarctic flora and occasional glaciation in the Baltic was succeeded by a Last Glacial Maximum sequence ca. 30-20 kyr BP, with the closure of fjords and subsequent ice streams in glacial lake basins in Kattegat and the Baltic. Steadily flowing ice from Sweden bordered the Norwegian Channel Ice Stream. A deglaciation sequence ca. 20-15 kyr BP indicates the transgression of arctic waters, retreat of the Swedish ice and advance of Baltic ice streams succeeded by a return to interstadial conditions.When ameliorated ice-free conditions prevailed in maritime regions, glaciers advanced through the Baltic and when interstadial regimes dominated the Baltic, glaciers expanded off the Norwegian coast. The largest glacier extent was reached in the North Sea around 29 kyr BP, about 22 kyr BP in Denmark and ca. 18 kyr BP in the Baltic. Our model provides new data for future numerical and qualitative landform-based models. Copyright

  18. Stress Granule Components G3BP1 and G3BP2 Play a Proviral Role Early in Chikungunya Virus Replication

    PubMed Central

    Scholte, Florine E. M.; Tas, Ali; Albulescu, Irina C.; Žusinaite, Eva; Merits, Andres; Snijder, Eric J.

    2015-01-01

    ABSTRACT Stress granules (SGs) are protein-mRNA aggregates that are formed in response to environmental stresses, resulting in translational inhibition. SGs are generally believed to play an antiviral role and are manipulated by many viruses, including various alphaviruses. GTPase-activating protein (SH3 domain)-binding protein 1 (G3BP1) is a key component and commonly used marker of SGs. Its homolog G3BP2 is a less extensively studied SG component. Here, we demonstrate that Chikungunya virus (CHIKV) infection induces cytoplasmic G3BP1- and G3BP2-containing granules that differ from bona fide SGs in terms of morphology, composition, and behavior. For several Old World alphaviruses it has been shown that nonstructural protein 3 (nsP3) interacts with G3BPs, presumably to inhibit SG formation, and we have confirmed this interaction in CHIKV-infected cells. Surprisingly, CHIKV also relied on G3BPs for efficient replication, as simultaneous depletion of G3BP1 and G3BP2 reduced viral RNA levels, CHIKV protein expression, and viral progeny titers. The G3BPs colocalized with CHIKV nsP2 and nsP3 in cytoplasmic foci, but no colocalization with nsP1, nsP4, or dsRNA was observed. Furthermore, G3BPs could not be detected in a cellular fraction enriched for CHIKV replication/transcription complexes, suggesting that they are not directly involved in CHIKV RNA synthesis. Depletion of G3BPs did not affect viral entry, translation of incoming genomes, or nonstructural polyprotein processing but resulted in severely reduced levels of negative-stranded (and consequently also positive-stranded) RNA. This suggests a role for the G3BPs in the switch from translation to genome amplification, although the exact mechanism by which they act remains to be explored. IMPORTANCE Chikungunya virus (CHIKV) causes a severe polyarthritis that has affected millions of people since its reemergence in 2004. The lack of approved vaccines or therapeutic options and the ongoing explosive outbreak in the

  19. Mutation particle swarm optimization of the BP-PID controller for piezoelectric ceramics

    NASA Astrophysics Data System (ADS)

    Zheng, Huaqing; Jiang, Minlan

    2016-01-01

    PID control is the most common used method in industrial control because its structure is simple and it is easy to implement. PID controller has good control effect, now it has been widely used. However, PID method has a few limitations. The overshoot of the PID controller is very big. The adjustment time is long. When the parameters of controlled plant are changing over time, the parameters of controller could hardly change automatically to adjust to changing environment. Thus, it can't meet the demand of control quality in the process of controlling piezoelectric ceramic. In order to effectively control the piezoelectric ceramic and improve the control accuracy, this paper replaced the learning algorithm of the BP with the mutation particle swarm optimization algorithm(MPSO) on the process of the parameters setting of BP-PID. That designed a better self-adaptive controller which is combing the BP neural network based on mutation particle swarm optimization with the conventional PID control theory. This combination is called the MPSO-BP-PID. In the mechanism of the MPSO, the mutation operation is carried out with the fitness variance and the global best fitness value as the standard. That can overcome the precocious of the PSO and strengthen its global search ability. As a result, the MPSO-BP-PID can complete controlling the controlled plant with higher speed and accuracy. Therefore, the MPSO-BP-PID is applied to the piezoelectric ceramic. It can effectively overcome the hysteresis, nonlinearity of the piezoelectric ceramic. In the experiment, compared with BP-PID and PSO-BP-PID, it proved that MPSO is effective and the MPSO-BP-PID has stronger adaptability and robustness.

  20. Students’ Achievement Goals, Learning-Related Emotions and Academic Achievement

    PubMed Central

    Lüftenegger, Marko; Klug, Julia; Harrer, Katharina; Langer, Marie; Spiel, Christiane; Schober, Barbara

    2016-01-01

    In the present research, the recently proposed 3 × 2 model of achievement goals is tested and associations with achievement emotions and their joint influence on academic achievement are investigated. The study was conducted with 388 students using the 3 × 2 Achievement Goal Questionnaire including the six proposed goal constructs (task-approach, task-avoidance, self-approach, self-avoidance, other-approach, other-avoidance) and the enjoyment and boredom scales from the Achievement Emotion Questionnaire. Exam grades were used as an indicator of academic achievement. Findings from CFAs provided strong support for the proposed structure of the 3 × 2 achievement goal model. Self-based goals, other-based goals and task-approach goals predicted enjoyment. Task-approach goals negatively predicted boredom. Task-approach and other-approach predicted achievement. The indirect effects of achievement goals through emotion variables on achievement were assessed using bias-corrected bootstrapping. No mediation effects were found. Implications for educational practice are discussed. PMID:27199836

  1. Adequacy target in hemodialysis.

    PubMed

    Canaud, Bernard

    2004-01-01

    Over the last decade, the concept of dialysis adequacy has evolved to become a component of the optimal dialysis that includes quantitative and qualitative aspects. Current method used to assess dialysis efficacy in ESRD patients relies on a targeting approach using several vital indicators. Dialysis quality is a complex and evolutionary concept that has to be viewed in a quality assurance process to improve outcomes of ESRD patients. To simplify this assessment we propose a quantitative approach including several steps: the first step consists of selecting pertinent indicators (targets) tracking specific uremia metabolic abnormalities and defining suitable range values (target values); the second step consists of defining a method checking that targeted values are achieved on a regular basis; the third step consists of validating that targeted values offer the best survival to ESRD patients; the fourth step consists of correcting treatment prescription (treatment schedule) and implementation (effective treatment delivered) to improve treatment delivery and performances. Based on this approach, it is then possible to assess the efficacy of dialysis therapy both at the individual and at the dialysis unit level, that can be easily implemented in a computerized automatic control system. PMID:15599891

  2. The Sinuous Target

    SciTech Connect

    Zwaska, R.

    2015-06-01

    We report on the concept for a target material comprised of a multitude of interlaced wires of small dimension. This target material concept is primarily directed at high-power neutrino targets where the thermal shock is large due to small beam sizes and short durations; it also has applications to other high-power targets, particularly where the energy deposition is great or a high surface area is preferred. This approach ameliorates the problem of thermal shock by engineering a material with high strength on the micro-scale, but a very low modulus of elasticity on the meso-scale. The low modulus of elasticity is achieved by constructing the material of spring-like wire segments much smaller than the beam dimension. The intrinsic bends of the wires will allow them to absorb the strain of thermal shock with minimal stress. Furthermore, the interlaced nature of the wires provides containment of any segment that might become loose. We will discuss the progress on studies of analogue materials and fabrication techniques for sinuous target materials.

  3. BP-C1 in the treatment of patients with stage IV breast cancer: a randomized, double-blind, placebo-controlled multicenter study and an additional open-label treatment phase

    PubMed Central

    Larsen, Stig; Butthongkomvong, Kritiya; Manikhas, Alexey; Trishkina, Ekaterina; Poddubuskaya, Elena; Matrosova, Marina; Srimuninnimit, Vichien; Lindkær-Jensen, Steen

    2014-01-01

    The aims were to compare the efficacy and tolerability of a new benzene-poly-carboxylic acids complex with cis-diammineplatinum (II) dichloride (BP-C1) versus placebo and to investigate the long-term tolerability of BP-C1 in the treatment of patients with metastatic breast cancer. Material and methods A randomized, double-blind, placebo-controlled multicenter study was performed with a semi-crossover design. Patients allocated to placebo switched to BP-C1 after 32 days of treatment. Patients who completed 32 days of BP-C1 treatment were offered the opportunity to continue on BP-C1 for an additional 32 days in an open-label extension. Patients were then followed up for another 28 days. Thirty patients were given daily intramuscular injections of 0.035 mg/kg of body weight BP-C1 or placebo for 32 days. Biochemistry, hematology, National Cancer Institute Common Terminology Criteria for Adverse Events (CTC-NCI), European Organisation for Research and Treatment of Cancer quality of life questionnaire (QOL-C30 and the breast-cancer–specific BR23) data were recorded at screening and after every 16 days of treatment. Computed tomography was performed at screening and every 32 days. Results The sum of target lesions increased 2.4% in the BP-C1 group and 14.3% in the placebo group. Only the increase in the placebo group was significant (P=0.013). The difference between the groups was significant in favor of BP-C1 (P=0.04). There was a significant difference (P=0.026) in favor of BP-C1 regarding Response Evaluation Criteria In Solid Tumors (RECIST) classification. The sum of lesions increased slightly in the patients receiving 64 days of continuous BP-C1 treatment, of whom 68.4% were classified as responders. The sum CTC-NCI toxicity score increased nonsignificantly in the BP-C1 group but significantly in the placebo group (P=0.05). The difference in increase between groups did not meet the level of significance (P=0.12). The sum toxicity score was reduced in the patients

  4. Geoarchaeological evidence from Peru for a 5000 years B.P. onset of El Nino

    SciTech Connect

    Sandweiss, D.H.; Richardson, J.B. III; Rollins, H.B.

    1996-09-13

    For the tropical west coast of South America, where El Nino/Southern Oscillation (ENSO) is most pronounced, archaeological and associated paleontological deposits in northern Peru revealed a major climate change at about 5000 years before the present (yr B.P.). The data implied the presence of stable, warm tropical water as far south as 10{degrees}S during the early mid-Holocene (about 8000 to 5000 yr B.P.). These data suggest that ENSO did not occur for some millennia preceding 5000 yr B.P., when global and regional climate was warmer than today. 36 refs., 1 fig., 3 tabs.

  5. Achievement as Resistance: The Development of a Critical Race Achievement Ideology among Black Achievers

    ERIC Educational Resources Information Center

    Carter, Dorinda J.

    2008-01-01

    In this article, Dorinda Carter examines the embodiment of a critical race achievement ideology in high-achieving black students. She conducted a yearlong qualitative investigation of the adaptive behaviors that nine high-achieving black students developed and employed to navigate the process of schooling at an upper-class, predominantly white,…

  6. Resveratrol induces apoptosis by directly targeting Ras-GTPase-activating protein SH3 domain-binding protein 1.

    PubMed

    Oi, N; Yuan, J; Malakhova, M; Luo, K; Li, Y; Ryu, J; Zhang, L; Bode, A M; Xu, Z; Li, Y; Lou, Z; Dong, Z

    2015-05-14

    Resveratrol (trans-3,5,4'-truhydroxystilbene) possesses a strong anticancer activity exhibited as the induction of apoptosis through p53 activation. However, the molecular mechanism and direct target(s) of resveratrol-induced p53 activation remain elusive. Here, the Ras-GTPase-activating protein SH3 domain-binding protein 1 (G3BP1) was identified as a potential target of resveratrol, and in vitro binding assay results using resveratrol-conjugated Sepharose 4B beads confirmed their direct binding. Depletion of G3BP1 significantly diminishes resveratrol-induced p53 expression and apoptosis. We also found that G3BP1 negatively regulates p53 expression by interacting with ubiquitin-specific protease 10 (USP10), a deubiquitinating enzyme of p53. Disruption of the interaction of p53 with USP10 by G3BP1 interference leads to the suppression of p53 deubiquitination. Resveratrol, on the other hand, directly binds to G3BP1 and prevents the G3BP1/USP10 interaction, resulting in enhanced USP10-mediated deubiquitination of p53, and consequently increased p53 expression. These findings disclose a novel mechanism of resveratrol-induced p53 activation and resveratrol-induced apoptosis by direct targeting of G3BP1.

  7. Target assembly

    DOEpatents

    Lewis, Richard A.

    1980-01-01

    A target for a proton beam which is capable of generating neutrons for absorption in a breeding blanket includes a plurality of solid pins formed of a neutron emissive target material disposed parallel to the path of the beam and which are arranged axially in a plurality of layers so that pins in each layer are offset with respect to pins in all other layers, enough layers being used so that each proton in the beam will strike at least one pin with means being provided to cool the pins. For a 300 mA, 1 GeV beam (300 MW), stainless steel pins, 12 inches long and 0.23 inches in diameter are arranged in triangular array in six layers with one sixth of the pins in each layer, the number of pins being such that the entire cross sectional area of the beam is covered by the pins with minimum overlap of pins.

  8. Camouflage target reconnaissance based on hyperspectral imaging technology

    NASA Astrophysics Data System (ADS)

    Hua, Wenshen; Guo, Tong; Liu, Xun

    2015-08-01

    Efficient camouflaged target reconnaissance technology makes great influence on modern warfare. Hyperspectral images can provide large spectral range and high spectral resolution, which are invaluable in discriminating between camouflaged targets and backgrounds. Hyperspectral target detection and classification technology are utilized to achieve single class and multi-class camouflaged targets reconnaissance respectively. Constrained energy minimization (CEM), a widely used algorithm in hyperspectral target detection, is employed to achieve one class camouflage target reconnaissance. Then, support vector machine (SVM), a classification method, is proposed to achieve multi-class camouflage target reconnaissance. Experiments have been conducted to demonstrate the efficiency of the proposed method.

  9. Crystal structure of a soluble decoy receptor IL-22BP bound to interleukin-22.

    PubMed

    de Moura, Patricia Ribeiro; Watanabe, Leandra; Bleicher, Lucas; Colau, Didier; Dumoutier, Laure; Lemaire, Muriel M; Renauld, Jean-Christophe; Polikarpov, Igor

    2009-04-01

    Interleukin-22 (IL-22) plays an important role in the regulation of immune and inflammatory responses in mammals. The IL-22 binding protein (IL-22BP), a soluble receptor that specifically binds IL-22, prevents the IL-22/interleukin-22 receptor 1 (IL-22R1)/interleukin-10 receptor 2 (IL-10R2) complex assembly and blocks IL-22 biological activity. Here we present the crystal structure of the IL-22/IL-22BP complex at 2.75 A resolution. The structure reveals IL-22BP residues critical for IL-22 binding, which were confirmed by site-directed mutagenesis and functional studies. Comparison of IL-22/IL-22BP and IL-22/IL-22R1 crystal structures shows that both receptors display an overlapping IL-22 binding surface, which is consistent with the inhibitory role played by IL-22 binding protein.

  10. WS-BP: An efficient wolf search based back-propagation algorithm

    NASA Astrophysics Data System (ADS)

    Nawi, Nazri Mohd; Rehman, M. Z.; Khan, Abdullah

    2015-05-01

    Wolf Search (WS) is a heuristic based optimization algorithm. Inspired by the preying and survival capabilities of the wolves, this algorithm is highly capable to search large spaces in the candidate solutions. This paper investigates the use of WS algorithm in combination with back-propagation neural network (BPNN) algorithm to overcome the local minima problem and to improve convergence in gradient descent. The performance of the proposed Wolf Search based Back-Propagation (WS-BP) algorithm is compared with Artificial Bee Colony Back-Propagation (ABC-BP), Bat Based Back-Propagation (Bat-BP), and conventional BPNN algorithms. Specifically, OR and XOR datasets are used for training the network. The simulation results show that the WS-BP algorithm effectively avoids the local minima and converge to global minima.

  11. DLC/BP ultra durable LWIR protective coatings for ZnS windows

    NASA Astrophysics Data System (ADS)

    Li, Qiantao; Liu, Shijun; Xiong, Changxin

    2007-12-01

    DLC/BP ultra durable LWIR (long wave infrared) protective coatings have been designed and prepared on ZnS (Zinc Sulphide) windows successfully. Both of BP and DLC coatings are deposited by RF-PECVD (radio frequency enhanced plasma chemical vapor deposition) process, but in different chamber. The transmittance, micro-hardness and durability of DLC/BP coatings have been investigated, which are measured by FTIR spectroscopy, micro-hardness tester and simulative harsh environmental test system. The ZnS window outer face coated with DLC/BP coatings and inner face coated with high efficient antireflection coatings is also fabricated. In the band of 8~11.5μm, the measured maximum transmittance is above 93% and the average transmittance is about 89%. The coated ZnS windows meet with the demands of LWIR electro-optics systems workable in battlefield environment.

  12. Sodium nitroprusside: low price and safe drug to control BP during thrombolysis in AIS.

    PubMed

    Koslyk, Jessyca L; Ducci, Renata D; Nóvak, Edison M; Zétola, Viviane F; Lange, Marcos C

    2015-09-01

    This study analyzes the use of sodium nitroprusside (SN) as an option to reduce blood pressure (BP) below 180/105 mmHg during the management of acute ischemic stroke (AIS) in patients submitted to intravenous thrombolysis.Method The sample was composed by 60 patients who had AIS and were submitted to intravenous rtPA, split in two groups: half in the control group (CG) with BP < 180/105 mmHg and half in SN group with BP > 180/105 mmHg. Outcome variables were any hemorrhagic transformation (HT); the presence of symptomatic HT, National Institute of Health Stroke Scale (NIHSS) after 24 hours of treatment; the independence on discharge and death until three months after stroke onset.Results There were no statistical differences between both groups to any of the outcome variables analyzed.Conclusion The SN might be safe for BP control during thrombolysis to AIS. PMID:26352493

  13. Prediction of BP reactivity to talking using hybrid soft computing approaches.

    PubMed

    Kaur, Gurmanik; Arora, Ajat Shatru; Jain, Vijender Kumar

    2014-01-01

    High blood pressure (BP) is associated with an increased risk of cardiovascular diseases. Therefore, optimal precision in measurement of BP is appropriate in clinical and research studies. In this work, anthropometric characteristics including age, height, weight, body mass index (BMI), and arm circumference (AC) were used as independent predictor variables for the prediction of BP reactivity to talking. Principal component analysis (PCA) was fused with artificial neural network (ANN), adaptive neurofuzzy inference system (ANFIS), and least square-support vector machine (LS-SVM) model to remove the multicollinearity effect among anthropometric predictor variables. The statistical tests in terms of coefficient of determination (R (2)), root mean square error (RMSE), and mean absolute percentage error (MAPE) revealed that PCA based LS-SVM (PCA-LS-SVM) model produced a more efficient prediction of BP reactivity as compared to other models. This assessment presents the importance and advantages posed by PCA fused prediction models for prediction of biological variables. PMID:25328536

  14. 1. ENVIRONMENT, FROM NORTHWEST, SHOWING B&P INTERLOCKING TOWER AND POWER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. ENVIRONMENT, FROM NORTHWEST, SHOWING B&P INTERLOCKING TOWER AND POWER SUBSTATIONS - Baltimore & Potomac Interlocking Tower, Adjacent to AMTRAK railroad tracks in block bounded by Howard Street, Jones Falls Expressway, Maryland Avenue & Falls Road, Baltimore, Independent City, MD

  15. 78 FR 53137 - Flint Hills Resources Alaska, LLC, BP Pipelines (Alaska) Inc., ConocoPhillips Transportation...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-28

    ...Phillips Transportation Alaska, Inc., ExxonMobil Pipeline Company; Notice of Complaint Take notice that on... formal complaint against BP Pipelines (Alaska) Inc., ConocoPhillips Transportation Alaska, Inc.,...

  16. Environmental Conditions in northern Gulf of Mexico Estuaries: before and after the BP Oil Spill

    EPA Science Inventory

    This presentation provides a summary of ecological condition and sediment chemistry data for northern Gulf of Mexico estuaries that were exposed to oil and oil-related contaminants from the BP Oil Spill.

  17. Prediction of BP Reactivity to Talking Using Hybrid Soft Computing Approaches

    PubMed Central

    Arora, Ajat Shatru; Jain, Vijender Kumar

    2014-01-01

    High blood pressure (BP) is associated with an increased risk of cardiovascular diseases. Therefore, optimal precision in measurement of BP is appropriate in clinical and research studies. In this work, anthropometric characteristics including age, height, weight, body mass index (BMI), and arm circumference (AC) were used as independent predictor variables for the prediction of BP reactivity to talking. Principal component analysis (PCA) was fused with artificial neural network (ANN), adaptive neurofuzzy inference system (ANFIS), and least square-support vector machine (LS-SVM) model to remove the multicollinearity effect among anthropometric predictor variables. The statistical tests in terms of coefficient of determination (R 2), root mean square error (RMSE), and mean absolute percentage error (MAPE) revealed that PCA based LS-SVM (PCA-LS-SVM) model produced a more efficient prediction of BP reactivity as compared to other models. This assessment presents the importance and advantages posed by PCA fused prediction models for prediction of biological variables. PMID:25328536

  18. A targeted enrichment strategy for massively parallel sequencing of angiosperm plastid genomes1

    PubMed Central

    Stull, Gregory W.; Moore, Michael J.; Mandala, Venkata S.; Douglas, Norman A.; Kates, Heather-Rose; Qi, Xinshuai; Brockington, Samuel F.; Soltis, Pamela S.; Soltis, Douglas E.; Gitzendanner, Matthew A.

    2013-01-01

    • Premise of the study: We explored a targeted enrichment strategy to facilitate rapid and low-cost next-generation sequencing (NGS) of numerous complete plastid genomes from across the phylogenetic breadth of angiosperms. • Methods and Results: A custom RNA probe set including the complete sequences of 22 previously sequenced eudicot plastomes was designed to facilitate hybridization-based targeted enrichment of eudicot plastid genomes. Using this probe set and an Agilent SureSelect targeted enrichment kit, we conducted an enrichment experiment including 24 angiosperms (22 eudicots, two monocots), which were subsequently sequenced on a single lane of the Illumina GAIIx with single-end, 100-bp reads. This approach yielded nearly complete to complete plastid genomes with exceptionally high coverage (mean coverage: 717×), even for the two monocots. • Conclusions: Our enrichment experiment was highly successful even though many aspects of the capture process employed were suboptimal. Hence, significant improvements to this methodology are feasible. With this general approach and probe set, it should be possible to sequence more than 300 essentially complete plastid genomes in a single Illumina GAIIx lane (achieving ∼50× mean coverage). However, given the complications of pooling numerous samples for multiplex sequencing and the limited number of barcodes (e.g., 96) available in commercial kits, we recommend 96 samples as a current practical maximum for multiplex plastome sequencing. This high-throughput approach should facilitate large-scale plastid genome sequencing at any level of phylogenetic diversity in angiosperms. PMID:25202518

  19. The research of multi-frame target recognition based on laser active imaging

    NASA Astrophysics Data System (ADS)

    Wang, Can-jin; Sun, Tao; Wang, Tin-feng; Chen, Juan

    2013-09-01

    Laser active imaging is fit to conditions such as no difference in temperature between target and background, pitch-black night, bad visibility. Also it can be used to detect a faint target in long range or small target in deep space, which has advantage of high definition and good contrast. In one word, it is immune to environment. However, due to the affect of long distance, limited laser energy and atmospheric backscatter, it is impossible to illuminate the whole scene at the same time. It means that the target in every single frame is unevenly or partly illuminated, which make the recognition more difficult. At the same time the speckle noise which is common in laser active imaging blurs the images . In this paper we do some research on laser active imaging and propose a new target recognition method based on multi-frame images . Firstly, multi pulses of laser is used to obtain sub-images for different parts of scene. A denoising method combined homomorphic filter with wavelet domain SURE is used to suppress speckle noise. And blind deconvolution is introduced to obtain low-noise and clear sub-images. Then these sub-images are registered and stitched to combine a completely and uniformly illuminated scene image. After that, a new target recognition method based on contour moments is proposed. Firstly, canny operator is used to obtain contours. For each contour, seven invariant Hu moments are calculated to generate the feature vectors. At last the feature vectors are input into double hidden layers BP neural network for classification . Experiments results indicate that the proposed algorithm could achieve a high recognition rate and satisfactory real-time performance for laser active imaging.

  20. The Mechanics of Human Achievement

    PubMed Central

    Duckworth, Angela L.; Eichstaedt, Johannes C.; Ungar, Lyle H.

    2015-01-01

    Countless studies have addressed why some individuals achieve more than others. Nevertheless, the psychology of achievement lacks a unifying conceptual framework for synthesizing these empirical insights. We propose organizing achievement-related traits by two possible mechanisms of action: Traits that determine the rate at which an individual learns a skill are talent variables and can be distinguished conceptually from traits that determine the effort an individual puts forth. This approach takes inspiration from Newtonian mechanics: achievement is akin to distance traveled, effort to time, skill to speed, and talent to acceleration. A novel prediction from this model is that individual differences in effort (but not talent) influence achievement (but not skill) more substantially over longer (rather than shorter) time intervals. Conceptualizing skill as the multiplicative product of talent and effort, and achievement as the multiplicative product of skill and effort, advances similar, but less formal, propositions by several important earlier thinkers. PMID:26236393

  1. Mathematics Achievement in High- and Low-Achieving Secondary Schools

    ERIC Educational Resources Information Center

    Mohammadpour, Ebrahim; Shekarchizadeh, Ahmadreza

    2015-01-01

    This paper identifies the amount of variance in mathematics achievement in high- and low-achieving schools that can be explained by school-level factors, while controlling for student-level factors. The data were obtained from 2679 Iranian eighth graders who participated in the 2007 Trends in International Mathematics and Science Study. Of the…

  2. Heterostructured hBN-BP-hBN Nanodetectors at Terahertz Frequencies.

    PubMed

    Viti, Leonardo; Hu, Jin; Coquillat, Dominique; Politano, Antonio; Consejo, Christophe; Knap, Wojciech; Vitiello, Miriam S

    2016-09-01

    By reassembling thin isolated atomic planes of hexagonal borum nitride (hBN) with a few layer phosphorene black phosphorus (BP), hBN/BP/hBN heterostructures are mechanically stacked to devise high-efficiency THz photodetectors operating in the 0.3-0.65 THz range, from 4 K to 300 K, with a record signal-to-noise ratio of 20 000.

  3. Discrete Sampling Test Plan for the 200-BP-5 Operable Unit

    SciTech Connect

    Sweeney, Mark D.

    2010-02-04

    The Discrete Groundwater Sampling Project is conducted by the Pacific Northwest National Laboratory (PNNL) on behalf of CH2M HILL Plateau Remediation Company. The project is focused on delivering groundwater samples from proscribed horizons within select groundwater wells residing in the 200-BP-5 Operable Unit (200-BP-5 OU) on the Hanford Site. This document provides the scope, schedule, methodology, and other details of the PNNL discrete sampling effort.

  4. Study on the identifying of meat's visible spectrum based on BP artificial neural network

    NASA Astrophysics Data System (ADS)

    Li, Xiaotian; Zhang, Tieqiang; Li, Bo; Jiang, Yongheng; Liu, Binghui; Li, Zhaokai

    2006-01-01

    A method to identify different meat by the visible and reflected spectra of meat with BP artificial neural net (BP-ANN) was introduced in this paper. The visible and reflected spectra (from 420 to 535nm) of different meat (beef and pork) were measured with fiber sensor spectrometer. A kind of ANN with a double-hidden layer was created to identify the different meat automatically. Its right ratio reaches 92.71%.

  5. Improving enantioselectivity towards tertiary alcohols using mutants of Bacillus sp. BP-7 esterase EstBP7 holding a rare GGG(X)-oxyanion hole.

    PubMed

    Fillat, Amanda; Romea, Pedro; Urpí, Fèlix; Pastor, F I Javier; Diaz, Pilar

    2014-05-01

    Lipases and esterases are important biocatalysts for synthetic organic fine chemistry. An esterase from Bacillus sp. BP-7 (EstBP7) bears in its amino acid sequence a rare GGG(A)X oxyanion hole motif, where an uncommon threonine (T) is found at the third position. Detection of this pattern motivated evaluation of the ability of EstBP7 for conversion of tertiary alcohols. The enzyme was engineered in order to optimize its performance to provide important chiral building blocks: five variants with mutations in the oxyanion hole motif were created to investigate the influence on activity and enantioselectivity in the kinetic resolution of eight acetates of tertiary alcohols. Wild-type enzyme converted all esters of tertiary alcohols assayed with low enantioselectivity, whereas some of the mutants displayed significantly increased E-values. One of the mutants (EstBP7-AGA; Mut 5) showed an E >100 towards a complex tertiary alcohol acetate (2-(4-pyridyl)but-3-yn-2-yl acetate) at low reaction temperature (4 °C). Therefore, the catalytic toolbox was expanded for biocatalysis of optically pure tertiary alcohols valuable for the pharmaceutical industry. PMID:24407449

  6. Attribution theory in science achievement

    NASA Astrophysics Data System (ADS)

    Craig, Martin

    Recent research reveals consistent lags in American students' science achievement scores. Not only are the scores lower in the United States compared to other developed nations, but even within the United States, too many students are well below science proficiency scores for their grade levels. The current research addresses this problem by examining potential malleable factors that may predict science achievement in twelfth graders using 2009 data from the National Assessment of Educational Progress (NAEP). Principle component factor analysis was conducted to determine the specific items that contribute to each overall factor. A series of multiple regressions were then analyzed and formed the predictive value of each of these factors for science achievement. All significant factors were ultimately examined together (also using multiple regression) to determine the most powerful predictors of science achievement, identifying factors that predict science achievement, the results of which suggested interventions to strengthen students' science achievement scores and encourage persistence in the sciences at the college level and beyond. Although there is a variety of research highlighting how students in the US are falling behind other developing nations in science and math achievement, as yet, little research has addressed ways of intervening to address this gap. The current research is a starting point, seeking to identify malleable factors that contribute to science achievement. More specifically, this research examined the types of attributions that predict science achievement in twelfth grade students.

  7. Molecular mechanism of the dual activity of 4EGI-1: Dissociating eIF4G from eIF4E but stabilizing the binding of unphosphorylated 4E-BP1

    PubMed Central

    Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos; Rodriguez-Mias, Ricard A.; Wagner, Gerhard; Léger-Abraham, Mélissa

    2015-01-01

    The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T37/T46, followed by T70 and S65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is a goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ60 (motif 1) but lack known phosphorylation sites. We report here a 2.1-Å crystal structure of mouse eIF4E in complex with m7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP150–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S65 and T70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. The binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation. PMID:26170285

  8. Regulation of B cell differentiation by the ubiquitin-binding protein TAX1BP1

    PubMed Central

    Matsushita, Nobuko; Suzuki, Midori; Ikebe, Emi; Nagashima, Shun; Inatome, Ryoko; Asano, Kenichi; Tanaka, Masato; Matsushita, Masayuki; Kondo, Eisaku; Iha, Hidekatsu; Yanagi, Shigeru

    2016-01-01

    Tax1-binding protein 1 (TAX1BP1) is a ubiquitin-binding protein that restricts nuclear factor-κB (NF-κB) activation and facilitates the termination of aberrant inflammation. However, its roles in B-cell activation and differentiation are poorly understood. To evaluate the function of TAX1BP1 in B cells, we established TAX1BP1-deficient DT40 B cells that are hyper-responsive to CD40-induced extracellular signal-regulated kinase (ERK) activation signaling, exhibit prolonged and exaggerated ERK phosphorylation and show enhanced B lymphocyte-induced maturation protein 1 (Blimp-1; a transcription factor inducing plasma cell differentiation) expression that is ERK-dependent. Furthermore, TAX1BP1-deficient cells exhibit significantly decreased surface IgM expression and increased IgM secretion. Moreover, TAX1BP1-deficient mice display reduced germinal center formation and antigen-specific antibody production. These findings show that TAX1BP1 restricts ERK activation and Blimp-1 expression and regulates germinal center formation. PMID:27515252

  9. HP1BP3, a Chromatin Retention Factor for Co-transcriptional MicroRNA Processing.

    PubMed

    Liu, Haoming; Liang, Chunyang; Kollipara, Rahul K; Matsui, Masayuki; Ke, Xiong; Jeong, Byung-Cheon; Wang, Zhiqiang; Yoo, Kyoung Shin; Yadav, Gaya P; Kinch, Lisa N; Grishin, Nicholas V; Nam, Yunsun; Corey, David R; Kittler, Ralf; Liu, Qinghua

    2016-08-01

    Recent studies suggest that the microprocessor (Drosha-DGCR8) complex can be recruited to chromatin to catalyze co-transcriptional processing of primary microRNAs (pri-miRNAs) in mammalian cells. However, the molecular mechanism of co-transcriptional miRNA processing is poorly understood. Here we find that HP1BP3, a histone H1-like chromatin protein, specifically associates with the microprocessor and promotes global miRNA biogenesis in human cells. Chromatin immunoprecipitation (ChIP) studies reveal genome-wide co-localization of HP1BP3 and Drosha and HP1BP3-dependent Drosha binding to actively transcribed miRNA loci. Moreover, HP1BP3 specifically binds endogenous pri-miRNAs and facilitates the Drosha/pri-miRNA association in vivo. Knockdown of HP1BP3 compromises pri-miRNA processing by causing premature release of pri-miRNAs from the chromatin. Taken together, these studies suggest that HP1BP3 promotes co-transcriptional miRNA processing via chromatin retention of nascent pri-miRNA transcripts. This work significantly expands the functional repertoire of the H1 family of proteins and suggests the existence of chromatin retention factors for widespread co-transcriptional miRNA processing.

  10. CacyBP/SIP binds ERK1/2 and affects transcriptional activity of Elk-1

    SciTech Connect

    Kilanczyk, Ewa; Filipek, Slawomir; Jastrzebska, Beata; Filipek, Anna

    2009-02-27

    In this work we showed for the first time that mouse CacyBP/SIP interacts with extracellular signal regulated kinases 1 and 2 (ERK1/2). We also established that a calcium binding protein, S100A6, competes for this interaction. Moreover, the E217K mutant of CacyBP/SIP does not bind significantly to ERK1/2 although it retains the ability to interact with S100A6. Molecular modeling shows that the E217K mutation in the 189-219 CacyBP/SIP fragment markedly changes its electrostatic potential, suggesting that the binding with ERK1/2 might have an electrostatic character. We also demonstrate that CacyBP/SIP-ERK1/2 interaction inhibits phosphorylation of the Elk-1 transcription factor in vitro and in the nuclear fraction of NB2a cells. Altogether, our data suggest that the binding of CacyBP/SIP with ERK1/2 might regulate Elk-1 phosphorylation/transcriptional activity and that S100A6 might further modulate this effect via Ca{sup 2+}-dependent interaction with CacyBP/SIP and competition with ERK1/2.

  11. The preparation of BP single crystals by high pressure flux method

    NASA Technical Reports Server (NTRS)

    Kumashiro, Y.; Misawa, S.; Gonda, S.

    1984-01-01

    Single crystals of BP, a III-V compound semiconductor, were obtained by the high pressure flux method. Cu3P and Ni12P5 powders were used as the flux, and mixed with BP powder. Two kinds of mixtures were prepared: (1) 1.8g (BP) + 35 G (Cu3P) and (2) 1.7 g (BP) + 25 g (Ni12P5). They were compressed into pellets, heated at 1300 C for 24 h in an induction furnace under a pressure of 1 MPa using Ar-P2 gas, and slowly cooled to room temperature. In case (1), BP single crystals grew along the (III) plane, and in case (2) they grew as an aggregate of crystallites. The cathodoluminescence spectra of the synthetic BP crystals showed peaks near 680 nm (1.82 eV) for case (1), and 500 nm (2.47 eV) for case (2). By using the high pressure flux method conventional sized crystals were obtained in a relatively short time.

  12. Accelerator target

    DOEpatents

    Schlyer, D.J.; Ferrieri, R.A.; Koehler, C.

    1999-06-29

    A target includes a body having a depression in a front side for holding a sample for irradiation by a particle beam to produce a radioisotope. Cooling fins are disposed on a backside of the body opposite the depression. A foil is joined to the body front side to cover the depression and sample therein. A perforate grid is joined to the body atop the foil for supporting the foil and for transmitting the particle beam therethrough. A coolant is circulated over the fins to cool the body during the particle beam irradiation of the sample in the depression. 5 figs.

  13. Accelerator target

    DOEpatents

    Schlyer, David J.; Ferrieri, Richard A.; Koehler, Conrad

    1999-01-01

    A target includes a body having a depression in a front side for holding a sample for irradiation by a particle beam to produce a radioisotope. Cooling fins are disposed on a backside of the body opposite the depression. A foil is joined to the body front side to cover the depression and sample therein. A perforate grid is joined to the body atop the foil for supporting the foil and for transmitting the particle beam therethrough. A coolant is circulated over the fins to cool the body during the particle beam irradiation of the sample in the depression.

  14. 15q11.2 microdeletion (BP1-BP2) and developmental delay, behaviour issues, epilepsy and congenital heart disease: a series of 52 patients.

    PubMed

    Vanlerberghe, Clémence; Petit, Florence; Malan, Valérie; Vincent-Delorme, Catherine; Bouquillon, Sonia; Boute, Odile; Holder-Espinasse, Muriel; Delobel, Bruno; Duban, Bénédicte; Vallee, Louis; Cuisset, Jean-Marie; Lemaitre, Marie-Pierre; Vantyghem, Marie-Christine; Pigeyre, Marie; Lanco-Dosen, Sandrine; Plessis, Ghislaine; Gerard, Marion; Decamp, Matthieu; Mathieu, Michèle; Morin, Gilles; Jedraszak, Guillaume; Bilan, Frédéric; Gilbert-Dussardier, Brigitte; Fauvert, Delphine; Roume, Joëlle; Cormier-Daire, Valérie; Caumes, Roseline; Puechberty, Jacques; Genevieve, David; Sarda, Pierre; Pinson, Lucie; Blanchet, Patricia; Lemeur, Nathalie; Sheth, Frenny; Manouvrier-Hanu, Sylvie; Andrieux, Joris

    2015-03-01

    Proximal region of chromosome 15 long arm is rich in duplicons that, define five breakpoints (BP) for 15q rearrangements. 15q11.2 microdeletion between BP1 and BP2 has been previously associated with developmental delay and atypical psychological patterns. This region contains four highly-conserved and non-imprinted genes: NIPA1, NIPA2, CYFIP1, TUBGCP5. Our goal was to investigate the phenotypes associated with this microdeletion in a cohort of 52 patients. This copy number variation (CNV) was prevalent in 0.8% patients presenting with developmental delay, psychological pattern issues and/or multiple congenital malformations. This was studied by array-CGH at six different French Genetic laboratories. We collected data from 52 unrelated patients (including 3 foetuses) after excluding patients with an associated genetic alteration (known CNV, aneuploidy or known monogenic disease). Out of 52 patients, mild or moderate developmental delay was observed in 68.3%, 85.4% had speech impairment and 63.4% had psychological issues such as Attention Deficit and Hyperactivity Disorder, Autistic Spectrum Disorder or Obsessive-Compulsive Disorder. Seizures were noted in 18.7% patients and associated congenital heart disease in 17.3%. Parents were analysed for abnormalities in the region in 65.4% families. Amongst these families, 'de novo' microdeletions were observed in 18.8% and 81.2% were inherited from one of the parents. Incomplete penetrance and variable expressivity were observed amongst the patients. Our results support the hypothesis that 15q11.2 (BP1-BP2) microdeletion is associated with developmental delay, abnormal behaviour, generalized epilepsy and congenital heart disease. The later feature has been rarely described. Incomplete penetrance and variability of expression demands further assessment and studies.

  15. Occurrence of 4-tert-butylphenol (4-t-BP) biodegradation in an aquatic sample caused by the presence of Spirodela polyrrhiza and isolation of a 4-t-BP-utilizing bacterium.

    PubMed

    Ogata, Yuka; Toyama, Tadashi; Yu, Ning; Wang, Xuan; Sei, Kazunari; Ike, Michihiko

    2013-04-01

    Although 4-tert-butylphenol (4-t-BP) is a serious aquatic pollutant, its biodegradation in aquatic environments has not been well documented. In this study, 4-t-BP was obviously and repeatedly removed from water from four different environments in the presence of Spirodela polyrrhiza, giant duckweed, but 4-t-BP persisted in the environmental waters in the absence of S. polyrrhiza. Also, 4-t-BP was not removed from autoclaved pond water with sterilized S. polyrrhiza. These results suggest that the 4-t-BP removal from the environmental waters was caused by biodegradation stimulated by the presence of S. polyrrhiza rather than by uptake by the plant. Moreover, Sphingobium fuliginis OMI capable of utilizing 4-t-BP as a sole carbon and energy source was isolated from the S. polyrrhiza rhizosphere. Strain OMI degraded 4-t-BP via a meta-cleavage pathway, and also degraded a broad range of alkylphenols with linear or branched alkyl side chains containing two to nine carbon atoms. Root exudates of S. polyrrhiza stimulated 4-t-BP degradation and cell growth of strain OMI. Thus, the stimulating effects of S. polyrrhiza root exudates on 4-t-BP-degrading bacteria might have contributed to 4-t-BP removal in the environmental waters with S. polyrrhiza. These results demonstrate that the S. polyrrhiza-bacteria association may be applicable to the removal of highly persistent 4-t-BP from wastewaters or polluted aquatic environments.

  16. Targeting Breast Cancer Metastasis

    PubMed Central

    Jin, Xin; Mu, Ping

    2015-01-01

    Metastasis is the leading cause of breast cancer-associated deaths. Despite the significant improvement in current therapies in extending patient life, 30–40% of patients may eventually suffer from distant relapse and succumb to the disease. Consequently, a deeper understanding of the metastasis biology is key to developing better treatment strategies and achieving long-lasting therapeutic efficacies against breast cancer. This review covers recent breakthroughs in the discovery of various metastatic traits that contribute to the metastasis cascade of breast cancer, which may provide novel avenues for therapeutic targeting. PMID:26380552

  17. Perils of Standardized Achievement Testing

    ERIC Educational Resources Information Center

    Haladyna, Thomas M.

    2006-01-01

    This article argues that the validity of standardized achievement test-score interpretation and use is problematic; consequently, confidence and trust in such test scores may often be unwarranted. The problem is particularly severe in high-stakes situations. This essay provides a context for understanding standardized achievement testing, then…

  18. Poor Results for High Achievers

    ERIC Educational Resources Information Center

    Bui, Sa; Imberman, Scott; Craig, Steven

    2012-01-01

    Three million students in the United States are classified as gifted, yet little is known about the effectiveness of traditional gifted and talented (G&T) programs. In theory, G&T programs might help high-achieving students because they group them with other high achievers and typically offer specially trained teachers and a more advanced…

  19. Parental Involvement and Academic Achievement

    ERIC Educational Resources Information Center

    Goodwin, Sarah Christine

    2015-01-01

    This research study examined the correlation between student achievement and parent's perceptions of their involvement in their child's schooling. Parent participants completed the Parent Involvement Project Parent Questionnaire. Results slightly indicated parents of students with higher level of achievement perceived less demand or invitations…

  20. Examination Regimes and Student Achievement

    ERIC Educational Resources Information Center

    Cosentino de Cohen, Clemencia

    2010-01-01

    Examination regimes at the end of secondary school vary greatly intra- and cross-nationally, and in recent years have undergone important reforms often geared towards increasing student achievement. This research presents a comparative analysis of the relationship between examination regimes and student achievement in the OECD. Using a micro…

  1. General Achievement Trends: New Jersey

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  2. Teaching the Low Level Achiever.

    ERIC Educational Resources Information Center

    Salomone, Ronald E., Ed.

    1986-01-01

    Intended for teachers of the English language arts, the articles in this issue offer suggestions and techniques for teaching the low level achiever. Titles and authors of the articles are as follows: (1) "A Point to Ponder" (Rachel Martin); (2) "Tracking: A Self-Fulfilling Prophecy of Failure for the Low Level Achiever" (James Christopher Davis);…

  3. Family Status and School Achievement.

    ERIC Educational Resources Information Center

    Chalker, Rhoda N.; Horns, Virginia

    This study tested the hypothesis that there is no significant difference in reading achievement among children in grades 2 through 5 related to family structure. Researchers administered the Stanford Achievement Test to 119 students in an Alabama city suburban school system. Of the sample, 69 children lived in intact families and 50 lived in…

  4. General Achievement Trends: North Carolina

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  5. Classroom Composition and Achievement Gains.

    ERIC Educational Resources Information Center

    Leiter, Jeffrey

    1983-01-01

    Third-grade students in high ability groups in mathematics achieved greater gains than students in low ability groups. The opposite results occurred in reading achievement. Possible reasons for this difference include different instructional techniques for reading and math and the effect of home environment on learning. (IS)

  6. Raising Boys' Achievement in Schools.

    ERIC Educational Resources Information Center

    Bleach, Kevan, Ed.

    This book offers insights into the range of strategies and good practice being used to raise the achievement of boys. Case studies by school-based practitioners suggest ideas and measures to address the issue of achievement by boys. The contributions are: (1) "Why the Likely Lads Lag Behind" (Kevan Bleach); (2) "Helping Boys Do Better in Their…

  7. School Size and Student Achievement

    ERIC Educational Resources Information Center

    Riggen, Vicki

    2013-01-01

    This study examined whether a relationship between high school size and student achievement exists in Illinois public high schools in reading and math, as measured by the Prairie State Achievement Exam (PSAE), which is administered to all Illinois 11th-grade students. This study also examined whether the factors of socioeconomic status, English…

  8. Stress Correlates and Academic Achievement.

    ERIC Educational Resources Information Center

    Bentley, Donna Anderson; And Others

    An ongoing concern for educators is the identification of factors that contribute to or are associated with academic achievement; one such group of variables that has received little attention are those involving stress. The relationship between perceived sources of stress and academic achievement was examined to determine if reactions to stress…

  9. Salt Marsh Sediment Biogeochemical Response to the BP Blowout.

    PubMed

    Mills, Calista G; McNeal, Karen S

    2014-09-01

    The impact of the blowout on salt marshes was investigated by observing the biogeochemistry in salt marsh sediments along the Gulf Coast. High sulfide levels due to hydrocarbon loading, increased microbial activity, and microbial community shifts can lead to plant browning and mortality. Sediment biogeochemical processes that degrade enriched carbon pools through sulfate reduction are primarily responsible for the biodegradation of spilled hydrocarbons. An assessment of the impact of contamination on salt marshes at Skiff Island, LA, and Cat Island, Marsh Point, and Saltpan Island, MS, was achieved through sediment electrode profiling, microbial community profiling, and quantification of hydrocarbon contamination, which captured the spatial sedimentary biogeochemical response that affects salt marsh productivity. At western locations (Skiff and Cat Islands), total petroleum hydrocarbons (TPHs) ranged from 2183 to 2996 mg kg, which was more than double the TPH concentration observed at eastern locales. At eastern study locations (e.g., Marsh Point), sedimentary pore-water HS concentrations were higher (maximum value = 231 mg L) and detected further up in the sediment column than at western locales (e.g., Skiff Island). Similarly, anaerobic and aerobic microbial activity, as measured by C substrate utilization profiles and well-color development, was as high or higher at eastern locations as compared with western locations. These results indicate that other factors besides location or degree of contamination, perhaps sedimentary dynamics and physical processes specific to each marsh, should be considered when determining salt marsh response to hydrocarbon contamination.

  10. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  11. The TIP60 complex regulates bivalent chromatin recognition by 53BP1 through direct H4K20me binding and H2AK15 acetylation

    PubMed Central

    Jacquet, Karine; Fradet-Turcotte, Amélie; Avvakumov, Nikita; Lambert, Jean-Philippe; Roques, Céline; Pandita, Raj K.; Paquet, Eric; Herst, Pauline; Gingras, Anne-Claude; Pandita, Tej K.; Legube, Gaëlle; Doyon, Yannick; Durocher, Daniel; Côté, Jacques

    2016-01-01

    SUMMARY The NuA4/TIP60 acetyltransferase complex is a key regulator of genome expression and stability. Here, we identified MBTD1 as a new stable subunit of the complex and gleaned intriguing insights into TIP60’s function. Harboring a histone reader domain for H4K20me1/2, MBTD1 allows TIP60 to associate with specific gene promoters and to promote the repair of DNA double strand breaks by homologous recombination. Interestingly, the non-homologous end joining factor 53BP1 engages chromatin through simultaneous binding of H4K20me2 and H2AK15ub, and it was postulated that Tip60-dependent acetylation of H4 regulates this binding. Our findings now indicate that the TIP60 complex is a potent regulator of DNA damage repair pathways in part by targeting the same histone mark as 53BP1. In addition, deposition of H2AK15ub by RNF168 inhibits chromatin acetylation by TIP60, while this residue can be acetylated by TIP60 in vivo, blocking its ubiquitylation. Altogether, these results uncover an intricate mechanism orchestrated by the TIP60 complex which regulates 53BP1-dependent repair pathway selection through incompatible bivalent binding and modification of chromatin. PMID:27153538

  12. Escaping the Cut by Restriction Enzymes Through Single-Strand Self-Annealing of Host-Edited 12-bp and Longer Synthetic Palindromes

    PubMed Central

    2012-01-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5′ CCCGAATTCGGG 3′, (2) by a 22-bp related sequence 5′ CTCGTGCCGAATTCGGCACGAG 3′, and (3) by a longer 44-bp related sequence: 5′ CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3′. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (−) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5′ G/AATTC 3′, its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  13. RhoE inhibits 4E-BP1 phosphorylation and eIF4E function impairing cap-dependent translation.

    PubMed

    Villalonga, Priam; Fernández de Mattos, Silvia; Ridley, Anne J

    2009-12-18

    The Rho GTPase family member RhoE inhibits RhoA/ROCK signaling to promote actin stress fiber and focal adhesion disassembly. We have previously reported that RhoE also inhibits cell cycle progression and Ras-induced transformation, specifically preventing cyclin D1 translation. Here we investigate the molecular mechanisms underlying those observations. RhoE inhibits the phosphorylation of the translational repressor 4E-BP1 in response to extracellular stimuli. However, RhoE does not affect the activation of mTOR, the major kinase regulating 4E-BP1 phosphorylation, as indicated by the phosphorylation levels of the mTOR substrate S6K, the dynamics of mTOR/Raptor association, and the observation that RhoE, as opposed to rapamycin, does not impair cellular growth. Interestingly, RhoE prevents the release of the eukaryotic initiation factor eIF4E from 4E-BP1, inhibiting cap-dependent translation. Accordingly, RhoE also inhibits the expression and the transcriptional activity of the eIF4E target c-Myc. Consistent with its crucial role in cell proliferation, we show that eIF4E can rescue both cell cycle progression and Ras-induced transformation in RhoE-expressing cells, indicating that the inhibition of eIF4E function is critical to mediate the anti-proliferative effects of RhoE.

  14. Identification and characterization of a novel calcyclin binding protein (CacyBP) gene from Apis cerana cerana.

    PubMed

    Yu, Xiaoli; Lu, Wenjing; Sun, Rujiang; Guo, Xingqi; Xu, Baohua

    2012-08-01

    Calcyclin binding protein (CacyBP), a homolog of Sgt1, was shown to interact with some S100 proteins, Skp1, tubulin, actin and ERK1/2 kinases. Studies have also shown that CacyBP is a neuronal protein in mammals. Limited information is available regarding the properties and functions of CacyBP in insects. Here, we cloned and characterized a novel CacyBP gene, named AccCacyBP, from honeybee (Apis cerana cerana). Bioinformatic analysis indicated that AccCacyBP was highly conserved and closely related to the CacyBP of other insects. Promoter analysis revealed a number of putative tissue, development and stress-related transcription factor-binding sites. RT-qPCR demonstrated that AccCacyBP was expressed at all of the stages of development, especially in the brains of honeybees. Moreover, immunohistochemistry analysis showed the presence of AccCacyBP in the brain. The transcript levels of AccCacyBP in the brains of honeybees were developmentally induced and upregulated by exposure to oxidative stresses, including UV-light, acetamiprid and HgCl(2). This study demonstrates that the CacyBP gene in honeybees may be a neuronal protein involved in the developmental regulation and the stress-response of the brain of honeybees. PMID:22539186

  15. G3BP-Caprin1-USP10 complexes mediate stress granule condensation and associate with 40S subunits.

    PubMed

    Kedersha, Nancy; Panas, Marc D; Achorn, Christopher A; Lyons, Shawn; Tisdale, Sarah; Hickman, Tyler; Thomas, Marshall; Lieberman, Judy; McInerney, Gerald M; Ivanov, Pavel; Anderson, Paul

    2016-03-28

    Mammalian stress granules (SGs) contain stalled translation preinitiation complexes that are assembled into discrete granules by specific RNA-binding proteins such as G3BP. We now show that cells lacking both G3BP1 and G3BP2 cannot form SGs in response to eukaryotic initiation factor 2α phosphorylation or eIF4A inhibition, but are still SG-competent when challenged with severe heat or osmotic stress. Rescue experiments using G3BP1 mutants show that phosphomimetic G3BP1-S149E fails to rescue SG formation, whereas G3BP1-F33W, a mutant unable to bind G3BP partner proteins Caprin1 or USP10, rescues SG formation. Caprin1/USP10 binding to G3BP is mutually exclusive: Caprin binding promotes, but USP10 binding inhibits, SG formation. G3BP interacts with 40S ribosomal subunits through its RGG motif, which is also required for G3BP-mediated SG formation. We propose that G3BP mediates the condensation of SGs by shifting between two different states that are controlled by the phosphorylation of S149 and by binding to Caprin1 or USP10. PMID:27022092

  16. G3BP-Caprin1-USP10 complexes mediate stress granule condensation and associate with 40S subunits.

    PubMed

    Kedersha, Nancy; Panas, Marc D; Achorn, Christopher A; Lyons, Shawn; Tisdale, Sarah; Hickman, Tyler; Thomas, Marshall; Lieberman, Judy; McInerney, Gerald M; Ivanov, Pavel; Anderson, Paul

    2016-03-28

    Mammalian stress granules (SGs) contain stalled translation preinitiation complexes that are assembled into discrete granules by specific RNA-binding proteins such as G3BP. We now show that cells lacking both G3BP1 and G3BP2 cannot form SGs in response to eukaryotic initiation factor 2α phosphorylation or eIF4A inhibition, but are still SG-competent when challenged with severe heat or osmotic stress. Rescue experiments using G3BP1 mutants show that phosphomimetic G3BP1-S149E fails to rescue SG formation, whereas G3BP1-F33W, a mutant unable to bind G3BP partner proteins Caprin1 or USP10, rescues SG formation. Caprin1/USP10 binding to G3BP is mutually exclusive: Caprin binding promotes, but USP10 binding inhibits, SG formation. G3BP interacts with 40S ribosomal subunits through its RGG motif, which is also required for G3BP-mediated SG formation. We propose that G3BP mediates the condensation of SGs by shifting between two different states that are controlled by the phosphorylation of S149 and by binding to Caprin1 or USP10.

  17. Continuous lake-sediment records of glaciation in the Sierra Nevada between 52,600 and 12,500 14C yr B.P.

    USGS Publications Warehouse

    Benson, L.V.; May, Howard M.; Antweiler, R.C.; Brinton, T.I.; Kashgarian, Michaele; Smoot, J.P.; Lund, S.P.

    1998-01-01

    The chemistry of the carbonate-free clay-size fraction of Owens Lake sediments supports the use of total organic carbon and magnetic susceptibility as indicators of stadial-interstadial oscillations. Owens Lake records of total organic carbon, magnetic susceptibility, and chemical composition of the carbonate-free, clay-size fraction indicate that Tioga glaciation began ~24,500 and ended by ~13,600 14C yr B.P. Many of the components of glacial rock flour (e.g., TiO2, MnO, BaO) found in Owens Lake sediments achieved maximum values during the Tioga glaciation when valley glaciers reached their greatest extent. Total organic carbon and SiO2 (amorphous) concentrations reached minimum values during Tioga glaciation, resulting from decreases in productivity that accompanied the introduction of rock flour into the surface waters of Owens Lake. At least 20 stadial-interstadial oscillations occurred in the Sierra Nevada between 52,600 and 14,000 14C yr B.P. Total organic carbon data from a Pyramid Lake sediment core also indicate oscillations in glacier activity between >39,500 and ~13,600 14C yr B.P. Alpine glacier oscillations occurred on a frequency of ???1900 yr in both basins, suggesting that millennial-scale oscillations occurred in California and Nevada during most of the past 52,600 yr.

  18. Sex, Prescribing Practices and Guideline Recommended, Blood Pressure, and LDL Cholesterol Targets at Baseline in the BARI 2D Trial

    PubMed Central

    Magee, Michelle F.; Tamis-Holland, Jacqueline E.; Lu, Jiang; Bittner, Vera A.; Brooks, Maria Mori; Lopes, Neuza; Jacobs, Alice K.; Study Group, BARI 2D

    2015-01-01

    Background. Research has shown less aggressive treatment and poorer control of cardiovascular disease (CVD) risk factors in women than men. Methods. We analyzed sex differences in pharmacotherapy strategies and attainment of goals for hemoglobin A1c (HbA1c), blood pressure (BP), and low density lipoprotein cholesterol (LDL-C) in patients with type 2 diabetes and established coronary artery disease enrolled into the BARI 2D trial. Results. Similar numbers of drugs were prescribed in both women and men. Women were less frequent on metformin or sulfonylurea and more likely to take insulin and to be on higher doses of hydroxymethylglutaryl-CoA reductase inhibitors (statins) than men. After adjusting for baseline differences and treatment prescribed, women were less likely to achieve goals for HbA1c (OR = 0.71, 95% CI 0.57, 0.88) and LDL-C (OR = 0.64, 95% CI 0.53, 0.78). More antihypertensives were prescribed to women, and yet BP ≤ 130/80 mmHg did not differ by sex. Conclusions. Women entering the BARI 2D trial were as aggressively treated with drugs as men. Despite equivalent treatment, women less frequently met targets for HbA1c and LDL-C. Our findings suggest that there may be sex differences in response to drug therapies used to treat diabetes, hypertension, and hyperlipidemia. PMID:25873955

  19. Mathematics anxiety and mathematics achievement

    NASA Astrophysics Data System (ADS)

    Sherman, Brian F.; Wither (Post.), David P.

    2003-09-01

    This paper is a distillation of the major result from the 1998 Ph.D. thesis of the late David Wither. It details a longitudinal study over five years of the relationship between mathematics anxiety and mathematics achievement. It starts from the already well documented negative correlation between the two, and seeks to establish one of the three hypotheses—that mathematics anxiety causes an impairment of mathematics achievement; that lack of mathematics achievement causes mathematics anxiety; or that there is a third underlying cause of the two.

  20. E258K HCM-causing mutation in cardiac MyBP-C reduces contractile force and accelerates twitch kinetics by disrupting the cMyBP-C and myosin S2 interaction.

    PubMed

    De Lange, Willem J; Grimes, Adrian C; Hegge, Laura F; Spring, Alexander M; Brost, Taylor M; Ralphe, J Carter

    2013-09-01

    Mutations in cardiac myosin binding protein C (cMyBP-C) are prevalent causes of hypertrophic cardiomyopathy (HCM). Although HCM-causing truncation mutations in cMyBP-C are well studied, the growing number of disease-related cMyBP-C missense mutations remain poorly understood. Our objective was to define the primary contractile effect and molecular disease mechanisms of the prevalent cMyBP-C E258K HCM-causing mutation in nonremodeled murine engineered cardiac tissue (mECT). Wild-type and human E258K cMyBP-C were expressed in mECT lacking endogenous mouse cMyBP-C through adenoviral-mediated gene transfer. Expression of E258K cMyBP-C did not affect cardiac cell survival and was appropriately incorporated into the cardiac sarcomere. Functionally, expression of E258K cMyBP-C caused accelerated contractile kinetics and severely compromised twitch force amplitude in mECT. Yeast two-hybrid analysis revealed that E258K cMyBP-C abolished interaction between the N terminal of cMyBP-C and myosin heavy chain sub-fragment 2 (S2). Furthermore, this mutation increased the affinity between the N terminal of cMyBP-C and actin. Assessment of phosphorylation of three serine residues in cMyBP-C showed that aberrant phosphorylation of cMyBP-C is unlikely to be responsible for altering these interactions. We show that the E258K mutation in cMyBP-C abolishes interaction between N-terminal cMyBP-C and myosin S2 by directly disrupting the cMyBP-C-S2 interface, independent of cMyBP-C phosphorylation. Similar to cMyBP-C ablation or phosphorylation, abolition of this inhibitory interaction accelerates contractile kinetics. Additionally, the E258K mutation impaired force production of mECT, which suggests that in addition to the loss of physiological function, this mutation disrupts contractility possibly by tethering the thick and thin filament or acting as an internal load.

  1. Using Design To Achieve Sustainability

    EPA Science Inventory

    Sustainability is defined as meeting the needs of this generation without compromising the ability of future generations to meet their needs. This is a conditional statement that places the responsibility for achieving sustainability squarely in hands of designers and planners....

  2. Childhood Obesity and Cognitive Achievement.

    PubMed

    Black, Nicole; Johnston, David W; Peeters, Anna

    2015-09-01

    Obese children tend to perform worse academically than normal-weight children. If poor cognitive achievement is truly a consequence of childhood obesity, this relationship has significant policy implications. Therefore, an important question is to what extent can this correlation be explained by other factors that jointly determine obesity and cognitive achievement in childhood? To answer this question, we exploit a rich longitudinal dataset of Australian children, which is linked to national assessments in math and literacy. Using a range of estimators, we find that obesity and body mass index are negatively related to cognitive achievement for boys but not girls. This effect cannot be explained by sociodemographic factors, past cognitive achievement or unobserved time-invariant characteristics and is robust to different measures of adiposity. Given the enormous importance of early human capital development for future well-being and prosperity, this negative effect for boys is concerning and warrants further investigation. PMID:26123250

  3. Mastery Achievement of Intellectual Skills.

    ERIC Educational Resources Information Center

    Trembath, Richard J.; White, Richard T.

    1979-01-01

    Mastery learning techniques were improved through mathematics instruction based on a validated learning hierarchy, presenting tasks in a sequence consistent with the requirements of the hierarchy, and requiring learners to demonstrate achievement before being allowed to proceed. (Author/GDC)

  4. Achieving Standards through Environmental Education.

    ERIC Educational Resources Information Center

    Kaspar, Mike

    1999-01-01

    Most states do not have the time or resources to develop environmental education standards from scratch. Highlights the role that environmental education and its interdisciplinary nature can play in helping students achieve. (DDR)

  5. Childhood Obesity and Cognitive Achievement.

    PubMed

    Black, Nicole; Johnston, David W; Peeters, Anna

    2015-09-01

    Obese children tend to perform worse academically than normal-weight children. If poor cognitive achievement is truly a consequence of childhood obesity, this relationship has significant policy implications. Therefore, an important question is to what extent can this correlation be explained by other factors that jointly determine obesity and cognitive achievement in childhood? To answer this question, we exploit a rich longitudinal dataset of Australian children, which is linked to national assessments in math and literacy. Using a range of estimators, we find that obesity and body mass index are negatively related to cognitive achievement for boys but not girls. This effect cannot be explained by sociodemographic factors, past cognitive achievement or unobserved time-invariant characteristics and is robust to different measures of adiposity. Given the enormous importance of early human capital development for future well-being and prosperity, this negative effect for boys is concerning and warrants further investigation.

  6. Effects of bpV(pic) and bpV(phen) on H9c2 cardiomyoblasts during both hypoxia/reoxygenation and H2O2-induced injuries.

    PubMed

    Tian, Youqing; Daoud, Abdelkader; Shang, Jing

    2012-03-01

    Reactive oxygen species (ROS) are involved in myocardial injury. ROS are known to inactivate lipid phosphatase and tension homolog on chromosome 10 (PTEN), an enzyme that increases apoptosis in neonatal cardiomyocytes. BpV(pic) and bpV(phen), two bisperoxovanadium molecules and PTEN inhibitors, may be involved in limiting myocardial infarction. To compare the protective effects of bpV(pic) and bpV(phen) on ROS-induced cardiomyocyte injury and their possible mechanisms, we selected two popular models of hypoxia/reoxygenation (H/R) and H2O2-induced injury in H9c2 cardiomyoblasts to investigate their effects against injury. We found that pre-treatment with bpV(pic) and bpV(phen) increased the viability and protected the morphology of H9c2 cells under the conditions of H/R and H2O2 by inhibiting LDH release, apoptosis and caspases 3/8/9 activities. However, their respective inhibitory abilities in the two models were different, suggesting that the quantity of ROS from the two models might be different. However, the conflict between ROS and PTEN may affect the action of bpV(pic) and bpV(phen). Taken together, the results demonstrate that bpV(pic) and bpV(phen) have inhibitory effects on oxidative stress-induced cardiomyocyte injury that may be partially modulated by the action of ROS on PTEN.

  7. High temporal Resolution Fire History in Eastern Africa: the Last 16 kyr cal. BP

    NASA Astrophysics Data System (ADS)

    Vanniere, B.; Carcaillet, C.; Garcin, Y.; Vullien, A.; Williamson, D.

    2004-12-01

    Charcoal series, based on a high temporal resolution analysis, at Lake Massoko (9°20' S, 33° 45' E, 770 a.s.l., SW Tanzania) reveals numerous changes of fire regime over the last 16 kyr cal BP. Data are based on the tallying of charcoal from 700 continuous 1 cm thick samples along a 7m long sequence. The structure of charcoal particles is well preserved with an length:width ratio superior to 5; this appears to testify to the local provenance of the material studied and to the rapid transport of particles to the lake. The majority of particles belongs to herbaceous cuticles produced by savanna or bush fires. Time control is supported by 14 radiocarbon dates. Mean time resolution per sample of 17 yr provides the first long detailed biomass burning record in Africa. This record evidences frequent fires events during the last 16 kyr, indicating that fire is a key component of east African ecosystems since, at least, the last glacial stage up to present. From 16 to 12 kyr cal BP, the charcoal influx into the lake is low except during two specific sequences, between 13.5-12.5 kyr cal BP and 14.5-14 kyr cal BP. These may correspond to more arid or more biomass-available phases. Around 10 kyr cal BP, at the early Holocene a greater influx of charcoal is recorded in the lake, probably as a result of a high fire regime likely triggered by severe droughts. Between 8.3 and 1.7 kyr cal BP, the charcoal influx displays a cyclic fire history of ca. 500 yr. Low fire regime, between 3.5-2.5, 5.5-5 and 7.5-7 kyr cal BP, correspond to wetter periods. About 12 sequences of fire increase and decrease are highlighted, which appears to support a high climatic variability during the middle-Holocene. After 1.7 kyr BP, there is a long lasting increase of charcoal influx into the lake, as observed by black carbon analysis (Thevenon et al., 2003). This particular period, without analog since 16 kyr cal BP, is consistent with the development of Iron Age settlements in the region, slash

  8. Quantitative Profiling of Chromatome Dynamics Reveals a Novel Role for HP1BP3 in Hypoxia-induced Oncogenesis*

    PubMed Central

    Dutta, Bamaprasad; Yan, Ren; Lim, Sai Kiang; Tam, James P.; Sze, Siu Kwan

    2014-01-01

    In contrast to the intensely studied genetic and epigenetic changes that induce host cell transformation to initiate tumor development, those that promote the malignant progression of cancer remain poorly defined. As emerging evidence suggests that the hypoxic tumor microenvironment could re-model the chromatin-associated proteome (chromatome) to induce epigenetic changes and alter gene expression in cancer cells, we hypothesized that hypoxia-driven evolution of the chromatome promotes malignant changes and the development of therapy resistance in tumor cells. To test this hypothesis, we isolated chromatins from tumor cells treated with varying conditions of normoxia, hypoxia, and re-oxygenation and then partially digested them with DNase I and analyzed them for changes in euchromatin- and heterochromatin-associated proteins using an iTRAQ-based quantitative proteomic approach. We identified a total of 1446 proteins with a high level of confidence, including 819 proteins that were observed to change their chromatin association topology under hypoxic conditions. These hypoxia-sensitive proteins included key mediators of chromatin organization, transcriptional regulation, and DNA repair. Furthermore, our proteomic and functional experiments revealed a novel role for the chromatin organizer protein HP1BP3 in mediating chromatin condensation during hypoxia, leading to increased tumor cell viability, radio-resistance, chemo-resistance, and self-renewal. Taken together, our findings indicate that HP1BP3 is a key mediator of tumor progression and cancer cell acquisition of therapy-resistant traits, and thus might represent a novel therapeutic target in a range of human malignancies. PMID:25100860

  9. A multi-proxy warm season temperature reconstruction (3400 cal yr BP - 1500 cal yr BP) from the varved sediments of Lake Silvaplana

    NASA Astrophysics Data System (ADS)

    Stewart, Monique; Larocque, Isabelle; Grosjean, Martin

    2010-05-01

    A multi-proxy analysis of a nine-meter sediment core from Lake Silvaplana (1791 m a.s.l., 46°24'N, 9°42'E - 46°30'N, 9°52'E), including an innovative application of Spectrolino (380 - 730 nm) data, provides a decadal warm season temperature reconstruction (3400 cal yr BP - 1500 cal yr BP). The climate of this region has been shown to be representative of continental Europe (Trachsel et al., 2009). Consequently, we offer one of the first high-resolution multi-proxy records of European climate for this time period. The sediment of Silvaplana contains annual (‘varved') layers. Therefore, a chronology has been based on varve counts, 210Pb, 137Cs, documented flood layers and radiocarbon dates (Blass et al., 2007a;b). These varves enable high-resolution (sub-decadal) sampling and measurement of geochemical (Spectrolino, Biogenic Silica [BSi], varve thickness) and biological (chironomids) parameters. Spectrolino and BSi Flux measurements of the upper three meters of the core have been used to develop two independent calibrations-in-time and warm season (JJAS) temperature reconstructions back to AD 1177 (Spectrolino calibration period = 1864 - 1949; r = 0.92; pcorr = 0.001; BSi calibration period = 1864 - 1949; r = 0.67; pcorr = 0.03) (Trachsel et al., in review a;b; Blass et al., 2007b). A third warm season (July) temperature reconstruction to AD 1177 has been developed from chironomids (Larocque et al., 2009; Larocque-Tobler et al., 2009; accepted). Finally, Leemann and Niessen (1994), Ohlendorf et al. (1997), Nussbaumer et al. (in prep.) and Blass et al. (2007a) have shown a close relationship between local glacial activity and mean summer temperature. Here, the laboratory methods and calibrations-in-time previously used to reconstruct temperatures to AD 1177 are applied to the lower six meters of sediments (Spectrolino and varve thickness: 3400 cal yr BP - 1500 cal yr BP; BSi and chironomids: 2550 cal yr BP - 1810 cal yr BP). Both the BSi and chironomid based

  10. Components of the CtBP1/BARS-dependent fission machinery.

    PubMed

    Valente, Carmen; Luini, Alberto; Corda, Daniela

    2013-10-01

    The brefeldin A ADP-ribosylated substrate, a member of the C-terminal-binding protein family that is referred to as CtBP1/BARS, is a dual-function protein that acts as a transcriptional co-repressor in the nucleus and as an inducer of membrane fission in the cytoplasm. In this review, we first discuss the mechanisms that enable CtBP1/BARS to shift between the nuclear transcriptional co-repressor and the cytosolic fission-inducing activities. Then, we focus on the role of CtBP1/BARS in membrane fission. CtBP1/BARS controls several fission events including macropinocytosis, fluid-phase endocytosis, COPI-coated vesicle formation, basolaterally directed post-Golgi carrier formation, and Golgi partitioning in mitosis. We report on recent advances in our understanding of the CtBP1/BARS membrane fission machineries that operate at the trans-side and at the cis-side of the Golgi complex. Specifically, we discuss how these machineries are assembled and regulated, and how they operate in the formation of the basolaterally directed post-Golgi carriers.

  11. Mutations in TAX1BP3 cause dilated cardiomyopathy with septo-optic dysplasia.

    PubMed

    Reinstein, Eyal; Orvin, Katia; Tayeb-Fligelman, Einav; Stiebel-Kalish, Hadas; Tzur, Shay; Pimienta, Allen L; Bazak, Lily; Bengal, Tuvia; Cohen, Lior; Gaton, Dan D; Bormans, Concetta; Landau, Meytal; Kornowski, Ran; Shohat, Mordechai; Behar, Doron M

    2015-04-01

    We describe a Bedouin family with a novel autosomal recessive syndrome characterized by dilated cardiomyopathy and septo-optic dysplasia. Genetic analysis revealed a homozygous missense mutation in TAX1BP3, which encodes a small PDZ domain containing protein implicated in regulation of the Wnt/β-catenin signaling pathway, as the causative mutation. The mutation affects a conserved residue located at the core of TAX1BP3 binding pocket and is predicted to impair the nature of a crucial hydrophobic patch, thereby interrupting the structure and stability of the protein, and its ability to interact with other proteins. TAX1BP3 is highly expressed in heart and brain and consistent with the clinical findings observed in our patients; a knockdown of TAX1BP3 causes elongation defects, enlarged pericard, and enlarged head structures in zebrafish embryos. Thus, we describe a new genetic disorder that expands the monogenic cardiomyopathy disease spectrum and suggests that TAX1BP3 is essential for heart and brain development.

  12. Stable semiconductor black phosphorus (BP)@titanium dioxide (TiO2) hybrid photocatalysts

    PubMed Central

    Uk Lee, Hyun; Lee, Soon Chang; Won, Jonghan; Son, Byung-Chul; Choi, Saehae; Kim, Yooseok; Park, So Young; Kim, Hee-Sik; Lee, Young-Chul; Lee, Jouhahn

    2015-01-01

    Over the past few decades, two-dimensional (2D) and layered materials have emerged as new fields. Due to the zero-band-gap nature of graphene and the low photocatalytic performance of MoS2, more advanced semiconducting 2D materials have been prompted. As a result, semiconductor black phosphorus (BP) is a derived cutting-edge post-graphene contender for nanoelectrical application, because of its direct-band-gap nature. For the first time, we report on robust BP@TiO2 hybrid photocatalysts offering enhanced photocatalytic performance under light irradiation in environmental and biomedical fields, with negligible affected on temperature and pH conditions, as compared with MoS2@TiO2 prepared by the identical synthesis method. Remarkably, in contrast to pure few layered BP, which, due to its intrinsic sensitivity to oxygen and humidity was readily dissolved after just several uses, the BP@TiO2 hybrid photocatalysts showed a ~92% photocatalytic activity after 15 runs. Thus, metal-oxide-stabilized BP photocatalysts can be practically applied as a promising alternative to graphene and MoS2. PMID:25732720

  13. Stable semiconductor black phosphorus (BP)@titanium dioxide (TiO2) hybrid photocatalysts

    NASA Astrophysics Data System (ADS)

    Uk Lee, Hyun; Lee, Soon Chang; Won, Jonghan; Son, Byung-Chul; Choi, Saehae; Kim, Yooseok; Park, So Young; Kim, Hee-Sik; Lee, Young-Chul; Lee, Jouhahn

    2015-03-01

    Over the past few decades, two-dimensional (2D) and layered materials have emerged as new fields. Due to the zero-band-gap nature of graphene and the low photocatalytic performance of MoS2, more advanced semiconducting 2D materials have been prompted. As a result, semiconductor black phosphorus (BP) is a derived cutting-edge post-graphene contender for nanoelectrical application, because of its direct-band-gap nature. For the first time, we report on robust BP@TiO2 hybrid photocatalysts offering enhanced photocatalytic performance under light irradiation in environmental and biomedical fields, with negligible affected on temperature and pH conditions, as compared with MoS2@TiO2 prepared by the identical synthesis method. Remarkably, in contrast to pure few layered BP, which, due to its intrinsic sensitivity to oxygen and humidity was readily dissolved after just several uses, the BP@TiO2 hybrid photocatalysts showed a ~92% photocatalytic activity after 15 runs. Thus, metal-oxide-stabilized BP photocatalysts can be practically applied as a promising alternative to graphene and MoS2.

  14. Polymorphism of the borophosphate anion in K(Fe,Al)[BP2O8(OH)] and Rb(Al, Fe)[BP2O8(OH)] crystal structures

    NASA Astrophysics Data System (ADS)

    Yakubovich, O. V.; Steele, I. M.; Dimitrova, O. V.

    2010-09-01

    The crystal structure of two borophosphates, Rb(Al,Fe)[BP2O8(OH)] ( a = 9.381(6), b = 8.398(5), c = 9.579(6) Å, β = 102.605(10)°, sp. gr. P21/ c) and K(Fe,Al)[BP2O8(OH)] ( a = 5.139(2), b = 8.065(4), c = 8.290(4)Å, α = 86.841(8)°, β = 80.346(8)°, γ = 86.622(8)°, sp. gr. P bar 1 ), obtained by hydrothermal synthesis in the AlCl3: FeCl3: K3PO4(Rb3PO4): B2O3: H2O system has been established using X-ray diffraction (Bruker Smart diffractometer, T = 100 K). Hydrogen atoms are located and their coordinates and thermal parameters are refined. It is shown that the polymorphism of the [BP2O8(OH)]4- borophosphate anion has a morphotropic nature and is related to the substitutions both in the cationic part of the structure and in the octahedral position of the anionic mixed framework. The synthesis of new isotypic triclinic compounds under hydrothermal conditions is predicted.

  15. Early treatment of hypertension in acute ischemic and intracerebral hemorrhagic stroke: progress achieved, challenges, and perspectives.

    PubMed

    Feldstein, Carlos A

    2014-03-01

    Hypertension is the leading risk factor for ischemic and intracerebral hemorrhagic subtypes of stroke. Additionally, high blood pressure (BP) in the acute cerebrovascular event is associated with poor outcome, and a high percentage of stroke survivors have inadequate control of hypertension. The present is a systematic review of prospective, randomized, and controlled trials carried out on safety and efficacy of antihypertensive treatment of both subtypes of acute stroke. Six trials involving 7512 patients were included, which revealed controversies on the speed and the goals of treatment. These controversies could be due at least in part, from the fact that some studies analyzed the results of antihypertensive treatment in ischemic and intracerebral hemorrhagic subtypes of acute stroke together, and from a different prevalence of past-stroke in the randomized groups. Further research is necessary to establish whether standard antihypertensive treatment provides greater benefit than simple observation in patients with ischemic acute stroke and Stage 2 hypertension of JNC 7, albeit they were not candidates for acute reperfusion. In that case, the target reduction in BP could be 10% to 15% within 24 hours. The recently published INTERACT 2 has provided evidence that patients with hemorrhagic stroke may receive intensive antihypertensive treatment safely with the goal of reducing systolic BP to levels no lower than 130 mm Hg. It is important to take into account that marked BP lowering in acute stroke increases the risk of poor outcome by worsening cerebral ischemia from deterioration of cerebral blood flow autoregulation. PMID:24220549

  16. An Ethylene-responsive Factor BpERF11 Negatively Modulates Salt and Osmotic Tolerance in Betula platyphylla.

    PubMed

    Zhang, Wenhui; Yang, Guiyan; Mu, Dan; Li, Hongyan; Zang, Dandan; Xu, Hongyun; Zou, Xuezhong; Wang, Yucheng

    2016-01-01

    Ethylene responsive factors (ERFs) play important roles in the abiotic stress; however, only a few ERF genes from woody plants have been functionally characterized. In the present study, an ERF gene from Betula platyphylla (birch), BpERF11, was functionally characterized in response to abiotic stress. BpERF11 is a nuclear protein, which could specifically bind to GCC boxes and DRE motifs. BpERF11-overexpressing and BpERF11 RNA interference (RNAi) knockdown plants were generated for gain- and loss-of-function analysis. BpERF11 negatively regulates resistance to salt and severe osmotic stress, and the transgenic birch plants overexpressing BpERF11 shows increased electrolyte leakage and malondialdehyde (MDA) contents. BpERF11 inhibits the expression of an AtMYB61 homologous gene, resulting in increased stomatal aperture, which elevated the transpiration rate. Furthermore, BpERF11 downregulates the expression of P5CS, SOD and POD genes, but upregulates the expression of PRODH and P5CDH, which results in reduced proline levels and increased reactive oxygen species (ROS) accumulation. BpERF11 also significantly inhibits the expression of LEA and dehydrin genes that involve in abiotic stress tolerance. Therefore, BpERF11 serves as a transcription factor that negatively regulates salt and severe osmotic tolerance by modulating various physiological processes. PMID:26980058

  17. 4E-BP1 participates in maintaining spindle integrity and genomic stability via interacting with PLK1

    PubMed Central

    Shang, Zeng-Fu; Yu, Lan; Li, Bing; Tu, Wen-Zhi; Wang, Yu; Liu, Xiao-Dan; Guan, Hua; Huang, Bo; Rang, Wei-Qing; Zhou, Ping-Kun

    2012-01-01

    The essential function of eIF4E-binding protein 1 (4E-BP1) in translation initiation has been well established; however, the role of 4E-BP1 in normal cell cycle progression is coming to attention. Here, we revealed the role of 4E-BP1 on mitotic regulation and chromosomal DNA dynamics during mitosis. First, we have observed the co-localization of the phosphorylated 4E-BP1 at T37/46 with Polo-like kinase 1 (PLK1) at the centrosomes during. Depression of 4E-BP1 by small interfering RNA in HepG2 or HeLa cells resulted in an increased outcome of polyploidy and aberrant mitosis, including chromosomal DNA misaligned and multi-polar spindles or multiple centrosomes. We observed that 4E-BP1 interacted with PLK1 directly in vitro and in vivo in mitotic cells, and the C-terminal aa 77–118 of 4E-BP1 mediates its interaction with PLK1. PLK1 can phosphorylate 4E-BP1 in vitro. Furthermore, the depletion of 4E-BP1 sensitized HepG2 and HeLa cells to the microtubule disruption agent paclitaxel. These results demonstrate that 4E-BP1, beyond its role in translation regulation, can function as a regulator of mitosis via interacting with PLK1, and possibly plays a role in genomic stability maintaining. PMID:22918237

  18. Regulation of PMP22 mRNA by G3BP1 affects cell proliferation in breast cancer cells

    PubMed Central

    2013-01-01

    Background Regulation of mRNAs is one way to control protein levels and thereby important cellular processes such as growth, invasion and apoptosis. G3BPs constitute a family of mRNA-binding proteins, shown to be overexpressed in several cancer types, including breast, colon and pancreas cancer. G3BP has been reported to both stabilize and induce degradation of specific mRNAs. Results Here, we show that G3BP1, but not G3BP2, supports proliferation of several breast cancer cell lines. Global gene expression analyses of G3BP1- and G3BP2-depleted cells indicate that primarily G3BP1, and much less G3BP2, influences mRNA expression levels. Peripheral myelin protein 22 (PMP22) was one gene that was significantly influenced by G3BP1 depletion which led to a 2–3 fold increased expression. Depletion of PMP22 resulted in increased proliferation and the G3BP1-mediated effect on proliferation was not seen upon PMP22-depletion. Conclusions This indicates a novel role for G3BP1 in the regulation of cell proliferation in breast cancer cells, perhaps via a regulatory effect on PMP22 expression. PMID:24321297

  19. An Ethylene-responsive Factor BpERF11 Negatively Modulates Salt and Osmotic Tolerance in Betula platyphylla

    PubMed Central

    Zhang, Wenhui; Yang, Guiyan; Mu, Dan; Li, Hongyan; Zang, Dandan; Xu, Hongyun; Zou, Xuezhong; Wang, Yucheng

    2016-01-01

    Ethylene responsive factors (ERFs) play important roles in the abiotic stress; however, only a few ERF genes from woody plants have been functionally characterized. In the present study, an ERF gene from Betula platyphylla (birch), BpERF11, was functionally characterized in response to abiotic stress. BpERF11 is a nuclear protein, which could specifically bind to GCC boxes and DRE motifs. BpERF11-overexpressing and BpERF11 RNA interference (RNAi) knockdown plants were generated for gain- and loss-of-function analysis. BpERF11 negatively regulates resistance to salt and severe osmotic stress, and the transgenic birch plants overexpressing BpERF11 shows increased electrolyte leakage and malondialdehyde (MDA) contents. BpERF11 inhibits the expression of an AtMYB61 homologous gene, resulting in increased stomatal aperture, which elevated the transpiration rate. Furthermore, BpERF11 downregulates the expression of P5CS, SOD and POD genes, but upregulates the expression of PRODH and P5CDH, which results in reduced proline levels and increased reactive oxygen species (ROS) accumulation. BpERF11 also significantly inhibits the expression of LEA and dehydrin genes that involve in abiotic stress tolerance. Therefore, BpERF11 serves as a transcription factor that negatively regulates salt and severe osmotic tolerance by modulating various physiological processes. PMID:26980058

  20. Bone marrow transplantation improves autoinflammation and inflammatory bone loss in SH3BP2 knock-in cherubism mice.

    PubMed

    Yoshitaka, Teruhito; Kittaka, Mizuho; Ishida, Shu; Mizuno, Noriyoshi; Mukai, Tomoyuki; Ueki, Yasuyoshi

    2015-02-01

    Cherubism (OMIM#118400) is a genetic disorder in children characterized by excessive jawbone destruction with proliferation of fibro-osseous lesions containing a large number of osteoclasts. Mutations in the SH3-domain binding protein 2 (SH3BP2) are responsible for cherubism. Analysis of the knock-in (KI) mouse model of cherubism showed that homozygous cherubism mice (Sh3bp2(KI/KI)) spontaneously develop systemic autoinflammation and inflammatory bone loss and that cherubism is a TNF-α-dependent hematopoietic disorder. In this study, we investigated whether bone marrow transplantation (BMT) is effective for the treatment of inflammation and bone loss in Sh3bp2(KI/KI) mice. Bone marrow (BM) cells from wild-type (Sh3bp2(+/+)) mice were transplanted to 6-week-old Sh3bp2(KI/KI) mice with developing inflammation and to 10-week-old Sh3bp2(KI/KI) mice with established inflammation. Six-week-old Sh3bp2(KI/KI) mice transplanted with Sh3bp2(+/+) BM cells exhibited improved body weight loss, facial swelling, and survival rate. Inflammatory lesions in the liver and lung as well as bone loss in calvaria and mandibula were ameliorated at 10weeks after BMT compared to Sh3bp2(KI/KI) mice transplanted with Sh3bp2(KI/KI) BM cells. Elevation of serum TNF-α levels was not detected after BMT. BMT was effective for up to 20weeks in 6-week-old Sh3bp2(KI/KI) mice transplanted with Sh3bp2(+/+) BM cells. BMT also ameliorated the inflammation and bone loss in 10-week-old Sh3bp2(KI/KI) mice. Thus our study demonstrates that BMT improves the inflammation and bone loss in cherubism mice. BMT may be effective for the treatment of cherubism patients.

  1. Bone Marrow Transplantation Improves Autoinflammation and Inflammatory Bone Loss in SH3BP2 Knock-In Cherubism Mice

    PubMed Central

    Yoshitaka, Teruhito; Kittaka, Mizuho; Ishida, Shu; Mizuno, Noriyoshi; Mukai, Tomoyuki; Ueki, Yasuyoshi

    2014-01-01

    Cherubism (OMIM#118400) is a genetic disorder in children characterized by excessive jawbone destruction with proliferation of fibro-osseous lesions containing a large number of osteoclasts. Mutations in the SH3-domain binding protein 2 (SH3BP2) are responsible for cherubism. Analysis of the knock-in (KI) mouse model of cherubism showed that homozygous cherubism mice (Sh3bp2KI/KI) spontaneously develop systemic autoinflammation and inflammatory bone loss and that cherubism is a TNF-α-dependent hematopoietic disorder. In this study, we investigated whether bone marrow transplantation (BMT) is effective for the treatment of inflammation and bone loss in Sh3bp2KI/KI mice. Bone marrow (BM) cells from wild-type (Sh3bp2+/+) mice were transplanted to 6-week-old Sh3bp2KI/KI mice with developing inflammation and to 10-week-old Sh3bp2KI/KI mice with established inflammation. Six-week-old Sh3bp2KI/KI mice transplanted with Sh3bp2+/+ BM cells exhibited improved body weight loss, facial swelling, and survival rate. Inflammatory lesions in the liver and lung as well as bone loss in calvaria and mandibula were ameliorated at 10 weeks after BMT compared to Sh3bp2KI/KI mice transplanted with Sh3bp2KI/KI BM cells. Elevation of serum TNF-α levels was not detected after BMT. BMT was effective for up to 20 weeks in 6-week-old Sh3bp2KI/KI mice transplanted with Sh3bp2+/+ BM cells. BMT also ameliorated the inflammation and bone loss in 10-week-old Sh3bp2KI/KI mice. Thus our study demonstrates that BMT improves the inflammation and bone loss in cherubism mice. BMT may be effective for the treatment of cherubism patients. PMID:25445458

  2. Dual targeting of peroxisomal proteins

    PubMed Central

    Ast, Julia; Stiebler, Alina C.; Freitag, Johannes; Bölker, Michael

    2013-01-01

    Cellular compartmentalization into organelles serves to separate biological processes within the environment of a single cell. While some metabolic reactions are specific to a single organelle, others occur in more than one cellular compartment. Specific targeting of proteins to compartments inside of eukaryotic cells is mediated by defined sequence motifs. To achieve multiple targeting to different compartments cells use a variety of strategies. Here, we focus on mechanisms leading to dual targeting of peroxisomal proteins. In many instances, isoforms of peroxisomal proteins with distinct intracellular localization are encoded by separate genes. But also single genes can give rise to differentially localized proteins. Different isoforms can be generated by use of alternative transcriptional start sites, by differential splicing or ribosomal read-through of stop codons. In all these cases different peptide variants are produced, of which only one carries a peroxisomal targeting signal. Alternatively, peroxisomal proteins contain additional signals that compete for intracellular targeting. Dual localization of proteins residing in both the cytoplasm and in peroxisomes may also result from use of inefficient targeting signals. The recent observation that some bona fide cytoplasmic enzymes were also found in peroxisomes indicates that dual targeting of proteins to both the cytoplasm and the peroxisome might be more widespread. Although current knowledge of proteins exhibiting only partial peroxisomal targeting is far from being complete, we speculate that the metabolic capacity of peroxisomes might be larger than previously assumed. PMID:24151469

  3. Dual targeting of peroxisomal proteins.

    PubMed

    Ast, Julia; Stiebler, Alina C; Freitag, Johannes; Bölker, Michael

    2013-10-18

    Cellular compartmentalization into organelles serves to separate biological processes within the environment of a single cell. While some metabolic reactions are specific to a single organelle, others occur in more than one cellular compartment. Specific targeting of proteins to compartments inside of eukaryotic cells is mediated by defined sequence motifs. To achieve multiple targeting to different compartments cells use a variety of strategies. Here, we focus on mechanisms leading to dual targeting of peroxisomal proteins. In many instances, isoforms of peroxisomal proteins with distinct intracellular localization are encoded by separate genes. But also single genes can give rise to differentially localized proteins. Different isoforms can be generated by use of alternative transcriptional start sites, by differential splicing or ribosomal read-through of stop codons. In all these cases different peptide variants are produced, of which only one carries a peroxisomal targeting signal. Alternatively, peroxisomal proteins contain additional signals that compete for intracellular targeting. Dual localization of proteins residing in both the cytoplasm and in peroxisomes may also result from use of inefficient targeting signals. The recent observation that some bona fide cytoplasmic enzymes were also found in peroxisomes indicates that dual targeting of proteins to both the cytoplasm and the peroxisome might be more widespread. Although current knowledge of proteins exhibiting only partial peroxisomal targeting is far from being complete, we speculate that the metabolic capacity of peroxisomes might be larger than previously assumed.

  4. Environmental change in the Limfjord, Denmark (ca 7500-1500 cal yrs BP): a multiproxy study

    NASA Astrophysics Data System (ADS)

    Lewis, Jonathan P.; Ryves, David B.; Rasmussen, Peter; Knudsen, Karen L.; Petersen, Kaj S.; Olsen, Jesper; Leng, Melanie J.; Kristensen, Peter; McGowan, Suzanne; Philippsen, Bente

    2013-10-01

    The Limfjord region of northern Jutland, Denmark, supports a rich archaeological record dating back to the Mesolithic, which documents long-term change in human practices and utilisation of marine resources since approximately 7500 BP. The presence and availability of marine resources in the Limfjord is sensitively regulated by environmental parameters such as salinity, sedimentary regime, nutrient status and primary productivity, but long-term changes in these parameters are currently poorly understood. In this study a multiproxy approach (including sedimentary parameters, diatoms, molluscs, foraminifera, sedimentary pigments, C and O stable isotopes and plant macrofossils) has been adopted to assess environmental change over the period ca 7500-1500 cal yrs BP at Kilen, a coastal fjord (before AD 1856) situated in the Western Limfjord. A diatom-based salinity transfer function based on a pan-Baltic training set has been applied to the fossil diatom dataset for quantitative assessment of salinity change over the study period. This study demonstrates that large-scale shifts in salinity are a common feature of the Limfjord's long-term history and are driven by the level of connection with the North Sea and the Skagerrak respectively, which in turn is likely driven by the complex interplay between climate, sea-level change, current velocity and rates of erosion/sedimentary accretion. Three shifts in state at Kilen are identified over the study period: a deep, periodically stratified fjord with medium-high salinity (and high productivity) between ca 7500-5000 BP, followed by a gradual transition to a shallow benthic system with more oceanic conditions (i.e. higher salinity, lower productivity, slower sedimentary accumulation rate and poorer fossil preservation) after ca 5000 BP and no stratification after ca 4400 BP, and lastly, within this shallow phase, an abrupt shift to brackish conditions around 2000 BP. Environmental-societal interactions are discussed on the

  5. The pseudophosphatase MK-STYX interacts with G3BP and decreases stress granule formation

    PubMed Central

    Hinton, Shantá D.; Myers, Michael P.; Roggero, Vincent R.; Allison, Lizabeth A.; Tonks, Nicholas K.

    2010-01-01

    MK-STYX [MAPK (mitogen-activated protein kinase) phospho-serine/threonine/tyrosine-binding protein] is a pseudophosphatase member of the dual-specificity phosphatase subfamily of the PTPs (protein tyrosine phosphatases). MK-STYX is catalytically inactive due to the absence of two amino acids from the signature motif that are essential for phosphatase activity. The nucleophilic cysteine residue and the adjacent histidine residue, which are conserved in all active dual-specificity phosphatases, are replaced by serine and phenylalanine residues respectively in MK-STYX. Mutations to introduce histidine and cysteine residues into the active site of MK-STYX generated an active phosphatase. Using MS, we identified G3BP1 [Ras-GAP (GTPase-activating protein) SH3 (Src homology 3) domain-binding protein-1], a regulator of Ras signalling, as a binding partner of MK-STYX. We observed that G3BP1 bound to native MK-STYX; however, binding to the mutant catalytically active form of MK-STYX was dramatically reduced. G3BP1 is also an RNA-binding protein with endoribonuclease activity that is recruited to ‘stress granules’ after stress stimuli. Stress granules are large subcellular structures that serve as sites of mRNA sorting, in which untranslated mRNAs accumulate. We have shown that expression of MK-STYX inhibited stress granule formation induced either by aresenite or expression of G3BP itself; however, the catalytically active mutant MK-STYX was impaired in its ability to inhibit G3BP-induced stress granule assembly. These results reveal a novel facet of the function of a member of the PTP family, illustrating a role for MK-STYX in regulating the ability of G3BP1 to integrate changes in growth-factor stimulation and environmental stress with the regulation of protein synthesis. PMID:20180778

  6. Regulation of complement activation by C-reactive protein: targeting of the inhibitory activity of C4b-binding protein.

    PubMed

    Sjöberg, Andreas P; Trouw, Leendert A; McGrath, Fabian D G; Hack, C Erik; Blom, Anna M

    2006-06-15

    C-reactive protein (CRP) is the major acute phase protein in humans. It has been shown that CRP interacts with factor H, an inhibitor of the alternative pathway of complement, and now we demonstrate binding of CRP to the fluid-phase inhibitor of the classical pathway, C4b-binding protein (C4BP). C4BP bound to directly immobilized recombinant CRP as well as CRP attached to phosphorylcholine. The binding was sensitive to ionic strength and was enhanced in the presence of calcium. C4BP lacking beta-chain and protein S, which is a form of C4BP increasing upon inflammation, bound CRP with higher affinity than the C4BP-protein S complex. The binding could not be blocked with mAbs directed against peripheral parts of the alpha-chains of C4BP while the isolated central core of C4BP obtained by partial proteolytic digestion bound CRP, indicating that the binding site for CRP is localized in the central core of the C4BP molecule. Furthermore, we found complexes in serum from a patient with an elevated CRP level and trace amounts of CRP were also identified in a plasma-derived C4BP preparation. We were also able to detect C4BP-CRP complexes in solution and established that C4BP retains full complement regulatory activity in the presence of CRP. In addition, we found that C4BP can compete with C1q for binding to immobilized CRP and that it inhibits complement activation locally. We hypothesize that CRP limits excessive complement activation on targets via its interactions with both factor H and C4BP.

  7. The structural basis of modified nucleosome recognition by 53BP1.

    PubMed

    Wilson, Marcus D; Benlekbir, Samir; Fradet-Turcotte, Amélie; Sherker, Alana; Julien, Jean-Philippe; McEwan, Andrea; Noordermeer, Sylvie M; Sicheri, Frank; Rubinstein, John L; Durocher, Daniel

    2016-08-01

    DNA double-strand breaks (DSBs) elicit a histone modification cascade that controls DNA repair. This pathway involves the sequential ubiquitination of histones H1 and H2A by the E3 ubiquitin ligases RNF8 and RNF168, respectively. RNF168 ubiquitinates H2A on lysine 13 and lysine 15 (refs 7, 8) (yielding H2AK13ub and H2AK15ub, respectively), an event that triggers the recruitment of 53BP1 (also known as TP53BP1) to chromatin flanking DSBs. 53BP1 binds specifically to H2AK15ub-containing nucleosomes through a peptide segment termed the ubiquitination-dependent recruitment motif (UDR), which requires the simultaneous engagement of histone H4 lysine 20 dimethylation (H4K20me2) by its tandem Tudor domain. How 53BP1 interacts with these two histone marks in the nucleosomal context, how it recognizes ubiquitin, and how it discriminates between H2AK13ub and H2AK15ub is unknown. Here we present the electron cryomicroscopy (cryo-EM) structure of a dimerized human 53BP1 fragment bound to a H4K20me2-containing and H2AK15ub-containing nucleosome core particle (NCP-ubme) at 4.5 Å resolution. The structure reveals that H4K20me2 and H2AK15ub recognition involves intimate contacts with multiple nucleosomal elements including the acidic patch. Ubiquitin recognition by 53BP1 is unusual and involves the sandwiching of the UDR segment between ubiquitin and the NCP surface. The selectivity for H2AK15ub is imparted by two arginine fingers in the H2A amino-terminal tail, which straddle the nucleosomal DNA and serve to position ubiquitin over the NCP-bound UDR segment. The structure of the complex between NCP-ubme and 53BP1 reveals the basis of 53BP1 recruitment to DSB sites and illuminates how combinations of histone marks and nucleosomal elements cooperate to produce highly specific chromatin responses, such as those elicited following chromosome breaks.

  8. NotCal04 - Comparison / Calibration 14C records 26-50 cal kBP

    SciTech Connect

    der Plicht, J v; Beck, J; Bard, E; Baille, M

    2004-11-11

    The radiocarbon calibration curve, IntCal04, extends back to 26 cal kBP. While several high resolution records exist beyond this limit, these data sets exhibit discrepancies one to another of up to several millennia. As a result, no calibration curve for the time range 26-50 cal kBP can be recommended as yet, but in this paper the IntCal04 working group compares the available data sets and offers a discussion of the information that they hold.

  9. Placement of the GaBP ring system in the banded gastric bypass operation.

    PubMed

    Fobi, Mathias A L

    2005-09-01

    Currently, bariatric surgeons fashion the band or ring reinforcement prosthesis, to control the stoma in the vertical banded gastroplasty and gastric bypass operations for morbid obesity. To meet this need, the GaBP Ring system has been developed in various sizes, and consists of 4 main parts to provide a means for inserting a ring around the gastric pouch in the banded gastric bypass or the vertical banded gastroplasty. The pre-manufactured and sterilized device provides for better standardization and quality control than individually surgeon-fashioned devices. The GaBP Ring system is described, and the technique of placement and the pertinent initial clinical results are presented. PMID:16197796

  10. Crystal growth of Ba 3BP 3O 12 with BPO 4-NaF flux

    NASA Astrophysics Data System (ADS)

    Zhang, Zhi-Jun; Wang, Hong; Hu, Guan-Qin; Chen, Hao-Hong; Yang, Xin-Xin; Zhao, Jing-Tai

    2010-04-01

    Single crystals of Ba 3BP 3O 12 with size of 10×8×2 mm 3 have been grown by the top-seeded solution growth (TSSG) method using BPO 4-NaF mixture as the flux. The crystals were characterized by X-ray powder diffraction, field emission scanning electron microscopy (FE-SEM) and transmittance spectrum. Ba 3BP 3O 12 single crystal exhibits wide transparency in the range 250-800 nm. The preparation process of starting materials and the effect of flux on the crystal growth were discussed.

  11. L-serine deficiency caused by genetic Phgdh deletion leads to robust induction of 4E-BP1 and subsequent repression of translation initiation in the developing central nervous system.

    PubMed

    Sayano, Tomoko; Kawakami, Yuriko; Kusada, Wataru; Suzuki, Takeshi; Kawano, Yuki; Watanabe, Akihiro; Takashima, Kana; Arimoto, Yashiho; Esaki, Kayoko; Wada, Akira; Yoshizawa, Fumiaki; Watanabe, Masahiko; Okamoto, Masahiro; Hirabayashi, Yoshio; Furuya, Shigeki

    2013-03-01

    Targeted disruption in mice of the gene encoding D-3-phosphoglycerate dehydrogenase (Phgdh) results in embryonic lethality associated with a striking reduction in free L-serine and growth retardation including severe brain malformation. We previously observed a severe impairment in neurogenesis of the central nervous system of Phgdh knockout (KO) embryos and a reduction in the protein content of their brains. Although these findings suggest that L-serine deficiency links attenuation of mRNA translation to severe developmental malformation of the central nervous system, the underlying key molecular event remains unexplored. Here we demonstrate that mRNA of Eif4ebp1 encoding eukaryotic initiation factor 4 binding protein 1 and its protein, 4E-BP1, are markedly induced in the central nervous system of Phgdh KO embryos, whereas a modest induction is observed in the liver. The increase in 4E-BP1 was associated with a decrease in the cap initiation complex in the brain, as shown by lower levels of eukaryotic translation initiation factor 4G bound to eukaryotic translation initiation factor 4E (eIF4E) and increased eIF4E interaction with 4E-BP1 based on 7-methyl-GTP chromatography. eIF4E protein and polysomes were also diminished in Phgdh KO embryos. Induction of Eif4ebp1 mRNA and of 4E-BP1 was reproduced in mouse embryonic fibroblasts established from Phgdh KO embryos under the condition of L-serine deprivation. Induction of Eif4ebp1 mRNA was suppressed only when L-serine was supplemented in the culture medium, indicating that reduced L-serine availability regulates the induction of Eif4ebp1/4E-BP1. These data suggest that elevated levels of 4E-BP1 may be involved in a mechanism to arrest brain development in Phgdh KO embryos. PMID:23350942

  12. Inertial-confinement-fusion targets

    SciTech Connect

    Hendricks, C.D.

    1982-08-10

    Much of the research in laser fusion has been done using simple ball on-stalk targets filled with a deuterium-tritium mixture. The targets operated in the exploding pusher mode in which the laser energy was delivered in a very short time (approx. 100 ps or less) and was absorbed by the glass wall of the target. The high energy density in the glass literally exploded the shell with the inward moving glass compressing the DT fuel to high temperatures and moderate densities. Temperatures achieved were high enough to produce DT reactions and accompanying thermonuclear neutrons and alpha particles. The primary criteria imposed on the target builders were: (1) wall thickness, (2) sphere diameter, and (3) fuel in the sphere.

  13. SCF ubiquitin ligase targeted therapies

    PubMed Central

    Skaar, Jeffrey R.; Pagan, Julia K.; Pagano, Michele

    2015-01-01

    Summary The recent clinical successes of inhibitors of the proteasome for the treatment of cancer have highlighted the therapeutic potential of this protein degradation system. Proteasome inhibitors prevent the degradation of numerous proteins, so increased specificity could be achieved by inhibiting the components of the ubiquitin-proteasome system that target specific subsets of proteins for degradation. F-box proteins are the substrate-targeting subunits of SKP1-CUL1-F-box protein (SCF) ubiquitin ligase complexes. Through the degradation of a plethora of diverse substrates, SCF ubiquitin ligases control a large number of processes at the cellular and organismal levels, and their misregulation is implicated in many pathologies. SCF ligases are characterized by a high specificity for their substrates, so they represent promising drug targets. However, the potential for therapeutic manipulation of SCF complexes remains an underdeveloped area. This review will explore and discuss potential strategies to target SCF-mediated biology to treat human diseases. PMID:25394868

  14. Determinants of Small Ubiquitin-like Modifier 1 (SUMO1) Protein Specificity, E3 Ligase, and SUMO-RanGAP1 Binding Activities of Nucleoporin RanBP2

    SciTech Connect

    Gareau, Jaclyn R.; Reverter, David; Lima, Christopher D.

    2012-02-16

    The RanBP2 nucleoporin contains an internal repeat domain (IR1-M-IR2) that catalyzes E3 ligase activity and forms a stable complex with SUMO-modified RanGAP1 and UBC9 at the nuclear pore complex. RanBP2 exhibits specificity for SUMO1 as RanGAP1-SUMO1/UBC9 forms a more stable complex with RanBP2 compared with RanGAP1-SUMO2 that results in greater protection of RanGAP-SUMO1 from proteases. The IR1-M-IR2 SUMO E3 ligase activity also shows a similar preference for SUMO1. We utilized deletions and domain swap constructs in protease protection assays and automodification assays to define RanBP2 domains responsible for RanGAP1-SUMO1 protection and SUMO1-specific E3 ligase activity. Our data suggest that elements in both IR1 and IR2 exhibit specificity for SUMO1. IR1 protects RanGAP1-SUMO1/UBC9 and functions as the primary E3 ligase of RanBP2, whereas IR2 retains the ability to interact with SUMO1 to promote SUMO1-specific E3 ligase activity. To determine the structural basis for SUMO1 specificity, a hybrid IR1 construct and IR1 were used to determine three new structures for complexes containing UBC9 with RanGAP1-SUMO1/2. These structures show more extensive contacts among SUMO, UBC9, and RanBP2 in complexes containing SUMO1 compared with SUMO2 and suggest that differences in SUMO specificity may be achieved through these subtle conformational differences.

  15. Engineering targeted viral vectors for gene therapy.

    PubMed

    Waehler, Reinhard; Russell, Stephen J; Curiel, David T

    2007-08-01

    To achieve therapeutic success, transfer vehicles for gene therapy must be capable of transducing target cells while avoiding impact on non-target cells. Despite the high transduction efficiency of viral vectors, their tropism frequently does not match the therapeutic need. In the past, this lack of appropriate targeting allowed only partial exploitation of the great potential of gene therapy. Substantial progress in modifying viral vectors using diverse techniques now allows targeting to many cell types in vitro. Although important challenges remain for in vivo applications, the first clinical trials with targeted vectors have already begun to take place.

  16. MicroRNA-873 (MiRNA-873) Inhibits Glioblastoma Tumorigenesis and Metastasis by Suppressing the Expression of IGF2BP1

    PubMed Central

    Wang, Ren-jie; Li, Jian-wei; Bao, Bu-he; Wu, Huan-cheng; Du, Zhen-hua; Su, Jing-liang; Zhang, Ming-hua; Liang, Hai-qian

    2015-01-01

    Glioblastoma multiforme (GBM) is known as a highly malignant brain tumor with a poor prognosis, despite intensive research and clinical efforts. In this study, we observed that microRNA-873 (miR-873) was expressed at low levels in GBM and that the overexpression of miR-873 dramatically reduced the cell proliferation, migration, and invasion of GBM cells. Our further investigations of the inhibition mechanism indicated that miR-873 negatively affected the carcinogenesis and metastasis of GBM by down-regulating the expression of IGF2BP1, which stabilizes the mRNA transcripts of its target genes. These results demonstrate that miR-873 may constitute a potential target for GBM therapy. PMID:25670861

  17. Prevalence of Obesity and Its Influence on Achievement of Cardiometabolic Therapeutic Goals in Chinese Type 2 Diabetes Patients: An Analysis of the Nationwide, Cross-Sectional 3B Study

    PubMed Central

    Zhou, Xianghai; Ji, Linong; Ran, Xingwu; Su, Benli; Ji, Qiuhe; Pan, Changyu; Weng, Jianping; Ma, Changsheng; Hao, Chuanming; Zhang, Danyi; Hu, Dayi

    2016-01-01

    Background There are few data on the prevalence of obesity and its influence on achieving blood glucose, blood pressure, and blood lipid (3B) goals in Chinese type 2 diabetes outpatients. Methods Patient demographic data, anthropometric measurements, medications, and blood glucose and lipid profiles of 24,512 type 2 diabetes patients from a large, geographically diverse study (CCMR-3B) were analyzed. Using cut-points for body mass index (BMI) and waist circumference (WC) recommended by the Working Group on Obesity in China, overweight and obesity were defined as BMIs of 24–27.9kg/m2 and ≥28.0kg/m2. Central obesity was defined as a waist circumference ≥80cm in women and ≥85cm in men. The 3B therapeutic goals were HbA1c<7.0%, BP<140/90mmHg and LDL-C<2.6mmol/L. Results Overall, 43.0% of type 2 diabetes patients were overweight and 16.7% were obese; 13.3% of overweight and and10.1% of obese patients achieved all the 3B target goals. Overweight or obese patients were less likely to achieve 3B goals than those with normal BMIs. More than a half the overweight or obese patients (69.6%) were centrally obese. Patients with abdominal obesity were less likely to achieve cardiometabolic targets than those without abdominal obesity. In multivariate logistic regression analysis, female, higher BMI and waist circumference, smoking, drinking, sedentary lifestyle, and longer diabetes duration were significantly correlated with failure to achieve 3B control goals. Conclusions Obesity is highly prevalent and associated with poor 3B control in Chinese type 2 diabetes patients. In clinical practice, more attention and resources should focus on weight loss for such patients. PMID:26726883

  18. Florida's Fit to Achieve Program.

    ERIC Educational Resources Information Center

    Sander, Allan N.; And Others

    1993-01-01

    Describes Florida's "Fit to Achieve," a cardiovascular fitness education program for elementary students. Children are taught responsibility for their own cardiovascular fitness through proper exercise, personal exercise habits, and regular aerobic exercise. The program stresses collaborative effort between physical educators and classroom…

  19. Adequacy, Litigation, and Student Achievement

    ERIC Educational Resources Information Center

    Glenn, William

    2008-01-01

    The court system has been an increasingly important forum in the attempts to remedy the persistent achievement gaps in American education. In the past twenty years, school finance adequacy litigation has replaced desegregation as the most widely used legal strategy in these efforts. Despite the widespread use of adequacy litigation, few…

  20. Scheduling and Achievement. Research Brief

    ERIC Educational Resources Information Center

    Walker, Karen

    2006-01-01

    To use a block schedule or a traditional schedule? Which structure will produce the best and highest achievement rates for students? The research is mixed on this due to numerous variables such as: (1) socioeconomic levels; (2) academic levels; (3) length of time a given schedule has been in operation; (4) strategies being used in the classrooms;…