Science.gov

Sample records for achieving target bp

  1. Comparing Science Achievement Constructs: Targeted and Achieved

    ERIC Educational Resources Information Center

    Ferrara, Steve; Duncan, Teresa

    2011-01-01

    This article illustrates how test specifications based solely on academic content standards, without attention to other cognitive skills and item response demands, can fall short of their targeted constructs. First, the authors inductively describe the science achievement construct represented by a statewide sixth-grade science proficiency test.…

  2. RNA-binding protein IGF2BP3 targeting of oncogenic transcripts promotes hematopoietic progenitor proliferation

    PubMed Central

    Palanichamy, Jayanth Kumar; Tran, Tiffany M.; Howard, Jonathan M.; Contreras, Jorge R.; Fernando, Thilini R.; Sterne-Weiler, Timothy; Katzman, Sol; Toloue, Masoud; Yan, Weihong; Sanford, Jeremy R.; Rao, Dinesh S.

    2016-01-01

    Posttranscriptional control of gene expression is important for defining both normal and pathological cellular phenotypes. In vitro, RNA-binding proteins (RBPs) have recently been shown to play important roles in posttranscriptional regulation; however, the contribution of RBPs to cell specification is not well understood. Here, we determined that the RBP insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) is specifically overexpressed in mixed lineage leukemia–rearranged (MLL-rearranged) B-acute lymphoblastic leukemia (B-ALL), which constitutes a subtype of this malignancy associated with poor prognosis and high risk of relapse. IGF2BP3 was required for the survival of B-ALL cell lines, as knockdown led to decreased proliferation and increased apoptosis. Enforced expression of IGF2BP3 provided murine BM cells with a strong survival advantage, led to proliferation of hematopoietic stem and progenitor cells, and skewed hematopoietic development to the B cell/myeloid lineage. Cross-link immunoprecipitation and high throughput sequencing uncovered the IGF2BP3-regulated transcriptome, which includes oncogenes MYC and CDK6 as direct targets. IGF2BP3 regulated transcripts via targeting elements within 3′ untranslated regions (3′UTR), and enforced IGF2BP3 expression in mice resulted in enhanced expression of Myc and Cdk6 in BM. Together, our data suggest that IGF2BP3-mediated targeting of oncogenic transcripts may represent a critical pathogenetic mechanism in MLL-rearranged B-ALL and support IGF2BP3 and its cognate RNA-binding partners as potential therapeutic targets in this disease. PMID:26974154

  3. A DNA target of 30 bp is sufficient for RNA-directed DNA methylation.

    PubMed

    Pélissier, T; Wassenegger, M

    2000-01-01

    In higher plants, RNA-DNA interactions can trigger de novo methylation of genomic sequences via a process that is termed RNA-directed DNA methylation (RdDM). In potato spindle tuber viroid (PSTVd)-infected tobacco plants, this process can potentially lead to methylation of all C residues at symmetrical and nonsymmetrical sites within chromosomal inserts that consist of multimers of the 359-bp-long PSTVd cDNA. Using PSTVd cDNA subfragments, we found that genomic targets with as few as 30 nt of sequence complementarity to the viroid RNA are detected and methylated. Genomic sequencing analyses of genome-integrated 30- and 60-bp-long PSTVd subfragments demonstrated that de novo cytosine methylation is not limited to the canonical CpG, CpNpG sites. Sixty-base-pair-long PSTVd cDNA constructs appeared to be densely methylated in nearly all tobacco leaf cells. With the 30-bp-long PSTVd-specific construct, the proportion of cells displaying dense transgene methylation was significantly reduced, suggesting that a minimal target size of about 30 bp is necessary for RdDM. The methylation patterns observed for two different 60-bp constructs further suggested that the sequence identity of the target may influence the methylation mechanism. Finally, a link between viroid pathogenicity and PSTVd RNA-directed methylation of host sequences is proposed. PMID:10668798

  4. Targeting TopBP1 at a convergent point of multiple oncogenic pathways for cancer therapy

    PubMed Central

    Chowdhury, Pinki; Lin, Gregory E.; Liu, Kang; Song, Yongcheng; Lin, Fang-Tsyr; Lin, Weei-Chin

    2014-01-01

    The progression of many solid tumors is driven by de-regulation of multiple common pathways, particularly Rb, PI (3) K/Akt and p53. Prior studies identified TopBP1as a key mediator for the oncogenic gain-of-function activities of mutant p53 (mutp53) in cancer. In Akt-hyperactive cancer, TopBP1 forms oligomers and represses E2F1-dependent apoptosis. Here we perform a molecular docking screening and identify a lead compound, calcein, capable of blocking TopBP1 oligomerization and p53 binding, resulting in re-activation of E2F1-dependent apoptosis and blockade of mutp53 gain-of-function. Calcein AM, the cell permeable derivative of calcein, shows significant anti-tumor activity in a wide-spectrum of cultured cancer cells harboring high TopBP1 levels. These biochemical findings are recapitulated in breast cancer xenograft models. Thus, our study provides proof-of-concept evidence for targeting TopBP1, a convergent point of multiple pathways, as a cancer therapy. PMID:25400145

  5. Trypanosoma cruzi: specific detection of parasites by PCR in infected humans and vectors using a set of primers (BP1/BP2) targeted to a nuclear DNA sequence.

    PubMed

    Silber, A M; Búa, J; Porcel, B M; Segura, E L; Ruiz, A M

    1997-03-01

    In the present work we evaluate Trypanosoma cruzi DNA detection by PCR using the nuclear oligonucleotides BP1/BP2 as primers. These primers are targeted to the 5' and 3' ends of the coding region for the flagellar protein F29. An amplification product of BP1/BP2 is a DNA band 692 bp long. Titration assays were performed to evaluate the minimum amount of parasite DNA that can be detected by this assay, resulting in 10 fg (equivalent to about 1/20 of the genome). The assay was also performed using T. cruzi DNA from different strains, clones, and human-derived isolates obtaining, in all cases, amplification products. No DNA amplification was observed when the PCR was performed using DNA from Leishmania braziliensis, but when T. rangeli DNA was used, a 615-bp-long fragment was amplified. Under appropriate gel conditions T. cruzi and T. rangeli DNA amplicons could be differentiated. When both conventional xenodiagnosis and PCR detection of parasite DNA in the feces of insect vectors fed with blood from infected patients were compared, 10 of 20 samples were positive by both techniques. However, 2 other samples with positive serology were also positive by PCR. When PCR was performed on blood samples from infected and uninfected individuals, 62 of 65 serologically positive human samples amplified the BP1/BP2 692-bp T. cruzi DNA fragment (sensitivity >95%). The 3 negative samples were positive when Southern blot hybridization was performed using the radiolabeled PCR amplification product as probe (sensitivity 100%). PMID:9085919

  6. BP Targets in Hypertension: What Should We Do Now That SPRINT Is Out?

    PubMed

    Bhatt, Hemal; Ghazi, Lama; Calhoun, David; Oparil, Suzanne

    2016-10-01

    Systolic blood pressure (SBP) is an important predictor of cardiovascular disease (CVD) outcomes. Lowering SBP has been shown to reduce CVD morbidity and mortality, but the optimal SBP target continues to be a topic of intense debate. The Systolic Blood Pressure Intervention Trial (SPRINT) reported a significantly lower risk for CVD outcomes and all-cause mortality by targeting SBP <120 mmHg compared with <140 mmHg in a population of hypertensive persons at high CV risk. In this review, we discuss the strengths, limitations, and generalizability of SPRINT findings to other hypertensive populations that were excluded from the trial, including those with diabetes or prior stroke, <50 years old, and at lower CVD risk. We will focus on the implications of SPRINT findings for appropriate BP targets in high-risk groups of hypertensive persons, including the elderly and those with chronic kidney disease (CKD). We will also address the cost-effectiveness of intensive BP treatment as implemented in SPRINT and the implications of SPRINT for health care policy and future BP guidelines. PMID:27566331

  7. Synergies and trade-offs in achieving global biodiversity targets.

    PubMed

    Di Marco, Moreno; Butchart, Stuart H M; Visconti, Piero; Buchanan, Graeme M; Ficetola, Gentile F; Rondinini, Carlo

    2016-02-01

    After their failure to achieve a significant reduction in the global rate of biodiversity loss by 2010, world governments adopted 20 new ambitious Aichi biodiversity targets to be met by 2020. Efforts to achieve one particular target can contribute to achieving others, but different targets may sometimes require conflicting solutions. Consequently, lack of strategic thinking might result, once again, in a failure to achieve global commitments to biodiversity conservation. We illustrate this dilemma by focusing on Aichi Target 11. This target requires an expansion of terrestrial protected area coverage, which could also contribute to reducing the loss of natural habitats (Target 5), reducing human-induced species decline and extinction (Target 12), and maintaining global carbon stocks (Target 15). We considered the potential impact of expanding protected areas to mitigate global deforestation and the consequences for the distribution of suitable habitat for >10,000 species of forest vertebrates (amphibians, birds, and mammals). We first identified places where deforestation might have the highest impact on remaining forests and then identified places where deforestation might have the highest impact on forest vertebrates (considering aggregate suitable habitat for species). Expanding protected areas toward locations with the highest deforestation rates (Target 5) or the highest potential loss of aggregate species' suitable habitat (Target 12) resulted in partially different protected area network configurations (overlapping with each other by about 73%). Moreover, the latter approach contributed to safeguarding about 30% more global carbon stocks than the former. Further investigation of synergies and trade-offs between targets would shed light on these and other complex interactions, such as the interaction between reducing overexploitation of natural resources (Targets 6, 7), controlling invasive alien species (Target 9), and preventing extinctions of native

  8. Survey and Rapid Detection of Bordetella pertussis in Clinical Samples Targeting the BP485 in China

    PubMed Central

    Liu, Wei; Xu, Yinghua; Dong, Derong; Li, Huan; Zhao, Xiangna; Li, Lili; Zhang, Ying; Wei, Xiao; Wang, Xuesong; Huang, Simo; Zeng, Ming; Huang, Liuyu; Zhang, Shumin; Yuan, Jing

    2015-01-01

    Bordetella pertussis is an important human respiratory pathogen. Here, we describe a loop-mediated isothermal amplification (LAMP) method for the rapid detection of B. pertussis in clinical samples based on a visual test. The LAMP assay detected the BP485 target sequence within 60 min with a detection limit of 1.3 pg/μl, a 10-fold increase in sensitivity compared with conventional PCR. All 31 non-pertussis respiratory pathogens tested were negative for LAMP detection, indicating the high specificity of the primers for B. pertussis. To evaluate the application of the LAMP assay to clinical diagnosis, of 105 sputum and nasopharyngeal samples collected from the patients with suspected respiratory infections in China, a total of 12 B. pertussis isolates were identified from 33 positive samples detected by LAMP-based surveillance targeting BP485. Strikingly, a 4.5 months old baby and her mother were found to be infected with B. pertussis at the same time. All isolates belonged to different B. pertussis multilocus sequence typing groups with different alleles of the virulence-related genes including four alleles of ptxA, six of prn, four of tcfA, two of fim2, and three of fim3. The diversity of B. pertussis carrying toxin genes in clinical strains indicates a rapid and continuing evolution of B. pertussis. This combined with its high prevalence will make it difficult to control. In conclusion, we have developed a visual detection LAMP assay, which could be a useful tool for rapid B. pertussis detection, especially in situations where resources are poor and in point-of-care tests. PMID:25798436

  9. CtBP1 associates metabolic syndrome and breast carcinogenesis targeting multiple miRNAs

    PubMed Central

    De Luca, Paola; Dalton, Guillermo N.; Scalise, Georgina D.; Moiola, Cristian P.; Porretti, Juliana; Massillo, Cintia; Kordon, Edith; Gardner, Kevin; Zalazar, Florencia; Flumian, Carolina; Todaro, Laura; Vazquez, Elba S.; Meiss, Roberto; De Siervi, Adriana

    2016-01-01

    Metabolic syndrome (MeS) has been identified as a risk factor for breast cancer. C-terminal binding protein 1 (CtBP1) is a co-repressor of tumor suppressor genes that is activated by low NAD+/NADH ratio. High fat diet (HFD) increases intracellular NADH. We investigated the effect of CtBP1 hyperactivation by HFD intake on mouse breast carcinogenesis. We generated a MeS-like disease in female mice by chronically feeding animals with HFD. MeS increased postnatal mammary gland development and generated prominent duct patterns with markedly increased CtBP1 and Cyclin D1 expression. CtBP1 induced breast cancer cells proliferation. Serum from animals with MeS enriched the stem-like/progenitor cell population from breast cancer cells. CtBP1 increased breast tumor growth in MeS mice modulating multiple genes and miRNA expression implicated in cell proliferation, progenitor cells phenotype, epithelial to mesenchymal transition, mammary development and cell communication in the xenografts. These results define a novel function for CtBP1 in breast carcinogenesis. PMID:26933806

  10. CtBP1 associates metabolic syndrome and breast carcinogenesis targeting multiple miRNAs.

    PubMed

    De Luca, Paola; Dalton, Guillermo N; Scalise, Georgina D; Moiola, Cristian P; Porretti, Juliana; Massillo, Cintia; Kordon, Edith; Gardner, Kevin; Zalazar, Florencia; Flumian, Carolina; Todaro, Laura; Vazquez, Elba S; Meiss, Roberto; De Siervi, Adriana

    2016-04-01

    Metabolic syndrome (MeS) has been identified as a risk factor for breast cancer. C-terminal binding protein 1 (CtBP1) is a co-repressor of tumor suppressor genes that is activated by low NAD+/NADH ratio. High fat diet (HFD) increases intracellular NADH. We investigated the effect of CtBP1 hyperactivation by HFD intake on mouse breast carcinogenesis. We generated a MeS-like disease in female mice by chronically feeding animals with HFD. MeS increased postnatal mammary gland development and generated prominent duct patterns with markedly increased CtBP1 and Cyclin D1 expression. CtBP1 induced breast cancer cells proliferation. Serum from animals with MeS enriched the stem-like/progenitor cell population from breast cancer cells. CtBP1 increased breast tumor growth in MeS mice modulating multiple genes and miRNA expression implicated in cell proliferation, progenitor cells phenotype, epithelial to mesenchymal transition, mammary development and cell communication in the xenografts. These results define a novel function for CtBP1 in breast carcinogenesis. PMID:26933806

  11. miR-506 inhibits the proliferation and invasion by targeting IGF2BP1 in glioblastoma

    PubMed Central

    Luo, Yonggang; Sun, Ranran; Zhang, Jun; Sun, Tongwen; Liu, Xianzhi; Yang, Bo

    2015-01-01

    Increasing evidence has indicated that microRNAs (miRNAs) play an essential role in cancers. Deregulation of miR-506 was reported in several cancers. However, the expression and function of miR-506 in glioblastoma remain unclear. Our data showed that the level of miR-506 was downregulated in glioblastoma tissues and cell lines. Overexpression of miR-506 repressed cell growth, blocked G1/S transition, and suppressed cell invasion in glioblastoma cell. Moreover, IGF2BP1 was a direct target of miR-506 in glioblastoma cells. Knockdown of IGF2BP1 recapitulated the anti-proliferative and anti-invasive effects of miR-506, whereas IGF2BP1 overexpression antagonized the tumor-suppressive function of miR-506. Our data showed that miRNA-506 played a tumor suppressor gene role in human glioblastoma by regulating IGF2BP1 gene and might be a new therapeutic target of human glioblastoma. PMID:26692944

  12. What would it take to achieve the Paris temperature targets?

    NASA Astrophysics Data System (ADS)

    Sanderson, Benjamin M.; O'Neill, Brian C.; Tebaldi, Claudia

    2016-07-01

    The 2015 Paris Agreement aims to limit warming to 2 or 1.5°C above preindustrial level, although combined Intended Nationally Determined Contributions (INDCs) are likely insufficient to achieve these targets. We propose a set of idealized emission pathways consistent with the targets. If countries reduce emissions in line with their INDCs, the 2°C threshold could be avoided only if net zero greenhouse gas emissions (GHGEs) are achieved by 2085 and late century negative emissions are considerably in excess of those assumed in Representative Concentration Pathway (RCP) 2.6 (net -5 Gt CO2/yr, compared with -1.5 Gt CO2/yr in RCP2.6). More aggressive near-term reductions would allow 2°C to be avoided with less end-of-century carbon removal capacity. A 10% cut in GHGEs by 2030 (relative to 2015) could likely achieve 2°C with RCP2.6 level negative emissions. The 1.5°C target requires GHGEs to be reduced by almost a third by 2030 and net zero by 2050, while a 50 year overshoot of 1.5°C allows net zero GHGEs by 2060.

  13. Comprehensive profiling of novel microRNA-9 targets and a tumor suppressor role of microRNA-9 via targeting IGF2BP1 in hepatocellular carcinoma

    PubMed Central

    Wang, Yongfeng; Li, Xiaojun; Xie, Qing; Jia, Junqiao; Yan, Ying; Guo, Zhengyang; Gao, Jian; Yao, Mingjie; Chen, Xiangmei; Lu, Fengmin

    2015-01-01

    MicroRNA-9 (miR-9) dysregulation is implicated in a variety of human malignancies including hepatocellular carcinoma (HCC), but its role remains contradictory. In this study, we explored the expression and methylation status of miR-9 in HCC samples, as well as the tumor-related functions of miR-9 in vitro. Bioinformatics analysis, array-based RNA expression profile, and literature retrieval were used to identify miR-9 targets in HCC. The potential downstream candidates were then validated by luciferase reporter assay, real-time quantitative PCR, and western blot or enzyme linked immunosorbent assay (ELISA). The expression status and clinicopathologic significances of miR-9 target genes in clinical samples were further explored. The results showed that miR-9 was frequently downregulated in primary HCC. Its silencing was largely contributed by a high frequency (42.5%) of mir-9-1 hypermethylation, which was correlated with bigger tumor size (P = 0.0234). In vitro functional studies revealed that miR-9 restoration retarded HCC cell proliferation and migration. IL-6, AP3B1, TC10, ONECUT2, IGF2BP1, MYO1D, and ANXA2 were confirmed to be miR-9 targets in HCC. Among them, ONECUT2, IGF2BP1, and ANXA2 were confirmed to be aberrantly upregulated in HCC. Moreover, upregulation of ONECUT2, IGF2BP1, and IL-6 were significantly associated with poor post-surgery prognosis (P = 0.0458, P = 0.0037 and P = 0.0461, respectively). Mechanically, miR-9 plays a tumor suppressive role partially through a functional miR-9/IGF2BP1/AKT&ERK axis. Our study suggests that miR-9 functions as a tumor suppressor in HCC progression by inhibiting a series of target genes, including the newly validated miR-9/IGF2BP1/AKT&ERK axis, thus providing potential therapeutic targets and novel prognostic biomarkers for HCC patients. PMID:26547929

  14. Resveratrol induces apoptosis by directly targeting Ras-GTPase activating protein SH3 domain binding protein 1 (G3BP1)

    PubMed Central

    Oi, Naomi; Yuan, Jian; Malakhova, Margarita; Luo, Kuntian; Li, Yunhui; Ryu, Joohyun; Zhang, Lei; Bode, Ann M.; Xu, Zengguang; Li, Yan; Lou, Zhenkun; Dong, Zigang

    2014-01-01

    Resveratrol possesses a strong anticancer activity exhibited as the induction of apoptosis through p53 activation. However, the molecular mechanism and direct target(s) of resveratrol-induced p53 activation remain elusive. Here, the Ras-GTPase activating protein SH3 domain binding protein 1 (G3BP1) was identified as a potential target of resveratrol, and in vitro binding assay results using resveratrol (RSVL)-conjugated Sepharose 4B beads confirmed their direct binding. Depletion of G3BP1 significantly diminishes resveratrol-induced p53 expression and apoptosis. We also found that G3BP1 negatively regulates p53 expression by interacting with ubiquitin-specific protease 10 (USP10), a deubiquitinating enzyme of p53. Disruption of the interaction of p53 with USP10 by G3BP1 interference leads to suppression of p53 deubiquitination. Resveratrol, on the other hand, directly binds to G3BP1 and prevents the G3BP1/USP10 interaction, resulting in enhanced USP10-mediated deubiquitination of p53 and consequently increased p53 expression. These findings disclose a novel mechanism of resveratrol-induced p53 activation and resveratrol-induced apoptosis by direct targeting of G3BP1. PMID:24998844

  15. Target plasma achievements for unity beta operation in ET

    NASA Astrophysics Data System (ADS)

    Gourdain, P.-A.; Carter, T. A.; Gauvreau, J.-L.; Grossman, A.; Lafonteese, D. J.; Pace, D. C.; Schmitz, L. W.; Taylor, R. J.

    2003-10-01

    The Electric Tokamak (ET) at UCLA (t_pulse<5s, τ_E<0.5s, V_loop>0.3V, B=0.25T) is now in a critical stage of research to exceed the conventional beta limit. The latest program is aiming for 10s long plasma discharges at unity peak beta by means of 2^d harmonic ICRF heating and current profile control. A stable computational MHD high beta path has been found for ET high aspect ratio configuration leading from the Troyon limit to unity beta using an in-house equilibrium code and the DCON stability code. This critical path involves high power ICRF injection (5MW) for targeted plasma heating and ballooning/kink modes stabilization by poloidal rotation. Another major component is high plasma density using core and edge fueling relying on kinetic neutral beam and inboard/outboard gas puff. At this regime current profile control using fast wave current drive, with bootstrap current optimization, will be possible. A magnetic well should develop, leading to high beta plasmas with omnigenous properties. To achieve these goals, a tight feedback system between power and particle injections and plasma diagnostics is mandatory.

  16. Structural Insights into Membrane Targeting by the Flagellar Calcium-binding Protein (FCaBP) a Myristoylated and Palmitoylated Calcium Sensor in Trypanosoma cruzi

    SciTech Connect

    J Wingard; J Ladner; M Vanarotti; A Fisher; H Robinson; K Buchanan; D Engman; J Ames

    2011-12-31

    The flagellar calcium-binding protein (FCaBP) of the protozoan Trypanosoma cruzi is targeted to the flagellar membrane where it regulates flagellar function and assembly. As a first step toward understanding the Ca{sup 2+}-induced conformational changes important for membrane-targeting, we report here the x-ray crystal structure of FCaBP in the Ca{sup 2+}-free state determined at 2.2{angstrom} resolution. The first 17 residues from the N terminus appear unstructured and solvent-exposed. Residues implicated in membrane targeting (Lys-19, Lys-22, and Lys-25) are flanked by an exposed N-terminal helix (residues 26-37), forming a patch of positive charge on the protein surface that may interact electrostatically with flagellar membrane targets. The four EF-hands in FCaBP each adopt a 'closed conformation' similar to that seen in Ca{sup 2+}-free calmodulin. The overall fold of FCaBP is closest to that of grancalcin and other members of the penta EF-hand superfamily. Unlike the dimeric penta EF-hand proteins, FCaBP lacks a fifth EF-hand and is monomeric. The unstructured N-terminal region of FCaBP suggests that its covalently attached myristoyl group at the N terminus may be solvent-exposed, in contrast to the highly sequestered myristoyl group seen in recoverin and GCAP1. NMR analysis demonstrates that the myristoyl group attached to FCaBP is indeed solvent-exposed in both the Ca{sup 2+}-free and Ca{sup 2+}-bound states, and myristoylation has no effect on protein structure and folding stability. We propose that exposed acyl groups at the N terminus may anchor FCaBP to the flagellar membrane and that Ca{sup 2+}-induced conformational changes may control its binding to membrane-bound protein targets..

  17. IFE target fabrication and injection—achieving "believability"

    NASA Astrophysics Data System (ADS)

    Schultz, K. R.; Goodin, D. T.; Nobile, A.

    2001-05-01

    At the heart of an inertial fusion energy (IFE) power plant is a target that has been compressed and heated to fusion conditions by the incident driver energy beams. The "Target Factory" at an inertial fusion power plant must produce about 500,000 targets per day, fill them with deuterium-tritium fuel, cool them to cryogenic temperature, and layer the solid fuel into a symmetric and smooth shell inside the capsule. The target must then accurately be delivered to the target chamber center at a rate of about 5 Hz, with a precisely predicted target location. These fragile targets must survive injection into the target chamber without damage. While IFE power plant design studies have presented plausible scenarios for IFE target fabrication and injection, these issues have become "believability" issues for IFE. A credible pathway for development of accurate, economic and reliable IFE target fabrication and injection must be demonstrated before we can proceed with the next major step in the IFE Program, the construction of an IFE Integrated Research Experiment. General Atomics is designing, constructing, and testing an experimental Target Injection and Tracking System to develop the scientific understanding necessary for injection of IFE targets into a high temperature reaction chamber. This paper summarizes the requirements for IFE target fabrication and injection, reviews the results from the studies that predict success, discusses the development program now underway, and presents the current status of and results from that program.

  18. Healthy latrine development model to achieve MDGs target

    NASA Astrophysics Data System (ADS)

    Soedjono, Eddy S.; Arumsari, Nurvita

    2014-03-01

    A case happened in Pungging sub-district was one example of low level healthy habits of East Java inhabitants. According to the data of Mojokerto district Health Service until the end of 2010, there are 219 families (or about 8% of total families in Pungging sub-district) which do not have their own latrine. Moreover, if we observe closely to their prosperity level, the percentage of disadvantaged families and prosperous level I is still adequately high about 29,54% of the total number of families in Pungging sub-district. Accordingly, comprehensive studies related to basic sanitation requirement need to be done, not only in the matter of quantity but also in the matter of quality. Furthermore, further studies on people's knowledge and understanding on healthy sanitation also needed in the effort to understand people's demand to own latrine (willingness to pay) and ability to pay. Consequently, the design of healthy latrine which agrees with people's demand and ability is needed in order to achieve the target of Open Defecation Free (ODF) in 2015. The research methodology includes literary study, data collection, data analysis, and healthy latrine design. Out of 75 respondents, only 32% of them who attended counselling program on healthy latrine and only 48% of them who have knowledge on healthy latrine, but in reality 96% of respondents stated that healthy latrine is important. Healthy latrine, according to the respondents, is a place of defecation (BAB) which has components like latrine bowl or septic tank. Estimation on WTP distribution which is divided in two categories; low category with range of willingness to pay from IDR 0 to IDR 200,000 is IDR 90,048,000. On the other hand, high category with range of willingness to pay more than IDR 1,000,000 is IDR 749,964,768. Estimation on respondents' ATP in the area of study on the sanitation maintenance service is from IDR 7,000 to IDR 30,000.

  19. Epitope-Dependent Pathogenicity of Antibodies Targeting a Major Bullous Pemphigoid Autoantigen Collagen XVII/BP180.

    PubMed

    Wada, Mayumi; Nishie, Wataru; Ujiie, Hideyuki; Izumi, Kentaro; Iwata, Hiroaki; Natsuga, Ken; Nakamura, Hideki; Kitagawa, Yoshimasa; Shimizu, Hiroshi

    2016-05-01

    In bullous pemphigoid, the common autoimmune blistering disorder, IgG autoantibodies target various epitopes on hemidesmosomal transmembrane collagen XVII (COL17)/BP180. Antibodies (Abs) targeting the extracellular noncollagenous 16th A domain of COL17 may be pathogenic; however, the pathogenic roles of Abs targeting non-noncollagenous 16th A regions are poorly understood. In this study using a pathogenic and a nonpathogenic monoclonal antibody (mAb) targeting the noncollagenous 16th A domain (mAb TS39-3) and the C-terminus domain (mAb C17-C1), respectively, we show that endocytosis of immune complexes after binding of Abs to cell surface COL17 is a key phenomenon that induces skin fragility. Passive transfer of IgG1 mouse mAb TS39-3 but not mAb C17-C1 induces dermal-epidermal separation in neonatal human COL17-expressing transgenic mice. Interestingly, mAb C17-C1 strongly binds with the dermal-epidermal junction of the recipient mice skin, suggesting that binding of Abs with COL17 is insufficient to induce skin fragility. In cultured normal human epidermal keratinocytes treated with these mAbs, mAb TS39-3 but not mAb C17-C1 internalizes immune complexes after binding with cell surface COL17 via macropinocytosis, resulting in reduced COL17 expression. This study shows that pathogenicity of Abs targeting COL17 is epitope dependent, which is associated with macropinocytosis-mediated endocytosis of immune complexes and finally results in the depletion of COL17 expression in basal keratinocytes. PMID:26827765

  20. Inhibition of GLI1 Expression by Targeting the CRD-BP-GLI1 mRNA Interaction Using a Specific Oligonucleotide.

    PubMed

    Mehmood, Kashif; Akhtar, Daud; Mackedenski, Sebastian; Wang, Chuyi; Lee, Chow H

    2016-06-01

    The stabilization of glioma-associated oncogene 1 (GLI1) mRNA by coding region determinant binding protein (CRD-BP) through the Wnt/β-catenin signaling pathway is implicated in the proliferation of colorectal cancer and basal cell carcinoma. Here, we set out to characterize the physical interaction between CRD-BP and GLI1 mRNA so as to find inhibitors for such interaction. Studies using CRD-BP variants with a point mutation in the GXXG motif at each KH domain showed that KH1 and KH2 domain are critical for the binding of GLI1 RNA. The smallest region of GLI1 RNA binding to CRD-BP was mapped to nucleotides (nts) 320-380. A 37-nt S1 RNA sense oligonucleotide, containing two distinct stem-loops present in nts 320-380 of GLI1 RNA, was found to be effective in blocking CRD-BP-GLI1 RNA interaction. Studies using various competitor RNAs with modifications to S1 RNA oligonucleotide further displayed that both the sequences and the structure of the two stem-loops are important for CRD-BP-GLI1 RNA binding. The role of the two-stem-loop motif in influencing CRD-BP-RNA interaction was further investigated in cells. The 2'-O-methyl derivative of the S1 RNA oligonucleotide significantly decreased GLI1, c-myc, and CD44 mRNA levels, in a panel of colon and breast cancer cells. The results from this study demonstrate the potential importance of the two-stem-loop motif as a target region for the inhibition of the CRD-BP-GLI1 RNA interaction and Hedgehog signaling pathway. Such results pave the way for the development of novel inhibitors that act by destabilizing the CRD-BP-GLI1 mRNA interaction. PMID:27036131

  1. Dynamics of the subcellular localization of RalBP1/RLIP through the cell cycle: the role of targeting signals and of protein-protein interactions.

    PubMed

    Fillatre, Jonathan; Delacour, Delphine; Van Hove, Lucie; Bagarre, Thomas; Houssin, Nathalie; Soulika, Marina; Veitia, Reiner A; Moreau, Jacques

    2012-05-01

    The small G protein Ras regulates many cell processes, such as gene expression, proliferation, apoptosis, and cell differentiation. Its mutations are associated with one-third of all cancers. Ras functions are mediated, at least in part, by Ral proteins and their downstream effector the Ral-binding protein 1 (RalBP1). RalBP1 is involved in endocytosis and in regulating the dynamics of the actin cytoskeleton. It also regulates early development since it is required for the completion of gastrulation in Xenopus laevis. RalBP1 has also been reported to be the main transporter of glutathione electrophiles, and it is involved in multidrug resistance. Such a variety of functions could be explained by a differential regulation of RalBP1 localization. In this study, we have detected endogenous RalBP1 in the nucleus of interphasic cells. This nuclear targeting is mediated by nuclear localization sequences that map to the N-terminal third of the protein. Moreover, in X. laevis embryos, a C-terminal coiled-coil sequence mediates RalBP1 retention in the nucleus. We have also observed RalBP1 at the level of the actin cytoskeleton, a localization that depends on interaction of the protein with active Ral. During mitosis RalBP1 also associates with the mitotic spindle and the centrosome, a localization that could be negatively regulated by active Ral. Finally, we demonstrate the presence of post-transcriptional and post-translational isoforms of RalBP1 lacking the Ral-binding domain, which opens new possibilities for the existence of Ral-independent functions. PMID:22319010

  2. Identification of Targets of CUG-BP, Elav-Like Family Member 1 (CELF1) Regulation in Embryonic Heart Muscle

    PubMed Central

    Coram, Ryan J.; Ladd, Andrea N.

    2016-01-01

    CUG-BP, Elav-like family member 1 (CELF1) is a highly conserved RNA binding protein that regulates pre-mRNA alternative splicing, polyadenylation, mRNA stability, and translation. In the heart, CELF1 is expressed in the myocardium, where its levels are tightly regulated during development. CELF1 levels peak in the heart during embryogenesis, and aberrant up-regulation of CELF1 in the adult heart has been implicated in cardiac pathogenesis in myotonic dystrophy type 1, as well as in diabetic cardiomyopathy. Either inhibition of CELF activity or over-expression of CELF1 in heart muscle causes cardiomyopathy in transgenic mice. Nonetheless, many of the cardiac targets of CELF1 regulation remain unknown. In this study, to identify cardiac targets of CELF1 we performed cross-linking immunoprecipitation (CLIP) for CELF1 from embryonic day 8 chicken hearts. We identified a previously unannotated exon in MYH7B as a novel target of CELF1-mediated regulation. We demonstrated that knockdown of CELF1 in primary chicken embryonic cardiomyocytes leads to increased inclusion of this exon and decreased MYH7B levels. We also investigated global changes in the transcriptome of primary embryonic cardiomyocytes following CELF1 knockdown in a published RNA-seq dataset. Pathway and network analyses identified strong associations between CELF1 and regulation of cell cycle and translation. Important regulatory proteins, including both RNA binding proteins and a cardiac transcription factor, were affected by loss of CELF1. Together, these data suggest that CELF1 is a key regulator of cardiomyocyte gene expression. PMID:26866591

  3. Identification of Targets of CUG-BP, Elav-Like Family Member 1 (CELF1) Regulation in Embryonic Heart Muscle.

    PubMed

    Blech-Hermoni, Yotam; Dasgupta, Twishasri; Coram, Ryan J; Ladd, Andrea N

    2016-01-01

    CUG-BP, Elav-like family member 1 (CELF1) is a highly conserved RNA binding protein that regulates pre-mRNA alternative splicing, polyadenylation, mRNA stability, and translation. In the heart, CELF1 is expressed in the myocardium, where its levels are tightly regulated during development. CELF1 levels peak in the heart during embryogenesis, and aberrant up-regulation of CELF1 in the adult heart has been implicated in cardiac pathogenesis in myotonic dystrophy type 1, as well as in diabetic cardiomyopathy. Either inhibition of CELF activity or over-expression of CELF1 in heart muscle causes cardiomyopathy in transgenic mice. Nonetheless, many of the cardiac targets of CELF1 regulation remain unknown. In this study, to identify cardiac targets of CELF1 we performed cross-linking immunoprecipitation (CLIP) for CELF1 from embryonic day 8 chicken hearts. We identified a previously unannotated exon in MYH7B as a novel target of CELF1-mediated regulation. We demonstrated that knockdown of CELF1 in primary chicken embryonic cardiomyocytes leads to increased inclusion of this exon and decreased MYH7B levels. We also investigated global changes in the transcriptome of primary embryonic cardiomyocytes following CELF1 knockdown in a published RNA-seq dataset. Pathway and network analyses identified strong associations between CELF1 and regulation of cell cycle and translation. Important regulatory proteins, including both RNA binding proteins and a cardiac transcription factor, were affected by loss of CELF1. Together, these data suggest that CELF1 is a key regulator of cardiomyocyte gene expression. PMID:26866591

  4. Targeting the latent reservoir to achieve functional HIV cure

    PubMed Central

    Cary, Daniele C.; Peterlin, B. Matija

    2016-01-01

    While highly active anti-retroviral therapy has greatly improved the lives of HIV-infected individuals, current treatments are unable to completely eradicate the virus. This is due to the presence of HIV latently infected cells which harbor transcriptionally silent HIV. Latent HIV does not replicate or produce viral proteins, thereby preventing efficient targeting by anti-retroviral drugs. Strategies to target the HIV latent reservoir include viral reactivation, enhancing host defense mechanisms, keeping latent HIV silent, and using gene therapy techniques to knock out or reactivate latent HIV. While research into each of these areas has yielded promising results, currently no one mechanism eradicates latent HIV. Instead, combinations of these approaches should be considered for a potential HIV functional cure. PMID:27303638

  5. Achieving target voriconazole concentrations more accurately in children and adolescents.

    PubMed

    Neely, Michael; Margol, Ashley; Fu, Xiaowei; van Guilder, Michael; Bayard, David; Schumitzky, Alan; Orbach, Regina; Liu, Siyu; Louie, Stan; Hope, William

    2015-01-01

    Despite the documented benefit of voriconazole therapeutic drug monitoring, nonlinear pharmacokinetics make the timing of steady-state trough sampling and appropriate dose adjustments unpredictable by conventional methods. We developed a nonparametric population model with data from 141 previously richly sampled children and adults. We then used it in our multiple-model Bayesian adaptive control algorithm to predict measured concentrations and doses in a separate cohort of 33 pediatric patients aged 8 months to 17 years who were receiving voriconazole and enrolled in a pharmacokinetic study. Using all available samples to estimate the individual Bayesian posterior parameter values, the median percent prediction bias relative to a measured target trough concentration in the patients was 1.1% (interquartile range, -17.1 to 10%). Compared to the actual dose that resulted in the target concentration, the percent bias of the predicted dose was -0.7% (interquartile range, -7 to 20%). Using only trough concentrations to generate the Bayesian posterior parameter values, the target bias was 6.4% (interquartile range, -1.4 to 14.7%; P = 0.16 versus the full posterior parameter value) and the dose bias was -6.7% (interquartile range, -18.7 to 2.4%; P = 0.15). Use of a sample collected at an optimal time of 4 h after a dose, in addition to the trough concentration, resulted in a nonsignificantly improved target bias of 3.8% (interquartile range, -13.1 to 18%; P = 0.32) and a dose bias of -3.5% (interquartile range, -18 to 14%; P = 0.33). With the nonparametric population model and trough concentrations, our control algorithm can accurately manage voriconazole therapy in children independently of steady-state conditions, and it is generalizable to any drug with a nonparametric pharmacokinetic model. (This study has been registered at ClinicalTrials.gov under registration no. NCT01976078.). PMID:25779580

  6. Achieving Target Voriconazole Concentrations More Accurately in Children and Adolescents

    PubMed Central

    Margol, Ashley; Fu, Xiaowei; van Guilder, Michael; Bayard, David; Schumitzky, Alan; Orbach, Regina; Liu, Siyu; Louie, Stan; Hope, William

    2015-01-01

    Despite the documented benefit of voriconazole therapeutic drug monitoring, nonlinear pharmacokinetics make the timing of steady-state trough sampling and appropriate dose adjustments unpredictable by conventional methods. We developed a nonparametric population model with data from 141 previously richly sampled children and adults. We then used it in our multiple-model Bayesian adaptive control algorithm to predict measured concentrations and doses in a separate cohort of 33 pediatric patients aged 8 months to 17 years who were receiving voriconazole and enrolled in a pharmacokinetic study. Using all available samples to estimate the individual Bayesian posterior parameter values, the median percent prediction bias relative to a measured target trough concentration in the patients was 1.1% (interquartile range, −17.1 to 10%). Compared to the actual dose that resulted in the target concentration, the percent bias of the predicted dose was −0.7% (interquartile range, −7 to 20%). Using only trough concentrations to generate the Bayesian posterior parameter values, the target bias was 6.4% (interquartile range, −1.4 to 14.7%; P = 0.16 versus the full posterior parameter value) and the dose bias was −6.7% (interquartile range, −18.7 to 2.4%; P = 0.15). Use of a sample collected at an optimal time of 4 h after a dose, in addition to the trough concentration, resulted in a nonsignificantly improved target bias of 3.8% (interquartile range, −13.1 to 18%; P = 0.32) and a dose bias of −3.5% (interquartile range, −18 to 14%; P = 0.33). With the nonparametric population model and trough concentrations, our control algorithm can accurately manage voriconazole therapy in children independently of steady-state conditions, and it is generalizable to any drug with a nonparametric pharmacokinetic model. (This study has been registered at ClinicalTrials.gov under registration no. NCT01976078.) PMID:25779580

  7. Targeting of the Plant Vacuolar Sorting Receptor BP80 Is Dependent on Multiple Sorting Signals in the Cytosolic Tail[W

    PubMed Central

    daSilva, Luis L.P.; Foresti, Ombretta; Denecke, Jurgen

    2006-01-01

    Although signals for vacuolar sorting of soluble proteins are well described, we have yet to learn how the plant vacuolar sorting receptor BP80 reaches its correct destination and recycles. To shed light on receptor targeting, we used an in vivo competition assay in which a truncated receptor (green fluorescent protein-BP80) specifically competes with sorting machinery and causes hypersecretion of BP80-ligands from tobacco (Nicotiana tabacum) leaf protoplasts. We show that both the transmembrane domain and the cytosolic tail of BP80 contain information necessary for efficient progress to the prevacuolar compartment (PVC). Furthermore, the tail must be exposed on the correct membrane surface to compete with sorting machinery. Mutational analysis of conserved residues revealed that multiple sequence motifs are necessary for competition, one of which is a typical Tyr-based motif (YXXΦ). Substitution of Tyr-612 for Ala causes partial retention in the Golgi apparatus, mistargeting to the plasma membrane (PM), and slower progress to the PVC. A role in Golgi-to-PVC transport was confirmed by generating the corresponding mutation on full-length BP80. The mutant receptor was partially mistargeted to the PM and induced the secretion of a coexpressed BP80-ligand. Further mutants indicate that the cytosolic tail is likely to contain other information besides the YXXΦ motif, possibly for endoplasmic reticulum export, endocytosis from the PM, and PVC-to-Golgi recycling. PMID:16714388

  8. NF-κBp65 and Expression of Its Pro-Inflammatory Target Genes Are Upregulated in the Subcutaneous Adipose Tissue of Cachectic Cancer Patients

    PubMed Central

    Gonzalez Camargo, Rodolfo; Mendes dos Reis Riccardi, Daniela; Quintas Teixeira Ribeiro, Henrique; Carlos Carnevali, Luiz; Marques de Matos-Neto, Emidio; Enjiu, Lucas; Xavier Neves, Rodrigo; Darck Carola Correia Lima, Joanna; Galvão Figuerêdo, Raquel; Sérgio Martins de Alcântara, Paulo; Maximiano, Linda; Otoch, José; Batista, Miguel Luiz; Püschel, Gerhard; Seelaender, Marilia

    2015-01-01

    Cancer cachexia, of which the most notable symptom is severe and rapid weight loss, is present in the majority of patients with advanced cancer. Inflammatory mediators play an important role in the development of cachexia, envisaged as a chronic inflammatory syndrome. The white adipose tissue (WAT) is one of the first compartments affected in cancer cachexia and suffers a high rate of lipolysis. It secretes several cytokines capable of directly regulating intermediate metabolism. A common pathway in the regulation of the expression of pro-inflammatory cytokines in WAT is the activation of the nuclear transcription factor kappa-B (NF-κB). We have examined the gene expression of the subunits NF-κBp65 and NF-κBp50, as well as NF-κBp65 and NF-κBp50 binding, the gene expression of pro-inflammatory mediators under NF-κB control (IL-1β, IL-6, INF-γ, TNF-α, MCP-1), and its inhibitory protein, nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IκB-α). The observational study involved 35 patients (control group, n = 12 and cancer group, n = 23, further divided into cachectic and non-cachectic). NF-κBp65 and its target genes expression (TNF-α, IL-1β, MCP-1 and IκB-α) were significantly higher in cachectic cancer patients. Moreover, NF-κBp65 gene expression correlated positively with the expression of its target genes. The results strongly suggest that the NF-κB pathway plays a role in the promotion of WAT inflammation during cachexia. PMID:26053616

  9. Blood pressure (BP) assessment-from BP level to BP variability.

    PubMed

    Feber, Janusz; Litwin, Mieczyslaw

    2016-07-01

    The assessment of blood pressure (BP) can be challenging in children, especially in very young individuals, due to their variable body size and lack of cooperation. In the absence of data relating BP with cardiovascular outcomes in children, there is a need to convert absolute BP values (in mmHg) into age-, gender- and height appropriate BP percentiles or Z-scores in order to compare a patient's BP with the BP of healthy children of the same age, but also of children of different ages. Traditionally, the interpretation of BP has been based mainly on the assessment of the BP level obtained by office, home or 24-h BP monitoring. Recent studies suggest that it is not only BP level (i.e. average BP) but also BP variability that is clinically important for the development of target organ damage, including the progression of chronic kidney disease. In this review we describe current methods to evaluate of BP level, outline available methods for BP variability assessment and discuss the clinical consequences of BP variability, including its potential role in the management of hypertension. PMID:26201477

  10. Targeting Poly (ADP-Ribose) Polymerase and the c-Myb-TopBP1-ATR-Chk1 Signaling Pathway in Castration-Resistant Prostate Cancer

    PubMed Central

    Li, Likun; Chang, Wenjun; Yang, Guang; Ren, Chengzhen; Park, Sanghee; Karantanos, Theodoros; Karanika, Styliani; Wang, Jianxiang; Yin, Jianhua; Shah, Parantu K.; Takahiro, Hirayama; Dobashi, Masato; Zhang, Wenling; Efstathiou, Eleni; Maity, Sankar N.; Aparicio, Ana M.; Tapia, Elsa M Li Ning; Troncoso, Patricia; Broom, Bradley; Xiao, Lianchun; Lee, Hyun-Sung; Lee, Ju-Seog; Corn, Paul G.; Navone, Nora; Thompson, Timothy C.

    2014-01-01

    Androgen deprivation is the standard systemic treatment for advanced prostate cancer (PCa), but most patients ultimately develop castration-resistance. We show here that MYB is transcriptionally activated by androgen deprivation or impairment of androgen receptor (AR) signaling. MYB gene silencing significantly inhibited PCa growth in vitro and in vivo. Microarray data revealed that c-Myb shares a substantial subset of DNA damage response (DDR) target genes with AR, suggesting that c-Myb may replace AR for the dominant role in the regulation of their common DDR target genes in AR inhibition-resistant or AR-negative PCa. Gene signatures comprising AR, MYB, and their common DDR target genes are significantly correlated with metastasis, castration-resistance, recurrence, and shorter overall survival in PCa patients. We demonstrated in vitro that silencing of MYB, BRCA1 or TOPBP1 synergized with poly (ADP-ribose) polymerase (PARP) inhibitor olaparib (OLA) to increase cytotoxicity to PCa cells. We further demonstrated that targeting the c-Myb-TopBP1-ATR-Chk1 pathway by using the Chk1 inhibitor AZD7762 synergizes with OLA to increase PCa cytotoxicity. Our results reveal new mechanism-based therapeutic approaches for PCa by targeting PARP and the c-Myb-TopBP1-ATR-Chk1 pathway. PMID:24847116

  11. Dissection of the C-terminal region of E1A redefines the roles of CtBP and other cellular targets in oncogenic transformation.

    PubMed

    Cohen, M J; Yousef, A F; Massimi, P; Fonseca, G J; Todorovic, B; Pelka, P; Turnell, A S; Banks, L; Mymryk, J S

    2013-09-01

    Human adenovirus E1A makes extensive connections with the cellular protein interaction network. By doing so, E1A can manipulate many cellular programs, including cell cycle progression. Through these reprogramming events, E1A functions as a growth-promoting oncogene and has been used extensively to investigate mechanisms contributing to oncogenesis. Nevertheless, it remains unclear how the C-terminal region of E1A contributes to oncogenic transformation. Although this region is required for transformation in cooperation with E1B, it paradoxically suppresses transformation in cooperation with activated Ras. Previous analysis has suggested that the interaction of E1A with CtBP plays a pivotal role in both activities. However, some C-terminal mutants of E1A retain CtBP binding and yet exhibit defects in transformation, suggesting that other targets of this region are also necessary. To explore the roles of these additional factors, we performed an extensive mutational analysis of the C terminus of E1A. We identified key residues that are specifically required for binding all known targets of the C terminus of E1A. We further tested each mutant for the ability to both localize to the nucleus and transform primary rat cells in cooperation with E1B-55K or Ras. Interaction of E1A with importin α3/Qip1, dual-specificity tyrosine-regulated kinase 1A (DYRK1A), HAN11, and CtBP influenced transformation with E1B-55K. Interestingly, the interaction of E1A with DYRK1A and HAN11 appeared to play a role in suppression of transformation by activated Ras whereas interaction with CtBP was not necessary. This unexpected result suggests a need for revision of current models and provides new insight into transformation by the C terminus of E1A. PMID:23864635

  12. The structure of TAX1BP1 UBZ1+2 provides insight into target specificity and adaptability.

    PubMed

    Ceregido, M Angeles; Spínola Amilibia, Mercedes; Buts, Lieven; Rivera-Torres, José; Garcia-Pino, Abel; Bravo, Jerónimo; van Nuland, Nico A J

    2014-02-01

    TAX1BP1 is a novel ubiquitin-binding adaptor protein involved in the negative regulation of the NF-kappaB transcription factor, which is a key player in inflammatory responses, immunity and tumorigenesis. TAX1BP1 recruits A20 to the ubiquitinated signaling proteins TRAF6 and RIP1, leading to their A20-mediated deubiquitination and the disruption of IL-1-induced and TNF-induced NF-kappaB signaling, respectively. The two zinc fingers localized at its C-terminus function as novel ubiquitin-binding domains (UBZ, ubiquitin-binding zinc finger). Here we present for the first time both the solution and crystal structures of two classical UBZ domains in tandem within the human TAX1BP1. The relative orientation of the two domains is slightly different in the X-ray structure with respect to the NMR structure, indicating some degree of conformational flexibility, which is rationalized by NMR relaxation data. The observed degree of flexibility and stability between the two UBZ domains might have consequences on the recognition mechanism of interacting partners. PMID:24239949

  13. The likelihood of achieving quantified road safety targets: a binary logistic regression model for possible factors.

    PubMed

    Sze, N N; Wong, S C; Lee, C Y

    2014-12-01

    In past several decades, many countries have set quantified road safety targets to motivate transport authorities to develop systematic road safety strategies and measures and facilitate the achievement of continuous road safety improvement. Studies have been conducted to evaluate the association between the setting of quantified road safety targets and road fatality reduction, in both the short and long run, by comparing road fatalities before and after the implementation of a quantified road safety target. However, not much work has been done to evaluate whether the quantified road safety targets are actually achieved. In this study, we used a binary logistic regression model to examine the factors - including vehicle ownership, fatality rate, and national income, in addition to level of ambition and duration of target - that contribute to a target's success. We analyzed 55 quantified road safety targets set by 29 countries from 1981 to 2009, and the results indicate that targets that are in progress and with lower level of ambitions had a higher likelihood of eventually being achieved. Moreover, possible interaction effects on the association between level of ambition and the likelihood of success are also revealed. PMID:25255417

  14. Reversible Masking Using Low-Molecular-Weight Neutral Lipids to Achieve Optimal-Targeted Delivery

    PubMed Central

    Templeton, Nancy Smyth; Senzer, Neil

    2012-01-01

    Intravenous injection of therapeutics is required to effectively treat or cure metastatic cancer, certain cardiovascular diseases, and other acquired or inherited diseases. Using this route of delivery allows potential uptake in all disease targets that are accessed by the bloodstream. However, normal tissues and organs also have the potential for uptake of therapeutic agents. Therefore, investigators have used targeted delivery to attempt delivery solely to the target cells; however, use of ligands on the surface of delivery vehicles to target specific cell surface receptors is not sufficient to avoid nonspecific uptake. PEGylation has been used for decades to try to avoid nonspecific uptake but suffers from many problems known as “The PEGylation Dilemma.” We have solved this dilemma by replacing PEGylation with reversible masking using low-molecular-weight neutral lipids in order to achieve optimal-targeted delivery solely to target cells. Our paper will focus on this topic. PMID:22655199

  15. Targeted Genes Sequencing Identified a Novel 15 bp Deletion on GJA8 in a Chinese Family with Autosomal Dominant Congenital Cataracts

    PubMed Central

    Min, Han-Yi; Qiao, Peng-Peng; Asan; Yan, Zhi-Hui; Jiang, Hui-Feng; Zhu, Ya-Ping; Du, Hui-Qian; Li, Qin; Wang, Jia-Wei; Zhang, Jie; Sun, Jun; Yi, Xin; Yang, Ling

    2016-01-01

    Background: Congenital cataract (CC) is the leading cause of visual impairment or blindness in children worldwide. Because of highly genetic and clinical heterogeneity, a molecular diagnosis of the lens disease remains a challenge. Methods: In this study, we tested a three-generation Chinese family with autosomal dominant CCs by targeted sequencing of 45 CC genes on next generation sequencing and evaluated the pathogenicity of the detected mutation by protein structure, pedigree validation, and molecular dynamics (MD) simulation. Results: A novel 15 bp deletion on GJA8 (c.426_440delGCTGGAGGGGACCCT or p. 143_147delLEGTL) was detected in the family. The deletion, concerned with an in-frame deletion of 5 amino acid residues in a highly evolutionarily conserved region within the cytoplasmic loop domain of the gap junction channel protein connexin 50 (Cx50), was in full cosegregation with the cataract phenotypes in the family but not found in 1100 control exomes. MD simulation revealed that the introduction of the deletion destabilized the Cx50 gap junction channel, indicating the deletion as a dominant-negative mutation. Conclusions: The above results support the pathogenic role of the 15 bp deletion on GJA8 in the Chinese family and demonstrate targeted genes sequencing as a resolution to molecular diagnosis of CCs. PMID:26996484

  16. G3BP1, G3BP2 and CAPRIN1 Are Required for Translation of Interferon Stimulated mRNAs and Are Targeted by a Dengue Virus Non-coding RNA

    PubMed Central

    Bidet, Katell; Dadlani, Dhivya; Garcia-Blanco, Mariano A.

    2014-01-01

    Viral RNA-host protein interactions are critical for replication of flaviviruses, a genus of positive-strand RNA viruses comprising major vector-borne human pathogens including dengue viruses (DENV). We examined three conserved host RNA-binding proteins (RBPs) G3BP1, G3BP2 and CAPRIN1 in dengue virus (DENV-2) infection and found them to be novel regulators of the interferon (IFN) response against DENV-2. The three RBPs were required for the accumulation of the protein products of several interferon stimulated genes (ISGs), and for efficient translation of PKR and IFITM2 mRNAs. This identifies G3BP1, G3BP2 and CAPRIN1 as novel regulators of the antiviral state. Their antiviral activity was antagonized by the abundant DENV-2 non-coding subgenomic flaviviral RNA (sfRNA), which bound to G3BP1, G3BP2 and CAPRIN1, inhibited their activity and lead to profound inhibition of ISG mRNA translation. This work describes a new and unexpected level of regulation for interferon stimulated gene expression and presents the first mechanism of action for an sfRNA as a molecular sponge of anti-viral effectors in human cells. PMID:24992036

  17. Real-time imaging systems' combination of methods to achieve automatic target recognition

    NASA Astrophysics Data System (ADS)

    Maraviglia, Carlos G.; Williams, Elmer F.; Pezzulich, Alan Z.

    1998-03-01

    Using a combination of strategies real time imaging weapons systems are achieving their goals of detecting their intended targets. The demands of acquiring a target in a cluttered environment in a timely manner with a high degree of confidence demands compromise be made as to having a truly automatic system. A combination of techniques such as dedicated image processing hardware, real time operating systems, mixes of algorithmic methods, and multi-sensor detectors are a forbearance of the unleashed potential of future weapons system and their incorporation in truly autonomous target acquisition. Elements such as position information, sensor gain controls, way marks for mid course correction, and augmentation with different imaging spectrums as well as future capabilities such as neural net expert systems and decision processors over seeing a fusion matrix architecture may be considered tools for a weapon system's achievement of its ultimate goal. Currently, acquiring a target in a cluttered environment in a timely manner with a high degree of confidence demands compromises be made as to having a truly automatic system. It is now necessary to include a human in the track decision loop, a system feature that may be long lived. Automatic Track Recognition will still be the desired goal in future systems due to the variability of military missions and desirability of an expendable asset. Furthermore, with the increasing incorporation of multi-sensor information into the track decision the human element's real time contribution must be carefully engineered.

  18. Quantitative Guidance for Stove Usage and Performance to Achieve Health and Environmental Targets

    PubMed Central

    Chiang, Ranyee A.

    2015-01-01

    Background Displacing the use of polluting and inefficient cookstoves in developing countries is necessary to achieve the potential health and environmental benefits sought through clean cooking solutions. Yet little quantitative context has been provided on how much displacement of traditional technologies is needed to achieve targets for household air pollutant concentrations or fuel savings. Objectives This paper provides instructive guidance on the usage of cooking technologies required to achieve health and environmental improvements. Methods We evaluated different scenarios of displacement of traditional stoves with use of higher performing technologies. The air quality and fuel consumption impacts were estimated for these scenarios using a single-zone box model of indoor air quality and ratios of thermal efficiency. Results Stove performance and usage should be considered together, as lower performing stoves can result in similar or greater benefits than a higher performing stove if the lower performing stove has considerably higher displacement of the baseline stove. Based on the indoor air quality model, there are multiple performance–usage scenarios for achieving modest indoor air quality improvements. To meet World Health Organization guidance levels, however, three-stone fire and basic charcoal stove usage must be nearly eliminated to achieve the particulate matter target (< 1–3 hr/week), and substantially limited to meet the carbon monoxide guideline (< 7–9 hr/week). Conclusions Moderate health gains may be achieved with various performance–usage scenarios. The greatest benefits are estimated to be achieved by near-complete displacement of traditional stoves with clean technologies, emphasizing the need to shift in the long term to near exclusive use of clean fuels and stoves. The performance–usage scenarios are also provided as a tool to guide technology selection and prioritize behavior change opportunities to maximize impact. Citation

  19. Achieving CO2 reductions in Colombia: Effects of carbon taxes and abatement targets

    SciTech Connect

    Calderón, Silvia; Alvarez, Andres Camilo; Loboguerrero, Ana Maria; Arango, Santiago; Calvin, Katherine; Kober, Tom; Daenzer, Kathryn; Fisher-Vanden, Karen

    2015-06-03

    In this paper we investigate CO2 emission scenarios for Colombia and the effects of implementing carbon taxes and abatement targets on the energy system. By comparing baseline and policy scenario results from two integrated assessment partial equilibrium models TIAM-ECN and GCAM and two general equilibrium models Phoenix and MEG4C, we provide an indication of future developments and dynamics in the Colombian energy system. Currently, the carbon intensity of the energy system in Colombia is low compared to other countries in Latin America. However, this trend may change given the projected rapid growth of the economy and the potential increase in the use of carbon-based technologies. Climate policy in Colombia is under development and has yet to consider economic instruments such as taxes and abatement targets. This paper shows how taxes or abatement targets can achieve significant CO2 reductions in Colombia. Though abatement may be achieved through different pathways, taxes and targets promote the entry of cleaner energy sources into the market and reduce final energy demand through energy efficiency improvements and other demand-side responses. The electric power sector plays an important role in achieving CO2 emission reductions in Colombia, through the increase of hydropower, the introduction of wind technologies, and the deployment of biomass, coal and natural gas with CO2 capture and storage (CCS). Uncertainty over the prevailing mitigation pathway reinforces the importance of climate policy to guide sectors toward low-carbon technologies. This paper also assesses the economy-wide implications of mitigation policies such as potential losses in GDP and consumption. As a result, an assessment of the legal, institutional, social and environmental barriers to economy-wide mitigation policies is critical yet beyond the scope of this paper.

  20. Achieving CO2 reductions in Colombia: Effects of carbon taxes and abatement targets

    DOE PAGESBeta

    Calderón, Silvia; Alvarez, Andres Camilo; Loboguerrero, Ana Maria; Arango, Santiago; Calvin, Katherine; Kober, Tom; Daenzer, Kathryn; Fisher-Vanden, Karen

    2015-06-03

    In this paper we investigate CO2 emission scenarios for Colombia and the effects of implementing carbon taxes and abatement targets on the energy system. By comparing baseline and policy scenario results from two integrated assessment partial equilibrium models TIAM-ECN and GCAM and two general equilibrium models Phoenix and MEG4C, we provide an indication of future developments and dynamics in the Colombian energy system. Currently, the carbon intensity of the energy system in Colombia is low compared to other countries in Latin America. However, this trend may change given the projected rapid growth of the economy and the potential increase inmore » the use of carbon-based technologies. Climate policy in Colombia is under development and has yet to consider economic instruments such as taxes and abatement targets. This paper shows how taxes or abatement targets can achieve significant CO2 reductions in Colombia. Though abatement may be achieved through different pathways, taxes and targets promote the entry of cleaner energy sources into the market and reduce final energy demand through energy efficiency improvements and other demand-side responses. The electric power sector plays an important role in achieving CO2 emission reductions in Colombia, through the increase of hydropower, the introduction of wind technologies, and the deployment of biomass, coal and natural gas with CO2 capture and storage (CCS). Uncertainty over the prevailing mitigation pathway reinforces the importance of climate policy to guide sectors toward low-carbon technologies. This paper also assesses the economy-wide implications of mitigation policies such as potential losses in GDP and consumption. As a result, an assessment of the legal, institutional, social and environmental barriers to economy-wide mitigation policies is critical yet beyond the scope of this paper.« less

  1. Achieving targeted and quantifiable alteration of mRNA splicing with Morpholino oligos

    SciTech Connect

    Morcos, Paul A. . E-mail: pmorcos@gene-tools.com

    2007-06-29

    This work represents the first guide for using steric-block antisense oligos as tools for effective and targeted modification of RNA splicing. Comparison of several steric-block oligo types shows the properties of Morpholinos provide significant advantages over other potential splice-blocking oligos. The procedures and complications of designing effective splice-blocking Morpholino oligos are described. The design process requires complete pre-mRNA sequence for defining suitable targets, which usually generate specific predictable messengers. To validate the targeting procedure, the level and nature of transcript alteration is characterized by RT-PCR analysis of splice modification in a {beta}-globin splice model system. An oligo-walking study reveals that while U1 and U2 small nuclear RiboNucleoProtein (snRNP) binding sites are the most effective targets for blocking splicing, inclusion of these sites is not required to achieve effective splice modifications. The most effective targeting strategy employs simultaneously blocking snRNP binding sites and splice-junctions. The work presented here continues to be the basis for most of the successful Morpholino oligos designed for the worldwide research community to block RNA splicing.

  2. Achieving Target Pressures with Combined Surgery: Primary Patchless Ahmed Valve Combined with Phacoemulsification vs Primary Phacotrabeculectomy

    PubMed Central

    Sánchez-Noguera, Carmen C; Cárdenas-Gómez, Lorena; Castañeda-Diez, Rafael; Thomas, Ravi; Gil-Carrasco, Félix

    2015-01-01

    ABSTRACT Purpose: To evaluate the ability of phacoemulsification combined with either primary trabeculectomy (PT) or primary Ahmed glaucoma valve implantation (PAVI) to achieve target intraocular pressures (TIOP) in adults with primary open angle glaucoma. Materials and methods: Chart review of 214 adult patients operated between January 2002 and June 2008 with a minimum follow-up of 6 months. Group 1 comprised 181 eyes of 166 patients undergoing PT while group 2 included 50 eyes of 49 patients in combination with primary AVI. Target lOPs were pre-determined for each patient and success was defined as an IOP at or lower than target with or without medications. An IOP above target, loss of light perception or need for additional procedures to lower IOP were considered a failure. Results: Mean preoperative IOP was 17.2 mm Hg in group 1 and 17.3 in group 2. Mean postoperative IOPs were 10.2 and 9.2 on day 1, 12.2 and 11.6 at year 1, and 10.7 in both groups at year 5. Survival rates in groups 1 and 2 were 96.7 vs 96% at 6 months, 89 vs 96% at 12 months, 83.5 vs 96% at 24 months and 79.4 vs 89.1% at 36, 48 and 72 months. Transient bleb leaks were more frequent in group 1 (26 eyes, 14.4 vs 0%, p = 0.001) and transient choroidal detachments were more frequent in group 2 (7 eyes, 3.9 vs 6 eyes, 12%, p = 0.038). Conclusion: Midterm results for achieving target pressures using combined phacoemulsification with either PT or PAVI are comparable. The profile of complications is different for the two procedures. How to cite this article: Albis-Donado O, Sánchez-Noguera CC, Cárdenas-Gómez L, Castañeda-Diez R, Thomas R, Gil-Carrasco F. Achieving Target Pressures with Combined Surgery: Primary Patchless Ahmed Valve Combined with Phacoemulsification vs Primary Phacotrabeculectomy. J Curr Glaucoma Pract 2015;9(1):6-11. PMID:26997825

  3. Proteomic identification of potential target proteins regulated by the SCF(F) (bp1) -mediated proteolysis pathway in Fusarium oxysporum.

    PubMed

    Miguel-Rojas, Cristina; Hera, Concepcion

    2013-12-01

    F-box proteins function in the recruitment of proteins for SCF ubiquitination and proteasome degradation. Here, we studied the role of Fbp1, a nonessential F-box protein of the tomato pathogen Fusarium oxysporum f. sp. lycopersici. The Δfbp1 mutant showed a significant delay in the production of wilt symptoms on tomato plants and was impaired in invasive growth on cellophane membranes and on living plant tissue. To search for target proteins recruited by Fbp1, a combination of sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and matrix-assisted laser desorption/ionization time-of-flight/time-of-flight (MALDI-TOF/TOF) was used to compare proteins in mycelia of the wild-type and Δfbp1 mutant. The proteomic approach identified 41 proteins differing significantly in abundance between the two strains, 17 of which were more abundant in the Δfbp1 mutant, suggesting a possible regulation by proteasome degradation. Interestingly, several of the identified proteins were related to vesicle trafficking. Microscopic analysis revealed an impairment of the Δfbp1 strain in directional growth and in the structure of the Spitzenkörper, suggesting a role of Fbp1 in hyphal orientation. Our results indicate that Fbp1 regulates protein turnover and pathogenicity in F. oxysporum. PMID:23855991

  4. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    PubMed Central

    Thyssen, Gregory N.; Fang, David D.; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D.; Condon, Tracy L.; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  5. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene.

    PubMed

    Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  6. IKKβ/NFκBp65 activated by interleukin-13 targets the autophagy-related genes LC3B and beclin 1 in fibroblasts co-cultured with breast cancer cells

    PubMed Central

    LI, WEN-LIN; XIONG, LI-XIA; SHI, XIAO-YU; XIAO, LIANG; QI, GUAN-YUN; MENG, CHUANG

    2016-01-01

    Interleukin-13 (IL-13), a Th2 cytokine, plays an important role in fibrosis, inflammation, tissue hyperresponsiveness and tumor development. Although studies have demonstrated that IL-13 exerts its roles through signal transducer and activator of transcription 6 (STAT6) signaling pathway, recent studies have revealed that I kappa B kinase (IKK)/nuclear factor kappa B (NFκB) pathway may also be involved in. The aim of this study was to investigate whether IL-13 delivers signals to IKKβ/NFκBp65 and whether autophagy genes are IL-13-induced the activation of NFκBp65 transcriptional targets in fibroblasts of breast tumor stroma. We examined the phosphorylation of IKKβ, the activation of NFκBp65 and NFκBp65-targeted autophagy genes in fibroblasts co-cultured with breast cancer cells under the condition of IL-13 stimulation. Results of this study showed that IL-13 induced IKKβ phosphorylation in the fibroblast line ESF co-cultured with breast cancer cell line BT474, and subsequently NFκBp65 was activated and aimed at beclin 1 and microtubule-associated protein 1 light chain 3 B (MAP1LC3B or LC3B) in these ESF cells. BMS345541, an inhibitor of IKK/NFκB pathway, significantly inhibited the IL-13-induced the activation of NFκB and also inhibited NFκB-targeted beclin 1 and LC3B expression. Our results suggest that IL-13 regulates beclin 1 and LC3B expression through IKKβ/NFκBp65 in fibroblasts co-cultured with breast cancer cells, and IL-13 plays role in activating IKKβ/NFκBp65. PMID:27073433

  7. Envelope-chimeric Entry-targeted Measles Virus Escapes Neutralization and Achieves Oncolysis

    PubMed Central

    Miest, Tanner S; Yaiw, Koon-Chu; Frenzke, Marie; Lampe, Johanna; Hudacek, Andrew W; Springfeld, Christoph; von Messling, Veronika; Ungerechts, Guy; Cattaneo, Roberto

    2011-01-01

    Measles virus (MV) is a promising vector for cancer therapy and multivalent vaccination, but high prevalence of pre-existing neutralizing antibodies may reduce therapeutic efficacy, particularly following systemic administration. MV has only one serotype, but here we show that its envelope glycoproteins can be exchanged with those of the closely related canine distemper virus (CDV), generating a chimeric virus capable of escaping neutralization. To target its entry, we displayed on the CDV attachment protein a single-chain antibody specific for a designated receptor. To enhance oncolytic efficacy we armed the virus with a prodrug convertase gene capable of locally activating chemotherapeutic prodrugs. The new virus achieved high titers, was genetically stable, and was resistant to neutralization by sera from both MV-immunized mice and MV-immune humans. The new virus targeted syngeneic murine tumor cells expressing the designated receptor implanted in immunocompetent mice, and synergized with a chemotherapeutic prodrug in a model of oncolysis. Importantly, the chimeric MV remained oncolytic when administered systemically even in the presence of anti-MV antibodies capable of abrogating the therapeutic efficacy of the parental, nonshielded MV. This work shows that targeting, arming, and shielding can be combined to generate a tumor-specific, neutralization-resistant virus that can synergize with chemotherapeutics. PMID:21610701

  8. Risk factors that affect reproductive target achievement in fertile dairy cows.

    PubMed

    Aungier, S P M; Roche, J F; Diskin, M G; Crowe, M A

    2014-01-01

    The aims of the present study were to investigate (1) the risk factors that influence the achievement of reproductive targets postpartum (pp) and (2) the key factors that influence pregnancy rate following first artificial insemination (AI) in dairy cows. Ninety-eight Holstein-Friesian pp cows were blood sampled from wk 1 to 4 pp for hematology and biochemistry. Reproductive tract health was assessed weekly by ultrasonography and vaginal mucus scoring. Body condition score (BCS), lameness score, and milk yield were assessed every 2 wk. Milk samples for progesterone assay were collected twice weekly and on d 4, 5, and 7 after AI. Risk factors associated with achieving reproductive targets depended on (1) increased metabolic activity of the liver (increased glutamate dehydrogenase at calving and increased γ-glutamyl transpeptidase in wk 4), (2) a competent immune system (increased neutrophils in wk 1; decreased α1-acid glycoprotein in wk 1, 2, and 3), (3) an endocrine system that was capable of responding by producing sufficient triiodothyronine in wk 2 and increased insulin-like growth factor I in wk 3 and 4, (4) a lower negative energy balance status (decreased nonesterified fatty acid concentration in wk 1; decreased β-hydroxybutyrate concentration in wk 2; BCS loss between calving and d 28 pp <0.5), (5) good reproductive tract health [normal uterine scan at d 45 pp; clear vaginal mucus discharge at first ovulation and at d 45 pp; resumed ovarian cyclicity by the end of the voluntary waiting period (≥ d 35 pp)], and (6) adequate diet (to ensure increased glutathione peroxidase in wk 2 and 3 and increased magnesium in wk 4). Risk factors that increased the odds of a successful first AI were previous ovulation(s) (odds ratio=3.17 per ovulation), BCS >2.5 at AI (odds ratio=3.01), and clear vaginal mucus (score=0) compared with purulent mucus (score >0) 4 d after first AI (odds ratio=2.99). In conclusion, this study identified key risk factors in the early pp

  9. HDAC4 as a potential therapeutic target in neurodegenerative diseases: a summary of recent achievements

    PubMed Central

    Mielcarek, Michal; Zielonka, Daniel; Carnemolla, Alisia; Marcinkowski, Jerzy T.; Guidez, Fabien

    2015-01-01

    For the past decade protein acetylation has been shown to be a crucial post-transcriptional modification involved in the regulation of protein functions. Histone acetyltransferases (HATs) mediate acetylation of histones which results in the nucleosomal relaxation associated with gene expression. The reverse reaction, histone deacetylation, is mediated by histone deacetylases (HDACs) leading to chromatin condensation followed by transcriptional repression. HDACs are divided into distinct classes: I, IIa, IIb, III, and IV, on the basis of size and sequence homology, as well as formation of distinct repressor complexes. Implications of HDACs in many diseases, such as cancer, heart failure, and neurodegeneration, have identified these molecules as unique and attractive therapeutic targets. The emergence of HDAC4 among the members of class IIa family as a major player in synaptic plasticity raises important questions about its functions in the brain. The characterization of HDAC4 specific substrates and molecular partners in the brain will not only provide a better understanding of HDAC4 biological functions but also might help to develop new therapeutic strategies to target numerous malignancies. In this review we highlight and summarize recent achievements in understanding the biological role of HDAC4 in neurodegenerative processes. PMID:25759639

  10. Targeting zinc finger domains with small molecules: solution structure and binding studies of the RanBP2-type zinc finger of RBM5

    PubMed Central

    Farina, Biancamaria; Fattorusso, Roberto

    2012-01-01

    The RNA Binding Motif protein 5 (RBM5), also known as Luca15 or H37, is a component of prespliceosomal complexes, that regulates the alternative splicing of several mRNAs, such as Fas and caspase-2. The rbm5 gene is located at the 2p21.3 chromosomal region, which is strongly associated with lung cancer and many other cancers. Both increased and decreased levels of RBM5 can play a role in tumor progression. In particular, down-regulation of rbm5 is involved in lung cancer and other cancers upon Ras activation, and, also, represents a molecular signature associated with metastasis in various solid tumors. On the other hand, up-regulation of rbm5 occurs in breast and ovarian cancer. Moreover, RBM5 was also found to be involved in the early stage of the HIV-1 viral cycle, representing a potential target for the treatment of the HIV-1 infection. While the molecular basis for RNA recognition and ubiquitin interaction have been structurally characterized, small molecules binding this ZF domain that may contribute to characterize their activity and to develop potential therapeutic agents have not been yet reported. Via an NMR screening of a fragment library we identified several binders and the complex of the most promising one, named compound 1, with the RBM5 ZF1 was structurally characterized in solution. Interestingly, the binding mechanism reveals that compound 1 occupies the RNA binding pocket and is therefore able to compete with the RNA to bind RBM5 RanBP2-type ZF domain, as indicated by NMR studies. PMID:22162216

  11. Achieving cholesterol targets by individualizing starting doses of statin according to baseline low-density lipoprotein cholesterol and coronary artery disease risk category: The CANadians Achieve Cholesterol Targets Fast with Atorvastatin Stratified Titration (CanACTFAST) study

    PubMed Central

    Ur, Ehud; Langer, Anatoly; Rabkin, Simon W; Calciu, Cristina-Dana; Leiter, Lawrence A

    2010-01-01

    BACKGROUND: Despite an increasing body of evidence on the benefit of lowering elevated levels of low-density lipoprotein cholesterol (LDL-C), there is still considerable concern that patients are not achieving target LDL-C levels. OBJECTIVE: The CANadians Achieve Cholesterol Targets Fast with Atorvastatin Stratified Titration (CanACTFAST) trial tested whether an algorithm-based statin dosing approach would enable patients to achieve LDL-C and total cholesterol/high-density lipoprotein cholesterol (TC/HDL-C) ratio targets quickly. METHODS: Subjects requiring statin therapy, but with an LDL-C level of 5.7 mmol/L or lower, and triglycerides of 6.8 mmol/L or lower at screening participated in the 12-week study, which had two open-label, six-week phases: a treatment period during which patients received 10 mg, 20 mg, 40 mg or 80 mg of atorvastatin based on an algorithm incorporating baseline LDL-C value and cardiovascular risk; and patients who achieved both LDL-C and TC/HDL-C ratio targets at six weeks continued on the same atorvastatin dose. Patients who did not achieve both targets received dose uptitration using a single-step titration regimen. The primary efficacy outcome was the proportion of patients achieving target LDL-C levels after 12 weeks. RESULTS: Of 2016 subjects screened at 88 Canadian sites, 1258 were assigned to a study drug (1101 were statin-free and 157 were statin-treated at baseline). The proportion of subjects who achieved LDL-C targets after 12 weeks of treatment was 86% (95% CI 84% to 88%) for statin-free patients and 54% (95% CI 46% to 61%) for statin-treated patients. Overall, 1003 subjects (80%; 95% CI 78% to 82%) achieved both lipid targets. CONCLUSIONS: Algorithm-based statin dosing enables patients to achieve LDL-C and TC/HDL-C ratio targets quickly, with either no titration or a single titration. PMID:20151053

  12. Determination of contrast media administration to achieve a targeted contrast enhancement in CT

    NASA Astrophysics Data System (ADS)

    Sahbaee, Pooyan; Li, Yuan; Segars, Paul; Marin, Daniele; Nelson, Rendon; Samei, Ehsan

    2015-03-01

    Contrast enhancement is a key component of CT imaging and offer opportunities for optimization. The design and optimization of new techniques however requires orchestration with the scan parameters and further a methodology to relate contrast enhancement and injection function. In this study, we used such a methodology to develop a method, analytical inverse method, to predict the required injection function to achieve a desired contrast enhancement in a given organ by incorporation of a physiologically based compartmental model. The method was evaluated across 32 different target contrast enhancement functions for aorta, kidney, stomach, small intestine, and liver. The results exhibited that the analytical inverse method offers accurate performance with error in the range of 10% deviation between the predicted and desired organ enhancement curves. However, this method is incapable of predicting the injection function based on the liver enhancement. The findings of this study can be useful in optimizing contrast medium injection function as well as the scan timing to provide more consistency in the way that the contrast enhanced CT examinations are performed. To our knowledge, this work is one of the first attempts to predict the contrast material injection function for a desired organ enhancement curve.

  13. GADIS: Algorithm for designing sequences to achieve target secondary structure profiles of intrinsically disordered proteins.

    PubMed

    Harmon, Tyler S; Crabtree, Michael D; Shammas, Sarah L; Posey, Ammon E; Clarke, Jane; Pappu, Rohit V

    2016-09-01

    Many intrinsically disordered proteins (IDPs) participate in coupled folding and binding reactions and form alpha helical structures in their bound complexes. Alanine, glycine, or proline scanning mutagenesis approaches are often used to dissect the contributions of intrinsic helicities to coupled folding and binding. These experiments can yield confounding results because the mutagenesis strategy changes the amino acid compositions of IDPs. Therefore, an important next step in mutagenesis-based approaches to mechanistic studies of coupled folding and binding is the design of sequences that satisfy three major constraints. These are (i) achieving a target intrinsic alpha helicity profile; (ii) fixing the positions of residues corresponding to the binding interface; and (iii) maintaining the native amino acid composition. Here, we report the development of a G: enetic A: lgorithm for D: esign of I: ntrinsic secondary S: tructure (GADIS) for designing sequences that satisfy the specified constraints. We describe the algorithm and present results to demonstrate the applicability of GADIS by designing sequence variants of the intrinsically disordered PUMA system that undergoes coupled folding and binding to Mcl-1. Our sequence designs span a range of intrinsic helicity profiles. The predicted variations in sequence-encoded mean helicities are tested against experimental measurements. PMID:27503953

  14. On achieving the state's household recycling target: A case study of Northern New Jersey, USA

    SciTech Connect

    Otegbeye, M.; Abdel-Malek, L.; Hsieh, H.N.; Meegoda, J.N.

    2009-02-15

    In recent times, the State of New Jersey (USA) has been making attempts at promoting recycling as an environmentally friendly means of attaining self-sufficiency at waste disposal, and the state has put in place a 50% recycling target for its municipal solid waste stream. While the environmental benefits of recycling are obvious, a recycling program must be cost effective to ensure its long-term sustainability. In this paper, a linear programming model is developed to examine the current state of recycling in selected counties in Northern New Jersey and assess the needs to achieve the state's recycling goal in these areas. The optimum quantities of waste to be sent to the different waste facilities, which include landfills, incinerators, transfer stations, recycling and composting plants, are determined by the model. The study shows that for these counties, the gap between the current waste practices where the recycling rate stands at 32% and the state's goal can be bridged by more efficient utilization of existing facilities and reasonable investment in expanding those for recycling activities.

  15. Lentiviral Vpx Accessory Factor Targets VprBP/DCAF1 Substrate Adaptor for Cullin 4 E3 Ubiquitin Ligase to Enable Macrophage Infection

    PubMed Central

    Srivastava, Smita; Swanson, Selene K.; Manel, Nicolas; Florens, Laurence; Washburn, Michael P.; Skowronski, Jacek

    2008-01-01

    Vpx is a small virion-associated adaptor protein encoded by viruses of the HIV-2/SIVsm lineage of primate lentiviruses that enables these viruses to transduce monocyte-derived cells. This probably reflects the ability of Vpx to overcome an as yet uncharacterized block to an early event in the virus life cycle in these cells, but the underlying mechanism has remained elusive. Using biochemical and proteomic approaches, we have found that Vpx protein of the pathogenic SIVmac 239 strain associates with a ternary protein complex comprising DDB1 and VprBP subunits of Cullin 4–based E3 ubiquitin ligase, and DDA1, which has been implicated in the regulation of E3 catalytic activity, and that Vpx participates in the Cullin 4 E3 complex comprising VprBP. We further demonstrate that the ability of SIVmac as well as HIV-2 Vpx to interact with VprBP and its associated Cullin 4 complex is required for efficient reverse transcription of SIVmac RNA genome in primary macrophages. Strikingly, macrophages in which VprBP levels are depleted by RNA interference resist SIVmac infection. Thus, our observations reveal that Vpx interacts with both catalytic and regulatory components of the ubiquitin proteasome system and demonstrate that these interactions are critical for Vpx ability to enable efficient SIVmac replication in primary macrophages. Furthermore, they identify VprBP/DCAF1 substrate receptor for Cullin 4 E3 ubiquitin ligase and its associated protein complex as immediate downstream effector of Vpx for this function. Together, our findings suggest a model in which Vpx usurps VprBP-associated Cullin 4 ubiquitin ligase to enable efficient reverse transcription and thereby overcome a block to lentivirus replication in monocyte-derived cells, and thus provide novel insights into the underlying molecular mechanism. PMID:18464893

  16. Prenatal Transmission of Syphilis and Human Immunodeficiency Virus in Brazil: Achieving Regional Targets for Elimination

    PubMed Central

    Cerda, Rodrigo; Perez, Freddy; Domingues, Rosa Maria S.M.; Luz, Paula M.; Grinsztejn, Beatriz; Veloso, Valdilea G.; Caffe, Sonja; Francke, Jordan A.; Freedberg, Kenneth A.; Ciaranello, Andrea L.

    2015-01-01

    Background. The Pan-American Health Organization has called for reducing (1) human immunodeficiency virus (HIV) mother-to-child transmission (MTCT) to ≤0.30 infections/1000 live births (LB), (2) HIV MTCT risk to ≤2.0%, and (3) congenital syphilis (CS) incidence to ≤0.50/1000 LB in the Americas by 2015. Methods. Using published Brazilian data in a mathematical model, we simulated a cohort of pregnant women from antenatal care (ANC) through birth. We investigated 2 scenarios: “current access” (89.1% receive one ANC syphilis test and 41.1% receive 2; 81.7% receive one ANC HIV test and 18.9% receive birth testing; if diagnosed, 81.0% are treated for syphilis and 87.5% are treated for HIV) and “ideal access” (95% of women undergo 2 HIV and syphilis screenings; 95% receive appropriate treatment). We conducted univariate and multivariate sensitivity analyses on key inputs. Results. With current access, we projected 2.95 CS cases/1000 LB, 0.29 HIV infections/1000 LB, 7.1% HIV MTCT risk, and 11.11 intrauterine fetal demises (IUFD)/1000 pregnancies, with significant regional variation. With ideal access, we projected improved outcomes: 1.00 CS cases/1000 LB, 0.10 HIV infections/1000 LB, HIV MTCT risk of 2.4%, and 10.65 IUFD/1000 pregnancies. Increased testing drove the greatest improvements. Even with ideal access, only HIV infections/1000 LB met elimination goals. Achieving all targets required testing and treatment >95% and reductions in prevalence and incidence of HIV and syphilis. Conclusions. Increasing access to care and HIV and syphilis antenatal testing will substantially reduce HIV and syphilis MTCT in Brazil. In addition, regionally tailored interventions reducing syphilis incidence and prevalence and supporting HIV treatment adherence are necessary to completely meet elimination goals. PMID:26180825

  17. Prenatal Transmission of Syphilis and Human Immunodeficiency Virus in Brazil: Achieving Regional Targets for Elimination.

    PubMed

    Cerda, Rodrigo; Perez, Freddy; Domingues, Rosa Maria S M; Luz, Paula M; Grinsztejn, Beatriz; Veloso, Valdilea G; Caffe, Sonja; Francke, Jordan A; Freedberg, Kenneth A; Ciaranello, Andrea L

    2015-04-01

    Background.  The Pan-American Health Organization has called for reducing (1) human immunodeficiency virus (HIV) mother-to-child transmission (MTCT) to ≤0.30 infections/1000 live births (LB), (2) HIV MTCT risk to ≤2.0%, and (3) congenital syphilis (CS) incidence to ≤0.50/1000 LB in the Americas by 2015. Methods.  Using published Brazilian data in a mathematical model, we simulated a cohort of pregnant women from antenatal care (ANC) through birth. We investigated 2 scenarios: "current access" (89.1% receive one ANC syphilis test and 41.1% receive 2; 81.7% receive one ANC HIV test and 18.9% receive birth testing; if diagnosed, 81.0% are treated for syphilis and 87.5% are treated for HIV) and "ideal access" (95% of women undergo 2 HIV and syphilis screenings; 95% receive appropriate treatment). We conducted univariate and multivariate sensitivity analyses on key inputs. Results.  With current access, we projected 2.95 CS cases/1000 LB, 0.29 HIV infections/1000 LB, 7.1% HIV MTCT risk, and 11.11 intrauterine fetal demises (IUFD)/1000 pregnancies, with significant regional variation. With ideal access, we projected improved outcomes: 1.00 CS cases/1000 LB, 0.10 HIV infections/1000 LB, HIV MTCT risk of 2.4%, and 10.65 IUFD/1000 pregnancies. Increased testing drove the greatest improvements. Even with ideal access, only HIV infections/1000 LB met elimination goals. Achieving all targets required testing and treatment >95% and reductions in prevalence and incidence of HIV and syphilis. Conclusions.  Increasing access to care and HIV and syphilis antenatal testing will substantially reduce HIV and syphilis MTCT in Brazil. In addition, regionally tailored interventions reducing syphilis incidence and prevalence and supporting HIV treatment adherence are necessary to completely meet elimination goals. PMID:26180825

  18. Optimal achieved blood pressure in acute intracerebral hemorrhage

    PubMed Central

    Arima, Hisatomi; Heeley, Emma; Delcourt, Candice; Hirakawa, Yoichiro; Wang, Xia; Woodward, Mark; Robinson, Thompson; Stapf, Christian; Parsons, Mark; Lavados, Pablo M.; Huang, Yining; Wang, Jiguang; Chalmers, John

    2015-01-01

    Objectives: To investigate the effects of intensive blood pressure (BP) lowering according to baseline BP levels and optimal achieved BP levels in patients with acute intracerebral hemorrhage (ICH). Methods: INTERACT2 was an open, blinded endpoint, randomized controlled trial in 2,839 patients with ICH within 6 hours of onset and elevated systolic BP (SBP) (150–220 mm Hg) who were allocated to receive intensive (target SBP <140 mm Hg within 1 hour, with lower limit of 130 mm Hg for treatment cessation) or guideline-recommended (target SBP <180 mm Hg) BP-lowering treatment. Outcome was physical function across all 7 levels of the modified Rankin Scale at 90 days. Results: Analysis of the randomized comparisons showed that intensive BP lowering produced comparable benefits on physical function at 90 days in 5 subgroups defined by baseline SBP of <160, 160–169, 170–179, 180–189, and ≥190 mm Hg (p homogeneity = 0.790). Analyses of achieved BP showed linear increases in the risk of physical dysfunction for achieved SBP above 130 mm Hg for both hyperacute (1–24 hours) and acute (2–7 days) phases while modest increases were also observed for achieved SBP below 130 mm Hg. Conclusions: Intensive BP lowering appears beneficial across a wide range of baseline SBP levels, and target SBP level of 130–139 mm Hg is likely to provide maximum benefit in acute ICH. Classification of evidence: This study provides Class I evidence that the effect of intensive BP lowering on physical function is not influenced by baseline BP. PMID:25552575

  19. Epidemiological impact of achieving UNAIDS 90-90-90 targets for HIV care in India: a modelling study

    PubMed Central

    Maddali, Manoj V; Gupta, Amita; Shah, Maunank

    2016-01-01

    Objective Recent UNAIDS ‘90-90-90’ targets propose that to end the HIV epidemic by 2030, 90% of persons living with HIV (PLWH) worldwide should know their diagnosis, 90% of diagnosed PLWH should be on antiretroviral therapy (ART) and 90% of PLWH on ART should be virally suppressed by 2020. We sought to quantify the epidemiological impact of achieving these targets in India. Methods We constructed a dynamic-transmission model of the Indian HIV epidemic to project HIV infections and AIDS-related deaths that would occur in India over 15 years. We considered several scenarios: continuation of current care engagement (with early ART initiation), achieving 90-90-90 targets on time and delaying achievement by 5 or 10 years. Results In the base case, assuming continuation of current care engagement, we project 794 000 (95% uncertainty range (UR) 571 000–1 104 000) HIV infections and 689 000 (95% UR 468 000–976 000) AIDS-related deaths in India over 15 years. In this scenario, nearly half of PLWH diagnosed would fail to achieve viral suppression by 2030. With achievement of 90-90-90 targets, India could avert 392 000 (95% UR 248 000–559 000) transmissions (48% reduction) and 414 000 (95% UR 260 000–598 000) AIDS-related deaths (59% reduction) compared to the base-case scenario. Furthermore, fewer than 20 000 (95% UR 12 000–30 000) HIV infections would occur in 2030. Delaying achievement of targets resulted in a similar reduction in HIV incidence by 2030 but at the cost of excess overall infections and mortality. Conclusions India can halve the epidemiological burden of HIV over 15 years with achievement of the UNAIDS 90-90-90 targets. Reaching the targets on time will require comprehensive healthcare strengthening, especially in early diagnosis and treatment, expanded access to second-line and third-line ART and long-term retention in care. PMID:27388363

  20. Communicating Non-Targeted Effects of Ionizing Radiation to Achieve Adaptive Homeostasis in Tissues

    SciTech Connect

    Morgan, William F.

    2011-06-04

    Non-targeted effects, i.e., those responses in cells or tissues that were not subject to energy deposition events after localized exposure to ionizing radiaton, are well-established. While they are not universal phenotype, when they do occur they can be associated with subsequent tissue or whole body responses. Here it is argued that non-targeted effects are a tissue level response to restore equilibrium within an organ system, and thus restores tissue homeostasis. This "adaptive homeostasis" has evolved in response to a variety of environmental and other such stresses an individual is exposed to in their lifetime. These non-targeted effects are not likely to impact significantly on estimates of potential risks associated with radiation exposure because they are presumably "built into" current risk estimates. However, they could have implications for radiation carcinogenesis, by driving processes in targeted and non-targeted cells that could eliminate transformed cells or transform cells from a normal phenotype to a phenotype associated with malignancy within a tissue.

  1. Determinants for Achieving the LDL-C Target of Lipid Control for Secondary Prevention of Cardiovascular Events in Taiwan

    PubMed Central

    Ho, Li-Ting; Yin, Wei-Hsian; Chuang, Shao-Yuan; Tseng, Wei-Kung; Wu, Yen-Wen; Hsieh, I-Chang; Lin, Tsung-Hsien; Li, Yi-Heng; Huang, Lien-Chi; Wang, Kuo-Yang; Ueng, Kwo-Chang; Fang, Ching-Chang; Pan, Wen-Harn; Yeh, Hung-I; Wu, Chau-Chung; Chen, Jaw-Wen

    2015-01-01

    Background Epidemiological and clinical studies have clearly established the link between low-density lipoprotein cholesterol (LDL-C) and atherosclerosis-related cardiovascular consequences. Although it has been a common practice for physicians to prescribe lipid-lowering therapy for patients with dyslipidemia, the achievement rate is still not satisfied in Taiwan. Therefore, the determinants for achieving the LDL-C target needed to be clarified for better healthcare of the patients with dyslipidemia. Method This registry-type prospective observational study enrolled the patients with cardiovascular diseases (coronary artery disease (CAD) and cerebrovascular disease (CVD)) from 18 medical centers across Taiwan, and clinically followed them for five years. At every clinical visit, vital signs, clinical endpoints, adverse events, concurrent medications and laboratory specimens were obtained as thoroughly as possible. The lipid profile (total cholesterol, high-density lipoprotein cholesterol, LDL-C, triglyceride), liver enzymes, and creatinine phosphokinase were evaluated at baseline, and every year thereafter. The cross sectional observational data was analyzed for this report. Result Among the 3,486 registered patients, 54% had their LDL-C < 100 mg/dL. By univariate analysis, the patients achieving the LDL-C target were associated with older age, more male sex, taller height, lower blood pressure, more under lipid-lowering therapy, more smoking cessation, more history of CAD, DM, physical activity, but less history of CVD. The multivariate analysis showed statin therapy was the most significant independent determinant for achieving the treatment target, followed by age, history of CAD, diabetes, blood pressure, and sex. However, most patients were on regimens of very-low to low equipotent doses of statins. Conclusion Although the lipid treatment guideline adherence is improving in recent years, only 54% of the patients with cardiovascular diseases have achieved

  2. [Update of planning tables of cholesterol-lowering therapy orientated to achieve LDL therapeutic targets].

    PubMed

    Masana, Luis; Plana, Núria

    2015-01-01

    This is the third update of a planning-table for use in cholesterol-lowering therapy, so as to obtain LDLc objectives. This is an easy to use laptop tool to help choose the best statin or combination therapy (statin plus ezetimibe) depending on the current LDL concentration of the patient, and the LDLc objective to achieve. It is based on a colour code that indicates the drugs that are efficient enough to help patients to achieve their LDL goal. Along with the table, recommendations are given for the best strategy in order to implement the optimal therapy in a maximum of two clinical encounters. PMID:25865752

  3. Narrowing the Field: Achieve Engagement Outcomes Faster by Targeting Potential Alumni Leaders

    ERIC Educational Resources Information Center

    Coolman, Jason

    2013-01-01

    Traditional alumni relations programs are about prompting graduates to do something--anything--for or with the institution. In this article, the author proposes something different: an outcome-oriented alumni relations programming model, which the author calls "strategic advancement," that focuses on smaller, targeted sets of graduates…

  4. Nutritionists in industry can play a key role in helping to achieve Health of the Nation targets for nutrition.

    PubMed

    Kirk, T R; de Looy, A; Fletcher, R; Ruxton, C H

    2007-06-01

    Nutritionists working in food manufacturing and retailing are potentially in a more powerful position than any other professional group to contribute towards achieving the national targets for nutrition and the reduction of nutrition-related diseases, set out in The Health of the Nation (DoH, 1992) and in Scotland's Health, A Challenge to Us All (Scottish Office, 1993). The present paper sets out the details of this argument. First, a review is given of the functions and types of activities carried out by nutritionists in industry. Then a number of key practical ways in which nutritionists, through their activities and functions, can help towards achieving national targets for nutrition and nutrition-related diseases are described. Finally, suggestions are made about the knowledge, skills, and personal attributes needed by nutritionists who intend making successful careers in industry and who wish, at the same time, to contribute towards improving the health of the nation. PMID:17539871

  5. Can China achieve the WHO global targets for TB control by 2035?

    PubMed

    Huynh, Grace H

    2016-03-01

    To reach the ambitious WHO TB global targets by 2035, it is likely that China will need a comprehensive strategy that builds on its existing high-quality directly observed treatment, short-course program. This will require optimizing the use of existing tools within a changing health system landscape. In addition, new tools are needed to identify and treat TB in high-risk groups and in older people, who are a growing driver of disease incidence. Lastly, strategies are needed to address the proximate risk factors and social determinants that underlie trends in TB burden. PMID:26884495

  6. Trade-offs of different land and bioenergy policies on the path to achieving climate targets

    SciTech Connect

    Calvin, Katherine V.; Wise, Marshall A.; Kyle, G. Page; Patel, Pralit L.; Clarke, Leon E.; Edmonds, James A.

    2013-10-16

    Many papers have shown that bioenergy and land-use are potentially important elements in a strategy to limit anthropogenic climate change. But, significant expansion of bioenergy production can have a large terrestrial footprint. In this paper, we test the implications for land use, the global energy system, carbon cycle, and carbon prices of meeting a specific climate target, using a single fossil fuel and industrial sector policy instrument—the carbon tax, but with five alternative bioenergy and land-use policy architectures. We find that the policies we examined have differing effects on the different segments of the economy. Comprehensive land policies can reduce land-use change emissions, increasing allowable emissions in the energy system, but have implications for the cost of food. Bioenergy taxes and constraints, on the other hand, have little effect on food prices, but can result in increased carbon and energy prices.

  7. Functional Antagonism of Human CD40 Achieved by Targeting a Unique Species-Specific Epitope.

    PubMed

    Yamniuk, Aaron P; Suri, Anish; Krystek, Stanley R; Tamura, James; Ramamurthy, Vidhyashankar; Kuhn, Robert; Carroll, Karen; Fleener, Catherine; Ryseck, Rolf; Cheng, Lin; An, Yongmi; Drew, Philip; Grant, Steven; Suchard, Suzanne J; Nadler, Steven G; Bryson, James W; Sheriff, Steven

    2016-07-17

    Current clinical anti-CD40 biologic agents include both antagonist molecules for the treatment of autoimmune diseases and agonist molecules for immuno-oncology, yet the relationship between CD40 epitope and these opposing biological outcomes is not well defined. This report describes the identification of potent antagonist domain antibodies (dAbs) that bind to a novel human CD40-specific epitope that is divergent in the CD40 of nonhuman primates. A similarly selected anti-cynomolgus CD40 dAb recognizing the homologous epitope is also a potent antagonist. Mutagenesis, biochemical, and X-ray crystallography studies demonstrate that the epitope is distinct from that of CD40 agonists. Both the human-specific and cynomolgus-specific molecules remain pure antagonists even when formatted as bivalent Fc-fusion proteins, making this an attractive therapeutic format for targeting hCD40 in autoimmune indications. PMID:27216500

  8. Different systolic blood pressure targets for people with history of stroke or transient ischaemic attack: PAST-BP (Prevention After Stroke—Blood Pressure) randomised controlled trial

    PubMed Central

    McManus, Richard J; Roalfe, Andrea; Fletcher, Kate; Taylor, Clare J; Martin, Una; Virdee, Satnam; Greenfield, Sheila; Hobbs, F D Richard

    2016-01-01

    Objective To assess whether using intensive blood pressure targets leads to lower blood pressure in a community population of people with prevalent cerebrovascular disease. Design Open label randomised controlled trial. Setting 99 general practices in England, with participants recruited in 2009-11. Participants People with a history of stroke or transient ischaemic attack whose systolic blood pressure was 125 mm Hg or above. Interventions Intensive systolic blood pressure target (<130 mm Hg or 10 mm Hg reduction from baseline if this was <140 mm Hg) or standard target (<140 mm Hg). Apart from the different target, patients in both arms were actively managed in the same way with regular reviews by the primary care team. Main outcome measure Change in systolic blood pressure between baseline and 12 months. Results 529 patients (mean age 72) were enrolled, 266 to the intensive target arm and 263 to the standard target arm, of whom 379 were included in the primary analysis (182 (68%) intensive arm; 197 (75%) standard arm). 84 patients withdrew from the study during the follow-up period (52 intensive arm; 32 standard arm). Mean systolic blood pressure dropped by 16.1 mm Hg to 127.4 mm Hg in the intensive target arm and by 12.8 mm Hg to 129.4 mm Hg in the standard arm (difference between groups 2.9 (95% confidence interval 0.2 to 5.7) mm Hg; P=0.03). Conclusions Aiming for target below 130 mm Hg rather than 140 mm Hg for systolic blood pressure in people with cerebrovascular disease in primary care led to a small additional reduction in blood pressure. Active management of systolic blood pressure in this population using a <140 mm Hg target led to a clinically important reduction in blood pressure. Trial registration Current Controlled Trials ISRCTN29062286. PMID:26919870

  9. How much does it cost to achieve coverage targets for primary healthcare services? A costing model from Aceh, Indonesia.

    PubMed

    Abdullah, Asnawi; Hort, Krishna; Abidin, Azwar Zaenal; Amin, Fadilah M

    2012-01-01

    Despite significant investment in improving service infrastructure and training of staff, public primary healthcare services in low-income and middle-income countries tend to perform poorly in reaching coverage targets. One of the factors identified in Aceh, Indonesia was the lack of operational funds for service provision. The objective of this study was to develop a simple and transparent costing tool that enables health planners to calculate the unit costs of providing basic health services to estimate additional budgets required to deliver services in accordance with national targets. The tool was developed using a standard economic approach that linked the input activities to achieving six national priority programs at primary healthcare level: health promotion, sanitation and environment health, maternal and child health and family planning, nutrition, immunization and communicable diseases control, and treatment of common illness. Costing was focused on costs of delivery of the programs that need to be funded by local government budgets. The costing tool consisting of 16 linked Microsoft Excel worksheets was developed and tested in several districts enabled the calculation of the unit costs of delivering of the six national priority programs per coverage target of each program (such as unit costs of delivering of maternal and child health program per pregnant mother). This costing tool can be used by health planners to estimate additional money required to achieve a certain level of coverage of programs, and it can be adjusted for different costs and program delivery parameters in different settings. PMID:22887349

  10. The Knowledge Base for Achieving the Sustainable Development Goal Targets on Water Supply, Sanitation and Hygiene.

    PubMed

    Hutton, Guy; Chase, Claire

    2016-01-01

    Safe drinking water, sanitation, and hygiene (WASH) are fundamental to an improved standard of living. Globally, 91% of households used improved drinking water sources in 2015, while for improved sanitation it is 68%. Wealth disparities are stark, with rural populations, slum dwellers and marginalized groups lagging significantly behind. Service coverage is significantly lower when considering the new water and sanitation targets under the sustainable development goals (SDGs) which aspire to a higher standard of 'safely managed' water and sanitation. Lack of access to WASH can have an economic impact as much as 7% of Gross Domestic Product, not including the social and environmental consequences. Research points to significant health and socio-economic consequences of poor nutritional status, child growth and school performance caused by inadequate WASH. Groundwater over-extraction and pollution of surface water bodies have serious impacts on water resource availability and biodiversity, while climate change exacerbates the health risks of water insecurity. A significant literature documents the beneficial impacts of WASH interventions, and a growing number of impact evaluation studies assess how interventions are optimally financed, implemented and sustained. Many innovations in behavior change and service delivery offer potential for scaling up services to meet the SDGs. PMID:27240389

  11. The Knowledge Base for Achieving the Sustainable Development Goal Targets on Water Supply, Sanitation and Hygiene

    PubMed Central

    Hutton, Guy; Chase, Claire

    2016-01-01

    Safe drinking water, sanitation, and hygiene (WASH) are fundamental to an improved standard of living. Globally, 91% of households used improved drinking water sources in 2015, while for improved sanitation it is 68%. Wealth disparities are stark, with rural populations, slum dwellers and marginalized groups lagging significantly behind. Service coverage is significantly lower when considering the new water and sanitation targets under the sustainable development goals (SDGs) which aspire to a higher standard of ‘safely managed’ water and sanitation. Lack of access to WASH can have an economic impact as much as 7% of Gross Domestic Product, not including the social and environmental consequences. Research points to significant health and socio-economic consequences of poor nutritional status, child growth and school performance caused by inadequate WASH. Groundwater over-extraction and pollution of surface water bodies have serious impacts on water resource availability and biodiversity, while climate change exacerbates the health risks of water insecurity. A significant literature documents the beneficial impacts of WASH interventions, and a growing number of impact evaluation studies assess how interventions are optimally financed, implemented and sustained. Many innovations in behavior change and service delivery offer potential for scaling up services to meet the SDGs. PMID:27240389

  12. Physiological geroscience: targeting function to increase healthspan and achieve optimal longevity.

    PubMed

    Seals, Douglas R; Justice, Jamie N; LaRocca, Thomas J

    2016-04-15

    Most nations of the world are undergoing rapid and dramatic population ageing, which presents great socio-economic challenges, as well as opportunities, for individuals, families, governments and societies. The prevailing biomedical strategy for reducing the healthcare impact of population ageing has been 'compression of morbidity' and, more recently, to increase healthspan, both of which seek to extend the healthy period of life and delay the development of chronic diseases and disability until a brief period at the end of life. Indeed, a recently established field within biological ageing research, 'geroscience', is focused on healthspan extension. Superimposed on this background are new attitudes and demand for 'optimal longevity' - living long, but with good health and quality of life. A key obstacle to achieving optimal longevity is the progressive decline in physiological function that occurs with ageing, which causes functional limitations (e.g. reduced mobility) and increases the risk of chronic diseases, disability and mortality. Current efforts to increase healthspan centre on slowing the fundamental biological processes of ageing such as inflammation/oxidative stress, increased senescence, mitochondrial dysfunction, impaired proteostasis and reduced stress resistance. We propose that optimization of physiological function throughout the lifespan should be a major emphasis of any contemporary biomedical policy addressing global ageing. Effective strategies should delay, reduce in magnitude or abolish reductions in function with ageing (primary prevention) and/or improve function or slow further declines in older adults with already impaired function (secondary prevention). Healthy lifestyle practices featuring regular physical activity and ideal energy intake/diet composition represent first-line function-preserving strategies, with pharmacological agents, including existing and new pharmaceuticals and novel 'nutraceutical' compounds, serving as potential

  13. Elevated BP after AKI.

    PubMed

    Hsu, Chi-Yuan; Hsu, Raymond K; Yang, Jingrong; Ordonez, Juan D; Zheng, Sijie; Go, Alan S

    2016-03-01

    The connection between AKI and BP elevation is unclear. We conducted a retrospective cohort study to evaluate whether AKI in the hospital is independently associated with BP elevation during the first 2 years after discharge among previously normotensive adults. We studied adult members of Kaiser Permanente Northern California, a large integrated health care delivery system, who were hospitalized between 2008 and 2011, had available preadmission serum creatinine and BP measures, and were not known to be hypertensive or have BP>140/90 mmHg. Among 43,611 eligible patients, 2451 experienced AKI defined using observed changes in serum creatinine concentration measured during hospitalization. Survivors of AKI were more likely than those without AKI to have elevated BP-defined as documented BP>140/90 mmHg measured during an ambulatory, nonemergency department visit-during follow-up (46.1% versus 41.2% at 730 days; P<0.001). This difference was evident within the first 180 days (30.6% versus 23.1%; P<0.001). In multivariable models, AKI was independently associated with a 22% (95% confidence interval, 12% to 33%) increase in the odds of developing elevated BP during follow-up, with higher adjusted odds with more severe AKI. Results were similar in sensitivity analyses when elevated BP was defined as having at least two BP readings of >140/90 mmHg or those with evidence of CKD were excluded. We conclude that AKI is an independent risk factor for subsequent development of elevated BP. Preventing AKI during a hospitalization may have clinical and public health benefits beyond the immediate hospitalization. PMID:26134154

  14. GLOBIN-5-Dependent O2 Responses Are Regulated by PDL-1/PrBP That Targets Prenylated Soluble Guanylate Cyclases to Dendritic Endings

    PubMed Central

    Soltesz, Zoltan; Oda, Shigekazu; Zelmanovich, Veronica; Abergel, Zohar

    2014-01-01

    Aerobic animals constantly monitor and adapt to changes in O2 levels. The molecular mechanisms involved in sensing O2 are, however, incompletely understood. Previous studies showed that a hexacoordinated globin called GLB-5 tunes the dynamic range of O2-sensing neurons in natural C. elegans isolates, but is defective in the N2 lab reference strain (McGrath et al., 2009; Persson et al., 2009). GLB-5 enables a sharp behavioral switch when O2 changes between 21 and 17%. Here, we show that GLB-5 also confers rapid behavioral and cellular recovery from exposure to hypoxia. Hypoxia reconfigures O2-evoked Ca2+ responses in the URX O2 sensors, and GLB-5 enables rapid recovery of these responses upon re-oxygenation. Forward genetic screens indicate that GLB-5's effects on O2 sensing require PDL-1, the C. elegans ortholog of mammalian PrBP/PDE6δ protein. In mammals, PDE6δ regulates the traffic and activity of prenylated proteins (Zhang et al., 2004; Norton et al., 2005). PDL-1 promotes localization of GCY-33 and GCY-35, atypical soluble guanylate cyclases that act as O2 sensors, to the dendritic endings of URX and BAG neurons, where they colocalize with GLB-5. Both GCY-33 and GCY-35 are predicted to be prenylated. Dendritic localization is not essential for GCY-35 to function as an O2 sensor, but disrupting pdl-1 alters the URX neuron's O2 response properties. Functional GLB-5 can restore dendritic localization of GCY-33 in pdl-1 mutants, suggesting GCY-33 and GLB-5 are in a complex. Our data suggest GLB-5 and the soluble guanylate cyclases operate in close proximity to sculpt O2 responses. PMID:25505325

  15. A Pharmacist-Staffed, Virtual Gout Management Clinic for Achieving Target Serum Uric Acid Levels: A Randomized Clinical Trial

    PubMed Central

    Goldfien, Robert; Pressman, Alice; Jacobson, Alice; Ng, Michele; Avins, Andrew

    2016-01-01

    Context: Relatively few patients with gout receive appropriate treatment. Objective: To determine whether a pharmacist-staffed gout management program is more effective than usual care in achieving target serum uric acid (sUA) levels in gout patients. Design: A parallel-group, randomized controlled trial of a pharmacist-staffed, telephone-based program for managing hyperuricemia vs usual care. Trial duration was 26 weeks. Main Outcome Measures: Primary outcome measure was achieving sUA levels at or below 6 mg/dL at the 26-week visit. Secondary outcome was mean change in sUA levels in the control and intervention groups. Participants were adults with recurrent gout and sUA levels above 6.0 mg/dL. Participants were randomly assigned to management by a clinical pharmacist following protocol or to monitoring of sUA levels but management of their gout by their usual treating physician. Results: Of 102 patients who met eligibility criteria, 77 subjects obtained a baseline sUA measurement and were entered into the trial. Among 37 participants in the intervention group, 13 (35%) had sUA levels at or below 6.0 mg/dL at 26 weeks, compared with 5 (13%) of 40 participants in the control group (risk ratio = 2.8, 95% confidence interval [CI] = 1.1 to 7.1, p = 0.03). The mean change in sUA levels among controls was +0.1 mg/dL compared with −1.5 mg/dL in the intervention group (sUA difference = −1.6, 95% CI = −0.9 to −2.4, p < 0.001). Conclusions: A structured pharmacist-staffed program was more effective than usual care for achieving target sUA levels. These results suggest a structured program could greatly improve gout management. PMID:27352414

  16. Efficacy of a liquid low-energy formula diet in achieving preoperative target weight loss before bariatric surgery.

    PubMed

    Nielsen, Lone V; Nielsen, Mette S; Schmidt, Julie B; Pedersen, Sue D; Sjödin, Anders

    2016-01-01

    A preoperative weight loss of 8 % is a prerequisite to undergo bariatric surgery (BS) in Denmark. The aim of the present study was to evaluate the efficacy of a 7- or an 11-week low-energy diet (LCD) for achieving preoperative target weight before BS. A total of thirty obese patients (BMI 46·0 (sd 4·4) kg/m(2)) followed an LCD (Cambridge Weight Plan(®), 4184 kJ/d (1000 kcal/d)) for 7 or 11 weeks as preparation for BS. Anthropometric measurements including body composition (dual-energy X-ray absorptiometry), blood parameters and blood pressure were assessed at weeks 0, 7 and 11. At week 7, the majority of patients (77 %) had reached their target weight, and this was achieved after 5·4 (sem 0·3) weeks. Mean weight loss was 9·3 (sem 0·5) % (P < 0·01) and consisted of 41·6 % fat-free mass (FFM) and 58·4 % fat mass. The weight loss was accompanied by a decrease in systolic and diastolic blood pressure (7·1 (sem 2·3) and 7·3 (sem 1·8) mmHg, respectively, all P < 0·01) as well as an improved metabolic profile (8·2 (sem 1·8) % decrease in fasting glucose (P < 0·01), 28·6 (sem 6·4) % decrease in fasting insulin (P < 0·01), 23·1 (sem 2·2) % decrease in LDL (P < 0·01), and 9·7 (sem 4·7) % decrease in TAG (P < 0·05)). Weight, FFM and fat mass continued to decrease from week 7 to 11 (all P < 0·01), whereas no additional improvements was observed in the metabolic parameters. Severely obese patients can safely achieve preoperative target weight on an LCD within 7 weeks as part of preparation for BS. However, the considerable reduction in FFM in severely obese subjects needs further investigation. PMID:27293559

  17. Association of achieved dialysis dose with mortality in the hemodialysis study: an example of "dose-targeting bias".

    PubMed

    Greene, Tom; Daugirdas, John; Depner, Thomas; Allon, Michael; Beck, Gerald; Chumlea, Cameron; Delmez, James; Gotch, Frank; Kusek, John W; Levin, Nathan; Owen, William; Schulman, Gerald; Star, Robert; Toto, Robert; Eknoyan, Garabed

    2005-11-01

    In the intention-to-treat analysis of the Hemodialysis Study, all-cause mortality did not differ significantly between the high versus standard hemodialysis dose groups. The association of mortality with delivered dose within each of the two randomized treatment groups was examined, and implications for observational studies were considered. Time-dependent Cox regression was used to relate the relative risk (RR) for mortality to the running mean of the achieved equilibrated Kt/V (eKt/V) over the preceding 4 mo. eKt/V was categorized by quintiles within each dose group. Analyses were controlled for case-mix factors and baseline anthropometric volume. Within each randomized dose group, mortality was elevated markedly when achieved eKt/V was in the lowest quintile (RR, 1.93; 95% confidence interval [CI], 1.40 to 2.66; P < 0.0001 in the standard-dose group; RR, 2.04; 95% CI, 1.50 to 2.76; P < 0.0001 in the high-dose group; RR relative to the middle quintiles). The mortality rate in the lowest eKt/V quintile of the high-dose group was higher than in the full standard-dose group (RR, 1.59; 95% CI, 1.29 to 1.96; P < 0.0001). Each 0.1 eKt/V unit below the group median was associated with a 58% higher mortality in the standard-dose group (P < 0.001) and a 37% higher mortality in the high-dose group (P < 0.001). The magnitude of these dose-mortality effects was seven- to 12-fold higher than the upper limit of the 95% CI from the intention-to-treat analysis. The effects were attenuated in lagged analyses but did not disappear. When dialysis dose is targeted closely, as under the controlled conditions of the Hemodialysis Study, patients with the lowest achieved dose relative to their target dose experience markedly increased mortality, to a degree that is not compatible with a biologic effect of dose. The possibility of similar (albeit smaller) biases should be considered when analyzing observational data sets relating mortality to achieved dose of dialysis. PMID:16192421

  18. Combining active farmer involvement with detailed farm data in Denmark: a promising method for achieving water framework directive targets?

    PubMed

    Wright, Stuart A L; Jacobsen, Brian H

    2010-01-01

    The Water Framework Directive (WFD) encourages active involvement during its implementation, although no specific participatory methods are suggested, whilst implementing the target-oriented Directive will require detailed agri-environmental data at catchment and farm level. The paper is a case study of the Danish AGWAplan project, which actively involved farmers in the selection of measures to reduce diffuse nutrient pollution at farm and catchment level, thereby providing an example of how active involvement might be operationalised. Active involvement has been identified as being of central importance to the success of the WFD. The project also entailed the accumulation of extensive agri-environmental data. The aim of the paper is to evaluate AGWAplan to establish the extent to which its expected objectives have been achieved and how, and to determine whether the project approach might facilitate WFD goals if implemented in forthcoming river basin management plans (RBMPs). AGWAplan resulted in advantageous outcomes, including win-win solutions to reduce nutrient leaching and greater acceptance of policy, although the original reduction targets where not fully reached. The paper concludes that actively involving farmers in a similar manner in RBMPs may make an important contribution to the implementation of the WFD, although caveats regarding its potential for transfer to other areas are identified. PMID:20453337

  19. The Target Achievement Control Test: Evaluating real-time myoelectric pattern recognition control of a multifunctional upper-limb prosthesis

    PubMed Central

    Simon, Ann M.; Hargrove, Levi J.; Lock, Blair A.; Kuiken, Todd A.

    2014-01-01

    Despite high classification accuracies (~95%) of myoelectric control systems based on pattern recognition, it is unclear how well offline measures translate to real-time closed-loop control. Recently, a real-time virtual test analyzed how well subjects completed motions using a multiple–degree of freedom (DOF) classifier. Although this test provided real-time performance metrics, the required task was oversimplified: motion speeds were normalized and unintended movements were ignored. We included these considerations in a new, more challenging virtual test, the Target Achievement Control (TAC) Test. Users attempted to move a virtual arm into a target posture using myoelectric pattern recognition. Five transradial amputees performed the test with various classifier (one vs. three DOF) and task complexities (one vs. three required motions per posture). No significant difference was found in classification accuracy between the one- and three- DOF classifiers (97.2%±2.0% and 94.1%±3.1%, respectively) (p=0.14). Subjects completed 31% fewer trials in significantly more time using the three-DOF classifier. Subjects took 3.6±0.8 times longer to reach a three-motion posture compared to a one-motion posture. The results highlight the need for closed-loop performance measures and demonstrate that the TAC Test provides a useful and more challenging tool to test real-time pattern recognition performance. PMID:21938650

  20. 78 FR 60270 - BP America Inc., BP Corporation North America Inc., BP America Production Company, and BP Energy...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-01

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission BP America Inc., BP Corporation North America Inc., BP America Production Company, and BP Energy Company; Notice of Designation of Commission Staff as Non-Decisional With...

  1. Population Pharmacokinetics of Colistin Methanesulfonate in Rats: Achieving Sustained Lung Concentrations of Colistin for Targeting Respiratory Infections

    PubMed Central

    W. S. Yapa, Shalini; Li, Jian; Porter, Christopher J. H.; Nation, Roger L.

    2013-01-01

    Colistin methanesulfonate (CMS), the inactive prodrug of colistin, is administered by inhalation for the management of respiratory infections. However, limited pharmacokinetic data are available for CMS and colistin following pulmonary delivery. This study investigates the pharmacokinetics of CMS and colistin following intravenous (i.v.) and intratracheal (i.t.) administration in rats and determines the targeting advantage after direct delivery into the lungs. In addition to plasma, bronchoalveolar lavage (BAL) fluid was collected to quantify drug concentrations in lung epithelial lining fluid (ELF). The resulting data were analyzed using a population modeling approach in S-ADAPT. A three-compartment model described the disposition of both compounds in plasma following i.v. administration. The estimated mean clearance from the central compartment was 0.122 liters/h for CMS and 0.0657 liters/h for colistin. Conversion of CMS to colistin from all three compartments was required to fit the plasma data. The fraction of the i.v. dose converted to colistin in the systemic circulation was 0.0255. Two BAL fluid compartments were required to reflect drug kinetics in the ELF after i.t. dosing. A slow conversion of CMS (mean conversion time [MCTCMS] = 3.48 h) in the lungs contributed to high and sustained concentrations of colistin in ELF. The fraction of the CMS dose converted to colistin in ELF (fm,ELF = 0.226) was higher than the corresponding fractional conversion in plasma after i.v. administration. In conclusion, pulmonary administration of CMS achieves high and sustained exposures of colistin in lungs for targeting respiratory infections. PMID:23917323

  2. Anti-BP180-type mucous membrane pemphigoid immunoglobulin G shows heterogeneity of internalization of BP180/collagen XVII into keratinocyte cytoplasm.

    PubMed

    Imanishi, Akiko; Imanishi, Hisayoshi; Hiroyasu, Sho; Ozawa, Toshiyuki; Koga, Hiroshi; Ishii, Norito; Kitajima, Yasuo; Hashimoto, Takashi; Tsuruta, Daisuke

    2016-06-01

    Anti-BP180-type mucous membrane pemphigoid (BP180-MMP) is a rare autoimmune subepidermal blistering disease that targets the C terminus of BP180/collagen XVII. Currently, the pathomechanism of BP180-MMP is not well understood. We reported previously that immunoglobulin G (IgG) from patients with bullous pemphigoid (BP) can induce internalization of BP180 via a macropinocytic pathway, which depletes BP180 and weakens epidermal cell-matrix integrity. The purpose of the present study was to elucidate the pathomechanism of BP180-MMP. Immunohistochemistry of biopsy specimens from two patients with BP180-MMP revealed that one patient had BP180 internalization, but the other did not. In live-cell imaging using IgG from patients with BP180-MMP on several keratinocyte cell lines, IgG from only three out of the seven patients was associated with BP180 internalization into the cytoplasm. Our results suggest that IgG from patients with BP180-MMP shows heterogeneity of internalization of BP180. This variability in BP180 internalization in patients with BP or BP180-MMP may lead to differences in clinical presentation. PMID:26658728

  3. Can we bet on negative emissions to achieve the 2°C target even under strong carbon cycle feedbacks?

    NASA Astrophysics Data System (ADS)

    Tanaka, K.; Yamagata, Y.; Yokohata, T.; Emori, S.; Hanaoka, T.

    2015-12-01

    tentative results point to a key policy message: do not rely on negative emissions to achieve the 2°C target. It would make more sense to gear climate mitigation actions toward the stabilization target without betting on negative emissions because negative emissions might create large overshoot in case of strong feedbacks.

  4. Gracilaria lemaneiformis polysaccharide as integrin-targeting surface decorator of selenium nanoparticles to achieve enhanced anticancer efficacy.

    PubMed

    Jiang, Wenting; Fu, Yuanting; Yang, Fang; Yang, Yufeng; Liu, Ting; Zheng, Wenjie; Zeng, Lilan; Chen, Tianfeng

    2014-08-27

    The poor permeability of glioma parenchyma represents a major limit for antiglioblastoma drug delivery. Gracilaria lemaneiformis polysaccharide (GLP), which has a high binding affinity to αvβ3 integrin overexpressed in glioma cells, was employed in the present study to functionalize selenium nanoparticles (SeNPs) to achieve antiglioblastoma efficacy. GLP-SeNPs showed satisfactory size distribution, high stability, and selectivity between cancer and normal cells. In U87 glioma cell membrane, which has a high integrin expression level, GLP-SeNPs exhibited significantly higher cellular uptake than unmodified SeNPs. As expected, U87 cells exhibited a greater uptake of GLP-SeNPs than C6 cells with low integrin expression level. Furthermore, the internalization of GLP-SeNPs was inhibited by cyclo-(Arg-Gly-Asp-Phe-Lys) peptides, suggesting that cellular uptake into U87 cells and C6 cells occurred via αvβ3 integrin-mediated endocytosis. For U87 cells, the cytotoxicity of SeNPs decorated by GLP was enhanced significantly because of the induction of various apoptosis signaling pathways. Internalized GLP-SeNPs triggered intracellular reactive oxygen species downregulation. Therefore, p53, MAPKs, and AKT pathways were activated to advance cell apoptosis. These findings suggest that surface decoration of nanomaterials with GLP could be an efficient strategy for design and preparation of glioblastoma targeting nanodrugs. PMID:25073123

  5. Achieving blood pressure goals: why aren't we?

    PubMed

    Cushman, William C; Basile, Jan

    2006-12-01

    The Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC 7) recommends a blood pressure (BP) goal of <140/90 mm Hg in patients with hypertension and <130/80 mm Hg in those with diabetes or chronic kidney disease. Achievement of BP goals is associated with significant benefits in cardiovascular morbidity and mortality. Although evidence suggests these goals are attainable, only about one third of patients are meeting them. There is a significant gap between treatment guideline recommendations and their implementation in clinical practice. Many clinicians appear satisfied with modest BP reductions and do not make the necessary treatment adjustments to achieve BP goals. Patient nonadherence is another important reason for lack of BP control. For the success of clinical trials to be reproduced in clinical practice, clinicians must recognize the importance of treating BP to goal, emphasize to patients the need to adhere to treatments, and provide persistent, goal-targeted therapy. PMID:17170612

  6. Both Patient and Facility Contribute to Achieving the Centers for Medicare and Medicaid Services' Pay-for-Performance Target for Dialysis Adequacy

    PubMed Central

    Tighiouart, Hocine; Meyer, Klemens B.; Miskulin, Dana C.

    2011-01-01

    The Centers for Medicare and Medicaid Services (CMS) designated the achieved urea reduction ratio (URR) as a pay-for-performance measure, but to what extent this measure reflects patient characteristics and adherence instead of its intent to reflect facility performance is unknown. Here, we quantified the contributions of patient case-mix and adherence to the variability in achieving URR targets across dialysis facilities. We found that 92% of 10,069 hemodialysis patients treated at 173 facilities during the last quarter of 2004 achieved the target URR ≥65%. Mixed-effect models with random intercept for dialysis facility revealed a significant facility effect: 11.5% of the variation in achievement of target URR was attributable to the facility level. Adjusting for patient case-mix reduced the proportion of variation attributable to the facility level to 6.7%. Patient gender, body surface area, dialysis access, and adherence with treatment strongly associated with achievement of the URR target. We could not identify specific facility characteristics that explained the remaining variation between facilities. These data suggest that if adherence is not a modifiable patient characteristic, providers could be unfairly penalized for caring for these patients under current CMS policy. These penalties may have unintended consequences. PMID:22025629

  7. Optical and mechanical behavior of GeC and BP antireflection coatings under rain erosion tests

    NASA Astrophysics Data System (ADS)

    Mackowski, Jean-Marie; Cimma, B.; Lacuve, J.; Laprat, Patrice

    1994-09-01

    Thick germanium carbide (GeC) and boron phosphide (BP) films are successfully grown on various zinc sulfide and germanium substrates at temperatures up to 450 degree(s)C by reactive radio-frequency sputtering (RRFS). The sputtering conditions are respectively a germanium target within a medium of methane-argon for GeC films and a high density boron target in a sputtering medium of phosphine-argon for BP films. The rain erosion resistance of GeC and BP films protected or not by diamond-like carbon (DLC) coating on top are measured for water drop diameter of 1.2 mm or 2 mm with an impact velocity ranging from 210 m/s to 265 m/s on the Saab-Scania whirling-arm rig facilities (Linkoping, Sweden). Rain erosion resistance of BP films for a wavelength band in the 8 micrometers to 10 micrometers range shows no damage for a speed up to 250 m/s with an exposure time up to 10 min, whereas the GeC rain erosion resistance shows no damage up to 235 m/s for the same exposure time. The transmission of each film is well correlated to its optical absorption at 10.6 micrometers . The GeC absorption can be reduced down to 40 cm-1 whereas the BP absorption stays around 220 cm-1 for sputtered films. So the compromise between the optical performance and the rain erosion resistance can be achieved by the use of GeC or BP films.

  8. Evaluation of the Specificity of BP3385 for Bordetella pertussis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BP3385 has been proposed as a diagnostic PCR target for discriminating between Bordetella pertussis and other Bordetella species that also infect humans. Our results demonstrate this gene is also present in some strains of Bordetella hinzii and Bordetella bronchiseptica....

  9. Mechanisms Directing the Nuclear Localization of the CtBP Family Proteins

    PubMed Central

    Verger, Alexis; Quinlan, Kate G. R.; Crofts, Linda A.; Spanò, Stefania; Corda, Daniela; Kable, Eleanor P. W.; Braet, Filip; Crossley, Merlin

    2006-01-01

    The C-terminal binding protein (CtBP) family includes four proteins (CtBP1 [CtBP1-L], CtBP3/BARS [CtBP1-S], CtBP2, and RIBEYE) which are implicated both in transcriptional repression and in intracellular trafficking. However, the precise mechanisms by which different CtBP proteins are targeted to different subcellular regions remains unknown. Here, we report that the nuclear import of the various CtBP proteins and splice isoforms is differentially regulated. We show that CtBP2 contains a unique nuclear localization signal (NLS) located within its N-terminal region, which contributes to its nuclear accumulation. Using heterokaryon assays, we show that CtBP2 is capable of shuttling between the nucleus and cytoplasm of the cell. Moreover, CtBP2 can heterodimerize with CtBP1-L and CtBP1-S and direct them to the nucleus. This effect strongly depends on the CtBP2 NLS. PXDLS motif-containing transcription factors, such as BKLF, that bind CtBP proteins can also direct them to the nucleus. We also report the identification of a splice isoform of CtBP2, CtBP2-S, that lacks the N-terminal NLS and localizes to the cytoplasm. Finally, we show that mutation of the CtBP NADH binding site impairs the ability of the proteins to dimerize and to associate with BKLF. This reduces the nuclear accumulation of CtBP1. Our results suggest a model in which the nuclear localization of CtBP proteins is influenced by the CtBP2 NLS, by binding to PXDLS motif partner proteins, and through the effect of NADH on CtBP dimerization. PMID:16782877

  10. [Achievement of therapeutic target in subjects on statin treatment in clinical practice. Results of the STAR (Statins Target Assessment in Real practice) study].

    PubMed

    Degli Esposti, Luca; Sangiorgi, Diego; Arca, Marcello; Vigna, Giovanni B; Budal, Stefano; Degli Esposti, Ezio

    2011-12-01

    The primary aim of the STAR Study (Statins Target Assessment in Real practice) was to determine the LDL-cholesterol reduction and to analyse patient's and therapeutic factors associated to LDL-cholesterol target attainment in newly treated subjects with statins in an unselected population in clinical practice setting. Administrative databases (including pharmaceutical prescriptions and hospital admissions) and laboratory test databases (including LDL-cholesterol values) of five local health units, distributed in Emilia Romagna, Toscana and Umbria, were linked. A retrospective cohort study was conducted and all subjects aged > or =18 years with a first prescription for statins (newly treated subjects) between January 1st, 2007 and June 30th, 2008 were included. All statin prescriptions over a 12 months follow-up period were considered and used to calculate adherence to treatment. Baseline and follow-up LDL-cholesterol, respectively, were defined according to the nearest determination to the first prescription for statins and to the end of the follow-up period. A total of 3.232 subjects was included, 1.516 males (47%) and 1.716 females (53%), with an average age equal to 65.9 +/- 11.3 years. Among included subjects, 22.,6% had a gap to LDL-cholesterol target <10%, 30.0% between 10 and 29%, 20.7% between 30 and 49%, and 26.7% . or =50%. Among those with a gap to target > or =50%, 30-49%, and 10-29%, respectively, LDL-cholesterol target was attained by 7.1%, 41.8%, and 62.% of subjects. LDL-cholesterol target attainment was associated to gap to target, adherence with treatment, and type of statin. PMID:22567731

  11. The Relationship between Anxiety and Attitude of Students Learning Turkish as a Foreign Language and Their Achievement on Target Language

    ERIC Educational Resources Information Center

    Gocer, Ali

    2014-01-01

    The purpose of this study is to assess the anxiety connected with target language of the high school students learning Turkish as a foreign language. In this study, descriptive relational screening model was used. Two scales were used for collecting data. First scale was FLCAS-Foreign Language Classroom Anxiety Scale; it was developed by Horwitz…

  12. The Potential for School-Based Interventions That Target Executive Function to Improve Academic Achievement: A Review

    ERIC Educational Resources Information Center

    Jacob, Robin; Parkinson, Julia

    2015-01-01

    This article systematically reviews what is known empirically about the association between executive function and student achievement in both reading and math and critically assesses the evidence for a causal association between the two. Using meta-analytic techniques, the review finds that there is a moderate unconditional association between…

  13. Targeted Funding for Educationally Disadvantaged Students: A Regression Discontinuity Estimate of the Impact on High School Student Achievement

    ERIC Educational Resources Information Center

    Henry, Gary T.; Fortner, C. Kevin; Thompson, Charles L.

    2010-01-01

    Evaluating the impacts of public school funding on student achievement has been an important objective for informing education policymaking but fraught with data and methodological limitations. Findings from prior research have been mixed at best, leaving policymakers with little advice about the benefits of allocating public resources to schools…

  14. Small Molecule, NSC95397, Inhibits the CtBP1-Protein Partner Interaction and CtBP1-Mediated Transcriptional Repression.

    PubMed

    Blevins, Melanie A; Kouznetsova, Jennifer; Krueger, Aaron B; King, Rebecca; Griner, Lesley Mathews; Hu, Xin; Southall, Noel; Marugan, Juan J; Zhang, Qinghong; Ferrer, Marc; Zhao, Rui

    2015-06-01

    Carboxyl-terminal binding protein (CtBP) is a transcriptional corepressor that suppresses multiple proapoptotic and epithelial genes. CtBP is overexpressed in many human cancers, and its overexpression increases stem cell-like features, epithelial-mesenchymal transition, and cancer cell survival. Knockdown of CtBP also increases apoptosis independent of p53 in cell culture. Therefore, targeting CtBP with small molecules that disrupt its interaction with transcription factor partners may be an effective cancer therapy. To elicit its corepressing effect, CtBP binds to a conserved peptide motif in each transcription factor partner. We developed an AlphaScreen high-throughput screening assay to monitor the interaction between CtBP and E1A (which mimics the interaction between CtBP and its transcriptional partners). We screened the LOPAC library of 1280 bioactive compounds and identified NSC95397, which inhibits the CtBP-E1A interaction (IC50 = 2.9 µM). The inhibitory activity of NSC95397 was confirmed using two secondary assays and a counterscreen. NSC95397 also behaved as a weak substrate of CtBP dehydrogenase activity and did not inhibit another dehydrogenase, lactase dehydrogenase. Finally, NSC95397 was able to disrupt CtBP-mediated transcriptional repression of a target gene. These studies present a new possibility for the development of a therapeutic agent targeting tumors through disrupting the CtBP transcriptional complex. PMID:25477201

  15. Enabling implementation of the Global Vaccine Action Plan: developing investment cases to achieve targets for measles and rubella prevention.

    PubMed

    Thompson, Kimberly M; Strebel, Peter M; Dabbagh, Alya; Cherian, Thomas; Cochi, Stephen L

    2013-04-18

    Global prevention and control of infectious diseases requires significant investment of financial and human resources and well-functioning leadership and management structures. The reality of competing demands for limited resources leads to trade-offs and questions about the relative value of specific investments. Developing investment cases can help to provide stakeholders with information about the benefits, costs, and risks associated with available options, including examination of social, political, governance, and ethical issues. We describe the process of developing investment cases for globally coordinated management of action plans for measles and rubella as tools for enabling the implementation of the Global Vaccine Action Plan (GVAP). We focus on considerations related to the timing of efforts to achieve measles and rubella goals independently and within the context of ongoing polio eradication efforts, other immunization priorities, and other efforts to control communicable diseases or child survival initiatives. Our analysis suggests that the interactions between the availability and sustainability of financial support, sufficient supplies of vaccines, capacity of vaccine delivery systems, and commitments at all levels will impact the feasibility and timing of achieving national, regional, and global goals. The timing of investments and achievements will determine the net financial and health benefits obtained. The methodology, framing, and assumptions used to characterize net benefits and uncertainties in the investment cases will impact estimates and perceptions about the value of prevention achieved overall by the GVAP. We suggest that appropriately valuing the benefits of investments of measles and rubella prevention will require the use of integrated dynamic disease, economic, risk, and decision analytic models in combination with consideration of qualitative factors, and that synthesizing information in the form of investment cases may help

  16. Markedly Enhanced Skeletal Muscle Transfection Achieved by the Ultrasound-Targeted Delivery of Non-Viral Gene Nanocarriers with Microbubbles

    PubMed Central

    Burke, Caitlin W.; Suk, Jung Soo; Kim, Anthony J.; Hsiang, Yu-Han J.; Klibanov, Alexander L.; Hanes, Justin; Price, Richard J.

    2012-01-01

    Our goal was to enhance ultrasound (US)-targeted skeletal muscle transfection through the use of poly(ethyleneglycol) (PEG)/polyethylenimine (PEI) nanocomplex gene carriers and adjustments to US and microbubble (MB) parameters. C57BL/6 mice received an intravenous infusion of MBs and either “naked” luciferase plasmid or luciferase plasmid condensed in PEG/PEI nanocomplexes. Pulsed ultrasound (1MHz; 0.6 MPa or 0.8 MPa) was applied to the right hindlimb for 12 mins. Luciferase activity in both hindlimbs was assessed at 3, 5, 7, and 10 days post-treatment by bioluminescent imaging. When targeted to hindlimb using unsorted MBs and 0.6 MPa US, 7 days after treatment, we observed a >60-fold increase in luciferase activity in PEG/PEI nanocomplex treated muscles over muscles treated with “naked” plasmid DNA. Luciferase activity was consistently greater after treatment with PEG/PEI nanocomplexes at 0.6 MPa as compared to 0.8 MPa. The combination of small diameter MBs and 0.6 MPa US also resulted in significantly greater gene expression when compared to concentration matched intramuscular injections, a control condition in which considerably more PEG/PEI nanocomplexes were present in tissue. This result suggests that, in addition to facilitating PEG/PEI nanocomplex delivery from the bloodstream to tissue, US enhances transfection via one or more secondary mechanisms, including increased cellular uptake and/or trafficking to the nucleus of PEG/PEI nanocomplexes. We conclude that PEG/PEI nanocomplexes may be used to markedly enhance the amplitude of US-MB-targeted skeletal muscle transfection and that activating “small” MBs with a moderate level (0.6 MPa) of acoustic pressure can further enhance these effects. PMID:22800583

  17. Transcriptional Regulation of CRD-BP by c-myc

    PubMed Central

    Noubissi, Felicite K.; Nikiforov, Mikhail A.; Colburn, Nancy; Spiegelman, Vladimir S.

    2010-01-01

    The coding region determinant binding protein, CRD-BP, is a multifunctional RNA binding protein involved in different processes such as mRNA turnover, translation control, and localization. It is mostly expressed in fetal and neonatal tissues, where it regulates many transcripts essential for normal embryonic development. CRD-BP is scarce or absent in normal adult tissues but reactivated and/or overexpressed in various neoplastic and preneoplastic tumors and in most cell lines. Its expression has been associated with the most aggressive form of some cancers. CRD-BP is an important regulator of different genes including a variety of oncogenes or proto-oncogenes (c-myc, β-TrCP1, GLI1, etc.). Regulation of CRD-BP expression is critical for proper control of its targets as its overexpression may play an important role in abnormal cell proliferation, suppression of apoptosis, invasion, and metastasis. Molecular bases of the regulatory mechanisms governing CRD-BP expression are still not completely elucidated. In this article, we have identified c-myc as a novel transcriptional regulator of CRD-BP. We show that c-myc binds to CRD-BP promoter and induces its transcription. This induction of CRD-BP expression contributes to the role of c-myc in the regulation of translation, increase in cell size, and acceleration of cell cycle progression via a mechanism involving upregulation of β-TrCP1 levels and activities and accelerated degradation of PDCD4. PMID:21779431

  18. Trends and implications for achieving VISION 2020 human resources for eye health targets in 16 countries of sub-Saharan Africa by the year 2020

    PubMed Central

    2014-01-01

    Background Development of human resources for eye health (HReH) is a major global eye health strategy to reduce the prevalence of avoidable visual impairment by the year 2020. Building on our previous analysis of current progress towards key HReH indicators and cataract surgery rates (CSRs), we predicted future indicator achievement among 16 countries of sub-Saharan Africa by 2020. Methods Surgical and HReH data were collected from national eye care programme coordinators on six practitioner cadres: ophthalmologists, cataract surgeons, ophthalmic clinical officers, ophthalmic nurses, optometrists and ‘mid-level refractionists’ and combined them with publicly available population data to calculate practitioner-to-population ratios and CSRs. Data on workforce entry and exit (2008 to 2010) was used to project practitioner population and CSR growth between 2011 and 2020 in relation to projected growth in the general population. Associations between indicator progress and the presence of a non-physician cataract surgeon cadre were also explored using Wilcoxon rank sum tests and Spearman rank correlations. Results In our 16-country sample, practitioner per million population ratios are predicted to increase slightly for surgeons (ophthalmologists/cataract surgeons, from 3.1 in 2011 to 3.4 in 2020) and ophthalmic nurses/clinical officers (5.8 to 6.8) but remain low for refractionists (including optometrists, at 3.6 in 2011 and 2020). Among countries that have not already achieved target indicators, however, practitioner growth will be insufficient for any additional countries to reach the surgeon and refractionist targets by year 2020. Without further strategy change and investment, even after 2020, surgeon growth is only expected to sufficiently outpace general population growth to reach the target in one country. For nurses, two additional countries will achieve the target while one will fall below it. In 2011, high surgeon practitioner ratios were associated with

  19. Nonspecific targeting of iron oxide nanoparticles to the liver, kidney and spleen: A novel approach to achieving specificity

    NASA Astrophysics Data System (ADS)

    Palihawadana Arachchige, Maheshika; Flack, Amanda; Chen, Xuequn; Li, Jing; Oupicky, David; Cheng, Y.-C. Norman; Shen, Yimin; Jena, Bhanu; Lawes, Gavin

    2013-03-01

    Recently, there has been significant interest in developing Fe3O4 nanoparticles for biomedical applications including targeted drug delivery and magnetic resonance imaging. One of the major problems in these applications is the undesirable filtration of these materials by the mononuclear phagocyte system. Preliminary magnetic resonance imaging and magnetization studies on hyaluronic acid coated nanoparticles injected intravenously into mice confirm that the nanoparticles accumulate in the liver, spleen, and kidneys. To identify whether certain specific proteins are responsible for nanoparticle accumulation in these organs, we exposed hyaluronic acid coated nanoparticles to proteins extracted from the liver, spleen, and kidneys, together with blood plasma proteins, then subsequently used gel electrophoresis and mass spectroscopy to identify the proteins binding to the nanoparticles. We find that the unwanted accumulation of nanoparticles in these organs can potentially be attributed to specific binding by a small number of proteins. By appropriately functionalizing the iron oxide nanoparticles, we expect that the nanoparticles uptake in the liver, spleen, and kidneys will be reduced.

  20. Nonspecific targeting of iron oxide nanoparticles to the liver, kidney and spleen: A novel approach to achieving specificity

    NASA Astrophysics Data System (ADS)

    Palihawadana Arachchige, Maheshika; Flack, Amanda; Chen, Xuequn; Li, Jing; Oupicky, David; Cheng, Y.-C. Norman; Shen, Yimin; Jena, Bhanu; Lawes, Gavin

    2012-10-01

    Recently there has been significant interest in developing Fe3O4 nanoparticles for biomedical applications including targeted drug delivery and magnetic resonance imaging. One of the major problems in applying these nanoparticles clinically is to minimize the undesirable filtration of these materials by the mononuclear phagocyte system. Preliminary MRI and magnetization studies on hyaluronic acid coated nanoparticles injected intravenously into mice confirm that the nanoparticles accumulate in the liver, spleen, and kidneys. To identify whether this nanoparticle accumulation are due to some certain specific proteins, we exposed hyaluronic acid coated nanoparticles to proteins extracted from these organs, together with blood plasma proteins, then used gel electrophoresis together with mass spectroscopy to identify the proteins binding to the nanoparticles. We find that the accumulation of nanoparticles in these organs can be due to specific binding by a small number of proteins. By appropriately functionalizing the Fe3O4 nanoparticles, possibly by blocking the binding sites of these specific proteins, we expect that the nanoparticles uptake in the liver, spleen, and kidneys will be reduced, which, in turn, could increase the concentration of nanoparticles at tumor sites.

  1. Peptide Decoration of Nanovehicles to Achieve Active Targeting and Pathology-Responsive Cellular Uptake for Bone Metastasis Chemotherapy

    PubMed Central

    Jia, Huizhen; Jia, Wanjian; Miller, Scott; Bowman, Beth; Feng, Jun; Zhan, Fenghuang

    2015-01-01

    To improve bone metastases chemotherapy, a peptide-conjugated diblock copolymer consisting of chimeric peptide, poly(ethylene glycol) and poly(trimethylene carbonate) (Pep-b-PEG-b-PTMC) is fabricated as a drug carrier capable of bone-seeking targeting as well as pathology-responsive charge reversal to ensure effective cellular uptake at the lesion sites. The chimeric peptide CKGHPGGPQAsp8 consists of an osteotropic anionic Asp8, a cathepsin K (CTSK)-cleavable substrate (HPGGPQ) and cationic residue tethered to polymer chain. Pep-b-PEG-b-PTMC can spontaneously self-assemble into negatively charged nanomicelles (~75 nm). As to the model drug of doxorubicin, Pep-b-PEG-b-PTM shows 30.0 ± 1 % and 90.1 ± 2 % for loading content and loading efficiency, respectively. High bone binding capability is demonstrated with that 66 % of Pep-b-PEG-b-PTMC micelles are able to bind to hydroxyl apatite, whereas less than 15 % is for Pep-free micelles. The nanomicelles exhibit a negative-to-positive charge conversion from −18.5 ± 1.9 mV to 15.2 ± 1.8 mV upon exposure to CTSK, an enzyme overexpressed in bone metastatic microenvironments. Such a pathology-responsive transition would lead to remarkably enhanced cellular uptake of the nanomicelles upon reaching lesion sites, thus improving the drug efficacy as verified by the in vitro cytotoxicity assay and the in vivo study in myeloma-bearing 5TGM1 mice model. PMID:26082834

  2. Target Hemoglobin May Be Achieved with Intravenous Iron Alone in Anemic Patients with Cardiorenal Syndrome: An Observational Study

    PubMed Central

    Ben-Assa, Eyal; Shacham, Yacov; Shashar, Moshe; Leshem-Rubinow, Eran; Gal-Oz, Amir; Schwartz, Idit F.; Schwartz, Doron; Silverberg, Donald S.; Chernin, Gil

    2015-01-01

    Background The treatment of anemia in patients with cardiorenal syndrome (CRS) is based mainly on intravenous (IV) iron therapy and/or erythropoiesis-stimulating agents (ESAs). There are concerns about the safety of ESAs due to a potentially higher risk for stroke and malignancy. Objective We aimed to explore whether IV iron alone is sufficient to improve anemia in CRS patients and to define the predictors of treatment response. Methods We retrospectively analyzed data of 81 CRS patient treated for anemia at our clinic. All patients received IV iron for 6 weeks. A subset of patients was additionally given subcutaneous ESAs. The end point was the improvement from baseline in hemoglobin (Hb) and ferritin levels at week 7. Results We retrieved the files of 81 patients; 34 received IV iron alone and 47 were given IV iron and ESAs (the combination group). The Hb levels significantly increased in both groups (in the IV iron alone group: 10.6 ± 1.1 to 11.9 ±1.1 g/dl, p < 0.001; in the combination group: 10.2 ± 0.9 to 12.4 ± 1.3 g/dl, p < 0.001), but more pronouncedly in the combination group (2.17 vs. 1.24 g/dl; p = 0.001). The platelet count decreased significantly in the IV iron alone group but was unchanged in the combination group. Eighty percent of patients attained a Hb target of 11 g/dl, with no significant difference between the two groups (73.5 vs. 85.1%; p = 0.197). Low baseline Hb was the only predictor of a favorable outcome to treatment. Conclusion Our observational study suggests that IV iron treatment without ESAs may substantially raise the Hb level to ≥11 g/dl in CRS patients. This treatment strategy may reduce the use of ESAs and hence its potential adverse effects. PMID:26648941

  3. Coated minispheres of salmon calcitonin target rat intestinal regions to achieve systemic bioavailability: Comparison between intestinal instillation and oral gavage.

    PubMed

    Aguirre, Tanira A S; Aversa, Vincenzo; Rosa, Mónica; Guterres, Sílvia S; Pohlmann, Adriana R; Coulter, Ivan; Brayden, David J

    2016-09-28

    Achieving oral peptide delivery is an elusive challenge. Emulsion-based minispheres of salmon calcitonin (sCT) were synthesized using single multiple pill (SmPill®) technology incorporating the permeation enhancers (PEs): sodium taurodeoxycholate (NaTDC), sodium caprate (C10), or coco-glucoside (CG), or the pH acidifier, citric acid (CA). Minispheres were coated with an outer layer of Eudragit® L30 D-55 (designed for jejunal release) or Surelease®/Pectin (designed for colonic release). The process was mild and in vitro biological activity of sCT was retained upon release from minispheres stored up to 4months. In vitro release profiles suggested that sCT was released from minispheres by diffusion through coatings due to swelling of gelatin and the polymeric matrix upon contact with PBS at pH6.8. X-ray analysis confirmed that coated minispheres dissolved at the intended intestinal region of rats following oral gavage. Uncoated minispheres at a dose of ~2000I.U.sCT/kg were administered to rats by intra-jejunal (i.j.) or intra-colonic (i.c.) instillation and caused hypocalcaemia. Notable sCT absolute bioavailability (F) values were: 5.5% from minispheres containing NaTDC (i.j), 17.3% with CG (i.c.) and 18.2% with C10 (i.c.). Coated minispheres administered by oral gavage at threefold higher doses also induced hypocalcaemia. A highly competitive F value of 2.7% was obtained for orally-administered sCT-minispheres containing CG (45μmol/kg) and coated with Eudragit®. In conclusion, the SmPill® technology is a potential dosage form for several peptides when formulated with PEs and coated for regional delivery. PK data from instillations over-estimates oral bioavailability and poorly predicts rank ordering of formulations. PMID:27480451

  4. TIDEL-II: first-line use of imatinib in CML with early switch to nilotinib for failure to achieve time-dependent molecular targets.

    PubMed

    Yeung, David T; Osborn, Michael P; White, Deborah L; Branford, Susan; Braley, Jodi; Herschtal, Alan; Kornhauser, Michael; Issa, Samar; Hiwase, Devendra K; Hertzberg, Mark; Schwarer, Anthony P; Filshie, Robin; Arthur, Christopher K; Kwan, Yiu Lam; Trotman, Judith; Forsyth, Cecily J; Taper, John; Ross, David M; Beresford, Jennifer; Tam, Constantine; Mills, Anthony K; Grigg, Andrew P; Hughes, Timothy P

    2015-02-01

    The Therapeutic Intensification in De Novo Leukaemia (TIDEL)-II study enrolled 210 patients with chronic phase chronic myeloid leukemia (CML) in two equal, sequential cohorts. All started treatment with imatinib 600 mg/day. Imatinib plasma trough level was performed at day 22 and if <1000 ng/mL, imatinib 800 mg/day was given. Patients were then assessed against molecular targets: BCR-ABL1 ≤10%, ≤1%, and ≤0.1% at 3, 6, and 12 months, respectively. Cohort 1 patients failing any target escalated to imatinib 800 mg/day, and subsequently switched to nilotinib 400 mg twice daily for failing the same target 3 months later. Cohort 2 patients failing any target switched to nilotinib directly, as did patients with intolerance or loss of response in either cohort. At 2 years, 55% of patients remained on imatinib, and 30% on nilotinib. Only 12% were >10% BCR-ABL1 at 3 months. Confirmed major molecular response was achieved in 64% at 12 months and 73% at 24 months. MR4.5 (BCR-ABL1 ≤0.0032%) at 24 months was 34%. Overall survival was 96% and transformation-free survival was 95% at 3 years. This trial supports the feasibility and efficacy of an imatinib-based approach with selective, early switching to nilotinib. This trial was registered at www.anzctr.org.au as #12607000325404. PMID:25519749

  5. NREL 2012 Achievement of Ethanol Cost Targets: Biochemical Ethanol Fermentation via Dilute-Acid Pretreatment and Enzymatic Hydrolysis of Corn Stover

    SciTech Connect

    Tao, L.; Schell, D.; Davis, R.; Tan, E.; Elander, R.; Bratis, A.

    2014-04-01

    For the DOE Bioenergy Technologies Office, the annual State of Technology (SOT) assessment is an essential activity for quantifying the benefits of biochemical platform research. This assessment has historically allowed the impact of research progress achieved through targeted Bioenergy Technologies Office funding to be quantified in terms of economic improvements within the context of a fully integrated cellulosic ethanol production process. As such, progress toward the ultimate 2012 goal of demonstrating cost-competitive cellulosic ethanol technology can be tracked. With an assumed feedstock cost for corn stover of $58.50/ton this target has historically been set at $1.41/gal ethanol for conversion costs only (exclusive of feedstock) and $2.15/gal total production cost (inclusive of feedstock) or minimum ethanol selling price (MESP). This year, fully integrated cellulosic ethanol production data generated by National Renewable Energy Laboratory (NREL) researchers in their Integrated Biorefinery Research Facility (IBRF) successfully demonstrated performance commensurate with both the FY 2012 SOT MESP target of $2.15/gal (2007$, $58.50/ton feedstock cost) and the conversion target of $1.41/gal through core research and process improvements in pretreatment, enzymatic hydrolysis, and fermentation.

  6. Reducing mortality in HIV-infected infants and achieving the 90–90–90 target through innovative diagnosis approaches

    PubMed Central

    Essajee, Shaffiq; Vojnov, Lara; Penazzato, Martina; Jani, Ilesh; Siberry, George K; Fiscus, Susan A; Markby, Jessica

    2015-01-01

    -to-child transmission. Facility-based SMS printers speed up the return of laboratory results and may be of value for other testing services apart from HIV infant diagnosis. Conclusions New tools and strategies for HIV infant diagnosis could have a significant positive impact on the identification and retention of HIV-infected infants. In order to be most effective, national programmes should carefully consider which ideas to implement and how best to integrate novel strategies into existing systems. There is no single solution that will work everywhere. Rather, a number of approaches need to be considered and should be linked in order to achieve the greatest impact on the continuum of care from testing to treatment. PMID:26639120

  7. Binding of the wheat basic leucine zipper protein EmBP-1 to nucleosomal binding sites is modulated by nucleosome positioning.

    PubMed Central

    Niu, X; Adams, C C; Workman, J L; Guiltinan, M J

    1996-01-01

    To investigate interactions of the basic leucine zipper transcription factor EmBP-1 with its recognition sites in nucleosomal DNA, we reconstituted an abscisic acid response element and a high-affinity binding site for EmBP-1 into human and wheat nucleosome cores in vitro. DNA binding studies demonstrated that nucleosomal elements can be bound by EmBP-1 at reduced affinities relative to naked DNA. EmBP-1 affinity was lowest when the recognition sites were positioned near the center of the nucleosome. Binding was achieved with a truncated DNA binding domain; however, binding of full-length EmBP-1 caused additional strong DNase I hypersensitivity flanking the binding sites. Similar results were observed with nucleosomes reconstituted with either human or wheat histones, demonstrating a conserved mechanism of transcription factor-nucleosome interactions. We conclude that positioning of recognition sequences on a nucleosome may play an important role in regulating interactions of EmBP-1 with its target sites in plant cells. PMID:8837510

  8. Does contemporary vancomycin dosing achieve therapeutic targets in a heterogeneous clinical cohort of critically ill patients? Data from the multinational DALI study

    PubMed Central

    2014-01-01

    Introduction The objective of this study was to describe the pharmacokinetics of vancomycin in ICU patients and to examine whether contemporary antibiotic dosing results in concentrations that have been associated with favourable response. Methods The Defining Antibiotic Levels in Intensive Care (DALI) study was a prospective, multicentre pharmacokinetic point-prevalence study. Antibiotic dosing was as per the treating clinician either by intermittent bolus or continuous infusion. Target trough concentration was defined as ≥15 mg/L and target pharmacodynamic index was defined as an area under the concentration-time curve over a 24-hour period divided by the minimum inhibitory concentration of the suspected bacteria (AUC0–24/MIC ratio) >400 (assuming MIC ≤1 mg/L). Results Data of 42 patients from 26 ICUs were eligible for analysis. A total of 24 patients received vancomycin by continuous infusion (57%). Daily dosage of vancomycin was 27 mg/kg (interquartile range (IQR) 18 to 32), and not different between patients receiving intermittent or continuous infusion. Trough concentrations were highly variable (median 27, IQR 8 to 23 mg/L). Target trough concentrations were achieved in 57% of patients, but more frequently in patients receiving continuous infusion (71% versus 39%; P = 0.038). Also the target AUC0–24/MIC ratio was reached more frequently in patients receiving continuous infusion (88% versus 50%; P = 0.008). Multivariable logistic regression analysis with adjustment by the propensity score could not confirm continuous infusion as an independent predictor of an AUC0–24/MIC >400 (odds ratio (OR) 1.65, 95% confidence interval (CI) 0.2 to 12.0) or a Cmin ≥15 mg/L (OR 1.8, 95% CI 0.4 to 8.5). Conclusions This study demonstrated large interindividual variability in vancomycin pharmacokinetic and pharmacodynamic target attainment in ICU patients. These data suggests that a re-evaluation of current vancomycin dosing recommendations in

  9. BP details new recycling process

    SciTech Connect

    Chynoweth, E.

    1992-04-22

    BP Chemicals (London) is developing a preprocessing thermal cracker for recycling mixed plastics waste as an add-on to existing petrochemicals or refinery complexes. The company is currently discussing the technology with other plastic producers to {open_quotes}move forward together,{close_quotes} say Serge Huybrechts, branch R&D manager at BP Chemicals at Grangemouth. He says the unit would be able to deliver an intermediate feed of similar composition to chemical naphtha for chemical or refinery processes including steam cracking, catalytic cracking, coking, gasification, and hydrocracking. In comparison, pyrolysis gives a range of products, from light gas to heavy aromatics, that are difficult to integrate into existing equipment.

  10. A Rapid, Cost-Effective Method of Assembly and Purification of Synthetic DNA Probes >100 bp

    PubMed Central

    Jensen, Michael A.; Jauregui, Lauren; Davis, Ronald W.

    2012-01-01

    Here we introduce a rapid, cost-effective method of generating molecular DNA probes in just under 15 minutes without the need for expensive, time-consuming gel-extraction steps. As an example, we enzymatically concatenated six variable strands (50 bp) with a common strand sequence (51 bp) in a single pool using Fast-Link DNA ligase to produce 101 bp targets (10 min). Unincorporated species were then filtered out by passing the crude reaction through a size-exclusion column (<5 min). We then compared full-length product yield of crude and purified samples using HPLC analysis; the results of which clearly show our method yields three-quarters that of the crude sample (50% higher than by gel-extraction). And while we substantially reduced the amount of unligated product with our filtration process, higher purity and yield, with an increase in number of stands per reaction (>12) could be achieved with further optimization. Moreover, for large-scale assays, we envision this method to be fully automated with the use of robotics such as the Biomek FX; here, potentially thousands of samples could be pooled, ligated and purified in either a 96, 384 or 1536-well platform in just minutes. PMID:22493688

  11. IGF2BP3 modulates the interaction of invasion-associated transcripts with RISC

    PubMed Central

    Ennajdaoui, Hanane; Howard, Jonathan M.; Sterne-Weiler, Timothy; Jahanbani, Fereshteh; Coyne, Doyle J.; Uren, Philip J.; Dargyte, Marija; Katzman, Sol; Draper, Jolene M.; Wallace, Andrew; Cazarez, Oscar; Burns, Suzanne C.; Qiao, Mei; Hinck, Lindsay; Smith, Andrew D.; Toloue, Masoud M.; Blencowe, Benjamin J.; Penalva, Luiz O.F.; Sanford, Jeremy R.

    2016-01-01

    Summary Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) expression correlates with malignancy. But its role(s) in pathogenesis remain enigmatic. Here, we interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC) cells. Using a combination of genome-wide approaches we identify 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual-nucleotide resolution crosslinking immunoprecipitation (iCLIP) revealed significant overlap of IGF2BP3 and miRNA binding sites. IGF2BP3 promotes association of the RNA induced silencing complex (RISC) with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions. PMID:27210763

  12. IGF2BP3 Modulates the Interaction of Invasion-Associated Transcripts with RISC.

    PubMed

    Ennajdaoui, Hanane; Howard, Jonathan M; Sterne-Weiler, Timothy; Jahanbani, Fereshteh; Coyne, Doyle J; Uren, Philip J; Dargyte, Marija; Katzman, Sol; Draper, Jolene M; Wallace, Andrew; Cazarez, Oscar; Burns, Suzanne C; Qiao, Mei; Hinck, Lindsay; Smith, Andrew D; Toloue, Masoud M; Blencowe, Benjamin J; Penalva, Luiz O F; Sanford, Jeremy R

    2016-05-31

    Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) expression correlates with malignancy, but its role(s) in pathogenesis remains enigmatic. We interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC) cells. Using a combination of genome-wide approaches, we have identified 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation, and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual nucleotide resolution crosslinking immunoprecipitation (iCLIP) revealed significant overlap of IGF2BP3 and microRNA (miRNA) binding sites. IGF2BP3 promotes association of the RNA-induced silencing complex (RISC) with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions. PMID:27210763

  13. Attainment of Canadian Diabetes Association recommended targets in patients with type 2 diabetes

    PubMed Central

    McCrate, Farah; Godwin, Marshall; Murphy, Laura

    2010-01-01

    OBJECTIVE To examine the degree to which targets for diabetes (blood pressure [BP], glycated hemoglobin [HbA1c], and low-density lipoprotein cholesterol [LDL-C]) are achieved in family practices and how these results compare with family physicians’ perceptions of how well targets are being achieved. DESIGN Chart audit and physician survey. SETTING Newfoundland and Labrador. PARTICIPANTS Patients with type 2 diabetes and their family physicians. INTERVENTIONS The charts of 20 patients with type 2 diabetes were randomly chosen from each of 8 family physician practices in St John’s, Nfld, and data were abstracted. All family physicians in the province were surveyed using a modified Dillman method. MAIN OUTCOME MEASURES The most recent HbA1c, LDL-C, and BP measurements listed in each audited chart; surveyed family physicians’ knowledge of the recommended targets for HbA1c, LDL-C, and BP and their estimates of what percentage of their patients were at those recommended targets. RESULTS The chart audit revealed that 20.6% of patients were at the recommended target for BP, 48.1% were at the recommended target for HbA1c, and 17.5% were at the recommended target for LDL-C. When targets were examined collectively, only 2.5% of patients were achieving targets in all 3 areas. The survey found that most family physicians were aware of the recommended targets for BP, LDL-C, and HbA1c. However, their estimates of the percentages of patients in their practices achieving these targets appeared high (59.3% for BP, 58.2% for HbA1c, and 48.4% for LDL-C) compared with the results of the chart audit. CONCLUSION The findings of the chart audit are consistent with other published reports, which have illustrated that a large majority of patients with diabetes fall short of reaching recommended targets for BP, blood glucose, and lipid levels. Although family physicians are knowledgeable about recommended targets, there is a gap between knowledge and clinical outcomes. The reasons for

  14. Achieving Goal Blood Pressure.

    PubMed

    Laurent, Stéphane

    2015-07-01

    Both monotherapy and combination therapy options are appropriate for antihypertensive therapy according to the 2013 European Society of Hypertension (ESH)/European Society of Cardiology (ESC) guidelines. Most patients require more than one agent to achieve blood pressure (BP) control, and adding a second agent is more effective than doubling the dose of existing therapy. The addition of a third agent may be required to achieve adequate BP reductions in some patients. Single-pill fixed-dose combinations (FDCs) allow multiple-drug regimens to be delivered without any negative impact on patient compliance or persistence with therapy. FDCs also have documented beneficial clinical effects and use of FDCs containing two or three agents is recommended by the 2013 ESH/ESC guidelines. PMID:26002423

  15. Oncofetal protein IGF2BP3 facilitates the activity of proto-oncogene protein eIF4E through the destabilization of EIF4E-BP2 mRNA.

    PubMed

    Mizutani, R; Imamachi, N; Suzuki, Y; Yoshida, H; Tochigi, N; Oonishi, T; Suzuki, Y; Akimitsu, N

    2016-07-01

    RNA-binding proteins (RBPs) have important roles in tumorigenesis. Although IGF2BP3, an evolutionally conserved RBP, has been reported as a useful diagnostic marker for various cancers and has been considered a regulator of tumorigenesis, little is known of the function of IGF2BP3 because of lack of information regarding IGF2BP3 target mRNAs. Here, we report the identification of IGF2BP3 target mRNAs and IGF2BP3 function in cancer proliferation. We identified mRNAs with altered expression in IGF2BP3-depleted cells by massive sequencing analysis and IGF2BP3-binding RNAs by immunoprecipitation of IGF2BP3 followed by massive sequencing analysis, resulting in the identification of 110 candidates that are negatively regulated by IGF2BP3. We found that IGF2BP3 destabilized EIF4E-BP2 and MEIS3 mRNAs. Co-immunoprecipitation analysis revealed the interaction between IGF2BP3 and ribonucleases such as XRN2 and exosome component. The retarded proliferation of IGF2BP3-depleted cells was partially rescued by the depletion of EIF4E-BP2, which negatively regulates eukaryotic translation initiation factor 4E (eIF4E), an activator of translation and a well-known proto-oncogene. Consistent with this observation, IGF2BP3 depletion reduced phosphorylated eIF4E, the active form, and translational efficiency of eIF4E target transcripts. Reduction of phosphorylated eIF4E by IGF2BP3 depletion was rescued by EIF4E-BP2 depletion. At last, we found an inverse correlation between the expression level of IGF2BP3 and EIF4E-BP2 in human lung adenocarcinoma tissues. Together, these results suggest that IGF2BP3 promotes eIF4E-mediated translational activation through the reduction of EIF4E-BP2 via mRNA degradation, leading to enhanced cell proliferation. This is the first report demonstrating that IGF2BP3 is an RNA-destabilizing factor. Notably, here we provide the first evidence for the functional linkage between two previously well-known cancer biomarkers, IGF2BP3 and eIF4E. PMID:26522719

  16. Vitamin D-fortified milk achieves the targeted serum 25-hydroxyvitamin D concentration without affecting that of parathyroid hormone in New Zealand toddlers.

    PubMed

    Houghton, Lisa A; Gray, Andrew R; Szymlek-Gay, Ewa A; Heath, Anne-Louise M; Ferguson, Elaine L

    2011-10-01

    For young children, the level of vitamin D required to ensure that most achieve targeted serum 25-hydroxyvitamin D [25(OH)D] ≥50 nmol/L has not been studied. We aimed to investigate the effect of vitamin D-fortified milk on serum 25(OH)D and parathyroid hormone (PTH) concentrations and to examine the dose-response relationship between vitamin D intake from study milks and serum 25(OH)D concentrations in healthy toddlers aged 12-20 mo living in Dunedin, New Zealand (latitude 46°S). Data from a 20-wk, partially blinded, randomized trial that investigated the effect of providing red meat or fortified toddler milk on the iron, zinc, iodine, and vitamin D status in young New Zealand children (n = 181; mean age 17 mo) were used. Adherence to the intervention was assessed by 7-d weighed diaries at wk 2, 7, 11, 15, and 19. Serum 25(OH)D concentration was measured at baseline and wk 20. Mean vitamin D intake provided by fortified milk was 3.7 μg/d (range, 0-10.4 μg/d). After 20 wk, serum 25(OH)D concentrations but not PTH were significantly different in the milk groups. The prevalence of having a serum 25(OH)D <50 nmol/L remained relatively unchanged at 43% in the meat group, whereas it significantly decreased to between 11 and 15% in those consuming fortified study milk. In New Zealand, vitamin D intake in young children is minimal. Our findings indicate that habitual consumption of vitamin D-fortified milk providing a mean intake of nearly 4 μg/d was effective in achieving adequate year-round serum 25(OH)D for most children. PMID:21832027

  17. Split vector systems for ultra-targeted gene delivery: a contrivance to achieve ethical assurance of somatic gene therapy in vivo.

    PubMed

    Tolmachov, Oleg E

    2014-08-01

    Tightly controlled spatial localisation of therapeutic gene delivery is essential to maximize the benefits of somatic gene therapy in vivo and to reduce its undesired effects on the 'bystander' cell populations, most importantly germline cells. Indeed, complete ethical assurance of somatic gene therapy can only be achieved with ultra-targeted gene delivery, which excludes the risk of inadvertent germline gene transfer. Thus, it is desired to supplement existing strategies of physical focusing and biological (cell-specific) targeting of gene delivery with an additional principle for the rigid control over spread of gene transfer within the body. In this paper I advance the concept of 'combinatorial' targeting of therapeutic gene transfer in vivo. I hypothesize that it is possible to engineer complex gene delivery vector systems consisting of several components, each one of them capable of independent spread within the human body but incapable of independent facilitation of gene transfer. As the gene delivery augmented by such split vector systems would be reliant on the simultaneous availability of all the vector system components at a predetermined body site, it is envisaged that higher order reaction kinetics required for the assembly of the functional gene transfer configuration would sharpen spatial localisation of gene transfer via curtailing the blurring effect of the vector spread within the body. A particular implementation of such split vector system could be obtained through supplementing a viral therapeutic gene vector with a separate auxiliary vector carrying a non-integrative and non-replicative form of a gene (e.g., mRNA) coding for a cellular receptor of the therapeutic vector component. Gene-transfer-enabling components of the vector system, which would be delivered separately from the vector component loaded with the therapeutic gene cargo, could also be cell-membrane-insertion-proficient receptors, elements of artificial transmembrane channels

  18. Subepidermal Blistering Induced by Human Autoantibodies to BP180 Requires Innate Immune Players in a Humanized Bullous Pemphigoid Mouse Model

    PubMed Central

    Liu, Zhi; Sui, Wen; Zhao, Minglang; Li, Zhuowei; Li, Ning; Thresher, Randy; Giudice, George J.; Fairley, Janet A.; Sitaru, Cassian; Zillikens, Detlef; Ning, Gang; Marinkovich, Peter; Diaz, Luis A.

    2008-01-01

    Bullous pemphigoid (BP) is a cutaneous autoimmune inflammatory disease associated with subepidermal blistering and autoantibodies against BP180, a transmembrane collagen and major component of the hemidesmosome. Numerous inflammatory cells infiltrate the upper dermis in BP. IgG autoantibodies in BP fix complement and target multiple BP180 epitopes that are highly clustered within a non-collagen linker domain, termed NC16A. Anti-BP180 antibodies induce BP in mice. In this study, we generated a humanized mouse strain, in which the murine BP180NC14A is replaced with the homologous human BP180NC16A epitope cluster region. We show that the humanized NC16A (NC16A+/+) mice injected with anti-BP180NC16A autoantibodies develop BP-like subepidermal blisters. The F(ab′)2 fragments of pathogenic IgG fail to activate complement cascade and are no longer pathogenic. The NC16A+/+ mice pretreated with mast cell activation blocker or depleting of complement or neutrophils become resistant to BP. These findings suggest that the humoral response in BP critically depends on innate immune system players. PMID:18922680

  19. High-Dose Continuous Oxacillin Infusion Results in Achievement of Pharmacokinetics Targets in Critically Ill Patients with Deep Sternal Wound Infections following Cardiac Surgery

    PubMed Central

    Verdier, Marie-Clémence; Launey, Yoann; Malherbe, Alexandre; Dermu, Marine; Piau, Caroline; Flécher, Erwan; Tribut, Olivier; Mallédant, Yannick; Seguin, Philippe

    2014-01-01

    Knowledge regarding antimicrobial therapy strategies in deep sternal wound infections (DSWI) following cardiac surgery is limited. Therefore, we aimed to determine the steady-state plasma and mediastinal concentrations of oxacillin administered by continuous infusion in critically ill patients with DSWI and to compare these concentrations with the susceptibility of staphylococci recovered. A continuous infusion of oxacillin (150 to 200 mg/kg of body weight/24 h) was administered after a loading dose (50 mg/kg). Plasma and mediastinal concentrations of total and unbound oxacillin were determined 4 h after the loading dose (H4) and then at day 1 (H24) and day 2 (H48). Twelve patients were included. Nine patients exhibited bacteremia, 5 were in septic shock, 8 were positive for Staphylococcus aureus, and 4 were positive for coagulase-negative staphylococci. The median MIC (first to third interquartile range) was 0.25 (0.24 to 0.41) mg/liter. Median plasma concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 64.4 (41.4 to 78.5) and 20.4 (12.4 to 30.4) mg/liter, 56.9 (31.4 to 80.6) and 21.7 (6.5 to 27.3) mg/liter, and 57.5 (32.2 to 85.1) and 20 (14.3 to 35.7) mg/liter. The median mediastinal concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 2.3 (0.7 to 25.9) and 0.9 (<0.5 to 15) mg/liter, 29.1 (19.7 to 38.2) and 12.6 (5.9 to 19.8) mg/liter, and 31.6 (14.9 to 42.9) and 17.1 (6.7 to 26.7) mg/liter. High-dose oxacillin delivered by continuous infusion is a valuable strategy to achieve our pharmacokinetic target (4× MIC) at the site of action at H24. But concerns remain in cases of higher MICs, emphasizing the need for clinicians to obtain the MICs for the bacteria and to monitor oxacillin concentrations, especially the unbound forms, at the target site. PMID:24982092

  20. High-dose continuous oxacillin infusion results in achievement of pharmacokinetics targets in critically ill patients with deep sternal wound infections following cardiac surgery.

    PubMed

    Nesseler, Nicolas; Verdier, Marie-Clémence; Launey, Yoann; Malherbe, Alexandre; Dermu, Marine; Piau, Caroline; Flécher, Erwan; Tribut, Olivier; Mallédant, Yannick; Seguin, Philippe

    2014-09-01

    Knowledge regarding antimicrobial therapy strategies in deep sternal wound infections (DSWI) following cardiac surgery is limited. Therefore, we aimed to determine the steady-state plasma and mediastinal concentrations of oxacillin administered by continuous infusion in critically ill patients with DSWI and to compare these concentrations with the susceptibility of staphylococci recovered. A continuous infusion of oxacillin (150 to 200 mg/kg of body weight/24 h) was administered after a loading dose (50 mg/kg). Plasma and mediastinal concentrations of total and unbound oxacillin were determined 4 h after the loading dose (H4) and then at day 1 (H24) and day 2 (H48). Twelve patients were included. Nine patients exhibited bacteremia, 5 were in septic shock, 8 were positive for Staphylococcus aureus, and 4 were positive for coagulase-negative staphylococci. The median MIC (first to third interquartile range) was 0.25 (0.24 to 0.41) mg/liter. Median plasma concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 64.4 (41.4 to 78.5) and 20.4 (12.4 to 30.4) mg/liter, 56.9 (31.4 to 80.6) and 21.7 (6.5 to 27.3) mg/liter, and 57.5 (32.2 to 85.1) and 20 (14.3 to 35.7) mg/liter. The median mediastinal concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 2.3 (0.7 to 25.9) and 0.9 (<0.5 to 15) mg/liter, 29.1 (19.7 to 38.2) and 12.6 (5.9 to 19.8) mg/liter, and 31.6 (14.9 to 42.9) and 17.1 (6.7 to 26.7) mg/liter. High-dose oxacillin delivered by continuous infusion is a valuable strategy to achieve our pharmacokinetic target (4× MIC) at the site of action at H24. But concerns remain in cases of higher MICs, emphasizing the need for clinicians to obtain the MICs for the bacteria and to monitor oxacillin concentrations, especially the unbound forms, at the target site. PMID:24982092

  1. RanBP2 Modulates Cox11 and Hexokinase I Activities and Haploinsufficiency of RanBP2 Causes Deficits in Glucose Metabolism

    PubMed Central

    Guruju, Mallikarjuna; Oswald, John; Raz, Dorit; Bush, Ronald A; Sieving, Paul A; Lu, Xinrong; Bock, Cheryl B; Ferreira, Paulo A

    2006-01-01

    The Ran-binding protein 2 (RanBP2) is a large multimodular and pleiotropic protein. Several molecular partners with distinct functions interacting specifically with selective modules of RanBP2 have been identified. Yet, the significance of these interactions with RanBP2 and the genetic and physiological role(s) of RanBP2 in a whole-animal model remain elusive. Here, we report the identification of two novel partners of RanBP2 and a novel physiological role of RanBP2 in a mouse model. RanBP2 associates in vitro and in vivo and colocalizes with the mitochondrial metallochaperone, Cox11, and the pacemaker of glycolysis, hexokinase type I (HKI) via its leucine-rich domain. The leucine-rich domain of RanBP2 also exhibits strong chaperone activity toward intermediate and mature folding species of Cox11 supporting a chaperone role of RanBP2 in the cytosol during Cox11 biogenesis. Cox11 partially colocalizes with HKI, thus supporting additional and distinct roles in cell function. Cox11 is a strong inhibitor of HKI, and RanBP2 suppresses the inhibitory activity of Cox11 over HKI. To probe the physiological role of RanBP2 and its role in HKI function, a mouse model harboring a genetically disrupted RanBP2 locus was generated. RanBP2−/− are embryonically lethal, and haploinsufficiency of RanBP2 in an inbred strain causes a pronounced decrease of HKI and ATP levels selectively in the central nervous system. Inbred RanBP2+/− mice also exhibit deficits in growth rates and glucose catabolism without impairment of glucose uptake and gluconeogenesis. These phenotypes are accompanied by a decrease in the electrophysiological responses of photosensory and postreceptoral neurons. Hence, RanBP2 and its partners emerge as critical modulators of neuronal HKI, glucose catabolism, energy homeostasis, and targets for metabolic, aging disorders and allied neuropathies. PMID:17069463

  2. Attainment of multifactorial treatment targets among the elderly in a lipid clinic

    PubMed Central

    Barkas, Fotios; Liberopoulos, Evangelos; Klouras, Eleftherios; Liontos, Angelos; Elisaf, Moses

    2015-01-01

    Objective To examine target attainment of lipid-lowering, antihypertensive and antidiabetic treatment in the elderly in a specialist setting of a University Hospital in Greece. Methods This was a retrospective study including consecutive subjects ≥ 65 years old (n = 465) with a follow-up ≥ 3 years. Low-density lipoprotein cholesterol (LDL-C), blood pressure (BP) and glycated hemoglobin (HbA1c) goal achievement were recorded according to European Society of Cardiology/European Atherosclerosis Society (ESC/EAS), European Society of Hypertension (ESH)/ESC and European Association for the Study of Diabetes (EASD) guidelines. Results The LDL-C targets were attained by 27%, 48% and 62% of very high, high and moderate risk patients, respectively. Those receiving statin + ezetimibe achieved higher rates of LDL-C goal achievement compared with those receiving statin monotherapy (48% vs. 33%, P < 0.05). Of the diabetic subjects, 71% had BP < 140/85 mmHg, while 78% of those without diabetes had BP < 140/90 mmHg. A higher proportion of the non-diabetic individuals (86%) had BP < 150/90 mmHg. Also, a higher proportion of those with diabetes had HbA1c < 8% rather than < 7% (88% and 47%, respectively). Of note, almost one out of three non-diabetic individuals and one out of ten diabetic individuals had achieved all three treatment targets. Conclusions Even in a specialist setting of a University Hospital, a high proportion of the elderly remain at suboptimal LDL-C, BP and HbA1c levels. The use of drug combinations could improve multifactorial treatment target attainment, while less strict targets could be more easily achieved in this population. PMID:26089847

  3. Achieved Blood Pressures in the Secondary Prevention of Small Subcortical Strokes (SPS3) Study: Challenges and Lessons Learned

    PubMed Central

    Pergola, Pablo E.; Szychowski, Jeff M.; Talbert, Robert; del Brutto, Oscar; Castellanos, Mar; Graves, John W.; Matamala, Gonzalo; Pretell, Edwin Javier; Yee, Jerry; Rebello, Rosario; Zhang, Yu; Benavente, Oscar R.

    2014-01-01

    BACKGROUND Lowering blood pressure (BP) after stroke remains a challenge, even in the context of clinical trials. The Secondary Prevention of Small Subcortical Strokes (SPS3) BP protocol, BP management during the study, and achieved BPs are described here. METHODS Patients with recent symptomatic lacunar stroke were randomized to 1 of 2 levels of systolic BP (SBP) targets: lower: <130mm Hg, or higher: 130–149mm Hg. SBP management over the course of the trial was examined by race/ethnicity and other baseline conditions. RESULTS Mean SBP decreased for both groups from baseline to the last follow-up, from 142.4 to 126.7mm Hg for the lower SBP target group and from 143.6 to 137.4mm Hg for the higher SBP target group. At baseline, participants in both groups used an average of 1.7±1.2 antihypertensive medications, which increased to a mean of 2.4±1.4 (lower group) and 1.8±1.4 (higher group) by the end-study visit. It took an average of 6 months for patients to reach their SBP target, sustained to the last follow-up. Black participants had the highest proportion of SBP ≥150mm Hg at both study entry (40%) and end-study visit (17%), as compared with whites (9%) and Hispanics (11%). CONCLUSIONS These results show that it is possible to safely lower BP even to a SBP goal <130mm Hg in a variety of patients and settings, including private and academic centers in multiple countries. This provides further support for protocol-driven care in lowering BP and consequently reducing the burden of stroke. PMID:24610884

  4. Genome-wide profiles of CtBP link metabolism with genome stability and epithelial reprogramming in breast cancer

    PubMed Central

    Di, Li-Jun; Byun, Jung S.; Wong, Madeline M.; Wakano, Clay; Taylor, Tara; Bilke, Sven; Baek, Songjoon; Hunter, Kent; Yang, Howard; Lee, Maxwell; Zvosec, Celia; Khramtsova, Galina; Cheng, Fan; Perou, Charles M.; Miller, C. Ryan; Raab, Rachel; Olopade, Olufunmilayo I.; Gardner, Kevin

    2013-01-01

    The C-terminal binding protein (CtBP) is a NADH-dependent transcriptional repressor that links carbohydrate metabolism to epigenetic regulation by recruiting diverse histone modifying complexes to chromatin. Here, global profiling of CtBP in breast cancer cells reveals that it drives epithelial to mesenchymal transition, stem cell pathways, and genome instability. CtBP expression induces mesenchymal and stem cell-like features while CtBP depletion or caloric restriction reverses gene repression and increases DNA repair. Multiple members of the CtBP-targeted gene network are selectively down-regulated in aggressive breast cancer subtypes. Differential expression of CtBP-targeted genes predicts poor clinical outcome in breast cancer patients, and elevated levels of CtBP in patient tumors predict shorter median survival. Finally, both CtBP promoter targeting and gene repression can be reversed by small molecule inhibition. These findings define broad roles for CtBP in breast cancer biology and suggest novel chromatin-based strategies for pharmacologic and metabolic intervention in cancer. PMID:23385593

  5. Role of Transcriptional Corepressor CtBP1 in Prostate Cancer Progression12

    PubMed Central

    Wang, Rui; Asangani, Irfan A; Chakravarthi, Balabhadrapatruni VSK; Ateeq, Bushra; Lonigro, Robert J; Cao, Qi; Mani, Ram-Shankar; Camacho, Daniel F; McGregor, Natalie; Schumann, Taibriana EW; Jing, Xiaojun; Menawat, Radhika; Tomlins, Scott A; Zheng, Heng; Otte, Arie P; Mehra, Rohit; Siddiqui, Javed; Dhanasekaran, Saravana M; Nyati, Mukesh K; Pienta, Kenneth J; Palanisamy, Nallasivam; Kunju, Lakshmi P; Rubin, Mark A; Chinnaiyan, Arul M; Varambally, Sooryanarayana

    2012-01-01

    Transcriptional repressors and corepressors play a critical role in cellular homeostasis and are frequently altered in cancer. C-terminal binding protein 1 (CtBP1), a transcriptional corepressor that regulates the expression of tumor suppressors and genes involved in cell death, is known to play a role in multiple cancers. In this study, we observed the overexpression and mislocalization of CtBP1 in metastatic prostate cancer and demonstrated the functional significance of CtBP1 in prostate cancer progression. Transient and stable knockdown of CtBP1 in prostate cancer cells inhibited their proliferation and invasion. Expression profiling studies of prostate cancer cell lines revealed that multiple tumor suppressor genes are repressed by CtBP1. Furthermore, our studies indicate a role for CtBP1 in conferring radiation resistance to prostate cancer cell lines. In vivo studies using chicken chorioallantoic membrane assay, xenograft studies, and murine metastasis models suggested a role for CtBP1 in prostate tumor growth and metastasis. Taken together, our studies demonstrated that dysregulated expression of CtBP1 plays an important role in prostate cancer progression and may serve as a viable therapeutic target. PMID:23097625

  6. Overexpressed CacyBP/SIP leads to the suppression of growth in renal cell carcinoma

    SciTech Connect

    Sun, Shiren; Ning, Xiaoxuan; Liu, Jie; Liu, Lili; Chen, Yu; Han, Shuang; Zhang, Yanqi; Liang, Jie; Wu, Kaichun; Fan, Daiming . E-mail: fandaim@fmmu.edu.cn

    2007-05-18

    Calcyclin-binding protein/Siah-1-interacting protein (CacyBP/SIP), a target protein of S100, has been identified as a component of a novel ubiquitinylation complex leading to {beta}-catenin degradation, which was found to be related to the malignant phenotypes of gastric cancer. However, the roles of CacyBP/SIP in renal cell carcinoma still remain unclear. In the present study, we had analyzed the expression of the CacyBP/SIP protein in human renal cancer cells and clinical tissue samples. The possible roles of CacyBP/SIP in regulating the malignant phenotype of renal cancer cells were also investigated. The results demonstrated that the expression of CacyBP/SIP was markedly down-regulated in renal cell carcinoma tissues and cell lines. Ectopic overexpression of CacyBP/SIP in A498 cells inhibited the proliferation of this cell and delayed cell cycle progression significantly, which might be related to the down-regulation of Cyclin D1 through reducing {beta}-catenin protein. CacyBP/SIP also suppressed colony formation in soft agar and its tumorigenicity in nude mice. Taken together, our work showed that CacyBP/SIP, as a novel down-regulated gene in renal cell carcinoma, suppressed proliferation and tumorigenesis of renal cancer cells.

  7. Electronic states of BP, BP +, BP -, B 2P 2, B2P2- and B2P2+

    NASA Astrophysics Data System (ADS)

    Linguerri, Roberto; Komiha, Najia; Oswald, Rainer; Mitrushchenkov, Alexander; Rosmus, Pavel

    2008-05-01

    Using augmented sextuple zeta basis sets and internally contracted multireference configuration interaction (MRCI) wavefunctions, potential energy, electric dipole and transition moments have been computed for the X 3Π, a 1Σ +, b 1Π and A 3Σ - states of BP, X 2Σ + and A 2Π states of BP - and X 4Σ - and A 4Π states of BP +. From these data spectroscopic constants, radiative transition probabilities and photoelectron spectra of BP - and BP have been evaluated. The non-vanishing spin-orbit coupling elements between the four low lying triplet and singlet states of the neutral BP have also been calculated from MRCI wavefunctions. The treatment of the corresponding perturbations in the manifold of dense rovibrational states in the three lowest states would require a precise knowledge of the electronic excitation energies. Our best singlet-triplet separations (X-a) are calculated to be 2412 cm -1 (MRCI) and 2482 cm -1 (restricted coupled cluster with perturbative triples (RCCSD(T))) with an estimated error bound of about ±200 cm -1. All three states have long radiative lifetimes with cascading among the rovibrational levels of different states. The ionization energy IE e of BP is calculated to be 9.22 eV (MRCI) and 9.48 eV (RCCSD(T)), the electron affinity EA e 2.51 eV (MRCI) and 2.74 eV (RCCSD(T)). The photoelectron spectra of BP and BP - have been obtained from the Franck-Condon factors of the MRCI potentials. For the UV spectroscopy the dipole allowed radiative transition probabilities are given for A 3Σ - ↔ X 3Π, b 1Π ↔ a 1Σ + of BP, A 2Π ↔ X 2Σ + of BP - and A 4Π ↔ X 4Σ - of BP +. The ionization energy IE e of B 2P 2 of 8.71 eV and the electron affinity EA e of 2.34 eV have been calculated by the RCCSD(T)/aVQZ approach. Also the harmonic vibrational wavenumbers for the electronic ground states of the ions B2P2+ and B2P2- are given.

  8. The adaptor 3BP2 is required for KIT receptor expression and human mast cell survival

    PubMed Central

    Ainsua-Enrich, Erola; Serrano-Candelas, Eva; Álvarez-Errico, Damiana; Picado, César; Sayós, Joan; Rivera, Juan; Martín, Margarita

    2015-01-01

    3BP2 is a cytoplasmic adaptor protein that acts as a positive regulator in mast cell FcεRI-dependent signaling. The KIT receptor whose ligand is the stem cell factor (SCF) is necessary for mast cell development, proliferation and survival as well as for optimal IgE-dependent signal. Activating mutations in KIT have been associated with several diseases including mastocytosis. In the present work, we found that 3BP2 silencing impairs KIT signaling pathways, thus affecting PI3K and MAP kinase pathways in human mast cells from HMC-1, LAD2 (human mast cell lines) and CD34+-derived mast cells. Unexpectedly, silencing of 3BP2 reduces KIT expression in normal human mast cells as well as in HMC-1 cells where KIT is mutated, thus increasing cellular apoptosis and caspase 3/7 activity. 3BP2 silencing reduces KIT transcription expression levels. Interestingly, 3BP2 silencing decreased MITF expression, a transcription factor involved in KIT expression. Reconstitution of 3BP2 in knockdown cells leads to reversal of KIT expression as well as survival phenotype. Accordingly MITF reconstitution enhances KIT expression levels in 3BP2 silenced cells. Moreover, downregulation of KIT expression by miRNA221 overexpression or the proteasome inhibitor bortezomib also reduced 3BP2 and MITF expression. Furthermore, KIT tyrosine activity inhibition reduced 3BP2 and MITF expression, demonstrating again a tight and reciprocal relationship between these molecules. Taken together, our results show that 3BP2 regulates human mast cell survival and participates in KIT-mediated signal transduction by directly controlling KIT receptor expression, suggesting its potential as a therapeutic target in mast cell-mediated inflammatory diseases and deregulated KIT disorders. PMID:25810396

  9. BP: synthesis and properties of boron phosphide

    NASA Astrophysics Data System (ADS)

    Woo, Katherine; Lee, Kathleen; Kovnir, Kirill

    2016-07-01

    Cubic boron phosphide, BP, is notorious for its difficult synthesis, thus preventing it from being a widely used material in spite of having numerous favorable technological properties. In the current work, three different methods of synthesis are developed and compared: from the high temperature reaction of elements, Sn flux assisted synthesis, and a solid state metathesis reaction. Structural and optical properties of the products synthesized from the three methods were thoroughly characterized. Solid state metathesis is shown to be the cleanest and most efficient method in terms of reaction temperature and time. Synthesis by Sn flux resulted in a novel Sn-doped BP compound. Undoped BP samples exhibit an optical bandgap of ∼2.2 eV while Sn-doped BP exhibits a significantly smaller bandgap of 1.74 eV. All synthesized samples show high stability in concentrated hydrochloric acid, saturated sodium hydroxide solutions, and fresh aqua regia.

  10. Solution NMR Structure of the Ca2+-bound N-terminal Domain of CaBP7

    PubMed Central

    McCue, Hannah V.; Patel, Pryank; Herbert, Andrew P.; Lian, Lu-Yun; Burgoyne, Robert D.; Haynes, Lee P.

    2012-01-01

    Calcium-binding protein 7 (CaBP7) is a member of the calmodulin (CaM) superfamily that harbors two high affinity EF-hand motifs and a C-terminal transmembrane domain. CaBP7 has been previously shown to interact with and modulate phosphatidylinositol 4-kinase III-β (PI4KIIIβ) activity in in vitro assays and affects vesicle transport in neurons when overexpressed. Here we show that the N-terminal domain (NTD) of CaBP7 is sufficient to mediate the interaction of CaBP7 with PI4KIIIβ. CaBP7 NTD encompasses the two high affinity Ca2+ binding sites, and structural characterization through multiangle light scattering, circular dichroism, and NMR reveals unique properties for this domain. CaBP7 NTD binds specifically to Ca2+ but not Mg2+ and undergoes significant conformational changes in both secondary and tertiary structure upon Ca2+ binding. The Ca2+-bound form of CaBP7 NTD is monomeric and exhibits an open conformation similar to that of CaM. Ca2+-bound CaBP7 NTD has a solvent-exposed hydrophobic surface that is more expansive than observed in CaM or CaBP1. Within this hydrophobic pocket, there is a significant reduction in the number of methionine residues that are conserved in CaM and CaBP1 and shown to be important for target recognition. In CaBP7 NTD, these residues are replaced with isoleucine and leucine residues with branched side chains that are intrinsically more rigid than the flexible methionine side chain. We propose that these differences in surface hydrophobicity, charge, and methionine content may be important in determining highly specific interactions of CaBP7 with target proteins, such as PI4KIIIβ. PMID:22989873

  11. Reaching Grid Parity Using BP Solar Crystalline Silicon Technology: A Systems Class Application

    SciTech Connect

    Cunningham, Daniel W; Wohlgemuth, John; Carlson, David E; Clark, Roger F; Gleaton, Mark; Posbic, John P; Zahler, James

    2010-12-06

    The primary target market for this program was the residential and commercial PV markets, drawing on BP Solar's premium product and service offerings, brand and marketing strength, and unique routes to market. These two markets were chosen because: (1) in 2005 they represented more than 50% of the overall US PV market; (2) they are the two markets that will likely meet grid parity first; and (3) they are the two market segments in which product development can lead to the added value necessary to generate market growth before reaching grid parity. Federal investment in this program resulted in substantial progress toward the DOE TPP target, providing significant advancements in the following areas: (1) Lower component costs particularly the modules and inverters. (2) Increased availability and lower cost of silicon feedstock. (3) Product specifically developed for residential and commercial applications. (4) Reducing the cost of installation through optimization of the products. (5) Increased value of electricity in mid-term to drive volume increases, via the green grid technology. (6) Large scale manufacture of PV products in the US, generating increased US employment in manufacturing and installation. To achieve these goals BP Solar assembled a team that included suppliers of critical materials, automated equipment developers/manufacturers, inverter and other BOS manufacturers, a utility company, and University research groups. The program addressed all aspects of the crystalline silicon PV business from raw materials (particularly silicon feedstock) through installation of the system on the customers site. By involving the material and equipment vendors, we ensured that supplies of silicon feedstock and other PV specific materials like encapsulation materials (EVA and cover glass) will be available in the quantities required to meet the DOE goals of 5 to 10 GW of installed US PV by 2015 and at the prices necessary for PV systems to reach grid parity in 2015

  12. Single peptide ligand-functionalized uniform hollow mesoporous silica nanoparticles achieving dual-targeting drug delivery to tumor cells and angiogenic blood vessel cells

    PubMed Central

    Liu, Yang; Chen, Qing; Xu, Ming; Guan, Guannan; Hu, Wen; Liang, Ying; Zhao, Xiuli; Qiao, Mingxi; Chen, Dawei; Liu, Hao

    2015-01-01

    Background The purpose of this study was to construct hollow mesoporous silica nanoparticles (HMSN) decorated with tLyp-1 peptide (tHMSN) for dual-targeting drug delivery to tumor cells and angiogenic blood vessel cells. Methods HMSN were synthesized de novo using a novel cationic surfactant-assisted selective etching strategy and were then modified with tLyp-1. Multiple methods, including transmission electron microscopy, X-ray photoelectron spectroscopy, thermogravimetric analysis, bicinchoninic acid assay, and nitrogen adsorption and desorption isotherms, were used to characterize the tHMSN. Doxorubicin were chosen as the model cargo, and the uptake of doxorubicin-loaded tHMSN into MDA-MB-231 cells and human umbilical vein endothelial cells (HUVECs), as models of tumor cells and tumor neovascular endothelial cells, respectively, were observed and detected by confocal laser scanning microscopy and flow cytometry. An in vitro pharmacodynamic study and a study of the mechanism via which the nanoparticles were endocytosed were also performed. Results HMSN with a highly uniform size and well oriented mesopores were synthesized. After tHMSN were characterized, enhanced uptake of the cargo carried by tHMSN into MDA-MB-231 cells and HUVECs compared with that of their unmodified counterparts was validated by confocal laser scanning microscopy and flow cytometry at the qualitative and quantitative levels, respectively. Further, the pharmacodynamic study suggested that, compared with their unmodified counterparts, doxorubicin-loaded tHMSN had an enhanced inhibitory effect on MDA-MB-231 cells and HUVECs in vitro. Finally, a preliminary study on the mechanism by which the nanoparticles were endocytosed indicated that the clathrin-mediated endocytosis pathway has a primary role in the transport of tHMSN into the cytoplasm. Conclusion tHMSN might serve as an effective active targeting nanocarrier strategy for anti-mammary cancer drug delivery. PMID:25834425

  13. Target Blood Pressure in Patients with Diabetes: Asian Perspective.

    PubMed

    Park, Sungha; Kario, Kazuomi; Park, Chang Gyu; Huang, Qi Fang; Cheng, Hao Min; Hoshide, Satoshi; Wang, Ji Guang; Chen, Chen Huan

    2016-11-01

    Recently, the Action to Control Cardiovascular Risk in Diabetes (ACCORD) blood pressure (BP) trial enrolled 4733 participants with type 2 diabetes and randomized them to a target systolic blood pressure (SBP) of less than 120 mm Hg or 140 mm Hg. Despite the significant difference in the achieved SBP, there was no significant difference in the incidence of primary outcomes. Based on this evidence, the target SBP for diabetics has been revised in the majority of major guidelines. However, there is a steeper association between SBP and stroke in Asians than other ethnicities, with stroke being the leading cause of cardiovascular mortality. This suggests that target BP in the Asian region should be tailored towards prevention of stroke. In the ACCORD study, the intensive BP treatment was associated with significant reductions in both total stroke and non-fatal stroke. The results from the ACCORD study are supported by a subgroup analysis from the ONgoing Telmisartan Alone and in combination with Ramipril Global Endpoint Trial (ONTARGET) study, which showed that, in diabetic patients, the risk of stroke continues to decrease to a SBP value of 115 mm Hg with no evidence of J curve. As diabetes is highly associated with underlying coronary artery disease, there is a justified concern for adverse effects resulting from too much lowering of BP. In a post hoc analysis of 6400 diabetic subjects enrolled in the International Verapamil SR-Trandolapril (INVEST) study, subjects with SBP of less than 110 mm Hg were associated with a significant increase in all-cause mortality. In the ONTARGET study, at any levels of achieved SBP, diastolic blood pressure (DBP) below 67 mm Hg was associated with increased risk for cardiovascular outcomes. As such, a prudent approach would be to target a SBP of 130-140 mm Hg and DBP of above 60 mm Hg in diabetics with coronary artery disease. In conclusion, hypertension, in association with diabetes, has been found to be significantly correlated

  14. Survey of the bp/tee genes from clinical group A streptococcus isolates in New Zealand - implications for vaccine development.

    PubMed

    Steemson, John D; Moreland, Nicole J; Williamson, Deborah; Morgan, Julie; Carter, Philip E; Proft, Thomas

    2014-12-01

    Group A streptococcus (GAS) is responsible for a wide range of diseases ranging from superficial infections, such as pharyngitis and impetigo, to life-threatening diseases, such as toxic shock syndrome and acute rheumatic fever (ARF). GAS pili are hair-like extensions protruding from the cell surface and consist of highly immunogenic structural proteins: the backbone pilin (BP) and one or two accessory pilins (AP1 and AP2). The protease-resistant BP builds the pilus shaft and has been recognized as the T-antigen, which forms the basis of a major serological typing scheme that is often used as a supplement to M typing. A previous sequence analysis of the bp gene (tee gene) in 39 GAS isolates revealed 15 different bp/tee types. In this study, we sequenced the bp/tee gene from 100 GAS isolates obtained from patients with pharyngitis, ARF or invasive disease in New Zealand. We found 20 new bp/tee alleles and four new bp/tee types/subtypes. No association between bp/tee type and clinical outcome was observed. We confirmed earlier reports that the emm type and tee type are associated strongly, but we also found exceptions, where multiple tee types could be found in certain M/emm type strains, such as M/emm89. We also reported, for the first time, the existence of a chimeric bp/tee allele, which was assigned into a new subclade (bp/tee3.1). A strong sequence conservation of the bp/tee gene was observed within the individual bp/tee types/subtypes (>97 % sequence identity), as well as between historical and contemporary New Zealand and international GAS strains. This temporal and geographical sequence stability provided further evidence for the potential use of the BP/T-antigen as a vaccine target. PMID:25190737

  15. Translation control during prolonged mTORC1 inhibition mediated by 4E-BP3.

    PubMed

    Tsukumo, Yoshinori; Alain, Tommy; Fonseca, Bruno D; Nadon, Robert; Sonenberg, Nahum

    2016-01-01

    Targeting mTORC1 is a highly promising strategy in cancer therapy. Suppression of mTORC1 activity leads to rapid dephosphorylation of eIF4E-binding proteins (4E-BP1-3) and subsequent inhibition of mRNA translation. However, how the different 4E-BPs affect translation during prolonged use of mTOR inhibitors is not known. Here we show that the expression of 4E-BP3, but not that of 4E-BP1 or 4E-BP2, is transcriptionally induced during prolonged mTORC1 inhibition in vitro and in vivo. Mechanistically, our data reveal that 4E-BP3 expression is controlled by the transcription factor TFE3 through a cis-regulatory element in the EIF4EBP3 gene promoter. CRISPR/Cas9-mediated EIF4EBP3 gene disruption in human cancer cells mitigated the inhibition of translation and proliferation caused by prolonged treatment with mTOR inhibitors. Our findings show that 4E-BP3 is an important effector of mTORC1 and a robust predictive biomarker of therapeutic response to prolonged treatment with mTOR-targeting drugs in cancer. PMID:27319316

  16. Translation control during prolonged mTORC1 inhibition mediated by 4E-BP3

    PubMed Central

    Tsukumo, Yoshinori; Alain, Tommy; Fonseca, Bruno D.; Nadon, Robert; Sonenberg, Nahum

    2016-01-01

    Targeting mTORC1 is a highly promising strategy in cancer therapy. Suppression of mTORC1 activity leads to rapid dephosphorylation of eIF4E-binding proteins (4E-BP1–3) and subsequent inhibition of mRNA translation. However, how the different 4E-BPs affect translation during prolonged use of mTOR inhibitors is not known. Here we show that the expression of 4E-BP3, but not that of 4E-BP1 or 4E-BP2, is transcriptionally induced during prolonged mTORC1 inhibition in vitro and in vivo. Mechanistically, our data reveal that 4E-BP3 expression is controlled by the transcription factor TFE3 through a cis-regulatory element in the EIF4EBP3 gene promoter. CRISPR/Cas9-mediated EIF4EBP3 gene disruption in human cancer cells mitigated the inhibition of translation and proliferation caused by prolonged treatment with mTOR inhibitors. Our findings show that 4E-BP3 is an important effector of mTORC1 and a robust predictive biomarker of therapeutic response to prolonged treatment with mTOR-targeting drugs in cancer. PMID:27319316

  17. Fuel and vehicle technology choices for passenger vehicles in achieving stringent CO2 targets: connections between transportation and other energy sectors.

    PubMed

    Grahn, M; Azar, C; Williander, M I; Anderson, J E; Mueller, S A; Wallington, T J

    2009-05-01

    The regionalized Global Energy Transition (GET-R 6.0) model has been modified to include a detailed description of light-duty vehicle options and used to investigate the potential impact of carbon capture and storage (CCS) and concentrating solar power (CSP) on cost-effective fuel/vehicle technologies in a carbon-constrained world. Total CO2 emissions were constrained to achieve stabilization at 400-550 ppm, by 2100, at lowesttotal system cost The dominantfuel/vehicle technologies varied significantly depending on CO2 constraint future cost of vehicle technologies, and availability of CCS and CSP. For many cases, no one technology dominated on a global scale. CCS provides relatively inexpensive low-CO2 electricity and heatwhich prolongs the use of traditional ICEVs. CSP displaces fossil fuel derived electricity, prolongs the use of traditional ICEVs, and promotes electrification of passenger vehicles. In all cases considered, CCS and CSP availability had a major impact on the lowest cost fuel/vehicle technologies, and alternative fuels are needed in response to expected dwindling oil and natural gas supply potential by the end of the century. PMID:19534159

  18. "Kill" the messenger: Targeting of cell-derived microparticles in lupus nephritis.

    PubMed

    Nielsen, Christoffer T; Rasmussen, Niclas S; Heegaard, Niels H H; Jacobsen, Søren

    2016-07-01

    Immune complex (IC) deposition in the glomerular basement membrane (GBM) is a key early pathogenic event in lupus nephritis (LN). The clarification of the mechanisms behind IC deposition will enable targeted therapy in the future. Circulating cell-derived microparticles (MPs) have been proposed as major sources of extracellular autoantigens and ICs and triggers of autoimmunity in LN. The overabundance of galectin-3-binding protein (G3BP) along with immunoglobulins and a few other proteins specifically distinguish circulating MPs in patients with systemic lupus erythematosus (SLE), and this is most pronounced in patients with active LN. G3BP co-localizes with deposited ICs in renal biopsies from LN patients supporting a significant presence of MPs in the IC deposits. G3BP binds strongly to glomerular basement membrane proteins and integrins. Accordingly, MP surface proteins, especially G3BP, may be essential for the deposition of ICs in kidneys and thus for the ensuing formation of MP-derived electron dense structures in the GBM, and immune activation in LN. This review focuses on the notion of targeting surface molecules on MPs as an entirely novel treatment strategy in LN. By targeting MPs, a double hit may be achieved by attenuating both the autoantigenic fueling of immune complexes and the triggering of the adaptive immune system. Thereby, early pathogenic events may be blocked in contrast to current treatment strategies that primarily target and modulate later events in the cellular and humoral immune response. PMID:26970484

  19. Achieving the salt intake target of 6 g/day in the current food supply in free-living adults using two dietary education strategies.

    PubMed

    Ireland, Dani-Maree; Clifton, Peter M; Keogh, Jennifer B

    2010-05-01

    There are national targets for salt intake of 6 g salt/day in Australia and the United States. Despite this, there is limited knowledge about the effectiveness of dietary education in reducing salt intake to this level. The objective of this study was to investigate whether dietary education enabled a reduction in salt consumption. In an 8-week parallel study, 49 healthy free-living adults were recruited from the Adelaide community by newspaper advertisement. In a randomized parallel design, participants received dietary education to choose foods identified by either Australia's National Heart Foundation Tick symbol or by the Food Standards Australia and New Zealand's low-salt guideline of 120 mg sodium/100 g food. Sodium excretion was assessed by 24-hour urinary sodium collections at baseline and weeks 4 and 8. Participants' experiences of following the education strategies were recorded by self-administered questionnaire. These data were collected between August and October 2008. Forty-three participants completed the study. After 8 weeks, urinary sodium excretion decreased from 121+/-50 to 106+/-47 mmol/24 hours (7.3+/-3.0 to 6.4+/-2.8 g salt/24 hours) in the Tick group and from 132+/-44 to 98+/-50 mmol/24 hours (7.9+/-2.6 to 6.0+/-3.0 g salt/24 hours) in the Food Standards Australia New Zealand group (P<0.05, with no between-group difference). Barriers to salt reduction were limited variety and food choice, difficulty when eating out, and increased time associated with identifying foods. In conclusion, dietary sodium reduction is possible among free-living individuals who received dietary advice. PMID:20430138

  20. E4BP4 overexpression: a protective mechanism in CD4+ T cells from SLE patients.

    PubMed

    Zhao, Ming; Liu, Qian; Liang, Gongping; Wang, Litao; Luo, Shuangyan; Tang, Qian; Zhao, Hongjun; Su, Yuwen; Yung, Susan; Chan, Tak Mao; Lu, Qianjin

    2013-03-01

    Systemic lupus erythematosus (SLE) is a prototype autoimmune disease characterized by various immunological abnormalities, including dysregulated activation of T and B lymphocytes, which trigger autoantibody production and immune-complex deposition. E4BP4, also known as NFIL3, has emerged as a major transcription factor that regulates the development and function of immune cells in a number of lineages. E4BP4 has been shown to regulate cytokines expression, and its synthesis is in turn controlled by various cytokines. To date, the roles of E4BP4 in immune dysregulation and autoimmune disorders are unclear. In this study, we demonstrated that E4BP4 expression is increased in CD4(+) T cells isolated from patients with active systemic lupus erythematosus (SLE), especially in patients treated with glucocorticoid (GC). Increased expression of E4BP4 inhibited the activation and self-reactivity of T cells stimulated by anti-CD3/CD28 antibodies. In contrast, the self-reactivity was enhanced in CD4(+) T cells from SLE patients following E4BP4 gene silencing and the production of autoantibody was increased in autologous B cells. We further demonstrated that E4BP4 directly regulated CD40L expression by binding to the promoter region and altering histone acetylation and methylation of the CD40L loci. Taken together, our data provide evidence that E4BP4 can inhibit CD40L expression through epigenetic modifications in the promoter region of CD40L, thus negatively regulating self-reactivity of SLE CD4(+) T cells. Furthermore, our data demonstrate that overexpression of E4BP4 initiates a protective mechanism in SLE CD4(+) T cells, which may be a promising target in the therapy for SLE. PMID:23340290

  1. Identification of a Fragment-like Small Molecule Ligand for the Methyl-lysine Binding Protein, 53BP1

    PubMed Central

    Perfetti, Michael T.; Baughma, Brandi M.; Dickson, Bradley M.; Mu, Yunxiang; Cui, Gaofeng; Mader, Pavel; Dong, Aiping; Norris, Jacqueline L.; Rothbart, Scott B.; Strahl, Brian D.; Brown, Peter J.; Janzen, William P.; Arrowsmith, Cheryl H.; Mer, Georges; McBride, Kevin M.

    2015-01-01

    Improving our understanding of the role of chromatin regulators in the initiation, development, and suppression of cancer and other devastating diseases is critical, as they are integral players in regulating DNA integrity and gene expression. Developing small molecule inhibitors for this target class with cellular activity is a crucial step toward elucidating their specific functions. We specifically targeted the DNA damage response protein, 53BP1, which uses its tandem tudor domain to recognize histone H4 dimethylated on lysine 20 (H4K20me2), a modification induced by double-strand DNA breaks. Through a cross-screening approach we identified UNC2170 (1) as a micromolar ligand of 53BP1, which demonstrates at least 17-fold selectivity for 53BP1 as compared to other methyl-lysine (Kme) binding proteins tested. Structural studies revealed that the tert-butyl amine of UNC2170 anchors the compound in the methyl-lysine (Kme) binding pocket of 53BP1, making it competitive with endogenous Kme substrates. X-ray crystallography also demonstrated that UNC2170 binds at the interface of two tudor domains of a 53BP1 dimer. Importantly, this compound functions as a 53BP1 antagonist in cellular lysates and shows cellular activity by suppressing class switch recombination, a process which requires a functional 53BP1 tudor domain. These results demonstrate that UNC2170 is a functionally active, fragment-like ligand for 53BP1. PMID:25590533

  2. 3-Bromopyruvate: targets and outcomes.

    PubMed

    Shoshan, Maria C

    2012-02-01

    The pyruvate mimetic 3-bromopyruvate (3-BP) is generally presented as an inhibitor of glycolysis and has shown remarkable efficacy in not only preventing tumor growth, but even eradicating existant tumors in animal studies. We here review reported molecular targets of 3-BP and suggest that the very range of possible targets, which pertain to the altered energy metabolism of tumor cells, contributes both to the efficacy and the tumor specificity of the drug. Its in vivo efficacy is suggested to be due to a combination of glycolytic and mitochondrial targets, as well as to secondary effects affecting the tumor microenvironment. The cytotoxicity of 3-BP is less due to pyruvate mimicry than to alkylation of, e.g., key thiols. Alkylation of DNA/RNA has not been reported. More research is warranted to better understand the pharmacokinetics of 3-BP, and its potential toxic effects to normal cells, in particular those that are highly ATP-/mitochondrion-dependent. PMID:22298255

  3. RanBP9 at the intersection between cofilin and Aβ pathologies: rescue of neurodegenerative changes by RanBP9 reduction

    PubMed Central

    Woo, J A; Boggess, T; Uhlar, C; Wang, X; Khan, H; Cappos, G; Joly-Amado, A; De Narvaez, E; Majid, S; Minamide, L S; Bamburg, J R; Morgan, D; Weeber, E; Kang, D E

    2015-01-01

    Molecular pathways underlying the neurotoxicity and production of amyloid β protein (Aβ) represent potentially promising therapeutic targets for Alzheimer's disease (AD). We recently found that overexpression of the scaffolding protein RanBP9 increases Aβ production in cell lines and in transgenic mice while promoting cofilin activation and mitochondrial dysfunction. Translocation of cofilin to mitochondria and induction of cofilin–actin pathology require the activation/dephosphorylation of cofilin by Slingshot homolog 1 (SSH1) and cysteine oxidation of cofilin. In this study, we found that endogenous RanBP9 positively regulates SSH1 levels and mediates Aβ-induced translocation of cofilin to mitochondria and induction of cofilin–actin pathology in cultured cells, primary neurons, and in vivo. Endogenous level of RanBP9 was also required for Aβ-induced collapse of growth cones in immature neurons (days in vitro 9 (DIV9)) and depletion of synaptic proteins in mature neurons (DIV21). In vivo, amyloid precursor protein (APP)/presenilin-1 (PS1) mice exhibited 3.5-fold increased RanBP9 levels, and RanBP9 reduction protected against cofilin–actin pathology, synaptic damage, gliosis, and Aβ accumulation associated with APP/PS1 mice. Brains slices derived from APP/PS1 mice showed significantly impaired long-term potentiation (LTP), and RanBP9 reduction significantly enhanced paired pulse facilitation and LTP, as well as partially rescued contextual memory deficits associated with APP/PS1 mice. Therefore, these results underscore the critical importance of endogenous RanBP9 not only in Aβ accumulation but also in mediating the neurotoxic actions of Aβ at the level of synaptic plasticity, mitochondria, and cofilin–actin pathology via control of the SSH1-cofilin pathway in vivo. PMID:25741591

  4. Characterization of a cancer cell line that expresses a splicing variant form of 53BP1: Separation of checkpoint and repair functions in 53BP1

    SciTech Connect

    Iwabuchi, Kuniyoshi Matsui, Tadashi; Hashimoto, Mitsumasa; Matsumoto, Yoshihisa; Kurihara, Takayuki; Date, Takayasu

    2008-11-21

    53BP1 plays important roles in checkpoint signaling and repair for DNA double-strand breaks. We found that a colon cancer cell line, SW48, expressed a splicing variant form of 53BP1, which lacks the residues corresponding to exons 10 and 11. Activation of ATM and phosphorylation of ATM and ATR targets occurred in SW48 cells in response to X-irradiation, and these X-ray-induced responses were not enhanced by expression of full-length 53BP1 in SW48 cells, indicating that this splicing variant fully activates the major checkpoint signaling in SW48 cells. In contrast, the expression of full-length 53BP1 in SW48 cells promoted the repair of X-ray-induced DNA damage, evidenced by faster disappearance of X-ray-induced {gamma}-H2AX foci, a marker for DNA damage, and less residual chromosomal aberrations after X-irradiation. We conclude that the two major roles of 53BP1, the checkpoint signaling and repair for DNA damage, can be functionally separated.

  5. Structural plasticity of methyllysine recognition by the tandem Tudor domain of 53BP1

    PubMed Central

    Tong, Qiong; Cui, Gaofeng; Botuyan, Maria Victoria; Rothbart, Scott B.; Hayashi, Ryo; Musselman, Catherine A.; Singh, Namit; Appella, Ettore; Strahl, Brian D.; Mer, Georges; Kutateladze, Tatiana G.

    2014-01-01

    SUMMARY p53 is dynamically regulated through various posttranslational modifications (PTMs), which differentially modulate its function and stability. The dimethylated marks p53K370me2 and p53K382me2 are associated with p53 activation or stabilization and both are recognized by the tandem Tudor domain (TTD) of 53BP1, a p53 co-factor. Here we detail the molecular mechanisms for the recognition of p53K370me2 and p53K382me2 by 53BP1. The solution structures of TTD in complex with the p53K370me2 and p53K382me2 peptides show a remarkable plasticity of 53BP1 in accommodating these diverse dimethyllysine-containing sequences. We demonstrate that dimeric TTDs are capable of interacting with the two PTMs on a single p53K370me2K382me2 peptide, greatly strengthening the 53BP1-p53 interaction. Analysis of binding affinities of TTD toward methylated p53 and histones reveals strong preference of 53BP1 for p53K382me2, H4K20me2, and H3K36me2 and suggests a possible role of multivalent contacts of 53BP1 in p53 targeting to and accumulation at the sites of DNA damage. PMID:25579814

  6. Drosophila Longevity Assurance Conferred by Reduced Insulin Receptor Substrate Chico Partially Requires d4eBP

    PubMed Central

    Bai, Hua; Post, Stephanie; Kang, Ping; Tatar, Marc

    2015-01-01

    Mutations of the insulin/IGF signaling (IIS) pathway extend Drosophila lifespan. Based on genetic epistasis analyses, this longevity assurance is attributed to downstream effects of the FOXO transcription factor. However, as reported FOXO accounts for only a portion of the observed longevity benefit, suggesting there are additional outputs of IIS to mediate aging. One candidate is target of rapamycin complex 1 (TORC1). Reduced TORC1 activity is reported to slow aging, whereas reduced IIS is reported to repress TORC1 activity. The eukaryotic translation initiation factor 4E binding protein (4E-BP) is repressed by TORC1, and activated 4E-BP is reported to increase Drosophila lifespan. Here we use genetic epistasis analyses to test whether longevity assurance mutants of chico, the Drosophila insulin receptor substrate homolog, require Drosophila d4eBP to slow aging. In chico heterozygotes, which are robustly long-lived, d4eBP is required but not sufficient to slow aging. Remarkably, d4eBP is not required or sufficient for chico homozygotes to extend longevity. Likewise, chico heterozygote females partially require d4eBP to preserve age-dependent locomotion, and both chico genotypes require d4eBP to improve stress-resistance. Reproduction and most measures of growth affected by either chico genotype are always independent of d4eBP. In females, chico heterozygotes paradoxically produce more rather than less phosphorylated 4E-BP (p4E-BP). Altered IRS function within the IIS pathway of Drosophila appears to have partial, conditional capacity to regulate aging through an unconventional interaction with 4E-BP. PMID:26252766

  7. The Nedd4-binding partner 1 (N4BP1) protein is an inhibitor of the E3 ligase Itch.

    PubMed

    Oberst, Andrew; Malatesta, Martina; Aqeilan, Rami I; Rossi, Mario; Salomoni, Paolo; Murillas, Rodolfo; Sharma, Prashant; Kuehn, Michael R; Oren, Moshe; Croce, Carlo M; Bernassola, Francesca; Melino, Gerry

    2007-07-01

    Nedd4-binding partner-1 (N4BP1) has been identified as a protein interactor and a substrate of the homologous to E6AP C terminus (HECT) domain-containing E3 ubiquitin-protein ligase (E3), Nedd4. Here, we describe a previously unrecognized functional interaction between N4BP1 and Itch, a Nedd4 structurally related E3, which contains four WW domains, conferring substrate-binding activity. We show that N4BP1 association with the second WW domain (WW2) of Itch interferes with E3 binding to its substrates. In particular, we found that N4BP1 and p73 alpha, a target of Itch-mediated ubiquitin/proteasome proteolysis, share the same binding site. By competing with p73 alpha for binding to the WW2 domain, N4BP1 reduces the ability of Itch to recruit and ubiquitylate p73 alpha and inhibits Itch autoubiquitylation activity both in in vitro and in vivo ubiquitylation assays. Similarly, both c-Jun and p63 polyubiquitylation by Itch are inhibited by N4BP1. As a consequence, genetic and RNAi knockdown of N4BP1 diminish the steady-state protein levels and significantly impair the transcriptional activity of Itch substrates. Notably, stress-induced induction of c-Jun was impaired in N4BP1(-/-) cells. These results demonstrate that N4BP1 functions as a negative regulator of Itch. In addition, because inhibition of Itch by N4BP1 results in the stabilization of crucial cell death regulators such as p73 alpha and c-Jun, it is conceivable that N4BP1 may have a role in regulating tumor progression and the response of cancer cells to chemotherapy. PMID:17592138

  8. PEP-1-FK506BP inhibits alkali burn-induced corneal inflammation on the rat model of corneal alkali injury.

    PubMed

    Kim, Dae Won; Lee, Sung Ho; Shin, Min Jea; Kim, Kibom; Ku, Sae Kwang; Youn, Jong Kyu; Cho, Su Bin; Park, Jung Hwan; Lee, Chi Hern; Son, Ora; Sohn, Eun Jeong; Cho, Sung-Woo; Park, Jong Hoon; Kim, Hyun Ah; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

    2015-11-01

    FK506 binding protein 12 (FK506BP) is a small peptide with a single FK506BP domain that is involved in suppression of immune response and reactive oxygen species. FK506BP has emerged as a potential drug target for several inflammatory diseases. Here, we examined the protective effects of directly applied cell permeable FK506BP (PEP-1-FK506BP) on corneal alkali burn injury (CAI). In the cornea, there was a significant decrease in the number of cells expressing pro-inflammation, apoptotic, and angiogenic factors such as TNF-α, COX-2, and VEGF. Both corneal opacity and corneal neovascularization (CNV) were significantly decreased in the PEP-1-FK506BP treated group. Our results showed that PEP-1-FK506BP can significantly inhibit alkali burn-induced corneal inflammation in rats, possibly by accelerating corneal wound healing and by reducing the production of angiogenic factors and inflammatory cytokines. These results suggest that PEP-1-FK506BP may be a potential therapeutic agent for CAI. PMID:25817214

  9. PEP-1-FK506BP inhibits alkali burn-induced corneal inflammation on the rat model of corneal alkali injury

    PubMed Central

    Kim, Dae Won; Lee, Sung Ho; Shin, Min Jea; Kim, Kibom; Ku, Sae Kwang; Youn, Jong Kyu; Cho, Su Bin; Park, Jung Hwan; Lee, Chi Hern; Son, Ora; Sohn, Eun Jeong; Cho, Sung-Woo; Park, Jong Hoon; Kim, Hyun Ah; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

    2015-01-01

    FK506 binding protein 12 (FK506BP) is a small peptide with a single FK506BP domain that is involved in suppression of immune response and reactive oxygen species. FK506BP has emerged as a potential drug target for several inflammatory diseases. Here, we examined the protective effects of directly applied cell permeable FK506BP (PEP-1-FK506BP) on corneal alkali burn injury (CAI). In the cornea, there was a significant decrease in the number of cells expressing pro-inflammation, apoptotic, and angiogenic factors such as TNF-α, COX-2, and VEGF. Both corneal opacity and corneal neovascularization (CNV) were significantly decreased in the PEP-1-FK506BP treated group. Our results showed that PEP-1-FK506BP can significantly inhibit alkali burn-induced corneal inflammation in rats, possibly by accelerating corneal wound healing and by reducing the production of angiogenic factors and inflammatory cytokines. These results suggest that PEP-1-FK506BP may be a potential therapeutic agent for CAI. [BMB Reports 2015; 48(11): 618-623] PMID:25817214

  10. 2014 Eighth Joint National Committee Panel Recommendation for Blood Pressure Targets Revisited

    PubMed Central

    Bangalore, Sripal; Gong, Yan; Cooper-DeHoff, Rhonda M.; Pepine, Carl J.; Messerli, Franz H.

    2014-01-01

    BACKGROUND The 2014 Eighth Joint National Committee panel recommendations for management of high blood pressure (BP) recommend a systolic BP threshold for initiation of drug therapy and a therapeutic target of <150 mm Hg in those ≥60 years of age, a departure from prior recommendations of <140 mm Hg. However, it is not known whether this is an optimal choice, especially for the large population with coronary artery disease (CAD). OBJECTIVES This study sought to evaluate optimal BP in patients ≥60 years of age. METHODS Patients 60 years of age or older with CAD and baseline systolic BP >150 mm Hg randomized to a treatment strategy on the basis of either atenolol/hydrochlorothiazide or verapamil-SR (sustained release)/trandolapril in INVEST (INternational VErapamil SR Trandolapril STudy) were categorized into 3 groups on the basis of achieved on-treatment systolic BP: group 1, <140 mm Hg; group 2, 140 to <150 mm Hg; and group 3, ≥150 mm Hg. Primary outcome was first occurrence of all-cause death, nonfatal myocardial infarction (MI), or nonfatal stroke. Secondary outcomes were all-cause mortality, cardiovascular mortality, total MI, nonfatal MI, total stroke, nonfatal stroke, heart failure, or revascularization, tabulated separately. Outcomes for each group were compared in unadjusted and multiple propensity score–adjusted models. RESULTS Among 8,354 patients included in this analysis with an accumulated 22,308 patient-years of follow-up, 4,787 (57%) achieved systolic BP of <140 mm Hg (group 1), 1,747 (21%) achieved systolic BP of 140 to <150 mm Hg (group 2), and 1,820 (22%) achieved systolic BP of ≥150 mm Hg (group 3). In unadjusted models, group 1 had the lowest rates of the primary outcome (9.36% vs. 12.71% vs. 21.32%; p < 0.0001), all-cause mortality (7.92% vs. 10.07% vs. 16.81%; p < 0.0001), cardiovascular mortality (3.26% vs. 4.58% vs. 7.80%; p < 0.0001), MI (1.07% vs. 1.03% vs. 2.91%; p < 0.0001), total stroke (1.19% vs. 2.63% vs. 3.85%; p <0

  11. The 15q11.2 BP1–BP2 Microdeletion Syndrome: A Review

    PubMed Central

    Cox, Devin M.; Butler, Merlin G.

    2015-01-01

    Patients with the 15q11.2 BP1–BP2 microdeletion can present with developmental and language delay, neurobehavioral disturbances and psychiatric problems. Autism, seizures, schizophrenia and mild dysmorphic features are less commonly seen. The 15q11.2 BP1–BP2 microdeletion involving four genes (i.e., TUBGCP5, CYFIP1, NIPA1, NIPA2) is emerging as a recognized syndrome with a prevalence ranging from 0.57%–1.27% of patients presenting for microarray analysis which is a two to four fold increase compared with controls. Review of clinical features from about 200 individuals were grouped into five categories and included developmental (73%) and speech (67%) delays; dysmorphic ears (46%) and palatal anomalies (46%); writing (60%) and reading (57%) difficulties, memory problems (60%) and verbal IQ scores ≤75 (50%); general behavioral problems, unspecified (55%) and abnormal brain imaging (43%). Other clinical features noted but not considered as common were seizures/epilepsy (26%), autism spectrum disorder (27%), attention deficit disorder (ADD)/attention deficit hyperactivity disorder (ADHD) (35%), schizophrenia/paranoid psychosis (20%) and motor delay (42%). Not all individuals with the deletion are clinically affected, yet the collection of findings appear to share biological pathways and presumed genetic mechanisms. Neuropsychiatric and behavior disturbances and mild dysmorphic features are associated with genomic imbalances of the 15q11.2 BP1–BP2 region, including microdeletions, but with an apparent incomplete penetrance and variable expressivity. PMID:25689425

  12. Asiago spectroscopic classification of ASASSN-16bp

    NASA Astrophysics Data System (ADS)

    Tomasella, L.; Pastorello, A.; Benetti, S.; Cappellaro, E.; Elias-Rosa, N.; Ochner, P.; Tartaglia, L.; Terreran, G.; Turatto, M.

    2016-02-01

    The Asiago Transient Classification Program (Tomasella et al. 2014, AN, 335, 841) reports the spectroscopic classification of ASASSN-16bp ( = AT 2016adq), discovered by All Sky Automated Survey for SuperNovae ASAS-SN (see Shappee et al. 2014, ApJ, 788, 48 and http://www.astronomy.ohio-state.edu/~assassin/index.shtml ), in CGCG 336-041 (Atel #8666) The observation was performed with the Asiago 1.82 m Copernico Telescope (+AFOSC; range 340-820 nm; resolution 1.4 nm). Name | Discovery UT | Obs. Date UT |z | Type | Phase |Notes ASASSN-16bp | 20160209.61 | 20160211.11 |0.034194 | Ia | ~10d | (1) (1) Also known as SN2016adq in CGCG 336-041 (z=0.034194, d=145 Mpc, via NED).

  13. [EFFICACY OF STANDARD TWO-YEAR COMPREHENSIVE THERAPY TO ACHIEVE TARGET BLOOD PRESSURE AND REGRESSION DEGREES OF REMODELING OF THE LEFT VENTRICULAR HYPERTROPHY IN PATIENTS AFTER ACUTE MYOCARDIAL INFARCTION WITH COMORBID HYPERTENSION].

    PubMed

    Denesiuk, E V

    2015-01-01

    The study involved 23 men after acute myocardial infarction (AMI) with comorbid arterial hypertension (AH). Mean age of patients was 56.7 years. Recurrent myocardial infarction was determined in 38.4%, cardiac failure I-III functional classes--100% of the cases. All patients underwent clinical examination, electrocardiography and echocardiography, blood lipid profile. Standard comprehensive treatment for two years included an perindopril 5-10 mg/day, beta-blocker bisoprolol--5-10 mg/day, antisclerotic drug atorvastatin--20 mg/day and aspirin--75 mg/day. The patients after treatment was determined by a gradual increase towards the target of AT at 3, 6 and 12 to 24 months. Concentric left ventricular hypertrophy (LVH) before treatment was determined in 47.8%, eccentric--in 52.2% of patients. In the study of degrees of LVH I (initial) the extent to treatment was determined by 4.3%, II (moderate)--26.1%, III (large)--at 69.6%, indicating the development of cardiac remodeling. After the treatment was determined by marked reduction III (large) degree and transfer it in the II (moderate) and I (small) degree of left ventricular hypertrophy due to more or less pronounced changes remodeling left ventricular. The obtained data allow a more detailed and adequately assess the structural and functional outcome variables and determine the regression of myocardial hypertrophy in the background to achieve target blood pressure, which is important in practical cardiology. PMID:27491146

  14. Nephrotoxicity of selectively deuterated and methylated analogues of Tris-BP and Bis-BP in the rat.

    PubMed

    Søderlund, E J; Omichinski, J G; Dahl, J E; Nelson, S D; Dybing, E

    1988-03-01

    Selectively deuterated and methylated analogues of the flame retardant tris(2,3-dibromopropyl)phosphate (Tris-BP) and its nephrotoxic metabolite bis(2,3-dibromopropyl)phosphate (Bis-BP) were compared to Tris-BP and Bis-BP in inducing acute renal damage in rats. None of the deuterated Tris-BP or Bis-BP analogues significantly altered morphological evidence of nephrotoxicity compared to the protio compounds. On the other hand, some of the selectively methylated analogues were much less nephrotoxic. Although the C1-methyl analogues of both Tris-BP and Bis-BP were as potent nephrotoxicants as Tris-BP and Bis-BP, respectively, neither the C2-methyl nor the C3-methyl analogues were significantly nephrotoxic. Interestingly, whereas the 3,4-dibromobutyl homologue of Tris-BP was not nephrotoxic, the corresponding 3,4-dibromobutyl-Bis homologue was as nephrotoxic as Bis-BP. Additional investigations with treatments that are known to decrease nephrotoxicity caused by several halogenated alkenes, showed that L-(alpha S,5S)-alpha-amino-3-chloro-4,5-dihydro-5-isoxazoleacetic acid (AT-125) and aminooxyacetic acid were without effects on Tris-BP induced renal damage. Probenecid pretreatment led to a reduction in Tris-BP and Bis-BP tubular necrosis, these effects may be related to inhibition of Bis-BP uptake in the kidney. It appears that the cysteine conjugate beta-lyase pathway is not involved in the generation of nephrotoxic metabolites of Tris-BP. PMID:3375186

  15. 53BP1 deficiency combined with telomere dysfunction activates ATR-dependent DNA damage response.

    PubMed

    Martínez, Paula; Flores, Juana M; Blasco, Maria A

    2012-04-16

    TRF1 protects mammalian telomeres from fusion and fragility. Depletion of TRF1 leads to telomere fusions as well as accumulation of γ-H2AX foci and activation of both the ataxia telangiectasia mutated (ATM)- and the ataxia telangiectasia and Rad3 related (ATR)-mediated deoxyribonucleic acid (DNA) damage response (DDR) pathways. 53BP1, which is also present at dysfunctional telomeres, is a target of ATM that accumulates at DNA double-strand breaks and favors nonhomologous end-joining (NHEJ) repair over ATM-dependent resection and homology-directed repair (homologous recombination [HR]). To address the role of 53BP1 at dysfunctional telomeres, we generated mice lacking TRF1 and 53BP1. 53BP1 deficiency significantly rescued telomere fusions in mouse embryonic fibroblasts (MEFs) lacking TRF1, but they showed evidence of a switch from the NHEJ- to HR-mediated repair of uncapped telomeres. Concomitantly, double-mutant MEFs showed evidence of hyperactivation of the ATR-dependent DDR. In intact mice, combined 53BP1/TRF1 deficiency in stratified epithelia resulted in earlier onset of DNA damage and increased CHK1 phosphorylation during embryonic development, leading to aggravation of skin phenotypes. PMID:22508511

  16. HP1BP3 expression determines maternal behavior and offspring survival.

    PubMed

    Garfinkel, B P; Arad, S; Neuner, S M; Netser, S; Wagner, S; Kaczorowski, C C; Rosen, C J; Gal, M; Soreq, H; Orly, J

    2016-09-01

    Maternal care is an indispensable behavioral component necessary for survival and reproductive success in mammals, and postpartum maternal behavior is mediated by an incompletely understood complex interplay of signals including effects of epigenetic regulation. We approached this issue using our recently established mice with targeted deletion of heterochromatin protein 1 binding protein 3 (HP1BP3), which we found to be a novel epigenetic repressor with critical roles in postnatal growth. Here, we report a dramatic reduction in the survival of pups born to Hp1bp3(-/-) deficient mouse dams, which could be rescued by co-fostering with wild-type dams. Hp1bp3(-/-) females failed to retrieve both their own pups and foster pups in a pup retrieval test, and showed reduced anxiety-like behavior in the open-field and elevated-plus-maze tests. In contrast, Hp1bp3(-/-) females showed no deficits in behaviors often associated with impaired maternal care, including social behavior, depression, motor coordination and olfactory capability; and maintained unchanged anxiety-associated hallmarks such as cholinergic status and brain miRNA profiles. Collectively, our results suggest a novel role for HP1BP3 in regulating maternal and anxiety-related behavior in mice and call for exploring ways to manipulate this epigenetic process. PMID:27470444

  17. Solution NMR structure of the Ca2+-bound N-terminal domain of CaBP7: a regulator of golgi trafficking.

    PubMed

    McCue, Hannah V; Patel, Pryank; Herbert, Andrew P; Lian, Lu-Yun; Burgoyne, Robert D; Haynes, Lee P

    2012-11-01

    Calcium-binding protein 7 (CaBP7) is a member of the calmodulin (CaM) superfamily that harbors two high affinity EF-hand motifs and a C-terminal transmembrane domain. CaBP7 has been previously shown to interact with and modulate phosphatidylinositol 4-kinase III-β (PI4KIIIβ) activity in in vitro assays and affects vesicle transport in neurons when overexpressed. Here we show that the N-terminal domain (NTD) of CaBP7 is sufficient to mediate the interaction of CaBP7 with PI4KIIIβ. CaBP7 NTD encompasses the two high affinity Ca(2+) binding sites, and structural characterization through multiangle light scattering, circular dichroism, and NMR reveals unique properties for this domain. CaBP7 NTD binds specifically to Ca(2+) but not Mg(2+) and undergoes significant conformational changes in both secondary and tertiary structure upon Ca(2+) binding. The Ca(2+)-bound form of CaBP7 NTD is monomeric and exhibits an open conformation similar to that of CaM. Ca(2+)-bound CaBP7 NTD has a solvent-exposed hydrophobic surface that is more expansive than observed in CaM or CaBP1. Within this hydrophobic pocket, there is a significant reduction in the number of methionine residues that are conserved in CaM and CaBP1 and shown to be important for target recognition. In CaBP7 NTD, these residues are replaced with isoleucine and leucine residues with branched side chains that are intrinsically more rigid than the flexible methionine side chain. We propose that these differences in surface hydrophobicity, charge, and methionine content may be important in determining highly specific interactions of CaBP7 with target proteins, such as PI4KIIIβ. PMID:22989873

  18. The RNA Binding Protein Igf2bp1 Is Required for Zebrafish RGC Axon Outgrowth In Vivo

    PubMed Central

    Gaynes, John A.; Otsuna, Hideo; Campbell, Douglas S.; Manfredi, John P.; Levine, Edward M.

    2015-01-01

    Attractive growth cone turning requires Igf2bp1-dependent local translation of β-actin mRNA in response to external cues in vitro. While in vivo studies have shown that Igf2bp1 is required for cell migration and axon terminal branching, a requirement for Igf2bp1 function during axon outgrowth has not been demonstrated. Using a timelapse assay in the zebrafish retinotectal system, we demonstrate that the β-actin 3’UTR is sufficient to target local translation of the photoconvertible fluorescent protein Kaede in growth cones of pathfinding retinal ganglion cells (RGCs) in vivo. Igf2bp1 knockdown reduced RGC axonal outgrowth and tectal coverage and retinal cell survival. RGC-specific expression of a phosphomimetic Igf2bp1 reduced the density of axonal projections in the optic tract while sparing RGCs, demonstrating for the first time that Igf2bp1 is required during axon outgrowth in vivo. Therefore, regulation of local translation mediated by Igf2bp proteins may be required at all stages of axon development. PMID:26325373

  19. An isocorydine derivative (d-ICD) inhibits drug resistance by downregulating IGF2BP3 expression in hepatocellular carcinoma

    PubMed Central

    Ge, Chao; Chen, Lijuan; Fang, Tao; Li, Hong; Tian, Hua; Liu, Junxi; Chen, Taoyang; Jiang, Guoping; Xie, Haiyang; Cui, Ying; Yao, Ming; Li, Jinjun

    2015-01-01

    In our previous studies, we reported that CD133+ cancer stem cells (CSCs) were chemoresistant in hepatocellular carcinoma (HCC) and that isocorydine treatment decreased the percentage of CD133+ CSCs. Here, we found that a derivative of isocorydine (d-ICD) inhibited HCC cell growth, particularly among the CD133+ subpopulation, and rendered HCC cells more sensitive to sorafenib treatment. d-ICD inhibited IGF2BP3 expression in a time-dependent manner, and IGF2BP3 expression negatively correlated with d-ICD-induced growth suppression. IGF2BP3 overexpression enriched the CD133+ CSC subpopulation in HCC, enhanced tumor sphere formation and suppressed the cytotoxic effects of sorafenib and doxorubicin. The expression of drug resistance-related genes, including ABCB1 and ABCG2, and the CSC marker CD133 expression was increased after IGF2BP3 overexpression. The significance of these observations was underscored by our findings that high IGF2BP3 expression predicted poor survival in a cohort of 236 patients with HCC and positively correlated with ABCG2 and CD133 expression in vivo. These results suggested that the d-ICD may inhibit HCC cells growth by IGF2BP3 decrease and that IGF2BP3 may serve as a therapeutic target for HCC. PMID:26327240

  20. Palmitoylation regulates plasma membrane–nuclear shuttling of R7BP, a novel membrane anchor for the RGS7 family

    PubMed Central

    Drenan, Ryan M.; Doupnik, Craig A.; Boyle, Maureen P.; Muglia, Louis J.; Huettner, James E.; Linder, Maurine E.; Blumer, Kendall J.

    2005-01-01

    The RGS7 (R7) family of RGS proteins bound to the divergent Gβ subunit Gβ5 is a crucial regulator of G protein–coupled receptor (GPCR) signaling in the visual and nervous systems. Here, we identify R7BP, a novel neuronally expressed protein that binds R7–Gβ5 complexes and shuttles them between the plasma membrane and nucleus. Regional expression of R7BP, Gβ5, and R7 isoforms in brain is highly coincident. R7BP is palmitoylated near its COOH terminus, which targets the protein to the plasma membrane. Depalmitoylation of R7BP translocates R7BP–R7–Gβ5 complexes from the plasma membrane to the nucleus. Compared with nonpalmitoylated R7BP, palmitoylated R7BP greatly augments the ability of RGS7 to attenuate GPCR-mediated G protein–regulated inward rectifying potassium channel activation. Thus, by controlling plasma membrane nuclear–shuttling of R7BP–R7–Gβ5 complexes, reversible palmitoylation of R7BP provides a novel mechanism that regulates GPCR signaling and potentially transduces signals directly from the plasma membrane to the nucleus. PMID:15897264

  1. Tackling Targets.

    ERIC Educational Resources Information Center

    Further Education Unit, London (England).

    This document is designed to help British training and enterprise councils (TECs) and further education (FE) colleges develop and implement strategies for achieving the National Targets for Education and Training (NTET), which were developed by the Confederation of British Industry in 1992 and endorsed by the British government. The findings from…

  2. Blood pressure telemonitoring is useful to achieve blood pressure control in inadequately treated patients with arterial hypertension.

    PubMed

    Neumann, C L; Menne, J; Rieken, E M; Fischer, N; Weber, M H; Haller, H; Schulz, E G

    2011-12-01

    Failing to reach blood pressure (BP) goals is one of the main problems in hypertension management. Especially in high-risk patients, intensive monitoring including frequently office visits or new techniques to monitor home BP is required. A total of 60 patients with uncontrolled hypertension were included and randomized into a group with telemetric BP monitoring (TBPM) (n=30) and a control group receiving standard care (n=30). During the 3-month study period, patients received in addition to their antihypertensive pre-treatment up to 2 × 300 mg irbesartan to achieve the required target BP. All patients were instructed to measure their BP once daily in the morning. In the TBPM group automatic alerts were generated by the central database server using pre-defined algorithms and patients were subsequently contacted by the physician. At baseline mean 24-h ambulant BP monitoring (ABPM) was 143.3±11.1/82.6±9.9 mm Hg in the TBPM group and 141.4±12.6/82.1±6.5 mm Hg in the standard care group. During treatment mean systolic BP showed a more intensive decrease in the TBPM vs control group (-17.0±11.1 mm Hg vs -9.8±13.7 mm Hg; P=0.032). Patients in the TBPM group had a more pronounced night dipping and a higher reduction of mean pulse pressure than controls (-8.1±5.9 mm Hg vs -2.8±7.4 mm Hg, P=0.004). After 3 months, TBPM-treated patients were given a higher mean daily dose of irbesartan (375±187 mg vs 222±147 mg in controls; P=<0.001). We demonstrated that with TBPM a more effective and faster titration of the antihypertensive agent is possible. The alarm criteria chosen were useful to improve BP control. PMID:21228822

  3. Loss of SH3BP2 function suppresses bone destruction in TNF-driven and collagen-induced arthritis mouse models

    PubMed Central

    Mukai, Tomoyuki; Gallant, Richard; Ishida, Shu; Kittaka, Mizuho; Yoshitaka, Teruhito; Fox, David A.; Morita, Yoshitaka; Nishida, Keiichiro; Rottapel, Robert; Ueki, Yasuyoshi

    2014-01-01

    Objective SH3BP2 is a signaling adapter protein which regulates immune and skeletal systems. The purpose of this study was to investigate the role of SH3BP2 in arthritis in human TNF-α transgenic (hTNFtg) and collagen-induced arthritis (CIA) models. Methods First, SH3BP2-deficient (Sh3bp2–/–) and wild-type (Sh3bp2+/+) mice were crossed with hTNFtg mice. Inflammation and bone loss were examined by clinical inspection and histological and micro-CT analyses. Osteoclastogenesis was evaluated with primary bone marrow-derived M-CSF-dependent macrophages (BMMs). Second, CIA was induced in Sh3bp2–/– and Sh3bp2+/+ mice, and the incidence and severity of arthritis were evaluated. Anti-mouse type II collagen (CII) antibody levels were measured by ELISA. Lymph node cell responses to CII were also determined. Results SH3BP2-deficiency did not alter the severity of joint swelling but suppressed bone erosion in the hTNFtg model. Bone loss of talus and tibia was prevented in Sh3bp2–/–/hTNFtg mice compared to Sh3bp2+/+/hTNFtg mice. RANKL- and TNF-α-induced osteoclastogenesis was suppressed in Sh3bp2–/– BMM cultures. NFATc1 nuclear localization in response to TNF-α was decreased in Sh3bp2–/– BMMs compared to Sh3bp2+/+ BMMs. In the CIA model, SH3BP2-deficiency suppressed the incidence of arthritis, which was associated with decreased anti-CII antibody production, while the antigen-specific T-cell responses in lymph nodes were not significantly different between Sh3bp2+/+ and Sh3bp2–/– mice. Conclusion SH3BP2-deficiency prevents bone loss via impaired osteoclastogenesis in the hTNFtg model and suppresses the induction of arthritis via decreased autoantibody production in the CIA model. Therefore, SH3BP2 could be a therapeutic target for rheumatoid arthritis. PMID:25470448

  4. G3BP1 promotes stress-induced RNA granule interactions to preserve polyadenylated mRNA

    PubMed Central

    Aulas, Anaïs; Caron, Guillaume; Gkogkas, Christos G.; Mohamed, Nguyen-Vi; Destroismaisons, Laurie; Sonenberg, Nahum; Leclerc, Nicole; Parker, J. Alex

    2015-01-01

    G3BP1, a target of TDP-43, is required for normal stress granule (SG) assembly, but the functional consequences of failed SG assembly remain unknown. Here, using both transformed cell lines and primary neurons, we investigated the functional impact of this disruption in SG dynamics. While stress-induced translational repression and recruitment of key SG proteins was undisturbed, depletion of G3BP1 or its upstream regulator TDP-43 disturbed normal interactions between SGs and processing bodies (PBs). This was concomitant with decreased SG size, reduced SG–PB docking, and impaired preservation of polyadenylated mRNA. Reintroduction of G3BP1 alone was sufficient to rescue all of these phenotypes, indicating that G3BP1 is essential for normal SG–PB interactions and SG function. PMID:25847539

  5. A Damage-Independent Role for 53BP1 that Impacts Break Order and Igh Architecture during Class Switch Recombination.

    PubMed

    Rocha, Pedro P; Raviram, Ramya; Fu, Yi; Kim, JungHyun; Luo, Vincent M; Aljoufi, Arafat; Swanzey, Emily; Pasquarella, Alessandra; Balestrini, Alessia; Miraldi, Emily R; Bonneau, Richard; Petrini, John; Schotta, Gunnar; Skok, Jane A

    2016-06-28

    During class switch recombination (CSR), B cells replace the Igh Cμ or δ exons with another downstream constant region exon (CH), altering the antibody isotype. CSR occurs through the introduction of AID-mediated double-strand breaks (DSBs) in switch regions and subsequent ligation of broken ends. Here, we developed an assay to investigate the dynamics of DSB formation in individual cells. We demonstrate that the upstream switch region Sμ is first targeted during recombination and that the mechanism underlying this control relies on 53BP1. Surprisingly, regulation of break order occurs through residual binding of 53BP1 to chromatin before the introduction of damage and independent of its established role in DNA repair. Using chromosome conformation capture, we show that 53BP1 mediates changes in chromatin architecture that affect break order. Finally, our results explain how changes in Igh architecture in the absence of 53BP1 could promote inversional rearrangements that compromise CSR. PMID:27320916

  6. Structural basis for the sequence-specific RNA-recognition mechanism of human CUG-BP1 RRM3

    PubMed Central

    Tsuda, Kengo; Kuwasako, Kanako; Takahashi, Mari; Someya, Tatsuhiko; Inoue, Makoto; Terada, Takaho; Kobayashi, Naohiro; Shirouzu, Mikako; Kigawa, Takanori; Tanaka, Akiko; Sugano, Sumio; Güntert, Peter; Muto, Yutaka; Yokoyama, Shigeyuki

    2009-01-01

    The CUG-binding protein 1 (CUG-BP1) is a member of the CUG-BP1 and ETR-like factors (CELF) family or the Bruno-like family and is involved in the control of splicing, translation and mRNA degradation. Several target RNA sequences of CUG-BP1 have been predicted, such as the CUG triplet repeat, the GU-rich sequences and the AU-rich element of nuclear pre-mRNAs and/or cytoplasmic mRNA. CUG-BP1 has three RNA-recognition motifs (RRMs), among which the third RRM (RRM3) can bind to the target RNAs on its own. In this study, we solved the solution structure of the CUG-BP1 RRM3 by hetero-nuclear NMR spectroscopy. The CUG-BP1 RRM3 exhibited a noncanonical RRM fold, with the four-stranded β-sheet surface tightly associated with the N-terminal extension. Furthermore, we determined the solution structure of the CUG-BP1 RRM3 in the complex with (UG)3 RNA, and discovered that the UGU trinucleotide is specifically recognized through extensive stacking interactions and hydrogen bonds within the pocket formed by the β-sheet surface and the N-terminal extension. This study revealed the unique mechanism that enables the CUG-BP1 RRM3 to discriminate the short RNA segment from other sequences, thus providing the molecular basis for the comprehension of the role of the RRM3s in the CELF/Bruno-like family. PMID:19553194

  7. Inhibition of 4E-BP1 Sensitizes U87 Glioblastoma Xenograft Tumors to Irradiation by Decreasing Hypoxia Tolerance

    SciTech Connect

    Dubois, Ludwig; Magagnin, Michael G.; Cleven, Arjen H.G.; Weppler, Sherry A.; Grenacher, Beat; Landuyt, Willy; Lieuwes, Natasja; Lambin, Philippe; Gorr, Thomas A.; Koritzinsky, Marianne

    2009-03-15

    Purpose: Eukaryotic initiation factor 4E (eIF4E) is an essential rate-limiting factor for cap-dependent translation in eukaryotic cells. Elevated eIF4E activity is common in many human tumors and is associated with disease progression. The growth-promoting effects of eIF4E are in turn negatively regulated by 4E-BP1. However, although 4E-BP1 harbors anti-growth activity, its expression is paradoxically elevated in some tumors. The aim of this study was to investigate the functional role of 4E-BP1 in the context of solid tumors. Methods and Materials: In vitro and in vivo growth properties, hypoxia tolerance, and response to radiation were assessed for HeLa and U87 cells, after stable expression of shRNA specific for 4E-BP1. Results: We found that loss of 4E-BP1 expression did not significantly alter in vitro growth but did accelerate the growth of U87 tumor xenografts, consistent with the growth-promoting function of deregulated eIF4E. However, cells lacking 4E-BP1 were significantly more sensitive to hypoxia-induced cell death in vitro. Furthermore, 4E-BP1 knockdown cells produced tumors more sensitive to radiation because of a reduction in the viable fraction of radioresistant hypoxic cells. Decreased hypoxia tolerance in the 4E-BP1 knockdown tumors was evident by increased cleaved caspase-3 levels and was associated with a reduction in adenosine triphosphate (ATP). Conclusions: Our results suggest that although tumors often demonstrate increases in cap-dependent translation, regulation of this activity is required to facilitate energy conservation, hypoxia tolerance, and tumor radioresistance. Furthermore, we suggest that targeting translational control may be an effective way to target hypoxic cells and radioresistance in metabolically hyperactive tumors.

  8. Recruitment of histone methyltransferase G9a mediates transcriptional repression of Fgf21 gene by E4BP4 protein.

    PubMed

    Tong, Xin; Zhang, Deqiang; Buelow, Katie; Guha, Anirvan; Arthurs, Blake; Brady, Hugh J M; Yin, Lei

    2013-02-22

    The liver responds to fasting-refeeding cycles by reprogramming expression of metabolic genes. Fasting potently induces one of the key hepatic hormones, fibroblast growth factor 21 (FGF21), to promote lipolysis, fatty acid oxidation, and ketogenesis, whereas refeeding suppresses its expression. We previously reported that the basic leucine zipper transcription factor E4BP4 (E4 binding protein 4) represses Fgf21 expression and disrupts its circadian oscillations in cultured hepatocytes. However, the epigenetic mechanism for E4BP4-dependent suppression of Fgf21 has not yet been addressed. Here we present evidence that histone methyltransferase G9a mediates E4BP4-dependent repression of Fgf21 during refeeding by promoting repressive histone modification. We find that Fgf21 expression is up-regulated in E4bp4 knock-out mouse liver. We demonstrate that the G9a-specific inhibitor BIX01294 abolishes suppression of the Fgf21 promoter activity by E4BP4, whereas overexpression of E4bp4 leads to increased levels of dimethylation of histone 3 lysine 9 (H3K9me2) around the Fgf21 promoter region. Furthermore, we also show that E4BP4 interacts with G9a, and knockdown of G9a blocks repression of Fgf21 promoter activity and expression in cells overexpressing E4bp4. A G9a mutant lacking catalytic activity, due to deletion of the SET domain, fails to inhibit the Fgf21 promoter activity. Importantly, acute hepatic knockdown by adenoviral shRNA targeting G9a abolishes Fgf21 repression by refeeding, concomitant with decreased levels of H3K9me2 around the Fgf21 promoter region. In summary, we show that G9a mediates E4BP4-dependent suppression of hepatic Fgf21 by enhancing histone methylation (H3K9me2) of the Fgf21 promoter. PMID:23283977

  9. Interaction with CCNH/CDK7 facilitates CtBP2 promoting esophageal squamous cell carcinoma (ESCC) metastasis via upregulating epithelial-mesenchymal transition (EMT) progression.

    PubMed

    Zhang, Jianguo; Zhu, Junya; Yang, Lei; Guan, Chengqi; Ni, Runzhou; Wang, Yuchan; Ji, Lili; Tian, Ye

    2015-09-01

    CtBP2, as a transcriptional corepressor of epithelial-specific genes, has been reported to promote tumor due to upregulating epithelial-mesenchymal transition (EMT) in cancer cells. CtBP2 was also demonstrated to contribute to the proliferation of esophageal squamous cell carcinoma (ESCC) cells through a negative transcriptional regulation of p16(INK4A). In this study, for the first time, we reported that CtBP2 expression, along with CCNH/CDK7, was higher in ESCC tissues with lymph node metastases than in those without lymph node metastases. Moreover, both CtBP2 and CCNH/CDK7 were positively correlated with E-cadherin, tumor grade, and tumor metastasis. However, the concrete mechanism of CtBP2's role in enhancing ESCC migration remains incompletely understood. We confirmed that CCNH/CDK7 could directly interact with CtBP2 in ESCC cells in vivo and in vitro. Furthermore, our data demonstrate for the first time that CtBP2 enhanced the migration of ESCC cells in a CCNH/CDK7-dependent manner. Our results indicated that CCNH/CDK7-CtBP2 axis may augment ESCC cell migration, and targeting the interaction of both may provide a novel therapeutic target of ESCC. PMID:25820824

  10. Inhibition of HIF-1{alpha} activity by BP-1 ameliorates adjuvant induced arthritis in rats

    SciTech Connect

    Shankar, J.; Thippegowda, P.B.; Kanum, S.A.

    2009-09-18

    Rheumatoid arthritis (RA) is a chronic inflammatory, angiogenic disease. Inflamed synovitis is a hallmark of RA which is hypoxic in nature. Vascular endothelial growth factor (VEGF), one of the key regulators of angiogenesis, is overexpressed in the pathogenesis of RA. VEGF expression is regulated by hypoxia-inducible factor-1{alpha} (HIF-1{alpha}), a master regulator of homeostasis which plays a pivotal role in hypoxia-induced angiogenesis. In this study we show that synthetic benzophenone analogue, 2-benzoyl-phenoxy acetamide (BP-1) can act as a novel anti-arthritic agent in an experimental adjuvant induced arthritis (AIA) rat model by targeting VEGF and HIF-1{alpha}. BP-1 administered hypoxic endothelial cells and arthritic animals clearly showed down regulation of VEGF expression. Further, BP-1 inhibits nuclear translocation of HIF-1{alpha}, which in turn suppresses transcription of the VEGF gene. These results suggest a further possible clinical application of the BP-1 derivative as an anti-arthritic agent in association with conventional chemotherapeutic agents.

  11. FOXO/4E-BP Signaling in Drosophila Muscles Regulates Organism-wide Proteostasis During Aging

    PubMed Central

    Demontis, Fabio; Perrimon, Norbert

    2011-01-01

    SUMMARY The progressive loss of muscle strength during aging is a common degenerative event of unclear pathogenesis. Although muscle functional decline precedes age-related changes in other tissues, its contribution to systemic aging is unknown. Here, we show that muscle aging is characterized in Drosophila by the progressive accumulation of protein aggregates that associate with impaired muscle function. The transcription factor FOXO and its target 4E-BP remove damaged proteins at least in part via the autophagy/lysosome system, while foxo mutants have dysfunctional proteostasis. Both FOXO and 4E-BP delay muscle functional decay and extend lifespan. Moreover, FOXO/4E-BP signaling in muscles decreases feeding behavior and the release of Insulin from producing cells, which in turn delays the age-related accumulation of protein aggregates in other tissues. These findings reveal an organism-wide regulation of proteostasis in response to muscle aging, and a key role of FOXO/4E-BP signaling in the coordination of organismal and tissue aging. PMID:21111239

  12. Trailer siting issues: BP Texas City.

    PubMed

    Kaszniak, Mark; Holmstrom, Donald

    2008-11-15

    On 23 March, 2005, a series of explosions and fires occurred at the BP Texas City refinery during the startup of an isomerization (ISOM) process unit. Fifteen workers were killed and about 180 others were injured. All of the fatalities were contract workers; the deaths and most of the serious injuries occurred in and around temporary office trailers that had been sited near a blowdown drum and stack open to the atmosphere as part of ongoing turnaround activities in an adjacent unit. Due to problems that developed during the ISOM startup, flammable hydrocarbon liquid overfilled the blowdown drum and stack which resulted in a geyser-like release out the top into the atmosphere. The flammable hydrocarbons fell to the ground releasing vapors that were likely ignited from a nearby idling diesel pickup truck. A total of 44 trailers were damaged by the blast pressure wave that propagated through the refinery when the vapor cloud exploded. Thirteen trailers were totally destroyed and workers were injured in trailers as far as 479ft away from the release. The focus of this paper will be on trailer siting issues, including: need for work/office trailers within process units, adequacy of risk analysis methods in API RP 752, and minimum safe distance requirements PMID:18294765

  13. Polarized internal target apparatus

    DOEpatents

    Holt, R.J.

    1984-10-10

    A polarized internal target apparatus with a polarized gas target of improved polarization and density (achieved by mixing target gas atoms with a small amount of alkali metal gas atoms, and passing a high intensity polarized light source into the mixture to cause the alkali metal gas atoms to become polarized which interact in spin exchange collisions with target gas atoms yielding polarized target gas atoms) is described.

  14. Polarized internal target apparatus

    DOEpatents

    Holt, Roy J.

    1986-01-01

    A polarized internal target apparatus with a polarized gas target of improved polarization and density achieved by mixing target gas atoms with a small amount of alkali metal gas atoms, and passing a high intensity polarized light source into the mixture to cause the alkali metal gas atoms to become polarized which interact in spin exchange collisions with target gas atoms yielding polarized target gas atoms.

  15. Yarn Quality Prediction Based on Improved BP Neural Network

    NASA Astrophysics Data System (ADS)

    Yang, Jian-Guo; Xiong, Jing-Wei; Xun, Lan

    Aiming at the key quality indexes xbt in spinning processing is caused by many complex and interactions factors. A xbt prediction model is put forward based on the PSO-BP neural network, which adjusts weights of BP neural network using particle swarm optimization (PSO) rather than the traditional gradient descent method, is used to improve the convergence speed of neural network and the ability of getting the global optimal solution. As the object of a large number of field detection data in a spinning workshop, the results show that, compared with the traditional BP algorithm and GA-BP algorithm, the PSO-BP neural network can obvious improve yarn quality prediction model precision and stability.

  16. Ran Binding Protein 9 (RanBP9) is a novel mediator of cellular DNA damage response in lung cancer cells

    PubMed Central

    Palmieri, Dario; Scarpa, Mario; Tessari, Anna; Uka, Rexhep; Amari, Foued; Lee, Cindy; Richmond, Timothy; Foray, Claudia; Sheetz, Tyler; Braddom, Ashley; Burd, Christin E.; Parvin, Jeffrey D.; Ludwig, Thomas; Croce, Carlo M.; Coppola, Vincenzo

    2016-01-01

    Ran Binding Protein 9 (RanBP9, also known as RanBPM) is an evolutionary conserved scaffold protein present both in the nucleus and the cytoplasm of cells whose biological functions remain elusive. We show that active ATM phosphorylates RanBP9 on at least two different residues (S181 and S603). In response to IR, RanBP9 rapidly accumulates into the nucleus of lung cancer cells, but this nuclear accumulation is prevented by ATM inhibition. RanBP9 stable silencing in three different lung cancer cell lines significantly affects the DNA Damage Response (DDR), resulting in delayed activation of key components of the cellular response to IR such as ATM itself, Chk2, γH2AX, and p53. Accordingly, abrogation of RanBP9 expression reduces homologous recombination-dependent DNA repair efficiency, causing an abnormal activation of IR-induced senescence and apoptosis. In summary, here we report that RanBP9 is a novel mediator of the cellular DDR, whose accumulation into the nucleus upon IR is dependent on ATM kinase activity. RanBP9 absence hampers the molecular mechanisms leading to efficient repair of damaged DNA, resulting in enhanced sensitivity to genotoxic stress. These findings suggest that targeting RanBP9 might enhance lung cancer cell sensitivity to genotoxic anti-neoplastic treatment. PMID:26943034

  17. Characterization of ARF-BP1/HUWE1 Interactions with CTCF, MYC, ARF and p53 in MYC-Driven B Cell Neoplasms

    PubMed Central

    Qi, Chen-Feng; Kim, Yong-Soo; Xiang, Shao; Abdullaev, Ziedulla; Torrey, Ted A.; Janz, Siegfried; Kovalchuk, Alexander L.; Sun, Jiafang; Chen, Delin; Cho, William C.; Gu, Wei; Morse, Herbert C.

    2012-01-01

    Transcriptional activation of MYC is a hallmark of many B cell lineage neoplasms. MYC provides a constitutive proliferative signal but can also initiate ARF-dependent activation of p53 and apoptosis. The E3 ubiquitin ligase, ARF-BP1, encoded by HUWE1, modulates the activity of both the MYC and the ARF-p53 signaling pathways, prompting us to determine if it is involved in the pathogenesis of MYC-driven B cell lymphomas. ARF-BP1 was expressed at high levels in cell lines from lymphomas with either wild type or mutated p53 but not in ARF-deficient cells. Downregulation of ARF-BP1 resulted in elevated steady state levels of p53, growth arrest and apoptosis. Co-immunoprecipitation studies identified a multiprotein complex comprised of ARF-BP1, ARF, p53, MYC and the multifunctional DNA-binding factor, CTCF, which is involved in the transcriptional regulation of MYC, p53 and ARF. ARF-BP1 bound and ubiquitylated CTCF leading to its proteasomal degradation. ARF-BP1 and CTCF thus appear to be key cofactors linking the MYC proliferative and p53-ARF apoptotic pathways. In addition, ARF-BP1 could be a therapeutic target for MYC-driven B lineage neoplasms, even if p53 is inactive, with inhibition reducing the transcriptional activity of MYC for its target genes and stabilizing the apoptosis-promoting activities of p53. PMID:22754359

  18. Repurposing the CRISPR-Cas9 system for targeted DNA methylation.

    PubMed

    Vojta, Aleksandar; Dobrinić, Paula; Tadić, Vanja; Bočkor, Luka; Korać, Petra; Julg, Boris; Klasić, Marija; Zoldoš, Vlatka

    2016-07-01

    Epigenetic studies relied so far on correlations between epigenetic marks and gene expression pattern. Technologies developed for epigenome editing now enable direct study of functional relevance of precise epigenetic modifications and gene regulation. The reversible nature of epigenetic modifications, including DNA methylation, has been already exploited in cancer therapy for remodeling the aberrant epigenetic landscape. However, this was achieved non-selectively using epigenetic inhibitors. Epigenetic editing at specific loci represents a novel approach that might selectively and heritably alter gene expression. Here, we developed a CRISPR-Cas9-based tool for specific DNA methylation consisting of deactivated Cas9 (dCas9) nuclease and catalytic domain of the DNA methyltransferase DNMT3A targeted by co-expression of a guide RNA to any 20 bp DNA sequence followed by the NGG trinucleotide. We demonstrated targeted CpG methylation in a ∼35 bp wide region by the fusion protein. We also showed that multiple guide RNAs could target the dCas9-DNMT3A construct to multiple adjacent sites, which enabled methylation of a larger part of the promoter. DNA methylation activity was specific for the targeted region and heritable across mitotic divisions. Finally, we demonstrated that directed DNA methylation of a wider promoter region of the target loci IL6ST and BACH2 decreased their expression. PMID:26969735

  19. Repurposing the CRISPR-Cas9 system for targeted DNA methylation

    PubMed Central

    Vojta, Aleksandar; Dobrinić, Paula; Tadić, Vanja; Bočkor, Luka; Korać, Petra; Julg, Boris; Klasić, Marija; Zoldoš, Vlatka

    2016-01-01

    Epigenetic studies relied so far on correlations between epigenetic marks and gene expression pattern. Technologies developed for epigenome editing now enable direct study of functional relevance of precise epigenetic modifications and gene regulation. The reversible nature of epigenetic modifications, including DNA methylation, has been already exploited in cancer therapy for remodeling the aberrant epigenetic landscape. However, this was achieved non-selectively using epigenetic inhibitors. Epigenetic editing at specific loci represents a novel approach that might selectively and heritably alter gene expression. Here, we developed a CRISPR-Cas9-based tool for specific DNA methylation consisting of deactivated Cas9 (dCas9) nuclease and catalytic domain of the DNA methyltransferase DNMT3A targeted by co–expression of a guide RNA to any 20 bp DNA sequence followed by the NGG trinucleotide. We demonstrated targeted CpG methylation in a ∼35 bp wide region by the fusion protein. We also showed that multiple guide RNAs could target the dCas9-DNMT3A construct to multiple adjacent sites, which enabled methylation of a larger part of the promoter. DNA methylation activity was specific for the targeted region and heritable across mitotic divisions. Finally, we demonstrated that directed DNA methylation of a wider promoter region of the target loci IL6ST and BACH2 decreased their expression. PMID:26969735

  20. Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus

    PubMed Central

    Muñoz, Inés G.; Prieto, Jesús; Subramanian, Sunita; Coloma, Javier; Redondo, Pilar; Villate, Maider; Merino, Nekane; Marenchino, Marco; D'Abramo, Marco; Gervasio, Francesco L.; Grizot, Sylvestre; Daboussi, Fayza; Smith, Julianne; Chion-Sotinel, Isabelle; Pâques, Frédéric; Duchateau, Philippe; Alibés, Andreu; Stricher, François; Serrano, Luis; Blanco, Francisco J.; Montoya, Guillermo

    2011-01-01

    Homing endonucleases recognize long target DNA sequences generating an accurate double-strand break that promotes gene targeting through homologous recombination. We have modified the homodimeric I-CreI endonuclease through protein engineering to target a specific DNA sequence within the human RAG1 gene. Mutations in RAG1 produce severe combined immunodeficiency (SCID), a monogenic disease leading to defective immune response in the individuals, leaving them vulnerable to infectious diseases. The structures of two engineered heterodimeric variants and one single-chain variant of I-CreI, in complex with a 24-bp oligonucleotide of the human RAG1 gene sequence, show how the DNA binding is achieved through interactions in the major groove. In addition, the introduction of the G19S mutation in the neighborhood of the catalytic site lowers the reaction energy barrier for DNA cleavage without compromising DNA recognition. Gene-targeting experiments in human cell lines show that the designed single-chain molecule preserves its in vivo activity with higher specificity, further enhanced by the G19S mutation. This is the first time that an engineered meganuclease variant targets the human RAG1 locus by stimulating homologous recombination in human cell lines up to 265 bp away from the cleavage site. Our analysis illustrates the key features for à la carte procedure in protein–DNA recognition design, opening new possibilities for SCID patients whose illness can be treated ex vivo. PMID:20846960

  1. Graded Achievement, Tested Achievement, and Validity

    ERIC Educational Resources Information Center

    Brookhart, Susan M.

    2015-01-01

    Twenty-eight studies of grades, over a century, were reviewed using the argument-based approach to validity suggested by Kane as a theoretical framework. The review draws conclusions about the meaning of graded achievement, its relation to tested achievement, and changes in the construct of graded achievement over time. "Graded…

  2. Possible enhancement of BP180 autoantibody production by herpes zoster.

    PubMed

    Kamiya, Koji; Aoyama, Yumi; Suzuki, Takahiro; Niwa, Haruo; Horio, Ai; Nishio, Eiichi; Tokura, Yoshiki

    2016-02-01

    Bullous pemphigoid (BP) is an autoimmune blistering disease caused by autoantibodies against type XVII collagen/BP180 (BP180). Although the mechanisms of autoantibody production remain to be elucidated, herpes virus infections have been identified as a possible triggering factor for pemphigus. We report a case of herpes zoster (HZ) having anti-BP180 serum antibodies. The patient developed sudden-onset, tense blisters and edematous erythema on the right anterior chest, shoulder and upper back. Histopathology showed remarkable degeneration of keratinocytes, acantholysis and blister formation with ballooning cells, indicating herpes virus infection. A polymerase chain reaction analysis of varicella zoster virus (VZV) was positive in crusts and effusions from the skin lesions, confirming the definitive diagnosis of HZ. Notably, we found that the patient had anti-BP180 serum antibodies in association with the occurrence of HZ. After successful treatment with valacyclovir hydrochloride for 7 days, the serum levels of anti-BP180 antibodies decreased in accordance with the improvement of skin lesions. These findings suggest that the production of anti-BP180 antibodies could be triggered by the reactivation of VZV. PMID:26212492

  3. Dufulin Activates HrBP1 to Produce Antiviral Responses in Tobacco

    PubMed Central

    Chen, Zhuo; Zeng, Mengjiao; Song, Baoan; Hou, Chengrui; Hu, Deyu; Li, Xiangyang; Wang, Zhenchao; Fan, Huitao; Bi, Liang; Liu, Jiaju; Yu, Dandan; Jin, Linhong; Yang, Song

    2012-01-01

    Background Dufulin is a new antiviral agent that is highly effective against plant viruses and acts by activating systemic acquired resistance (SAR) in plants. In recent years, it has been used widely to prevent and control tobacco and rice viral diseases in China. However, its targets and mechanism of action are still poorly understood. Methodology/Principal Findings Here, differential in-gel electrophoresis (DIGE) and classical two-dimensional electrophoresis (2-DE) techniques were combined with mass spectrometry (MS) to identify the target of Dufulin. More than 40 proteins were found to be differentially expressed (≥1.5 fold or ≤1.5 fold) upon Dufulin treatment in Nicotiana tabacum K326. Based on annotations in the Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) databases, these proteins were found to be related to disease resistance. Directed acyclic graph (DAG) analysis of the various pathways demonstrated harpin binding protein-1 (HrBP1) as the target of action of Dufulin. Additionally, western blotting, semi-quantitative reverse transcription polymerase chain reaction (RT-PCR), and real time PCR analyses were also conducted to identify the specific mechanism of action of Dufulin. Our results show that activation of HrBP1 triggers the salicylic acid (SA) signaling pathway and thereby produces antiviral responses in the plant host. A protective assay based on lesion counting further confirmed the antiviral activity of Dufulin. Conclusion This study identified HrBP1 as a target protein of Dufulin and that Dufulin can activate the SA signaling pathway to induce host plants to generate antiviral responses. PMID:22662252

  4. Interaction with cyclin H/cyclin-dependent kinase 7 (CCNH/CDK7) stabilizes C-terminal binding protein 2 (CtBP2) and promotes cancer cell migration.

    PubMed

    Wang, Yuchan; Liu, Fang; Mao, Feng; Hang, Qinlei; Huang, Xiaodong; He, Song; Wang, Yingying; Cheng, Chun; Wang, Huijie; Xu, Guangfei; Zhang, Tianyi; Shen, Aiguo

    2013-03-29

    CtBP2 has been demonstrated to possess tumor-promoting capacities by virtue of up-regulating epithelial-mesenchymal transition (EMT) and down-regulating apoptosis in cancer cells. As a result, cellular CtBP2 levels are considered a key factor determining the outcome of oncogenic transformation. How pro-tumorigenic and anti-tumorigenic factors compete for fine-tuning CtBP2 levels is incompletely understood. Here we report that the cyclin H/cyclin-dependent kinase 7 (CCNH/CDK7) complex interacted with CtBP2 in vivo and in vitro. Depletion of either CCNH or CDK7 decreased CtBP2 protein levels by accelerating proteasome-dependent CtBP2 clearance. Further analysis revealed that CCNH/CDK7 competed with the tumor repressor HIPK2 for CtBP2 binding and consequently inhibited phosphorylation and dimerization of CtBP2. Phosphorylation-defective CtBP2 interacted more strongly with CCNH/CDK7 and was more resistant to degradation. Finally, overexpression of CtBP2 increased whereas depletion of CtBP2 dampened the invasive and migratory potential of breast cancer cells. CtBP2 promoted the invasion and migration of breast cancer cells in a CCNH-dependent manner. Taken together, our data have delineated a novel pathway that regulates CtBP2 stability, suggesting that targeting the CCNH/CDK7-CtBP2 axis may yield a viable anti-tumor strategy. PMID:23393140

  5. The oncogenic triangle of HMGA2, LIN28B and IGF2BP1 antagonizes tumor-suppressive actions of the let-7 family

    PubMed Central

    Busch, Bianca; Bley, Nadine; Müller, Simon; Glaß, Markus; Misiak, Danny; Lederer, Marcell; Vetter, Martina; Strauß, Hans-Georg; Thomssen, Christoph; Hüttelmaier, Stefan

    2016-01-01

    The tumor-suppressive let-7 microRNA family targets various oncogene-encoding mRNAs. We identify the let-7 targets HMGA2, LIN28B and IGF2BP1 to form a let-7 antagonizing self-promoting oncogenic triangle. Surprisingly, 3′-end processing of IGF2BP1 mRNAs is unaltered in aggressive cancers and tumor-derived cells although IGF2BP1 synthesis was proposed to escape let-7 attack by APA-dependent (alternative polyadenylation) 3′ UTR shortening. However, the expression of the triangle factors is inversely correlated with let-7 levels and promoted by LIN28B impairing let-7 biogenesis. Moreover, IGF2BP1 enhances the expression of all triangle factors by recruiting the respective mRNAs in mRNPs lacking AGO proteins and let-7 miRNAs. This indicates that the downregulation of let-7, largely facilitated by LIN28B upregulation, and the protection of let-7 target mRNAs by IGF2BP1-directed shielding in mRNPs synergize in enhancing the expression of triangle factors. The oncogenic potential of this triangle was confirmed in ovarian cancer (OC)-derived ES-2 cells transduced with let-7 targeting decoys. In these, the depletion of HMGA2 only diminishes tumor cell growth under permissive conditions. The depletion of LIN28B and more prominently IGF2BP1 severely impairs tumor cell viability, self-renewal and 2D as well as 3D migration. In conclusion, this suggests the targeting of the HMGA2-LIN28B-IGF2BP1 triangle as a promising strategy in cancer treatment. PMID:26917013

  6. The oncogenic triangle of HMGA2, LIN28B and IGF2BP1 antagonizes tumor-suppressive actions of the let-7 family.

    PubMed

    Busch, Bianca; Bley, Nadine; Müller, Simon; Glaß, Markus; Misiak, Danny; Lederer, Marcell; Vetter, Martina; Strauß, Hans-Georg; Thomssen, Christoph; Hüttelmaier, Stefan

    2016-05-01

    The tumor-suppressive let-7 microRNA family targets various oncogene-encoding mRNAs. We identify the let-7 targets HMGA2, LIN28B and IGF2BP1 to form a let-7 antagonizing self-promoting oncogenic triangle. Surprisingly, 3'-end processing of IGF2BP1 mRNAs is unaltered in aggressive cancers and tumor-derived cells although IGF2BP1 synthesis was proposed to escape let-7 attack by APA-dependent (alternative polyadenylation) 3' UTR shortening. However, the expression of the triangle factors is inversely correlated with let-7 levels and promoted by LIN28B impairing let-7 biogenesis. Moreover, IGF2BP1 enhances the expression of all triangle factors by recruiting the respective mRNAs in mRNPs lacking AGO proteins and let-7 miRNAs. This indicates that the downregulation of let-7, largely facilitated by LIN28B upregulation, and the protection of let-7 target mRNAs by IGF2BP1-directed shielding in mRNPs synergize in enhancing the expression of triangle factors. The oncogenic potential of this triangle was confirmed in ovarian cancer (OC)-derived ES-2 cells transduced with let-7 targeting decoys. In these, the depletion of HMGA2 only diminishes tumor cell growth under permissive conditions. The depletion of LIN28B and more prominently IGF2BP1 severely impairs tumor cell viability, self-renewal and 2D as well as 3D migration. In conclusion, this suggests the targeting of the HMGA2-LIN28B-IGF2BP1 triangle as a promising strategy in cancer treatment. PMID:26917013

  7. TNKS1BP1 functions in DNA double-strand break repair though facilitating DNA-PKcs autophosphorylation dependent on PARP-1

    PubMed Central

    Zou, Lian-Hong; Shang, Zeng-Fu; Tan, Wei; Liu, Xiao-Dan; Xu, Qin-Zhi; Song, Man; Wang, Yu; Guan, Hua; Zhang, Shi-Meng; Yu, Lan; Zhong, Cai-Gao; Zhou, Ping-Kun

    2015-01-01

    TNKS1BP1 was originally identified as an interaction protein of tankyrase 1, which belongs to the poly(ADP-ribose) polymerase (PARP) superfamily. PARP members play important roles for example in DNA repair, telomere stability and mitosis regulation. Although the TNKS1BP1 protein was considered to be a poly(ADP-ribosyl)ation acceptor of tankyrase 1, its function is still unknown. Here we firstly identified that TNKS1BP1 was up-regulated by ionizing radiation (IR) and the depletion of TNKS1BP1 significantly sensitized cancer cells to IR. Neutral comet assay, pulsed-field gel electrophoresis, and γH2AX foci analysis indicated that TNKS1BP1 is required for the efficient repair of DNA double-strand breaks (DSB). The TNKS1BP1 protein was demonstrated to interact with DNA-dependent protein kinase (DNA-PKcs) and poly(ADP-ribose) polymerase 1 (PARP-1), by co-immunoprecipitation analysis. Moreover, TNKS1BP1 was shown to promote the association of PARP-1 and DNA-PKcs. Overexpression of TNKS1BP1 induced the autophosphorylation of DNA-PKcs/Ser2056 in a PARP-1 dependent manner, which contributed to an increased capability of DNA DSB repair. Inhibition of PARP-1 blocked the TNKS1BP1-mediated DNA-PKcs autophosphorylation and attenuated the PARylation of DNA-PKcs. TNKS1BP1 is a newly described component of the DNA DSB repair machinery, which provides much more mechanistic evidence for the rationale of developing effective anticancer measures by targeting PARP-1 and DNA-PKcs. PMID:25749521

  8. Methanococcus vannielii selenium-binding protein (SeBP): Chemical reactivity of recombinant SeBP produced in Escherichia coli

    PubMed Central

    Patteson, Kemberly G.; Trivedi, Neel; Stadtman, Thressa C.

    2005-01-01

    A selenium-binding protein (SeBP) from Methanococcus vannielii was recently identified, and its gene was isolated and overexpressed in Escherichia coli [Self, W. T., Pierce, R. & Stadtman, T. C. (2004) IUBMB Life 56, 501–507]. SeBP and recombinant SeBP (rSeBP) migrated as ≈42-kDa species on native gels and as ≈33-kDa species on SDS gels. rSeBP consists of identical 8.8-kDa subunits, each containing a single cysteine residue. rSeBP isolated in the absence of reducing agents contained oxidized cysteine (89%) and very little bound selenium (0.05 eq or less per subunit). Complete reduction of the oxidized cysteine residues in rSeBP with Tris(2-carboxyethyl)phosphine required addition of a denaturant, such as 1 M guanidine-hydrochloride. With selenite as the selenium source and the isolated reduced protein as sole reductant, binding of one selenium per tetramer under anaerobic conditions required four cysteine thiol groups, one on each subunit. In the corresponding reaction, with reduced glutathione (GSH), equimolar amounts of selenodiglutathione (GSSeSG) and glutathione disulfide are formed from selenite and 4 GSH. At GSH-to-selenite ratios >4:1, conversion of GSSeSG to a perselenide derivative, GSSe–, occurs. However, with the reduced rSeBP as sole electron donor in the reaction with selenite, further conversion of the R-SSeS-R product apparently did not occur. Prior alkylation of the cysteine thiol groups in reduced rSeBP prevented selenite reduction and selenium binding under comparable conditions. PMID:16103372

  9. Multi-Functional Regulation of 4E-BP Gene Expression by the Ccr4-Not Complex

    PubMed Central

    Okada, Hirokazu; Schittenhelm, Ralf B.; Straessle, Anna; Hafen, Ernst

    2015-01-01

    The mechanistic target of rapamycin (mTOR) signaling pathway is highly conserved from yeast to humans. It senses various environmental cues to regulate cellular growth and homeostasis. Deregulation of the pathway has been implicated in many pathological conditions including cancer. Phosphorylation cascades through the pathway have been extensively studied but not much is known about the regulation of gene expression of the pathway components. Here, we report that the mRNA level of eukaryotic translation initiation factor (eIF) subunit 4E-binding protein (4E-BP) gene, one of the key mTOR signaling components, is regulated by the highly conserved Ccr4-Not complex. RNAi knockdown of Not1, a putative scaffold protein of this protein complex, increases the mRNA level of 4E-BP in Drosophila Kc cells. Examination of the gene expression mechanism using reporter swap constructs reveals that Not1 depletion increases reporter mRNAs with the 3’UTR of 4E-BP gene, but decreases the ones with the 4E-BP promoter region, suggesting that Ccr4-Not complex regulates both degradation and transcription of 4E-BP mRNA. These results indicate that the Ccr4-Not complex controls expression of a single gene at multiple levels and adjusts the magnitude of the total effect. Thus, our study reveals a novel regulatory mechanism of a key component of the mTOR signaling pathway at the level of gene expression. PMID:25793896

  10. Bp'S Baku-Tbilisi-Ceyhan pipeline: the new corporate colonialism.

    PubMed

    Marriott, James; Muttitt, Greg

    2006-01-01

    An international campaign was waged questioning the benefits of BP's Baku-Tbilisi-Ceyhan pipeline in an effort to avoid a "zone of sacrifice" there. This article is an offshoot of that effort and explains the contemporary struggle over the pipeline project. The authors describe the project's background and evaluate the actual and potential impacts of the project in which they consider eight areas. They also assess BP's capacity to confront resistance to the pipeline. PMID:16867890

  11. Magnetically attached sputter targets

    DOEpatents

    Makowiecki, D.M.; McKernan, M.A.

    1994-02-15

    An improved method and assembly for attaching sputtering targets to cathode assemblies of sputtering systems which includes a magnetically permeable material is described. The magnetically permeable material is imbedded in a target base that is brazed, welded, or soldered to the sputter target, or is mechanically retained in the target material. Target attachment to the cathode is achieved by virtue of the permanent magnets and/or the pole pieces in the cathode assembly that create magnetic flux lines adjacent to the backing plate, which strongly attract the magnetically permeable material in the target assembly. 11 figures.

  12. Magnetically attached sputter targets

    DOEpatents

    Makowiecki, Daniel M.; McKernan, Mark A.

    1994-01-01

    An improved method and assembly for attaching sputtering targets to cathode assemblies of sputtering systems which includes a magnetically permeable material. The magnetically permeable material is imbedded in a target base that is brazed, welded, or soldered to the sputter target, or is mechanically retained in the target material. Target attachment to the cathode is achieved by virtue of the permanent magnets and/or the pole pieces in the cathode assembly that create magnetic flux lines adjacent to the backing plate, which strongly attract the magnetically permeable material in the target assembly.

  13. Black Phosphorus (BP) Nanodots for Potential Biomedical Applications.

    PubMed

    Lee, Hyun Uk; Park, So Young; Lee, Soon Chang; Choi, Saehae; Seo, Soonjoo; Kim, Hyeran; Won, Jonghan; Choi, Kyuseok; Kang, Kyoung Suk; Park, Hyun Gyu; Kim, Hee-Sik; An, Ha Rim; Jeong, Kwang-Hun; Lee, Young-Chul; Lee, Jouhahn

    2016-01-13

    Recently, the appeal of 2D black phosphorus (BP) has been rising due to its unique optical and electronic properties with a tunable band gap (≈0.3-1.5 eV). While numerous research efforts have recently been devoted to nano- and optoelectronic applications of BP, no attention has been paid to promising medical applications. In this article, the preparation of BP-nanodots of a few nm to <20 nm with an average diameter of ≈10 nm and height of ≈8.7 nm is reported by a modified ultrasonication-assisted solution method. Stable formation of nontoxic phosphates and phosphonates from BP crystals with exposure in water or air is observed. As for the BP-nanodot crystals' stability (ionization and persistence of fluorescent intensity) in aqueous solution, after 10 d, ≈80% at 1.5 mg mL(-1) are degraded (i.e., ionized) in phosphate buffered saline. They showed no or little cytotoxic cell-viability effects in vitro involving blue- and green-fluorescence cell imaging. Thus, BP-nanodots can be considered a promising agent for drug delivery or cellular tracking systems. PMID:26584654

  14. Mitotic protein kinase CDK1 phosphorylation of mRNA translation regulator 4E-BP1 Ser83 may contribute to cell transformation.

    PubMed

    Velásquez, Celestino; Cheng, Erdong; Shuda, Masahiro; Lee-Oesterreich, Paula J; Pogge von Strandmann, Lisa; Gritsenko, Marina A; Jacobs, Jon M; Moore, Patrick S; Chang, Yuan

    2016-07-26

    Mammalian target of rapamycin (mTOR)-directed eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) phosphorylation promotes cap-dependent translation and tumorigenesis. During mitosis, cyclin-dependent kinase 1 (CDK1) substitutes for mTOR and fully phosphorylates 4E-BP1 at canonical sites (T37, T46, S65, and T70) and the noncanonical S83 site, resulting in a mitosis-specific hyperphosphorylated δ isoform. Colocalization studies with a phospho-S83 specific antibody indicate that 4E-BP1 S83 phosphorylation accumulates at centrosomes during prophase, peaks at metaphase, and decreases through telophase. Although S83 phosphorylation of 4E-BP1 does not affect general cap-dependent translation, expression of an alanine substitution mutant 4E-BP1.S83A partially reverses rodent cell transformation induced by Merkel cell polyomavirus small T antigen viral oncoprotein. In contrast to inhibitory mTOR 4E-BP1 phosphorylation, these findings suggest that mitotic CDK1-directed phosphorylation of δ-4E-BP1 may yield a gain of function, distinct from translation regulation, that may be important in tumorigenesis and mitotic centrosome function. PMID:27402756

  15. Mitotic protein kinase CDK1 phosphorylation of mRNA translation regulator 4E-BP1 Ser83 may contribute to cell transformation

    PubMed Central

    Velásquez, Celestino; Cheng, Erdong; Shuda, Masahiro; Lee-Oesterreich, Paula J.; Pogge von Strandmann, Lisa; Gritsenko, Marina A.; Jacobs, Jon M.; Moore, Patrick S.; Chang, Yuan

    2016-01-01

    Mammalian target of rapamycin (mTOR)-directed eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) phosphorylation promotes cap-dependent translation and tumorigenesis. During mitosis, cyclin-dependent kinase 1 (CDK1) substitutes for mTOR and fully phosphorylates 4E-BP1 at canonical sites (T37, T46, S65, and T70) and the noncanonical S83 site, resulting in a mitosis-specific hyperphosphorylated δ isoform. Colocalization studies with a phospho-S83 specific antibody indicate that 4E-BP1 S83 phosphorylation accumulates at centrosomes during prophase, peaks at metaphase, and decreases through telophase. Although S83 phosphorylation of 4E-BP1 does not affect general cap-dependent translation, expression of an alanine substitution mutant 4E-BP1.S83A partially reverses rodent cell transformation induced by Merkel cell polyomavirus small T antigen viral oncoprotein. In contrast to inhibitory mTOR 4E-BP1 phosphorylation, these findings suggest that mitotic CDK1-directed phosphorylation of δ-4E-BP1 may yield a gain of function, distinct from translation regulation, that may be important in tumorigenesis and mitotic centrosome function. PMID:27402756

  16. Speech recognition method based on genetic vector quantization and BP neural network

    NASA Astrophysics Data System (ADS)

    Gao, Li'ai; Li, Lihua; Zhou, Jian; Zhao, Qiuxia

    2009-07-01

    Vector Quantization is one of popular codebook design methods for speech recognition at present. In the process of codebook design, traditional LBG algorithm owns the advantage of fast convergence, but it is easy to get the local optimal result and be influenced by initial codebook. According to the understanding that Genetic Algorithm has the capability of getting the global optimal result, this paper proposes a hybrid clustering method GA-L based on Genetic Algorithm and LBG algorithm to improve the codebook.. Then using genetic neural networks for speech recognition. consequently search a global optimization codebook of the training vector space. The experiments show that neural network identification method based on genetic algorithm can extricate from its local maximum value and the initial restrictions, it can show superior to the standard genetic algorithm and BP neural network algorithm from various sources, and the genetic BP neural networks has a higher recognition rate and the unique application advantages than the general BP neural network in the same GA-VQ codebook, it can achieve a win-win situation in the time and efficiency.

  17. Prevalence of the 4977-bp and 4408-bp mitochondrial DNA deletions in mesenteric arteries from patients with colorectal cancer.

    PubMed

    Li, Tao; Chen, Gui-Lan; Lan, Huan; Mao, Liang; Zeng, Bo

    2016-09-01

    Mitochondrial DNA (mtDNA) deletions are found in many diseased tissues and lead to impairment of mitochondrial functions. In this study, we found wide presence of the common 4977-bp and a novel 4408-bp deletion in the mtDNA of mesenteric arteries from patients with colorectal cancer. These two deletions were also detected in samples from healthy individuals. The content of mtDNA with the 4977-bp deletion was significantly lower in healthy controls than cancer-associated samples, and there was no significant difference for the 4408-bp deletion between the two groups. These results suggest that mtDNA in blood vessels around cancer cells may be strongly affected by oxidative stress and tend to accumulate more large-scale variations. PMID:26332461

  18. What Are Optimal Blood Pressure Targets for Patients with Hypertension and Chronic Kidney Disease?

    PubMed

    Modi, Gopesh K; Agarwal, Rajiv

    2015-11-01

    To maximize the risk benefit ratio of blood pressure control in people with chronic kidney diseases (CKD), a number of guidelines provide recommendations on optimal blood pressure (BP) targets in CKD. This review examines these guidelines, their supporting evidence base, and generalizability and limitations of current standards of care. Over the years, the BP targets are liberalized. They now focus on the usual BP target of <140/90 mmHg. In the elderly, where guidelines call for a target of <150/90 mmHg in the general population, the recommendations provide room for the clinician to tailor therapy. Among those with albuminuria of >300 mg/g creatinine, low-quality evidence suggests targeting BP to <130/90 mmHg. Individualization of BP lowering is a key based on comorbid conditions, response to treatment, and level of kidney function. Consideration of out of clinic BP monitoring either implemented by home BP recordings or ambulatory BP measurements may enhance BP control. PMID:26374454

  19. E4BP4 expression is regulated by the t(17;19)-associated oncoprotein E2A-HLF in pro-B cells.

    PubMed

    Yeung, Jenny; O'Sullivan, Elaine; Hubank, Mike; Brady, Hugh J M

    2004-06-01

    The E4BP4 basic leucine zipper (bZIP) transcription factor is regulated by interleukin-3 (IL-3) in pro-B cells and has been reported to promote survival of the murine IL-3-dependent pro-B cell lines, FL5.12 and Baf-3. The E2A-HLF oncoprotein arises from a t(17;19) translocation in childhood pro-B cell acute lymphoblastic leukaemia and acts as an anti-apoptotic factor in FL5.12 and Baf-3 cells. To assess the functions of E2A-HLF and E4BP4 in cell survival, a tetracycline-inducible system was established in Baf-3 cells to express E4BP4 or E2A-HLF. Upon IL-3 withdrawal, expression of E2A-HLF conferred resistance to apoptosis whereas overexpression of E4BP4 did not. E4BP4 and E2A-HLF both recognized the same DNA sequence in reporter gene assays, but had opposite effects on transcription. E2A-HLF acts as a transcriptional activator and E4BP4 as a transcriptional repressor. Furthermore, E4BP4 is a downstream transcriptional target of E2A-HLF. Our data suggests that the overexpression of E4BP4 is unable to block apoptosis induced by IL-3 withdrawal and that the expression of E2A-HLF does not replace the function of E4BP4 in mediating survival. PMID:15147370

  20. Detection of IGF2BP3, HOXB7, and NEK2 mRNA Expression in Brush Cytology Specimens as a New Diagnostic Tool in Patients with Biliary Strictures

    PubMed Central

    Nischalke, Hans Dieter; Schmitz, Volker; Luda, Carolin; Aldenhoff, Katharina; Berger, Cordula; Feldmann, Georg; Sauerbruch, Tilman; Spengler, Ulrich; Nattermann, Jacob

    2012-01-01

    Introduction It is a challenging task to distinguish between benign and malignant lesions in patients with biliary strictures. Here we analyze whether determination of target gene mRNA levels in intraductal brush cytology specimens may be used to improve the diagnosis of bile duct carcinoma. Materials and Methods Brush cytology specimens from 119 patients with biliary strictures (malignant: n = 72; benign: n = 47) were analyzed in a retrospective cohort study. mRNA of IGF-II mRNA-binding protein 3 (IGF2BP3), homeobox B7 (HOXB7), Forkhead box M1 (FOXM1), kinesin family member 2C (KIF2C) and serine/threonine kinase NEK2 was determined by semi-quantitative RT-PCR using the ΔCt method. Results IGF2BP3 (p<0.0001), HOXB7 (p<0.0001), and NEK2 (p<0.0001) mRNA expression levels were significantly increased in patients with cholangiocarcinoma or pancreatic cancer. Median ΔCt values differed by 3.5 cycles (IGF2BP3), 2.8 cycles (HOXB7) and 1.3 cycles (NEK2) corresponding to 11-fold, 7-fold and 2.5-fold increased mRNA levels in malignant versus benign samples. Sensitivity to detect biliary cancer was 76.4% for IGF2BP3 (80.9% specificity); 72.2% for HOXB7 (78.7% specificity) and 65.3% for NEK2 (72.3% specificity), whereas routine cytology reached only 43.1% sensitivity (85.4% specificity). Diagnostic precision was further improved, when all three molecular markers were assessed in combination (77.8% sensitivity, 87.2% specificity) and achieved 87.5% sensitivity and 87.2% specificity when molecular markers were combined with routine cytology. Conclusions Our data suggest that measuring IGF2BP3, HOXB7 and NEK2 mRNA levels by RT-PCR in addition to cytology has the potential to improve detection of malignant biliary disorders from brush cytology specimens. PMID:22879911

  1. Marine04 Marine radiocarbon age calibration, 26 ? 0 ka BP

    SciTech Connect

    Hughen, K; Baille, M; Bard, E; Beck, J; Bertrand, C; Blackwell, P; Buck, C; Burr, G; Cutler, K; Damon, P; Edwards, R; Fairbanks, R; Friedrich, M; Guilderson, T; Kromer, B; McCormac, F; Manning, S; Bronk-Ramsey, C; Reimer, P; Reimer, R; Remmele, S; Southon, J; Stuiver, M; Talamo, S; Taylor, F; der Plicht, J v; Weyhenmeyer, C

    2004-11-01

    New radiocarbon calibration curves, IntCal04 and Marine04, have been constructed and internationally ratified to replace the terrestrial and marine components of IntCal98. The new calibration datasets extend an additional 2000 years, from 0-26 ka cal BP (Before Present, 0 cal BP = AD 1950), and provide much higher resolution, greater precision and more detailed structure than IntCal98. For the Marine04 curve, dendrochronologically dated tree-ring samples, converted with a box-diffusion model to marine mixed-layer ages, cover the period from 0-10.5 ka cal BP. Beyond 10.5 ka cal BP, high-resolution marine data become available from foraminifera in varved sediments and U/Th-dated corals. The marine records are corrected with site-specific {sup 14}C reservoir age information to provide a single global marine mixed-layer calibration from 10.5-26.0 ka cal BP. A substantial enhancement relative to IntCal98 is the introduction of a random walk model, which takes into account the uncertainty in both the calendar age and the radiocarbon age to calculate the underlying calibration curve. The marine datasets and calibration curve for marine samples from the surface mixed layer (Marine04) are discussed here. The tree-ring datasets, sources of uncertainty, and regional offsets are presented in detail in a companion paper by Reimer et al.

  2. In situ SUMOylation analysis reveals a modulatory role of RanBP2 in the nuclear rim and PML bodies

    SciTech Connect

    Saitoh, Noriko . E-mail: hisa@gpo.kumamoto-u.ac.jp; Uchimura, Yasuhiro; Tachibana, Taro; Sugahara, Satoko; Saitoh, Hisato; Nakao, Mitsuyoshi . E-mail: mnakao@gpo.kumamoto-u.ac.jp

    2006-05-01

    SUMO modification plays a critical role in a number of cellular functions including nucleocytoplasmic transport, gene expression, cell cycle and formation of subnuclear structures such as promyelocytic leukemia (PML) bodies. In order to identify the sites where SUMOylation takes place in the cell, we developed an in situ SUMOylation assay using a semi-intact cell system and subsequently combined it with siRNA-based knockdown of nucleoporin RanBP2, also known as Nup358, which is one of the known SUMO E3 proteins. With the in situ SUMOylation assay, we found that both nuclear rim and PML bodies, besides mitotic apparatuses, are major targets for active SUMOylation. The ability to analyze possible SUMO conjugation sites would be a valuable tool to investigate where SUMO E3-like activities and/or SUMO substrates exist in the cell. Specific knockdown of RanBP2 completely abolished SUMOylation along the nuclear rim and dislocated RanGAP1 from the nuclear pore complexes. Interestingly, the loss of RanBP2 markedly reduced the number of PML bodies, in contrast to other, normal-appearing nuclear compartments including the nuclear lamina, nucleolus and chromatin, suggesting a novel link between RanBP2 and PML bodies. SUMOylation facilitated by RanBP2 at the nuclear rim may be a key step for the formation of a particular subnuclear organization. Our data imply that SUMO E3 proteins like RanBP2 facilitate spatio-temporal SUMOylation for certain nuclear structure and function.

  3. Muscle-specific 4E-BP1 signaling activation improves metabolic parameters during aging and obesity.

    PubMed

    Tsai, Shihyin; Sitzmann, Joanna M; Dastidar, Somasish G; Rodriguez, Ariana A; Vu, Stephanie L; McDonald, Circe E; Academia, Emmeline C; O'Leary, Monique N; Ashe, Travis D; La Spada, Albert R; Kennedy, Brian K

    2015-08-01

    Eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) is a key downstream effector of mTOR complex 1 (mTORC1) that represses cap-dependent mRNA translation initiation by sequestering the translation initiation factor eIF4E. Reduced mTORC1 signaling is associated with life span extension and improved metabolic homeostasis, yet the downstream targets that mediate these benefits are unclear. Here, we demonstrated that enhanced 4E-BP1 activity in mouse skeletal muscle protects against age- and diet-induced insulin resistance and metabolic rate decline. Transgenic animals displayed increased energy expenditure; altered adipose tissue distribution, including reduced white adipose accumulation and preserved brown adipose mass; and were protected from hepatic steatosis. Skeletal muscle-specific 4E-BP1 mediated metabolic protection directly through increased translation of peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) and enhanced respiratory function. Non-cell autonomous protection was through preservation of brown adipose tissue metabolism, which was increased in 4E-BP1 transgenic animals during normal aging and in a response to diet-induced type 2 diabetes. Adipose phenotypes may derive from enhanced skeletal muscle expression and secretion of the known myokine FGF21. Unlike skeletal muscle, enhanced adipose-specific 4E-BP1 activity was not protective but instead was deleterious in response to the same challenges. These findings indicate that regulation of 4E-BP1 in skeletal muscle may serve as an important conduit through which mTORC1 controls metabolism. PMID:26121750

  4. Muscle-specific 4E-BP1 signaling activation improves metabolic parameters during aging and obesity

    PubMed Central

    Tsai, Shihyin; Sitzmann, Joanna M.; Dastidar, Somasish G.; Rodriguez, Ariana A.; Vu, Stephanie L.; McDonald, Circe E.; Academia, Emmeline C.; O’Leary, Monique N.; Ashe, Travis D.; La Spada, Albert R.; Kennedy, Brian K.

    2015-01-01

    Eukaryotic translation initiation factor 4E–binding protein 1 (4E-BP1) is a key downstream effector of mTOR complex 1 (mTORC1) that represses cap-dependent mRNA translation initiation by sequestering the translation initiation factor eIF4E. Reduced mTORC1 signaling is associated with life span extension and improved metabolic homeostasis, yet the downstream targets that mediate these benefits are unclear. Here, we demonstrated that enhanced 4E-BP1 activity in mouse skeletal muscle protects against age- and diet-induced insulin resistance and metabolic rate decline. Transgenic animals displayed increased energy expenditure; altered adipose tissue distribution, including reduced white adipose accumulation and preserved brown adipose mass; and were protected from hepatic steatosis. Skeletal muscle–specific 4E-BP1 mediated metabolic protection directly through increased translation of peroxisome proliferator–activated receptor γ coactivator-1α (PGC-1α) and enhanced respiratory function. Non–cell autonomous protection was through preservation of brown adipose tissue metabolism, which was increased in 4E-BP1 transgenic animals during normal aging and in a response to diet-induced type 2 diabetes. Adipose phenotypes may derive from enhanced skeletal muscle expression and secretion of the known myokine FGF21. Unlike skeletal muscle, enhanced adipose-specific 4E-BP1 activity was not protective but instead was deleterious in response to the same challenges. These findings indicate that regulation of 4E-BP1 in skeletal muscle may serve as an important conduit through which mTORC1 controls metabolism. PMID:26121750

  5. Preliminary Geological Findings on the BP-1 Simulant

    NASA Technical Reports Server (NTRS)

    Rickman, D. L.

    2010-01-01

    The following is a summation of information and discussion between Doug Stoeser of the USGS and Doug Rickman of NASA in February and March, 2010 pertaining to the BP-1 simulant. The analytical results and the bulk of the text are from communications from Dr. Stoeser. The BP-1 simulant is made from Black Point Basalt Flow, San Francisco Volcanic Field, northern Arizona. There is an aggregate (road metal) quarry on the northern margin of the flow towards the west end that was used as a Desert Research and Technology Studies (Desert RATS) analog test site. Silty material from this site was also used in laboratory tests and found to have geotechnical properties similar to the LHT-2M and Chenobi regolith simulants and is being proposed as a possible simulant for geotechnical use. It currently has the designation of BP-1 (Black Point 1). Figure

  6. Endothelin-1 and the kidney – beyond BP

    PubMed Central

    Dhaun, Neeraj; Webb, David J; Kluth, David C

    2012-01-01

    Since its discovery over 20 years ago endothelin-1 (ET-1) has been implicated in a number of physiological and pathophysiological processes. Its role in the development and progression of chronic kidney disease (CKD) is well established and is an area of ongoing intense research. There are now available a number of ET receptor antagonists many of which have been used in trials with CKD patients and shown to reduce BP and proteinuria. However, ET-1 has a number of BP-independent effects. Importantly, and in relation to the kidney, ET-1 has clear roles to play in cell proliferation, podocyte dysfunction, inflammation and fibrosis, and arguably, these actions of ET-1 may be more significant in the progression of CKD than its prohypertensive actions. This review will focus on the potential role of ET-1 in renal disease with an emphasis on its BP-independent actions. PMID:22670597

  7. Preliminary Geological Findings on the BP-1 Simulant

    NASA Technical Reports Server (NTRS)

    Stoeser, D. B.; Rickman, D. L.; Wilson, S.

    2010-01-01

    A waste material from an aggregate producing quarry has been used to make an inexpensive lunar simulant called BP-1. The feedstock is the Black Point lava flow in northern Arizona. Although this is part of the San Francisco volcanic field, which is also the source of the JSC-1 series feedstock, BP-1 and JSC-1 are distinct. Chemically, the Black Point flow is an amygdaloidal nepheline-bearing basalt. The amygdules are filled with secondary minerals containing opaline silica, calcium carbonate, and ferric iron minerals. X-ray diffraction (XRD) detected approximately 3% quartz, which is in line with tests done by the Kennedy Space Center Industrial Hygiene Office. Users of this material should use appropriate protective equipment. XRD also showed the presence of significant halite and some bassanite. Both are interpreted to be evaporative residues due to recycling of wash water at the quarry. The size distribution of BP-1 may be superior to some other simulants for some applications.

  8. Immunohistochemical analysis of the Akt/mTOR/4E-BP1 signalling pathway in canine haemangiomas and haemangiosarcomas.

    PubMed

    Murai, A; Abou Asa, S; Kodama, A; Sakai, H; Hirata, A; Yanai, T

    2012-11-01

    The specific signalling pathways that are deregulated in canine endothelial tumours have not yet fully elucidated. Therefore, the aim of the present study was to examine activation of the Akt/mammalian target of rapamycin (mTOR)/eukaryotic initiation factor 4E-binding protein 1 (4E-BP1) signalling pathway in spontaneously arising canine haemangiomas (HAs) and haemangiosarcomas (HSAs) in order to identify novel molecular targets for treatment. Surgically-resected samples of HA (n = 27), HSA (n = 37), granulation tissue (n = 4) and normal skin (n = 4) were investigated by immunohistochemistry. Approximately 80% of the HSA samples had moderate to intense expression of phosphorylated Akt at Ser473 (p-Akt Ser473), p-Akt Thr308, p-4E-BP1 Thr37/46 and eukaryotic initiation factor 4E, which was significantly higher than in the HAs and was similar to the expression in activated endothelial cells (ECs). Although p-mTOR complex1 (p-mTORC1) Ser2448 was expressed by most of the activated ECs, only 35% of the HSA samples had weak to moderate expression. Because mTORC2 and phosphorylates Akt Ser473 was activated in HSA samples, the present findings suggest that the mTORC2/Akt/4E-BP1 pathway, regulated independently of mTORC1, may be important for targeting therapy in canine HSAs. PMID:22789858

  9. Feline Calicivirus Infection Disrupts Assembly of Cytoplasmic Stress Granules and Induces G3BP1 Cleavage

    PubMed Central

    Humoud, Majid N.; Doyle, Nicole; Royall, Elizabeth; Willcocks, Margaret M.; Sorgeloos, Frederic; van Kuppeveld, Frank; Roberts, Lisa O.; Goodfellow, Ian G.; Langereis, Martijn A.

    2016-01-01

    models to understand norovirus biology. Recent studies have suggested that the assembly of stress granules is central in orchestrating stress and antiviral responses to restrict viral replication. Overall, our study provides the first insight on how caliciviruses impair stress granule assembly by targeting the nucleating factor G3BP1 via the viral proteinase NS6Pro. This work provides new insights into host-pathogen interactions that regulate stress pathways during FCV infection. PMID:27147742

  10. BP-Broker use-cases in the UncertWeb framework

    NASA Astrophysics Data System (ADS)

    Roncella, Roberto; Bigagli, Lorenzo; Schulz, Michael; Stasch, Christoph; Proß, Benjamin; Jones, Richard; Santoro, Mattia

    2013-04-01

    The UncertWeb framework is a distributed, Web-based Information and Communication Technology (ICT) system to support scientific data modeling in presence of uncertainty. We designed and prototyped a core component of the UncertWeb framework: the Business Process Broker. The BP-Broker implements several functionalities, such as: discovery of available processes/BPs, preprocessing of a BP into its executable form (EBP), publication of EBPs and their execution through a workflow-engine. According to the Composition-as-a-Service (CaaS) approach, the BP-Broker supports discovery and chaining of modeling resources (and processing resources in general), providing the necessary interoperability services for creating, validating, editing, storing, publishing, and executing scientific workflows. The UncertWeb project targeted several scenarios, which were used to evaluate and test the BP-Broker. The scenarios cover the following environmental application domains: biodiversity and habitat change, land use and policy modeling, local air quality forecasting, and individual activity in the environment. This work reports on the study of a number of use-cases, by means of the BP-Broker, namely: - eHabitat use-case: implements a Monte Carlo simulation performed on a deterministic ecological model; an extended use-case supports inter-comparison of model outputs; - FERA use-case: is composed of a set of models for predicting land-use and crop yield response to climatic and economic change; - NILU use-case: is composed of a Probabilistic Air Quality Forecasting model for predicting concentrations of air pollutants; - Albatross use-case: includes two model services for simulating activity-travel patterns of individuals in time and space; - Overlay use-case: integrates the NILU scenario with the Albatross scenario to calculate the exposure to air pollutants of individuals. Our aim was to prove the feasibility of describing composite modeling processes with a high-level, abstract

  11. 200-BP-5 operable unit treatability test report

    SciTech Connect

    1996-04-01

    The 200-BP-5 Operable Unit was established in response to recommendations presented in the 200 East Groundwater Aggregate Area Management Study Report (AAMSR) (DOE-RL 1993a). Recognizing different approaches to remediation, the groundwater AAMSR recommended separating groundwater from source and vadose zone operable units and subdividing 200 East Area groundwater into two operable units. The division between the 200-BP-5 and 200-PO-1 Operable Units was based principally on source operable unit boundaries and distribution of groundwater plumes derived from either B Plant or Plutonium/Uranium Extraction (PUREX) Plant liquid waste disposal sites.

  12. Pilot-scale treatability test plan for the 200-BP-5 operable unit

    SciTech Connect

    Not Available

    1994-08-01

    This document presents the treatability test plan for pilot-scale pump and treat testing at the 200-BP-5 Operable Unit. This treatability test plan has been prepared in response to an agreement between the U.S. Department of Energy (DOE), the U.S. Environmental Protection Agency (EPA), and the State of Washington Department of Ecology (Ecology), as documented in Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement, Ecology et al. 1989a) Change Control Form M-13-93-03 (Ecology et al. 1994) and a recent 200 NPL Agreement Change Control Form (Appendix A). The agreement also requires that, following completion of the activities described in this test plan, a 200-BP-5 Operable Unit Interim Remedial Measure (IRM) Proposed Plan be developed for use in preparing an Interim Action Record of Decision (ROD). The IRM Proposed Plan will be supported by the results of this treatability test plan, as well as by other 200-BP-5 Operable Unit activities (e.g., development of a qualitative risk assessment). Once issued, the Interim Action ROD will specify the interim action(s) for groundwater contamination at the 200-BP-5 Operable Unit. The treatability test approach is to conduct a pilot-scale pump and treat test for each of the two contaminant plumes associated with the 200-BP-5 Operable Unit. Primary contaminants of concern are {sup 99}Tc and {sup 60}Co for underwater affected by past discharges to the 216-BY Cribs, and {sup 90}Sr, {sup 239/240}Pu, and Cs for groundwater affected by past discharges to the 216-B-5 Reverse Well. The purpose of the pilot-scale treatability testing presented in this testplan is to provide the data basis for preparing an IRM Proposed Plan. To achieve this objective, treatability testing must: Assess the performance of groundwater pumping with respect to the ability to extract a significant amount of the primary contaminant mass present in the two contaminant plumes.

  13. Varieties of Achievement Motivation.

    ERIC Educational Resources Information Center

    Kukla, Andre; Scher, Hal

    1986-01-01

    A recent article by Nicholls on achievement motivation is criticized on three points: (1) definitions of achievement motives are ambiguous; (2) behavioral consequences predicted do not follow from explicit theoretical assumptions; and (3) Nicholls's account of the relation between his theory and other achievement theories is factually incorrect.…

  14. Motivation and School Achievement.

    ERIC Educational Resources Information Center

    Maehr, Martin L.; Archer, Jennifer

    Addressing the question, "What can be done to promote school achievement?", this paper summarizes the literature on motivation relating to classroom achievement and school effectiveness. Particular attention is given to how values, ideology, and various cultural patterns impinge on classroom performance and serve to enhance motivation to achieve.…

  15. Mobility and Reading Achievement.

    ERIC Educational Resources Information Center

    Waters, Theresa Z.

    A study examined the effect of geographic mobility on elementary school students' achievement. Although such mobility, which requires students to make multiple moves among schools, can have a negative impact on academic achievement, the hypothesis for the study was that it was not a determining factor in reading achievement test scores. Subjects…

  16. PASS and Reading Achievement.

    ERIC Educational Resources Information Center

    Kirby, John R.

    Two studies examined the effectiveness of the PASS (Planning, Attention, Simultaneous, and Successive cognitive processes) theory of intelligence in predicting reading achievement scores of normally achieving children and distinguishing children with reading disabilities from normally achieving children. The first study dealt with predicting…

  17. c-Jun NH2-terminal kinase promotes apoptosis by down-regulating the transcriptional co-repressor CtBP.

    PubMed

    Wang, Su-Yan; Iordanov, Mihail; Zhang, Qinghong

    2006-11-17

    Genetic knock out of the transcriptional co-repressor carboxyl-terminal-binding protein (CtBP) in mouse embryonic fibroblasts results in up-regulation of several genes involved in apoptosis. We predicted, therefore, that a propensity toward apoptosis might be regulated through changes in cellular CtBP levels. Previously, we have identified the homeodomain-interacting protein kinase 2 as such a regulator and demonstrated that HIPK2 activation causes Ser-422 phosphorylation and degradation of CtBP. In this study, we found that c-Jun NH2-terminal kinase 1 activation triggered CtBP phosphorylation on Ser-422 and subsequent degradation, inducing p53-independent apoptosis in human lung cancer cells. JNK1 has previously been linked to UV-directed apoptosis. Expression of MKK7-JNK1 or exposure to UV irradiation reduced cellular levels of CtBP via a proteasome-mediated pathway. This effect was prevented by JNK1 deficiency. In addition, sustained activation of the JNK1 pathway by cisplatin similarly triggered CtBP degradation. These findings provide a novel target for chemotherapy in cancers lacking p53. PMID:16984892

  18. Glucocorticoid-mediated co-regulation of RCAN1-1, E4BP4 and BIM in human leukemia cells susceptible to apoptosis

    PubMed Central

    Saenz, G. Jonatan; Hovanessian, Rebeka; Gisis, Andrew D.; Medh, Rheem D.

    2015-01-01

    Glucocorticoids (GCs) are known to induce apoptosis of leukemia cells via gene regulatory changes affecting key pro-and anti-apoptotic genes. Three genes previously implicated in GC-evoked apoptosis in the CEM human T-cell leukemia model, RCAN1, E4BP4 and BIM, were studied in a panel of human lymphoid and myeloid leukemia cell lines. Of the two RCAN1 transcripts, the synthetic GC Dexamethasone (Dex) selectively upregulates RCAN1-1, but not RCAN1-4, in GC-susceptible Sup-B15, RS4;11, Kasumi-1 cells but not in GC-resistant Sup T1 and Loucy cells. E4BP4 and BIM regulation correlated with that of RCAN1-1. A putative GRE and four EBPREs were identified within 1500bp upstream from the transcription start site of RCAN1-1. GC-refractory CEM C1-15 cells sensitized to GC-evoked apoptosis by ectopic E4BP4 expression, CEM C1-15mE#3, showed restored RCAN1-1 upregulation, suggesting that RCAN1-1 is a downstream target of E4BP4. A model for coordinated regulation of RCAN1-1, E4BP4 and BIM, and their role in GC-evoked apoptosis is proposed. PMID:26102033

  19. Glucocorticoid-mediated co-regulation of RCAN1-1, E4BP4 and BIM in human leukemia cells susceptible to apoptosis.

    PubMed

    Saenz, G Jonatan; Hovanessian, Rebeka; Gisis, Andrew D; Medh, Rheem D

    2015-08-01

    Glucocorticoids (GCs) are known to induce apoptosis of leukemia cells via gene regulatory changes affecting key pro-and anti-apoptotic genes. Three genes previously implicated in GC-evoked apoptosis in the CEM human T-cell leukemia model, RCAN1, E4BP4 and BIM, were studied in a panel of human lymphoid and myeloid leukemia cell lines. Of the two RCAN1 transcripts, the synthetic GC Dexamethasone (Dex) selectively upregulates RCAN1-1, but not RCAN1-4, in GC-susceptible Sup-B15, RS4;11, Kasumi-1 cells but not in GC-resistant Sup T1 and Loucy cells. E4BP4 and BIM regulation correlated with that of RCAN1-1. A putative GRE and four EBPREs were identified within 1500bp upstream from the transcription start site of RCAN1-1. GC-refractory CEM C1-15 cells sensitized to GC-evoked apoptosis by ectopic E4BP4 expression, CEM C1-15mE#3, showed restored RCAN1-1 upregulation, suggesting that RCAN1-1 is a downstream target of E4BP4. A model for coordinated regulation of RCAN1-1, E4BP4 and BIM, and their role in GC-evoked apoptosis is proposed. PMID:26102033

  20. BP chief scientist nominated for senior energy role

    NASA Astrophysics Data System (ADS)

    Gwynne, Peter

    2014-01-01

    The Obama administration has nominated BP's chief scientist Ellen Williams to be director of the Advanced Research Projects Agency-Energy (ARPA-E), which was created in 2007 to fund "high-risk, high-reward" research into novel energy technologies that are too early for investment by the private sector.

  1. A review of glycemic efficacy of liraglutide once daily in achieving glycated hemoglobin targets compared with exenatide twice daily, or sitagliptin once daily in the treatment of type 2 diabetes.

    PubMed

    Alshali, Khalid Z; Karawagh, Abdullah M

    2016-08-01

    Incretin-based therapies such as glucagon-like peptide-1 (GLP-1) receptor agonists (RA) and dipeptidyl peptidase-4 (DPP-4) inhibitors have gained prominence in recent years for the treatment of type 2 diabetes (T2D). Such therapies offer the potential to stimulate endogenous insulin activity in proportion to circulating glucose levels; thereby, lowering the risk of hypoglycemic episodes. The synthetic GLP-1 RA exenatide, the human GLP-1 RA liraglutide, and the DPP-4 inhibitor sitagliptin are the first agents in their respective classes to be approved for the treatment of T2D and their efficacy and safety has been studied extensively in clinical trials. This article reviewed the efficacy of liraglutide once daily in achieving clinical guidelines-recommended glycated hemoglobin A1c levels in patients with T2D compared with exenatide twice daily, or sitagliptin once daily, based on published literature, with an aim to elucidate the preferred choice of incretin-related therapy in treating uncontrolled T2D. PMID:27464858

  2. The Autophagy Receptor TAX1BP1 and the Molecular Motor Myosin VI Are Required for Clearance of Salmonella Typhimurium by Autophagy.

    PubMed

    Tumbarello, David A; Manna, Paul T; Allen, Mark; Bycroft, Mark; Arden, Susan D; Kendrick-Jones, John; Buss, Folma

    2015-10-01

    Autophagy plays a key role during Salmonella infection, by eliminating these pathogens following escape into the cytosol. In this process, selective autophagy receptors, including the myosin VI adaptor proteins optineurin and NDP52, have been shown to recognize cytosolic pathogens. Here, we demonstrate that myosin VI and TAX1BP1 are recruited to ubiquitylated Salmonella and play a key role in xenophagy. The absence of TAX1BP1 causes an accumulation of ubiquitin-positive Salmonella, whereas loss of myosin VI leads to an increase in ubiquitylated and LC3-positive bacteria. Our structural studies demonstrate that the ubiquitin-binding site of TAX1BP1 overlaps with the myosin VI binding site and point mutations in the TAX1BP1 zinc finger domains that affect ubiquitin binding also ablate binding to myosin VI. This mutually exclusive binding and the association of TAX1BP1 with LC3 on the outer limiting membrane of autophagosomes may suggest a molecular mechanism for recruitment of this motor to autophagosomes. The predominant role of TAX1BP1, a paralogue of NDP52, in xenophagy is supported by our evolutionary analysis, which demonstrates that functionally intact NDP52 is missing in Xenopus and mice, whereas TAX1BP1 is expressed in all vertebrates analysed. In summary, this work highlights the importance of TAX1BP1 as a novel autophagy receptor in myosin VI-mediated xenophagy. Our study identifies essential new machinery for the autophagy-dependent clearance of Salmonella typhimurium and suggests modulation of myosin VI motor activity as a potential therapeutic target in cellular immunity. PMID:26451915

  3. The Autophagy Receptor TAX1BP1 and the Molecular Motor Myosin VI Are Required for Clearance of Salmonella Typhimurium by Autophagy

    PubMed Central

    Tumbarello, David A.; Manna, Paul T.; Allen, Mark; Bycroft, Mark; Arden, Susan D.; Kendrick-Jones, John; Buss, Folma

    2015-01-01

    Autophagy plays a key role during Salmonella infection, by eliminating these pathogens following escape into the cytosol. In this process, selective autophagy receptors, including the myosin VI adaptor proteins optineurin and NDP52, have been shown to recognize cytosolic pathogens. Here, we demonstrate that myosin VI and TAX1BP1 are recruited to ubiquitylated Salmonella and play a key role in xenophagy. The absence of TAX1BP1 causes an accumulation of ubiquitin-positive Salmonella, whereas loss of myosin VI leads to an increase in ubiquitylated and LC3-positive bacteria. Our structural studies demonstrate that the ubiquitin-binding site of TAX1BP1 overlaps with the myosin VI binding site and point mutations in the TAX1BP1 zinc finger domains that affect ubiquitin binding also ablate binding to myosin VI. This mutually exclusive binding and the association of TAX1BP1 with LC3 on the outer limiting membrane of autophagosomes may suggest a molecular mechanism for recruitment of this motor to autophagosomes. The predominant role of TAX1BP1, a paralogue of NDP52, in xenophagy is supported by our evolutionary analysis, which demonstrates that functionally intact NDP52 is missing in Xenopus and mice, whereas TAX1BP1 is expressed in all vertebrates analysed. In summary, this work highlights the importance of TAX1BP1 as a novel autophagy receptor in myosin VI-mediated xenophagy. Our study identifies essential new machinery for the autophagy-dependent clearance of Salmonella typhimurium and suggests modulation of myosin VI motor activity as a potential therapeutic target in cellular immunity. PMID:26451915

  4. PTHrP(1-34)-mediated repression of the PHEX gene in osteoblastic cells involves the transcriptional repressor E4BP4.

    PubMed

    Pellicelli, Martin; Taheri, Maryam; St-Louis, Mathieu; Bériault, Véronique; Desgroseillers, Luc; Boileau, Guy; Moreau, Alain

    2012-06-01

    PHosphate-regulating gene with homology to Endopeptidase on the X chromosome (PHEX) has been identified as the gene mutated in X-linked hypophosphatemia (XLH) syndrome, the most prevalent form of rickets in humans. The predominant expression of PHEX in bones and teeth, and the defective mineralization of these tissues in XLH patients indicate that PHEX is an important regulator of mineralization. Parathyroid hormone (PTH) and PTH-related protein (PTHrP) are known to regulate the expression of numerous genes in osteoblastic cells through activation of the protein kinase A pathway, including repression of PHEX. PTH also activates the transcriptional repressor E4BP4 through the same pathway, suggesting that PTH or PTHrP-mediated repression of PHEX expression could involve E4BP4. To evaluate this possibility, we treated UMR-106 osteoblastic cells with PTHrP(1-34), and used RT-PCR and immunoblotting to analyze PHEX and E4BP4 expression. E4BP4 mRNA and protein levels were rapidly increased in cells treated with PTHrP(1-34), with a concomitant decrease in PHEX expression. This downregulation of PHEX could be reproduced by overexpression of E4BP4. Moreover, PTHrP(1-34)-mediated PHEX repression was blocked when cells were transfected with a siRNA targeting E4BP4 mRNA. Finally, DNA pull-down and luciferase assays showed that two E4BP4 response elements located in PHEX promoter were functional. These results underline the important role of E4BP4 in osteoblastic cells and further define the repression mechanism of PHEX gene by PTHrP(1-34). PMID:21826652

  5. A translational study "case report" on the small molecule "energy blocker" 3-bromopyruvate (3BP) as a potent anticancer agent: from bench side to bedside.

    PubMed

    Ko, Y H; Verhoeven, H A; Lee, M J; Corbin, D J; Vogl, T J; Pedersen, P L

    2012-02-01

    The small alkylating molecule, 3-bromopyruvate (3BP), is a potent and specific anticancer agent. 3BP is different in its action from most currently available chemo-drugs. Thus, 3BP targets cancer cells' energy metabolism, both its high glycolysis ("Warburg Effect") and mitochondrial oxidative phosphorylation. This inhibits/ blocks total energy production leading to a depletion of energy reserves. Moreover, 3BP as an "Energy Blocker", is very rapid in killing such cells. This is in sharp contrast to most commonly used anticancer agents that usually take longer to show a noticeable effect. In addition, 3BP at its effective concentrations that kill cancer cells has little or no effect on normal cells. Therefore, 3BP can be considered a member, perhaps one of the first, of a new class of anticancer agents. Following 3BP's discovery as a novel anticancer agent in vitro in the Year 2000 (Published in Ko et al. Can Lett 173:83-91, 2001), and also as a highly effective and rapid anticancer agent in vivo shortly thereafter (Ko et al. Biochem Biophys Res Commun 324:269-275, 2004), its efficacy as a potent anticancer agent in humans was demonstrated. Here, based on translational research, we report results of a case study in a young adult cancer patient with fibrolamellar hepatocellular carcinoma. Thus, a bench side discovery in the Department of Biological Chemistry at Johns Hopkins University, School of Medicine was taken effectively to bedside treatment at Johann Wolfgang Goethe University Frankfurt/Main Hospital, Germany. The results obtained hold promise for 3BP as a future cancer therapeutic without apparent cyto-toxicity when formulated properly. PMID:22328020

  6. Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) overexpression in pancreatic ductal adenocarcinoma correlates with poor survival

    PubMed Central

    2010-01-01

    Background Pancreatic ductal adenocarcinoma is a lethal disease with a 5-year survival rate of 4% and typically presents in an advanced stage. In this setting, prognostic markers identifying the more agrressive tumors could aid in managment decisions. Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3, also known as IMP3 or KOC) is an oncofetal RNA-binding protein that regulates targets such as insulin-like growth factor-2 (IGF-2) and ACTB (beta-actin). Methods We evaluated the expression of IGF2BP3 by immunohistochemistry using a tissue microarray of 127 pancreatic ductal adenocarcinomas with tumor grade 1, 2 and 3 according to WHO criteria, and the prognostic value of IGF2BP3 expression. Results IGF2BP3 was found to be selectively overexpressed in pancreatic ductal adenocarcinoma tissues but not in benign pancreatic tissues. Nine (38%) patient samples of tumor grade 1 (n = 24) and 27 (44%) of tumor grade 2 (n = 61) showed expression of IGF2BP3. The highest rate of expression was seen in poorly differentiated specimen (grade 3, n = 42) with 26 (62%) positive samples. Overall survival was found to be significantly shorter in patients with IGF2BP3 expressing tumors (P = 0.024; RR 2.3, 95% CI 1.2-4.8). Conclusions Our data suggest that IGF2BP3 overexpression identifies a subset of pancreatic ductal adenocarcinomas with an extremely poor outcome and supports the rationale for developing therapies to target the IGF pathway in this cancer. PMID:20178612

  7. Evaluation of ELISA testing for BP180 and BP230 as a diagnostic modality for bullous pemphigoid: a clinical experience.

    PubMed

    Keller, Jesse J; Kittridge, Ashley L; Debanne, Sara M; Korman, Neil J

    2016-05-01

    Bullous pemphigoid (BP) is a common autoimmune blistering disorder of the elderly. Several diagnostic modalities are available, including clinical impression, histopathology, direct and indirect immunofluorescence, and enzyme-linked immunosorbent assay (ELISA) detection of pathogenic antibodies. In this study, we aim to examine the utility of the newest test, ELISA, in comparison to the constellation of other tests. We describe our clinical experience in which 170 patients diagnosed with bullous pemphigoid had multiple tests performed. BP180 alone showed a sensitivity of 54 % and specificity of 94 %. The positive predictive value (PPV) is 95 % while the negative predictive value (NPV) is 52 %. BP230 alone yielded a sensitivity of 48 % and specificity of 94 %. The PPV is 94 % and the NPV is 49 %. Using both tests in combination yielded a sensitivity of 66 % and specificity of 89 %. The PPV of at least one of two tests returning positive is 92 % while the NPV of dual negative tests is 58 %. Use of ELISAs for suspected cases of BP are an inadequate standalone test, and are only helpful in making the diagnosis should they return positive. However, they would appear to miss about one-third of cases. PMID:26895534

  8. What Should Be the Target Blood Pressure in Elderly Patients With Diabetes?

    PubMed

    Solini, Anna; Grossman, Ehud

    2016-08-01

    Hypertension is very common in elderly subjects with type 2 diabetes. The coexistence of hypertension and diabetes can be devastating to the cardiovascular system, and in these patients, tight blood pressure (BP) control is particularly beneficial. Little information is available regarding the target BP levels in elderly hypertensive patients with type 2 diabetes, and therefore extrapolation from data in the general population should be done. However, it is difficult to extrapolate from the general population to these frail individuals, who usually have isolated systolic hypertension, comorbidities, organ damage, cardiovascular disease, and renal failure and have a high rate of orthostatic and postprandial hypotension. On the basis of the available evidence, we provide arguments supporting the individualized approach in these patients. Target BP should be based on concomitant diseases, orthostatic BP changes, and the general condition of the patients. It is recommended to lower BP in the elderly patient with diabetes to <140-150/90 mmHg, providing the patient is in good condition. In patients with isolated systolic hypertension, the same target is reasonable providing the diastolic BP is >60 mmHg. In patients with coronary artery disease and in patients with orthostatic hypotension, excessive BP lowering should be avoided. In elderly hypertensive patients with diabetes, BP levels should be monitored closely in the sitting and the standing position, and the treatment should be tailored to prevent excessive fall in BP. PMID:27440838

  9. CENP-C recruits M18BP1 to centromeres to promote CENP-A chromatin assembly

    PubMed Central

    Moree, Ben; Meyer, Corey B.; Fuller, Colin J.

    2011-01-01

    Eukaryotic chromosomes segregate by attaching to microtubules of the mitotic spindle through a chromosomal microtubule binding site called the kinetochore. Kinetochores assemble on a specialized chromosomal locus termed the centromere, which is characterized by the replacement of histone H3 in centromeric nucleosomes with the essential histone H3 variant CENP-A (centromere protein A). Understanding how CENP-A chromatin is assembled and maintained is central to understanding chromosome segregation mechanisms. CENP-A nucleosome assembly requires the Mis18 complex and the CENP-A chaperone HJURP. These factors localize to centromeres in telophase/G1, when new CENP-A chromatin is assembled. The mechanisms that control their targeting are unknown. In this paper, we identify a mechanism for recruiting the Mis18 complex protein M18BP1 to centromeres. We show that depletion of CENP-C prevents M18BP1 targeting to metaphase centromeres and inhibits CENP-A chromatin assembly. We find that M18BP1 directly binds CENP-C through conserved domains in the CENP-C protein. Thus, CENP-C provides a link between existing CENP-A chromatin and the proteins required for new CENP-A nucleosome assembly. PMID:21911481

  10. CENP-C recruits M18BP1 to centromeres to promote CENP-A chromatin assembly.

    PubMed

    Moree, Ben; Meyer, Corey B; Fuller, Colin J; Straight, Aaron F

    2011-09-19

    Eukaryotic chromosomes segregate by attaching to microtubules of the mitotic spindle through a chromosomal microtubule binding site called the kinetochore. Kinetochores assemble on a specialized chromosomal locus termed the centromere, which is characterized by the replacement of histone H3 in centromeric nucleosomes with the essential histone H3 variant CENP-A (centromere protein A). Understanding how CENP-A chromatin is assembled and maintained is central to understanding chromosome segregation mechanisms. CENP-A nucleosome assembly requires the Mis18 complex and the CENP-A chaperone HJURP. These factors localize to centromeres in telophase/G1, when new CENP-A chromatin is assembled. The mechanisms that control their targeting are unknown. In this paper, we identify a mechanism for recruiting the Mis18 complex protein M18BP1 to centromeres. We show that depletion of CENP-C prevents M18BP1 targeting to metaphase centromeres and inhibits CENP-A chromatin assembly. We find that M18BP1 directly binds CENP-C through conserved domains in the CENP-C protein. Thus, CENP-C provides a link between existing CENP-A chromatin and the proteins required for new CENP-A nucleosome assembly. PMID:21911481

  11. BP-Dock: a flexible docking scheme for exploring protein-ligand interactions based on unbound structures.

    PubMed

    Bolia, Ashini; Gerek, Z Nevin; Ozkan, S Banu

    2014-03-24

    Molecular docking serves as an important tool in modeling protein-ligand interactions. However, it is still challenging to incorporate overall receptor flexibility, especially backbone flexibility, in docking due to the large conformational space that needs to be sampled. To overcome this problem, we developed a novel flexible docking approach, BP-Dock (Backbone Perturbation-Dock) that can integrate both backbone and side chain conformational changes induced by ligand binding through a multi-scale approach. In the BP-Dock method, we mimic the nature of binding-induced events as a first-order approximation by perturbing the residues along the protein chain with a small Brownian kick one at a time. The response fluctuation profile of the chain upon these perturbations is computed using the perturbation response scanning method. These response fluctuation profiles are then used to generate binding-induced multiple receptor conformations for ensemble docking. To evaluate the performance of BP-Dock, we applied our approach on a large and diverse data set using unbound structures as receptors. We also compared the BP-Dock results with bound and unbound docking, where overall receptor flexibility was not taken into account. Our results highlight the importance of modeling backbone flexibility in docking for recapitulating the experimental binding affinities, especially when an unbound structure is used. With BP-Dock, we can generate a wide range of binding site conformations realized in nature even in the absence of a ligand that can help us to improve the accuracy of unbound docking. We expect that our fast and efficient flexible docking approach may further aid in our understanding of protein-ligand interactions as well as virtual screening of novel targets for rational drug design. PMID:24380381

  12. Gate tunable WSe2-BP van der Waals heterojunction devices

    NASA Astrophysics Data System (ADS)

    Chen, Peng; Zhang, Ting Ting; Zhang, Jing; Xiang, Jianyong; Yu, Hua; Wu, Shuang; Lu, Xiaobo; Wang, Guole; Wen, Fusheng; Liu, Zhongyuan; Yang, Rong; Shi, Dongxia; Zhang, Guangyu

    2016-02-01

    Due to the weak screening effect, the concentration and type of charge carriers in 2D semiconductor heterostructures can be effectively tuned by electrostatic gating, enabling us to realize different types of heterojunctions in a single device. Such `type tunable' properties are useful for designing novel electrical or optoelectrical devices. Here, we demonstrate a `type tunable' heterojunction device construct with two pieces of ambipolar 2D semiconductors: WSe2 and black phosphorus (BP). This heterojunction could be tuned to either the p-p junction or n-n junction by gate modulation. The p-p junction shows a large current rectification ratio while the n-n junction shows a negligible current rectification ratio, indicating a large valence band offset and a small conduction band offset at the WSe2/BP interface. In the optoelectrical measurements, we found the amplitude and even the polarity of photocurrent could be modulated by electrostatic gating. Our study could further enhance the understanding of designing devices based on these `type tunable' van der Waals heterojunctions. Moreover, the properties of the WSe2/BP interface were also experimentally identified through the electrical and optoelectrical measurements in our study.Due to the weak screening effect, the concentration and type of charge carriers in 2D semiconductor heterostructures can be effectively tuned by electrostatic gating, enabling us to realize different types of heterojunctions in a single device. Such `type tunable' properties are useful for designing novel electrical or optoelectrical devices. Here, we demonstrate a `type tunable' heterojunction device construct with two pieces of ambipolar 2D semiconductors: WSe2 and black phosphorus (BP). This heterojunction could be tuned to either the p-p junction or n-n junction by gate modulation. The p-p junction shows a large current rectification ratio while the n-n junction shows a negligible current rectification ratio, indicating a large valence

  13. Heritability of Creative Achievement

    ERIC Educational Resources Information Center

    Piffer, Davide; Hur, Yoon-Mi

    2014-01-01

    Although creative achievement is a subject of much attention to lay people, the origin of individual differences in creative accomplishments remain poorly understood. This study examined genetic and environmental influences on creative achievement in an adult sample of 338 twins (mean age = 26.3 years; SD = 6.6 years). Twins completed the Creative…

  14. Confronting the Achievement Gap

    ERIC Educational Resources Information Center

    Gardner, David

    2007-01-01

    This article talks about the large achievement gap between children of color and their white peers. The reasons for the achievement gap are varied. First, many urban minorities come from a background of poverty. One of the detrimental effects of growing up in poverty is receiving inadequate nourishment at a time when bodies and brains are rapidly…

  15. States Address Achievement Gaps.

    ERIC Educational Resources Information Center

    Christie, Kathy

    2002-01-01

    Summarizes 2 state initiatives to address the achievement gap: North Carolina's report by the Advisory Commission on Raising Achievement and Closing Gaps, containing an 11-point strategy, and Kentucky's legislation putting in place 10 specific processes. The North Carolina report is available at www.dpi.state.nc.us.closingthegap; Kentucky's…

  16. Wechsler Individual Achievement Test.

    ERIC Educational Resources Information Center

    Taylor, Ronald L.

    1999-01-01

    This article describes the Wechsler Individual Achievement Test, a comprehensive measure of achievement for individuals in grades K-12. Eight subtests assess mathematics reasoning, spelling, reading comprehension, numerical operations, listening comprehension, oral expression, and written expression. Its administration, standardization,…

  17. Inverting the Achievement Pyramid

    ERIC Educational Resources Information Center

    White-Hood, Marian; Shindel, Melissa

    2006-01-01

    Attempting to invert the pyramid to improve student achievement and increase all students' chances for success is not a new endeavor. For decades, educators have strategized, formed think tanks, and developed school improvement teams to find better ways to improve the achievement of all students. Currently, the No Child Left Behind Act (NCLB) is…

  18. Achievement Test Program.

    ERIC Educational Resources Information Center

    Ohio State Dept. of Education, Columbus. Trade and Industrial Education Service.

    The Ohio Trade and Industrial Education Achievement Test battery is comprised of seven basic achievement tests: Machine Trades, Automotive Mechanics, Basic Electricity, Basic Electronics, Mechanical Drafting, Printing, and Sheet Metal. The tests were developed by subject matter committees and specialists in testing and research. The Ohio Trade and…

  19. General Achievement Trends: Maryland

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  20. General Achievement Trends: Arkansas

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  1. General Achievement Trends: Idaho

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  2. General Achievement Trends: Nebraska

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  3. General Achievement Trends: Colorado

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  4. General Achievement Trends: Iowa

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  5. General Achievement Trends: Hawaii

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  6. General Achievement Trends: Kentucky

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  7. General Achievement Trends: Florida

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  8. General Achievement Trends: Texas

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  9. General Achievement Trends: Oregon

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  10. General Achievement Trends: Virginia

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  11. Honoring Student Achievement

    ERIC Educational Resources Information Center

    Education Digest: Essential Readings Condensed for Quick Review, 2004

    2004-01-01

    Is the concept of "honor roll" obsolete? The honor roll has always been a way for schools to recognize the academic achievement of their students. But does it motivate students? In this article, several elementary school principals share their views about honoring student achievement. Among others, Virginia principal Nancy Moga said that students…

  12. Aiming at Achievement.

    ERIC Educational Resources Information Center

    Martinez, Paul

    The Raising Quality and Achievement Program is a 3-year initiative to support further education (FE) colleges in the United Kingdom in their drive to improve students' achievement and the quality of provision. The program offers the following: (1) quality information and advice; (2) onsite support for individual colleges; (3) help with…

  13. Achieving Perspective Transformation.

    ERIC Educational Resources Information Center

    Nowak, Jens

    Perspective transformation is a consciously achieved state in which the individual's perspective on life is transformed. The new perspective serves as a vantage point for life's actions and interactions, affecting the way life is lived. Three conditions are basic to achieving perspective transformation: (1) "feeling" experience, i.e., getting in…

  14. Achieving Public Schools

    ERIC Educational Resources Information Center

    Abowitz, Kathleen Knight

    2011-01-01

    Public schools are functionally provided through structural arrangements such as government funding, but public schools are achieved in substance, in part, through local governance. In this essay, Kathleen Knight Abowitz explains the bifocal nature of achieving public schools; that is, that schools are both subject to the unitary Public compact of…

  15. General Achievement Trends: Tennessee

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  16. Achievement-Based Resourcing.

    ERIC Educational Resources Information Center

    Fletcher, Mike; And Others

    1992-01-01

    This collection of seven articles examines achievement-based resourcing (ABR), the concept that the funding of educational institutions should be linked to their success in promoting student achievement, with a focus on the application of ABR to postsecondary education in the United Kingdom. The articles include: (1) "Introduction" (Mick…

  17. Spontaneous 8bp Deletion in Nbeal2 Recapitulates the Gray Platelet Syndrome in Mice

    PubMed Central

    Tomberg, Kärt; Khoriaty, Rami; Westrick, Randal J.; Fairfield, Heather E.; Reinholdt, Laura G.; Brodsky, Gary L.; Davizon-Castillo, Pavel; Ginsburg, David; Di Paola, Jorge

    2016-01-01

    During the analysis of a whole genome ENU mutagenesis screen for thrombosis modifiers, a spontaneous 8 base pair (bp) deletion causing a frameshift in exon 27 of the Nbeal2 gene was identified. Though initially considered as a plausible thrombosis modifier, this Nbeal2 mutation failed to suppress the synthetic lethal thrombosis on which the original ENU screen was based. Mutations in NBEAL2 cause Gray Platelet Syndrome (GPS), an autosomal recessive bleeding disorder characterized by macrothrombocytopenia and gray-appearing platelets due to lack of platelet alpha granules. Mice homozygous for the Nbeal2 8 bp deletion (Nbeal2gps/gps) exhibit a phenotype similar to human GPS, with significantly reduced platelet counts compared to littermate controls (p = 1.63 x 10−7). Nbeal2gps/gps mice also have markedly reduced numbers of platelet alpha granules and an increased level of emperipolesis, consistent with previously characterized mice carrying targeted Nbeal2 null alleles. These findings confirm previous reports, provide an additional mouse model for GPS, and highlight the potentially confounding effect of background spontaneous mutation events in well-characterized mouse strains. PMID:26950939

  18. X-rays from magnetic intermediate mass Ap/Bp stars

    NASA Astrophysics Data System (ADS)

    Robrade, Jan

    2016-09-01

    The X-ray emission of magnetic intermediate mass Ap/Bp stars is reviewed and put into context of intrinsic as well as extrinsic hypotheses for its origin. New X-ray observations of Ap/Bp stars are presented and combined with an updated analysis of the available datasets, providing the largest sample of its type that is currently available. In the studied stars the X-ray detections are found predominantly among the more massive, hotter and more luminous targets. Their X-ray properties are quite diverse and beside strong soft X-ray emission significant magnetic activity is frequently present. While a connection between more powerful winds and brighter X-ray emission is expected in intrinsic models, the scatter in X-ray luminosity at given bolometric luminosity is so far unexplained and several observational features like X-ray light curves and flaring, luminosity distributions and spectral properties are often similar to those of low-mass stars. It remains to be seen if these features can be fully reproduced by magnetospheres of intermediate mass stars. The article discusses implications for magnetically confined wind-shock models (MCWS) and stellar magnetospheres under the assumption that the intrinsic model is applicable, but also examines the role of possible companions. Further, related magnetospheric phenomena are presented and an outlook on future perspectives is given.

  19. Calibration of the radiocarbon time scale at 37ka BP

    SciTech Connect

    Southon, J.R.; Deino, A.L.; Orsi, G.

    1995-12-01

    Results from radiocarbon and U-Th measurements on corals have provided a radiocarbon calibration beyond the range covered by tree ring series, but the uncertainties in the measurements beyond 20ka BP are very large. We have obtained new calibration data from radiocarbon dates on material associated with the catastrophic Campanian Ignimbrite eruption from the Phlegrean Fields near Naples. The eruption has been well dated by {sup 40}Ar/{sup 39}Ar to 37ka BP. Radiocarbon measurements were carried out on charcoal from a carbonized branch exposed within the ignimbrite tuff on the wall of an active quarry. The sample was split and analyzed at both the Naples and Lawrence Livermore AMS facilities. The offset between the Ar-Ar data and the radiocarbon results (recalculated using the true 5730-year half life for {sup 14}C) is consistent with predictions from paleomagnetic data and carbon cycle modeling.

  20. Spectropolarimetry of the classical T Tauri star BP Tauri

    NASA Astrophysics Data System (ADS)

    Chen, Wei; Johns-Krull, Christopher

    2012-05-01

    We implement a least-squares deconvolution (LSD) code to study magnetic fields on cool stars. We first apply our code to high resolution (R ~ 60,000) optical echelle spectra of several solar-like stars as tests of the code and to measure the mean longitudinal magnetic field on the surface of these stars. Null results or weak fields are detected on the solar-like stars as is expected, demonstrating the functionality of the LSD code. We then apply our LSD code to 6 nights of data on the Classical T Tauri Star BP Tau. A maximum field of 330 +/- 80 G is detected from the photospheric lines on BP Tau. Measurements of several emission lines (He I 5876 A˚, Ca II 8498 A˚ and 8542 A˚) show the presence of strong magnetic fields in the line formation regions, which are believed to be the base of the accretion footpoints.

  1. Variability of Balmer Profiles in Magnetic Ap/Bp Stars

    NASA Astrophysics Data System (ADS)

    Valyavin, G.; Lee, B.-C.; Shulyak, D.; Han, I.; Kochukhov, O.; Khang, D.-I.; Kim, K.-M.

    2007-06-01

    A set of high precision measurements of weak variations of hydrogen lines in spectra of seven magnetic Ap/Bp stars was carried out using the BOES echelle spectrograph of the Bohuynsan Optical Astronomy Observatory (South Korea). A weak (1-2 %) periodic variability of the Balmer line wings has been detected in the spectra of 2 program stars. Upper limits of possible variations are presented for the remaining 5 objects. We discuss the discovered variability in the framework of model atmospheres with magnetic force terms included. The periodic changes in the Balmer profiles are caused by perturbations in atmospheres of Ap/Bp stars due to their rotationally modulated non-force-free magnetic fields.

  2. Magnetospheric accretion on the T Tauri star BP Tauri

    NASA Astrophysics Data System (ADS)

    Donati, J.-F.; Jardine, M. M.; Gregory, S. G.; Petit, P.; Paletou, F.; Bouvier, J.; Dougados, C.; Ménard, F.; Collier Cameron, A.; Harries, T. J.; Hussain, G. A. J.; Unruh, Y.; Morin, J.; Marsden, S. C.; Manset, N.; Aurière, M.; Catala, C.; Alecian, E.

    2008-05-01

    From observations collected with the ESPaDOnS and NARVAL spectropolarimeters, we report the detection of Zeeman signatures on the classical T Tauri star (cTTS) BP Tau. Circular polarization signatures in photospheric lines and in narrow emission lines tracing magnetospheric accretion are monitored throughout most of the rotation cycle of BP Tau at two different epochs in 2006. We observe that rotational modulation dominates the temporal variations of both unpolarized and circularly polarized spectral proxies tracing the photosphere and the footpoints of accretion funnels. From the complete data sets at each epoch, we reconstruct the large-scale magnetic topology and the location of accretion spots at the surface of BP Tau using tomographic imaging. We find that the field of BP Tau involves a 1.2 kG dipole and 1.6 kG octupole, both slightly tilted with respect to the rotation axis. Accretion spots coincide with the two main magnetic poles at high latitudes and overlap with dark photospheric spots; they cover about 2 per cent of the stellar surface. The strong mainly axisymmetric poloidal field of BP Tau is very reminiscent of magnetic topologies of fully convective dwarfs. It suggests that magnetic fields of fully convective cTTSs such as BP Tau are likely not fossil remants, but rather result from vigorous dynamo action operating within the bulk of their convective zones. Preliminary modelling suggests that the magnetosphere of BP Tau extends to distances of at least 4R* to ensure that accretion spots are located at high latitudes, and is not blown open close to the surface by a putative stellar wind. It apparently succeeds in coupling to the accretion disc as far out as the corotation radius, and could possibly explain the slow rotation of BP Tau. Based on observations obtained at the Canada-France-Hawaii Telescope (CFHT) and at the Télescope Bernard Lyot (TBL). CFHT is operated by the National Research Council of Canada, the Institut National des Sciences de l

  3. Diffusion and Settling in Ap/Bp Stars

    SciTech Connect

    Turcotte, S

    2003-04-09

    Ap/Bp stars are magnetic chemically peculiar early A and late B type stars of the main sequence. They exhibit peculiar surface abundance anomalies that are thought to be the result of gravitational settling and radiative levitation. The physics of diffusion in these stars are reviewed briefly and some model predictions are discussed. While models reproduce some observations reasonably well, more work is needed before the behavior of diffusing elements in a complex magnetic field is fully understood.

  4. Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants.

    PubMed

    Luo, Ming; Gilbert, Brian; Ayliffe, Michael

    2016-07-01

    Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described. PMID:27146973

  5. Gate tunable WSe2-BP van der Waals heterojunction devices.

    PubMed

    Chen, Peng; Zhang, Ting Ting; zhang, Jing; Xiang, Jianyong; Yu, Hua; Wu, Shuang; Lu, Xiaobo; Wang, Guole; Wen, Fusheng; Liu, Zhongyuan; Yang, Rong; Shi, Dongxia; Zhang, Guangyu

    2016-02-14

    Due to the weak screening effect, the concentration and type of charge carriers in 2D semiconductor heterostructures can be effectively tuned by electrostatic gating, enabling us to realize different types of heterojunctions in a single device. Such 'type tunable' properties are useful for designing novel electrical or optoelectrical devices. Here, we demonstrate a 'type tunable' heterojunction device construct with two pieces of ambipolar 2D semiconductors: WSe2 and black phosphorus (BP). This heterojunction could be tuned to either the p-p junction or n-n junction by gate modulation. The p-p junction shows a large current rectification ratio while the n-n junction shows a negligible current rectification ratio, indicating a large valence band offset and a small conduction band offset at the WSe2/BP interface. In the optoelectrical measurements, we found the amplitude and even the polarity of photocurrent could be modulated by electrostatic gating. Our study could further enhance the understanding of designing devices based on these 'type tunable' van der Waals heterojunctions. Moreover, the properties of the WSe2/BP interface were also experimentally identified through the electrical and optoelectrical measurements in our study. PMID:26810387

  6. [Achievement of therapeutic objectives].

    PubMed

    Mantilla, Teresa

    2014-07-01

    Therapeutic objectives for patients with atherogenic dyslipidemia are achieved by improving patient compliance and adherence. Clinical practice guidelines address the importance of treatment compliance for achieving objectives. The combination of a fixed dose of pravastatin and fenofibrate increases the adherence by simplifying the drug regimen and reducing the number of daily doses. The good tolerance, the cost of the combination and the possibility of adjusting the administration to the patient's lifestyle helps achieve the objectives for these patients with high cardiovascular risk. PMID:25043543

  7. Microbial Consumption of Natural Gases Released from the BP Deepwater Horizon Oil Spill

    NASA Astrophysics Data System (ADS)

    Mendes, S. D.; Valentine, D. L.; Farwell, C.

    2010-12-01

    The BP Deepwater Horizon disaster caused the release of natural gas, which dissolved in the water column to form gas plumes. Containing methane, ethane, and propane, these gas plumes fuel microbial respiration. This work targeted the water column to quantify the maximum rate of microbial respiration in the natural gas plume. A novel method using uniformly 13C-labeled substrates as tracers was applied to determine the rate of microbial consumption of these gases in water surrounding the impacted area. Consumption rate experiments were performed on board the R/V Cape Hatteras (July 12-20, 2010) and analyzed using an isotope ratio mass spectrometer (IRMS). The kinetic order and maximum consumption rate of the microbial community were determined by experimental controls using the 13C-labeled tracers in temperature, time, and concentration series. Ongoing sampling efforts allow changes in the response of the microbial community to be monitored over time.

  8. BP Neural Network Model-based Physical Exercises and Dietary Habits Relationships Exploration

    PubMed Central

    Guo, Xingwei; Zhang, Xuesheng; Sun, Yi

    2015-01-01

    With the continuous progress of society, increment of social pressure, people have paid little and little attentions to physical exercises and dietary necessity. Take Beijing, Shanghai, Guangzhou, Shenzhen, Shijiazhuang and Baotou university students as research objects, targeted at physical exercises time and dietary habits, it starts investigation. Make principal component analysis of investigation results, results indicates that cereal intake is principal component in dietary habits; strenuous exercise time and general physical exercise time are the principal components in physical exercise. Utilize BP neural network model, analyze these seven cities’ physical exercises and dietary habits conditions, the result indicates that except for Shenzhen, all the other six cities haven’t reached the standard. PMID:26981164

  9. Towards a 3D dynamo model of the PMS star BP Tau

    NASA Astrophysics Data System (ADS)

    Bessolaz, N.; Brun, A. S.

    2011-12-01

    Studying how convective and magnetic properties of pre-main sequence stars change during their evolution towards the zero-age main sequence is a growing area of research triggered by the development of efficient spectropolarimeters. 3D simulations can help to identify the key parameters to understand the diversity (strength, topology) of magnetic fields observed. We present results of a dynamo computation done with the ASH code for a 0.7 M_⊙ pre-main sequence star with a 7.6 day rotation period which is nearly fully convective, using a realistic stratification contrast to resolve 90 % of the convective zone. This star corresponds to the target star BP Tau already observed with spectropolarimetry (Donati et al. 2008). We particularly compare the magnetic field properties found in our simulation with the observational constraints.

  10. Insulin signaling controls neurotransmission via the 4eBP-dependent modification of the exocytotic machinery.

    PubMed

    Mahoney, Rebekah Elizabeth; Azpurua, Jorge; Eaton, Benjamin A

    2016-01-01

    Altered insulin signaling has been linked to widespread nervous system dysfunction including cognitive dysfunction, neuropathy and susceptibility to neurodegenerative disease. However, knowledge of the cellular mechanisms underlying the effects of insulin on neuronal function is incomplete. Here, we show that cell autonomous insulin signaling within the Drosophila CM9 motor neuron regulates the release of neurotransmitter via alteration of the synaptic vesicle fusion machinery. This effect of insulin utilizes the FOXO-dependent regulation of the thor gene, which encodes the Drosophila homologue of the eif-4e binding protein (4eBP). A critical target of this regulatory mechanism is Complexin, a synaptic protein known to regulate synaptic vesicle exocytosis. We find that the amounts of Complexin protein observed at the synapse is regulated by insulin and genetic manipulations of Complexin levels support the model that increased synaptic Complexin reduces neurotransmission in response to insulin signaling. PMID:27525480

  11. Predicting Achievement and Motivation.

    ERIC Educational Resources Information Center

    Uguroglu, Margaret; Walberg, Herbert J.

    1986-01-01

    Motivation and nine other factors were measured for 970 students in grades five through eight in a study of factors predicting achievement and predicting motivation. Results are discussed. (Author/MT)

  12. Attractiveness and School Achievement

    ERIC Educational Resources Information Center

    Salvia, John; And Others

    1977-01-01

    The purpose of this study was to ascertain the relationship between rated attractiveness and two measures of school performance. Attractive children received significantly higher report cards and, to some degree, higher achievement test scores than their unattractive peers. (Author)

  13. Student Achievement and Motivation

    ERIC Educational Resources Information Center

    Flammer, Gordon H.; Mecham, Robert C.

    1974-01-01

    Compares the lecture and self-paced methods of instruction on the basis of student motivation and achieveme nt, comparing motivating and demotivating factors in each, and their potential for motivation and achievement. (Authors/JR)

  14. Features Extraction of Flotation Froth Images and BP Neural Network Soft-Sensor Model of Concentrate Grade Optimized by Shuffled Cuckoo Searching Algorithm

    PubMed Central

    Wang, Jie-sheng; Han, Shuang; Shen, Na-na; Li, Shu-xia

    2014-01-01

    For meeting the forecasting target of key technology indicators in the flotation process, a BP neural network soft-sensor model based on features extraction of flotation froth images and optimized by shuffled cuckoo search algorithm is proposed. Based on the digital image processing technique, the color features in HSI color space, the visual features based on the gray level cooccurrence matrix, and the shape characteristics based on the geometric theory of flotation froth images are extracted, respectively, as the input variables of the proposed soft-sensor model. Then the isometric mapping method is used to reduce the input dimension, the network size, and learning time of BP neural network. Finally, a shuffled cuckoo search algorithm is adopted to optimize the BP neural network soft-sensor model. Simulation results show that the model has better generalization results and prediction accuracy. PMID:25133210

  15. Features extraction of flotation froth images and BP neural network soft-sensor model of concentrate grade optimized by shuffled cuckoo searching algorithm.

    PubMed

    Wang, Jie-sheng; Han, Shuang; Shen, Na-na; Li, Shu-xia

    2014-01-01

    For meeting the forecasting target of key technology indicators in the flotation process, a BP neural network soft-sensor model based on features extraction of flotation froth images and optimized by shuffled cuckoo search algorithm is proposed. Based on the digital image processing technique, the color features in HSI color space, the visual features based on the gray level cooccurrence matrix, and the shape characteristics based on the geometric theory of flotation froth images are extracted, respectively, as the input variables of the proposed soft-sensor model. Then the isometric mapping method is used to reduce the input dimension, the network size, and learning time of BP neural network. Finally, a shuffled cuckoo search algorithm is adopted to optimize the BP neural network soft-sensor model. Simulation results show that the model has better generalization results and prediction accuracy. PMID:25133210

  16. PC-1/PrLZ confers resistance to rapamycin in prostate cancer cells through increased 4E-BP1 stability

    PubMed Central

    Wang, Jian; Wang, Hongtao; Huang, Fang; Zhang, Zhe; Wang, Ying; Zhou, Jianguang; Li, Shanhu

    2015-01-01

    An important strategy for improving advanced PCa treatment is targeted therapies combined with chemotherapy. PC-1, a prostate Leucine Zipper gene (PrLZ), is specifically expressed in prostate tissue as an androgen-induced gene and is up-regulated in advanced PCa. Recent work confirmed that PC-1 expression promotes PCa growth and androgen-independent progression. However, how this occurs and whether this can be used as a biomarker is uncertain. Here, we report that PC-1 overexpression confers PCa cells resistance to rapamycin treatment by antagonizing rapamycin-induced cytostasis and autophagy (rapamycin-sensitivity was observed in PC-1-deficient (shPC-1) C4-2 cells). Analysis of the mTOR pathway in PCa cells with PC-1 overexpressed and depressed revealed that eukaryotic initiation factor 4E-binding protein 1(4E-BP1) was highly regulated by PC-1. Immunohistochemistry assays indicated that 4E-BP1 up-regulation correlates with increased PC-1 expression in human prostate tumors and in PCa cells. Furthermore, PC-1 interacts directly with 4E-BP1 and stabilizes 4E-BP1 protein via inhibition of its ubiquitination and proteasomal degradation. Thus, PC-1 is a novel regulator of 4E-BP1 and our work suggests a potential mechanism through which PC-1 enhances PCa cell survival and malignant progression and increases chemoresistance. Thus, the PC-1-4E-BP1 interaction may represent a therapeutic target for treating advanced PCa. PMID:26011939

  17. Heritability of HR and BP Response To Exercise Training in the HERITAGE Family Study.

    ERIC Educational Resources Information Center

    Rice, Treva; Gagnon, Jacques; Leon, Arthur S.; Skinner, James S.; Wilmore, Jack H.; Bouchard, Claude; Rao, D. C.

    2002-01-01

    Assessed the heritability of response to exercise training in resting blood pressure (BP) and heart rate (HR) among sedentary Caucasians comprising 98 families who completed an exercise training program. Results indicated that the trainability of systolic BP and HR in families with elevated BP was partially determined by genetic factors. Diastolic…

  18. Levels of the E2 interacting protein TopBP1 modulate papillomavirus maintenance stage replication

    SciTech Connect

    Kanginakudru, Sriramana; DeSmet, Marsha; Thomas, Yanique; Morgan, Iain M.; Androphy, Elliot J.

    2015-04-15

    The evolutionarily conserved DNA topoisomerase II beta-binding protein 1 (TopBP1) functions in DNA replication, DNA damage response, and cell survival. We analyzed the role of TopBP1 in human and bovine papillomavirus genome replication. Consistent with prior reports, TopBP1 co-localized in discrete nuclear foci and was in complex with papillomavirus E2 protein. Similar to E2, TopBP1 is recruited to the region of the viral origin of replication during G1/S and early S phase. TopBP1 knockdown increased, while over-expression decreased transient virus replication, without affecting cell cycle. Similarly, using cell lines harboring HPV-16 or HPV-31 genome, TopBP1 knockdown increased while over-expression reduced viral copy number relative to genomic DNA. We propose a model in which TopBP1 serves dual roles in viral replication: it is essential for initiation of replication yet it restricts viral copy number. - Highlights: • Protein interaction study confirmed In-situ interaction between TopBP1 and E2. • TopBP1 present at papillomavirus ori in G1/S and early S phase of cell cycle. • TopBP1 knockdown increased, over-expression reduced virus replication. • TopBP1 protein level change did not influence cell survival or cell cycle. • TopBP1 displaced from papillomavirus ori after initiation of replication.

  19. Efficacy and tolerability of ezetimibe 10 mg/day coadministered with statins in patients with primary hypercholesterolemia who do not achieve target LDL-C while on statin monotherapy: A Canadian, multicentre, prospective study – the Ezetrol® Add-On Study

    PubMed Central

    Bissonnette, Stéphane; Habib, Rafik; Sampalis, Fotini; Boukas, Stella; Sampalis, John S

    2006-01-01

    BACKGROUND For patients who have above-target low-density lipoprotein cholesterol (LDL-C) levels while on statin monotherapy, coadministration of a cholesterol absorption inhibitor with the statin may decrease serum LDL-C levels and improve overall lipid profiles. OBJECTIVES To assess the effectiveness and safety of ezetimibe 10 mg/day coadministered with a statin in patients with primary hypercholesterolemia who have higher than recommended LDL-C levels while on statin monotherapy. METHODS A six-week, prospective, multicentre study of eligible patients who had above-target LDL-C levels while on monotherapy with any statin, regardless of dose, for a minimum of four weeks. All patients were treated for six weeks with 10 mg ezetimibe daily coad-ministered with their current statins. RESULTS A total of 1141 patients were screened, 953 (83.5%) fulfilled the study inclusion criteria and 837 (87.8%) completed the study. Reasons for withdrawal included: lost to follow-up (50 patients [5.2%]); protocol violations (45 patients [4.7%]); adverse events (19 patients [2.0%]); and withdrawal of consent (two patients [0.2%]). After six weeks of treatment, statistically significant (P=0.001) mean reductions were observed in LDL-C (30.05%), total cholesterol (20.84%), triglycerides (10.16%), apolipoprotein B (19.84%) and the total cholesterol to high-density lipoprotein cholesterol ratio (19.88%). At six weeks, 674 patients (80.5%) achieved target LDL-C levels. Fifty predominantly mild, nonserious adverse events related to ezetimibe were reported by 32 patients (3.4%). Frequently reported adverse events included constipation (n=7 [0.7% of patients]), diarrhea (n=4 [0.4%]) and dizziness (n=4 [0.4%]). CONCLUSION Ezetimibe coadministered with statins is effective in reducing LDL-C in patients who do not attain target LDL-C levels while on statin monotherapy. PMID:17036098

  20. P-2 Years Targeted to Achieve Grade 3 Reading Proficiency

    ERIC Educational Resources Information Center

    Gewertz, Catherine

    2011-01-01

    In a bid to help more students read proficiently in 3rd grade--a skill considered critical to their future educational success--new laws and initiatives springing up around the country require educators to step up their efforts to identify and help struggling readers even before they enter kindergarten. It's not unusual for states or school…

  1. USGS aerial resolution targets.

    USGS Publications Warehouse

    Salamonowicz, P.H.

    1982-01-01

    It is necessary to measure the achievable resolution of any airborne sensor that is to be used for metric purposes. Laboratory calibration facilities may be inadequate or inappropriate for determining the resolution of non-photographic sensors such as optical-mechanical scanners, television imaging tubes, and linear arrays. However, large target arrays imaged in the field can be used in testing such systems. The USGS has constructed an array of resolution targets in order to permit field testing of a variety of airborne sensing systems. The target array permits any interested organization with an airborne sensing system to accurately determine the operational resolution of its system. -from Author

  2. Fasciola hepatica calcium-binding protein FhCaBP2: structure of the dynein light chain-like domain.

    PubMed

    Nguyen, Thanh H; Thomas, Charlotte M; Timson, David J; van Raaij, Mark J

    2016-07-01

    The common liver fluke Fasciola hepatica causes an increasing burden on human and animal health, partly because of the spread of drug-resistant isolates. As a consequence, there is considerable interest in developing new drugs to combat liver fluke infections. A group of potential targets is a family of calcium-binding proteins which combine an N-terminal domain with two EF-hand motifs and a C-terminal domain with predicted similarity to dynein light chains (DLC-like domain). The function of these proteins is unknown, although in several species, they have been localised to the tegument, an important structure at the host-parasite interface. Here, we report the X-ray crystal structure of the DLC-like domain of F. hepatica calcium-binding protein 2 (FhCaBP2), solved using single-wavelength anomalous diffraction and refined at 2.3 Å resolution in two different crystal forms. The FhCaBP2 DLC-like domain has a structure similar to other DLC domains, with an anti-parallel β-sheet packed against an α-helical hairpin. Like other DLC domains, it dimerises through its β2-strand, which extends in an arch and forms the fifth strand in an extended β-sheet of the other monomer. The structure provides molecular details of the dimerisation of FhCaBP2, the first example from this family of parasite proteins. PMID:27083189

  3. Feasibility study report for the 200-BP-1 operable unit

    SciTech Connect

    Not Available

    1993-06-01

    This feasibility study examines a range of alternatives and provides recommendations for selecting a preferred alternative for remediating contamination at the 200-BP-1 operable unit. The 200-BP-1 operable unit is located in the center of the Hanford Site along the northern boundary of the 200 East Area. The 241-BY Tank Farm is located immediately to the south of the operable unit. 200-BP-1 is a source operable unit with contaminated soils associated primarily with nine inactive cribs (known as the 216-B cribs). These cribs were used for disposal of low-level radioactive liquid waste from U Plant uranium recovery operations, and waste storage tank condensate from the adjacent 241-BY Tank Farm. The cribs used for disposal of U Plant waste were in operation from 1955--1965, and the cribs used for disposal of tank condensate were in operation from 1965--1975. In addition to the cribs, four unplanned releases of radioactive materials have occurred within the operable unit. Contaminated surface soils associated with the unplanned releases have been consolidated over the cribs and covered with clean soil to reduce contaminant migration and exposure. Discharge of wastes to the cribs has resulted in soil and groundwater contamination. The groundwater is being addressed as part of the 200 East Aggregate Area, groundwater operable unit. Contaminated soils at the site can be categorized by the types of contaminants, their distribution in the soil column, and the risk posed by the various potential exposure pathways. Below the clean soil cover, the near surface soils contain low-levels of contamination with cesium-137, radium-226, strontium-90, thorium-228, and uranium. The lifetime incremental cancer risk associated with these soils if they were exposed at the surface is 9{times}10{sup {minus}5}.

  4. Estimating smoothness term for BP stereo matching with sparse disparities

    NASA Astrophysics Data System (ADS)

    He, Junxue; Li, Zhanming

    2011-06-01

    The belief propagation stereo matching algorithm has high computational cost and varied parameters. To address these problems and perform stereo matching in practical applications, we implement BP algorithm on cuda and propose an approach to estimate parameters of smoothness term in the energy function automatically. We use Harris corner detector and Pyramidal KLT feature tracker algorithm to extract a sparse disparity map. The rate of increase in the discontinuity cost can be compute out approximately. Experiments demonstrate that our approach is feasible and the approximate parameters of discontinuity cost can be computed out quickly.

  5. Sputter target

    DOEpatents

    Gates, Willard G.; Hale, Gerald J.

    1980-01-01

    The disclosure relates to an improved sputter target for use in the deposition of hard coatings. An exemplary target is given wherein titanium diboride is brazed to a tantalum backing plate using a gold-palladium-nickel braze alloy.

  6. Expression and Localization of CaBP Ca2+ Binding Proteins in the Mouse Cochlea.

    PubMed

    Yang, Tian; Scholl, Elizabeth S; Pan, Ning; Fritzsch, Bernd; Haeseleer, Françoise; Lee, Amy

    2016-01-01

    CaBPs are a family of EF-hand Ca2+ binding proteins that are structurally similar to calmodulin. CaBPs can interact with, and yet differentially modulate, effectors that are regulated by calmodulin, such as Cav1 voltage-gated Ca2+ channels. Immunolabeling studies suggest that multiple CaBP family members (CaBP1, 2, 4, and 5) are expressed in the cochlea. To gain insights into the respective auditory functions of these CaBPs, we characterized the expression and cellular localization of CaBPs in the mouse cochlea. By quantitative reverse transcription PCR, we show that CaBP1 and CaBP2 are the major CaBPs expressed in mouse cochlea both before and after hearing onset. Of the three alternatively spliced variants of CaBP1 (caldendrin, CaBP1-L, and CaBP1-S) and CaBP2 (CaBP2-alt, CaBP2-L, CaBP2-S), caldendrin and CaBP2-alt are the most abundant. By in situ hybridization, probes recognizing caldendrin strongly label the spiral ganglion, while probes designed to recognize all three isoforms of CaBP1 weakly label both the inner and outer hair cells as well as the spiral ganglion. Within the spiral ganglion, caldendrin/CaBP1 labeling is associated with cells resembling satellite glial cells. CaBP2-alt is strongly expressed in inner hair cells both before and after hearing onset. Probes designed to recognize all three variants of CaBP2 strongly label inner hair cells before hearing onset and outer hair cells after the onset of hearing. Thus, CaBP1 and CaBP2 may have overlapping roles in regulating Ca2+ signaling in the hair cells, and CaBP1 may have an additional function in the spiral ganglion. Our findings provide a framework for understanding the role of CaBP family members in the auditory periphery. PMID:26809054

  7. Expression and Localization of CaBP Ca2+ Binding Proteins in the Mouse Cochlea

    PubMed Central

    Pan, Ning; Fritzsch, Bernd; Haeseleer, Françoise; Lee, Amy

    2016-01-01

    CaBPs are a family of EF-hand Ca2+ binding proteins that are structurally similar to calmodulin. CaBPs can interact with, and yet differentially modulate, effectors that are regulated by calmodulin, such as Cav1 voltage-gated Ca2+ channels. Immunolabeling studies suggest that multiple CaBP family members (CaBP1, 2, 4, and 5) are expressed in the cochlea. To gain insights into the respective auditory functions of these CaBPs, we characterized the expression and cellular localization of CaBPs in the mouse cochlea. By quantitative reverse transcription PCR, we show that CaBP1 and CaBP2 are the major CaBPs expressed in mouse cochlea both before and after hearing onset. Of the three alternatively spliced variants of CaBP1 (caldendrin, CaBP1-L, and CaBP1-S) and CaBP2 (CaBP2-alt, CaBP2-L, CaBP2-S), caldendrin and CaBP2-alt are the most abundant. By in situ hybridization, probes recognizing caldendrin strongly label the spiral ganglion, while probes designed to recognize all three isoforms of CaBP1 weakly label both the inner and outer hair cells as well as the spiral ganglion. Within the spiral ganglion, caldendrin/CaBP1 labeling is associated with cells resembling satellite glial cells. CaBP2-alt is strongly expressed in inner hair cells both before and after hearing onset. Probes designed to recognize all three variants of CaBP2 strongly label inner hair cells before hearing onset and outer hair cells after the onset of hearing. Thus, CaBP1 and CaBP2 may have overlapping roles in regulating Ca2+ signaling in the hair cells, and CaBP1 may have an additional function in the spiral ganglion. Our findings provide a framework for understanding the role of CaBP family members in the auditory periphery. PMID:26809054

  8. Explorations in achievement motivation

    NASA Technical Reports Server (NTRS)

    Helmreich, Robert L.

    1982-01-01

    Recent research on the nature of achievement motivation is reviewed. A three-factor model of intrinsic motives is presented and related to various criteria of performance, job satisfaction and leisure activities. The relationships between intrinsic and extrinsic motives are discussed. Needed areas for future research are described.

  9. Achieving health care affordability.

    PubMed

    Payson, Norman C

    2002-10-01

    Not all plans are jumping headlong into the consumer-centric arena. In this article, the CEO of Oxford Health Plans discusses how advanced managed care can achieve what other consumer-centric programs seek to do--provide affordable, quality health care. PMID:12391815

  10. Issues in Achievement Testing.

    ERIC Educational Resources Information Center

    Baker, Eva L.

    This booklet is intended to help school personnel, parents, students, and members of the community understand concepts and research relating to achievement testing in public schools. The paper's sections include: (1) test use with direct effects on students (test of certification, selection, and placement); (2) test use with indirect effects on…

  11. Achieving Peace through Education.

    ERIC Educational Resources Information Center

    Clarken, Rodney H.

    While it is generally agreed that peace is desirable, there are barriers to achieving a peaceful world. These barriers are classified into three major areas: (1) an erroneous view of human nature; (2) injustice; and (3) fear of world unity. In a discussion of these barriers, it is noted that although the consciousness and conscience of the world…

  12. Achieving All Our Ambitions

    ERIC Educational Resources Information Center

    Hartley, Tricia

    2009-01-01

    National learning and skills policy aims both to build economic prosperity and to achieve social justice. Participation in higher education (HE) has the potential to contribute substantially to both aims. That is why the Campaign for Learning has supported the ambition to increase the proportion of the working-age population with a Level 4…

  13. Intelligence and Educational Achievement

    ERIC Educational Resources Information Center

    Deary, Ian J.; Strand, Steve; Smith, Pauline; Fernandes, Cres

    2007-01-01

    This 5-year prospective longitudinal study of 70,000+ English children examined the association between psychometric intelligence at age 11 years and educational achievement in national examinations in 25 academic subjects at age 16. The correlation between a latent intelligence trait (Spearman's "g"from CAT2E) and a latent trait of educational…

  14. SALT and Spelling Achievement.

    ERIC Educational Resources Information Center

    Nelson, Joan

    A study investigated the effects of suggestopedic accelerative learning and teaching (SALT) on the spelling achievement, attitudes toward school, and memory skills of fourth-grade students. Subjects were 20 male and 28 female students from two self-contained classrooms at Kennedy Elementary School in Rexburg, Idaho. The control classroom and the…

  15. NCLB: Achievement Robin Hood?

    ERIC Educational Resources Information Center

    Bracey, Gerald W.

    2008-01-01

    In his "Wall Street Journal" op-ed on the 25th of anniversary of "A Nation At Risk", former assistant secretary of education Chester E. Finn Jr. applauded the report for turning U.S. education away from equality and toward achievement. It was not surprising, then, that in mid-2008, Finn arranged a conference to examine the potential "Robin Hood…

  16. INTELLIGENCE, PERSONALITY AND ACHIEVEMENT.

    ERIC Educational Resources Information Center

    MUIR, R.C.; AND OTHERS

    A LONGITUDINAL DEVELOPMENTAL STUDY OF A GROUP OF MIDDLE CLASS CHILDREN IS DESCRIBED, WITH EMPHASIS ON A SEGMENT OF THE RESEARCH INVESTIGATING THE RELATIONSHIP OF ACHIEVEMENT, INTELLIGENCE, AND EMOTIONAL DISTURBANCE. THE SUBJECTS WERE 105 CHILDREN AGED FIVE TO 6.3 ATTENDING TWO SCHOOLS IN MONTREAL. EACH CHILD WAS ASSESSED IN THE AREAS OF…

  17. School Students' Science Achievement

    ERIC Educational Resources Information Center

    Shymansky, James; Wang, Tzu-Ling; Annetta, Leonard; Everett, Susan; Yore, Larry D.

    2013-01-01

    This paper is a report of the impact of an externally funded, multiyear systemic reform project on students' science achievement on a modified version of the Third International Mathematics and Science Study (TIMSS) test in 33 small, rural school districts in two Midwest states. The systemic reform effort utilized a cascading leadership strategy…

  18. Advancing Student Achievement

    ERIC Educational Resources Information Center

    Walberg, Herbert J.

    2010-01-01

    For the last half century, higher spending and many modern reforms have failed to raise the achievement of students in the United States to the levels of other economically advanced countries. A possible explanation, says Herbert Walberg, is that much current education theory is ill informed about scientific psychology, often drawing on fads and…

  19. Essays on Educational Achievement

    ERIC Educational Resources Information Center

    Ampaabeng, Samuel Kofi

    2013-01-01

    This dissertation examines the determinants of student outcomes--achievement, attainment, occupational choices and earnings--in three different contexts. The first two chapters focus on Ghana while the final chapter focuses on the US state of Massachusetts. In the first chapter, I exploit the incidence of famine and malnutrition that resulted to…

  20. Increasing Male Academic Achievement

    ERIC Educational Resources Information Center

    Jackson, Barbara Talbert

    2008-01-01

    The No Child Left Behind legislation has brought greater attention to the academic performance of American youth. Its emphasis on student achievement requires a closer analysis of assessment data by school districts. To address the findings, educators must seek strategies to remedy failing results. In a mid-Atlantic district of the Unites States,…

  1. Setting and Achieving Objectives.

    ERIC Educational Resources Information Center

    Knoop, Robert

    1986-01-01

    Provides basic guidelines which school officials and school boards may find helpful in negotiating, establishing, and managing objectives. Discusses characteristics of good objectives, specific and directional objectives, multiple objectives, participation in setting objectives, feedback on goal process and achievement, and managing a school…

  2. Schools Achieving Gender Equity.

    ERIC Educational Resources Information Center

    Revis, Emma

    This guide is designed to assist teachers presenting the Schools Achieving Gender Equity (SAGE) curriculum for vocational education students, which was developed to align gender equity concepts with the Kentucky Education Reform Act (KERA). Included in the guide are lesson plans for classes on the following topics: legal issues of gender equity,…

  3. Iowa Women of Achievement.

    ERIC Educational Resources Information Center

    Ohrn, Deborah Gore, Ed.

    1993-01-01

    This issue of the Goldfinch highlights some of Iowa's 20th century women of achievement. These women have devoted their lives to working for human rights, education, equality, and individual rights. They come from the worlds of politics, art, music, education, sports, business, entertainment, and social work. They represent Native Americans,…

  4. Achievements or Disasters?

    ERIC Educational Resources Information Center

    Goodwin, MacArthur

    2000-01-01

    Focuses on policy issues that have affected arts education in the twentieth century, such as: interest in discipline-based arts education, influence of national arts associations, and national standards and coordinated assessment. States that whether the policy decisions are viewed as achievements or disasters are for future determination. (CMK)

  5. Minority Achievement Report.

    ERIC Educational Resources Information Center

    Prince George's Community Coll., Largo, MD. Office of Institutional Research and Analysis.

    This report summarizes the achievements of Prince George's Community College (PGCC) with regard to minority outcomes. Table 1 summarizes the undergraduate enrollment trends for African Americans as well as total minorities from fall 1994 through fall 1998. Both the headcount number of African American students and the proportion of African…

  6. Appraising Reading Achievement.

    ERIC Educational Resources Information Center

    Ediger, Marlow

    To determine quality sequence in pupil progress, evaluation approaches need to be used which guide the teacher to assist learners to attain optimally. Teachers must use a variety of procedures to appraise student achievement in reading, because no one approach is adequate. Appraisal approaches might include: (1) observation and subsequent…

  7. Improving Student Achievement through Character Education.

    ERIC Educational Resources Information Center

    Finck, Chip; Hansen, Cynthia; Jensen, Jane

    This report describes a program for improving moral character to increase academic achievement. Targeted population consisted of middle school students in a growing middle class community in a northern suburb of Chicago, Illinois. The problem, an absence of proper moral character, was documented through data collected from discipline referrals to…

  8. Increasing Math Achievement through Use of Music.

    ERIC Educational Resources Information Center

    Bryant-Jones, Marian; Shimmins, Kymberley J.; Vega, Jill D.

    This report describes a program for increasing math achievement through the use of musical interventions including repeated exposure to Mozart classical music and School House Rock, and introduction to teacher-made songs that introduce mathematical concepts in the music classroom. The students of the targeted second and fourth grade classes…

  9. AMP-activated protein kinase phosphorylates CtBP1 and down-regulates its activity

    SciTech Connect

    Kim, Jae-Hwan; Choi, Soo-Youn; Kang, Byung-Hee; Lee, Soon-Min; Cho, Eun-Jung; Youn, Hong-Duk

    2013-02-01

    Highlights: ► AMPK phosphorylates CtBP1 on serine 158. ► AMPK-mediated phosphorylation of CtBP1 causes the ubiquitination and nuclear export of CtBP1. ► AMPK downregulates the CtBP1-mediated repression of Bax transcription. -- Abstract: CtBP is a transcriptional repressor which plays a significant role in the regulation of cell proliferation and tumor progression. It was reported that glucose withdrawal causes induction of Bax due to the dissociation of CtBP from the Bax promoter. However, the precise mechanism involved in the regulation of CtBP still remains unclear. In this study, we found that an activated AMP-activated protein kinase (AMPK) phosphorylates CtBP1 on Ser-158 upon metabolic stresses. Moreover, AMPK-mediated phosphorylation of CtBP1 (S158) attenuates the repressive function of CtBP1. We also confirmed that triggering activation of AMPK by various factors resulted in an increase of Bax gene expression. These findings provide connections of AMPK with CtBP1-mediated regulation of Bax expression for cell death under metabolic stresses.

  10. Phosphorylation and Rapid Relocalization of 53BP1 to Nuclear Foci upon DNA Damage

    PubMed Central

    Anderson, Lindsay; Henderson, Catherine; Adachi, Yasuhisa

    2001-01-01

    53BP1 is a human BRCT protein that was originally identified as a p53-interacting protein by the Saccharomyces cerevisiae two-hybrid screen. Although the carboxyl-terminal BRCT domain shows similarity to Crb2, a DNA damage checkpoint protein in fission yeast, there is no evidence so far that implicates 53BP1 in the checkpoint. We have identified a Xenopus homologue of 53BP1 (XL53BP1). XL53BP1 is associated with chromatin and, in some cells, localized to a few large foci under normal conditions. Gamma-ray irradiation induces increased numbers of the nuclear foci in a dose-dependent manner. The damage-induced 53BP1 foci appear rapidly (in 30 min) after irradiation, and de novo protein synthesis is not required for this response. In human cells, 53BP1 foci colocalize with Mrel1 foci at later stages of the postirradiation period. XL53BP1 is hyperphosphorylated after X-ray irradiation, and inhibitors of ATM-related kinases delay the relocalization and reduce the phosphorylation of XL53BP1 in response to X-irradiation. In AT cells, which lack ATM kinase, the irradiation-induced responses of 53BP1 are similarly affected. These results suggest a role for 53BP1 in the DNA damage response and/or checkpoint control which may involve signaling of damage to p53. PMID:11238909

  11. Liver Protein Targets of Hepatotoxic 4-Bromophenol Metabolites

    PubMed Central

    Koen, Yakov M.; Hajovsky, Heather; Liu, Ke; Williams, Todd D.; Galeva, Nadezhda A.; Staudinger, Jeffrey L.; Hanzlik, Robert P.

    2012-01-01

    The hepatotoxicity of bromobenzene (BB) is directly related to the covalent binding of both initially formed epoxide and secondary quinone metabolites to at least 45 different liver proteins. 4-Bromophenol (4BP) is a significant BB metabolite and a precursor to reactive quinone metabolites, yet when administered exogenously it has negligible hepatotoxicity compared to BB. The protein adducts of 4BP were thus labeled as non-toxic (Monks, T. J.; Hinson, J. A.; Gillette, J. R. (1982) Life Sci. 30, 841–848). To help identify which BB-derived adducts might be related to its cytotoxicity, we sought to identify the supposedly non-toxic adducts of 4BP and eliminate them from the BB target protein list. Administration of [14C]-4BP to phenobarbital-induced rats resulted in covalent binding of 0.25, 0.33 and 0.42 nmol-eq 4BP/mg protein in the mitochondrial, microsomal and cytosolic fractions, respectively. These values may be compared to published values of 3–6 nmol/mg protein from a comparable dose of [14C]-BB. After subcellular fractionation and 2D electrophoresis, 47 radioactive spots on 2D gels of the mitochondrial, microsomal and cytosolic fractions were excised, digested and analyzed by LC-MS/MS. Twenty nine of these spots contained apparently single proteins, of which 14 were non-redundant. Nine of the 14 are known BB targets. Incubating freshly-isolated rat hepatocytes with 4BP (0.1–0.5 mM) produced time- and concentration-dependent increases in lactate dehydrogenase release and changes in cellular morphology. LC-MS/MS analysis of the cell culture medium revealed rapid and extensive sulfation and glucuronidation of 4BP as well as formation of a quinone-derived glutathione conjugate. Studies with 7-hydroxycoumarin (7HC), (−)-borneol or D-(+)-galactosamine (DGN) showed that inhibiting the glucuronidation/sulfation of 4BP increased the formation of a GSH-bromoquinone adduct, increased covalent binding of 4BP to hepatocyte proteins and potentiated its cytotoxicity

  12. Phosphorylated 4E-BP1 is Associated with Poor Survival in Melanoma

    PubMed Central

    O’Reilly, Kathryn E.; Warycha, Melanie; Davies, Michael A.; Rodrik, Vanessa; Zhou, Xi K.; Yee, Herman; Polsky, David; Pavlick, Anna C.; Rosen, Neal; Bhardwaj, Nina; Mills, Gordon; Osman, Iman

    2009-01-01

    Purpose Both the PI3K/AKT and RAS/MAPK signal transduction pathways mediate 4E-BP1 phosphorylation, releasing 4E-BP1 from the mRNA cap and permitting translation initiation. Given the prevalence of PTEN and B-RAF mutations in melanoma, we first examined translation initiation, as measured by phosphorylated 4E-BP1, in metastatic melanoma tissues and cell lines. We then tested the association between amounts of total and phosphorylated 4E-BP1 and patient survival. Experimental Design Seven human metastatic melanoma cells lines and 72 metastatic melanoma patients with accessible metastatic tumor tissues and extended follow up information were studied. Expression of 4E-BP1 transcript, total 4E-BP1 protein, and phosphorylated 4E-BP1 were examined. The relationship between 4E-BP1 transcript and protein expression was assessed in a subset of patient tumors (n=41). The association between total and phospho-4E-BP1 levels and survival was examined in the larger cohort of patients (n=72). Results 4E-BP1 was hyperphosphorylated in 4/7 melanoma cell lines harboring BRAF and PTEN mutations as compared to untransformed melanocytes or RAS/RAF/PTEN wild type melanoma cells. 4E-BP1 transcript correlated with 4E-BP1 total protein levels as measured by the semi-quantitative reverse phase protein array (p=0.012). High levels of phosphorylated 4E-BP1 were associated with worse overall and post-recurrence survival (p=0.02, 0.0003 respectively). Conclusion Our data demonstrate that translation initiation is a common event in human metastatic melanoma and correlates with worse prognosis. Therefore, effective inhibition of the pathways responsible for 4E-BP1 phosphorylation should be considered to improve the treatment outcome of metastatic melanoma patients. PMID:19336517

  13. SPECTROPOLARIMETRY OF THE CLASSICAL T TAURI STAR BP TAU

    SciTech Connect

    Chen, Wei; Johns-Krull, Christopher M. E-mail: cmj@rice.edu

    2013-10-20

    We implement a least-squares deconvolution (LSD) code to study magnetic fields on cool stars. We first apply our code to high-resolution optical echelle spectra of 53 Cam (a magnetic Ap star) and three well-studied cool stars (Arcturus, 61 Cyg A, and ξ Boo A) as well as the Sun (by observing the asteroid Vesta) as tests of the code and the instrumentation. Our analysis is based on several hundred photospheric lines spanning the wavelength range 5000 Å to 9000 Å. We then apply our LSD code to six nights of data on the Classical T Tauri Star BP Tau. A maximum longitudinal field of 370 ± 80 G is detected from the photospheric lines on BP Tau. A 1.8 kG dipole tilted at 129° with respect to the rotation axis and a 1.4 kG octupole tilted at 104° with respect to the rotation axis, both with a filling factor of 0.25, best fit our LSD Stokes V profiles. Measurements of several emission lines (He I 5876 Å, Ca II 8498 Å, and 8542 Å) show the presence of strong magnetic fields in the line formation regions of these lines, which are believed to be the base of the accretion footpoints. The field strength measured from these lines shows night-to-night variability consistent with rotation of the star.

  14. Spectropolarimetry of the Classical T Tauri Star BP Tau

    NASA Astrophysics Data System (ADS)

    Chen, Wei; Johns-Krull, Christopher M.

    2013-10-01

    We implement a least-squares deconvolution (LSD) code to study magnetic fields on cool stars. We first apply our code to high-resolution optical echelle spectra of 53 Cam (a magnetic Ap star) and three well-studied cool stars (Arcturus, 61 Cyg A, and ξ Boo A) as well as the Sun (by observing the asteroid Vesta) as tests of the code and the instrumentation. Our analysis is based on several hundred photospheric lines spanning the wavelength range 5000 Å to 9000 Å. We then apply our LSD code to six nights of data on the Classical T Tauri Star BP Tau. A maximum longitudinal field of 370 ± 80 G is detected from the photospheric lines on BP Tau. A 1.8 kG dipole tilted at 129° with respect to the rotation axis and a 1.4 kG octupole tilted at 104° with respect to the rotation axis, both with a filling factor of 0.25, best fit our LSD Stokes V profiles. Measurements of several emission lines (He I 5876 Å, Ca II 8498 Å, and 8542 Å) show the presence of strong magnetic fields in the line formation regions of these lines, which are believed to be the base of the accretion footpoints. The field strength measured from these lines shows night-to-night variability consistent with rotation of the star.

  15. 4E-BP1 phosphorylation is mediated by the FRAP-p70s6k pathway and is independent of mitogen-activated protein kinase.

    PubMed Central

    von Manteuffel, S R; Gingras, A C; Ming, X F; Sonenberg, N; Thomas, G

    1996-01-01

    It has previously been argued that the repressor of protein synthesis initiation factor 4E, 4E-BP1, is a direct in vivo target of p42mapk. However, the immunosuppressant rapamycin blocks serum-induced 4E-BP1 phosphorylation and, in parallel, p70s6k activation, with no apparent effect on p42mapk activation. Consistent with this finding, the kinetics of serum-induced 4E-BP1 phosphorylation closely follow those of p70s6k activation rather than those of p42mapk. More striking, insulin, which does not induce p42mapk activation in human 293 cells or Swiss mouse 3T3 cells, induces 4E-BP1 phosphorylation and p70s6k activation in both cell types. Anisomycin, which, like insulin, does not activate p42mapk, promotes a small parallel increase in 4E-BP1 phosphorylation and p70s6k activation. The insulin effect on 4E-BP1 phosphorylation and p70s6k activation in both cell types is blocked by SQ20006, wortmannin, and rapamycin. These three inhibitors have no effect on p42mapk activation induced by phorbol 12-tetradecanoate 13-acetate, though wortmannin partially suppresses both the p70s6k response and the 4E-BP1 response. Finally, in porcine aortic endothelial cells stably transfected with either the wild-type platelet-derived growth factor receptor or a mutant receptor bearing the double point mutation 740F/751F, p42mapk activation in response to platelet-derived growth factor is unimpaired, but increased 4E-BP1 phosphorylation is ablated, as previously reported for p70s6k. The data presented here demonstrate that 4E-BP1 phosphorylation is mediated by the FRAP-p70s6k pathway and is independent of mitogen-activated protein kinase. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8633019

  16. Project ACHIEVE final report

    SciTech Connect

    1997-06-13

    Project ACHIEVE was a math/science academic enhancement program aimed at first year high school Hispanic American students. Four high schools -- two in El Paso, Texas and two in Bakersfield, California -- participated in this Department of Energy-funded program during the spring and summer of 1996. Over 50 students, many of whom felt they were facing a nightmare future, were given the opportunity to work closely with personal computers and software, sophisticated calculators, and computer-based laboratories -- an experience which their regular academic curriculum did not provide. Math and science projects, exercises, and experiments were completed that emphasized independent and creative applications of scientific and mathematical theories to real world problems. The most important outcome was the exposure Project ACHIEVE provided to students concerning the college and technical-field career possibilities available to them.

  17. Target capture and target ghosts

    NASA Astrophysics Data System (ADS)

    Auerbach, Steven P.

    1996-05-01

    Optimal detection methods for small targets rely on whitened matched filters, which convolve the measured data with the signal model, and whiten the result with the noise covariance. In real-world implementations of such filters, the noise covariance must be estimated from the data, and the resulting covariance estimate may be corrupted by presence of the target. The resulting loss in SNR is called 'target capture'. Target capture is often thought to be a problem only for bright targets. This presentation shows that target capture also arises for dim targets, leading to an SNR loss which is independent of target strength and depends on the averaging method used to estimate the noise covariance. This loss is due to a 'coherent beat' between the true noise and that portion of the estimated noise covariance due to the target. This beat leads to 'ghost targets', which diminish the target SNR by producing a negative target ghost at the target's position. A quantitative estimate of this effect will be given, and shown to agree with numerical results. The effect of averaging on SNR is also discussed for data scenes with synthetic injected targets, in cases where the noise covariance is estimated using 'no target' data. For these cases, it is shown that the so-called 'optimal' filter, which uses the true noise covariance, is actually worse than a 'sub-optimal' filter which estimates the noise from scene. This apparent contradiction is resolved by showing that the optimal filter is best if the same filter is used for many scenes, but is outperformed by a filter adapted to a specific scene.

  18. Silencing of CtBP1 suppresses the migration in human glioma cells.

    PubMed

    Zhao, Chengjin; Shen, Yifen; Tao, Xuelei; Xu, Jian; Lu, Junjie; Liu, Chao; Xu, Zhiwei; Tang, Qing; Tao, Tao; Zhang, Xiubing

    2016-06-01

    Carboxyl-terminal binding protein 1 (CtBP1), up-regulated in various types of human cancers, has been functionally associated with proliferation, anti-apoptosis, and EMT in vitro studies. However, the functional significance of CtBP1 in the pathophysiology of glioma remains unknown. In the present study, we showed the expression of CtBP1 was markedly higher in glioma tissues compared with normal brain tissues by Western blot analysis. Immunohistochemical analysis revealed that CtBP1 mainly localized in the nucleus of glioma cells. Statistical analysis suggested the upregulation of CtBP1 was considerably correlated with the WHO grade (P < 0.05) and those patients with high CtBP1 levels exhibited shorter survival time (P < 0.01). Silencing CtBP1 by short hairpin RNAi caused an inhibition of cell migration. Moreover, knockdown of CtBP1 increases E-cadherin expression and decreases vimentin expression. These data uncovered that CtBP1 protein is a valuable marker of glioma pathogenic process and that CtBP1 can serve as a novel prognostic marker for glioma therapy. PMID:27160109

  19. E4BP4 is a cardiac survival factor and essential for embryonic heart development.

    PubMed

    Weng, Yi-Jiun; Hsieh, Dennis Jine-Yuan; Kuo, Wei-Wen; Lai, Tung-Yuan; Hsu, Hsi-Hsien; Tsai, Chang-Hai; Tsai, Fuu-Jen; Lin, Ding-Yu; Lin, James A; Huang, Chih-Yang; Tung, Kwong-Chung

    2010-07-01

    The bZIP transcription factor E4BP4, has been demonstrated to be a survival factor in pro-B lymphocytes. GATA factors play important roles in transducing the IL-3 survival signal and transactivating the downstream survival gene, E4BP4. In heart, GATA sites are essential for proper transcription of several cardiac genes, and GATA-4 is a mediator of cardiomyocyte survival. However, the role E4BP4 plays in heart is still poorly understood. In this study, Dot-blot hybridization assays using Dig-labeled RNA probes revealed that the E4BP4 gene was expressed in cardiac tissue from several species including, monkey, dog, rabbit, and human. Western blot analysis showed that the E4BP4 protein was consistently present in all of these four species. Furthermore, immunohistochemistry revealed that the E4BP4 protein was overexpressed in diseased heart tissue in comparison with normal heart tissue. In addition, the overexpression of E4BP4 in vitro activated cell survival signaling pathway of cardiomyocytes. At last, siRNA-mediated knock down of E4BP4 in zebrafish resulted in malformed looping of the embryonic heart tube and decreased heart beating. Based on these results, we conclude that E4BP4 plays as a survival factor in heart and E4BP4 is essential for proper embryonic heart development. PMID:20186462

  20. An Analysis of the Rapidly Rotating Bp star HD 133880

    NASA Technical Reports Server (NTRS)

    Bailey, J. D.; Grunhut, J.; Shultz, M.; Wade, G.; Landstreet, J. D.; Bohlender, D.; Lim, J.; Wong, K.; Drake, S.; Linsky, J.

    2012-01-01

    HD 133880 is a rapidly rotating chemically peculiar B-type (Bp) star (nu sin i approx = 103km/s) and is host to one of the strongest magnetic fields of any Ap/Bp star. A member of the Upper Centaurus Lupus association, it is a star with a well-determined age of 16 Myr. 12 new spectra, four of which are polarimetric, obtained from the FEROS, ESPaDOnS and HARPS instruments, provide sufficient material from which to re-evaluate the magnetic field and obtain a first approximation to the atmospheric abundance distributions of He, O, Mg, Si, Ti. Cr, Fe, Ni, Pr and Nd. An abundance analysis was carried out using ZEEMAN, a program which synthesizes spectral line profiles for stars with permeating magnetic fields. The magnetic field structure was characterized by a colinear multipole expansion from the observed variations of the longitudinal and surface fields with rotational phase. Both magnetic hemispheres are clearly visible during the stellar rotation, and thus a three-ring abundance distribution model encompassing both magnetic poles and magnetic equator with equal spans in colatitude was adopted. Using the new magnetic field measurements and optical photometry together with previously published data, we refine the period of HD 133880 to P = 0.877 476 +/- 0.000009 d. Our simple axisymmetric magnetic field model is based on a predominantly quadrupolar component that roughly describes the field variations. Using spectrum synthesis, we derived mean abundances for O, Mg, Si, Ti, Cr, Fe and Pr. All elements; except Mg, are overabundant compared to the Son. Mg appears to be approximately uniform over the stellar surface, while all other elements are more abundant in the negative magnetic hemisphere than in the positive magnetic hemisphere. In contrast to most Ap/Bp stars which show an underabundance in 0, in HD 133880 this element is clearly overabundant compared to the solar abundance ratio. In studying the Ha and Paschen lines in the optical spectra, we could not

  1. Identify Melatonin as a Novel Therapeutic Reagent in the Treatment of 1-Bromopropane(1-BP) Intoxication

    PubMed Central

    Xu, Yongpeng; Wang, Shuo; Jiang, Lulu; Wang, Hui; Yang, Yilin; Li, Ming; Wang, Xujing; Zhao, Xiulan; Xie, Keqin

    2016-01-01

    Abstract 1-Bromopropane (1-BP) has been used as an alternative for fluoride compounds and 1-BP intoxication may involve lung, liver, and central neural system (CNS). Our previous studies showed that 1-BP impaired memory ability by compromising antioxidant cellular defenses. Melatonin is a powerful endogenous antioxidant, and the objective of this study was to explore the therapeutic role of melatonin in the treatment of 1-BP intoxication. Rats were intragastrically treated with 1-BP with or without melatonin, and then sacrificed on 27th day after 1-BP administration. The Morris water maze (MWM) test was used to evaluate the spatial learning and memory ability of the experimental animals, and NeuN staining was performed to assess neuron loss in hippocampus. We found that rats treated with 1-BP spent more time and swam longer distance before landing on the hidden platform with a comparable swimming speed, which was markedly mitigated by the pretreatment with melatonin in a concentration-dependent manner. In addition, 1-BP-induced notable decrease in neuron population in hippocampus by promoting apoptosis, and melatonin pretreatment attenuated those changes in brain. The GSH/GSSG ratio was proportionately decreased and heme oxygenase 1 was increased in the rats exposed to 1-BP (Figure 6), and administration of melatonin restored them. Meanwhile, MDA, the level of lipid peroxidation product, was significantly increased upon exposed to 1-BP, which was significantly attenuated by melatonin pretreatment, indicating that administration of 1-BP could interfere with redox homeostasis of brain in rat, and such 1-BP-induced biomedical changes were reversed by treatment with melatonin. We conclude that treatment with melatonin attenuates 1-BP-induced CNS toxicity through its ROS scavenging effect. PMID:26817862

  2. Identify Melatonin as a Novel Therapeutic Reagent in the Treatment of 1-Bromopropane(1-BP) Intoxication.

    PubMed

    Xu, Yongpeng; Wang, Shuo; Jiang, Lulu; Wang, Hui; Yang, Yilin; Li, Ming; Wang, Xujing; Zhao, Xiulan; Xie, Keqin

    2016-01-01

    1-Bromopropane (1-BP) has been used as an alternative for fluoride compounds and 1-BP intoxication may involve lung, liver, and central neural system (CNS). Our previous studies showed that 1-BP impaired memory ability by compromising antioxidant cellular defenses. Melatonin is a powerful endogenousantioxidant, and the objective of this study was to explore the therapeutic role of melatonin in the treatment of 1-BP intoxication. Rats were intragastrically treated with 1-BP with or without melatonin, and then sacrificed on 27th day after 1-BP administration. The Morris water maze (MWM) test was used to evaluate the spatial learning and memory ability of the experimental animals, and NeuN staining was performed to assess neuron loss in hippocampus. We found that rats treated with 1-BP spent more time and swam longer distance before landing on the hidden platform with a comparable swimming speed, which was markedly mitigated by the pretreatment with melatonin in a concentration-dependent manner. In addition, 1-BP-induced notable decrease in neuron population in hippocampus by promoting apoptosis, and melatonin pretreatment attenuated those changes in brain. The GSH/GSSG ratio was proportionately decreased and heme oxygenase 1 was increased in the rats exposed to 1-BP (Figure 6), and administration of melatonin restored them. Meanwhile, MDA, the level of lipid peroxidation product, was significantly increased upon exposed to 1-BP, which was significantly attenuated by melatonin pretreatment, indicating that administration of 1-BP could interfere with redox homeostasis of brain in rat, and such 1-BP-induced biomedical changes were reversed by treatment with melatonin.We conclude that treatment with melatonin attenuates 1-BP-induced CNS toxicity through its ROS scavenging effect. PMID:26817862

  3. Targeted delivery to bone and mineral deposits using bisphosphonate ligands.

    PubMed

    Cole, Lisa E; Vargo-Gogola, Tracy; Roeder, Ryan K

    2016-04-01

    The high concentration of mineral present in bone and pathological calcifications is unique compared with all other tissues and thus provides opportunity for targeted delivery of pharmaceutical drugs, including radiosensitizers and imaging probes. Targeted delivery enables accumulation of a high local dose of a therapeutic or imaging contrast agent to diseased bone or pathological calcifications. Bisphosphonates (BPs) are the most widely utilized bone-targeting ligand due to exhibiting high binding affinity to hydroxyapatite mineral. BPs can be conjugated to an agent that would otherwise have little or no affinity for the sites of interest. This article summarizes the current state of knowledge and practice for the use of BPs as ligands for targeted delivery to bone and mineral deposits. The clinical history of BPs is briefly summarized to emphasize the success of these molecules as therapeutics for metabolic bone diseases. Mechanisms of binding and the relative binding affinity of various BPs to bone mineral are introduced, including common methods for measuring binding affinity in vitro and in vivo. Current research is highlighted for the use of BP ligands for targeted delivery of BP conjugates in various applications, including (1) therapeutic drug delivery for metabolic bone diseases, bone cancer, other bone diseases, and engineered drug delivery platforms; (2) imaging probes for scintigraphy, fluorescence, positron emission tomography, magnetic resonance imaging, and computed tomography; and (3) radiotherapy. Last, and perhaps most importantly, key structure-function relationships are considered for the design of drugs with BP ligands, including the tether length between the BP and drug, the size of the drug, the number of BP ligands per drug, cleavable tethers between the BP and drug, and conjugation schemes. PMID:26482186

  4. Achieving Magnet status.

    PubMed

    Ellis, Beckie; Gates, Judy

    2005-01-01

    Magnet has become the gold standard for nursing excellence. It is the symbol of effective and safe patient care. It evaluates components that inspire safe care, including employee satisfaction and retention, professional education, and effective interdisciplinary collaboration. In an organization whose mission focuses on excellent patient care, Banner Thunderbird Medical Center found that pursuing Magnet status was clearly the next step. In this article, we will discuss committee selection, education, team building, planning, and the discovery process that define the Magnet journey. The road to obtaining Magnet status has permitted many opportunities to celebrate our achievements. PMID:16056158

  5. A photometric and spectrographic study of BP Pegasi

    SciTech Connect

    Kim, C.; Mcnamara, D.H.; Joner, M.D. Brigham Young Univ., Provo, UT )

    1989-11-01

    Photometric (uvby beta) and spectrographic observations of the dwarf Cepheid BP Peg are discussed. The observations are used to derive a reddening value of E(b-y) = 0.067 m. An effective temperature of 7470 K, a mean surface gravity, log g = 3.85, and a Fe/H abundance ratio of - 0.08 are obtained. Pulsation theory and stellar model sequences yield M(bol) = 1.4 m, mass = 1.85 solar masses, and age = 1.3 X 10 to the 9th yrs. Also, the radial-velocity data show a mean radial velocity of - 30 km/s and a total velocity range of 36 km/s. 14 refs.

  6. BP Cherry Point Cogeneration Project, Draft Environmental Impact Statement

    SciTech Connect

    N /A

    2003-09-19

    BP West Coast Products, LLC (BP or the Applicant) proposes to construct and operate a nominal 720-megawatt (MW), natural-gas-fired, combined-cycle cogeneration facility next to the existing BP Cherry Point Refinery in Whatcom County, Washington. The Applicant also owns and operates the refinery, but the cogeneration facility and the refinery would be operated as separate business units. The cogeneration facility and its ancillary infrastructure would provide steam and 85 MW of electricity to meet the operating needs of the refinery and 635 MW of electrical power for local and regional consumption. The proposed cogeneration facility would be located between Ferndale and Blaine in northwestern Whatcom County, Washington. The Canadian border is approximately 8 miles north of the proposed project site. The Washington State Energy Facility Site Evaluation Council (EFSEC) has jurisdiction over the evaluation of major energy facilities including the proposed project. As such, EFSEC will recommend approval or denial of the proposed cogeneration facility to the governor of Washington after an environmental review. On June 3, 2002, the Applicant filed an Application for Site Certification (ASC No. 2002-01) with EFSEC in accordance with Washington Administrative Code (WAC) 463-42. On April 22, 2003, the Applicant submitted an amended ASC that included, among other things, a change from air to water cooling. With the submission of the ASC and in accordance with the State Environmental Policy Act (SEPA) (WAC 463-47), EFSEC is evaluating the siting of the proposed project and conducting an environmental review with this Environmental Impact Statement (EIS). Because the proposed project requires federal agency approvals and permits, this EIS is intended to meet the requirements under both SEPA and the National Environmental Policy Act (NEPA). The Bonneville Power Administration (Bonneville) and U.S. Army Corps of Engineers (Corps) also will use this EIS as part of their

  7. Mitochondria: 3-bromopyruvate vs. mitochondria? A small molecule that attacks tumors by targeting their bioenergetic diversity.

    PubMed

    Galina, Antonio

    2014-09-01

    Enhanced glycolysis, the classic bioenergetic phenotype of cancer cells was described by Otto Warburg approximately 90 years ago. However, the Warburg hypothesis does not necessarily imply mitochondrial dysfunction. The alkyl-halogen, 3-bromopyruvate (3BP), would not be expected to have selective targets for cancer therapy due to its high potential reactivity toward many SH side groups. Contrary to predictions, 3BP interferes with glycolysis and oxidative phosphorylation in cancer cells without side effects in normal tissues. The mitochondrial hexokinase II has been claimed as the main target. This "Organelle in focus" article presents a historical view of the use of 3BP in biochemistry and its effects on ATP-producing pathways of cancer cells. I will discuss how the alkylated enzymes contribute to the cooperative collapse of mitochondria and apoptosis. Perspectives for targeting 3BP to bioenergetics enzymes for cancer treatment will be considered. PMID:24842108

  8. Icariside II, a natural mTOR inhibitor, disrupts aberrant energy homeostasis via suppressing mTORC1-4E-BP1 axis in sarcoma cells.

    PubMed

    Zhang, Chao; Yang, Lei; Geng, Ya-di; An, Fa-Liang; Xia, Yuan-Zheng; Guo, Chao; Luo, Jian-Guang; Zhang, Lu-Yong; Guo, Qing-Long; Kong, Ling-Yi

    2016-05-10

    The aberrant energy homeostasis that characterized by high rate of energy production (glycolysis) and energy consumption (mRNA translation) is associated with the development of cancer. As mammalian target of rapamycin (mTOR) is a critical regulator of aberrant energy homeostasis, it is an attractive target for anti-tumor intervention. The flavonoid compound Icariside II (IS) is a natural mTOR inhibitor derived from Epimedium. Koreanum. Herein, we evaluate the effect of IS on aberrant energy homeostasis. The reduction of glycolysis and mRNA translation in U2OS (osteosarcoma), S180 (fibrosarcoma) and SW1535 (chondrosarcoma) cells observed in our study, indicate that, IS inhibits aberrant energy homeostasis. This inhibition is found to be due to suppression of mammalian target of rapamycin complex 1 (mTORC1)-eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) axis through blocking the assembly of mTORC1. Furthermore, IS inhibits the cap-dependent translation of c-myc through mTORC1-4E-BP1 axis which links the relationship between mRNA translation and glycolysis. Inhibition of aberrant energy homeostasis by IS, contributes to its in vitro and in vivo anti-proliferation activity. These data indicate that IS disrupts aberrant energy homeostasis of sarcoma cells through suppression of mTORC1-4E-BP1 axis, providing a novel mechanism of IS to inhibit cell proliferation in sarcoma cells. PMID:27056897

  9. Lamin A/C-dependent interaction with 53BP1 promotes cellular responses to DNA damage

    PubMed Central

    Gibbs-Seymour, Ian; Markiewicz, Ewa; Bekker-Jensen, Simon; Mailand, Niels; Hutchison, Christopher J

    2015-01-01

    Lamins A/C have been implicated in DNA damage response pathways. We show that the DNA repair protein 53BP1 is a lamin A/C binding protein. In undamaged human dermal fibroblasts (HDF), 53BP1 is a nucleoskeleton protein. 53BP1 binds to lamins A/C via its Tudor domain, and this is abrogated by DNA damage. Lamins A/C regulate 53BP1 levels and consequently lamin A/C-null HDF display a 53BP1 null-like phenotype. Our data favour a model in which lamins A/C maintain a nucleoplasmic pool of 53BP1 in order to facilitate its rapid recruitment to sites of DNA damage and could explain why an absence of lamin A/C accelerates aging. PMID:25645366

  10. LIQUID TARGET

    DOEpatents

    Martin, M.D.; Salsig, W.W. Jr.

    1959-01-13

    A liquid handling apparatus is presented for a liquid material which is to be irradiated. The apparatus consists essentially of a reservoir for the liquid, a target element, a drain tank and a drain lock chamber. The target is in the form of a looped tube, the upper end of which is adapted to be disposed in a beam of atomic particles. The lower end of the target tube is in communication with the liquid in the reservoir and a means is provided to continuously circulate the liquid material to be irradiated through the target tube. Means to heat the reservoir tank is provided in the event that a metal is to be used as the target material. The apparatus is provided with suitable valves and shielding to provide maximum safety in operation.

  11. Target Homework to Maximize Learning

    ERIC Educational Resources Information Center

    Heitzmann, Ray

    2007-01-01

    Targeted homework is based upon the belief that homework can make a significant contribution to student achievement in the areas of knowledge, skills, and values. It centers on the notion that homework achieves maximum effectiveness when teachers share the school's homework policy as well as their policy with students and parents or guardians. The…

  12. Multiple target laser ablation system

    DOEpatents

    Mashburn, Douglas N.

    1996-01-01

    A laser ablation apparatus and method are provided in which multiple targets consisting of material to be ablated are mounted on a movable support. The material transfer rate is determined for each target material, and these rates are stored in a controller. A position detector determines which target material is in a position to be ablated, and then the controller controls the beam trigger timing and energy level to achieve a desired proportion of each constituent material in the resulting film.

  13. Multiple target laser ablation system

    DOEpatents

    Mashburn, D.N.

    1996-01-09

    A laser ablation apparatus and method are provided in which multiple targets consisting of material to be ablated are mounted on a movable support. The material transfer rate is determined for each target material, and these rates are stored in a controller. A position detector determines which target material is in a position to be ablated, and then the controller controls the beam trigger timing and energy level to achieve a desired proportion of each constituent material in the resulting film. 3 figs.

  14. Recognizing outstanding achievements

    NASA Astrophysics Data System (ADS)

    Speiss, Fred

    One function of any professional society is to provide an objective, informed means for recognizing outstanding achievements in its field. In AGU's Ocean Sciences section we have a variety of means for carrying out this duty. They include recognition of outstanding student presentations at our meetings, dedication of special sessions, nomination of individuals to be fellows of the Union, invitations to present Sverdrup lectures, and recommendations for Macelwane Medals, the Ocean Sciences Award, and the Ewing Medal.Since the decision to bestow these awards requires initiative and judgement by members of our section in addition to a deserving individual, it seems appropriate to review the selection process for each and to urge you to identify those deserving of recognition.

  15. Achieving closure at Fernald

    SciTech Connect

    Bradburne, John; Patton, Tisha C.

    2001-02-25

    When Fluor Fernald took over the management of the Fernald Environmental Management Project in 1992, the estimated closure date of the site was more than 25 years into the future. Fluor Fernald, in conjunction with DOE-Fernald, introduced the Accelerated Cleanup Plan, which was designed to substantially shorten that schedule and save taxpayers more than $3 billion. The management of Fluor Fernald believes there are three fundamental concerns that must be addressed by any contractor hoping to achieve closure of a site within the DOE complex. They are relationship management, resource management and contract management. Relationship management refers to the interaction between the site and local residents, regulators, union leadership, the workforce at large, the media, and any other interested stakeholder groups. Resource management is of course related to the effective administration of the site knowledge base and the skills of the workforce, the attraction and retention of qualified a nd competent technical personnel, and the best recognition and use of appropriate new technologies. Perhaps most importantly, resource management must also include a plan for survival in a flat-funding environment. Lastly, creative and disciplined contract management will be essential to effecting the closure of any DOE site. Fluor Fernald, together with DOE-Fernald, is breaking new ground in the closure arena, and ''business as usual'' has become a thing of the past. How Fluor Fernald has managed its work at the site over the last eight years, and how it will manage the new site closure contract in the future, will be an integral part of achieving successful closure at Fernald.

  16. Targeted Support

    ERIC Educational Resources Information Center

    Simon, Gabe

    2011-01-01

    Heritage Oak Elementary School (Placer County, CA) has continuously achieved a high level of academic success as measured by the California Standards Test. However, after examining student testing data in depth, staff discovered a large achievement gap between the overall school population, socio-economically disadvantaged students, and students…

  17. About the {open_quotes}Asian{close_quotes}-specific 9-bp deletion of mtDNA...

    SciTech Connect

    Torroni, A.; Petrozzi, M.; Santolamazza, P.

    1995-08-01

    The 9-bp deletion between the COII and tRNA{sup Lys} genes is due to the lack of one of two adjacent copies of a 9-bp sequence usually present in human mtDNA. This mutation is very common in Asians and populations of Asian ancestry (e.g., Polynesians and Amerinds) and often has been considered and ethnic-specific polymorphism for these populations. We now report the detection of the COII-tRNA{sup Lys} 9-bp deletion in an individual of Italian descent. To our knowledge, this is the first time that the 9-bp deletion has been observed in Europeans. 19 refs.

  18. The relationship between prenatal exposure to BP-3 and Hirschsprung's disease.

    PubMed

    Huo, Weiwei; Cai, Peng; Chen, Minjian; Li, Hongxing; Tang, Junwei; Xu, Chao; Zhu, Dongmei; Tang, Weibing; Xia, Yankai

    2016-02-01

    Hirschsprung's disease (HSCR) is neonatal intestinal abnormality which derived from the faliure of enteric neural crest cells migration to hindgut during embryogenesis from 5 to 12 weeks. Currenly, the knowledge of environmental factors contributing to HSCR is still scarce. Benzophenone-3 (BP-3) is one of the most widely used UV filters, and has weak estrogen and strong anti-androgenic effects. In order to examine the effect of maternal BP-3 exposure on development of offspring and explore the potential mechanism, we conducted case and control study and in vitro study. In this work, BP-3 concertrations in maternal urine was detected by ultra-high performance liquid chromatography. Besides, we investigated the cytotoxicity and receptor tyrosine kinase (RET) expression in cells exposed to BP-3. The results showed that maternal BP-3 exposure was associated with offspring's HSCR in the population as well as inhibited migration of 293T and SH-SY5Y cells. What's more, we discovered dose-response relationship between RET expression and BP-3 exposure dose, and miR-218 and some other genes involved in SLIT2/ROBO1-miR-218-RET/PLAG1 pathway were also related to BP-3 exposure. Therefore, we deduced that BP-3 influenced cell migration via SLIT2/ROBO1-miR-218-RET/PLAG1 pathway. Our study firstly revealed the relationship between maternal BP-3 exposure and HSCR as well as its potential mechanism. PMID:26454118

  19. Achievement Goals and Achievement Emotions: A Meta-Analysis

    ERIC Educational Resources Information Center

    Huang, Chiungjung

    2011-01-01

    This meta-analysis synthesized 93 independent samples (N = 30,003) in 77 studies that reported in 78 articles examining correlations between achievement goals and achievement emotions. Achievement goals were meaningfully associated with different achievement emotions. The correlations of mastery and mastery approach goals with positive achievement…

  20. S1219 residue of 53BP1 is phosphorylated by ATM kinase upon DNA damage and required for proper execution of DNA damage response

    SciTech Connect

    Lee, Haemi; Kwak, Hee-Jin; Cho, Il-taeg; Park, Seok Hee; Lee, Chang-Hun

    2009-01-02

    53BP1 is phosphorylated by the protein kinase ATM upon DNA damage. Even though several ATM phosphorylation sites in 53BP1 have been reported, those sites have little functional implications in the DNA damage response. Here, we show that ATM phosphorylates the S1219 residue of 53BP1 in vitro and that the residue is phosphorylated in cells exposed to ionizing radiation (IR). Transfection with siRNA targeting ATM abolished IR-induced phosphorylation at this residue, supporting the theory that this process is mediated by the kinase. To determine the functional relevance of this phosphorylation event, a U2OS cell line expressing S1219A mutant 53BP1 was established. IR-induced foci formation of MDC1 and {gamma}H2AX, DNA damage signaling molecules, was reduced in this cell line, implying that S1219 phosphorylation is required for recruitment of these molecules to DNA damage sites. Furthermore, overexpression of the mutant protein impeded IR-induced G2 arrest. In conclusion, we have shown that S1219 phosphorylation by ATM is required for proper execution of DNA damage response.

  1. [Estimation of soil organic matter and soil total nitrogen based on NIR spectroscopy and BP neural network].

    PubMed

    Zheng, Li-Hua; Li, Min-Zan; Pan, Luan; Sun, Jian-Ying; Tang, Ning

    2008-05-01

    Estimation models of soil organic matter (SOM) and soil total nitrogen (TN) were established based on NIR spectroscopy and BP neural network A total of 150 soil samples were collected from the tested farm, and the NIR spectra of all soil samples were measured. First, data pretreatment was performed for each sample with the method of locally weighted scatter plot smooth filtering. Then the box plot analysis for the measured SOM data and TN data were conducted separately and the information about the shape, location, and distribution of the target data was obtained. The variance between the SOM data was very small, and most of them were concentrated on the median. This was also observed from TN data. Thus clustering analysis was carried out for the target parameters of the soil samples so that the original dataset with 150 spectra was clustered to 50 groups. For each group, the average of spectral data was calculated at every wavelength to obtain a new spectrum. The new spectrum was calculated with natural logarithm and normalized, which was taken as a new sample. Principal component analysis (PCA) was executed for 50 new samples and the principal components with over 99.98% of cumulative proportion of correlation matrix were extracted to establish BP neural network. According to the analysis result of SOM content, the calibration accuracy of the model was 0.999, and the validation accuracy reached to 0.854. According to the analysis result of the soil TN content, the calibration accuracy of the model was close to 1, and the validation accuracy reached 0.808. The result shows that the smooth filter can weaken the noise in the data, expose the data features, provide a reasonable starting approach for parametric fitting; and improve the prediction accuracy; It is feasible and practical to estimate soil parameters by using BP neural network with the prediction accuracy of 0.854 (SOM) and 0.808 (TN); Compared to the other prediction modeling method, the BP neural network

  2. An analysis of the rapidly rotating Bp star HD 133880

    NASA Astrophysics Data System (ADS)

    Bailey, J. D.; Grunhut, J.; Shultz, M.; Wade, G.; Landstreet, J. D.; Bohlender, D.; Lim, J.; Wong, K.; Drake, S.; Linsky, J.

    2012-06-01

    HD 133880 is a rapidly rotating chemically peculiar B-type (Bp) star (v sin i≃ 103 km s-1) and is host to one of the strongest magnetic fields of any Ap/Bp star. A member of the Upper Centaurus Lupus association, it is a star with a well-determined age of 16 Myr. 12 new spectra, four of which are polarimetric, obtained from the FEROS, ESPaDOnS and HARPS instruments, provide sufficient material from which to re-evaluate the magnetic field and obtain a first approximation to the atmospheric abundance distributions of He, O, Mg, Si, Ti, Cr, Fe, Ni, Pr and Nd. An abundance analysis was carried out using ZEEMAN, a program which synthesizes spectral line profiles for stars with permeating magnetic fields. The magnetic field structure was characterized by a colinear multipole expansion from the observed variations of the longitudinal and surface fields with rotational phase. Both magnetic hemispheres are clearly visible during the stellar rotation, and thus a three-ring abundance distribution model encompassing both magnetic poles and magnetic equator with equal spans in colatitude was adopted. Using the new magnetic field measurements and optical photometry together with previously published data, we refine the period of HD 133880 to P= 0.877 476 ± 0.000 009 d. Our simple axisymmetric magnetic field model is based on a predominantly quadrupolar component that roughly describes the field variations. Using spectrum synthesis, we derived mean abundances for O, Mg, Si, Ti, Cr, Fe and Pr. All elements, except Mg, are overabundant compared to the Sun. Mg appears to be approximately uniform over the stellar surface, while all other elements are more abundant in the negative magnetic hemisphere than in the positive magnetic hemisphere. In contrast to most Ap/Bp stars which show an underabundance in O, in HD 133880 this element is clearly overabundant compared to the solar abundance ratio. In studying the Hα and Paschen lines in the optical spectra, we could not unambiguously

  3. Entrepreneur achievement. Liaoning province.

    PubMed

    Zhao, R

    1994-03-01

    This paper reports the successful entrepreneurial endeavors of members of a 20-person women's group in Liaoning Province, China. Jing Yuhong, a member of the Family Planning Association at Shileizi Village, Dalian City, provided the basis for their achievements by first building an entertainment/study room in her home to encourage married women to learn family planning. Once stocked with books, magazines, pamphlets, and other materials on family planning and agricultural technology, dozens of married women in the neighborhood flocked voluntarily to the room. Yuhong also set out to give these women a way to earn their own income as a means of helping then gain greater equality with their husbands and exert greater control over their personal reproductive and social lives. She gave a section of her farming land to the women's group, loaned approximately US$5200 to group members to help them generate income from small business initiatives, built a livestock shed in her garden for the group to raise marmots, and erected an awning behind her house under which mushrooms could be grown. The investment yielded $12,000 in the first year, allowing each woman to keep more than $520 in dividends. Members then soon began going to fairs in the capital and other places to learn about the outside world, and have successfully ventured out on their own to generate individual incomes. Ten out of twenty women engaged in these income-generating activities asked for and got the one-child certificate. PMID:12287775

  4. MicroRNAs-491-5p suppresses cell proliferation and invasion by inhibiting IGF2BP1 in non-small cell lung cancer

    PubMed Central

    Gong, Fangchao; Ren, Ping; Zhang, Yan; Jiang, Jindong; Zhang, Hong

    2016-01-01

    MicroRNAs-491-5p (miR-491-5p) has been found to involve in tumor initiation and development in several tumors. However, the biological function and underlying molecular mechanism of miR-491-5p in non-small lung cancer (NSCLC) remain unclear. This study was therefore to investigate biological role of and underlying molecular mechanisms of in NSCLC. It was found that miR-491-5p expression was significantly downregulated in NSCLC tissues when compared with corresponding adjacent normal tissues (P<0.01), and the value was negatively related to advanced and tumor-node-metastasis (TNM) stage and lymph node metastasis (both P<0.01). We also demonstrate that restoration of miR-491-5p suppressed NSCLC cell proliferation by arresting NSCLC cells in the G1/G0 phase and accelerating apoptosis. miR-491-5p also inhibited cell migration and invasion in NSCLC cells. Mechanically, IGF2BP1 was identified as direct targets of miR-491-5p. And IGF2BP1 expression was significantly upregulated, and correlated negative with miR-491-5p expression in NSCLC tissues. In vivo assay showed thatmiR-491-5p suppressed tumor growth in nude model by repressing IGF2BP1 expression. Collectively, miR-491-5p functioned as a tumor suppressor in NSCLC by targeting IGF2BP1. Restoration of miR-491-5p expression may represent a promising therapeutic approach for targeting malignant NSCLC. PMID:27158341

  5. Cell type-specific control of protein synthesis and proliferation by FGF-dependent signaling to the translation repressor 4E-BP.

    PubMed

    Ruoff, Rachel; Katsara, Olga; Kolupaeva, Victoria

    2016-07-01

    Regulation of protein synthesis plays a vital role in posttranscriptional modulation of gene expression. Translational control most commonly targets the initiation of protein synthesis: loading 40S ribosome complexes onto mRNA and AUG start codon recognition. This step is initiated by eukaryotic initiation factor 4E (eIF4E) (the m7GTP cap-binding protein), whose binding to eIF4G (a scaffolding subunit) and eIF4A (an ATP-dependent RNA helicase) leads to assembly of active eIF4F complex. The ability of eIF4E to recognize the cap is prevented by its binding to eIF4E binding protein (4E-BP), which thereby inhibits cap-dependent translation by sequestering eIF4E. The 4E-BP activity is, in turn, inhibited by mTORC1 [mTOR (the mechanistic target of rapamycin) complex 1] mediated phosphorylation. Here, we define a previously unidentified mechanism of mTOR-independent 4E-BP1 regulation that is used by chondrocytes upon FGF signaling. Chondrocytes are responsible for the formation of the skeleton long bones. Unlike the majority of cell types where FGF signaling triggers proliferation, chondrocytes respond to FGF with inhibition. We establish that FGF specifically suppresses protein synthesis in chondrocytes, but not in any other cells of mesenchymal origin. Furthermore, 4E-BP1 repressor activity is necessary not only for suppression of protein synthesis, but also for FGF-induced cell-cycle arrest. Importantly, FGF-induced changes in the 4E-BP1 activity observed in cell culture are likewise detected in vivo and reflect the action of FGF signaling on downstream targets during bone development. Thus, our findings demonstrate that FGF signaling differentially impacts protein synthesis through either stimulation or repression, in a cell-type-dependent manner, with 4E-BP1 being a key player. PMID:27313212

  6. Design and characterization of novel antimicrobial peptides, R-BP100 and RW-BP100, with activity against Gram-negative and Gram-positive bacteria.

    PubMed

    Torcato, Inês M; Huang, Yen-Hua; Franquelim, Henri G; Gaspar, Diana; Craik, David J; Castanho, Miguel A R B; Troeira Henriques, Sónia

    2013-03-01

    BP100 is a short cationic antimicrobial peptide with a mechanism of action dependent on peptide-lipid interactions and microbial surface charge neutralization. Although active against Gram-negative bacteria, BP100 is inactive against Gram-positive bacteria. In this study we report two newly designed BP100 analogues, RW-BP100 and R-BP100 that have the Tyr residue replaced with a Trp and/or the Lys residues replaced with an Arg. The new analogues in addition to being active against Gram-negative bacteria, possess activity against all tested Gram-positive bacteria. Mechanistic studies using atomic force microscopy, surface plasmon resonance and fluorescence methodologies reveal that the antibacterial efficiency follows the affinity for bacterial membrane. The studies suggest that the activity of BP100 and its analogues against Gram-negative bacteria is mainly driven by electrostatic interactions with the lipopolysaccharide layer and is followed by binding to and disruption of the inner membrane, whereas activity against Gram-positive bacteria, in addition to electrostatic attraction to the exposed lipoteichoic acids, requires an ability to more deeply insert in the membrane environment, which is favoured with Arg residues and is facilitated in the presence of a Trp residue. Knowledge on the mechanism of action of these antimicrobial peptides provides information that assists in the design of antimicrobials with higher efficacy and broader spectra of action, but also on the design of peptides with higher specificity if required. PMID:23246973

  7. The Homogeneity of School Achievement.

    ERIC Educational Resources Information Center

    Cahan, Sorel

    Since the measurement of school achievement involves the administration of achievement tests to various grades on various subjects, both grade level and subject matter contribute to within-school achievement variations. To determine whether achievement test scores vary most among different fields within a grade level, or within fields among…

  8. HEPEX - achievements and challenges!

    NASA Astrophysics Data System (ADS)

    Pappenberger, Florian; Ramos, Maria-Helena; Thielen, Jutta; Wood, Andy; Wang, Qj; Duan, Qingyun; Collischonn, Walter; Verkade, Jan; Voisin, Nathalie; Wetterhall, Fredrik; Vuillaume, Jean-Francois Emmanuel; Lucatero Villasenor, Diana; Cloke, Hannah L.; Schaake, John; van Andel, Schalk-Jan

    2014-05-01

    HEPEX is an international initiative bringing together hydrologists, meteorologists, researchers and end-users to develop advanced probabilistic hydrological forecast techniques for improved flood, drought and water management. HEPEX was launched in 2004 as an independent, cooperative international scientific activity. During the first meeting, the overarching goal was defined as: "to develop and test procedures to produce reliable hydrological ensemble forecasts, and to demonstrate their utility in decision making related to the water, environmental and emergency management sectors." The applications of hydrological ensemble predictions span across large spatio-temporal scales, ranging from short-term and localized predictions to global climate change and regional modeling. Within the HEPEX community, information is shared through its blog (www.hepex.org), meetings, testbeds and intercompaison experiments, as well as project reportings. Key questions of HEPEX are: * What adaptations are required for meteorological ensemble systems to be coupled with hydrological ensemble systems? * How should the existing hydrological ensemble prediction systems be modified to account for all sources of uncertainty within a forecast? * What is the best way for the user community to take advantage of ensemble forecasts and to make better decisions based on them? This year HEPEX celebrates its 10th year anniversary and this poster will present a review of the main operational and research achievements and challenges prepared by Hepex contributors on data assimilation, post-processing of hydrologic predictions, forecast verification, communication and use of probabilistic forecasts in decision-making. Additionally, we will present the most recent activities implemented by Hepex and illustrate how everyone can join the community and participate to the development of new approaches in hydrologic ensemble prediction.

  9. Lyapunov Exponent Criterion in the CR3BP

    NASA Astrophysics Data System (ADS)

    Quarles, Billy; Eberle, Jason; Cuntz, Manfred; Musielak, Zdzislaw

    2010-10-01

    Our specific focus is to describe the motion of an extra solar planet in a binary star system. We aim to accomplish this by using the methods of chaos theory as an alternate method to our previously established Hodograph method in the circular restricted 3-body problem (CR3BP). Previously Eberle et al. (2010) has shown that a parameter space exists depending only on the mass ratio μ and distance ratio ρo which allowed them to identify regions of stability. Our method will validate the previous results while also providing more information relating to the presence of resonances and their effects on orbital stability. We extend the previous studies by increasing the simulation time, applying the method of Lyapunov exponents, calculating the time series spectrum of the orbit, and determining the Lyapunov dimension. The obtained results demonstrate when a system becomes unstable by orbital energy criterion and the method of Lyapunov exponents provides a quantitative classification scale to characterize the instability. By applying the maximum Lyapunov exponent (MLE) to the parameter space, we determine a region of stability with MLE values larger than the surrounding region. The time series spectra and the Lyapunov Dimension methods are used to illustrate the reasons behind the stability plateau which eludes to the resonance phenomena.

  10. The BP oil spill and the bounty of Plaquemines Parish.

    PubMed

    Fertel, Randy

    2011-01-01

    The source of 25 to 30 percent of America's seafood, the Mississippi River Delta's cornucopian world is now uncertain. And yet, even if shrimp, oysters, and finfish are unaffected by the BP Oil Spill - a big if - one can already reflect on the passing of the culture once built upon gathering them. For almost three centuries, levees made life possible along the riverbanks and in the wetlands beyond. Those same levees also ensured the wetlands would eventually melt away into the Gulf. Cutting off the silt left behind during annual river inundations subjected the fragile land to erosion. Sulfur, natural gas, and oil production companies dug twenty thousand miles of canals to gain more direct routes to their fields and to pump out their mineral wealth. This caused salt-water intrusion that killed off plant life and caused more erosion. The world that sustained my Plaquemines ancestors was less subject to collapse following disasters not only because the ecosystem before the wetlands' ongoing loss was then more vibrant, complex, and robust; but also because their lives, especially their culinary lives, were more vibrant, complex, and robust. Life was hard, but when it came to putting food on the table, life followed the seasons. PMID:21591308

  11. BP Neural Network Could Help Improve Pre-miRNA Identification in Various Species

    PubMed Central

    Jiang, Limin; Zhang, Jingjun

    2016-01-01

    MicroRNAs (miRNAs) are a set of short (21–24 nt) noncoding RNAs that play significant regulatory roles in cells. In the past few years, research on miRNA-related problems has become a hot field of bioinformatics because of miRNAs' essential biological function. miRNA-related bioinformatics analysis is beneficial in several aspects, including the functions of miRNAs and other genes, the regulatory network between miRNAs and their target mRNAs, and even biological evolution. Distinguishing miRNA precursors from other hairpin-like sequences is important and is an essential procedure in detecting novel microRNAs. In this study, we employed backpropagation (BP) neural network together with 98-dimensional novel features for microRNA precursor identification. Results show that the precision and recall of our method are 95.53% and 96.67%, respectively. Results further demonstrate that the total prediction accuracy of our method is nearly 13.17% greater than the state-of-the-art microRNA precursor prediction software tools.

  12. Direct measurement of 11B(p ,γ )12C astrophysical S factors at low energies

    NASA Astrophysics Data System (ADS)

    He, J. J.; Jia, B. L.; Xu, S. W.; Chen, S. Z.; Ma, S. B.; Hou, S. Q.; Hu, J.; Zhang, L. Y.; Yu, X. Q.

    2016-05-01

    We directly measure the absolute cross section of 11B(p ,γ )12C in the energy region of Ec .m .=130 -257 keV by using a thin target for the first time. This work is performed on a 320-kV platform at the Institute of Modern Physics in Lanzhou. The astrophysical S factors of this reaction are obtained for capture to the ground and first excited states of 12C. The properties of the known resonance at ˜150 keV are derived and agree with the previous results. However, in the energy region of 170-240 keV, our S factors are about 15%-50% larger than the adopted values in NACRE II and are also larger than the upper limits of NACRE II by up to ˜20 % . This indicates that our new reaction rate is enhanced by about 15%-50% compared to the NACRE II adopted rate in the temperature region 0.32-0.62 GK.

  13. Insulin signaling controls neurotransmission via the 4eBP-dependent modification of the exocytotic machinery

    PubMed Central

    Mahoney, Rebekah Elizabeth; Azpurua, Jorge; Eaton, Benjamin A

    2016-01-01

    Altered insulin signaling has been linked to widespread nervous system dysfunction including cognitive dysfunction, neuropathy and susceptibility to neurodegenerative disease. However, knowledge of the cellular mechanisms underlying the effects of insulin on neuronal function is incomplete. Here, we show that cell autonomous insulin signaling within the Drosophila CM9 motor neuron regulates the release of neurotransmitter via alteration of the synaptic vesicle fusion machinery. This effect of insulin utilizes the FOXO-dependent regulation of the thor gene, which encodes the Drosophila homologue of the eif-4e binding protein (4eBP). A critical target of this regulatory mechanism is Complexin, a synaptic protein known to regulate synaptic vesicle exocytosis. We find that the amounts of Complexin protein observed at the synapse is regulated by insulin and genetic manipulations of Complexin levels support the model that increased synaptic Complexin reduces neurotransmission in response to insulin signaling. DOI: http://dx.doi.org/10.7554/eLife.16807.001 PMID:27525480

  14. Role of 14-Bp HLA-G, INDEL Polymorphism in Recurrent Miscarriage.

    PubMed

    Afkhami, Fateme; Yazdani, Neda; Khaniani, Mahmoud Shekari; Derakhshan, Sima Mansoori

    2016-01-01

    Mothers and their fetuses are hereditarily unlike. Surprisingly, no less than 50% human pregnancies reach full term despite the tendency of the immune system to eliminate of non-self units. Reduction of adaptive maternal immune answer, which is planned to reject strange factors, is essential for a pregnancy to reach full term. However, approximately 5% couples trying to conceive experience 2 recurrent miscarriages (RMs).HLA-G, which is produced by the external trophectoderm layer and has unique biological features, is involved in the implantation and maintenance of fetus. Serum HLA-G levels are correlated with the risk of RM. Recent studies indicate that a 14-bp HLA-G, INDEL polymorphism decreases the level of HLA-G mRNA, which in turn decreases the amount of HLA-G produced. An understanding of gene parameter and the function of polymorphic sites in the functioning of HLA-G products may enable the development of approaches targeting HLA-G for more detail of causes of RM. PMID:27357874

  15. 76 FR 69712 - Application To Export Electric Energy; BP Energy Company

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-09

    ... Application To Export Electric Energy; BP Energy Company AGENCY: Office of Electricity Delivery and Energy... its authority to transmit electric energy from the United States to Canada pursuant to section 202(e... (DOE) issued Order No. EA-315, which authorized BP Energy to transmit electric energy from the...

  16. 76 FR 69713 - Application To Export Electric Energy; BP Energy Company

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-09

    ... Application To Export Electric Energy; BP Energy Company AGENCY: Office of Electricity Delivery and Energy... its authority to transmit electric energy from the United States to Mexico pursuant to section 202(e... Order No. EA-314, which authorized BP Energy to transmit electric energy from the United States...

  17. TopBP1 deficiency impairs V(D)J recombination during lymphocyte development

    PubMed Central

    Kim, Jieun; Kyu Lee, Sung; Jeon, Yoon; Kim, Yehyun; Lee, Changjin; Ho Jeon, Sung; Shim, Jaegal; Kim, In-Hoo; Hong, Seokmann; Kim, Nayoung; Lee, Ho; Seong, Rho Hyun

    2014-01-01

    TopBP1 was initially identified as a topoisomerase II-β-binding protein and it plays roles in DNA replication and repair. We found that TopBP1 is expressed at high levels in lymphoid tissues and is essential for early lymphocyte development. Specific abrogation of TopBP1 expression resulted in transitional blocks during early lymphocyte development. These defects were, in major part, due to aberrant V(D)J rearrangements in pro-B cells, double-negative and double-positive thymocytes. We also show that TopBP1 was located at sites of V(D)J rearrangement. In TopBP1-deficient cells, γ-H2AX foci were found to be increased. In addition, greater amount of γ-H2AX product was precipitated from the regions where TopBP1 was localized than from controls, indicating that TopBP1 deficiency results in inefficient DNA double-strand break repair. The developmental defects were rescued by introducing functional TCR αβ transgenes. Our data demonstrate a novel role for TopBP1 as a crucial factor in V(D)J rearrangement during the development of B, T and iNKT cells. PMID:24442639

  18. 78 FR 53137 - Flint Hills Resources Alaska, LLC, BP Pipelines (Alaska) Inc., ConocoPhillips Transportation...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-28

    ... formal complaint against BP Pipelines (Alaska) Inc., ConocoPhillips Transportation Alaska, Inc., and... Energy Regulatory Commission Flint Hills Resources Alaska, LLC, BP Pipelines (Alaska) Inc., ConocoPhillips Transportation Alaska, Inc., ExxonMobil Pipeline Company; Notice of Complaint Take notice that...

  19. 53BP1 foci as a marker of tumor cell radiosensitivity.

    PubMed

    Markova, E; Vasilyev, S; Belyaev, I

    2015-01-01

    Predicting tumor radiosensitivity has yet to be routinely integrated into radiotherapy. We analyzed the possibility to assess radiosensitivity of tumor cells based on endogenous and radiation-induced 53BP1 foci which are molecular markers of DNA double strand breaks (DSB). In eleven tumor cell lines of different origin, radiosensitivity was assessed by surviving cell fraction following irradiation with 2 Gy (SF2). 53BP1 foci were measured at 4 and 12 h post-irradiation by confocal laser microscopy and dedicated software. The correlation of 53BP1 foci and their post-irradiation kinetics with SF2 was assessed using Spearman rank test. The SF2 correlated with both excess of radiation-induced 53BP1 foci per cell at 4 h after irradiation and decay in number of 53BP1 foci from 4 to 12 h post-irradiation. The fraction of cells with multiple endogenous 53BP1 foci also correlated with SF2 of tumor cells. We conclude that the radiosensitivity of tumor cells can be predicted by kinetics of formation and decay of 53BP1 foci after irradiation. For the first time we report that the fraction of cells with multiple endogenous 53BP1 foci can be used as a marker of tumor cell radiosensitivity. PMID:26278144

  20. 75 FR 65309 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-22

    ..., and mitigate the impact of, any oil spills associated with offshore drilling in the future. The... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling AGENCY: Department of... meeting of the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling...

  1. 75 FR 37783 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-30

    ... spill and develop options to guard against, and mitigate the impact of, any oil spills associated with... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling AGENCY: Department of... meeting of the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling...

  2. 75 FR 47584 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-06

    ..., and mitigate the impact of, any oil spills associated with offshore drilling in the future. The... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling AGENCY: Department of... meeting for the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling...

  3. 75 FR 39518 - National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling; Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-09

    ..., 2010, of the National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling, (75 FR... National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling; Correction AGENCY: Office...: Christopher A. Smith, (202) 586-0716. Corrections In the Federal Register of June 30, 2010, in FR Doc....

  4. 75 FR 68607 - BP Canada Energy Marketing Corp. Apache Corporation; Notice for Temporary Waivers

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-08

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission BP Canada Energy Marketing Corp. Apache Corporation; Notice for Temporary Waivers November 1, 2010. Take notice that on October 29, 2010, BP Canada Energy Marketing Corp....

  5. miR-548d-3p/TP53BP2 axis regulates the proliferation and apoptosis of breast cancer cells.

    PubMed

    Song, Qiong; Song, Jiangqiang; Wang, Qimin; Ma, Yanling; Sun, Nai; Ma, Jieyu; Chen, Qiu; Xia, Guishan; Huo, Yanping; Yang, Longqiu; Li, Baolin

    2016-02-01

    Fast growth and hardly any apoptosis are important characteristics of breast cancer, which assure the spread via invasion and metastasis of breast cancer cells. Inhibition of fast proliferation and induction of apoptosis are critical way to cure this cancer. microRNAs (miRNAs) had been increasingly reported to be the critical regulator of tumorigenesis. In our study, we found that increasing copy number of miR-548d-2-3p is critically involved poor prognosis. We overexpressed miR-548d-3p in MDA-MB-231cells and found that the proliferation was promoted significantly, whereas the inhibition of miR-548d-3p repressed the proliferation of MDA-MB-231 cells and also induced the increase in apoptosis. Additionally, we found that miR-548d-3p downregulated the expression of TP53BP2 by directly targeting the 3'UTR. We also found that knockdown of TP53BP2 significantly resorted the proliferation and apoptosis regulated by miR-548d-3p inhibitor. Our study showed that miR-548d-3p/TP53BP2 pathway is critically involved in the proliferation and apoptosis of breast cancer cells and may be new therapeutic target of breast cancer cells. PMID:26663100

  6. E4BP4: an unexpected player in the immune response.

    PubMed

    Male, Victoria; Nisoli, Ilaria; Gascoyne, Duncan M; Brady, Hugh J M

    2012-02-01

    Until recently, the basic leucine zipper transcription factor E4BP4 (also known as NFIL3) was of little interest to immunologists, being best known for its role in regulating circadian rhythm in chick pineal gland. However, characterisation of E4bp4(-/-) mice, independently generated in four different laboratories, has revealed roles for E4BP4 in diverse haematopoietic lineages. E4BP4 is essential for the development of NK cells and CD8α(+) conventional dendritic cells, and is also involved in macrophage activation, polarisation of CD4(+) T cell responses and B cell class switching to IgE. Here, we discuss the role of E4BP4 as a regulator of the immune response and highlight future questions for the field. PMID:22075207

  7. Human recognition based on head-shoulder contour extraction and BP neural network

    NASA Astrophysics Data System (ADS)

    Kong, Xiao-fang; Wang, Xiu-qin; Gu, Guohua; Chen, Qian; Qian, Wei-xian

    2014-11-01

    In practical application scenarios like video surveillance and human-computer interaction, human body movements are uncertain because the human body is a non-rigid object. Based on the fact that the head-shoulder part of human body can be less affected by the movement, and will seldom be obscured by other objects, in human detection and recognition, a head-shoulder model with its stable characteristics can be applied as a detection feature to describe the human body. In order to extract the head-shoulder contour accurately, a head-shoulder model establish method with combination of edge detection and the mean-shift algorithm in image clustering has been proposed in this paper. First, an adaptive method of mixture Gaussian background update has been used to extract targets from the video sequence. Second, edge detection has been used to extract the contour of moving objects, and the mean-shift algorithm has been combined to cluster parts of target's contour. Third, the head-shoulder model can be established, according to the width and height ratio of human head-shoulder combined with the projection histogram of the binary image, and the eigenvectors of the head-shoulder contour can be acquired. Finally, the relationship between head-shoulder contour eigenvectors and the moving objects will be formed by the training of back-propagation (BP) neural network classifier, and the human head-shoulder model can be clustered for human detection and recognition. Experiments have shown that the method combined with edge detection and mean-shift algorithm proposed in this paper can extract the complete head-shoulder contour, with low calculating complexity and high efficiency.

  8. Improving Secondary School Students' Achievement using Intrinsic Motivation

    ERIC Educational Resources Information Center

    Albrecht, Erik; Haapanen, Rebecca; Hall, Erin; Mantonya, Michelle

    2009-01-01

    This report describes a program for increasing students' intrinsic motivation in an effort to increase academic achievement. The targeted population consisted of secondary level students in a middle to upper-middle class suburban area. The students of the targeted secondary level classes appeared to be disengaged from learning due to a lack of…

  9. An Action Plan for Improving Mediocre or Stagnant Student Achievement

    ERIC Educational Resources Information Center

    Redmond, Kimberley B.

    2013-01-01

    Although all of the schools in the target school system adhere to a school improvement process, achievement scores remain mediocre or stagnant within the overseas school in Italy that serves children of United States armed service members. To address this problem, this study explored the target school's improvement process to discover how…

  10. The Impact of Reading Achievement on Overall Academic Achievement

    ERIC Educational Resources Information Center

    Churchwell, Dawn Earheart

    2009-01-01

    This study examined the relationship between reading achievement and achievement in other subject areas. The purpose of this study was to determine if there was a correlation between reading scores as measured by the Standardized Test for the Assessment of Reading (STAR) and academic achievement in language arts, math, science, and social studies…

  11. Attitude Towards Physics and Additional Mathematics Achievement Towards Physics Achievement

    ERIC Educational Resources Information Center

    Veloo, Arsaythamby; Nor, Rahimah; Khalid, Rozalina

    2015-01-01

    The purpose of this research is to identify the difference in students' attitude towards Physics and Additional Mathematics achievement based on gender and relationship between attitudinal variables towards Physics and Additional Mathematics achievement with achievement in Physics. This research focused on six variables, which is attitude towards…

  12. Predicting Mathematics Achievement: The Influence of Prior Achievement and Attitudes

    ERIC Educational Resources Information Center

    Hemmings, Brian; Grootenboer, Peter; Kay, Russell

    2011-01-01

    Achievement in mathematics is inextricably linked to future career opportunities, and therefore, understanding those factors that influence achievement is important. This study sought to examine the relationships among attitude towards mathematics, ability and mathematical achievement. This examination was also supported by a focus on gender…

  13. Development of an LC-MS/MS method for analysis of interconvertible Z/E isomers of the novel anticancer agent, Bp4eT.

    PubMed

    Stariat, Ján; Kovaríková, Petra; Klimes, Jirí; Kalinowski, Danuta S; Richardson, Des R

    2010-05-01

    This study was focused on a liquid chromatography/tandem mass spectrometry (LC/MS/MS) method development for quantification of a novel potential anticancer agent, 2-benzoylpyridine 4-ethyl-3-thiosemicarbazone (Bp4eT), in aqueous media. Solid Bp4eT was found to consist predominantly of the Z isomer, while in aqueous media, both isomers coexist. Sufficient separation of both isomers was achieved on a Synergi 4u Polar RP column with a mobile phase composed of 2 mM ammonium formate, acetonitrile, and methanol (30:63:7; v/v/v). The photo diode array analysis of both isomers demonstrated different absorption spectra which hindered UV-based quantification. However, an equal and reproducible response was found for both isomers using an MS detector, which enables the determination of the total content of Bp4eT (i.e., both E- and Z- isomeric forms) by summation of the peak areas of both isomers. 2-Hydroxy-1-naphthylaldehyde 4-methyl-3-thiosemicarbazone (N4mT) was selected as the internal standard. Quantification was performed in selective reaction monitoring using the main fragments of [M+H](+) (240 m/z for Bp4eT and 229 m/z for N4mT). The method was validated over 20-600 ng/ml. This procedure was applied to a preformulation study to determine the proper vehicle for parenteral administration. It was found that Bp4eT was poorly soluble in aqueous media. However, the solubility can be effectively improved using pharmaceutical cosolvents. In fact, a 1:1 mixture of PEG 300/0.14 M saline markedly increased solubility and may be a useful drug formulation for intravenous administration. This investigation further accelerates development of novel anticancer thiosemicarbazones. The described methods will be useful for analogs currently under development and suffering the same analytical issue. PMID:20127082

  14. Enhanced L-phenylalanine production by recombinant Escherichia coli BR-42 (pAP-B03) resistant to bacteriophage BP-1 via a two-stage feeding approach.

    PubMed

    Zhou, Haiyan; Liao, Xianyan; Liu, Long; Wang, Tianwen; Du, Guocheng; Chen, Jian

    2011-09-01

    The L-phenylalanine (L-Phe) production by Escherichia coli WSH-Z06 (pAP-B03) was frequently prevented by bacteriophage BP-1 infestation. To cope with the bacteriophage BP-1 problem for an improved L-Phe production, one bacteriophage BP-1-resistant mutant, E. coli BR-42, was obtained from 416 mutant colonies of E. coli WSH-Z06 after N-methyl-N'-nitro-N-nitrosoguanidine (NTG) mutagenesis by selection for resistance to bacteriophage BP-1. The recombinant E. coli BR-42-carrying plasmid pAP-B03 had a high capacity in L-Phe production and a remarkable tolerance to 1 × 10(10) pfu (plaque-forming unit)/ml bacteriophage stock. For an enhanced L-Phe production by E. coli BR-42 (pAP-B03), the effects of different feeding strategies including pH-stat, constant rate feeding, linear decreasing rate feeding, and exponential feeding on L-Phe production were investigated; and a two-stage feeding strategy, namely exponential feeding at μ (set) = 0.18 h(-1) in the first 20 h and a following linear varying rate feeding with F = (-0.55 × t + 18.6) ml/h, was developed to improve L-Phe production. With this two-stage feeding approach, a maximum L-Phe titer of 57.63 g/l with a high L-Phe productivity (1.15 g/l/h) was achieved, which was 15% higher than the highest level (50 g/l) reported so far according to our knowledge. The recombinant E. coli BR-42 (pAP-B03) is a potential L-Phe over-producer in substantial prevention of bacteriophage BP-1 infestation compared to its parent strain WSH-Z06 (pAP-B03). PMID:21104105

  15. Evaluator's Report on the Lowell Achievement Program 1986-1987.

    ERIC Educational Resources Information Center

    Phelan, William T.

    This report assesses the first year of a school achievement program in Lowell, Massachusetts (Lowell Achievement Program, LAP). The program targeted seventh and eighth grade students who were at risk for dropping out of school. The main goals of the program were to identify these students and to stimulate them to participate in their own learning…

  16. Bedtime versus at awakening administration of BP lowering drugs--is it the way to success?

    PubMed

    Bălan, H

    2009-01-01

    The "manometric" way of considering the complex management of high blood pressure (HBP) must remain ancient history. The huge therapeutical armamentarium existing nowadays allows us to select the drug/s most appropriate for the comorbidities/particularities of each case. The BP level target, unanimously considered a very important element of HBP management, must not be the only one. The so-called pleiotropic effects of the different classes of antihypertensive drugs must always influence our way of thinking. Another important possibility to improve the therapeutical efficacy of the antihypertensive treatment is chronotherapy. The aim of the present study is to demonstrate the possibility of some benefic effects by imposing, by chronotherapy, a "normal" "dipping" status of the BP values. Among the surrogate end-points that can be used to demonstrate the benefits of this kind of HBP management we chose the structural and functional cardiac parameters, echocardiographically determined--using the criteria of the American Society of Echocardiography. We studied the evolution of these parameters of the left ventricle (LV) and we have evaluated them after 3 months of once-a-day morning (at awakening) administration, and respectively after 3 months of once-a-day administration in the evening (at bedtime) of: Prestarium (perindopril) cp 10 mg Tarka (cp 180 mg verapamil hydrochloride/2 mg trandolapril) Norvasc (amlodipine besilat) cp 10 mg as monotherapy, in 60 patients. We studied the anatomical parameters of the left ventricle (dimensions measured enddiastolically: the thickness of the interventricular septum, the thickness of the posterior wall, the internal diameter of the LV), the LV mass (which has a cutedge value for hypertrophy of the LV-LVH--of 134 g/m2 for men and 110 g/m2 for women) and the functional parameters, systolic as diastolic of the LV. We noticed a statistically significant reduction (p < 0.05) in all the 3 subgroups, of the functional parameters, these

  17. The mTORC1/4E-BP pathway coordinates hemoglobin production with L-leucine availability.

    PubMed

    Chung, Jacky; Bauer, Daniel E; Ghamari, Alireza; Nizzi, Christopher P; Deck, Kathryn M; Kingsley, Paul D; Yien, Yvette Y; Huston, Nicholas C; Chen, Caiyong; Schultz, Iman J; Dalton, Arthur J; Wittig, Johannes G; Palis, James; Orkin, Stuart H; Lodish, Harvey F; Eisenstein, Richard S; Cantor, Alan B; Paw, Barry H

    2015-01-01

    In multicellular organisms, the mechanisms by which diverse cell types acquire distinct amino acids and how cellular function adapts to their availability are fundamental questions in biology. We found that increased neutral essential amino acid (NEAA) uptake was a critical component of erythropoiesis. As red blood cells matured, expression of the amino acid transporter gene Lat3 increased, which increased NEAA import. Inadequate NEAA uptake by pharmacologic inhibition or RNAi-mediated knockdown of LAT3 triggered a specific reduction in hemoglobin production in zebrafish embryos and murine erythroid cells through the mTORC1 (mammalian target of rapamycin complex 1)/4E-BP (eukaryotic translation initiation factor 4E-binding protein) pathway. CRISPR-mediated deletion of members of the 4E-BP family in murine erythroid cells rendered them resistant to mTORC1 and LAT3 inhibition and restored hemoglobin production. These results identify a developmental role for LAT3 in red blood cells and demonstrate that mTORC1 serves as a homeostatic sensor that couples hemoglobin production at the translational level to sufficient uptake of NEAAs, particularly L-leucine. PMID:25872869

  18. The mTORC1/4E-BP pathway coordinates hemoglobin production with L-leucine availability

    PubMed Central

    Chung, Jacky; Bauer, Daniel E.; Ghamari, Alireza; Nizzi, Christopher P.; Deck, Kathryn M.; Kingsley, Paul D.; Yien, Yvette Y.; Huston, Nicholas C.; Chen, Caiyong; Schultz, Iman J.; Dalton, Arthur J.; Wittig, Johannes G.; Palis, James; Orkin, Stuart H.; Lodish, Harvey F.; Eisenstein, Richard S.; Cantor, Alan B.; Paw, Barry H.

    2015-01-01

    In multicellular organisms, the mechanisms by which diverse cell types acquire distinct amino acids and how cellular function adapts to their availability are fundamental questions in biology. Here, we found that increased neutral essential amino acid (NEAA) uptake was a critical component of erythropoiesis. As red blood cells matured, expression of the amino acid transporter gene Lat3 increased, which increased NEAA import. Inadequate NEAA uptake by pharmacologic inhibition or RNAi-mediated knockdown of LAT3 triggered a specific reduction in hemoglobin production in zebrafish embryos and murine erythroid cells through the mTORC1 (mechanistic target of rapamycin complex 1)/4E-BP (eukaryotic translation initiation factor 4E-binding protein) pathway. CRISPR-mediated deletion of members of the 4E-BP family in murine erythroid cells rendered them resistant to mTORC1 and LAT3 inhibition and restored hemoglobin production. These results identify a developmental role for LAT3 in red blood cells and demonstrate that mTORC1 serves as a homeostatic sensor that couples hemoglobin production at the translational level to sufficient uptake of NEAAs, particularly L-leucine. PMID:25872869

  19. Human Pyruvate Dehydrogenase Complex E2 and E3BP Core Subunits: New Models and Insights from Molecular Dynamics Simulations.

    PubMed

    Hezaveh, Samira; Zeng, An-Ping; Jandt, Uwe

    2016-05-19

    Targeted manipulation and exploitation of beneficial properties of multienzyme complexes, especially for the design of novel and efficiently structured enzymatic reaction cascades, require a solid model understanding of mechanistic principles governing the structure and functionality of the complexes. This type of system-level and quantitative knowledge has been very scarce thus far. We utilize the human pyruvate dehydrogenase complex (hPDC) as a versatile template to conduct corresponding studies. Here we present new homology models of the core subunits of the hPDC, namely E2 and E3BP, as the first time effort to elucidate the assembly of hPDC core based on molecular dynamic simulation. New models of E2 and E3BP were generated and validated at atomistic level for different properties of the proteins. The results of the wild type dimer simulations showed a strong hydrophobic interaction between the C-terminal and the hydrophobic pocket which is the main driving force in the intertrimer binding and the core self-assembly. On the contrary, the C-terminal truncated versions exhibited a drastic loss of hydrophobic interaction leading to a dimeric separation. This study represents a significant step toward a model-based understanding of structure and function of large multienzyme systems like PDC for developing highly efficient biocatalyst or bioreaction cascades. PMID:27104227

  20. Commentary on the 2014 BP guidelines from the panel appointed to the Eighth Joint National Committee (JNC 8).

    PubMed

    Reisin, Efrain; Harris, Raymond C; Rahman, Mahboob

    2014-11-01

    The recently published article "2014 Evidence-based guideline for the management of high blood pressure in adults: Report from the panel members appointed to the Eighth Joint National Committee (JNC 8)" (James et al., JAMA 311: 507-520, 2014) has generated considerable controversy. In this commentary, we evaluate the document and compare the recommendations contained within it with those of the JNC 7 and other national and international guidelines. The evidence quality rating approach followed by the article "2014 Evidence-based guideline for the management of high blood pressure in adults: Report from the panel members appointed to the Eighth Joint National Committee (JNC 8)" (James et al., JAMA 311: 507-520, 2014) disqualified nearly 98% of previous studies from review; as a result, some of the key recommendations were on the basis of expert opinion alone. We are especially concerned that the recommendation to raise the systolic/diastolic BP levels at which treatment is initiated to ≥150/≥90 mmHg in adults≥60 years old may affect cardiovascular and renal health in these patients. Additionally, we recommend that hypertension guidelines should be updated every 3-4 years with a fresh approach to the definition of target BP levels, the use of modern technology in the diagnosis of hypertension, and the treatment of hypertension in special populations not addressed in earlier guidelines. PMID:25114277

  1. CacyBP/SIP nuclear translocation regulates p27Kip1 stability in gastric cancer cells

    PubMed Central

    Niu, Ying-Lin; Li, Ya-Jun; Wang, Jing-Bo; Lu, Yuan-Yuan; Liu, Zhen-Xiong; Feng, Shan-Shan; Hu, Jian-Guo; Zhai, Hui-Hong

    2016-01-01

    AIM: To investigate the mechanism of calcyclin binding protein/Siah-1 interacting protein (CacyBP/SIP) nuclear translocation in promoting the proliferation of gastric cancer (GC) cells. METHODS: The effect of CacyBP/SIP nuclear translocation on cell cycle was investigated by cell cycle analysis. Western blot analysis was used to assess the change in expression of cell cycle regulatory proteins and proteasome-mediated degradation of p27Kip1. Co-immunoprecipitation (co-IP) analysis was performed to examine the binding of CacyBP/SIP with Skp1. A CacyBP/SIP truncation mutant which lacked the Skp1 binding site was constructed and fused to a fluorescent protein. Subsequently, the effect on Skp1 binding with the fusion protein was examined by co-IP, while localization of fluorescent fusion protein observed by confocal laser microscopy, and change in p27Kip1 protein expression assessed by Western blot analysis. RESULTS: CacyBP/SIP nuclear translocation induced by gastrin promoted progression of GC cells from G1 phase. However, while CacyBP/SIP nuclear translocation was inhibited using siRNA to suppress CacyBP/SIP expression, cell cycle was clearly inhibited. CacyBP/SIP nuclear translocation significantly decreased the level of cell cycle inhibitor p27Kip1, increased Cyclin E protein expression whereas the levels of Skp1, Skp2, and CDK2 were not affected. Upon inhibition of CacyBP/SIP nuclear translocation, there were no changes in protein levels of p27Kip1 and Cyclin E, while p27Kip1 decrease could be prevented by the proteasome inhibitor MG132. Moreover, CacyBP/SIP was found to bind to Skp1 by immunoprecipitation, an event that was abolished by mutant CacyBP/SIP, which also failed to stimulate p27Kip1 degradation, even though the mutant could still translocate into the nucleus. CONCLUSION: CacyBP/SIP nuclear translocation contributes to the proliferation of GC cells, and CacyBP/SIP exerts this effect, at least in part, by stimulating ubiquitin-mediated degradation of p27

  2. The Sinuous Target

    SciTech Connect

    Zwaska, R.

    2015-06-01

    We report on the concept for a target material comprised of a multitude of interlaced wires of small dimension. This target material concept is primarily directed at high-power neutrino targets where the thermal shock is large due to small beam sizes and short durations; it also has applications to other high-power targets, particularly where the energy deposition is great or a high surface area is preferred. This approach ameliorates the problem of thermal shock by engineering a material with high strength on the micro-scale, but a very low modulus of elasticity on the meso-scale. The low modulus of elasticity is achieved by constructing the material of spring-like wire segments much smaller than the beam dimension. The intrinsic bends of the wires will allow them to absorb the strain of thermal shock with minimal stress. Furthermore, the interlaced nature of the wires provides containment of any segment that might become loose. We will discuss the progress on studies of analogue materials and fabrication techniques for sinuous target materials.

  3. [Research Reports on Academic Achievement.

    ERIC Educational Resources Information Center

    Latts, Sander; And Others

    1969-01-01

    Four counselors studied the relation between achievement and choice of major, achievement and motivation, counseling and motivation, and achievement and employment. To see if those with definite majors or career choices in mind did better than those without, 300 students were tested according to the certainty of their choice. No significant…

  4. Cherokee Culture and School Achievement.

    ERIC Educational Resources Information Center

    Brown, Anthony D.

    1980-01-01

    Compares the effect of cooperative and competitive behaviors of Cherokee and Anglo American elementary school students on academic achievement. Suggests changes in teaching techniques and lesson organization that might raise academic achievement while taking into consideration tribal traditions that limit scholastic achievement in an…

  5. Camouflage target reconnaissance based on hyperspectral imaging technology

    NASA Astrophysics Data System (ADS)

    Hua, Wenshen; Guo, Tong; Liu, Xun

    2015-08-01

    Efficient camouflaged target reconnaissance technology makes great influence on modern warfare. Hyperspectral images can provide large spectral range and high spectral resolution, which are invaluable in discriminating between camouflaged targets and backgrounds. Hyperspectral target detection and classification technology are utilized to achieve single class and multi-class camouflaged targets reconnaissance respectively. Constrained energy minimization (CEM), a widely used algorithm in hyperspectral target detection, is employed to achieve one class camouflage target reconnaissance. Then, support vector machine (SVM), a classification method, is proposed to achieve multi-class camouflage target reconnaissance. Experiments have been conducted to demonstrate the efficiency of the proposed method.

  6. Students' Achievement Goals, Learning-Related Emotions and Academic Achievement.

    PubMed

    Lüftenegger, Marko; Klug, Julia; Harrer, Katharina; Langer, Marie; Spiel, Christiane; Schober, Barbara

    2016-01-01

    In the present research, the recently proposed 3 × 2 model of achievement goals is tested and associations with achievement emotions and their joint influence on academic achievement are investigated. The study was conducted with 388 students using the 3 × 2 Achievement Goal Questionnaire including the six proposed goal constructs (task-approach, task-avoidance, self-approach, self-avoidance, other-approach, other-avoidance) and the enjoyment and boredom scales from the Achievement Emotion Questionnaire. Exam grades were used as an indicator of academic achievement. Findings from CFAs provided strong support for the proposed structure of the 3 × 2 achievement goal model. Self-based goals, other-based goals and task-approach goals predicted enjoyment. Task-approach goals negatively predicted boredom. Task-approach and other-approach predicted achievement. The indirect effects of achievement goals through emotion variables on achievement were assessed using bias-corrected bootstrapping. No mediation effects were found. Implications for educational practice are discussed. PMID:27199836

  7. Students’ Achievement Goals, Learning-Related Emotions and Academic Achievement

    PubMed Central

    Lüftenegger, Marko; Klug, Julia; Harrer, Katharina; Langer, Marie; Spiel, Christiane; Schober, Barbara

    2016-01-01

    In the present research, the recently proposed 3 × 2 model of achievement goals is tested and associations with achievement emotions and their joint influence on academic achievement are investigated. The study was conducted with 388 students using the 3 × 2 Achievement Goal Questionnaire including the six proposed goal constructs (task-approach, task-avoidance, self-approach, self-avoidance, other-approach, other-avoidance) and the enjoyment and boredom scales from the Achievement Emotion Questionnaire. Exam grades were used as an indicator of academic achievement. Findings from CFAs provided strong support for the proposed structure of the 3 × 2 achievement goal model. Self-based goals, other-based goals and task-approach goals predicted enjoyment. Task-approach goals negatively predicted boredom. Task-approach and other-approach predicted achievement. The indirect effects of achievement goals through emotion variables on achievement were assessed using bias-corrected bootstrapping. No mediation effects were found. Implications for educational practice are discussed. PMID:27199836

  8. Establishing a Dynamic Self-Adaptation Learning Algorithm of the BP Neural Network and Its Applications

    NASA Astrophysics Data System (ADS)

    Li, Xiaofeng; Xiang, Suying; Zhu, Pengfei; Wu, Min

    2015-12-01

    In order to avoid the inherent deficiencies of the traditional BP neural network, such as slow convergence speed, that easily leading to local minima, poor generalization ability and difficulty in determining the network structure, the dynamic self-adaptive learning algorithm of the BP neural network is put forward to improve the function of the BP neural network. The new algorithm combines the merit of principal component analysis, particle swarm optimization, correlation analysis and self-adaptive model, hence can effectively solve the problems of selecting structural parameters, initial connection weights and thresholds and learning rates of the BP neural network. This new algorithm not only reduces the human intervention, optimizes the topological structures of BP neural networks and improves the network generalization ability, but also accelerates the convergence speed of a network, avoids trapping into local minima, and enhances network adaptation ability and prediction ability. The dynamic self-adaptive learning algorithm of the BP neural network is used to forecast the total retail sale of consumer goods of Sichuan Province, China. Empirical results indicate that the new algorithm is superior to the traditional BP network algorithm in predicting accuracy and time consumption, which shows the feasibility and effectiveness of the new algorithm.

  9. YB-1 regulates stress granule formation and tumor progression by translationally activating G3BP1

    PubMed Central

    Somasekharan, Syam Prakash; El-Naggar, Amal; Leprivier, Gabriel; Cheng, Hongwei; Hajee, Shamil; Grunewald, Thomas G.P.; Zhang, Fan; Ng, Tony; Delattre, Olivier; Evdokimova, Valentina; Wang, Yuzhuo; Gleave, Martin

    2015-01-01

    Under cell stress, global protein synthesis is inhibited to preserve energy. One mechanism is to sequester and silence mRNAs in ribonucleoprotein complexes known as stress granules (SGs), which contain translationally silent mRNAs, preinitiation factors, and RNA-binding proteins. Y-box binding protein 1 (YB-1) localizes to SGs, but its role in SG biology is unknown. We now report that YB-1 directly binds to and translationally activates the 5′ untranslated region (UTR) of G3BP1 mRNAs, thereby controlling the availability of the G3BP1 SG nucleator for SG assembly. YB-1 inactivation in human sarcoma cells dramatically reduces G3BP1 and SG formation in vitro. YB-1 and G3BP1 expression are highly correlated in human sarcomas, and elevated G3BP1 expression correlates with poor survival. Finally, G3BP1 down-regulation in sarcoma xenografts prevents in vivo SG formation and tumor invasion, and completely blocks lung metastasis in mouse models. Together, these findings demonstrate a critical role for YB-1 in SG formation through translational activation of G3BP1, and highlight novel functions for SGs in tumor progression. PMID:25800057

  10. Cell cycle-dependent inhibition of 53BP1 signaling by BRCA1

    PubMed Central

    Feng, Lin; Li, Nan; Li, Yujing; Wang, Jiadong; Gao, Min; Wang, Wenqi; Chen, Junjie

    2015-01-01

    DNA damage response mediator protein 53BP1 is a key regulator of non-homologous end-joining (NHEJ) repair. 53BP1 protects DNA broken ends from resection by recruiting two downstream factors, RIF1 (RAP1-interacting factor 1) and PTIP (Pax transactivation domain-interacting protein), to double-stranded breaks (DSBs) via ATM (ataxia telangiectasia mutated)-mediated 53BP1 phosphorylation, and competes with BRCA1-mediated homologous recombination (HR) repair in G1 phase. In contrast, BRCA1 antagonizes 53BP1-direct NHEJ repair in S/G2 phases. We and others have found that BRCA1 prevents the translocation of RIF1 to DSBs in S/G2 phases; however, the underlying mechanism remains unclear. Here we show that efficient ATM-dependent 53BP1 phosphorylation is restricted to the G1 phase of the cell cycle, as a consequence RIF1 and PTIP accumulation at DSB sites only occur in G1 phase. Mechanistically, both BRCT and RING domains of BRCA1 are required for the inhibition of 53BP1 phosphorylation in S and G2 phases. Thus, our findings reveal how BRCA1 antagonizes 53BP1 signaling to ensure that HR repair is the dominant repair pathway in S/G2 phases.

  11. CENP-C facilitates the recruitment of M18BP1 to centromeric chromatin.

    PubMed

    Dambacher, Silvia; Deng, Wen; Hahn, Matthias; Sadic, Dennis; Fröhlich, Jonathan; Nuber, Alexander; Hoischen, Christian; Diekmann, Stephan; Leonhardt, Heinrich; Schotta, Gunnar

    2012-01-01

    Centromeres are important structural constituents of chromosomes that ensure proper chromosome segregation during mitosis by providing defined sites for kinetochore attachment. In higher eukaryotes, centromeres have no specific DNA sequence and thus, they are rather determined through epigenetic mechanisms. A fundamental process in centromere establishment is the incorporation of the histone variant CENP-A into centromeric chromatin, which provides a binding platform for the other centromeric proteins. The Mis18 complex, and, in particular, its member M18BP1 was shown to be essential for both incorporation and maintenance of CENP-A. Here we show that M18BP1 displays a cell cycle-regulated association with centromeric chromatin in mouse embryonic stem cells. M18BP1 is highly enriched at centromeric regions from late anaphase through to G1 phase. An interaction screen against 16 core centromeric proteins revealed a novel interaction of M18BP1 with CENP-C. We mapped the interaction domain in M18BP1 to a central region containing a conserved SANT domain and in CENP-C to the C-terminus. Knock-down of CENP-C leads to reduced M18BP1 association and lower CENP-A levels at centromeres, suggesting that CENP-C works as an important factor for centromeric M18BP1 recruitment and thus for maintaining centromeric CENP-A. PMID:22540025

  12. CENP-C facilitates the recruitment of M18BP1 to centromeric chromatin

    PubMed Central

    Dambacher, Silvia; Deng, Wen; Hahn, Matthias; Sadic, Dennis; Fröhlich, Jonathan; Nuber, Alexander; Hoischen, Christian; Diekmann, Stephan; Leonhardt, Heinrich; Schotta, Gunnar

    2012-01-01

    Centromeres are important structural constituents of chromosomes that ensure proper chromosome segregation during mitosis by providing defined sites for kinetochore attachment. In higher eukaryotes, centromeres have no specific DNA sequence and thus, they are rather determined through epigenetic mechanisms. A fundamental process in centromere establishment is the incorporation of the histone variant CENP-A into centromeric chromatin, which provides a binding platform for the other centromeric proteins. The Mis18 complex, and, in particular, its member M18BP1 was shown to be essential for both incorporation and maintenance of CENP-A.   Here we show that M18BP1 displays a cell cycle-regulated association with centromeric chromatin in mouse embryonic stem cells. M18BP1 is highly enriched at centromeric regions from late anaphase through to G1 phase. An interaction screen against 16 core centromeric proteins revealed a novel interaction of M18BP1 with CENP-C. We mapped the interaction domain in M18BP1 to a central region containing a conserved SANT domain and in CENP-C to the C-terminus. Knock-down of CENP-C leads to reduced M18BP1 association and lower CENP-A levels at centromeres, suggesting that CENP-C works as an important factor for centromeric M18BP1 recruitment and thus for maintaining centromeric CENP-A. PMID:22540025

  13. Divergent homologs of the predicted small RNA BpCand697 in Burkholderia spp.

    NASA Astrophysics Data System (ADS)

    Damiri, Nadzirah; Mohd-Padil, Hirzahida; Firdaus-Raih, Mohd

    2015-09-01

    The small RNA (sRNA) gene candidate, BpCand697 was previously reported to be unique to Burkholderia spp. and is encoded at 3' non-coding region of a putative AraC family transcription regulator gene. This study demonstrates the conservation of BpCand697 sequence across 32 Burkholderia spp. including B. pseudomallei, B. mallei, B. thailandensis and Burkholderia sp. by integrating both sequence homology and secondary structural analyses of BpCand697 within the dataset. The divergent sequence of BpCand697 was also used as a discriminatory power in clustering the dataset according to the potential virulence of Burkholderia spp., showing that B. thailandensis was clearly secluded from the virulent cluster of B. pseudomallei and B. mallei. Finally, the differential co-transcript expression of BpCand697 and its flanking gene, bpsl2391 was detected in Burkholderia pseudomallei D286 after grown under two different culture conditions using nutrient-rich and minimal media. It is hypothesized that the differential expression of BpCand697-bpsl2391 co-transcript between the two standard prepared media might correlate with nutrient availability in the culture media, suggesting that the physical co-localization of BpCand697 in B. pseudomallei D286 might be directly or indirectly involved with the transcript regulation of bpsl2391 under the selected in vitro culture conditions.

  14. Levels of the E2 interacting protein TopBP1 modulate papillomavirus maintenance stage replication.

    PubMed

    Kanginakudru, Sriramana; DeSmet, Marsha; Thomas, Yanique; Morgan, Iain M; Androphy, Elliot J

    2015-04-01

    The evolutionarily conserved DNA topoisomerase II beta-binding protein 1 (TopBP1) functions in DNA replication, DNA damage response, and cell survival. We analyzed the role of TopBP1 in human and bovine papillomavirus genome replication. Consistent with prior reports, TopBP1 co-localized in discrete nuclear foci and was in complex with papillomavirus E2 protein. Similar to E2, TopBP1 is recruited to the region of the viral origin of replication during G1/S and early S phase. TopBP1 knockdown increased, while over-expression decreased transient virus replication, without affecting cell cycle. Similarly, using cell lines harboring HPV-16 or HPV-31 genome, TopBP1 knockdown increased while over-expression reduced viral copy number relative to genomic DNA. We propose a model in which TopBP1 serves dual roles in viral replication: it is essential for initiation of replication yet it restricts viral copy number. PMID:25666521

  15. M2BP inhibits HIV-1 virion production in a vimentin filaments-dependent manner

    PubMed Central

    Wang, Qin; Zhang, Xiaolin; Han, Yuling; Wang, Xinlu; Gao, Guangxia

    2016-01-01

    M2BP (also called 90K) is an interferon-stimulated gene product that is upregulated in HIV-1 infection. A recent study revealed that M2BP reduces the infectivity of HIV-1 by inhibiting the processing of the viral envelope protein. Here we report that in addition to reducing viral infectivity, M2BP inhibits HIV-1 virion production. We provide evidence showing that M2BP inhibits HIV-1 Gag trafficking to the plasma membrane in a vimentin-dependent manner. When vimentin filaments were collapsed by treating cells with acrylamide or by overexpression of a dominant-negative mutant of vimentin, M2BP inhibition of HIV-1 virion production was significantly relieved. We further show that M2BP interacts with both HIV-1 Gag and vimentin and thereby mediates their interactions. We propose that M2BP traps HIV-1 Gag to vimentin filaments to inhibit the transportation of HIV-1 Gag to the plasma membrane. These findings uncover a novel mechanism by which a host antiviral factor inhibits HIV-1 virion production. PMID:27604950

  16. M2BP inhibits HIV-1 virion production in a vimentin filaments-dependent manner.

    PubMed

    Wang, Qin; Zhang, Xiaolin; Han, Yuling; Wang, Xinlu; Gao, Guangxia

    2016-01-01

    M2BP (also called 90K) is an interferon-stimulated gene product that is upregulated in HIV-1 infection. A recent study revealed that M2BP reduces the infectivity of HIV-1 by inhibiting the processing of the viral envelope protein. Here we report that in addition to reducing viral infectivity, M2BP inhibits HIV-1 virion production. We provide evidence showing that M2BP inhibits HIV-1 Gag trafficking to the plasma membrane in a vimentin-dependent manner. When vimentin filaments were collapsed by treating cells with acrylamide or by overexpression of a dominant-negative mutant of vimentin, M2BP inhibition of HIV-1 virion production was significantly relieved. We further show that M2BP interacts with both HIV-1 Gag and vimentin and thereby mediates their interactions. We propose that M2BP traps HIV-1 Gag to vimentin filaments to inhibit the transportation of HIV-1 Gag to the plasma membrane. These findings uncover a novel mechanism by which a host antiviral factor inhibits HIV-1 virion production. PMID:27604950

  17. Blood Pressure Targets in CKD: Lessons Learned from SPRINT and Previous Observational Studies.

    PubMed

    Gosmanova, Elvira O; Kovesdy, Csaba P

    2016-09-01

    Hypertension management is one of the most common clinical tasks in the care of patients with chronic kidney disease (CKD). Elevated blood pressure (BP) is associated with greater risk of all-cause mortality, cardiovascular (CV) disease, and CKD progression in this population. However, it is still debated, to what target(s) BP should be lowered in patients with signs of kidney damage. The Systolic Blood Pressure Intervention Trial (SPRINT) provided new and important information about the effects of lowering systolic BP to a target of <120 mmHg, which is lower than the levels currently recommended by the most guidelines (<140/90 mmHg). The SPRINT results were not only exciting but also surprising for many clinicians because evidence from well-conducted observational studies in CKD patient showed increased mortality in patients with CKD whose office systolic BP levels were <120 mmHg, as compared with systolic BP in 120-139 mmHg range. In the present review, we will discuss whether a systolic BP goal of <120 mmHg that was found to be beneficial for CV and all-cause mortality outcomes in the SPRINT can be generalized to the entire CKD population. PMID:27448402

  18. Mutation particle swarm optimization of the BP-PID controller for piezoelectric ceramics

    NASA Astrophysics Data System (ADS)

    Zheng, Huaqing; Jiang, Minlan

    2016-01-01

    PID control is the most common used method in industrial control because its structure is simple and it is easy to implement. PID controller has good control effect, now it has been widely used. However, PID method has a few limitations. The overshoot of the PID controller is very big. The adjustment time is long. When the parameters of controlled plant are changing over time, the parameters of controller could hardly change automatically to adjust to changing environment. Thus, it can't meet the demand of control quality in the process of controlling piezoelectric ceramic. In order to effectively control the piezoelectric ceramic and improve the control accuracy, this paper replaced the learning algorithm of the BP with the mutation particle swarm optimization algorithm(MPSO) on the process of the parameters setting of BP-PID. That designed a better self-adaptive controller which is combing the BP neural network based on mutation particle swarm optimization with the conventional PID control theory. This combination is called the MPSO-BP-PID. In the mechanism of the MPSO, the mutation operation is carried out with the fitness variance and the global best fitness value as the standard. That can overcome the precocious of the PSO and strengthen its global search ability. As a result, the MPSO-BP-PID can complete controlling the controlled plant with higher speed and accuracy. Therefore, the MPSO-BP-PID is applied to the piezoelectric ceramic. It can effectively overcome the hysteresis, nonlinearity of the piezoelectric ceramic. In the experiment, compared with BP-PID and PSO-BP-PID, it proved that MPSO is effective and the MPSO-BP-PID has stronger adaptability and robustness.

  19. Target assembly

    DOEpatents

    Lewis, Richard A.

    1980-01-01

    A target for a proton beam which is capable of generating neutrons for absorption in a breeding blanket includes a plurality of solid pins formed of a neutron emissive target material disposed parallel to the path of the beam and which are arranged axially in a plurality of layers so that pins in each layer are offset with respect to pins in all other layers, enough layers being used so that each proton in the beam will strike at least one pin with means being provided to cool the pins. For a 300 mA, 1 GeV beam (300 MW), stainless steel pins, 12 inches long and 0.23 inches in diameter are arranged in triangular array in six layers with one sixth of the pins in each layer, the number of pins being such that the entire cross sectional area of the beam is covered by the pins with minimum overlap of pins.

  20. Two Isoforms of the RNA Binding Protein, Coding Region Determinant-binding Protein (CRD-BP/IGF2BP1), Are Expressed in Breast Epithelium and Support Clonogenic Growth of Breast Tumor Cells*

    PubMed Central

    Fakhraldeen, Saja A.; Clark, Rod J.; Roopra, Avtar; Chin, Emily N.; Huang, Wei; Castorino, John; Wisinski, Kari B.; Kim, TaeWon; Spiegelman, Vladimir S.; Alexander, Caroline M.

    2015-01-01

    CRD-BP/IGF2BP1 has been characterized as an “oncofetal” RNA binding protein typically highly expressed in embryonic tissues, suppressed in normal adult tissues, but induced in many tumor types. In this study, we show that adult breast tissues express ubiquitous but low levels of CRD-BP protein and mRNA. Although CRD-BP mRNA expression is induced in breast tumor cells, levels remain ∼1000-fold lower than in embryonic tissues. Despite low expression levels, CRD-BP is required for clonogenic growth of breast cancer cells. We reveal that because the most common protein isoform in normal adult breast and breast tumors has an N-terminal deletion (lacking two RNA recognition motif (RRM) domains) and is therefore missing antibody epitopes, CRD-BP expression has been under-reported by previous studies. We show that a CRD-BP mutant mouse strain retains expression of the shorter transcript (ΔN-CRD-BP), which originates in intron 2, suggesting that the impact of complete ablation of this gene in mice is not yet known. Either the full-length CRD-BP or the N-terminally truncated version can rescue the clonogenicity of CRD-BP knockdown breast cancer cells, suggesting that clonogenic function is served by either CRD-BP isoform. In summary, although CRD-BP expression levels are low in breast cancer cells, this protein is necessary for clonogenic activity. PMID:25861986

  1. Clinical and Immunological Studies of 332 Japanese Patients Tentatively Diagnosed as Anti-BP180-type Mucous Membrane Pemphigoid: A Novel BP180 C-terminal Domain Enzyme-linked Immunosorbent Assay.

    PubMed

    Yasukochi, Atsushi; Teye, Kwesi; Ishii, Norito; Hashimoto, Takashi

    2016-08-23

    Diagnosis of anti-BP180-type mucous membrane pemphigoid (BP180-MMP) is frustrated by the difficulty of detecting BP180 reactivity. A total of 721 patients with suspected MMP, selected from a cohort of 4,698 patients with autoimmune bullous disease (AIBD), were included in this study. Of these, 332 patients were tentatively diagnosed as BP180-MMP if they showed IgG/IgA reactivity with the epidermal side of 1M NaCl-split-skin and/or positive reactivity with BP180 in at least one of our antigen detection methods. Clinically, a predominance of female patients was found. Oral mucosal and cutaneous lesions were found in 85.5% and 41.0% of patients, respectively, and frequent treatments were systemic steroids, tetracycline/minocycline and diaminodiphenyl sulfone. Various immunological methods, including a newly developed BP180 C-terminal domain enzyme-linked immunosorbent assay (ELISA), revealed frequent reactivity with BP180 C-terminal and NC16a domains. Some patients reacted with BP180 and other antigens, indicating that BP180-MMP tends to concur with other AIBDs. This large study of patients with suspected BP180-MMP indicates the difficulty of diagnosis of BP180-MMP and the diagnostic usefulness of BP180 C-terminal domain ELISA. PMID:26984589

  2. Geoarchaeological evidence from Peru for a 5000 years B.P. onset of El Nino

    SciTech Connect

    Sandweiss, D.H.; Richardson, J.B. III; Rollins, H.B.

    1996-09-13

    For the tropical west coast of South America, where El Nino/Southern Oscillation (ENSO) is most pronounced, archaeological and associated paleontological deposits in northern Peru revealed a major climate change at about 5000 years before the present (yr B.P.). The data implied the presence of stable, warm tropical water as far south as 10{degrees}S during the early mid-Holocene (about 8000 to 5000 yr B.P.). These data suggest that ENSO did not occur for some millennia preceding 5000 yr B.P., when global and regional climate was warmer than today. 36 refs., 1 fig., 3 tabs.

  3. Genetic and morphological features of human iPSC-derived neurons with chromosome 15q11.2 (BP1-BP2) deletions

    PubMed Central

    Das, DK; Tapias, V; D’Aiuto, L; Chowdari, KV; Francis, L; Zhi, Y; Ghosh, Bhattacharjee A; Surti, U; Tischfield, J; Sheldon, M; Moore, JC; Fish, K; Nimgaonkar, V

    2015-01-01

    Background Copy number variation on chromosome 15q11.2 (BP1-BP2) causes deletion of CYFIP1, NIPA1, NIPA2 and TUBGCP5; it also affects brain structure and elevates risk for several neurodevelopmental disorders that are associated with dendritic spine abnormalities. In rodents, altered cyfip1 expression changes dendritic spine morphology, motivating analyses of human neuronal cells derived from iPSCs (iPSC-neurons). Methods iPSCs were generated from a mother and her offspring, both carrying the 15q11.2 (BP1-BP2) deletion, and a non-deletion control. Gene expression in the deletion region was estimated using quantitative real-time PCR assays. Neural progenitor cells (NPCs) and iPSC-neurons were characterized using immunocytochemistry. Results CYFIP1, NIPA1, NIPA2 and TUBGCP5 gene expression was lower in iPSCs, NPCs and iPSC-neurons from the mother and her offspring in relation to control cells. CYFIP1 and PSD95 protein levels were lower in iPSC-neurons derived from the CNV bearing individuals using Western blot analysis. At 10 weeks post-differentiation, iPSC-neurons appeared to show dendritic spines and qualitative analysis suggested that dendritic morphology was altered in 15q11.2 deletion subjects compared with control cells. Conclusions The 15q11.2 (BP1-BP2) deletion is associated with reduced expression of four genes in iPSC-derived neuronal cells; it may also be associated altered iPSC-neuron dendritic morphology. PMID:26528485

  4. Achievement as Resistance: The Development of a Critical Race Achievement Ideology among Black Achievers

    ERIC Educational Resources Information Center

    Carter, Dorinda J.

    2008-01-01

    In this article, Dorinda Carter examines the embodiment of a critical race achievement ideology in high-achieving black students. She conducted a yearlong qualitative investigation of the adaptive behaviors that nine high-achieving black students developed and employed to navigate the process of schooling at an upper-class, predominantly white,…

  5. Molecular mechanism of the dual activity of 4EGI-1: Dissociating eIF4G from eIF4E but stabilizing the binding of unphosphorylated 4E-BP1

    PubMed Central

    Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos; Rodriguez-Mias, Ricard A.; Wagner, Gerhard; Léger-Abraham, Mélissa

    2015-01-01

    The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T37/T46, followed by T70 and S65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is a goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ60 (motif 1) but lack known phosphorylation sites. We report here a 2.1-Å crystal structure of mouse eIF4E in complex with m7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP150–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S65 and T70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. The binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation. PMID:26170285

  6. Targeted mutagenesis using CRISPR/Cas system in medaka

    PubMed Central

    Ansai, Satoshi; Kinoshita, Masato

    2014-01-01

    ABSTRACT Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system-based RNA-guided endonuclease (RGEN) has recently emerged as a simple and efficient tool for targeted genome editing. In this study, we showed successful targeted mutagenesis using RGENs in medaka, Oryzias latipes. Somatic and heritable mutations were induced with high efficiency at the targeted genomic sequence on the DJ-1 gene in embryos that had been injected with the single guide RNA (sgRNA) transcribed by a T7 promoter and capped RNA encoding a Cas9 nuclease. The sgRNAs that were designed for the target genomic sequences without the 5′ end of GG required by the T7 promoter induced the targeted mutations. This suggests that the RGEN can target any sequence adjacent to an NGG protospacer adjacent motif (PAM) sequence, which occurs once every 8 bp. The off-target alterations at 2 genomic loci harboring double mismatches in the 18-bp targeting sequences were induced in the RGEN-injected embryos. However, we also found that the off-target effects could be reduced by lower dosages of sgRNA. Taken together, our results suggest that CRISPR/Cas-mediated RGENs may be an efficient and flexible tool for genome editing in medaka. PMID:24728957

  7. Sex, Prescribing Practices and Guideline Recommended, Blood Pressure, and LDL Cholesterol Targets at Baseline in the BARI 2D Trial

    PubMed Central

    Magee, Michelle F.; Tamis-Holland, Jacqueline E.; Lu, Jiang; Bittner, Vera A.; Brooks, Maria Mori; Lopes, Neuza; Jacobs, Alice K.; Study Group, BARI 2D

    2015-01-01

    Background. Research has shown less aggressive treatment and poorer control of cardiovascular disease (CVD) risk factors in women than men. Methods. We analyzed sex differences in pharmacotherapy strategies and attainment of goals for hemoglobin A1c (HbA1c), blood pressure (BP), and low density lipoprotein cholesterol (LDL-C) in patients with type 2 diabetes and established coronary artery disease enrolled into the BARI 2D trial. Results. Similar numbers of drugs were prescribed in both women and men. Women were less frequent on metformin or sulfonylurea and more likely to take insulin and to be on higher doses of hydroxymethylglutaryl-CoA reductase inhibitors (statins) than men. After adjusting for baseline differences and treatment prescribed, women were less likely to achieve goals for HbA1c (OR = 0.71, 95% CI 0.57, 0.88) and LDL-C (OR = 0.64, 95% CI 0.53, 0.78). More antihypertensives were prescribed to women, and yet BP ≤ 130/80 mmHg did not differ by sex. Conclusions. Women entering the BARI 2D trial were as aggressively treated with drugs as men. Despite equivalent treatment, women less frequently met targets for HbA1c and LDL-C. Our findings suggest that there may be sex differences in response to drug therapies used to treat diabetes, hypertension, and hyperlipidemia. PMID:25873955

  8. The Mechanics of Human Achievement

    PubMed Central

    Duckworth, Angela L.; Eichstaedt, Johannes C.; Ungar, Lyle H.

    2015-01-01

    Countless studies have addressed why some individuals achieve more than others. Nevertheless, the psychology of achievement lacks a unifying conceptual framework for synthesizing these empirical insights. We propose organizing achievement-related traits by two possible mechanisms of action: Traits that determine the rate at which an individual learns a skill are talent variables and can be distinguished conceptually from traits that determine the effort an individual puts forth. This approach takes inspiration from Newtonian mechanics: achievement is akin to distance traveled, effort to time, skill to speed, and talent to acceleration. A novel prediction from this model is that individual differences in effort (but not talent) influence achievement (but not skill) more substantially over longer (rather than shorter) time intervals. Conceptualizing skill as the multiplicative product of talent and effort, and achievement as the multiplicative product of skill and effort, advances similar, but less formal, propositions by several important earlier thinkers. PMID:26236393

  9. Unmet Promise: Raising Minority Achievement. The Achievement Gap.

    ERIC Educational Resources Information Center

    Johnston, Robert C.; Viadero, Debra

    2000-01-01

    This first in a four-part series on why academic achievement gaps persist discusses how to raise minority achievement. It explains how earlier progress in closing the gap has stalled, while at the same time, the greater diversity of student populations and the rapid growth of the Hispanic population and of other ethnic groups have reshaped the…

  10. To Achieve or Not to Achieve: The Question of Women.

    ERIC Educational Resources Information Center

    Gilmore, Beatrice

    Questionnaire and projective data from 323 women aged 18 to 50 were analyzed in order to study the relationships of need achievement and motive to avoid success to age, sex role ideology, and stage in the family cycle. Family background and educational variables were also considered. Level of need achievement was found to be significantly related…

  11. Mathematics Achievement in High- and Low-Achieving Secondary Schools

    ERIC Educational Resources Information Center

    Mohammadpour, Ebrahim; Shekarchizadeh, Ahmadreza

    2015-01-01

    This paper identifies the amount of variance in mathematics achievement in high- and low-achieving schools that can be explained by school-level factors, while controlling for student-level factors. The data were obtained from 2679 Iranian eighth graders who participated in the 2007 Trends in International Mathematics and Science Study. Of the…

  12. Accelerator target

    SciTech Connect

    Schlyer, D.J.; Ferrieri, R.A.; Koehler, C.

    1999-06-29

    A target includes a body having a depression in a front side for holding a sample for irradiation by a particle beam to produce a radioisotope. Cooling fins are disposed on a backside of the body opposite the depression. A foil is joined to the body front side to cover the depression and sample therein. A perforate grid is joined to the body atop the foil for supporting the foil and for transmitting the particle beam therethrough. A coolant is circulated over the fins to cool the body during the particle beam irradiation of the sample in the depression. 5 figs.

  13. Accelerator target

    DOEpatents

    Schlyer, David J.; Ferrieri, Richard A.; Koehler, Conrad

    1999-01-01

    A target includes a body having a depression in a front side for holding a sample for irradiation by a particle beam to produce a radioisotope. Cooling fins are disposed on a backside of the body opposite the depression. A foil is joined to the body front side to cover the depression and sample therein. A perforate grid is joined to the body atop the foil for supporting the foil and for transmitting the particle beam therethrough. A coolant is circulated over the fins to cool the body during the particle beam irradiation of the sample in the depression.

  14. WS-BP: An efficient wolf search based back-propagation algorithm

    NASA Astrophysics Data System (ADS)

    Nawi, Nazri Mohd; Rehman, M. Z.; Khan, Abdullah

    2015-05-01

    Wolf Search (WS) is a heuristic based optimization algorithm. Inspired by the preying and survival capabilities of the wolves, this algorithm is highly capable to search large spaces in the candidate solutions. This paper investigates the use of WS algorithm in combination with back-propagation neural network (BPNN) algorithm to overcome the local minima problem and to improve convergence in gradient descent. The performance of the proposed Wolf Search based Back-Propagation (WS-BP) algorithm is compared with Artificial Bee Colony Back-Propagation (ABC-BP), Bat Based Back-Propagation (Bat-BP), and conventional BPNN algorithms. Specifically, OR and XOR datasets are used for training the network. The simulation results show that the WS-BP algorithm effectively avoids the local minima and converge to global minima.

  15. Identification and molecular characterization of BP75, a novel bromodomain-containing protein.

    PubMed

    Cuppen, E; van Ham, M; Pepers, B; Wieringa, B; Hendriks, W

    1999-10-15

    We here describe the identification and characterization of a novel bromodomain-containing protein, the bromodomain protein of 75 kDa (BP75). Initially, we identified BP75 in a two-hybrid screening for proteins that interact with the first PDZ (acronym for post-synaptic density protein PSD-95, Drosophila discs large tumor suppressor DlgA and the tight junction protein ZO-1) domain in protein tyrosine phosphatase-BAS-like (PTP-BL). We found that BP75 is expressed ubiquitously and show that both BP75 and a PTP-BL deletion mutant consisting of the first PDZ domain are located mainly in the nucleus, although cytoplasmic localization is also evident. Full-length PTP-BL, on the contrary, is predominantly localized in the cytoplasm, although some basal nuclear staining is observed. The described molecular interaction may reflect a mechanism of coupling submembraneous signalling events and nuclear events. PMID:10526152

  16. Prediction of BP reactivity to talking using hybrid soft computing approaches.

    PubMed

    Kaur, Gurmanik; Arora, Ajat Shatru; Jain, Vijender Kumar

    2014-01-01

    High blood pressure (BP) is associated with an increased risk of cardiovascular diseases. Therefore, optimal precision in measurement of BP is appropriate in clinical and research studies. In this work, anthropometric characteristics including age, height, weight, body mass index (BMI), and arm circumference (AC) were used as independent predictor variables for the prediction of BP reactivity to talking. Principal component analysis (PCA) was fused with artificial neural network (ANN), adaptive neurofuzzy inference system (ANFIS), and least square-support vector machine (LS-SVM) model to remove the multicollinearity effect among anthropometric predictor variables. The statistical tests in terms of coefficient of determination (R (2)), root mean square error (RMSE), and mean absolute percentage error (MAPE) revealed that PCA based LS-SVM (PCA-LS-SVM) model produced a more efficient prediction of BP reactivity as compared to other models. This assessment presents the importance and advantages posed by PCA fused prediction models for prediction of biological variables. PMID:25328536

  17. 1. ENVIRONMENT, FROM NORTHWEST, SHOWING B&P INTERLOCKING TOWER AND POWER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. ENVIRONMENT, FROM NORTHWEST, SHOWING B&P INTERLOCKING TOWER AND POWER SUBSTATIONS - Baltimore & Potomac Interlocking Tower, Adjacent to AMTRAK railroad tracks in block bounded by Howard Street, Jones Falls Expressway, Maryland Avenue & Falls Road, Baltimore, Independent City, MD

  18. Prediction of BP Reactivity to Talking Using Hybrid Soft Computing Approaches

    PubMed Central

    Arora, Ajat Shatru; Jain, Vijender Kumar

    2014-01-01

    High blood pressure (BP) is associated with an increased risk of cardiovascular diseases. Therefore, optimal precision in measurement of BP is appropriate in clinical and research studies. In this work, anthropometric characteristics including age, height, weight, body mass index (BMI), and arm circumference (AC) were used as independent predictor variables for the prediction of BP reactivity to talking. Principal component analysis (PCA) was fused with artificial neural network (ANN), adaptive neurofuzzy inference system (ANFIS), and least square-support vector machine (LS-SVM) model to remove the multicollinearity effect among anthropometric predictor variables. The statistical tests in terms of coefficient of determination (R 2), root mean square error (RMSE), and mean absolute percentage error (MAPE) revealed that PCA based LS-SVM (PCA-LS-SVM) model produced a more efficient prediction of BP reactivity as compared to other models. This assessment presents the importance and advantages posed by PCA fused prediction models for prediction of biological variables. PMID:25328536

  19. Sodium nitroprusside: low price and safe drug to control BP during thrombolysis in AIS.

    PubMed

    Koslyk, Jessyca L; Ducci, Renata D; Nóvak, Edison M; Zétola, Viviane F; Lange, Marcos C

    2015-09-01

    This study analyzes the use of sodium nitroprusside (SN) as an option to reduce blood pressure (BP) below 180/105 mmHg during the management of acute ischemic stroke (AIS) in patients submitted to intravenous thrombolysis.Method The sample was composed by 60 patients who had AIS and were submitted to intravenous rtPA, split in two groups: half in the control group (CG) with BP < 180/105 mmHg and half in SN group with BP > 180/105 mmHg. Outcome variables were any hemorrhagic transformation (HT); the presence of symptomatic HT, National Institute of Health Stroke Scale (NIHSS) after 24 hours of treatment; the independence on discharge and death until three months after stroke onset.Results There were no statistical differences between both groups to any of the outcome variables analyzed.Conclusion The SN might be safe for BP control during thrombolysis to AIS. PMID:26352493

  20. Environmental Conditions in northern Gulf of Mexico Estuaries: before and after the BP Oil Spill

    EPA Science Inventory

    This presentation provides a summary of ecological condition and sediment chemistry data for northern Gulf of Mexico estuaries that were exposed to oil and oil-related contaminants from the BP Oil Spill.

  1. Affective Processes and Academic Achievement.

    ERIC Educational Resources Information Center

    Feshbach, Norma Deitch; Feshbach, Seymour

    1987-01-01

    Data indicate that for girls, affective dispositional factors (empathy, depressive affectivity, aggression, and self-concept) are intimately linked to cognitive development and academic achievement. (PCB)

  2. Attribution theory in science achievement

    NASA Astrophysics Data System (ADS)

    Craig, Martin

    Recent research reveals consistent lags in American students' science achievement scores. Not only are the scores lower in the United States compared to other developed nations, but even within the United States, too many students are well below science proficiency scores for their grade levels. The current research addresses this problem by examining potential malleable factors that may predict science achievement in twelfth graders using 2009 data from the National Assessment of Educational Progress (NAEP). Principle component factor analysis was conducted to determine the specific items that contribute to each overall factor. A series of multiple regressions were then analyzed and formed the predictive value of each of these factors for science achievement. All significant factors were ultimately examined together (also using multiple regression) to determine the most powerful predictors of science achievement, identifying factors that predict science achievement, the results of which suggested interventions to strengthen students' science achievement scores and encourage persistence in the sciences at the college level and beyond. Although there is a variety of research highlighting how students in the US are falling behind other developing nations in science and math achievement, as yet, little research has addressed ways of intervening to address this gap. The current research is a starting point, seeking to identify malleable factors that contribute to science achievement. More specifically, this research examined the types of attributions that predict science achievement in twelfth grade students.

  3. Role of the CacyBP/SIP protein in gastric cancer

    PubMed Central

    ZHAI, HUIHONG; MENG, JUAN; JIN, HAIFENG; LI, YUANFEI; WANG, JINBO

    2015-01-01

    Various reports indicate that calcyclin binding protein/Siah-1-interacting protein (CacyBP/SIP) is an important protein in tumorigenesis, but whether CacyBP/SIP promotes or suppresses cancer may depend on the cell type. In order to investigate whether CacyBP/SIP is significant in gastric cancerous tumorigenesis, the present study used immunohistochemistry to analyze 181 gastric cancer tissue samples, as well as 181 healthy tissue samples from the same gastric cancer patients. The immunohistochemical results were compared against patient data and pathological analysis of the tissue slices, including gender, age, degree of tumor differentiation and tumor, node, metastasis (TNM) stage. In addition, the level of CacyBP/SIP expression was detected in three frozen tissue samples of gastric adenocarcinoma using western blot analysis. Of the 181 cases analyzed in the present study, 80 cases were identified as non-metastatic gastric cancer and 101 cases were identified as gastric cancer that had metastasized to the lymph nodes. Tissue biopsies from the two sets of patients were examined using immunohistochemistry to identify the level of CacyBP/SIP expression in metastatic and primary gastric cancer tissues. Statistical analyses were performed on all data. The immunohistochemical analysis revealed that CacyBP/SIP was expressed in 31% (56/181) of gastric adenocarcinoma tissue samples and 7% (12/181) of adjacent non-cancerous gastric tissues (P<0.05). Furthermore, the expression levels of CacyBP/SIP were higher in cancerous tissue compared with the adjacent non-cancerous gastric tissue using western blotting. No association was identified between CacyBP/SIP expression and patient age (P=0.975), gender (P=0.185), degree of tumor differentiation (P=0.076) or TNM stage (P=0.979). Among the 101 patients with metastatic gastric cancer, CacyBP/SIP was expressed at primary sites in 31% (31/101) of cases and at metastatic sites in 26% (26/101) of cases (P=0.434). However, among the

  4. Targeting Breast Cancer Metastasis

    PubMed Central

    Jin, Xin; Mu, Ping

    2015-01-01

    Metastasis is the leading cause of breast cancer-associated deaths. Despite the significant improvement in current therapies in extending patient life, 30–40% of patients may eventually suffer from distant relapse and succumb to the disease. Consequently, a deeper understanding of the metastasis biology is key to developing better treatment strategies and achieving long-lasting therapeutic efficacies against breast cancer. This review covers recent breakthroughs in the discovery of various metastatic traits that contribute to the metastasis cascade of breast cancer, which may provide novel avenues for therapeutic targeting. PMID:26380552

  5. A Role for Anti-BP180 Autoantibodies in Chronic Rhinosinusitis

    PubMed Central

    Jeffe, Jill S.; Seshadri, Sudarshan; Hamill, Kevin J.; Huang, Julia He; Carter, Roderick; Suh, Lydia; Hulse, Kathryn; Norton, James; Conley, David B.; Chandra, Rakesh K.; Kern, Robert C.; Jones, Jonathan C.R.; Schleimer, Robert P.; Tan, Bruce K.

    2013-01-01

    Objectives CRS is accompanied by evidence of a vigorous adaptive immune response, and emerging studies demonstrate that some nasal polyps manifest a polyclonal autoantibody response. We previously found that antibodies against BP180, a component of the hemidesmosome complex and the dominant epitope in autoimmune bullous pemphigoid, were found at elevated levels in nasal polyp tissue. Given the critical role of hemidesmosomes in maintaining epithelial integrity, we sought to investigate the distribution of BP180 in nasal tissue and evaluate for evidence of systemic autoimmunity against this antigen in CRS. Study Design Case-control experimental study Methods The expression and distribution of BP180 in cultured nasal epithelial cells and normal nasal tissue were confirmed using real-time PCR, Western immunoblotting, immunofluorescence and immunohistochemistry. Sera were collected from three groups: control, CRSsNP, and CRSwNP. A commercially available ELISA was utilized to compare anti-BP180 autoantibody levels in sera. Results BP180 is expressed in nasal epithelium, but is not confined to the basement membrane as it is in human skin. In cultured nasal epithelial cells, confocal immunofluoresence showed a punctate distribution of BP180 along the basal surface, consistent with its distribution in epithelial keratinocytes. There are significantly higher levels of circulating nonpathologic anti-BP180 autoantibodies in CRS patients compared with normal controls (p<0.05). Conclusions BP180 is more widely expressed in nasal epithelium versus skin, although it appears to play a similar role in formation of hemidesmosomes along the basement membrane. Further investigations are ongoing to characterize the pathogenicity of the anti-epithelial antibody response in CRS. PMID:24167818

  6. A novel E4BP4 element drives circadian expression of mPeriod2.

    PubMed

    Ohno, Tomoya; Onishi, Yoshiaki; Ishida, Norio

    2007-01-01

    Period2 (Per2) is an essential component of the mammalian clock mechanism and robust circadian expression of Per2 is essential for the maintenance of circadian rhythms. Although recent studies have shown that the circadian E2 enhancer (a non-canonical E-box) accounts for most of the circadian transcriptional drive of mPer2, little is known about the other cis-elements of mPer2 oscillatory transcription. Here, we examined the contribution of E4BP4 to Per2 mRNA oscillation in the cell-autonomous clock. Knockdown experiments of E4BP4 in both Northern blots and real-time luciferase assays suggested that endogenous E4BP4 negatively regulates Per2 mRNA oscillation. Sequence analysis revealed two putative E4BP4-binding sites (termed A-site and B-site) on mammalian Per2 promoter regions. Luciferase assays with mutant constructs showed that a novel E4BP4-binding site (B-site) is responsible for E4BP4-mediated transcriptional repression of Per2. Furthermore, chromatin immunoprecipitation assays in vivo showed that the peak of E4BP4 binding to the B-site on the Per2 promoter almost matched the trough of Per2 mRNA expression. Importantly, real-time luciferase assays showed that the B-site in addition to the E2 enhancer is required for robust circadian expression of Per2 in the cell-autonomous clock. These findings indicated that E4BP4 is required for the negative regulation of mammalian circadian clocks. PMID:17182630

  7. Discrete Sampling Test Plan for the 200-BP-5 Operable Unit

    SciTech Connect

    Sweeney, Mark D.

    2010-02-04

    The Discrete Groundwater Sampling Project is conducted by the Pacific Northwest National Laboratory (PNNL) on behalf of CH2M HILL Plateau Remediation Company. The project is focused on delivering groundwater samples from proscribed horizons within select groundwater wells residing in the 200-BP-5 Operable Unit (200-BP-5 OU) on the Hanford Site. This document provides the scope, schedule, methodology, and other details of the PNNL discrete sampling effort.

  8. Occurrence of 4-tert-butylphenol (4-t-BP) biodegradation in an aquatic sample caused by the presence of Spirodela polyrrhiza and isolation of a 4-t-BP-utilizing bacterium.

    PubMed

    Ogata, Yuka; Toyama, Tadashi; Yu, Ning; Wang, Xuan; Sei, Kazunari; Ike, Michihiko

    2013-04-01

    Although 4-tert-butylphenol (4-t-BP) is a serious aquatic pollutant, its biodegradation in aquatic environments has not been well documented. In this study, 4-t-BP was obviously and repeatedly removed from water from four different environments in the presence of Spirodela polyrrhiza, giant duckweed, but 4-t-BP persisted in the environmental waters in the absence of S. polyrrhiza. Also, 4-t-BP was not removed from autoclaved pond water with sterilized S. polyrrhiza. These results suggest that the 4-t-BP removal from the environmental waters was caused by biodegradation stimulated by the presence of S. polyrrhiza rather than by uptake by the plant. Moreover, Sphingobium fuliginis OMI capable of utilizing 4-t-BP as a sole carbon and energy source was isolated from the S. polyrrhiza rhizosphere. Strain OMI degraded 4-t-BP via a meta-cleavage pathway, and also degraded a broad range of alkylphenols with linear or branched alkyl side chains containing two to nine carbon atoms. Root exudates of S. polyrrhiza stimulated 4-t-BP degradation and cell growth of strain OMI. Thus, the stimulating effects of S. polyrrhiza root exudates on 4-t-BP-degrading bacteria might have contributed to 4-t-BP removal in the environmental waters with S. polyrrhiza. These results demonstrate that the S. polyrrhiza-bacteria association may be applicable to the removal of highly persistent 4-t-BP from wastewaters or polluted aquatic environments. PMID:22777343

  9. Effects of BP-14, a novel cyclin-dependent kinase inhibitor, on anaplastic thyroid cancer cells.

    PubMed

    Allegri, Lorenzo; Baldan, Federica; Mio, Catia; Puppin, Cinzia; Russo, Diego; Kryštof, Vladimir; Damante, Giuseppe

    2016-04-01

    Anaplastic thyroid carcinoma (ATC) is an extremely aggressive human malignancy characterized by a marked degree of invasiveness, absense of features of thyroid differentiation and resistance to current medical treatment. It is well known that ATCs are characterized by deregulation of genes related to cell cycle regulation, i.e., cyclin-dependent kinases (CDKs) and endogenous cyclin-dependent kinase inhibitors (CDKIs). Therefore, in the present study, the effect of a novel exogenous cyclin-dependent kinase inhibitor, BP-14, was investigated in three human ATC cell lines. The ATC-derived cell lines FRO, SW1736 and 8505C were treated with BP-14 alone or in combination with the mTOR inhibitor everolimus. In all ATC cell lines, treatment with BP-14 decreased cell viability and, in two of them, BP-14 modified expression of genes involved in epithelial-mesenchymal transition. Thus, our data indicate that BP-14 is a potential new compound effective against ATC. Combined treatment with BP-14 and the mTOR inhibitor everolimus had a strong synergistic effect on cell viability in all three cell lines, suggesting that the combined used of CDK and mTOR inhibitors may be a useful strategy for ATC treatment. PMID:26884249

  10. Asian-specific mitochondrial genome polymorphism (9-bp deletion) in Hungarian patients with mitochondrial disease.

    PubMed

    Pentelenyi, Klara; Remenyi, Viktoria; Gal, Aniko; Milley, Gyorgy Mate; Csosz, Aranka; Mende, Balazs Gusztav; Molnar, Maria Judit

    2016-05-01

    A 9-bp deletion of the mtDNA is known as an anthropological marker of people with East-Asian origin. This 9-bp mtDNA deletion was analyzed in 1073 Hungarians with suspected mitochondrial disease and in 468 healthy control individuals. Fourteen cases with the 9-bp deletion were found in the cohort of mitochondrial patients, and one individual from 468 controls. In six cases the 9-bp deletion was present together with pathogenic major deletions in the mitochondrial genome. In one patient we found a frame shift mutation in the D-loop region, and in another family a pathogenic m.8322 A > G mutation in the tRNA(Lys) gene. Although the 9-bp deletion is common in the populations of the Pacific region and Asia, it is present in the Hungarian population as well. This 9-bp deletion may induce instability of the mtDNA and may provoke the introduction of other pathogenic mutations. PMID:25242187

  11. 53BP1 fosters fidelity of homology-directed DNA repair.

    PubMed

    Ochs, Fena; Somyajit, Kumar; Altmeyer, Matthias; Rask, Maj-Britt; Lukas, Jiri; Lukas, Claudia

    2016-08-01

    Repair of DNA double-strand breaks (DSBs) in mammals is coordinated by the ubiquitin-dependent accumulation of 53BP1 at DSB-flanking chromatin. Owing to its ability to limit DNA-end processing, 53BP1 is thought to promote nonhomologous end-joining (NHEJ) and to suppress homology-directed repair (HDR). Here, we show that silencing 53BP1 or exhausting its capacity to bind damaged chromatin changes limited DSB resection to hyper-resection and results in a switch from error-free gene conversion by RAD51 to mutagenic single-strand annealing by RAD52. Thus, rather than suppressing HDR, 53BP1 fosters its fidelity. These findings illuminate causes and consequences of synthetic viability acquired through 53BP1 silencing in cells lacking the BRCA1 tumor suppressor. We show that such cells survive DSB assaults at the cost of increasing reliance on RAD52-mediated HDR, which may fuel genome instability. However, our findings suggest that when challenged by DSBs, BRCA1- and 53BP1-deficient cells may become hypersensitive to, and be eliminated by, RAD52 inhibition. PMID:27348077

  12. The negative transcription factor E4BP4 is associated with circadian clock protein PERIOD2.

    PubMed

    Ohno, Tomoya; Onishi, Yoshiaki; Ishida, Norio

    2007-03-23

    The bZIP transcription factor E4BP4, is a mammalian homologue of vrille that functions as a key negative component of the circadian clock. We have shown that the E4BP4-binding site (B-site) is required in addition to a non-canonical E-box (E2 enhancer) for robust circadian Period2 (Per2) expression in the cell-autonomous clock. While the E2 enhancer and the B-site are closely situated, correlations between each component bound to the E2 enhancer and the B-site remain obscure. Here, we show that E4BP4 interacts with PER2, which represses transcriptional activity via the E-box enhancer. Interaction with PER2 required the carboxyl-terminal region that contains the repression domain of E4BP4. We also found that E4BP4 interacts with CRYPTOCHROME2 (CRY2), a key negative regulator in the mammalian circadian clock. These results suggest that E4BP4 is a component of the negative regulator complex of mammalian circadian clocks. PMID:17274955

  13. The preparation of BP single crystals by high pressure flux method

    NASA Technical Reports Server (NTRS)

    Kumashiro, Y.; Misawa, S.; Gonda, S.

    1984-01-01

    Single crystals of BP, a III-V compound semiconductor, were obtained by the high pressure flux method. Cu3P and Ni12P5 powders were used as the flux, and mixed with BP powder. Two kinds of mixtures were prepared: (1) 1.8g (BP) + 35 G (Cu3P) and (2) 1.7 g (BP) + 25 g (Ni12P5). They were compressed into pellets, heated at 1300 C for 24 h in an induction furnace under a pressure of 1 MPa using Ar-P2 gas, and slowly cooled to room temperature. In case (1), BP single crystals grew along the (III) plane, and in case (2) they grew as an aggregate of crystallites. The cathodoluminescence spectra of the synthetic BP crystals showed peaks near 680 nm (1.82 eV) for case (1), and 500 nm (2.47 eV) for case (2). By using the high pressure flux method conventional sized crystals were obtained in a relatively short time.

  14. Regulation of B cell differentiation by the ubiquitin-binding protein TAX1BP1

    PubMed Central

    Matsushita, Nobuko; Suzuki, Midori; Ikebe, Emi; Nagashima, Shun; Inatome, Ryoko; Asano, Kenichi; Tanaka, Masato; Matsushita, Masayuki; Kondo, Eisaku; Iha, Hidekatsu; Yanagi, Shigeru

    2016-01-01

    Tax1-binding protein 1 (TAX1BP1) is a ubiquitin-binding protein that restricts nuclear factor-κB (NF-κB) activation and facilitates the termination of aberrant inflammation. However, its roles in B-cell activation and differentiation are poorly understood. To evaluate the function of TAX1BP1 in B cells, we established TAX1BP1-deficient DT40 B cells that are hyper-responsive to CD40-induced extracellular signal-regulated kinase (ERK) activation signaling, exhibit prolonged and exaggerated ERK phosphorylation and show enhanced B lymphocyte-induced maturation protein 1 (Blimp-1; a transcription factor inducing plasma cell differentiation) expression that is ERK-dependent. Furthermore, TAX1BP1-deficient cells exhibit significantly decreased surface IgM expression and increased IgM secretion. Moreover, TAX1BP1-deficient mice display reduced germinal center formation and antigen-specific antibody production. These findings show that TAX1BP1 restricts ERK activation and Blimp-1 expression and regulates germinal center formation. PMID:27515252

  15. The effects of PEP-1-FK506BP on dry eye disease in a rat model

    PubMed Central

    Kim, Dae Won; Lee, Sung Ho; Ku, Sae Kwang; Lee, Ji Eun; Cha, Hyun Ju; Youn, Jong Kyu; Kwon, Hyeok Yil; Park, Jong Hoon; Park, Eun Young; Cho, Sung-Woo; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

    2015-01-01

    As FK506 binding proteins (FK506BPs) are known to play an important role in the regulation of a variety of biological processes related to cell survival, this study was designed to examined the protective effects of FK506 binding protein 12 (FK506BP) on low humidity air flow induced dry eye in a rat model using transduced PEP-1-FK506BP. After the topical application of PEP-1-FK506BP, tear volumes were markedly increased and significant prevention of cornea damage was observed compared with dry eye rats. Further, immunohistochemical analysis demonstrated that PEP-1-FK506BP markedly prevented damage to the cornea, the bulbar conjunctiva, and the palpebral conjunctiva epithelial lining compared with dry eye rats. In addition, caspase-3 and PARP expression levels were found to be decreased. These results demonstrated that topical application of PEP-1-FK506BP significantly ameliorates dry eye injury in an animal model. Thus, we suggest that PEP-1-FK506BP can be developed as a new ophthalmic drop to treat dry eye diseases. [BMB Reports 2015; 48(3): 153-158] PMID:24998262

  16. The mTORC1 effectors S6K1 and 4E-BP play different roles in CNS axon regeneration.

    PubMed

    Yang, Liu; Miao, Linqing; Liang, Feisi; Huang, Haoliang; Teng, Xiuyin; Li, Shaohua; Nuriddinov, Jaloliddin; Selzer, Michael E; Hu, Yang

    2014-01-01

    Using mouse optic nerve (ON) crush as a CNS injury model, we and others have found that activation of the mammalian target of rapamycin complex 1 (mTORC1) in mature retinal ganglion cells by deletion of the negative regulators, phosphatase and tensin homologue (PTEN), and tuberous sclerosis 1 promotes ON regeneration. mTORC1 activation inhibits eukaryotic translation initiation factor 4E-binding protein (4E-BP) and activates ribosomal protein S6 kinase 1 (S6K1), both of which stimulate translation. We reasoned that mTORC1's regeneration-promoting effects might be separable from its deleterious effects by differential manipulation of its downstream effectors. Here we show that S6K1 activation, but not 4E-BP inhibition, is sufficient to promote axon regeneration. However, inhibition of 4E-BP is required for PTEN deletion-induced axon regeneration. Both activation and inhibition of S6K1 decrease the effect of PTEN deletion on axon regeneration, implicating a dual role of S6K1 in regulating axon growth. PMID:25382660

  17. The TIP60 complex regulates bivalent chromatin recognition by 53BP1 through direct H4K20me binding and H2AK15 acetylation

    PubMed Central

    Jacquet, Karine; Fradet-Turcotte, Amélie; Avvakumov, Nikita; Lambert, Jean-Philippe; Roques, Céline; Pandita, Raj K.; Paquet, Eric; Herst, Pauline; Gingras, Anne-Claude; Pandita, Tej K.; Legube, Gaëlle; Doyon, Yannick; Durocher, Daniel; Côté, Jacques

    2016-01-01

    SUMMARY The NuA4/TIP60 acetyltransferase complex is a key regulator of genome expression and stability. Here, we identified MBTD1 as a new stable subunit of the complex and gleaned intriguing insights into TIP60’s function. Harboring a histone reader domain for H4K20me1/2, MBTD1 allows TIP60 to associate with specific gene promoters and to promote the repair of DNA double strand breaks by homologous recombination. Interestingly, the non-homologous end joining factor 53BP1 engages chromatin through simultaneous binding of H4K20me2 and H2AK15ub, and it was postulated that Tip60-dependent acetylation of H4 regulates this binding. Our findings now indicate that the TIP60 complex is a potent regulator of DNA damage repair pathways in part by targeting the same histone mark as 53BP1. In addition, deposition of H2AK15ub by RNF168 inhibits chromatin acetylation by TIP60, while this residue can be acetylated by TIP60 in vivo, blocking its ubiquitylation. Altogether, these results uncover an intricate mechanism orchestrated by the TIP60 complex which regulates 53BP1-dependent repair pathway selection through incompatible bivalent binding and modification of chromatin. PMID:27153538

  18. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  19. RhoE Inhibits 4E-BP1 Phosphorylation and eIF4E Function Impairing Cap-dependent Translation*

    PubMed Central

    Villalonga, Priam; de Mattos, Silvia Fernández; Ridley, Anne J.

    2009-01-01

    The Rho GTPase family member RhoE inhibits RhoA/ROCK signaling to promote actin stress fiber and focal adhesion disassembly. We have previously reported that RhoE also inhibits cell cycle progression and Ras-induced transformation, specifically preventing cyclin D1 translation. Here we investigate the molecular mechanisms underlying those observations. RhoE inhibits the phosphorylation of the translational repressor 4E-BP1 in response to extracellular stimuli. However, RhoE does not affect the activation of mTOR, the major kinase regulating 4E-BP1 phosphorylation, as indicated by the phosphorylation levels of the mTOR substrate S6K, the dynamics of mTOR/Raptor association, and the observation that RhoE, as opposed to rapamycin, does not impair cellular growth. Interestingly, RhoE prevents the release of the eukaryotic initiation factor eIF4E from 4E-BP1, inhibiting cap-dependent translation. Accordingly, RhoE also inhibits the expression and the transcriptional activity of the eIF4E target c-Myc. Consistent with its crucial role in cell proliferation, we show that eIF4E can rescue both cell cycle progression and Ras-induced transformation in RhoE-expressing cells, indicating that the inhibition of eIF4E function is critical to mediate the anti-proliferative effects of RhoE. PMID:19850923

  20. General Achievement Trends: South Dakota

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  1. The Process of Science Achievement.

    ERIC Educational Resources Information Center

    Papanastasiou, Constantinos; Papanastasiou, Elena C.

    2002-01-01

    Investigates the science achievement of 8th grade students in Cyprus by using a structural equation model with three exogenous constructs--family's educational background, reinforcements, and school climate, and three endogenous constructs--teaching, student attitudes, and achievement. Proposes a model for the effects of family, school, student…

  2. Examination Regimes and Student Achievement

    ERIC Educational Resources Information Center

    Cosentino de Cohen, Clemencia

    2010-01-01

    Examination regimes at the end of secondary school vary greatly intra- and cross-nationally, and in recent years have undergone important reforms often geared towards increasing student achievement. This research presents a comparative analysis of the relationship between examination regimes and student achievement in the OECD. Using a micro…

  3. School Size and Student Achievement

    ERIC Educational Resources Information Center

    Riggen, Vicki

    2013-01-01

    This study examined whether a relationship between high school size and student achievement exists in Illinois public high schools in reading and math, as measured by the Prairie State Achievement Exam (PSAE), which is administered to all Illinois 11th-grade students. This study also examined whether the factors of socioeconomic status, English…

  4. Motivational Factors in School Achievement.

    ERIC Educational Resources Information Center

    Maehr, Martin L.

    A summary is presented of the literature on motivation relating to achievement in the classroom. Special attention is given to how values, ideology, and various cultural patterns may serve to enhance motivation to achieve in the classroom. In considering what determines motivation and personal investment in educational pursuits, the following…

  5. Parental Involvement and Academic Achievement

    ERIC Educational Resources Information Center

    Goodwin, Sarah Christine

    2015-01-01

    This research study examined the correlation between student achievement and parent's perceptions of their involvement in their child's schooling. Parent participants completed the Parent Involvement Project Parent Questionnaire. Results slightly indicated parents of students with higher level of achievement perceived less demand or invitations…

  6. General Achievement Trends: New Jersey

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  7. General Achievement Trends: North Carolina

    ERIC Educational Resources Information Center

    Center on Education Policy, 2009

    2009-01-01

    This general achievement trends profile includes information that the Center on Education Policy (CEP) and the Human Resources Research Organization (HumRRO) obtained from states from fall 2008 through April 2009. Included herein are: (1) Bullet points summarizing key findings about achievement trends in that state at three performance…

  8. Perils of Standardized Achievement Testing

    ERIC Educational Resources Information Center

    Haladyna, Thomas M.

    2006-01-01

    This article argues that the validity of standardized achievement test-score interpretation and use is problematic; consequently, confidence and trust in such test scores may often be unwarranted. The problem is particularly severe in high-stakes situations. This essay provides a context for understanding standardized achievement testing, then…

  9. Raising Boys' Achievement in Schools.

    ERIC Educational Resources Information Center

    Bleach, Kevan, Ed.

    This book offers insights into the range of strategies and good practice being used to raise the achievement of boys. Case studies by school-based practitioners suggest ideas and measures to address the issue of achievement by boys. The contributions are: (1) "Why the Likely Lads Lag Behind" (Kevan Bleach); (2) "Helping Boys Do Better in Their…

  10. Stress Correlates and Academic Achievement.

    ERIC Educational Resources Information Center

    Bentley, Donna Anderson; And Others

    An ongoing concern for educators is the identification of factors that contribute to or are associated with academic achievement; one such group of variables that has received little attention are those involving stress. The relationship between perceived sources of stress and academic achievement was examined to determine if reactions to stress…

  11. Achievement in Writing Geometry Proofs.

    ERIC Educational Resources Information Center

    Senk, Sharon L.

    In 1981 a nationwide assessment of achievement in writing geometry proofs was conducted by the Cognitive Development and Achievement in Secondary School Geometry project. Over 1,500 students in 11 schools in 5 states participated. This paper describes the sample, instruments, grading procedures, and selected results. Results include: (1) at the…

  12. Teaching the Low Level Achiever.

    ERIC Educational Resources Information Center

    Salomone, Ronald E., Ed.

    1986-01-01

    Intended for teachers of the English language arts, the articles in this issue offer suggestions and techniques for teaching the low level achiever. Titles and authors of the articles are as follows: (1) "A Point to Ponder" (Rachel Martin); (2) "Tracking: A Self-Fulfilling Prophecy of Failure for the Low Level Achiever" (James Christopher Davis);…

  13. Predicting Achievement in Foreign Language.

    ERIC Educational Resources Information Center

    Hart, Mary Elizabeth

    A review of research is inconclusive concerning the relationship between intelligence and language proficiency. A study of 10th grade students (n=35) examined scores on a high school entrance exam and achievement in foreign language after 1 year of study. Both math and reading showed a significant correlation with foreign language achievement; the…

  14. Superintendent Tenure and Student Achievement

    ERIC Educational Resources Information Center

    Simpson, Jennifer

    2013-01-01

    A correlational research design was used to examine the influence of superintendent tenure on student achievement in rural Appalachian Kentucky school districts. Superintendent tenure was compared to aggregated student achievement scores for 2011 and to changes in students' learning outcomes over the course of the superintendents' tenure. The…

  15. Continuous lake-sediment records of glaciation in the Sierra Nevada between 52,600 and 12,500 14C yr B.P.

    USGS Publications Warehouse

    Benson, L.V.; May, Howard M.; Antweiler, R.C.; Brinton, T.I.; Kashgarian, Michaele; Smoot, J.P.; Lund, S.P.

    1998-01-01

    The chemistry of the carbonate-free clay-size fraction of Owens Lake sediments supports the use of total organic carbon and magnetic susceptibility as indicators of stadial-interstadial oscillations. Owens Lake records of total organic carbon, magnetic susceptibility, and chemical composition of the carbonate-free, clay-size fraction indicate that Tioga glaciation began ~24,500 and ended by ~13,600 14C yr B.P. Many of the components of glacial rock flour (e.g., TiO2, MnO, BaO) found in Owens Lake sediments achieved maximum values during the Tioga glaciation when valley glaciers reached their greatest extent. Total organic carbon and SiO2 (amorphous) concentrations reached minimum values during Tioga glaciation, resulting from decreases in productivity that accompanied the introduction of rock flour into the surface waters of Owens Lake. At least 20 stadial-interstadial oscillations occurred in the Sierra Nevada between 52,600 and 14,000 14C yr B.P. Total organic carbon data from a Pyramid Lake sediment core also indicate oscillations in glacier activity between >39,500 and ~13,600 14C yr B.P. Alpine glacier oscillations occurred on a frequency of ???1900 yr in both basins, suggesting that millennial-scale oscillations occurred in California and Nevada during most of the past 52,600 yr.

  16. Apo-states of calmodulin and CaBP1 control CaV1 voltage-gated calcium channel function through direct competition for the IQ domain

    PubMed Central

    Findeisen, Felix; Rumpf, Christine; Minor, Daniel L.

    2013-01-01

    In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation (CDI) and limits calcium entry, whereas CaBP1 blocks CDI and allows sustained calcium influx. Here, we combine isothermal titration calorimetry (ITC) with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca2+/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium binding properties. The observation that the apo-forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. PMID:23811053

  17. 15q11.2 microdeletion (BP1-BP2) and developmental delay, behaviour issues, epilepsy and congenital heart disease: a series of 52 patients.

    PubMed

    Vanlerberghe, Clémence; Petit, Florence; Malan, Valérie; Vincent-Delorme, Catherine; Bouquillon, Sonia; Boute, Odile; Holder-Espinasse, Muriel; Delobel, Bruno; Duban, Bénédicte; Vallee, Louis; Cuisset, Jean-Marie; Lemaitre, Marie-Pierre; Vantyghem, Marie-Christine; Pigeyre, Marie; Lanco-Dosen, Sandrine; Plessis, Ghislaine; Gerard, Marion; Decamp, Matthieu; Mathieu, Michèle; Morin, Gilles; Jedraszak, Guillaume; Bilan, Frédéric; Gilbert-Dussardier, Brigitte; Fauvert, Delphine; Roume, Joëlle; Cormier-Daire, Valérie; Caumes, Roseline; Puechberty, Jacques; Genevieve, David; Sarda, Pierre; Pinson, Lucie; Blanchet, Patricia; Lemeur, Nathalie; Sheth, Frenny; Manouvrier-Hanu, Sylvie; Andrieux, Joris

    2015-03-01

    Proximal region of chromosome 15 long arm is rich in duplicons that, define five breakpoints (BP) for 15q rearrangements. 15q11.2 microdeletion between BP1 and BP2 has been previously associated with developmental delay and atypical psychological patterns. This region contains four highly-conserved and non-imprinted genes: NIPA1, NIPA2, CYFIP1, TUBGCP5. Our goal was to investigate the phenotypes associated with this microdeletion in a cohort of 52 patients. This copy number variation (CNV) was prevalent in 0.8% patients presenting with developmental delay, psychological pattern issues and/or multiple congenital malformations. This was studied by array-CGH at six different French Genetic laboratories. We collected data from 52 unrelated patients (including 3 foetuses) after excluding patients with an associated genetic alteration (known CNV, aneuploidy or known monogenic disease). Out of 52 patients, mild or moderate developmental delay was observed in 68.3%, 85.4% had speech impairment and 63.4% had psychological issues such as Attention Deficit and Hyperactivity Disorder, Autistic Spectrum Disorder or Obsessive-Compulsive Disorder. Seizures were noted in 18.7% patients and associated congenital heart disease in 17.3%. Parents were analysed for abnormalities in the region in 65.4% families. Amongst these families, 'de novo' microdeletions were observed in 18.8% and 81.2% were inherited from one of the parents. Incomplete penetrance and variable expressivity were observed amongst the patients. Our results support the hypothesis that 15q11.2 (BP1-BP2) microdeletion is associated with developmental delay, abnormal behaviour, generalized epilepsy and congenital heart disease. The later feature has been rarely described. Incomplete penetrance and variability of expression demands further assessment and studies. PMID:25596525

  18. AAV-mediated transduction and targeting of retinal bipolar cells with improved mGluR6 promoters in rodents and primates.

    PubMed

    Lu, Q; Ganjawala, T H; Ivanova, E; Cheng, J G; Troilo, D; Pan, Z-H

    2016-08-01

    Adeno-associated virus (AAV) vectors have been a powerful gene delivery vehicle to the retina for basic research and gene therapy. For many of these applications, achieving cell type-specific targeting and high transduction efficiency is desired. Recently, there has been increasing interest in AAV-mediated gene targeting to specific retinal bipolar cell types. A 200-bp enhancer in combination with a basal SV40 promoter has been commonly used to target transgenes into ON-type bipolar cells. In the current study, we searched for additional cis-regulatory elements in the mGluR6 gene for improving AAV-mediated transduction efficiency into retinal bipolar cells. Our results showed that the combination of the endogenous mGluR6 promoter with additional enhancers in the introns of the mGluR6 gene markedly enhanced AAV transduction efficiency as well as made the targeting more selective for rod bipolar cells in mice. Furthermore, the AAV vectors with the improved promoter could target to ON bipolar cells with robust transduction efficiency in the parafovea and the far peripheral retina of marmoset monkeys. The improved mGluR6 promoter constructs could provide a valuable tool for genetic manipulation in rod bipolar cells in mice and facilitate clinical applications for ON bipolar cell-based gene therapies. PMID:27115727

  19. Early treatment of hypertension in acute ischemic and intracerebral hemorrhagic stroke: progress achieved, challenges, and perspectives.

    PubMed

    Feldstein, Carlos A

    2014-03-01

    Hypertension is the leading risk factor for ischemic and intracerebral hemorrhagic subtypes of stroke. Additionally, high blood pressure (BP) in the acute cerebrovascular event is associated with poor outcome, and a high percentage of stroke survivors have inadequate control of hypertension. The present is a systematic review of prospective, randomized, and controlled trials carried out on safety and efficacy of antihypertensive treatment of both subtypes of acute stroke. Six trials involving 7512 patients were included, which revealed controversies on the speed and the goals of treatment. These controversies could be due at least in part, from the fact that some studies analyzed the results of antihypertensive treatment in ischemic and intracerebral hemorrhagic subtypes of acute stroke together, and from a different prevalence of past-stroke in the randomized groups. Further research is necessary to establish whether standard antihypertensive treatment provides greater benefit than simple observation in patients with ischemic acute stroke and Stage 2 hypertension of JNC 7, albeit they were not candidates for acute reperfusion. In that case, the target reduction in BP could be 10% to 15% within 24 hours. The recently published INTERACT 2 has provided evidence that patients with hemorrhagic stroke may receive intensive antihypertensive treatment safely with the goal of reducing systolic BP to levels no lower than 130 mm Hg. It is important to take into account that marked BP lowering in acute stroke increases the risk of poor outcome by worsening cerebral ischemia from deterioration of cerebral blood flow autoregulation. PMID:24220549

  20. G3BP-Caprin1-USP10 complexes mediate stress granule condensation and associate with 40S subunits.

    PubMed

    Kedersha, Nancy; Panas, Marc D; Achorn, Christopher A; Lyons, Shawn; Tisdale, Sarah; Hickman, Tyler; Thomas, Marshall; Lieberman, Judy; McInerney, Gerald M; Ivanov, Pavel; Anderson, Paul

    2016-03-28

    Mammalian stress granules (SGs) contain stalled translation preinitiation complexes that are assembled into discrete granules by specific RNA-binding proteins such as G3BP. We now show that cells lacking both G3BP1 and G3BP2 cannot form SGs in response to eukaryotic initiation factor 2α phosphorylation or eIF4A inhibition, but are still SG-competent when challenged with severe heat or osmotic stress. Rescue experiments using G3BP1 mutants show that phosphomimetic G3BP1-S149E fails to rescue SG formation, whereas G3BP1-F33W, a mutant unable to bind G3BP partner proteins Caprin1 or USP10, rescues SG formation. Caprin1/USP10 binding to G3BP is mutually exclusive: Caprin binding promotes, but USP10 binding inhibits, SG formation. G3BP interacts with 40S ribosomal subunits through its RGG motif, which is also required for G3BP-mediated SG formation. We propose that G3BP mediates the condensation of SGs by shifting between two different states that are controlled by the phosphorylation of S149 and by binding to Caprin1 or USP10. PMID:27022092

  1. Identification and characterization of a novel calcyclin binding protein (CacyBP) gene from Apis cerana cerana.

    PubMed

    Yu, Xiaoli; Lu, Wenjing; Sun, Rujiang; Guo, Xingqi; Xu, Baohua

    2012-08-01

    Calcyclin binding protein (CacyBP), a homolog of Sgt1, was shown to interact with some S100 proteins, Skp1, tubulin, actin and ERK1/2 kinases. Studies have also shown that CacyBP is a neuronal protein in mammals. Limited information is available regarding the properties and functions of CacyBP in insects. Here, we cloned and characterized a novel CacyBP gene, named AccCacyBP, from honeybee (Apis cerana cerana). Bioinformatic analysis indicated that AccCacyBP was highly conserved and closely related to the CacyBP of other insects. Promoter analysis revealed a number of putative tissue, development and stress-related transcription factor-binding sites. RT-qPCR demonstrated that AccCacyBP was expressed at all of the stages of development, especially in the brains of honeybees. Moreover, immunohistochemistry analysis showed the presence of AccCacyBP in the brain. The transcript levels of AccCacyBP in the brains of honeybees were developmentally induced and upregulated by exposure to oxidative stresses, including UV-light, acetamiprid and HgCl(2). This study demonstrates that the CacyBP gene in honeybees may be a neuronal protein involved in the developmental regulation and the stress-response of the brain of honeybees. PMID:22539186

  2. Non-monotonic mobility vs. length dependence observed in electrophoretic separation of 25 bp DNA ladder in Pluronic gels.

    NASA Astrophysics Data System (ADS)

    You, Seungyong; van Winkle, David

    2009-03-01

    We electrophoresed a double-stranded DNA ladder first in an agarose gel, then in gels of Pluronic F-127 at room temperature. The DNA ladder consisted of 19 discrete fragments ranging in length from 25 to 450 bp at 25 bp increments plus 500 bp. The DNA fragments were first separated in agarose gel and stacked normally with 25 bp having the highest mobility. A single lane of the separated DNA ladder in the agarose gel was inserted at the edge of a Pluronic gel slab. The DNA was electrophoresed from the agarose into the Pluronic gels perpendicular to the original separation axis. Mobilities of DNA fragments increased from 25 bp to 175 bp and then decreased from 175 bp to 500 bp. The 25 bp and 500 bp bands of the ladder had approximately the same mobility in several different Pluronic gel concentrations. Both were slower than most bands in between. The highest mobility fragments with length of 175 bp have 59.5 nm contour length which is about 3.5 times the diameter of a micelle (17 nm). This result suggests a crossover from chromatographic separation to electrophoretic separation for these short DNAs. This research is supported by the state of Florida (Martech) and Research Corporation.

  3. Adding protein to a carbohydrate supplement provided after endurance exercise enhances 4E-BP1 and RPS6 signaling in skeletal muscle.

    PubMed

    Morrison, Paul J; Hara, Daisuke; Ding, Zhenping; Ivy, John L

    2008-04-01

    To examine the role of both endurance exercise and nutrient supplementation on the activation of mRNA translation signaling pathways postexercise, rats were subjected to a 3-h swimming protocol. Immediately following exercise, the rats were provided with a solution containing either 23.7% wt/vol carbohydrates (CHO), 7.9% wt/vol protein (Pro), 31.6% wt/vol (23.7% wt/vol CHO + 7.9% wt/vol Pro) carbohydrates and Pro (CP), or a placebo (EX). The rats were then killed at 0, 30, and 90 min postexercise, and phosphorylation states of mammalian target of rapamycin (mTOR), ribosomal S6 kinase (p70(S6K)), ribosomal protein S6 (rpS6), and 4E-binding protein 1 (4E-BP1), were analyzed by immunoblot analysis in the red and white quadriceps muscle. Results demonstrated that rat groups provided with any of the three nutritional supplements (CHO, Pro, CP) transiently increased the phosphorylation states of mTOR, 4E-BP1, rpS6, and p70(S6K) compared with EX rats. Although CHO, Pro, and CP supplements phosphorylated mTOR and p70(S6K) after exercise, only CP elevated the phosphorylation of rpS6 above all other supplements 30 min postexercise and 4E-BP1 30 and 90 min postexercise. Furthermore, the phosphorylation states of 4E-BP1 (r(2) = 0.7942) and rpS6 (r(2) = 0.760) were highly correlated to insulin concentrations in each group. These results suggest that CP supplementation may be most effective in activating the mTOR-dependent signaling pathway in the postprandial state postexercise, and that there is a strong relationship between the insulin concentration and the activation of enzymes critical for mRNA translation. PMID:18239077

  4. BpMADS4 has a central role in inflorescence initiation in silver birch (Betula pendula).

    PubMed

    Elo, Annakaisa; Lemmetyinen, Juha; Novak, Anu; Keinonen, Kaija; Porali, Ilkka; Hassinen, Minna; Sopanen, Tuomas

    2007-09-01

    Acceleration of flowering would be beneficial for breeding trees with a long juvenile phase; conversely, inhibition of flowering would prevent the spread of transgenes from the genetically modified trees. We have previously isolated and characterized several MADS genes from silver birch (Betula pendula Roth). In this study, we investigated the more detailed function of one of them, BpMADS4, a member of the APETALA1/FRUITFULL group of MADS genes. The expression of BpMADS4 starts at very early stage of the male and female inflorescence development and the activity is high in the apex of the developing inflorescence. Later, some expression is detected in the bracts and in the flower initials. Ectopic expression of BpMADS4 accelerates flowering dramatically in normally flowering clones and also in the early-flowering birch clone, in which the earliest line flowered about 11 days after rooting, when the saplings were only 3 cm high. The birches transformed with the BpMADS4 antisense construct showed remarkable delay in flowering and the number of flowering individuals was reduced. Two of the transformed lines did not show any signs of flower development during our 2-year study, whereas all the control plants formed inflorescences within 107 days. Our results show that BpMADS4 has a critical role in the initiation of birch inflorescence development and that BpMADS4 seems to be involved in the transition from vegetative to reproductive development. Therefore, BpMADS4 provides a promising tool for the genetic enhancement of forest trees. PMID:18251933

  5. Childhood Obesity and Cognitive Achievement.

    PubMed

    Black, Nicole; Johnston, David W; Peeters, Anna

    2015-09-01

    Obese children tend to perform worse academically than normal-weight children. If poor cognitive achievement is truly a consequence of childhood obesity, this relationship has significant policy implications. Therefore, an important question is to what extent can this correlation be explained by other factors that jointly determine obesity and cognitive achievement in childhood? To answer this question, we exploit a rich longitudinal dataset of Australian children, which is linked to national assessments in math and literacy. Using a range of estimators, we find that obesity and body mass index are negatively related to cognitive achievement for boys but not girls. This effect cannot be explained by sociodemographic factors, past cognitive achievement or unobserved time-invariant characteristics and is robust to different measures of adiposity. Given the enormous importance of early human capital development for future well-being and prosperity, this negative effect for boys is concerning and warrants further investigation. PMID:26123250

  6. Using Design To Achieve Sustainability

    EPA Science Inventory

    Sustainability is defined as meeting the needs of this generation without compromising the ability of future generations to meet their needs. This is a conditional statement that places the responsibility for achieving sustainability squarely in hands of designers and planners....

  7. Strategies for targeting lentiviral vectors.

    PubMed

    Frecha, Cecilia; Szécsi, Judit; Cosset, Francois-Loîc; Verhoeyen, Els

    2008-12-01

    Vectors derived from retroviruses such as lentiviruses and onco-retroviruses are probably among the most suitable tools to achieve a long-term gene transfer since they allow stable integration of a transgene and its propagation in daughter cells. Lentiviral vectors should be preferred gene delivery vehicles over vectors derived from onco-retroviruses (MLV) since in contrast to the latter they can transduce non-proliferating target cells. Moreover, lentiviral vectors that have the capacity to deliver transgenes into specific tissues are expected to be of great value for various gene transfer approaches in vivo. Here we provide an overview of innovative approaches to upgrade lentiviral vectors for tissue or cell targeting and which have potential for in vivo gene delivery. In this overview we distinguish between three types of lentiviral vector targeting strategies (Fig 1): 1) targeting of vectors at the level of vector-cell entry through lentiviral vector surface modifications; 2) targeting at the level of transgene transcription by insertion of tissue specific promoters into lentiviral vectors; 3) a novel microRNA technology that rather than targeting the 'right' cells will 'detarget' transgene expression from non-target cells while achieving high expression in the target-cell. It is clear that each strategy is of enormous value for several gene therapy approaches but combining these three layers of transgene expression control will offer tools to really overcome several drawbacks in the field such as side-effect of off-target expression, clearance of transgene modified cells by immune response to the transgene and lack of biosecurity and efficiency in in vivo approaches. PMID:19075628

  8. Experimental validation of candidate schizophrenia gene ZNF804Aas target for hsa-miR-137

    PubMed Central

    Williamson, Vernell; McMichael, Gowon O.; Fanous, Ayman H.; Vladimirov, Vladimir I.

    2014-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that mainly function as negative regulators of gene expression (Lai, 2002) and have been shown to be involved in schizophrenia etiology through genetic and expression studies (Burmistrova et al., 2007; Hansen et al., 2007a; Perkins et al., 2007; Beveridge et al., 2010; Kim et al., 2010). In a mega analysis of genome-wide association study (GWAS) of schizophrenia (SZ) and bipolar disorders (BP), a polymorphism (rs1625579) located in the primary transcript of a miRNA gene, hsa-miR-137, was reported to be strongly associated with SZ. Four SZ loci (CACNA1C, TCF4, CSMD1, C10orf26) achieving genome-wide significance in the same study were predicted and later experimentally validated (Kwon et al., 2011) as hsa-miR-137 targets. Here, using in silico, cellular and luciferase based approaches we also provide evidence that another well replicated candidate schizophrenia gene, ZNF804A, is also target for hsa-miR-137. PMID:22883350

  9. Structural determinants in phycotoxins and AChBP conferring high affinity binding and nicotinic AChR antagonism

    PubMed Central

    Bourne, Yves; Radić, Zoran; Aráoz, Rómulo; Talley, Todd T.; Benoit, Evelyne; Servent, Denis; Taylor, Palmer; Molgó, Jordi; Marchot, Pascale

    2010-01-01

    Spirolide and gymnodimine macrocyclic imine phycotoxins belong to an emerging class of chemical agents associated with marine algal blooms and shellfish toxicity. Analysis of 13-desmethyl spirolide C and gymnodimine A by binding and voltage-clamp recordings on muscle-type α12βγδ and neuronal α3β2 and α4β2 nicotinic acetylcholine receptors reveals subnanomolar affinities, potent antagonism, and limited subtype selectivity. Their binding to acetylcholine-binding proteins (AChBP), as soluble receptor surrogates, exhibits picomolar affinities governed by diffusion-limited association and slow dissociation, accounting for apparent irreversibility. Crystal structures of the phycotoxins bound to Aplysia-AChBP (≈2.4Å) show toxins neatly imbedded within the nest of ar-omatic side chains contributed by loops C and F on opposing faces of the subunit interface, and which in physiological conditions accommodates acetylcholine. The structures also point to three major features: (i) the sequence-conserved loop C envelops the bound toxins to maximize surface complementarity; (ii) hydrogen bonding of the protonated imine nitrogen in the toxins with the carbonyl oxygen of loop C Trp147 tethers the toxin core centered within the pocket; and (iii) the spirolide bis-spiroacetal or gymnodimine tetrahydrofuran and their common cyclohexene-butyrolactone further anchor the toxins in apical and membrane directions, along the subunit interface. In contrast, the se-quence-variable loop F only sparingly contributes contact points to preserve the broad receptor subtype recognition unique to phycotoxins compared with other nicotinic antagonists. These data offer unique means for detecting spiroimine toxins in shellfish and identify distinctive ligands, functional determinants and binding regions for the design of new drugs able to target several receptor subtypes with high affinity. PMID:20224036

  10. Structural determinants in phycotoxins and AChBP conferring high affinity binding and nicotinic AChR antagonism.

    PubMed

    Bourne, Yves; Radic, Zoran; Aráoz, Rómulo; Talley, Todd T; Benoit, Evelyne; Servent, Denis; Taylor, Palmer; Molgó, Jordi; Marchot, Pascale

    2010-03-30

    Spirolide and gymnodimine macrocyclic imine phycotoxins belong to an emerging class of chemical agents associated with marine algal blooms and shellfish toxicity. Analysis of 13-desmethyl spirolide C and gymnodimine A by binding and voltage-clamp recordings on muscle-type alpha1(2)betagammadelta and neuronal alpha3beta2 and alpha4beta2 nicotinic acetylcholine receptors reveals subnanomolar affinities, potent antagonism, and limited subtype selectivity. Their binding to acetylcholine-binding proteins (AChBP), as soluble receptor surrogates, exhibits picomolar affinities governed by diffusion-limited association and slow dissociation, accounting for apparent irreversibility. Crystal structures of the phycotoxins bound to Aplysia-AChBP ( approximately 2.4A) show toxins neatly imbedded within the nest of ar-omatic side chains contributed by loops C and F on opposing faces of the subunit interface, and which in physiological conditions accommodates acetylcholine. The structures also point to three major features: (i) the sequence-conserved loop C envelops the bound toxins to maximize surface complementarity; (ii) hydrogen bonding of the protonated imine nitrogen in the toxins with the carbonyl oxygen of loop C Trp147 tethers the toxin core centered within the pocket; and (iii) the spirolide bis-spiroacetal or gymnodimine tetrahydrofuran and their common cyclohexene-butyrolactone further anchor the toxins in apical and membrane directions, along the subunit interface. In contrast, the se-quence-variable loop F only sparingly contributes contact points to preserve the broad receptor subtype recognition unique to phycotoxins compared with other nicotinic antagonists. These data offer unique means for detecting spiroimine toxins in shellfish and identify distinctive ligands, functional determinants and binding regions for the design of new drugs able to target several receptor subtypes with high affinity. PMID:20224036

  11. Dual targeting of peroxisomal proteins

    PubMed Central

    Ast, Julia; Stiebler, Alina C.; Freitag, Johannes; Bölker, Michael

    2013-01-01

    Cellular compartmentalization into organelles serves to separate biological processes within the environment of a single cell. While some metabolic reactions are specific to a single organelle, others occur in more than one cellular compartment. Specific targeting of proteins to compartments inside of eukaryotic cells is mediated by defined sequence motifs. To achieve multiple targeting to different compartments cells use a variety of strategies. Here, we focus on mechanisms leading to dual targeting of peroxisomal proteins. In many instances, isoforms of peroxisomal proteins with distinct intracellular localization are encoded by separate genes. But also single genes can give rise to differentially localized proteins. Different isoforms can be generated by use of alternative transcriptional start sites, by differential splicing or ribosomal read-through of stop codons. In all these cases different peptide variants are produced, of which only one carries a peroxisomal targeting signal. Alternatively, peroxisomal proteins contain additional signals that compete for intracellular targeting. Dual localization of proteins residing in both the cytoplasm and in peroxisomes may also result from use of inefficient targeting signals. The recent observation that some bona fide cytoplasmic enzymes were also found in peroxisomes indicates that dual targeting of proteins to both the cytoplasm and the peroxisome might be more widespread. Although current knowledge of proteins exhibiting only partial peroxisomal targeting is far from being complete, we speculate that the metabolic capacity of peroxisomes might be larger than previously assumed. PMID:24151469

  12. High temporal Resolution Fire History in Eastern Africa: the Last 16 kyr cal. BP

    NASA Astrophysics Data System (ADS)

    Vanniere, B.; Carcaillet, C.; Garcin, Y.; Vullien, A.; Williamson, D.

    2004-12-01

    Charcoal series, based on a high temporal resolution analysis, at Lake Massoko (9°20' S, 33° 45' E, 770 a.s.l., SW Tanzania) reveals numerous changes of fire regime over the last 16 kyr cal BP. Data are based on the tallying of charcoal from 700 continuous 1 cm thick samples along a 7m long sequence. The structure of charcoal particles is well preserved with an length:width ratio superior to 5; this appears to testify to the local provenance of the material studied and to the rapid transport of particles to the lake. The majority of particles belongs to herbaceous cuticles produced by savanna or bush fires. Time control is supported by 14 radiocarbon dates. Mean time resolution per sample of 17 yr provides the first long detailed biomass burning record in Africa. This record evidences frequent fires events during the last 16 kyr, indicating that fire is a key component of east African ecosystems since, at least, the last glacial stage up to present. From 16 to 12 kyr cal BP, the charcoal influx into the lake is low except during two specific sequences, between 13.5-12.5 kyr cal BP and 14.5-14 kyr cal BP. These may correspond to more arid or more biomass-available phases. Around 10 kyr cal BP, at the early Holocene a greater influx of charcoal is recorded in the lake, probably as a result of a high fire regime likely triggered by severe droughts. Between 8.3 and 1.7 kyr cal BP, the charcoal influx displays a cyclic fire history of ca. 500 yr. Low fire regime, between 3.5-2.5, 5.5-5 and 7.5-7 kyr cal BP, correspond to wetter periods. About 12 sequences of fire increase and decrease are highlighted, which appears to support a high climatic variability during the middle-Holocene. After 1.7 kyr BP, there is a long lasting increase of charcoal influx into the lake, as observed by black carbon analysis (Thevenon et al., 2003). This particular period, without analog since 16 kyr cal BP, is consistent with the development of Iron Age settlements in the region, slash

  13. Stable semiconductor black phosphorus (BP)@titanium dioxide (TiO2) hybrid photocatalysts.

    PubMed

    Lee, Hyun Uk; Lee, Soon Chang; Won, Jonghan; Son, Byung-Chul; Choi, Saehae; Kim, Yooseok; Park, So Young; Kim, Hee-Sik; Lee, Young-Chul; Lee, Jouhahn

    2015-01-01

    Over the past few decades, two-dimensional (2D) and layered materials have emerged as new fields. Due to the zero-band-gap nature of graphene and the low photocatalytic performance of MoS2, more advanced semiconducting 2D materials have been prompted. As a result, semiconductor black phosphorus (BP) is a derived cutting-edge post-graphene contender for nanoelectrical application, because of its direct-band-gap nature. For the first time, we report on robust BP@TiO2 hybrid photocatalysts offering enhanced photocatalytic performance under light irradiation in environmental and biomedical fields, with negligible affected on temperature and pH conditions, as compared with MoS2@TiO2 prepared by the identical synthesis method. Remarkably, in contrast to pure few layered BP, which, due to its intrinsic sensitivity to oxygen and humidity was readily dissolved after just several uses, the BP@TiO2 hybrid photocatalysts showed a ~92% photocatalytic activity after 15 runs. Thus, metal-oxide-stabilized BP photocatalysts can be practically applied as a promising alternative to graphene and MoS2. PMID:25732720

  14. A BP neural network model for sea state recognition using laser altimeter

    NASA Astrophysics Data System (ADS)

    Shi, Chun-bo; Jia, Xiao-dong; Li, Sheng; Wang, Zhen

    2009-07-01

    A BP neural network method for the recognition of sea state in laser altimeter is presented in this paper. Sea wave is the typical stochastic disturbance factor of laser altimeter effecting on low-altitude defense penetration of the intelligent antiship missiles, the recognition of sea state is studied in order to satisfy the practical needs of flying over the ocean. The BP neural network fed with the feature vector of laser range-measurement presents the analysis of features and outputs the estimation result of sea state. The two most distinguishing features are the mean and the variance of the sea echo, which are extracted from the distance characteristics of sea echo using general theory of statistics. The use of a feedforward network trained with the back-propagation algorithm is also investigated. The BP neural network is trained using sample data set to the neural network, and then the BP neural network trained is tested to recognize the sea state waiting for the classification. The network output shows the recognition accuracy of the model can up to 88%, and the results of tests show that the BP neural network model for the recognition of sea state is feasible and effective.

  15. Northern East Pacific Rise: Evolution from 25 m.y. B.P. to the present

    NASA Astrophysics Data System (ADS)

    Mammerickx, Jacqueline; Klitgord, Kim D.

    1982-08-01

    The northeast Pacific topography and magnetic lineations (25 m.y. B.P. to the Present) record the traces of three major spreading reorganizations. Only one spreading center is observed today, but there is evidence for several ephemeral episodes of twin spreading accompanying the evolution from an extensive Pacific-Guadalupe plate boundary to a much shortened Pacific-Cocos and Pacific-Rivera plate boundary. The 25 m.y. B.P. plate reorganization culminated with the formation of the Guadalupe plate, bound by the Murray fracture zone to the north and the Cocos-Nazca spreading ridge to the south. Between 25 and 12.5 m.y. B.P. spreading continued while the plate retained the same general outline. The 12.5-11 m.y. B.P. reorganization resulted in the creation of a much shortened Pacific-Cocos plate boundary located in its early stages over the Mathematician seamounts and a much reduced Cocos-plate. The last reorganizaton (6.5-3.5 m.y. B.P.) resulted in the abandonment of the Mathematician spreading ridge as a Pacific-Cocos plate boundary in favor of the East Pacific Rise.

  16. Stable semiconductor black phosphorus (BP)@titanium dioxide (TiO2) hybrid photocatalysts

    PubMed Central

    Uk Lee, Hyun; Lee, Soon Chang; Won, Jonghan; Son, Byung-Chul; Choi, Saehae; Kim, Yooseok; Park, So Young; Kim, Hee-Sik; Lee, Young-Chul; Lee, Jouhahn

    2015-01-01

    Over the past few decades, two-dimensional (2D) and layered materials have emerged as new fields. Due to the zero-band-gap nature of graphene and the low photocatalytic performance of MoS2, more advanced semiconducting 2D materials have been prompted. As a result, semiconductor black phosphorus (BP) is a derived cutting-edge post-graphene contender for nanoelectrical application, because of its direct-band-gap nature. For the first time, we report on robust BP@TiO2 hybrid photocatalysts offering enhanced photocatalytic performance under light irradiation in environmental and biomedical fields, with negligible affected on temperature and pH conditions, as compared with MoS2@TiO2 prepared by the identical synthesis method. Remarkably, in contrast to pure few layered BP, which, due to its intrinsic sensitivity to oxygen and humidity was readily dissolved after just several uses, the BP@TiO2 hybrid photocatalysts showed a ~92% photocatalytic activity after 15 runs. Thus, metal-oxide-stabilized BP photocatalysts can be practically applied as a promising alternative to graphene and MoS2. PMID:25732720

  17. HIV-1 Vpr increases HCV replication through VprBP in cell culture.

    PubMed

    Yan, Yanling; Huang, Fang; Yuan, Ting; Sun, Binlian; Yang, Rongge

    2016-09-01

    Coinfection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) occurs at a high frequency, in which HIV shows a promotion of HCV-derived liver diseases. However, the mechanism of how this occurs is not well understood. Our previous work has demonstrated that the HIV-1 accessory protein Vpr enhances HCV RNA replication in cell culture. Because Vpr performs most of its functions through host protein VprBP (DCAF1), the role of VprBP in the regulation of HCV by Vpr was investigated in this study. We found that the Vpr mutant Q65R, which is deficient in VprBP binding, could not enhance HCV replication. Furthermore, Vpr-mediated enhancement of HCV replication was severely diminished in VprBP knockdown cells. In addition, an inhibitor of Cullin RING E3 ligases, MLN4924, impaired the function of Vpr during HCV replication. Together, these results suggest that Vpr promotes HCV replication in a VprBP-dependent manner, and that the activity of Cullin RING E3 ligases is essential to this process. In conclusion, our findings demonstrate that HIV-1 Vpr makes the cellular environment more suitable for HCV replication, which might relate with the host ubiquitination system. PMID:27460548

  18. L-serine deficiency caused by genetic Phgdh deletion leads to robust induction of 4E-BP1 and subsequent repression of translation initiation in the developing central nervous system.

    PubMed

    Sayano, Tomoko; Kawakami, Yuriko; Kusada, Wataru; Suzuki, Takeshi; Kawano, Yuki; Watanabe, Akihiro; Takashima, Kana; Arimoto, Yashiho; Esaki, Kayoko; Wada, Akira; Yoshizawa, Fumiaki; Watanabe, Masahiko; Okamoto, Masahiro; Hirabayashi, Yoshio; Furuya, Shigeki

    2013-03-01

    Targeted disruption in mice of the gene encoding D-3-phosphoglycerate dehydrogenase (Phgdh) results in embryonic lethality associated with a striking reduction in free L-serine and growth retardation including severe brain malformation. We previously observed a severe impairment in neurogenesis of the central nervous system of Phgdh knockout (KO) embryos and a reduction in the protein content of their brains. Although these findings suggest that L-serine deficiency links attenuation of mRNA translation to severe developmental malformation of the central nervous system, the underlying key molecular event remains unexplored. Here we demonstrate that mRNA of Eif4ebp1 encoding eukaryotic initiation factor 4 binding protein 1 and its protein, 4E-BP1, are markedly induced in the central nervous system of Phgdh KO embryos, whereas a modest induction is observed in the liver. The increase in 4E-BP1 was associated with a decrease in the cap initiation complex in the brain, as shown by lower levels of eukaryotic translation initiation factor 4G bound to eukaryotic translation initiation factor 4E (eIF4E) and increased eIF4E interaction with 4E-BP1 based on 7-methyl-GTP chromatography. eIF4E protein and polysomes were also diminished in Phgdh KO embryos. Induction of Eif4ebp1 mRNA and of 4E-BP1 was reproduced in mouse embryonic fibroblasts established from Phgdh KO embryos under the condition of L-serine deprivation. Induction of Eif4ebp1 mRNA was suppressed only when L-serine was supplemented in the culture medium, indicating that reduced L-serine availability regulates the induction of Eif4ebp1/4E-BP1. These data suggest that elevated levels of 4E-BP1 may be involved in a mechanism to arrest brain development in Phgdh KO embryos. PMID:23350942

  19. Prevalence of Obesity and Its Influence on Achievement of Cardiometabolic Therapeutic Goals in Chinese Type 2 Diabetes Patients: An Analysis of the Nationwide, Cross-Sectional 3B Study

    PubMed Central

    Zhou, Xianghai; Ji, Linong; Ran, Xingwu; Su, Benli; Ji, Qiuhe; Pan, Changyu; Weng, Jianping; Ma, Changsheng; Hao, Chuanming; Zhang, Danyi; Hu, Dayi

    2016-01-01

    Background There are few data on the prevalence of obesity and its influence on achieving blood glucose, blood pressure, and blood lipid (3B) goals in Chinese type 2 diabetes outpatients. Methods Patient demographic data, anthropometric measurements, medications, and blood glucose and lipid profiles of 24,512 type 2 diabetes patients from a large, geographically diverse study (CCMR-3B) were analyzed. Using cut-points for body mass index (BMI) and waist circumference (WC) recommended by the Working Group on Obesity in China, overweight and obesity were defined as BMIs of 24–27.9kg/m2 and ≥28.0kg/m2. Central obesity was defined as a waist circumference ≥80cm in women and ≥85cm in men. The 3B therapeutic goals were HbA1c<7.0%, BP<140/90mmHg and LDL-C<2.6mmol/L. Results Overall, 43.0% of type 2 diabetes patients were overweight and 16.7% were obese; 13.3% of overweight and and10.1% of obese patients achieved all the 3B target goals. Overweight or obese patients were less likely to achieve 3B goals than those with normal BMIs. More than a half the overweight or obese patients (69.6%) were centrally obese. Patients with abdominal obesity were less likely to achieve cardiometabolic targets than those without abdominal obesity. In multivariate logistic regression analysis, female, higher BMI and waist circumference, smoking, drinking, sedentary lifestyle, and longer diabetes duration were significantly correlated with failure to achieve 3B control goals. Conclusions Obesity is highly prevalent and associated with poor 3B control in Chinese type 2 diabetes patients. In clinical practice, more attention and resources should focus on weight loss for such patients. PMID:26726883

  20. Regulation of PMP22 mRNA by G3BP1 affects cell proliferation in breast cancer cells

    PubMed Central

    2013-01-01

    Background Regulation of mRNAs is one way to control protein levels and thereby important cellular processes such as growth, invasion and apoptosis. G3BPs constitute a family of mRNA-binding proteins, shown to be overexpressed in several cancer types, including breast, colon and pancreas cancer. G3BP has been reported to both stabilize and induce degradation of specific mRNAs. Results Here, we show that G3BP1, but not G3BP2, supports proliferation of several breast cancer cell lines. Global gene expression analyses of G3BP1- and G3BP2-depleted cells indicate that primarily G3BP1, and much less G3BP2, influences mRNA expression levels. Peripheral myelin protein 22 (PMP22) was one gene that was significantly influenced by G3BP1 depletion which led to a 2–3 fold increased expression. Depletion of PMP22 resulted in increased proliferation and the G3BP1-mediated effect on proliferation was not seen upon PMP22-depletion. Conclusions This indicates a novel role for G3BP1 in the regulation of cell proliferation in breast cancer cells, perhaps via a regulatory effect on PMP22 expression. PMID:24321297

  1. CacyBP/SIP inhibits Doxourbicin-induced apoptosis of glioma cells due to activation of ERK1/2.

    PubMed

    Tang, Yuan; Zhan, Wenjian; Cao, Tong; Tang, Tianjin; Gao, Yong; Qiu, Zhichao; Fu, Chunling; Qian, Fengyuan; Yu, Rutong; Shi, Hengliang

    2016-03-01

    Calcyclin-binding protein or Siah-1-interacting protein (CacyBP/SIP) was previously reported to promote the proliferation of glioma cells. However, the effect of CacyBP/SIP on apoptosis of glioma is poorly understood. Here, our study shows that CacyBP/SIP plays a role in inhibiting doxorubicin (DOX) induced apoptosis of glioma cells U251 and U87. Overexpression of CacyBP/SIP obviously suppressed the DOX-induced cell apoptosis. On the contrary, silencing of CacyBP/SIP significantly promoted it. Further investigation indicated that inhibition of apoptosis by CacyBP/SIP was relevant to its nuclear translocation in response to the DOX treatment. Importantly, we found that the level of p-ERK1/2 in nuclei was related to the nuclear accumulation of CacyBP/SIP. Finally, the role of CacyBP/SIP was confirmed in vivo in a mouse model with the cell line stably silencing CacyBP/SIP. Taken together, our results suggest that CacyBP/SIP plays an important role in inhibiting apoptosis of glioma cells which might be mediated by ERK1/2 signaling pathway, which will provide some guidance for the treatment of glioma. PMID:26825673

  2. An Ethylene-responsive Factor BpERF11 Negatively Modulates Salt and Osmotic Tolerance in Betula platyphylla.

    PubMed

    Zhang, Wenhui; Yang, Guiyan; Mu, Dan; Li, Hongyan; Zang, Dandan; Xu, Hongyun; Zou, Xuezhong; Wang, Yucheng

    2016-01-01

    Ethylene responsive factors (ERFs) play important roles in the abiotic stress; however, only a few ERF genes from woody plants have been functionally characterized. In the present study, an ERF gene from Betula platyphylla (birch), BpERF11, was functionally characterized in response to abiotic stress. BpERF11 is a nuclear protein, which could specifically bind to GCC boxes and DRE motifs. BpERF11-overexpressing and BpERF11 RNA interference (RNAi) knockdown plants were generated for gain- and loss-of-function analysis. BpERF11 negatively regulates resistance to salt and severe osmotic stress, and the transgenic birch plants overexpressing BpERF11 shows increased electrolyte leakage and malondialdehyde (MDA) contents. BpERF11 inhibits the expression of an AtMYB61 homologous gene, resulting in increased stomatal aperture, which elevated the transpiration rate. Furthermore, BpERF11 downregulates the expression of P5CS, SOD and POD genes, but upregulates the expression of PRODH and P5CDH, which results in reduced proline levels and increased reactive oxygen species (ROS) accumulation. BpERF11 also significantly inhibits the expression of LEA and dehydrin genes that involve in abiotic stress tolerance. Therefore, BpERF11 serves as a transcription factor that negatively regulates salt and severe osmotic tolerance by modulating various physiological processes. PMID:26980058

  3. An Ethylene-responsive Factor BpERF11 Negatively Modulates Salt and Osmotic Tolerance in Betula platyphylla

    PubMed Central

    Zhang, Wenhui; Yang, Guiyan; Mu, Dan; Li, Hongyan; Zang, Dandan; Xu, Hongyun; Zou, Xuezhong; Wang, Yucheng

    2016-01-01

    Ethylene responsive factors (ERFs) play important roles in the abiotic stress; however, only a few ERF genes from woody plants have been functionally characterized. In the present study, an ERF gene from Betula platyphylla (birch), BpERF11, was functionally characterized in response to abiotic stress. BpERF11 is a nuclear protein, which could specifically bind to GCC boxes and DRE motifs. BpERF11-overexpressing and BpERF11 RNA interference (RNAi) knockdown plants were generated for gain- and loss-of-function analysis. BpERF11 negatively regulates resistance to salt and severe osmotic stress, and the transgenic birch plants overexpressing BpERF11 shows increased electrolyte leakage and malondialdehyde (MDA) contents. BpERF11 inhibits the expression of an AtMYB61 homologous gene, resulting in increased stomatal aperture, which elevated the transpiration rate. Furthermore, BpERF11 downregulates the expression of P5CS, SOD and POD genes, but upregulates the expression of PRODH and P5CDH, which results in reduced proline levels and increased reactive oxygen species (ROS) accumulation. BpERF11 also significantly inhibits the expression of LEA and dehydrin genes that involve in abiotic stress tolerance. Therefore, BpERF11 serves as a transcription factor that negatively regulates salt and severe osmotic tolerance by modulating various physiological processes. PMID:26980058

  4. Bone Marrow Transplantation Improves Autoinflammation and Inflammatory Bone Loss in SH3BP2 Knock-In Cherubism Mice

    PubMed Central

    Yoshitaka, Teruhito; Kittaka, Mizuho; Ishida, Shu; Mizuno, Noriyoshi; Mukai, Tomoyuki; Ueki, Yasuyoshi

    2014-01-01

    Cherubism (OMIM#118400) is a genetic disorder in children characterized by excessive jawbone destruction with proliferation of fibro-osseous lesions containing a large number of osteoclasts. Mutations in the SH3-domain binding protein 2 (SH3BP2) are responsible for cherubism. Analysis of the knock-in (KI) mouse model of cherubism showed that homozygous cherubism mice (Sh3bp2KI/KI) spontaneously develop systemic autoinflammation and inflammatory bone loss and that cherubism is a TNF-α-dependent hematopoietic disorder. In this study, we investigated whether bone marrow transplantation (BMT) is effective for the treatment of inflammation and bone loss in Sh3bp2KI/KI mice. Bone marrow (BM) cells from wild-type (Sh3bp2+/+) mice were transplanted to 6-week-old Sh3bp2KI/KI mice with developing inflammation and to 10-week-old Sh3bp2KI/KI mice with established inflammation. Six-week-old Sh3bp2KI/KI mice transplanted with Sh3bp2+/+ BM cells exhibited improved body weight loss, facial swelling, and survival rate. Inflammatory lesions in the liver and lung as well as bone loss in calvaria and mandibula were ameliorated at 10 weeks after BMT compared to Sh3bp2KI/KI mice transplanted with Sh3bp2KI/KI BM cells. Elevation of serum TNF-α levels was not detected after BMT. BMT was effective for up to 20 weeks in 6-week-old Sh3bp2KI/KI mice transplanted with Sh3bp2+/+ BM cells. BMT also ameliorated the inflammation and bone loss in 10-week-old Sh3bp2KI/KI mice. Thus our study demonstrates that BMT improves the inflammation and bone loss in cherubism mice. BMT may be effective for the treatment of cherubism patients. PMID:25445458

  5. Improving Upper Grade Math Achievement via the Integration of a Culturally Responsive Curriculum.

    ERIC Educational Resources Information Center

    Pajkos, Diane; Klein-Collins, John

    This report describes an intervention program for increasing mathematical achievement of African American students. Within the targeted population, it was evident that the disparity in math achievement between African American and White students was increasing each year. The targeted population consisted of sixth, seventh, and eighth grade…

  6. Determinants of Small Ubiquitin-like Modifier 1 (SUMO1) Protein Specificity, E3 Ligase, and SUMO-RanGAP1 Binding Activities of Nucleoporin RanBP2

    SciTech Connect

    Gareau, Jaclyn R.; Reverter, David; Lima, Christopher D.

    2012-02-16

    The RanBP2 nucleoporin contains an internal repeat domain (IR1-M-IR2) that catalyzes E3 ligase activity and forms a stable complex with SUMO-modified RanGAP1 and UBC9 at the nuclear pore complex. RanBP2 exhibits specificity for SUMO1 as RanGAP1-SUMO1/UBC9 forms a more stable complex with RanBP2 compared with RanGAP1-SUMO2 that results in greater protection of RanGAP-SUMO1 from proteases. The IR1-M-IR2 SUMO E3 ligase activity also shows a similar preference for SUMO1. We utilized deletions and domain swap constructs in protease protection assays and automodification assays to define RanBP2 domains responsible for RanGAP1-SUMO1 protection and SUMO1-specific E3 ligase activity. Our data suggest that elements in both IR1 and IR2 exhibit specificity for SUMO1. IR1 protects RanGAP1-SUMO1/UBC9 and functions as the primary E3 ligase of RanBP2, whereas IR2 retains the ability to interact with SUMO1 to promote SUMO1-specific E3 ligase activity. To determine the structural basis for SUMO1 specificity, a hybrid IR1 construct and IR1 were used to determine three new structures for complexes containing UBC9 with RanGAP1-SUMO1/2. These structures show more extensive contacts among SUMO, UBC9, and RanBP2 in complexes containing SUMO1 compared with SUMO2 and suggest that differences in SUMO specificity may be achieved through these subtle conformational differences.

  7. Black Phosphorus Based Field Effect Transistors with Simultaneously Achieved Near Ideal Subthreshold Swing and High Hole Mobility at Room Temperature

    NASA Astrophysics Data System (ADS)

    Liu, Xinke; Ang, Kah-Wee; Yu, Wenjie; He, Jiazhu; Feng, Xuewei; Liu, Qiang; Jiang, He; Dan Tang; Wen, Jiao; Lu, Youming; Liu, Wenjun; Cao, Peijiang; Han, Shun; Wu, Jing; Liu, Wenjun; Wang, Xi; Zhu, Deliang; He, Zhubing

    2016-04-01

    Black phosphorus (BP) has emerged as a promising two-dimensional (2D) material for next generation transistor applications due to its superior carrier transport properties. Among other issues, achieving reduced subthreshold swing and enhanced hole mobility simultaneously remains a challenge which requires careful optimization of the BP/gate oxide interface. Here, we report the realization of high performance BP transistors integrated with HfO2 high-k gate dielectric using a low temperature CMOS process. The fabricated devices were shown to demonstrate a near ideal subthreshold swing (SS) of ~69 mV/dec and a room temperature hole mobility of exceeding >400 cm2/Vs. These figure-of-merits are benchmarked to be the best-of-its-kind, which outperform previously reported BP transistors realized on traditional SiO2 gate dielectric. X-ray photoelectron spectroscopy (XPS) analysis further reveals the evidence of a more chemically stable BP when formed on HfO2 high-k as opposed to SiO2, which gives rise to a better interface quality that accounts for the SS and hole mobility improvement. These results unveil the potential of black phosphorus as an emerging channel material for future nanoelectronic device applications.

  8. Black Phosphorus Based Field Effect Transistors with Simultaneously Achieved Near Ideal Subthreshold Swing and High Hole Mobility at Room Temperature

    PubMed Central

    Liu, Xinke; Ang, Kah-Wee; Yu, Wenjie; He, Jiazhu; Feng, Xuewei; Liu, Qiang; Jiang, He; Dan Tang; Wen, Jiao; Lu, Youming; Liu, Wenjun; Cao, Peijiang; Han, Shun; Wu, Jing; Liu, Wenjun; Wang, Xi; Zhu, Deliang; He, Zhubing

    2016-01-01

    Black phosphorus (BP) has emerged as a promising two-dimensional (2D) material for next generation transistor applications due to its superior carrier transport properties. Among other issues, achieving reduced subthreshold swing and enhanced hole mobility simultaneously remains a challenge which requires careful optimization of the BP/gate oxide interface. Here, we report the realization of high performance BP transistors integrated with HfO2 high-k gate dielectric using a low temperature CMOS process. The fabricated devices were shown to demonstrate a near ideal subthreshold swing (SS) of ~69 mV/dec and a room temperature hole mobility of exceeding >400 cm2/Vs. These figure-of-merits are benchmarked to be the best-of-its-kind, which outperform previously reported BP transistors realized on traditional SiO2 gate dielectric. X-ray photoelectron spectroscopy (XPS) analysis further reveals the evidence of a more chemically stable BP when formed on HfO2 high-k as opposed to SiO2, which gives rise to a better interface quality that accounts for the SS and hole mobility improvement. These results unveil the potential of black phosphorus as an emerging channel material for future nanoelectronic device applications. PMID:27102711

  9. Black Phosphorus Based Field Effect Transistors with Simultaneously Achieved Near Ideal Subthreshold Swing and High Hole Mobility at Room Temperature.

    PubMed

    Liu, Xinke; Ang, Kah-Wee; Yu, Wenjie; He, Jiazhu; Feng, Xuewei; Liu, Qiang; Jiang, He; Dan Tang; Wen, Jiao; Lu, Youming; Liu, Wenjun; Cao, Peijiang; Han, Shun; Wu, Jing; Liu, Wenjun; Wang, Xi; Zhu, Deliang; He, Zhubing

    2016-01-01

    Black phosphorus (BP) has emerged as a promising two-dimensional (2D) material for next generation transistor applications due to its superior carrier transport properties. Among other issues, achieving reduced subthreshold swing and enhanced hole mobility simultaneously remains a challenge which requires careful optimization of the BP/gate oxide interface. Here, we report the realization of high performance BP transistors integrated with HfO2 high-k gate dielectric using a low temperature CMOS process. The fabricated devices were shown to demonstrate a near ideal subthreshold swing (SS) of ~69 mV/dec and a room temperature hole mobility of exceeding >400 cm(2)/Vs. These figure-of-merits are benchmarked to be the best-of-its-kind, which outperform previously reported BP transistors realized on traditional SiO2 gate dielectric. X-ray photoelectron spectroscopy (XPS) analysis further reveals the evidence of a more chemically stable BP when formed on HfO2 high-k as opposed to SiO2, which gives rise to a better interface quality that accounts for the SS and hole mobility improvement. These results unveil the potential of black phosphorus as an emerging channel material for future nanoelectronic device applications. PMID:27102711

  10. The Role of Butylidenephthalide in Targeting the Microenvironment Which Contributes to Liver Fibrosis Amelioration

    PubMed Central

    Chuang, Hong-Meng; Su, Hong-Lin; Li, Chien; Lin, Shinn-Zong; Yen, Ssu-Yin; Huang, Mao-Hsuan; Ho, Li-Ing; Chiou, Tzyy-Wen; Harn, Horng-Jyh

    2016-01-01

    The treatment of liver fibrosis has clinical limitations because of its multiple etiologies, such as epithelial–mesenchymal transition (EMT) promotion, cell regeneration and remodeling dysfunction, inflammatory cell activation, and scar tissue deposition. These factors might be considered as a new target for the fibrotic microenvironment, leading to increased fibrogenesis and liver fibrosis. Here, we investigate a small molecule named butylidenephthalide (BP) and its multiple effects on liver fibrosis treatment. Thioacetamide was used in vivo to induce chronic liver fibrosis. BP was administered orally in rats for a period of 2 and 4 weeks, which resulted in a significantly reduced fibrosis score (p < 0.05) and (p < 0.001), respectively. The inflammatory reaction of macrophage infiltration were reduced in the administration of BP, which led to the decrease in the transaminase levels. Moreover, we also found liver functions recovering (due to the increased serum albumin and reduced prothrombin time) where liver cells regenerated, which can be seen in the increase of Ki-67 on Oval cell. In addition, the fibrotic scar was also reduced, along with the expression of matrix metalloprotease by hepatic stellate cell. Furthermore, regarding the mechanism/study of EMT reduced by BP, the knockdown of BMP-7, which could reduce α-SMA expression, was mediated by the regulation of TGF-β, which implies its major role on EMT. Finally, in the in vivo study, BP treatment of liver fibrosis was reduced by Bmp7 knockdown in zebrafish, suggesting that BP leads to the reduction of liver fibrosis, which also depends on BMP-7 induction. These results suggest that BP had multiple targets for treating liver fibrosis in the following ways: reduction of EMT, decreasing inflammatory reaction, and liver cell proliferation. This multiple targets approach provided a new mechanism to treat liver injury and fibrosis. PMID:27199755

  11. SCF ubiquitin ligase targeted therapies

    PubMed Central

    Skaar, Jeffrey R.; Pagan, Julia K.; Pagano, Michele

    2015-01-01

    Summary The recent clinical successes of inhibitors of the proteasome for the treatment of cancer have highlighted the therapeutic potential of this protein degradation system. Proteasome inhibitors prevent the degradation of numerous proteins, so increased specificity could be achieved by inhibiting the components of the ubiquitin-proteasome system that target specific subsets of proteins for degradation. F-box proteins are the substrate-targeting subunits of SKP1-CUL1-F-box protein (SCF) ubiquitin ligase complexes. Through the degradation of a plethora of diverse substrates, SCF ubiquitin ligases control a large number of processes at the cellular and organismal levels, and their misregulation is implicated in many pathologies. SCF ligases are characterized by a high specificity for their substrates, so they represent promising drug targets. However, the potential for therapeutic manipulation of SCF complexes remains an underdeveloped area. This review will explore and discuss potential strategies to target SCF-mediated biology to treat human diseases. PMID:25394868

  12. Lags in Minority Achievement Defy Traditional Explanations. The Achievement Gap.

    ERIC Educational Resources Information Center

    Viadero, Debra; Johnston, Robert C.

    2000-01-01

    This second in a four-part series on why academic achievement gaps exist notes that standard explanations for why minority students trail behind non-Hispanic whites are not good enough, suggesting that no single explanation for the gap exists, but instead a multitude of factors are influential. Poverty, though not the single most important cause,…

  13. Central Iowa Low Achiever Mathematics Project - Low Achiever Motivational Project.

    ERIC Educational Resources Information Center

    Zimmerman, Joseph T.

    The materials in this booklet are designed especially for the low achieving student in mathematics. Containing some materials from a course in general mathematics, the booklet is intended to be used in conjunction with conventional textbook materials and is designed to serve as a source of new ideas for teachers and to relieve the teacher of much…

  14. A Study of the Mechanisms of Attachment of Allergised Lymphocytes to BP8 Ascites Tumour Cells

    PubMed Central

    Lee, P. J.; Cater, D. B.

    1969-01-01

    The attachment of allergised and non-allergised lymph-node cells from C57B1 mice to BP8 ascites tumour cells were compared in vitro in the presence of vaso-active agents and mediators of the inflammatory reaction. It was found that Priscol, noradrenaline, adrenaline, 5-HT and histamine caused some cell adherence, while bradykinin and lysolecithin caused a marked increase of adherence of the allergised lymph-node cells to the BP8 cells. Electrophoretic studies of BP8 cells in the presence of polyornithine showed an abolition of the anodic mobility. Theories of action of the various agents are discussed. ImagesFigs. 5-8Figs. 1-4 PMID:5364386

  15. Environmental change in the Limfjord, Denmark (ca 7500-1500 cal yrs BP): a multiproxy study

    NASA Astrophysics Data System (ADS)

    Lewis, Jonathan P.; Ryves, David B.; Rasmussen, Peter; Knudsen, Karen L.; Petersen, Kaj S.; Olsen, Jesper; Leng, Melanie J.; Kristensen, Peter; McGowan, Suzanne; Philippsen, Bente

    2013-10-01

    The Limfjord region of northern Jutland, Denmark, supports a rich archaeological record dating back to the Mesolithic, which documents long-term change in human practices and utilisation of marine resources since approximately 7500 BP. The presence and availability of marine resources in the Limfjord is sensitively regulated by environmental parameters such as salinity, sedimentary regime, nutrient status and primary productivity, but long-term changes in these parameters are currently poorly understood. In this study a multiproxy approach (including sedimentary parameters, diatoms, molluscs, foraminifera, sedimentary pigments, C and O stable isotopes and plant macrofossils) has been adopted to assess environmental change over the period ca 7500-1500 cal yrs BP at Kilen, a coastal fjord (before AD 1856) situated in the Western Limfjord. A diatom-based salinity transfer function based on a pan-Baltic training set has been applied to the fossil diatom dataset for quantitative assessment of salinity change over the study period. This study demonstrates that large-scale shifts in salinity are a common feature of the Limfjord's long-term history and are driven by the level of connection with the North Sea and the Skagerrak respectively, which in turn is likely driven by the complex interplay between climate, sea-level change, current velocity and rates of erosion/sedimentary accretion. Three shifts in state at Kilen are identified over the study period: a deep, periodically stratified fjord with medium-high salinity (and high productivity) between ca 7500-5000 BP, followed by a gradual transition to a shallow benthic system with more oceanic conditions (i.e. higher salinity, lower productivity, slower sedimentary accumulation rate and poorer fossil preservation) after ca 5000 BP and no stratification after ca 4400 BP, and lastly, within this shallow phase, an abrupt shift to brackish conditions around 2000 BP. Environmental-societal interactions are discussed on the

  16. Enhancing Academic Performance: Issues in Target Selection.

    ERIC Educational Resources Information Center

    Hoge, Robert D.; Andrews, D. A.

    1987-01-01

    Learning of subject matter and acquisition of academically relevant skills are important goals in enhancing academic achievement in the classroom. The results of 22 experiments reviewed in this article support the validity of the academic performance targets but not classroom behavior targets. Some limitations on these conclusions are discussed.…

  17. Study of the 10B(p, αγ) 7Be and 10B (p,p‧ γ)10B reactions for PIGE purposes

    NASA Astrophysics Data System (ADS)

    Lagoyannis, A.; Preketes-Sigalas, K.; Axiotis, M.; Foteinou, V.; Harissopulos, S.; Kokkoris, M.; Misaelides, P.; Paneta, V.; Patronis, N.

    2015-01-01

    Differential cross sections were measured at 8 angles and at proton energies from 2 to 5 MeV for the 10B(p, αγ) 7Be and 10B (p,p‧ γ)10B reactions using two thin targets. The γ-rays emitted at Eγ = 429 and 718 keV respectively, were detected by four HPGe detectors placed on a motorized turntable. The overall systematic uncertainty of the measurements was estimated to be ∼8% while the statistical errors did not exceed 5%. The validity of the obtained cross sections was tested by performing a thick target benchmarking experiment. The results of the present work are compared with existing ones from literature and possible explanations for the observed differences are discussed.

  18. The structural basis of modified nucleosome recognition by 53BP1.

    PubMed

    Wilson, Marcus D; Benlekbir, Samir; Fradet-Turcotte, Amélie; Sherker, Alana; Julien, Jean-Philippe; McEwan, Andrea; Noordermeer, Sylvie M; Sicheri, Frank; Rubinstein, John L; Durocher, Daniel

    2016-08-01

    DNA double-strand breaks (DSBs) elicit a histone modification cascade that controls DNA repair. This pathway involves the sequential ubiquitination of histones H1 and H2A by the E3 ubiquitin ligases RNF8 and RNF168, respectively. RNF168 ubiquitinates H2A on lysine 13 and lysine 15 (refs 7, 8) (yielding H2AK13ub and H2AK15ub, respectively), an event that triggers the recruitment of 53BP1 (also known as TP53BP1) to chromatin flanking DSBs. 53BP1 binds specifically to H2AK15ub-containing nucleosomes through a peptide segment termed the ubiquitination-dependent recruitment motif (UDR), which requires the simultaneous engagement of histone H4 lysine 20 dimethylation (H4K20me2) by its tandem Tudor domain. How 53BP1 interacts with these two histone marks in the nucleosomal context, how it recognizes ubiquitin, and how it discriminates between H2AK13ub and H2AK15ub is unknown. Here we present the electron cryomicroscopy (cryo-EM) structure of a dimerized human 53BP1 fragment bound to a H4K20me2-containing and H2AK15ub-containing nucleosome core particle (NCP-ubme) at 4.5 Å resolution. The structure reveals that H4K20me2 and H2AK15ub recognition involves intimate contacts with multiple nucleosomal elements including the acidic patch. Ubiquitin recognition by 53BP1 is unusual and involves the sandwiching of the UDR segment between ubiquitin and the NCP surface. The selectivity for H2AK15ub is imparted by two arginine fingers in the H2A amino-terminal tail, which straddle the nucleosomal DNA and serve to position ubiquitin over the NCP-bound UDR segment. The structure of the complex between NCP-ubme and 53BP1 reveals the basis of 53BP1 recruitment to DSB sites and illuminates how combinations of histone marks and nucleosomal elements cooperate to produce highly specific chromatin responses, such as those elicited following chromosome breaks. PMID:27462807

  19. NotCal04 - Comparison / Calibration 14C records 26-50 cal kBP

    SciTech Connect

    der Plicht, J v; Beck, J; Bard, E; Baille, M

    2004-11-11

    The radiocarbon calibration curve, IntCal04, extends back to 26 cal kBP. While several high resolution records exist beyond this limit, these data sets exhibit discrepancies one to another of up to several millennia. As a result, no calibration curve for the time range 26-50 cal kBP can be recommended as yet, but in this paper the IntCal04 working group compares the available data sets and offers a discussion of the information that they hold.

  20. Mitochondrial intergenic COII/tRNA(Lys) 9-bp deletion, a biomarker for hepatocellular carcinoma?

    PubMed

    Ren, Weihua; Li, Yawei; Li, Rui; Feng, Hongbo; Wu, Shuangting; Mao, Yuhui; Huang, Lei

    2016-07-01

    The COII/tRNA(Lys) intergenic 9-bp deletion is one of the most commonly studied human mitochondrial DNA (mtDNA) polymorphisms. It consists of the loss of one of two tandemly repeated copies of the sequence CCCCCTCTA from a non-coding region located between cytochrome oxidase II (COII) and tRNA(Lys) gene. Most recently, case-control studies have shown a positive association between this deletion with hepatocellular cancer. In this study, we first performed a detailed analysis between this deletion and clinical diseases; moreover, we took the phylogenetic approach to examine the pathogenicity status of 9-bp deletion. PMID:26017042