Science.gov

Sample records for acid bacterial species

  1. Comparative Study of Bacterial Communities in Nepenthes Pitchers and Their Correlation to Species and Fluid Acidity.

    PubMed

    Kanokratana, Pattanop; Mhuanthong, Wuttichai; Laothanachareon, Thanaporn; Tangphatsornruang, Sithichoke; Eurwilaichitr, Lily; Kruetreepradit, Trongtham; Mayes, Shawn; Champreda, Verawat

    2016-08-01

    Pitchers are specialized digestive organs of carnivorous plants which evolved for trapping prey and represent a unique environment harboring hidden diversity of unexplored microbes forming transient hydrolytic microcosms. In this study, the diversity of bacterial communities in the pitcher fluids of seven local Nepenthes found in Thailand was assessed by tagged 16S ribosomal RNA (rRNA) gene amplicon sequencing on an Ion PGM™ platform. A total of 1,101,000 filtered sequences were obtained which were taxonomically classified into 20 phyla, 48 classes, 72 orders, 153 families, and 442 genera while the remainder (1.43 %) could not be assigned to any existing taxa. Proteobacteria represented the predominant members in closed pitchers and more diversified bacterial taxa particularly Bacteriodetes and Actinobacteria, showed increasing abundance in open pitchers containing insect bodies. Principal coordinate analysis revealed that distribution of bacterial taxa was not significantly related to the Nepenthes species but strongly correlated to the pH of the pitcher fluids (pH 1.7-6.7). Acidicella was a highly dominant bacterial genus in acidic pitcher fluids while Dyella and Mycobacterium were also common genera in most pitchers. A unique microbial community structure was found in Nepenthes ampullaria which could reflect their adaptation to digest leaf litter, in addition to insect prey. The work revealed the highly unexplored nature of bacterial microcosms in Nepenthes pitcher fluids and provides insights into their community structure in this unique ecological system. PMID:27287538

  2. Peracetic Acid Treatment Generates Potent Inactivated Oral Vaccines from a Broad Range of Culturable Bacterial Species

    PubMed Central

    Moor, Kathrin; Wotzka, Sandra Y.; Toska, Albulena; Diard, Médéric; Hapfelmeier, Siegfried; Slack, Emma

    2016-01-01

    Our mucosal surfaces are the main sites of non-vector-borne pathogen entry, as well as the main interface with our commensal microbiota. We are still only beginning to understand how mucosal adaptive immunity interacts with commensal and pathogenic microbes to influence factors such as infectivity, phenotypic diversity, and within-host evolution. This is in part due to difficulties in generating specific mucosal adaptive immune responses without disrupting the mucosal microbial ecosystem itself. Here, we present a very simple tool to generate inactivated mucosal vaccines from a broad range of culturable bacteria. Oral gavage of 1010 peracetic acid-inactivated bacteria induces high-titer-specific intestinal IgA in the absence of any measurable inflammation or species invasion. As a proof of principle, we demonstrate that this technique is sufficient to provide fully protective immunity in the murine model of invasive non-typhoidal Salmonellosis, even in the face of severe innate immune deficiency. PMID:26904024

  3. Peracetic Acid Treatment Generates Potent Inactivated Oral Vaccines from a Broad Range of Culturable Bacterial Species.

    PubMed

    Moor, Kathrin; Wotzka, Sandra Y; Toska, Albulena; Diard, Médéric; Hapfelmeier, Siegfried; Slack, Emma

    2016-01-01

    Our mucosal surfaces are the main sites of non-vector-borne pathogen entry, as well as the main interface with our commensal microbiota. We are still only beginning to understand how mucosal adaptive immunity interacts with commensal and pathogenic microbes to influence factors such as infectivity, phenotypic diversity, and within-host evolution. This is in part due to difficulties in generating specific mucosal adaptive immune responses without disrupting the mucosal microbial ecosystem itself. Here, we present a very simple tool to generate inactivated mucosal vaccines from a broad range of culturable bacteria. Oral gavage of 10(10) peracetic acid-inactivated bacteria induces high-titer-specific intestinal IgA in the absence of any measurable inflammation or species invasion. As a proof of principle, we demonstrate that this technique is sufficient to provide fully protective immunity in the murine model of invasive non-typhoidal Salmonellosis, even in the face of severe innate immune deficiency. PMID:26904024

  4. Bacterial responses to reactive chlorine species.

    PubMed

    Gray, Michael J; Wholey, Wei-Yun; Jakob, Ursula

    2013-01-01

    Hypochlorous acid (HOCl), the active ingredient of household bleach, is the most common disinfectant in medical, industrial, and domestic use and plays an important role in microbial killing in the innate immune system. Given the critical importance of the antimicrobial properties of chlorine to public health, it is surprising how little is known about the ways in which bacteria sense and respond to reactive chlorine species (RCS). Although the literature on bacterial responses to reactive oxygen species (ROS) is enormous, work addressing bacterial responses to RCS has begun only recently. Transcriptomic and proteomic studies now provide new insights into how bacteria mount defenses against this important class of antimicrobial compounds. In this review, we summarize the current knowledge, emphasizing the overlaps between RCS stress responses and other more well-characterized bacterial defense systems, and identify outstanding questions that represent productive avenues for future research. PMID:23768204

  5. The enteric bacterial metabolite propionic acid alters brain and plasma phospholipid molecular species: further development of a rodent model of autism spectrum disorders

    PubMed Central

    2012-01-01

    Gastrointestinal symptoms and altered blood phospholipid profiles have been reported in patients with autism spectrum disorders (ASD). Most of the phospholipid analyses have been conducted on the fatty acid composition of isolated phospholipid classes following hydrolysis. A paucity of information exists on how the intact phospholipid molecular species are altered in ASD. We applied ESI/MS to determine how brain and blood intact phospholipid species were altered during the induction of ASD-like behaviors in rats following intraventricular infusions with the enteric bacterial metabolite propionic acid. Animals were infused daily for 8 days, locomotor activity assessed, and animals killed during the induced behaviors. Propionic acid infusions increased locomotor activity. Lipid analysis revealed treatment altered 21 brain and 30 blood phospholipid molecular species. Notable alterations were observed in the composition of brain SM, diacyl mono and polyunsaturated PC, PI, PS, PE, and plasmalogen PC and PE molecular species. These alterations suggest that the propionic acid rat model is a useful tool to study aberrations in lipid metabolism known to affect membrane fluidity, peroxisomal function, gap junction coupling capacity, signaling, and neuroinflammation, all of which may be associated with the pathogenesis of ASD. PMID:22747852

  6. BACTERIAL OXIDATION OF DIPICOLINIC ACID

    PubMed Central

    Kobayashi, Yasuo; Arima, Kei

    1962-01-01

    Kobayashi, Yasuo (University of Tokyo, Tokyo, Japan) and Kei Arima. Bacterial oxidation of dipicolinic acid. II. Identification of α-ketoglutaric acid and 3-hydroxydipicolinic acid and some properties of cell-free extracts. J. Bacteriol. 84:765–771. 1962—When a dipicolinic acid (DPA)-decomposing bacterium, Achromobacter strain 1–2, was incubated at 30 C with shaking in a DPA solution containing 10−3m arsenite, a keto acid was accumulated. The 2,4-dinitrophenylhydrazone of this acid was synthesized and identified as α-ketoglutaric acid by paper chromatography, visible absorption spectrum, infrared analysis, elemental analysis, and mixed melting point. During this incubation, oxalic acid equivalent to the consumed dipicolinic acid was produced. A fluorescent material was also isolated from culture fluid and identified as 3-hydroxydipicolinic acid by paper chromatography and the ultraviolet absorption spectrum. Further, cell-free extracts were prepared by sonic oscillation. Ferrous ion and a reduced di- or triphosphopyridine nucleotide-generating system were proven to be required for enzymic oxidation of DPA. And 3-hydroxydipicolinic acid was also oxidized by this preparation. From the results obtained, a possible metabolic pathway of dipicolinic acid was proposed. PMID:14033954

  7. Quantification of Bacterial Fatty Acids by Extraction and Methylation

    PubMed Central

    Politz, Mark; Lennen, Rebecca; Pfleger, Brian

    2016-01-01

    This protocol describes two similar methods for the extraction and methylation of fatty acids from bacterial cultures. The acid derivatization protocol (Lennen et al., 2013; Bligh and Dyer, 1959) results in the extraction and methylation of all fatty acids, both free and bound, from a bacterial culture, while the base derivatization protocol (Lennen and Pfleger, 2013) captures only bound (phospholipid, acyl-thioester) species. After extraction into hexane, the lipids may be analyzed by gas chromatography.

  8. Evidence of novel plant-species specific ammonia oxidizing bacterial clades in acidic South African fynbos soils.

    PubMed

    Ramond, Jean-Baptiste; Lako, Joseph D W; Stafford, William H L; Tuffin, Marla I; Cowan, Don A

    2015-08-01

    Ammonia-oxidizing bacteria (AOB) are essential in the biogeochemical cycling of nitrogen as they catalyze the rate-limiting oxidation of ammonia into nitrite. Since their first isolation in the late 19th century, chemolithoautotrophic AOBs have been identified in a wide range of natural (e.g., soils, sediments, estuarine, and freshwaters) and man created or impacted habitats (e.g., wastewater treatment plants and agricultural soils). However, little is known on the plant-species association of AOBs, particularly in the nutrient-starved fynbos terrestrial biome. In this study, we evaluated the diversity of AOBs in the plant canopy of three South African fynbos-specific plant species, namely Leucadendron xanthoconus, Leucospermum truncatulum and Leucadendron microcephalum, through the construction of amoA-gene clone libraries. Our results clearly demonstrate that plant-species specific and monophyletic AOB clades are present in fynbos canopy soils. PMID:25721729

  9. Eradication of bacterial species via photosensitization

    NASA Astrophysics Data System (ADS)

    Golding, Paul S.; Maddocks, L.; King, Terence A.; Drucker, D. B.

    1999-02-01

    Photosensitization and inactivation efficacy of three bacterial species: Prevotella nigrescens, Staphylococcus aureus and Escherichia coli have been investigated. Samples of Staphylococcus aureus and Escherichia coli were treated with the triphenylmethane dye malachite green isothiocyanate and exposed to light from a variety of continuous and pulsed light sauces at a wavelength of approximately 630 nm. Inactivation of the Gram-positive species Staphylococcus aureus was found to increase with radiation dose, whilst Gram-negative Escherichia coli was resistant to such treatment. Samples of the pigmented species Prevotella nigrescens were found to be inactivated by exposure to light alone. The mechanism of photosensitization and inactivation of Staphylococcus aureus with malachite green isothiocyanate is addressed. The possible roles of the excited triplet state of the photosensitizer, the involvement of molecular oxygen, and the bacterial cell wall are discussed. Photosensitization may provide a way of eliminating naturally pigmented species responsible for a variety of infections, including oral diseases such as gingivitis and periodontitis.

  10. Identification and ecology of bacterial communities associated with necroses of three cactus species.

    PubMed

    Foster, J L; Fogleman, J C

    1993-01-01

    To compare the bacterial communities residing in necrotic tissues of columnar cacti of the Sonoran Desert, isolates from 39 organ pipe, 19 saguaro, and 16 senita cacti were obtained. The isolates were clustered into 28 conspecific groups on the basis of their fatty acid profiles. The distributions of the individual bacterial isolates varied among cactus species. Seven of the 28 species groups were unique to a particular cactus species, whereas 8 species groups were found in all three cacti. The effective number of bacterial species for each cactus species was positively correlated with both the chemical complexity and glucose concentration of the plant tissues. The effective number of bacterial species and bacterial distribution patterns were compared with those known for communities of cactophilic yeasts. The observed bacterial distribution patterns are most likely due to differences in the chemical compositions of the three cactus species. PMID:8439142

  11. Bacterial Community Diversity Harboured by Interacting Species.

    PubMed

    Bili, Mikaël; Cortesero, Anne Marie; Mougel, Christophe; Gauthier, Jean Pierre; Ermel, Gwennola; Simon, Jean Christophe; Outreman, Yannick; Terrat, Sébastien; Mahéo, Frédérique; Poinsot, Denis

    2016-01-01

    All animals are infected by microbial partners that can be passengers or residents and influence many biological traits of their hosts. Even if important factors that structure the composition and abundance of microbial communities within and among host individuals have been recently described, such as diet, developmental stage or phylogeny, few studies have conducted cross-taxonomic comparisons, especially on host species related by trophic relationships. Here, we describe and compare the microbial communities associated with the cabbage root fly Delia radicum and its three major parasitoids: the two staphylinid beetles Aleochara bilineata and A. bipustulata and the hymenopteran parasitoid Trybliographa rapae. For each species, two populations from Western France were sampled and microbial communities were described through culture independent methods (454 pyrosequencing). Each sample harbored at least 59 to 261 different bacterial phylotypes but was strongly dominated by one or two. Microbial communities differed markedly in terms of composition and abundance, being mainly influenced by phylogenetic proximity but also geography to a minor extent. Surprisingly, despite their strong trophic interaction, parasitoids shared a very low proportion of microbial partners with their insect host. Three vertically transmitted symbionts from the genus Wolbachia, Rickettsia, and Spiroplasma were found in this study. Among them, Wolbachia and Spiroplasma were found in both the cabbage fly and at least one of its parasitoids, which could result from horizontal transfers through trophic interactions. Phylogenetic analysis showed that this hypothesis may explain some but not all cases. More work is needed to understand the dynamics of symbiotic associations within trophic network and the effect of these bacterial communities on the fitness of their hosts. PMID:27258532

  12. Bacterial Community Diversity Harboured by Interacting Species

    PubMed Central

    Bili, Mikaël; Cortesero, Anne Marie; Mougel, Christophe; Gauthier, Jean Pierre; Ermel, Gwennola; Simon, Jean Christophe; Outreman, Yannick; Terrat, Sébastien; Mahéo, Frédérique; Poinsot, Denis

    2016-01-01

    All animals are infected by microbial partners that can be passengers or residents and influence many biological traits of their hosts. Even if important factors that structure the composition and abundance of microbial communities within and among host individuals have been recently described, such as diet, developmental stage or phylogeny, few studies have conducted cross-taxonomic comparisons, especially on host species related by trophic relationships. Here, we describe and compare the microbial communities associated with the cabbage root fly Delia radicum and its three major parasitoids: the two staphylinid beetles Aleochara bilineata and A. bipustulata and the hymenopteran parasitoid Trybliographa rapae. For each species, two populations from Western France were sampled and microbial communities were described through culture independent methods (454 pyrosequencing). Each sample harbored at least 59 to 261 different bacterial phylotypes but was strongly dominated by one or two. Microbial communities differed markedly in terms of composition and abundance, being mainly influenced by phylogenetic proximity but also geography to a minor extent. Surprisingly, despite their strong trophic interaction, parasitoids shared a very low proportion of microbial partners with their insect host. Three vertically transmitted symbionts from the genus Wolbachia, Rickettsia, and Spiroplasma were found in this study. Among them, Wolbachia and Spiroplasma were found in both the cabbage fly and at least one of its parasitoids, which could result from horizontal transfers through trophic interactions. Phylogenetic analysis showed that this hypothesis may explain some but not all cases. More work is needed to understand the dynamics of symbiotic associations within trophic network and the effect of these bacterial communities on the fitness of their hosts. PMID:27258532

  13. Bacterial Lipoteichoic Acid Enhances Cryosurvival

    PubMed Central

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Scull, Erin; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2015-01-01

    Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. We show that lipoteichoic acid (LTA), a biopolymer in the cell wall of Gram-positive bacteria, can be added to B. subtilis cultures and increase freeze tolerance. At 1% w/v, LTA enables a 50% survival rate, similar to the results obtained with 1% w/v glycerol as measured with the resazurin cell viability assay. In the absence of added LTA or glycerol, a very small number of B. subtilis cells survive freezing. This suggests that an innate freeze tolerance mechanism exists. While cryoprotection can be provided by extracellular polymeric substances (EPS), our data demonstrate a role for LTA in cryoprotection. Currently, the exact mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. However, low temperature microscopy data show small ice crystals aligned along channels of liquid water. Our observations suggest that teichoic acids could protect liquid water within biofilms and planktonic bacteria, augmenting the role of brine while also raising the possibility for survival without brine present. PMID:25477208

  14. Bacterial communities in the phylloplane of Prunus species.

    PubMed

    Jo, Yeonhwa; Cho, Jin Kyong; Choi, Hoseong; Chu, Hyosub; Lian, Sen; Cho, Won Kyong

    2015-04-01

    Bacterial populations in the phylloplane of four different Prunus species were investigated by 16 S rRNA pyrosequencing. Bioinformatic analysis identified an average of 510 operational taxonomic units belonging to 159 genera in 76 families. The two genera, Sphingomonas and Methylobacterium, were dominant in the phylloplane of four Prunus species. Twenty three genera were commonly identified in the four Prunus species, indicating a high level of bacterial diversity dependent on the plant species. Our study based on 16 S rRNA sequencing reveals the complexity of bacterial diversity in the phylloplane of Prunus species in detail. PMID:25515303

  15. Bacterial Cyanuric Acid Hydrolase for Water Treatment.

    PubMed

    Yeom, Sujin; Mutlu, Baris R; Aksan, Alptekin; Wackett, Lawrence P

    2015-10-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  16. Bacterial Cyanuric Acid Hydrolase for Water Treatment

    PubMed Central

    Yeom, Sujin; Mutlu, Baris R.; Aksan, Alptekin

    2015-01-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  17. Defining Pathogenic Bacterial Species in the Genomic Era

    PubMed Central

    Georgiades, Kalliopi; Raoult, Didier

    2011-01-01

    Actual definitions of bacterial species are limited due to the current criteria of definition and the use of restrictive genetic tools. The 16S ribosomal RNA sequence, for example, has been widely used as a marker for phylogenetic analyses; however, its use often leads to misleading species definitions. According to the first genetic studies, removing a certain number of genes from pathogenic bacteria removes their capacity to infect hosts. However, more recent studies have demonstrated that the specialization of bacteria in eukaryotic cells is associated with massive gene loss, especially for allopatric endosymbionts that have been isolated for a long time in an intracellular niche. Indeed, sympatric free-living bacteria often have bigger genomes and exhibit greater resistance and plasticity and constitute species complexes rather than true species. Specialists, such as pathogenic bacteria, escape these bacterial complexes and colonize a niche, thereby gaining a species name. Their specialization allows them to become allopatric, and their gene losses eventually favor reductive genome evolution. A pathogenic species is characterized by a gene repertoire that is defined not only by genes that are present but also by those that are lacking. It is likely that current bacterial pathogens will disappear soon and be replaced by new ones that will emerge from bacterial complexes that are already in contact with humans. PMID:21687765

  18. Penicillin amidohydrolase productivity of locally isolated bacterial species.

    PubMed

    Mahmood, Z A; Shaikh, D; Zoha, S M

    1991-01-01

    Penicillin amidohydrolase productivity of four locally isolated bacterial species is described. Organisms were identified as Escherichia coli, Pseudomonas aeruginosa, Sarcina lutea and Bacillus megaterium. Highest enzyme productivity of 3.2 U/mL with a corresponding dry cell mass of 4.5 g/L was recorded from S. lutea. PMID:1821869

  19. Interactions between Lactobacillus crispatus and bacterial vaginosis (BV)-associated bacterial species in initial attachment and biofilm formation.

    PubMed

    Machado, António; Jefferson, Kimberly Kay; Cerca, Nuno

    2013-01-01

    Certain anaerobic bacterial species tend to predominate the vaginal flora during bacterial vaginosis (BV), with Gardnerella vaginalis being the most common. However, the exact role of G. vaginalis in BV has not yet been determined. The main goal of this study was to test the hypothesis that G. vaginalis is an early colonizer, paving the way for intermediate (e.g., Fusobacterium nucleatum) and late colonizers (e.g., Prevotella bivia). Theoretically, in order to function as an early colonizer, species would need to be able to adhere to vaginal epithelium, even in the presence of vaginal lactobacilli. Therefore, we quantified adherence of G. vaginalis and other BV-associated bacteria to an inert surface pre-coated with Lactobacillus crispatus using a new Peptide Nucleic Acid (PNA) Fluorescence In Situ Hybridization (FISH) methodology. We found that G. vaginalis had the greatest capacity to adhere in the presence of L. crispatus. Theoretically, an early colonizer would contribute to the adherence and/or growth of additional species, so we next quantified the effect of G. vaginalis biofilms on the adherence and growth of other BV-associated species by quantitative Polymerase Chain Reaction (qPCR) technique. Interestingly, G. vaginalis derived a growth benefit from the addition of a second species, regardless of the species. Conversely, G. vaginalis biofilms enhanced the growth of P. bivia, and to a minor extent of F. nucleatum. These results contribute to our understanding of BV biofilm formation and the progression of the disorder. PMID:23739678

  20. Bacterial Decarboxylation of o-Phthalic Acids

    PubMed Central

    Taylor, Barrie F.; Ribbons, Douglas W.

    1983-01-01

    The decarboxylation of phthalic acids was studied with Bacillus sp. strain FO, a marine mixed culture ON-7, and Pseudomonas testosteroni. The mixed culture ON-7, when grown anaerobically on phthalate but incubated aerobically with chloramphenicol, quantitatively converted phthalic acid to benzoic acid. Substituted phthalic acids were also decarboxylated: 4,5-dihydroxyphthalic acid to protocatechuic acid; 4-hydroxyphthalic and 4-chlorophthalic acids to 3-hydroxybenzoic and 3-chlorobenzoic acids, respectively; and 3-fluorophthalic acid to 2-and 3-fluorobenzoic acids. Bacillus sp. strain FO gave similar results except that 4,5-dihydroxyphthalic acid was not metabolized, and both 3- and 4-hydroxybenzoic acids were produced from 4-hydroxyphthalic acid. P. testosteroni decarboxylated 4-hydroxyphthalate (to 3-hydroxybenzoate) and 4,5-dihydroxyphthalate but not phthalic acid and halogenated phthalates. Thus, P. testosteroni and the mixed culture ON-7 possessed 4,5-dihydroxyphthalic acid decarboxylase, previously described in P. testosteroni, that metabolized 4,5-dihydroxyphthalic acid and specifically decarboxylated 4-hydroxyphthalic acid to 3-hydroxybenzoic acid. The mixed culture ON-7 and Bacillus sp. strain FO also possessed a novel decarboxylase that metabolized phthalic acid and halogenated phthalates, but not 4,5-dihydroxyphthalate, and randomly decarboxylated 4-hydroxyphthalic acid. The decarboxylation of phthalic acid is suggested to involve an initial reduction to 1,2-dihydrophthalic acid followed by oxidative decarboxylation to benzoic acid. PMID:16346440

  1. Prevalent bacterial species and novel phylotypes in advanced noma lesions.

    PubMed

    Paster, B J; Falkler Jr, W A; Enwonwu, C O; Idigbe, E O; Savage, K O; Levanos, V A; Tamer, M A; Ericson, R L; Lau, C N; Dewhirst, F E

    2002-06-01

    The purpose of this study was to determine the bacterial diversity in advanced noma lesions using culture-independent molecular methods. 16S ribosomal DNA bacterial genes from DNA isolated from advanced noma lesions of four Nigerian children were PCR amplified with universally conserved primers and spirochetal selective primers and cloned into Escherichia coli. Partial 16S rRNA sequences of approximately 500 bases from 212 cloned inserts were used initially to determine species identity or closest relatives by comparison with sequences of known species or phylotypes. Nearly complete sequences of approximately 1,500 bases were obtained for most of the potentially novel species. A total of 67 bacterial species or phylotypes were detected, 25 of which have not yet been grown in vitro. Nineteen of the species or phylotypes, including Propionibacterium acnes, Staphylococcus spp., and the opportunistic pathogens Stenotrophomonas maltophilia and Ochrobactrum anthropi were detected in more than one subject. Other known species that were detected included Achromobacter spp., Afipia spp., Brevundimonas diminuta, Capnocytophaga spp., Cardiobacterium sp., Eikenella corrodens, Fusobacterium spp., Gemella haemoylsans, and Neisseria spp. Phylotypes that were unique to noma infections included those in the genera Eubacterium, Flavobacterium, Kocuria, Microbacterium, and Porphyromonas and the related Streptococcus salivarius and genera Sphingomonas and TREPONEMA: Since advanced noma lesions are infections open to the environment, it was not surprising to detect species not commonly associated with the oral cavity, e.g., from soil. Several species previously implicated as putative pathogens of noma, such as spirochetes and Fusobacterium spp., were detected in at least one subject. However, due to the limited number of available noma subjects, it was not possible at this time to associate specific species with the disease. PMID:12037085

  2. Attached Bacterial Populations Shared by Four Species of Aquatic Angiosperms▿

    PubMed Central

    Crump, Byron C.; Koch, Evamaria W.

    2008-01-01

    Symbiotic relationships between microbes and plants are common and well studied in terrestrial ecosystems, but little is known about such relationships in aquatic environments. We compared the phylogenetic diversities of leaf- and root-attached bacteria from four species of aquatic angiosperms using denaturing gradient gel electrophoresis (DGGE) and DNA sequencing of PCR-amplified 16S rRNA genes. Plants were collected from three beds in Chesapeake Bay at sites characterized as freshwater (Vallisneria americana), brackish (Potomogeton perfoliatus and Stuckenia pectinata), and marine (Zostera marina). DGGE analyses showed that bacterial communities were very similar for replicate samples of leaves from canopy-forming plants S. pectinata and P. perfoliatus and less similar for replicate samples of leaves from meadow-forming plants Z. marina and V. americana and of roots of all species. In contrast, bacterial communities differed greatly among plant species and between leaves and roots. DNA sequencing identified 154 bacterial phylotypes, most of which were restricted to single plant species. However, 12 phylotypes were found on more than one plant species, and several of these phylotypes were abundant in clone libraries and represented the darkest bands in DGGE banding patterns. Root-attached phylotypes included relatives of sulfur-oxidizing Gammaproteobacteria and sulfate-reducing Deltaproteobacteria. Leaf-attached phylotypes included relatives of polymer-degrading Bacteroidetes and phototrophic Alphaproteobacteria. Also, leaves and roots of three plant species hosted relatives of methylotrophic Betaproteobacteria belonging to the family Methylophilaceae. These results suggest that aquatic angiosperms host specialized communities of bacteria on their surfaces, including several broadly distributed and potentially mutualistic bacterial populations. PMID:18676705

  3. Panamanian frog species host unique skin bacterial communities

    PubMed Central

    Belden, Lisa K.; Hughey, Myra C.; Rebollar, Eria A.; Umile, Thomas P.; Loftus, Stephen C.; Burzynski, Elizabeth A.; Minbiole, Kevin P. C.; House, Leanna L.; Jensen, Roderick V.; Becker, Matthew H.; Walke, Jenifer B.; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N.

    2015-01-01

    Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont

  4. Panamanian frog species host unique skin bacterial communities.

    PubMed

    Belden, Lisa K; Hughey, Myra C; Rebollar, Eria A; Umile, Thomas P; Loftus, Stephen C; Burzynski, Elizabeth A; Minbiole, Kevin P C; House, Leanna L; Jensen, Roderick V; Becker, Matthew H; Walke, Jenifer B; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N

    2015-01-01

    Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont

  5. The bacterial species dilemma and the genomic–phylogenetic species concept

    PubMed Central

    Staley, James T

    2006-01-01

    The number of species of Bacteria and Archaea (ca 5000) is surprisingly small considering their early evolution, genetic diversity and residence in all ecosystems. The bacterial species definition accounts in part for the small number of named species. The primary procedures required to identify new species of Bacteria and Archaea are DNA–DNA hybridization and phenotypic characterization. Recently, 16S rRNA gene sequencing and phylogenetic analysis have been applied to bacterial taxonomy. Although 16S phylogeny is arguably excellent for classification of Bacteria and Archaea from the Domain level down to the family or genus, it lacks resolution below that level. Newer approaches, including multilocus sequence analysis, and genome sequence and microarray analyses, promise to provide necessary information to better understand bacterial speciation. Indeed, recent data using these approaches, while meagre, support the view that speciation processes may occur at the subspecies level within ecological niches (ecovars) and owing to biogeography (geovars). A major dilemma for bacterial taxonomists is how to incorporate this new information into the present hierarchical system for classification of Bacteria and Archaea without causing undesirable confusion and contention. This author proposes the genomic–phylogenetic species concept (GPSC) for the taxonomy of prokaryotes. The aim is twofold. First, the GPSC would provide a conceptual and testable framework for bacterial taxonomy. Second, the GPSC would replace the burdensome requirement for DNA hybridization presently needed to describe new species. Furthermore, the GPSC is consistent with the present treatment at higher taxonomic levels. PMID:17062409

  6. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  7. Cutaneous bacterial species from Lithobates catesbeianus can inhibit pathogenic dermatophytes.

    PubMed

    Lauer, Antje; Hernandez, Trang

    2015-04-01

    Antibiotics are being successfully used to fight many infectious diseases caused by pathogenic microorganisms. However, new infectious diseases are continuously being identified, and some known pathogens are becoming resistant against known antibiotics. Furthermore, many antifungals are causing serious side effects in long-term treatments of patients, and many skin infections caused by dermatophytes are difficult to cure. The beneficial roles of resident cutaneous microbiota to inhibit pathogenic microorganisms have been shown for many vertebrate species. Microbial symbionts on the amphibian skin for example can be a source of powerful antimicrobial metabolites that can protect amphibians against diseases, such as chytridiomycosis, caused by a fungal pathogen. In this research, we investigated whether cutaneous bacterial species isolated from Lithobates catesbeianus (North American bullfrog), an invasive amphibian species that is resistant to chytridiomycosis, produce secondary metabolites that can be used to inhibit the growth of three species of dermatophytes (Microsporum gypseum, Epidermophyton floccosum, and Trichophyton mentagrophytes) which are known to cause topical or subdermal skin infections in humans. Strongly anti-dermatophyte bacterial species that belonged to the Bacillaceae, Streptomycetaceae, Pseudomonadaceae, Xanthomonadaceae, Aeromonadaceae, and Enterobacteriaceae were identified. This research has provided evidence of the presence of cutaneous anti-dermatophyte bacteria from L. catesbeianus which might provide a basis for health care providers to experiment with new antifungals in the future. PMID:25431089

  8. The bacterial species definition in the genomic era

    PubMed Central

    Konstantinidis, Konstantinos T; Ramette, Alban; Tiedje, James M

    2006-01-01

    The bacterial species definition, despite its eminent practical significance for identification, diagnosis, quarantine and diversity surveys, remains a very difficult issue to advance. Genomics now offers novel insights into intra-species diversity and the potential for emergence of a more soundly based system. Although we share the excitement, we argue that it is premature for a universal change to the definition because current knowledge is based on too few phylogenetic groups and too few samples of natural populations. Our analysis of five important bacterial groups suggests, however, that more stringent standards for species may be justifiable when a solid understanding of gene content and ecological distinctiveness becomes available. Our analysis also reveals what is actually encompassed in a species according to the current standards, in terms of whole-genome sequence and gene-content diversity, and shows that this does not correspond to coherent clusters for the environmental Burkholderia and Shewanella genera examined. In contrast, the obligatory pathogens, which have a very restricted ecological niche, do exhibit clusters. Therefore, the idea of biologically meaningful clusters of diversity that applies to most eukaryotes may not be universally applicable in the microbial world, or if such clusters exist, they may be found at different levels of distinction. PMID:17062412

  9. Lethal effect of butylated hydroxyanisole as related to bacterial fatty acid composition.

    PubMed

    Post, L S; Davidson, P M

    1986-07-01

    Bacillus cereus, Clostridium perfringens, Staphylococcus aureus, Pseudomonas fluorescens, Pseudomonas fragi, Escherichia coli, and Salmonella "anatum" were challenged with butylated hydroxyanisole (BHA). Susceptibility was measured as the concentration of BHA required to cause a 90% reduction in bacterial survivors. Staphylococcus aureus LP and P. fragi were two of the most resistant species examined; C. perfringens and P. fluorescens were the most susceptible. Gram stain reaction was found not to be a strict indicator of bacterial susceptibility to BHA. There was no obvious relationship between individual fatty acids and susceptibility. The ratio of saturated to unsaturated fatty acids in the total lipid fraction of only the gram-positive species was related to susceptibility. The ratios of saturated to unsaturated fatty acids of other fractions were not related to susceptibility. PMID:2873790

  10. Influence of Root Exudates on the Bacterial Degradation of Chlorobenzoic Acids

    PubMed Central

    Lovecká, Petra; Dražková, Milena; Macková, Martina; Macek, Tomas

    2013-01-01

    Degradation of chlorobenzoic acids (e.g., products of microbial degradation of PCB) by strains of microorganisms isolated from PCB contaminated soils was assessed. From seven bulk-soil isolates two strains unique in ability to degrade a wider range of chlorobenzoic acids than others were selected, individually and even in a complex mixture of 11 different chlorobenzoic acids. Such a feature is lacking in most tested degraders. To investigate the influence of vegetation on chlorobenzoic acids degraders, root exudates of two plant species known for supporting PCB degradation in soil were tested. While with individual chlorobenzoic acids the presence of plant exudates leads to a decrease of degradation yield, in case of a mixture of chlorobenzoic acids either a change in bacterial degradation specificity, associated with 3- and 4-chlorobenzoic acid, or an extension of the spectrum of degraded chlorobenzoic acids was observed. PMID:24222753

  11. Patterns of Gut Bacterial Colonization in Three Primate Species

    PubMed Central

    McKenney, Erin A.; Rodrigo, Allen; Yoder, Anne D.

    2015-01-01

    Host fitness is impacted by trillions of bacteria in the gastrointestinal tract that facilitate development and are inextricably tied to life history. During development, microbial colonization primes the gut metabolism and physiology, thereby setting the stage for adult nutrition and health. However, the ecological rules governing microbial succession are poorly understood. In this study, we examined the relationship between host lineage, captive diet, and life stage and gut microbiota characteristics in three primate species (infraorder, Lemuriformes). Fecal samples were collected from captive lemur mothers and their infants, from birth to weaning. Microbial DNA was extracted and the v4 region of 16S rDNA was sequenced on the Illumina platform using protocols from the Earth Microbiome Project. Here, we show that colonization proceeds along different successional trajectories in developing infants from species with differing dietary regimes and ecological profiles: frugivorous (fruit-eating) Varecia variegata, generalist Lemur catta, and folivorous (leaf-eating) Propithecus coquereli. Our analyses reveal community membership and succession patterns consistent with previous studies of human infants, suggesting that lemurs may serve as a useful model of microbial ecology in the primate gut. Each lemur species exhibits distinct species-specific bacterial diversity signatures correlating to life stages and life history traits, implying that gut microbial community assembly primes developing infants at species-specific rates for their respective adult feeding strategies. PMID:25970595

  12. Citramalic acid in cerebrospinal fluid of patients with bacterial meningitis.

    PubMed

    Perlman, S; Carr, S A

    1984-07-01

    Cerebrospinal fluid (CSF) from uninfected patients and from patients with bacterial and viral meningitis was analyzed by gas-liquid chromatography, with use of a flame ionization detector, and by gas chromatography-mass spectrometry. The resulting profiles were consistent and reproducible. Hydroxy acids were the compounds found in greatest abundance in both normal and infected CSF. Control experiments to establish the sensitivity and efficiency of the extraction and derivatization methods are also presented. Constituents of CSF from patients with bacterial meningitis differed quantitatively and qualitatively from those of CSF from uninfected patients or patients with nonbacterial infections. CSF from seven of eight patients with bacterial meningitis contained citramalic acid, a compound not previously identified in either normal or infected CSF. The implications of these findings are discussed. PMID:6145530

  13. Amino Acid-Based Zwitterionic Polymer Surfaces Highly Resist Long-Term Bacterial Adhesion.

    PubMed

    Liu, Qingsheng; Li, Wenchen; Wang, Hua; Newby, Bi-Min Zhang; Cheng, Fang; Liu, Lingyun

    2016-08-01

    The surfaces or coatings that can effectively suppress bacterial adhesion in the long term are of critical importance for biomedical applications. Herein, a group of amino acid-based zwitterionic polymers (pAAZ) were investigated for their long-term resistance to bacterial adhesion. The polymers were derived from natural amino acids including serine, ornithine, lysine, aspartic acid, and glutamic acid. The pAAZ brushes were grafted on gold via the surface-initiated photoiniferter-mediated polymerization (SI-PIMP). Results show that the pAAZ coatings highly suppressed adsorption from the undiluted human serum and plasma. Long-term bacterial adhesion on these surfaces was investigated, using two kinds of representative bacteria [Gram-positive Staphylococcus epidermidis and Gram-negative Pseudomonas aeruginosa] as the model species. Results demonstrate that the pAAZ surfaces were highly resistant to bacterial adhesion after culturing for 1, 5, 9, or even 14 days, representing at least 95% reduction at all time points compared to the control unmodified surfaces. The bacterial accumulation on the pAAZ surfaces after 9 or 14 days was even lower than on the surfaces grafted with poly[poly(ethyl glycol) methyl ether methacrylate] (pPEGMA), one of the most common antifouling materials known to date. The pAAZ brushes also exhibited excellent structural stability in phosphate-buffered saline after incubation for 4 weeks. The bacterial resistance and stability of pAAZ polymers suggest they have good potential to be used for those applications where long-term suppression to bacterial attachment is desired. PMID:27397718

  14. Bacterial Communities of Two Ubiquitous Great Barrier Reef Corals Reveals Both Site- and Species-Specificity of Common Bacterial Associates

    PubMed Central

    Kvennefors, E. Charlotte E.; Sampayo, Eugenia; Ridgway, Tyrone; Barnes, Andrew C.; Hoegh-Guldberg, Ove

    2010-01-01

    Background Coral-associated bacteria are increasingly considered to be important in coral health, and altered bacterial community structures have been linked to both coral disease and bleaching. Despite this, assessments of bacterial communities on corals rarely apply sufficient replication to adequately describe the natural variability. Replicated data such as these are crucial in determining potential roles of bacteria on coral. Methodology/Principal Findings Denaturing Gradient Gel Electrophoresis (DGGE) of the V3 region of the 16S ribosomal DNA was used in a highly replicated approach to analyse bacterial communities on both healthy and diseased corals. Although site-specific variations in the bacterial communities of healthy corals were present, host species-specific bacterial associates within a distinct cluster of gamma-proteobacteria could be identified, which are potentially linked to coral health. Corals affected by “White Syndrome” (WS) underwent pronounced changes in their bacterial communities in comparison to healthy colonies. However, the community structure and bacterial ribotypes identified in diseased corals did not support the previously suggested theory of a bacterial pathogen as the causative agent of the syndrome. Conclusions/Significance This is the first study to employ large numbers of replicated samples to assess the bacterial communities of healthy and diseased corals, and the first culture-independent assessment of bacterial communities on WS affected Acroporid corals on the GBR. Results indicate that a minimum of 6 replicate samples are required in order to draw inferences on species, spatial or health-related changes in community composition, as a set of clearly distinct bacterial community profiles exist in healthy corals. Coral bacterial communities may be both site and species specific. Furthermore, a cluster of gamma-proteobacterial ribotypes may represent a group of specific common coral and marine invertebrate associates

  15. Bacterial defluorination of 4-fluoroglutamic acid.

    PubMed

    Donnelly, Clár; Murphy, Cormac D

    2007-12-01

    Fluorinated amino acids are used as enzyme inhibitors, mechanistic probes and in the production of pharmacologically active peptides. Because enantiomerically pure 4-fluoroglutamate is difficult to prepare, the selective degradation of the L-isomer is a potentially convenient method of obtaining D-4-fluoroglutamate from the racemate. In this paper, we describe our investigations on the degradation of 4-fluoroglutamate by bacteria. Fluoride ion was detected in resting-cell cultures of a number of bacteria that were incubated with racemic 4-fluoroglutamate. Analysis of the culture supernatants by chiral gas chromatography-mass spectrometry revealed that only the L-isomer was degraded. The degradation of 4-fluoroglutamate was also examined in cell-free extracts of Streptomyces cattleya and Proteus mirabilis, and it was observed that equimolar concentrations of fluoride ion and ammonia were generated. The activity was located in the soluble fraction of cell extracts, thus is not related to the L-2-amino-4-chloro-4-pentenoic acid dehydrochlorinase previously identified in membrane fractions of P. mirabilis. PMID:17901951

  16. Validation of hierarchical cluster analysis for identification of bacterial species using 42 bacterial isolates

    NASA Astrophysics Data System (ADS)

    Ghebremedhin, Meron; Yesupriya, Shubha; Luka, Janos; Crane, Nicole J.

    2015-03-01

    Recent studies have demonstrated the potential advantages of the use of Raman spectroscopy in the biomedical field due to its rapidity and noninvasive nature. In this study, Raman spectroscopy is applied as a method for differentiating between bacteria isolates for Gram status and Genus species. We created models for identifying 28 bacterial isolates using spectra collected with a 785 nm laser excitation Raman spectroscopic system. In order to investigate the groupings of these samples, partial least squares discriminant analysis (PLSDA) and hierarchical cluster analysis (HCA) was implemented. In addition, cluster analyses of the isolates were performed using various data types consisting of, biochemical tests, gene sequence alignment, high resolution melt (HRM) analysis and antimicrobial susceptibility tests of minimum inhibitory concentration (MIC) and degree of antimicrobial resistance (SIR). In order to evaluate the ability of these models to correctly classify bacterial isolates using solely Raman spectroscopic data, a set of 14 validation samples were tested using the PLSDA models and consequently the HCA models. External cluster evaluation criteria of purity and Rand index were calculated at different taxonomic levels to compare the performance of clustering using Raman spectra as well as the other datasets. Results showed that Raman spectra performed comparably, and in some cases better than, the other data types with Rand index and purity values up to 0.933 and 0.947, respectively. This study clearly demonstrates that the discrimination of bacterial species using Raman spectroscopic data and hierarchical cluster analysis is possible and has the potential to be a powerful point-of-care tool in clinical settings.

  17. Extensive Identification of Bacterial Riboflavin Transporters and Their Distribution across Bacterial Species

    PubMed Central

    Merino, Enrique; Bonomi, Hernán Ruy; Goldbaum, Fernando Alberto; García-Angulo, Víctor Antonio

    2015-01-01

    Riboflavin, the precursor for the cofactors flavin mononucleotide (FMN) and flavin adenine dinucleotide, is an essential metabolite in all organisms. While the functions for de novo riboflavin biosynthesis and riboflavin import may coexist in bacteria, the extent of this co-occurrence is undetermined. The RibM, RibN, RfuABCD and the energy-coupling factor-RibU bacterial riboflavin transporters have been experimentally characterized. In addition, ImpX, RfnT and RibXY are proposed as riboflavin transporters based on positional clustering with riboflavin biosynthetic pathway (RBP) genes or conservation of the FMN riboswitch regulatory element. Here, we searched for the FMN riboswitch in bacterial genomes to identify genes encoding riboflavin transporters and assessed their distribution among bacteria. Two new putative riboflavin transporters were identified: RibZ in Clostridium and RibV in Mesoplasma florum. Trans-complementation of an Escherichia coli riboflavin auxotroph strain confirmed the riboflavin transport activity of RibZ from Clostridium difficile, RibXY from Chloroflexus aurantiacus, ImpX from Fusobacterium nucleatum and RfnT from Ochrobactrum anthropi. The analysis of the genomic distribution of all known bacterial riboflavin transporters revealed that most occur in species possessing the RBP and that some bacteria may even encode functional riboflavin transporters from two different families. Our results indicate that some species possess ancestral riboflavin transporters, while others possess transporters that appear to have evolved recently. Moreover, our data suggest that unidentified riboflavin transporters also exist. The present study doubles the number of experimentally characterized riboflavin transporters and suggests a specific, non-accessory role for these proteins in riboflavin-prototrophic bacteria. PMID:25938806

  18. Periodic Colony Formation by Bacterial Species Bacillus subtilis

    NASA Astrophysics Data System (ADS)

    Wakita, Jun-ichi; Shimada, Hirotoshi; Itoh, Hiroto; Matsuyama, Tohey; Matsushita, Mitsugu

    2001-03-01

    We have investigated the periodic colony growth of bacterial species Bacillus subtilis. A colony grows cyclically with the interface repeating an advance (migration phase) and a rest (consolidation phase) alternately on a surface of semi-solid agar plate under appropriate environmental conditions, resulting in a concentric ring-like colony. It was found from macroscopic observations that the characteristic quantities for the periodic growth such as the migration time, the consolidation time and the terrace spacing do not depend so much on nutrient concentration Cn, but do on agar concentration Ca. The consolidation time was a weakly increasing function of Ca, while the migration time and the terrace spacing were, respectively, weakly and strongly decreasing function of Ca. Overall, the cycle (migration-plus-consolidation) time seems to be constant, and does not depend so much on both Cn and Ca. Microscopically, bacterial cells inside the growing front of a colony keep increasing their population during both migration and consolidation phases. It was also confirmed that their secreting surfactant called surfactin does not affect their periodic growth qualitatively, i.e., mutant cells which cannot secrete surfactin produce a concentric ring-like colony. All these results suggest that the diffusion of the nutrient and the surfactin are irrelevant to their periodic growth.

  19. Species differences in unlocking B-side electron transfer in bacterial reaction centers.

    PubMed

    Dylla, Nicholas P; Faries, Kaitlyn M; Wyllie, Ryan M; Swenson, Angela M; Hanson, Deborah K; Holten, Dewey; Kirmaier, Christine; Laible, Philip D

    2016-08-01

    The structure of the bacterial photosynthetic reaction center (RC) reveals symmetry-related electron transfer (ET) pathways, but only one path is used in native RCs. Analogous mutations have been made in two Rhodobacter (R.) species. A glutamic acid at position 133 in the M subunit increases transmembrane charge separation via the naturally inactive (B-side) path through impacts on primary ET in mutant R. sphaeroidesRCs. Prior work showed that the analogous substitution in the R. capsulatusRC also increases B-side activity, but mainly affects secondary ET. The overall yields of transmembrane ET are similar, but enabled in fundamentally different ways. PMID:27325608

  20. Bacterial Associates of Two Caribbean Coral Species Reveal Species-Specific Distribution and Geographic Variability

    PubMed Central

    Moss, Anthony G.; Chadwick, Nanette E.; Liles, Mark R.

    2012-01-01

    Scleractinian corals harbor microorganisms that form dynamic associations with the coral host and exhibit substantial genetic and ecological diversity. Microbial associates may provide defense against pathogens and serve as bioindicators of changing environmental conditions. Here we describe the bacterial assemblages associated with two of the most common and phylogenetically divergent reef-building corals in the Caribbean, Montastraea faveolata and Porites astreoides. Contrasting life history strategies and disease susceptibilities indicate potential differences in their microbiota and immune function that may in part drive changes in the composition of coral reef communities. The ribotype structure and diversity of coral-associated bacteria within the surface mucosal layer (SML) of healthy corals were assessed using denaturing gradient gel electrophoresis (DGGE) fingerprinting and 454 bar-coded pyrosequencing. Corals were sampled at disparate Caribbean locations representing various levels of anthropogenic impact. We demonstrate here that M. faveolata and P. astreoides harbor distinct, host-specific bacteria but that specificity varies by species and site. P. astreoides generally hosts a bacterial assemblage of low diversity that is largely dominated by one bacterial genus, Endozoicomonas, within the order Oceanospirillales. The bacterial assemblages associated with M. faveolata are significantly more diverse and exhibit higher specificity at the family level than P. astreoides assemblages. Both corals have more bacterial diversity and higher abundances of disease-related bacteria at sites closer to the mainland than at those furthest away. The most diverse bacterial taxa and highest relative abundance of disease-associated bacteria were seen for corals near St. Thomas, U.S. Virgin Islands (USVI) (2.5 km from shore), and the least diverse taxa and lowest relative abundance were seen for corals near our most pristine site in Belize (20 km from shore). We conclude

  1. Modified MALDI MS fatty acid profiling for bacterial identification.

    PubMed

    Voorhees, Kent J; Jensen, Kirk R; McAlpin, Casey R; Rees, Jon C; Cody, Robert; Ubukata, Masaaki; Cox, Christopher R

    2013-07-01

    Bacterial fatty acid profiling is a well-established technique for bacterial identification. Ten bacteria were analyzed using both positive- and negative-ion modes with a modified matrix-assisted laser desorption ionization mass spectrometry (MALDI MS) approach using CaO as a matrix replacement (metal oxide laser ionization MS (MOLI MS)). The results show that reproducible lipid cleavage similar to thermal in situ tetramethyl ammonium hydroxide saponification/derivatization had occurred. Principal component analysis showed that replicates from each organism grouped in a unique space. Cross validation (CV) of spectra from both ionization modes resulted in greater than 94% validation of the data. When CV results were compared for the two ionization modes, negative-ion data produced a superior outcome. MOLI MS provides clinicians a rapid, reproducible and cost-effective bacterial diagnostic tool. PMID:23832941

  2. Bacterial communities and species-specific associations with the mucus of Brazilian coral species.

    PubMed

    Carlos, Camila; Torres, Tatiana T; Ottoboni, Laura M M

    2013-01-01

    We investigated the existence of species-specific associations between Brazilian coral species and bacteria. Pyrosequencing of the V3 region of the 16S rDNA was used to analyze the taxonomic composition of bacterial communities associated with the mucus of four coral species (Madracis decactis, Mussismilia hispida, Palythoa caribaeorum, and Tubastraea coccinea) in two seasons (winter and summer), which were compared with the surrounding water and sediment. The microbial communities found in samples of mucus, water, and sediment differed according to the composition and relative frequency of OTUs. The coral mucus community seemed to be more stable and resistant to seasonal variations, compared to the water and sediment communities. There was no influence of geographic location on the composition of the communities. The sediment community was extremely diverse and might act as a "seed bank" for the entire environment. Species-specific OTUs were found in P. caribaeorum, T. coccinea, and M. hispida. PMID:23567936

  3. Bacterial communities and species-specific associations with the mucus of Brazilian coral species

    PubMed Central

    Carlos, Camila; Torres, Tatiana T.; Ottoboni, Laura M. M.

    2013-01-01

    We investigated the existence of species-specific associations between Brazilian coral species and bacteria. Pyrosequencing of the V3 region of the 16S rDNA was used to analyze the taxonomic composition of bacterial communities associated with the mucus of four coral species (Madracis decactis, Mussismilia hispida, Palythoa caribaeorum, and Tubastraea coccinea) in two seasons (winter and summer), which were compared with the surrounding water and sediment. The microbial communities found in samples of mucus, water, and sediment differed according to the composition and relative frequency of OTUs. The coral mucus community seemed to be more stable and resistant to seasonal variations, compared to the water and sediment communities. There was no influence of geographic location on the composition of the communities. The sediment community was extremely diverse and might act as a "seed bank" for the entire environment. Species-specific OTUs were found in P. caribaeorum, T. coccinea, and M. hispida. PMID:23567936

  4. Rosacea, Reactive Oxygen Species, and Azelaic Acid

    PubMed Central

    2009-01-01

    Rosacea is a common skin condition thought to be primarily an inflammatory disorder. Neutrophils, in particular, have been implicated in the inflammation associated with rosacea and mediate many of their effects through the release of reactive oxygen species. Recently, the role of reactive oxygen species in the pathophysiology of rosacea has been recognized. Many effective agents for rosacea, including topical azelaic acid and topical metronidazole, have anti-inflammatory properties. in-vitro models have demonstrated the potent antioxidant effects of azelaic acid, providing a potential mechanistic explanation for its efficacy in the treatment of rosacea. PMID:20967185

  5. Bacterial communities of two parthenogenetic aphid species cocolonizing two host plants across the Hawaiian Islands.

    PubMed

    Jones, Ryan T; Bressan, Alberto; Greenwell, April M; Fierer, Noah

    2011-12-01

    Aphids (Hemiptera: Aphididae) have been the focus of several studies with respect to their interactions with inherited symbionts, but bacterial communities of most aphid species are still poorly characterized. In this research, we used bar-coded pyrosequencing to characterize bacterial communities in aphids. Specifically, we examined the diversity of bacteria in two obligately parthenogenetic aphid species (the melon aphid, Aphis gossypii, and the cardamom aphid, Pentalonia caladii) cocolonizing two plant species (taro, Colocasia esculenta, and ginger, Alpinia purpurata) across four Hawaiian Islands (Hawaii, Kauai, Maui, and Oahu). Results from this study revealed that heritable symbionts dominated the bacterial communities for both aphid species. The bacterial communities differed significantly between the two species, and A. gossypii harbored a more diverse bacterial community than P. caladii. The bacterial communities also differed across aphid populations sampled from the different islands; however, communities did not differ between aphids collected from the two host plants. PMID:21965398

  6. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors

    PubMed Central

    Getino, María; Fernández-López, Raúl; Palencia-Gándara, Carolina; Campos-Gómez, Javier; Sánchez-López, Jose M.; Martínez, Marta; Fernández, Antonio; de la Cruz, Fernando

    2016-01-01

    Bacterial conjugation is the main mechanism for the dissemination of multiple antibiotic resistance in human pathogens. This dissemination could be controlled by molecules that interfere with the conjugation process. A search for conjugation inhibitors among a collection of 1,632 natural compounds, identified tanzawaic acids A and B as best hits. They specially inhibited IncW and IncFII conjugative systems, including plasmids mobilized by them. Plasmids belonging to IncFI, IncI, IncL/M, IncX and IncH incompatibility groups were targeted to a lesser extent, whereas IncN and IncP plasmids were unaffected. Tanzawaic acids showed reduced toxicity in bacterial, fungal or human cells, when compared to synthetic conjugation inhibitors, opening the possibility of their deployment in complex environments, including natural settings relevant for antibiotic resistance dissemination. PMID:26812051

  7. Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species

    PubMed Central

    Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao

    2016-01-01

    Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species.

  8. Biomimetic/Optical Sensors for Detecting Bacterial Species

    NASA Technical Reports Server (NTRS)

    Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth

    2006-01-01

    Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites

  9. What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira

    PubMed Central

    Fouts, Derrick E.; Matthias, Michael A.; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E.; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L.; Haake, David A.; Haft, Daniel H.; Hartskeerl, Rudy; Ko, Albert I.; Levett, Paul N.; Matsunaga, James; Mechaly, Ariel E.; Monk, Jonathan M.; Nascimento, Ana L. T.; Nelson, Karen E.; Palsson, Bernhard; Peacock, Sharon J.; Picardeau, Mathieu; Ricaldi, Jessica N.; Thaipandungpanit, Janjira; Wunder, Elsio A.; Yang, X. Frank; Zhang, Jun-Jie; Vinetz, Joseph M.

    2016-01-01

    Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade’s refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic

  10. What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira.

    PubMed

    Fouts, Derrick E; Matthias, Michael A; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L; Haake, David A; Haft, Daniel H; Hartskeerl, Rudy; Ko, Albert I; Levett, Paul N; Matsunaga, James; Mechaly, Ariel E; Monk, Jonathan M; Nascimento, Ana L T; Nelson, Karen E; Palsson, Bernhard; Peacock, Sharon J; Picardeau, Mathieu; Ricaldi, Jessica N; Thaipandungpanit, Janjira; Wunder, Elsio A; Yang, X Frank; Zhang, Jun-Jie; Vinetz, Joseph M

    2016-02-01

    Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic

  11. Method for construction of bacterial strains with increased succinic acid production

    DOEpatents

    Donnelly, Mark I.; Sanville-Millard, Cynthia; Chatterjee, Ranjini

    2000-01-01

    A fermentation process for producing succinic acid is provided comprising selecting a bacterial strain that does not produce succinic acid in high yield, disrupting the normal regulation of sugar metabolism of said bacterial strain, and combining the mutant bacterial strain and selected sugar in anaerobic conditions to facilitate production of succinic acid. Also provided is a method for changing low yield succinic acid producing bacteria to high yield succinic acid producing bacteria comprising selecting a bacterial strain having a phosphotransferase system and altering the phosphotransferase system so as to allow the bacterial strain to simultaneously metabolize different sugars.

  12. Production of fusaric acid by Fusarium species.

    PubMed Central

    Bacon, C W; Porter, J K; Norred, W P; Leslie, J F

    1996-01-01

    Fusaric acid is a mycotoxin with low to moderate toxicity, which is of concern since it might be synergistic with other cooccurring mycotoxins. Fusaric acid is widespread on corn and corn-based food and feeds and is frequently found in grain, where Fusarium spp. are also isolated. We surveyed 78 strains of Fusarium moniliforme, F. crookwellense, F. subglutinans, F. sambucinum, F. napiforme, F. heterosporum, F. oxysporum, F. solani, and F. proliferatum for their ability to produce fusaric acid. Strains in Fusarium section Liseola also were assigned to mating population of the Gibberella fujikuroi species complex. The fungi could be divided into three classes, low (< 100 micrograms/g), moderate (100 to 500 micrograms/g), and high (> 500 micrograms/g), based on the amounts of this mycotoxin produced in culture on autoclaved corn. Strains of mating populations C from rice consistently produced moderate to high concentrations of fusaric acid. Two isolates, one each from mating populations C and D, produced fusaric acid in excess of 1,000 micrograms/g of corn. No isolates of any of the Fusarium species examined were negative for the production of fusaric acid on autoclaved corn. PMID:8899996

  13. Identification of bacterial species by untargeted NMR spectroscopy of the exo-metabolome.

    PubMed

    Palama, T L; Canard, I; Rautureau, G J P; Mirande, C; Chatellier, S; Elena-Herrmann, B

    2016-08-01

    Identification of bacterial species is a crucial bottleneck for clinical diagnosis of infectious diseases. Quick and reliable identification is a key factor to provide suitable antibiotherapies and avoid the development of multiple-drug resistance. We propose a novel nuclear magnetic resonance (NMR)-based metabolomics strategy for rapid discrimination and identification of several bacterial species that relies on untargeted metabolic profiling of supernatants from bacterial culture media. We show that six bacterial species (Gram negative: Escherichia coli, Pseudomonas aeruginosa, Proteus mirabilis; Gram positive: Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus saprophyticus) can be well discriminated from multivariate statistical analysis, opening new prospects for NMR applications to microbial clinical diagnosis. PMID:27349704

  14. Co-habiting amphibian species harbor unique skin bacterial communities in wild populations

    PubMed Central

    McKenzie, Valerie J; Bowers, Robert M; Fierer, Noah; Knight, Rob; Lauber, Christian L

    2012-01-01

    Although all plant and animal species harbor microbial symbionts, we know surprisingly little about the specificity of microbial communities to their hosts. Few studies have compared the microbiomes of different species of animals, and fewer still have examined animals in the wild. We sampled four pond habitats in Colorado, USA, where multiple amphibian species were present. In total, 32 amphibian individuals were sampled from three different species including northern leopard frogs (Lithobates pipiens), western chorus frogs (Pseudacris triseriata) and tiger salamanders (Ambystoma tigrinum). We compared the diversity and composition of the bacterial communities on the skin of the collected individuals via barcoded pyrosequencing of the 16S rRNA gene. Dominant bacterial phyla included Acidobacteria, Actinobacteria, Bacteriodetes, Cyanobacteria, Firmicutes and Proteobacteria. In total, we found members of 18 bacterial phyla, comparable to the taxonomic diversity typically found on human skin. Levels of bacterial diversity varied strongly across species: L. pipiens had the highest diversity; A. tigrinum the lowest. Host species was a highly significant predictor of bacterial community similarity, and co-habitation within the same pond was not significant, highlighting that the skin-associated bacterial communities do not simply reflect those bacterial communities found in their surrounding environments. Innate species differences thus appear to regulate the structure of skin bacterial communities on amphibians. In light of recent discoveries that some bacteria on amphibian skin have antifungal activity, our finding suggests that host-specific bacteria may have a role in the species-specific resistance to fungal pathogens. PMID:21955991

  15. Ubiquitin Activates Patatin-Like Phospholipases from Multiple Bacterial Species

    PubMed Central

    Anderson, David M.; Sato, Hiromi; Dirck, Aaron T.; Feix, Jimmy B.

    2014-01-01

    Phospholipase A2 enzymes are ubiquitously distributed throughout the prokaryotic and eukaryotic kingdoms and are utilized in a wide array of cellular processes and physiological and immunological responses. Several patatin-like phospholipase homologs of ExoU from Pseudomonas aeruginosa were selected on the premise that ubiquitin activation of this class of bacterial enzymes was a conserved process. We found that ubiquitin activated all phospholipases tested in both in vitro and in vivo assays via a conserved serine-aspartate catalytic dyad. Ubiquitin chains versus monomeric ubiquitin were superior in inducing catalysis, and ubiquitin-like proteins failed to activate phospholipase activity. Toxicity studies in a prokaryotic dual-expression system grouped the enzymes into high- and low-toxicity classes. Toxicity measured in eukaryotic cells also suggested a two-tiered classification but was not predictive of the severity of cellular damage, suggesting that each enzyme may correspond to unique properties perhaps based on its specific biological function. Additional studies on lipid binding preference suggest that some enzymes in this family may be differentially sensitive to phosphatidyl-4,5-bisphosphate in terms of catalytic activation enhancement and binding affinity. Further analysis of the function and amino acid sequences of this enzyme family may lead to a useful approach to formulating a unifying model of how these phospholipases behave after delivery into the cytoplasmic compartment. PMID:25404699

  16. Identification of beta-subunit of bacterial RNA-polymerase--a non-species-specific bacterial protein--as target of antibodies in primary biliary cirrhosis.

    PubMed

    Roesler, Kai-Wolfgang; Schmider, Wolfgang; Kist, Manfred; Batsford, Stephen; Schiltz, Emile; Oelke, Mathias; Tuczek, Anja; Dettenborn, Therese; Behringer, Dirk; Kreisel, Wolfgang

    2003-03-01

    Several observations suggest that bacteria induce autoimmunity in primary biliary cirrhosis (PBC). Since no PBC-specific bacterial species could be identified, it can be speculated that the triggers are non-species-specific bacterial proteins. This hypothesis would imply that several or even all bacterial species can trigger PBC. Therefore, we investigated whether PBC exhibits immune reactions to non-species-specific bacterial antigens. Yersinia enterocolitica O3 was screened for the presence of proteins that were labeled by immunoblotting using PBC sera. We focused our investigations on a 160-kDa protein, which was further enriched and characterized by partial N-terminal amino acid sequencing. The prevalence of antibodies to this protein was determined by immunoblotting in a variety of diseases. The 160-kDa protein was identified as the beta-subunit of bacterial RNA-polymerase, a highly conserved bacterial protein with a very high degree of sequence identity among all bacterial species. Antibodies to the beta-subunit of bacterial RNA polymerase were specific for this protein. Until now no mammalian protein could be found that cross-reacts with these antibodies. The prevalence of antibodies to the beta-subunit of bacterial RNA polymerase (ARPA) using the protein from Yersinia enterocolitica O3 (serum dilution 1:1000) was: healthy controls (HC, N = 101) 7.9%, primary biliary cirrhosis (PBC, N = 61) 32.8%, autoimmune hepatitis type 1 (AIH, N = 46) 26.1%, alcoholic liver cirrhosis (ALC, N = 44) 9.1%, Crohn's disease (CD, N = 38) 7.9%, ulcerative colitis (UC, N = 24) 8.3%, primary sclerosing cholangitis + UC (PSC/UC, N = 11) 0%, acute yersiniosis (Yers, N = 36) 19.4%, acute infection with Campylobacter jejuni (Camp, N = 10) 0%, acute Q-fever (QF, N = 16) 6.25%, chronic hepatitis C (HCV, N = 39) 7.7%, c-ANCA-positive vasculitis (Vasc, N = 40) 15%, systemic lupus erythematosus (SLE, N = 28) 10.7%, and malaria tropica (MT, N = 24) 16.7%. There was no significant

  17. A genomic perspective on a new bacterial genus and species from the Alcaligenaceae family, Basilea psittacipulmonis

    PubMed Central

    2014-01-01

    Background A novel Gram-negative, non-haemolytic, non-motile, rod-shaped bacterium was discovered in the lungs of a dead parakeet (Melopsittacus undulatus) that was kept in captivity in a petshop in Basel, Switzerland. The organism is described with a chemotaxonomic profile and the nearly complete genome sequence obtained through the assembly of short sequence reads. Results Genome sequence analysis and characterization of respiratory quinones, fatty acids, polar lipids, and biochemical phenotype is presented here. Comparison of gene sequences revealed that the most similar species is Pelistega europaea, with BLAST identities of only 93% to the 16S rDNA gene, 76% identity to the rpoB gene, and a similar GC content (~43%) as the organism isolated from the parakeet, DSM 24701 (40%). The closest full genome sequences are those of Bordetella spp. and Taylorella spp. High-throughput sequencing reads from the Illumina-Solexa platform were assembled with the Edena de novo assembler to form 195 contigs comprising the ~2 Mb genome. Genome annotation with RAST, construction of phylogenetic trees with the 16S rDNA (rrs) gene sequence and the rpoB gene, and phylogenetic placement using other highly conserved marker genes with ML Tree all suggest that the bacterial species belongs to the Alcaligenaceae family. Analysis of samples from cages with healthy parakeets suggested that the newly discovered bacterial species is not widespread in parakeet living quarters. Conclusions Classification of this organism in the current taxonomy system requires the formation of a new genus and species. We designate the new genus Basilea and the new species psittacipulmonis. The type strain of Basilea psittacipulmonis is DSM 24701 (= CIP 110308 T, 16S rDNA gene sequence Genbank accession number JX412111 and GI 406042063). PMID:24581117

  18. Catecholamines and in vitro growth of pathogenic bacteria: enhancement of growth varies greatly among bacterial species

    NASA Technical Reports Server (NTRS)

    Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald

    2003-01-01

    The purpose of this study was to examine the effects of catecholamines on in vitro growth of a range of bacterial species, including anaerobes. Bacteria tested included: Porphyromonas gingivalis, Bacteriodes fragilis, Shigella boydii, Shigella sonnie, Enterobacter Sp, and Salmonella choleraesuis. The results of the current study indicated that supplementation of bacterial cultures in minimal medium with norepinephrine or epinephrine did not result in increased growth of bacteria. Positive controls involving treatment of Escherichia coli with catecholamines did result in increased growth of that bacterial species. The results of the present study extend previous observations that showed differential capability of catecholamines to enhance bacterial growth in vitro.

  19. Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar.

    PubMed

    Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng

    2016-05-01

    Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites. PMID:26754813

  20. Assessing the complex sponge microbiota: core, variable and species-specific bacterial communities in marine sponges

    PubMed Central

    Schmitt, Susanne; Tsai, Peter; Bell, James; Fromont, Jane; Ilan, Micha; Lindquist, Niels; Perez, Thierry; Rodrigo, Allen; Schupp, Peter J; Vacelet, Jean; Webster, Nicole; Hentschel, Ute; Taylor, Michael W

    2012-01-01

    Marine sponges are well known for their associations with highly diverse, yet very specific and often highly similar microbiota. The aim of this study was to identify potential bacterial sub-populations in relation to sponge phylogeny and sampling sites and to define the core bacterial community. 16S ribosomal RNA gene amplicon pyrosequencing was applied to 32 sponge species from eight locations around the world's oceans, thereby generating 2567 operational taxonomic units (OTUs at the 97% sequence similarity level) in total and up to 364 different OTUs per sponge species. The taxonomic richness detected in this study comprised 25 bacterial phyla with Proteobacteria, Chloroflexi and Poribacteria being most diverse in sponges. Among these phyla were nine candidate phyla, six of them found for the first time in sponges. Similarity comparison of bacterial communities revealed no correlation with host phylogeny but a tropical sub-population in that tropical sponges have more similar bacterial communities to each other than to subtropical sponges. A minimal core bacterial community consisting of very few OTUs (97%, 95% and 90%) was found. These microbes have a global distribution and are probably acquired via environmental transmission. In contrast, a large species-specific bacterial community was detected, which is represented by OTUs present in only a single sponge species. The species-specific bacterial community is probably mainly vertically transmitted. It is proposed that different sponges contain different bacterial species, however, these bacteria are still closely related to each other explaining the observed similarity of bacterial communities in sponges in this and previous studies. This global analysis represents the most comprehensive study of bacterial symbionts in sponges to date and provides novel insights into the complex structure of these unique associations. PMID:21993395

  1. Characterization and bacterial adhesion of chitosan-perfluorinated acid films.

    PubMed

    Bierbrauer, Karina L; Alasino, Roxana V; Muñoz, Adrián; Beltramo, Dante M; Strumia, Miriam C

    2014-02-01

    We reported herein the study and characterization of films obtained by casting of chitosan solutions in perfluorinated acids, trifluoroacetic (TFA), perfluoropropionic (PFPA), and perfluorooctanoic (PFOA). The films were characterized by FTIR, solid state (13)C NMR, X-ray, AFM, contact angle, thermogravimetric effluent analysis by mass spectrometry, and rheology. The results showed a marked influence of chain length of the perfluorinated acids on the hydrophobic/hydrophilic ratio of the modified chitosan films which was evidenced by the different characteristics observed. The material that showed greater surface stability was chitosan-PFOA. Chitosan film with the addition of PFOA modifier became more hydrophobic, thus water vapor permeability diminished compared to chitosan films alone, this new material also depicted bacterial adhesion which, together with the features already described, proves its potential in applications for bioreactor coating. PMID:24189195

  2. Lactic acid bacterial extract as a biogenic mineral growth modifier

    NASA Astrophysics Data System (ADS)

    Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal

    2009-04-01

    The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.

  3. Species Specific Bacterial Spore Detection Using Lateral-Flow Immunoassay with DPA-Triggered Tb Luminescence

    NASA Technical Reports Server (NTRS)

    Ponce, Adrian

    2003-01-01

    A method of detecting bacterial spores incorporates (1) A method of lateral-flow immunoassay in combination with (2) A method based on the luminescence of Tb3+ ions to which molecules of dipicolinic acid (DPA) released from the spores have become bound. The present combination of lateral-flow immunoassay and DPA-triggered Tb luminescence was developed as a superior alternative to a prior lateral-flow immunoassay method in which detection involves the visual observation and/or measurement of red light scattered from colloidal gold nanoparticles. The advantage of the present combination method is that it affords both (1) High selectivity for spores of the species of bacteria that one seeks to detect (a characteristic of lateral-flow immunoassay in general) and (2) Detection sensitivity much greater (by virtue of the use of DPA-triggered Tb luminescence instead of gold nanoparticles) than that of the prior lateral-flow immunoassay method

  4. Resource-dependent attenuation of species interactions during bacterial succession

    PubMed Central

    Rivett, Damian W; Scheuerl, Thomas; Culbert, Christopher T; Mombrikotb, Shorok B; Johnstone, Emma; Barraclough, Timothy G; Bell, Thomas

    2016-01-01

    Bacterial communities are vital for many economically and ecologically important processes. The role of bacterial community composition in determining ecosystem functioning depends critically on interactions among bacterial taxa. Several studies have shown that, despite a predominance of negative interactions in communities, bacteria are able to display positive interactions given the appropriate evolutionary or ecological conditions. We were interested in how interspecific interactions develop over time in a naturalistic setting of low resource supply rates. We assembled aquatic bacterial communities in microcosms and assayed the productivity (respiration and growth) and substrate degradation while tracking community composition. The results demonstrated that while bacterial communities displayed strongly negative interactions during the early phase of colonisation and acclimatisation to novel biotic and abiotic factors, this antagonism declined over time towards a more neutral state. This was associated with a shift from use of labile substrates in early succession to use of recalcitrant substrates later in succession, confirming a crucial role of resource dynamics in linking interspecific interactions with ecosystem functioning. PMID:26894447

  5. Resource-dependent attenuation of species interactions during bacterial succession.

    PubMed

    Rivett, Damian W; Scheuerl, Thomas; Culbert, Christopher T; Mombrikotb, Shorok B; Johnstone, Emma; Barraclough, Timothy G; Bell, Thomas

    2016-09-01

    Bacterial communities are vital for many economically and ecologically important processes. The role of bacterial community composition in determining ecosystem functioning depends critically on interactions among bacterial taxa. Several studies have shown that, despite a predominance of negative interactions in communities, bacteria are able to display positive interactions given the appropriate evolutionary or ecological conditions. We were interested in how interspecific interactions develop over time in a naturalistic setting of low resource supply rates. We assembled aquatic bacterial communities in microcosms and assayed the productivity (respiration and growth) and substrate degradation while tracking community composition. The results demonstrated that while bacterial communities displayed strongly negative interactions during the early phase of colonisation and acclimatisation to novel biotic and abiotic factors, this antagonism declined over time towards a more neutral state. This was associated with a shift from use of labile substrates in early succession to use of recalcitrant substrates later in succession, confirming a crucial role of resource dynamics in linking interspecific interactions with ecosystem functioning. PMID:26894447

  6. Amazonian dark Earth and plant species from the Amazon region contribute to shape rhizosphere bacterial communities.

    PubMed

    Barbosa Lima, Amanda; Cannavan, Fabiana Souza; Navarrete, Acacio Aparecido; Teixeira, Wenceslau Geraldes; Kuramae, Eiko Eurya; Tsai, Siu Mui

    2015-05-01

    Amazonian Dark Earths (ADE) or Terra Preta de Índio formed in the past by pre-Columbian populations are highly sustained fertile soils supported by microbial communities that differ from those extant in adjacent soils. These soils are found in the Amazon region and are considered as a model soil when compared to the surrounding and background soils. The aim of this study was to assess the effects of ADE and its surrounding soil on the rhizosphere bacterial communities of two leguminous plant species that frequently occur in the Amazon region in forest sites (Mimosa debilis) and open areas (Senna alata). Bacterial community structure was evaluated using terminal restriction fragment length polymorphism (T-RFLP) and bacterial community composition by V4 16S rRNA gene region pyrosequencing. T-RFLP analysis showed effect of soil types and plant species on rhizosphere bacterial community structure. Differential abundance of bacterial phyla, such as Acidobacteria, Actinobacteria, Verrucomicrobia, and Firmicutes, revealed that soil type contributes to shape the bacterial communities. Furthermore, bacterial phyla such as Firmicutes and Nitrospira were mostly influenced by plant species. Plant roots influenced several soil chemical properties, especially when plants were grown in ADE. These results showed that differences observed in rhizosphere bacterial community structure and composition can be influenced by plant species and soil fertility due to variation in soil attributes. PMID:25103911

  7. Crustose coralline algal species host distinct bacterial assemblages on their surfaces.

    PubMed

    Sneed, Jennifer M; Ritson-Williams, Raphael; Paul, Valerie J

    2015-11-01

    Crustose coralline algae (CCA) are important components of many marine ecosystems. They aid in reef accretion and stabilization, create habitat for other organisms, contribute to carbon sequestration and are important settlement substrata for a number of marine invertebrates. Despite their ecological importance, little is known about the bacterial communities associated with CCA or whether differences in bacterial assemblages may have ecological implications. This study examined the bacterial communities on four different species of CCA collected in Belize using bacterial tag-encoded FLX amplicon pyrosequencing of the V1-V3 region of the 16S rDNA. CCA were dominated by Alphaproteobacteria, Gammaproteobacteria and Actinomycetes. At the operational taxonomic unit (OTU) level, each CCA species had a unique bacterial community that was significantly different from all other CCA species. Hydrolithon boergesenii and Titanoderma prototypum, CCA species that facilitate larval settlement in multiple corals, had higher abundances of OTUs related to bacteria that inhibit the growth and/or biofilm formation of coral pathogens. Fewer coral larvae settle on the surfaces of Paragoniolithon solubile and Porolithon pachydermum. These CCA species had higher abundances of OTUs related to known coral pathogens and cyanobacteria. Coral larvae may be able to use the observed differences in bacterial community composition on CCA species to assess the suitability of these substrata for settlement and selectively settle on CCA species that contain beneficial bacteria. PMID:25918832

  8. "Lachnoclostridium bouchesdurhonense," a new bacterial species isolated from human gut microbiota.

    PubMed

    Amadou, T; Hosny, M; La Scola, B; Cassir, N

    2016-09-01

    We report the main characteristics of "Lachnoclostridium bouchesdurhonense" strain AT5(T) (=CSUR P2181), a new bacterial species isolated from the gut microbiota of an obese patient from Marseille. PMID:27493758

  9. 'Lachnoclostridium massiliosenegalense', a new bacterial species isolated from the human gut microbiota.

    PubMed

    Tidjani Alou, M; Lagier, J-C; La Scola, B; Cassir, N

    2016-11-01

    We report the main characteristics of 'Lachnoclostridium massiliosenegalense' strain mt23(T) (=CSUR P299 =DSM 102084), a new bacterial species isolated from the gut microbiota of a healthy young girl from Senegal. PMID:27595004

  10. Effects of Host Plant Factors on the Bacterial Communities Associated with Two Whitefly Sibling Species

    PubMed Central

    Su, Ming-Ming; Guo, Lei; Tao, Yun-Li; Zhang, You-Jun; Wan, Fang-Hao; Chu, Dong

    2016-01-01

    Background Although discrepancy in the specific traits and ecological characteristics of Bemisia tabaci between species are partially attributed to the B. tabaci-associated bacteria, the factors that affect the diversity of B. tabaci-associated bacteria are not well-understood. We used the metagenomic approach to characterize the B. tabaci-associated bacterial community because the approach is an effective tool to identify the bacteria. Methodology and Results To investigate the effects of the host plant and a virus, tomato yellow leaf curl virus (TYLCV), on the bacterial communities of B. tabaci sibling species B and Q, we analyzed the bacterial communities associated with whitefly B and Q collected from healthy cotton, healthy tomato, and TYLCV-infected tomato. The analysis used miseq-based sequencing of a variable region of the bacterial 16S rDNA gene. For the bacteria associated with B. tabaci, we found that the influence of the host plant species was greater than that of the whitefly cryptic species. With further analysis of host plants infected with the TYLCV, the virus had no significant effects on the B. tabaci-associated bacterial community. Conclusions The effects of different plant hosts and TYLCV-infection on the diversity of B. tabaci-associated bacterial communities were successfully analyzed in this study. To explain why B. tabaci sibling species with different host ranges differ in performance, the analysis of the bacterial community may be essential to the explanation. PMID:27008327

  11. Exploring the bacterial microbiota associated with native South American species of Aphis (Hemiptera: Aphididae).

    PubMed

    Arneodo, J D; Ortego, J

    2014-06-01

    Aphids harbor a variety of bacterial endosymbionts, including the obligate symbiont Buchnera aphidicola and diverse facultative symbionts. The former supplies its host with essential amino acids. The latter are not indispensable for insect survival, but often improve their host's fitness. To date, the study of such associations was restricted to aphids of Holarctic origin. The bacterial microbiota of seven Aphis species from Argentina was investigated. The presence of B. aphidicola was assessed by specific PCR. Additional symbionts were identified through PCR with eubacterial universal primers, cloning, and sequencing of nearly complete 16S rRNA gene, intergenic spacer region, and partial 23S rRNA gene and subjected to phylogenetic analysis. Infection with B. aphidicola was confirmed in every species analyzed. The facultative symbiont Serratia symbiotica was detected in Aphis malalhuina Mier Durante, Nieto Nafría & Ortego, 2003, Aphis senecionicoides Blanchard, 1944, and Aphis schinifoliae Blanchard, 1939, while Hamiltonella defensa was identified in Aphis mendocina Mier Durante, Ortego & Nieto Nafría, 2006. Arsenophonus sp. was found infecting Aphis melosae Mier Durante & Ortego, 1999, and a new, undescribed Aphis sp. In Aphis danielae Remaudière, 1994, no facultative symbionts could be recorded. When analyzing the highly conserved 16S rRNA gene, the phylogenetic tree grouped the S. symbiotica, H. defensa, and Arsenophonus isolates into three well-defined clusters showing little variability among clones corresponding to the same aphid host species. This article reports for the first time the endosymbionts associated with aphids native to South America. Despite their geographic origin, the qualitative composition of their microbiota revealed no evident differences from that described for aphids in the Northern Hemisphere. PMID:24736017

  12. Bacterial species identification from MALDI-TOF mass spectra through data analysis and machine learning.

    PubMed

    De Bruyne, Katrien; Slabbinck, Bram; Waegeman, Willem; Vauterin, Paul; De Baets, Bernard; Vandamme, Peter

    2011-02-01

    At present, there is much variability between MALDI-TOF MS methodology for the characterization of bacteria through differences in e.g., sample preparation methods, matrix solutions, organic solvents, acquisition methods and data analysis methods. After evaluation of the existing methods, a standard protocol was developed to generate MALDI-TOF mass spectra obtained from a collection of reference strains belonging to the genera Leuconostoc, Fructobacillus and Lactococcus. Bacterial cells were harvested after 24h of growth at 28°C on the media MRS or TSA. Mass spectra were generated, using the CHCA matrix combined with a 50:48:2 acetonitrile:water:trifluoroacetic acid matrix solution, and analyzed by the cell smear method and the cell extract method. After a data preprocessing step, the resulting high quality data set was used for PCA, distance calculation and multi-dimensional scaling. Using these analyses, species-specific information in the MALDI-TOF mass spectra could be demonstrated. As a next step, the spectra, as well as the binary character set derived from these spectra, were successfully used for species identification within the genera Leuconostoc, Fructobacillus, and Lactococcus. Using MALDI-TOF MS identification libraries for Leuconostoc and Fructobacillus strains, 84% of the MALDI-TOF mass spectra were correctly identified at the species level. Similarly, the same analysis strategy within the genus Lactococcus resulted in 94% correct identifications, taking species and subspecies levels into consideration. Finally, two machine learning techniques were evaluated as alternative species identification tools. The two techniques, support vector machines and random forests, resulted in accuracies between 94% and 98% for the identification of Leuconostoc and Fructobacillus species, respectively. PMID:21295428

  13. Raman microspectroscopy for species identification and mapping within bacterial biofilms.

    PubMed

    Beier, Brooke D; Quivey, Robert G; Berger, Andrew J

    2012-01-01

    : A new method of mapping multiple species of oral bacteria in intact biofilms has been developed, using the optical technique of confocal Raman microscopy. A species classification algorithm, developed on dried biofilms, was used to analyze spectra of hydrated biofilms containing two microbial species central to dental health: Streptococcus sanguinis and Streptococcus mutans. The algorithm transferred successfully to the hydrated environment, correctly identifying the species of origin of single-species biofilms. We then used the algorithm successfully both to detect the presence of two species in mixed biofilms and to create spatial maps within these biofilms. PMID:22794329

  14. Role of antioxidant enzymes in bacterial resistance to organic acids.

    PubMed

    Bruno-Bárcena, Jose M; Azcárate-Peril, M Andrea; Hassan, Hosni M

    2010-05-01

    Growth in aerobic environments has been shown to generate reactive oxygen species (ROS) and to cause oxidative stress in most organisms. Antioxidant enzymes (i.e., superoxide dismutases and hydroperoxidases) and DNA repair mechanisms provide protection against ROS. Acid stress has been shown to be associated with the induction of Mn superoxide dismutase (MnSOD) in Lactococcus lactis and Staphylococcus aureus. However, the relationship between acid stress and oxidative stress is not well understood. In the present study, we showed that mutations in the gene coding for MnSOD (sodA) increased the toxicity of lactic acid at pH 3.5 in Streptococcus thermophilus. The inclusion of the iron chelators 2,2'-dipyridyl (DIP), diethienetriamine-pentaacetic acid (DTPA), and O-phenanthroline (O-Phe) provided partial protection against 330 mM lactic acid at pH 3.5. The results suggested that acid stress triggers an iron-mediated oxidative stress that can be ameliorated by MnSOD and iron chelators. These findings were further validated in Escherichia coli strains lacking both MnSOD and iron SOD (FeSOD) but expressing a heterologous MnSOD from S. thermophilus. We also found that, in E. coli, FeSOD did not provide the same protection afforded by MnSOD and that hydroperoxidases are equally important in protecting the cells against acid stress. These findings may explain the ability of some microorganisms to survive better in acidified environments, as in acid foods, during fermentation and accumulation of lactic acid or during passage through the low pH of the stomach. PMID:20305033

  15. An uncooked vegan diet shifts the profile of human fecal microflora: computerized analysis of direct stool sample gas-liquid chromatography profiles of bacterial cellular fatty acids.

    PubMed Central

    Peltonen, R; Ling, W H; Hänninen, O; Eerola, E

    1992-01-01

    The effect of an uncooked extreme vegan diet on fecal microflora was studied by direct stool sample gas-liquid chromatography (GLC) of bacterial cellular fatty acids and by quantitative bacterial culture by using classical microbiological techniques of isolation, identification, and enumeration of different bacterial species. Eighteen volunteers were divided randomly into two groups. The test group received an uncooked vegan diet for 1 month and a conventional diet of mixed Western type for the other month of the study. The control group consumed a conventional diet throughout the study period. Stool samples were collected. Bacterial cellular fatty acids were extracted directly from the stool samples and measured by GLC. Computerized analysis of the resulting fatty acid profiles was performed. Such a profile represents all bacterial cellular fatty acids in a sample and thus reflects its microflora and can be used to detect changes, differences, or similarities of bacterial flora between individual samples or sample groups. GLC profiles changed significantly in the test group after the induction and discontinuation of the vegan diet but not in the control group at any time, whereas quantitative bacterial culture did not detect any significant change in fecal bacteriology in either of the groups. The results suggest that an uncooked extreme vegan diet alters the fecal bacterial flora significantly when it is measured by direct stool sample GLC of bacterial fatty acids. PMID:1482187

  16. Ultralong C100 Mycolic Acids Support the Assignment of Segniliparus as a New Bacterial Genus

    PubMed Central

    Layre, Emilie; Sweet, Lindsay; Young, David C.; Posey, James E.; Butler, W. Ray; Moody, D. Branch

    2012-01-01

    Mycolic acid-producing bacteria isolated from the respiratory tract of human and non-human mammals were recently assigned as a distinct genus, Segniliparus, because they diverge from rhodococci and mycobacteria in genetic and chemical features. Using high accuracy mass spectrometry, we determined the chemical composition of 65 homologous mycolic acids in two Segniliparus species and separately analyzed the three subclasses to measure relative chain length, number and stereochemistry of unsaturations and cyclopropyl groups within each class. Whereas mycobacterial mycolate subclasses are distinguished from one another by R groups on the meromycolate chain, Segniliparus species synthesize solely non-oxygenated α-mycolates with high levels of cis unsaturation. Unexpectedly Segniliparus α-mycolates diverge into three subclasses based on large differences in carbon chain length with one bacterial culture producing mycolates that range from C58 to C100. Both the overall chain length (C100) and the chain length diversity (C42) are larger than previously seen for mycolic acid-producing organisms and provide direct chemical evidence for assignment of Segniliparus as a distinct genus. Yet, electron microscopy shows that the long and diverse mycolates pack into a typical appearing membrane. Therefore, these new and unexpected extremes of mycolic acid chemical structure raise questions about the modes of mycolic acid packing and folding into a membrane. PMID:22720018

  17. Confocal Raman microscopy for identification of bacterial species in biofilms

    NASA Astrophysics Data System (ADS)

    Beier, Brooke D.; Quivey, Robert G.; Berger, Andrew J.

    2011-03-01

    Implemented through a confocal microscope, Raman spectroscopy has been used to distinguish between biofilm samples of two common oral bacteria species, Streptococcus sanguinis and mutans, which are associated with healthy and cariogenic plaque, respectively. Biofilms of these species are studied as a model of dental plaque. A prediction model has been calibrated and validated using pure biofilms. This model has been used to identify the species of transferred and dehydrated samples (much like a plaque scraping) as well as hydrated biofilms in situ. Preliminary results of confocal Raman mapping of species in an intact two-species biofilm will be shown.

  18. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily.

    PubMed

    Matsunaga, James; Barocchi, Michele A; Croda, Julio; Young, Tracy A; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A; Reis, Mitermayer G; Riley, Lee W; Haake, David A; Ko, Albert I

    2003-08-01

    Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudogene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019

  19. Bacterial Communities of Diverse Drosophila Species: Ecological Context of a Host–Microbe Model System

    PubMed Central

    Bhatnagar, Srijak; Eisen, Jonathan A.; Kopp, Artyom

    2011-01-01

    Drosophila melanogaster is emerging as an important model of non-pathogenic host–microbe interactions. The genetic and experimental tractability of Drosophila has led to significant gains in our understanding of animal–microbial symbiosis. However, the full implications of these results cannot be appreciated without the knowledge of the microbial communities associated with natural Drosophila populations. In particular, it is not clear whether laboratory cultures can serve as an accurate model of host–microbe interactions that occur in the wild, or those that have occurred over evolutionary time. To fill this gap, we characterized natural bacterial communities associated with 14 species of Drosophila and related genera collected from distant geographic locations. To represent the ecological diversity of Drosophilids, examined species included fruit-, flower-, mushroom-, and cactus-feeders. In parallel, wild host populations were compared to laboratory strains, and controlled experiments were performed to assess the importance of host species and diet in shaping bacterial microbiome composition. We find that Drosophilid flies have taxonomically restricted bacterial communities, with 85% of the natural bacterial microbiome composed of only four bacterial families. The dominant bacterial taxa are widespread and found in many different host species despite the taxonomic, ecological, and geographic diversity of their hosts. Both natural surveys and laboratory experiments indicate that host diet plays a major role in shaping the Drosophila bacterial microbiome. Despite this, the internal bacterial microbiome represents only a highly reduced subset of the external bacterial communities, suggesting that the host exercises some level of control over the bacteria that inhabit its digestive tract. Finally, we show that laboratory strains provide only a limited model of natural host–microbe interactions. Bacterial taxa used in experimental studies are rare or absent in

  20. Bacterial profiling of White Plague Disease in a comparative coral species framework.

    PubMed

    Roder, Cornelia; Arif, Chatchanit; Bayer, Till; Aranda, Manuel; Daniels, Camille; Shibl, Ahmed; Chavanich, Suchana; Voolstra, Christian R

    2014-01-01

    Coral reefs are threatened throughout the world. A major factor contributing to their decline is outbreaks and propagation of coral diseases. Due to the complexity of coral-associated microbe communities, little is understood in terms of disease agents, hosts and vectors. It is known that compromised health in corals is correlated with shifts in bacterial assemblages colonizing coral mucus and tissue. However, general disease patterns remain, to a large extent, ambiguous as comparative studies over species, regions, or diseases are scarce. Here, we compare bacterial assemblages of samples from healthy (HH) colonies and such displaying signs of White Plague Disease (WPD) of two different coral species (Pavona duerdeni and Porites lutea) from the same reef in Koh Tao, Thailand, using 16S rRNA gene microarrays. In line with other studies, we found an increase of bacterial diversity in diseased (DD) corals, and a higher abundance of taxa from the families that include known coral pathogens (Alteromonadaceae, Rhodobacteraceae, Vibrionaceae). In our comparative framework analysis, we found differences in microbial assemblages between coral species and coral health states. Notably, patterns of bacterial community structures from HH and DD corals were maintained over species boundaries. Moreover, microbes that differentiated the two coral species did not overlap with microbes that were indicative of HH and DD corals. This suggests that while corals harbor distinct species-specific microbial assemblages, disease-specific bacterial abundance patterns exist that are maintained over coral species boundaries. PMID:23924783

  1. Direct detection of fatty acid ethyl esters using low temperature plasma (LTP) ambient ionization mass spectrometry for rapid bacterial differentiation.

    PubMed

    Zhang, J Isabella; Costa, Anthony B; Tao, W Andy; Cooks, R Graham

    2011-08-01

    Low temperature plasma mass spectrometry (LTP-MS) was employed to detect fatty acid ethyl esters (FAEE) from bacterial samples directly. Positive ion mode FAEE mass spectrometric profiles of sixteen different bacterial samples were obtained without extraction or other sample preparation. In the range m/z 200-300, LTP mass spectra show highly reproducible and characteristic patterns. To identify the FAEE's associated with the characteristic peaks, accurate masses were recorded in the full scan mode using an LTQ/Orbitrap instrument, and tandem mass spectrometry was performed. Data were examined by principal component analysis (PCA) to determine the degree of differentiation possible amongst different bacterial species. Gram-positive and gram-negative bacteria are readily distinguished, and 11 out of 13 Salmonella strains show distinctive patterns. Growth media effects are observed but do not interfere with species recognition based on the PCA results. PMID:21706093

  2. Bis(aminomethyl)phosphinic Acid, a Highly Promising Scaffold for the Development of Bacterial Urease Inhibitors

    PubMed Central

    2014-01-01

    Inhibitors of bacterial ureases are considered to be promising compounds in the treatment of infections caused by Helicobacter pylori in the gastric tract and/or by urealytic bacteria (e.g., Proteus species) in the urinary tract. A new, extended transition state scaffold, bis(aminomethyl)phosphinic acid, was successfully explored for the construction of effective enzyme inhibitors. A reliable methodology for the synthesis of phosphinate analogues in a three-component Mannich-type reaction was elaborated. The obtained molecules were assayed against ureases purified from Sporosarcina pasteurii and Proteus mirabilis, and aminomethyl(N-n-hexylaminomethyl)phosphinic acid was found to be the most potent inhibitor, with a Ki = 108 nM against the S. pasteurii enzyme. PMID:25699141

  3. Bis(aminomethyl)phosphinic Acid, a Highly Promising Scaffold for the Development of Bacterial Urease Inhibitors.

    PubMed

    Macegoniuk, Katarzyna; Dziełak, Anna; Mucha, Artur; Berlicki, Łukasz

    2015-02-12

    Inhibitors of bacterial ureases are considered to be promising compounds in the treatment of infections caused by Helicobacter pylori in the gastric tract and/or by urealytic bacteria (e.g., Proteus species) in the urinary tract. A new, extended transition state scaffold, bis(aminomethyl)phosphinic acid, was successfully explored for the construction of effective enzyme inhibitors. A reliable methodology for the synthesis of phosphinate analogues in a three-component Mannich-type reaction was elaborated. The obtained molecules were assayed against ureases purified from Sporosarcina pasteurii and Proteus mirabilis, and aminomethyl(N-n-hexylaminomethyl)phosphinic acid was found to be the most potent inhibitor, with a K i = 108 nM against the S. pasteurii enzyme. PMID:25699141

  4. Acetic Acid Bacterial Biota of the Pink Sugar Cane Mealybug, Saccharococcus sacchari, and Its Environs

    PubMed Central

    Ashbolt, Nicholas J.; Inkerman, Peter A.

    1990-01-01

    Saccharococcus sacchari is the primary colonizer of the developing “sterile” tissue between the leaf sheath and stem of sugar cane. The honeydew secreted by the mealybugs is acidic (about pH 3) and supports an atypical epiphytic microbiota dominated by acetobacter-like bacteria and acidophilic yeast species. However, Erwinia and Leuconostoc species predominate within the leaf sheath pocket region when the mealybugs die out. The unidentified acetobacters were readily isolated from S. sacchari throughout its life cycle and from other genera of mealybugs on sugar cane and various other plants, both above and below ground. No other insect present on sugar cane was a significant vector of acetic acid bacteria. The major factors restricting microbial diversity within the environs of mealybugs were considered to be yeast activity along with bacterial production of acetic acid, ketogluconic acids, and gamma-pyrones, in association with their lowering of pH. The microbial products may aid in suppressing the attack by the parasitic mold Aspergillus parasiticus on mealybugs but could act as attractants for the predatory fruit fly Cacoxenus perspicax. PMID:16348144

  5. The Biofilm Forming Potential of Bacterial Species in the Genus Campylobacter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The biofilm forming abilities of representative strains of 14 of the 16 species comprising the genus Campylobacter were determined on glass, stainless steel, and polystyrene plastic. The genus Campylobacter is comprised of bacterial species which are both sensitive to oxygen and nutritionally fasti...

  6. Bacterial response to acetate challenge: a comparison of tolerance among species.

    PubMed

    Lasko, D R; Zamboni, N; Sauer, U

    2000-08-01

    Although acetate formation and tolerance are important criteria for various aspects of biotechnological process development, available studies on acetate tolerance in different species are disparate. We evaluate the response of eight bacterial strains, including two variants of Escherichia coli, two variants of Staphylococcus capitis, and one each of Acetobacter aceti, Gluconobacter suboxydans, Lactobacillus acetotolerans, and L. bulgaricus, to acetate challenges under identical conditions. Our findings were: (1) wild-type organisms of species that are considered tolerant of acetate perform only slightly better than E. coli in unadapted shaker cultures; (2) the ability to tolerate acetate is strongly dependent on the carbon source, and is, especially for E. coli, much greater on glycerol than on glucose; (3) respiration is not as important to acetate tolerance in E. coli and S. capitis as has been reported for the acetic acid bacteria; (4) S. capitis was the least affected by acetate under all conditions and grew at up to 44 g/l acetate without any preconditioning; and (5) qualitative high-throughput screening of growth characteristics can be achieved with relatively inexpensive multiwell plate readers. PMID:10968640

  7. Species Composition of Bacterial Communities Influences Attraction of Mosquitoes to Experimental Plant Infusions

    PubMed Central

    Ponnusamy, Loganathan; Wesson, Dawn M.; Arellano, Consuelo; Schal, Coby

    2013-01-01

    In the container habitats of immature mosquitoes, catabolism of plant matter and other organic detritus by microbial organisms produces metabolites that mediate the oviposition behavior of Aedes aegypti and Aedes albopictus. Public health agencies commonly use oviposition traps containing plant infusions for monitoring populations of these mosquito species, which are global vectors of dengue viruses. In laboratory experiments, gravid females exhibited significantly diminished responses to experimental infusions made with sterilized white oak leaves, showing that attractive odorants were produced through microbial metabolic activity. We evaluated effects of infusion concentration and fermentation time on attraction of gravid females to infusions made from senescent bamboo or white oak leaves. We used plate counts of heterotrophic bacteria, total counts of 4′,6-diamidino-2-phenylindole-stained bacterial cells, and 16S ribosomal DNA (rDNA) polymerase chain reaction–denaturing gradient gel electrophoresis (DGGE) to show that changes in the relative abundance of bacteria and the species composition of bacterial communities influenced attraction of gravid A. aegypti and A. albopictus mosquitoes to infusions. DGGE profiles showed that bacterial species composition in infusions changed over time. Principal components analysis indicated that oviposition responses to plant infusions were in general most affected by bacterial diversity and abundance. Analysis of bacterial 16S rDNA sequences derived from DGGE bands revealed that Proteo-bacteria (Alpha-, Beta-, Delta-, and Gamma-) were the predominant bacteria detected in both types of plant infusions. Gravid A. aegypti were significantly attracted to a mix of 14 bacterial species cultured from bamboo leaf infusion. The oviposition response of gravid mosquitoes to plant infusions is strongly influenced by abundance and diversity of bacterial species, which in turn is affected by plant species, leaf biomass, and fermentation

  8. Bacterial community dynamics during industrial malting, with an emphasis on lactic acid bacteria.

    PubMed

    Justé, A; Malfliet, S; Waud, M; Crauwels, S; De Cooman, L; Aerts, G; Marsh, T L; Ruyters, S; Willems, K; Busschaert, P; Lievens, B

    2014-05-01

    Characterization of the microflora during malting is an essential step towards process management and optimization. Up till now, however, microbial characterization in the malting process has mostly been done using culture-dependent methods, probably leading to biased estimates of microbial diversity. The aim of this study was to characterize the bacterial communities using two culture-independent methods, including Terminal Restriction Fragment Length Polymorphism (T-RFLP) and 454 pyrosequencing, targeting the 16S rRNA gene. Studied samples originated from two harvest years and two malting houses malting the same batch of barley. Besides targeting the entire bacterial community (T-RFLP), emphasis was put on lactic acid bacteria (LAB) (T-RFLP and 454 pyrosequencing). The overall bacterial community richness was limited, but the community structure changed during the process. Zooming in on the LAB community using 454 pyrosequencing revealed a total of 47 species-level operational taxonomic units (OTUs). LAB diversity appeared relatively limited since 88% of the sequences were covered by the same five OTUs (representing members of Weissella, Lactobacillus and Leuconostoc) present in all samples investigated. Fluctuations in the relative abundances of the dominant LAB were observed with the process conditions. In addition, both the year of harvest and malting house influenced the LAB community structure. PMID:24387850

  9. Reactive oxygen species-mediated bacterial killing by B lymphocytes.

    PubMed

    Kovács, István; Horváth, Magdolna; Lányi, Árpád; Petheő, Gábor L; Geiszt, Miklós

    2015-06-01

    Regulated production of ROS is mainly attributed to Nox family enzymes. In neutrophil granulocytes and macrophages, Nox2 has a crucial role in bacterial killing, and the absence of phagocytic ROS production leads to the development of CGD. Expression of Nox2 was also described in B lymphocytes, where the role of the enzyme is still poorly understood. Here, we show that peritoneal B cells, which were shown recently to possess phagocytic activity, have a high capacity to produce ROS in a Nox2-dependent manner. In phagocytosing B cells, intense intraphagosomal ROS production is detected. Finally, by studying 2 animal models of CGD, we demonstrate that phagocyte oxidase-deficient B cells have a reduced capacity to kill bacteria. Our observations extend the number of immune cell types that produce ROS to kill pathogens. PMID:25821233

  10. Bacterial genomic epidemiology, from local outbreak characterization to species-history reconstruction.

    PubMed

    Gaiarsa, Stefano; De Marco, Leone; Comandatore, Francesco; Marone, Piero; Bandi, Claudio; Sassera, Davide

    2015-10-01

    Bacteriology has embraced the next-generation sequencing revolution, swiftly moving from the time of single genome sequencing to the age of genomic epidemiology. Hundreds and now even thousands of genomes are being sequenced for single bacterial species, allowing unprecedented levels of resolution and insight in the evolution and epidemic diffusion of the main bacterial pathogens. Here, we present a review of some of the most recent and groundbreaking studies in this field. PMID:26878934

  11. [Advances in the progress of anti-bacterial biofilms properties of acetic acid].

    PubMed

    Gao, Xinxin; Jin, Zhenghua; Chen, Xinxin; Yu, Jia'ao

    2016-06-01

    Bacterial biofilms are considered to be the hindrance in the treatment of chronic wound, because of their tolerance toward antibiotics and other antimicrobial agents. They also have strong ability to escape from the host immune attack. Acetic acid, as a kind of organic weak acid, can disturb the biofilms by freely diffusing through the bacterial biofilms and bacterial cell membrane structure. Then the acid dissociates to release the hydrogen ions, leading to the disorder of the acid-base imbalance, change of protein conformation, and the degradation of the DNA within the membranes. This paper reviews the literature on the characteristics and treatment strategies of the bacterial biofilms and the acetic acid intervention on them, so as to demonstrate the roles acetic acid may play in the treatment of chronic wound, and thus provide a convincing treatment strategy for this kind of disease. PMID:27321493

  12. Effect of Organic Matter Decomposition Level on Bacterial Species Diversity and Composition in Relationship to Pythium Damping-Off Severity

    PubMed Central

    Boehm, M. J.; Madden, L. V.; Hoitink, H. A. J.

    1993-01-01

    Rhizosphere bacteria were isolated from root tip segments of cucumber seedlings grown in a suppressive, slightly decomposed light-colored peat mix, a conducive, more decomposed dark-colored peat mix, and a suppressive dark peat mix amended with composted hardwood bark. The bacteria were identified by a gas chromatographic fatty acid methyl ester analysis. The total number of taxa recovered from a single root tip segment ranged from 9 to 18. No single taxon predominated on all root tip segments harvested from any of the mixes. The highest relative population density reached by a given taxon on any root tip segment was 45%. Hill's first and second diversity numbers, the modified Hill's ratio, and Hurlbert's rarefaction method, which were used as measures of species diversity, indicated that the organic matter decomposition level of the potting mixes did not affect bacterial species diversity. Bray-Curtis polar ordination and Dice resemblance functions, however, indicated that the organic matter decomposition level of a mix significantly influenced the composition of bacterial species in the rhizosphere. Pseudomonas spp. and other taxa capable of inducing suppression of pythium damping-off predominated in the suppressive mixes. These organisms were absent from the conducive mix, in which Arthrobacter and Bacillus spp. predominated. Although effective bacterial biocontrol agents were isolated from both the suppressive mixes and the conducive mix, the majority were isolated from the less decomposed suppressive mixes. Finally, the efficacy of strains was significantly greater in the slightly decomposed light peat mix than in the decomposed dark peat mix. Natural disease suppression within these mixes was associated with the organic matter decomposition level and the bacterial species compositions of the mixes. PMID:16349117

  13. In Silico Phylogenetic Analysis and Molecular Modelling Study of 2-Haloalkanoic Acid Dehalogenase Enzymes from Bacterial and Fungal Origin

    PubMed Central

    Satpathy, Raghunath; Konkimalla, V. B.; Ratha, Jagnyeswar

    2016-01-01

    2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA), conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K) and aspartate (D) residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models. PMID:26880911

  14. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03

    PubMed Central

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-01-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l-1. The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters. PMID:25253925

  15. Bacterial Fatty Acid Synthesis and its Relationships with Polyketide Synthetic Pathways

    PubMed Central

    Cronan, John E.; Thomas, Jacob

    2014-01-01

    This review presents the most thoroughly studied bacterial fatty acid synthetic pathway, that of Escherichia coli and then discusses the exceptions to the E. coli pathway present in other bacteria. The known interrelationships between the fatty acid and polyketide synthetic pathways are also assessed, mainly in the Streptomyces group of bacteria. Finally, we present a compendium of methods for analysis of bacterial fatty acid synthetic pathways. PMID:19362649

  16. Bacterial Community Structure of Acid-Impacted Lakes: What Controls Diversity?▿ †

    PubMed Central

    Percent, Sascha F.; Frischer, Marc E.; Vescio, Paul A.; Duffy, Ellen B.; Milano, Vincenzo; McLellan, Maggie; Stevens, Brett M.; Boylen, Charles W.; Nierzwicki-Bauer, Sandra A.

    2008-01-01

    Although it is recognized that acidification of freshwater systems results in decreased overall species richness of plants and animals, little is known about the response of aquatic microbial communities to acidification. In this study we examined bacterioplankton community diversity and structure in 18 lakes located in the Adirondack Park (in the state of New York in the United States) that were affected to various degrees by acidic deposition and assessed correlations with 31 physical and chemical parameters. The pH of these lakes ranged from 4.9 to 7.8. These studies were conducted as a component of the Adirondack Effects Assessment Program supported by the U.S. Environmental Protection Agency. Thirty-one independent 16S rRNA gene libraries consisting of 2,135 clones were constructed from epilimnion and hypolimnion water samples. Bacterioplankton community composition was determined by sequencing and amplified ribosomal DNA restriction analysis of the clone libraries. Nineteen bacterial classes representing 95 subclasses were observed, but clone libraries were dominated by representatives of the Actinobacteria and Betaproteobacteria classes. Although the diversity and richness of bacterioplankton communities were positively correlated with pH, the overall community composition assessed by principal component analysis was not. The strongest correlations were observed between bacterioplankton communities and lake depth, hydraulic retention time, dissolved inorganic carbon, and nonlabile monomeric aluminum concentrations. While there was not an overall correlation between bacterioplankton community structure and pH, several bacterial classes, including the Alphaproteobacteria, were directly correlated with acidity. These results indicate that unlike more identifiable correlations between acidity and species richness for higher trophic levels, controls on bacterioplankton community structure are likely more complex, involving both direct and indirect processes. PMID

  17. Synthetic riboswitches that induce gene expression in diverse bacterial species.

    PubMed

    Topp, Shana; Reynoso, Colleen M K; Seeliger, Jessica C; Goldlust, Ian S; Desai, Shawn K; Murat, Dorothée; Shen, Aimee; Puri, Aaron W; Komeili, Arash; Bertozzi, Carolyn R; Scott, June R; Gallivan, Justin P

    2010-12-01

    We developed a series of ligand-inducible riboswitches that control gene expression in diverse species of Gram-negative and Gram-positive bacteria, including human pathogens that have few or no previously reported inducible expression systems. We anticipate that these riboswitches will be useful tools for genetic studies in a wide range of bacteria. PMID:20935124

  18. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species

    PubMed Central

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-01-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species. PMID:26884157

  19. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species.

    PubMed

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-03-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species. PMID:26884157

  20. Inactivation of CRISPR-Cas systems by anti-CRISPR proteins in diverse bacterial species.

    PubMed

    Pawluk, April; Staals, Raymond H J; Taylor, Corinda; Watson, Bridget N J; Saha, Senjuti; Fineran, Peter C; Maxwell, Karen L; Davidson, Alan R

    2016-01-01

    CRISPR-Cas systems provide sequence-specific adaptive immunity against foreign nucleic acids(1,2). They are present in approximately half of all sequenced prokaryotes(3) and are expected to constitute a major barrier to horizontal gene transfer. We previously described nine distinct families of proteins encoded in Pseudomonas phage genomes that inhibit CRISPR-Cas function(4,5). We have developed a bioinformatic approach that enabled us to discover additional anti-CRISPR proteins encoded in phages and other mobile genetic elements of diverse bacterial species. We show that five previously undiscovered families of anti-CRISPRs inhibit the type I-F CRISPR-Cas systems of both Pseudomonas aeruginosa and Pectobacterium atrosepticum, and a dual specificity anti-CRISPR inactivates both type I-F and I-E CRISPR-Cas systems. Mirroring the distribution of the CRISPR-Cas systems they inactivate, these anti-CRISPRs were found in species distributed broadly across the phylum Proteobacteria. Importantly, anti-CRISPRs originating from species with divergent type I-F CRISPR-Cas systems were able to inhibit the two systems we tested, highlighting their broad specificity. These results suggest that all type I-F CRISPR-Cas systems are vulnerable to inhibition by anti-CRISPRs. Given the widespread occurrence and promiscuous activity of the anti-CRISPRs described here, we propose that anti-CRISPRs play an influential role in facilitating the movement of DNA between prokaryotes by breaching the barrier imposed by CRISPR-Cas systems. PMID:27573108

  1. Enzymatic Degradation of Polygalacturonic Acid by Yersinia and Klebsiella Species in Relation to Clinical Laboratory Procedures

    PubMed Central

    Starr, Mortimer P.; Chatterjee, Arun K.; Starr, Phoebe B.; Buchanan, Gordon E.

    1977-01-01

    As scored by several specified plating procedures, clinical and environmental strains of Yersinia enterocolitica, Yersinia pseudotuberculosis, and Klebsiella pneumoniae “Oxytocum” showed detectable, albeit generally weak, ability to digest polygalacturonic (pectic) acid. None of these bacterial strains had the vigorous and rapid pectolytic activity on these polygalacturonic acid-containing media that is typical of soft-rot Erwinia species, although some of the Oxytocum strains came fairly close. Analyses of the pectolytic enzyme contents of the cells and culture supernatants of the Yersinia and Klebsiella species revealed that readily detectable quantities of cell-bound polygalacturonic acid trans-eliminase and hydrolytic polygalacturonase were formed by the Yersinia and Klebsiella species; however, the total units of enzyme activity produced by these bacteria were, in general, lower than were produced by soft-rot Erwinia species. Furthermore, unlike the situation in soft-rot Erwinia cultures, these pectolytic enzymes of Yersinia and Klebsiella species were not excreted rapidly and massively into the growth medium. Cultures of other enterobacteria (Citrobacter species, Enterobacter species, Erwinia amylovora, Erwinia herbicola, Escherichia coli, Proteus species, Salmonella typhimurium, and Serratia marcescens) showed no pectolytic ability whatsoever by any of the plating procedures used and (to the extent they were so examined) produced no pectolytic enzymes detectable either in their cells or culture supernatants. This slow or weak release of pectolytic enzymes by Yersinia and Klebsiella species has a bearing on clinical laboratory procedures suitable for detecting their pectolytic activity; methods adequate for this purpose are detailed. PMID:334794

  2. Bacterial community in sclerotia of Cenococcum species and soil in sub-alpine forest, central Japan

    NASA Astrophysics Data System (ADS)

    Nonoyama, Y.; Narisawa, K.; Ohta, H.; Watanabe, M.

    2009-04-01

    Species of Cenococcum, ectomycorrhizal fungi, may be particularly abundant in cold- or nutrient-stressed habitats. The fungus is easily recognized by its jet-black hyphae, and distinct compact masses of fungal mycelium called sclerotia. They are hard, black, comparatively smooth and mostly spherical. Sclerotia are formed in rhizosphere and can provide sufficient inoculums for several years. The purpose of this study is to investigate bacterial community inside sclerotia, with an interest on contribution of sclerotia to microbial diversity in rhizosphere. To investigate bacterial community inside of the fungal sclerotia by 16S rDNA gene clone library, several hundred of sclerotia (ca. 1g) were collected from sub-alpine forest soil in central Japan. Furthermore, three sclerotium grains were applied to investigate internal bacteria community by culture method. The isolated bacterial strains were then proceeded to determine their 16S rDNA partial sequences. The predominant group determined by clone library analysis of 16S ribosomal RNA genes with DNA from the sclerotia was Acidobacteria in both sclerotia and soil. Bacterial community of sclerotia showed higher diversity compared to soil. On the contrary, bacterial flora isolated from single sclerotium differed each other. Additionally, the bacterial community was composed by limited species of related genus.

  3. Identification of different bacterial species in biofilms using confocal Raman microscopy

    NASA Astrophysics Data System (ADS)

    Beier, Brooke D.; Quivey, Robert G.; Berger, Andrew J.

    2010-11-01

    Confocal Raman microspectroscopy is used to discriminate between different species of bacteria grown in biofilms. Tests are performed using two bacterial species, Streptococcus sanguinis and Streptococcus mutans, which are major components of oral plaque and of particular interest due to their association with healthy and cariogenic plaque, respectively. Dehydrated biofilms of these species are studied as a simplified model of dental plaque. A prediction model based on principal component analysis and logistic regression is calibrated using pure biofilms of each species and validated on pure biofilms grown months later, achieving 96% accuracy in prospective classification. When biofilms of the two species are partially mixed together, Raman-based identifications are achieved within ~2 μm of the boundaries between species with 97% accuracy. This combination of spatial resolution and predication accuracy should be suitable for forming images of species distributions within intact two-species biofilms.

  4. Differing Prevalence and Diversity of Bacterial Species in Fetal Membranes from Very Preterm and Term Labor

    PubMed Central

    Jones, Hannah E.; Harris, Kathryn A.; Azizia, Malika; Bank, Lindsay; Carpenter, Bernadette; Hartley, John C.; Klein, Nigel; Peebles, Donald

    2009-01-01

    Background Intrauterine infection may play a role in preterm delivery due to spontaneous preterm labor (PTL) and preterm prolonged rupture of membranes (PPROM). Because bacteria previously associated with preterm delivery are often difficult to culture, a molecular biology approach was used to identify bacterial DNA in placenta and fetal membranes. Methodology/Principal findings We used broad-range 16S rDNA PCR and species-specific, real-time assays to amplify bacterial DNA from fetal membranes and placenta. 74 women were recruited to the following groups: PPROM <32 weeks (n = 26; 11 caesarean); PTL with intact membranes <32 weeks (n = 19; all vaginal birth); indicated preterm delivery <32 weeks (n = 8; all caesarean); term (n = 21; 11 caesarean). 50% (5/10) of term vaginal deliveries were positive for bacterial DNA. However, little spread was observed through tissues and species diversity was restricted. Minimal bacteria were detected in term elective section or indicated preterm deliveries. Bacterial prevalence was significantly increased in samples from PTL with intact membranes [89% (17/19) versus 50% (5/10) in term vaginal delivery p = 0.03] and PPROM (CS) [55% (6/11) versus 0% (0/11) in term elective CS, p = 0.01]. In addition, bacterial spread and diversity was greater in the preterm groups with 68% (13/19) PTL group having 3 or more positive samples and over 60% (12/19) showing two or more bacterial species (versus 20% (2/10) in term vaginal deliveries). Blood monocytes from women with PTL with intact membranes and PPROM who were 16S bacterial positive showed greater level of immune paresis (p = 0.03). A positive PCR result was associated with histological chorioamnionitis in preterm deliveries. Conclusion/Significance Bacteria are found in both preterm and term fetal membranes. A greater spread and diversity of bacterial species were found in tissues of women who had very preterm births. It is unclear to what extent the greater

  5. Assessing variation in bacterial composition between the rhizospheres of two mangrove tree species

    NASA Astrophysics Data System (ADS)

    Gomes, Newton C. M.; Cleary, Daniel F. R.; Pires, Ana C. C.; Almeida, Adelaide; Cunha, Angela; Mendonça-Hagler, Leda C. S.; Smalla, Kornelia

    2014-02-01

    This study aimed to determine to what extent roots from the common mangrove tree species Avicennia schaueriana and Laguncularia racemosa are able to impose a selective force on the composition of sediment bacterial communities in mangrove intertidal sediments using barcoded pyrosequencing analysis of 16S rRNA gene fragments (V4 hyper-variable region). The novel results showed that root systems of A. schaueriana and L. racemosa are associated with increased bacterial dominance, lower richness and compositional shifts of sediment bacterial communities. The proportion of OTUs (operational taxonomc units) belonging to the orders Rhizobiales and Vibrionales were enriched in rhizosphere samples from both plant species and sulphur-reducing bacteria (SRB) belonging to the order Desulfobacterales and Desulfuromonadales were enriched in the rhizosphere of A. schaueriana. In addition, Clostridium and Vibrio populations were more abundant in different mangrove rhizospheres. A. schaueriana and L. racemosa roots appear to be able to impose a selective force on the composition of mangrove sediment bacterial communities and this phenomenon appears to be plant species specific. Our findings provide new insights into the potential ecological roles of bacterial guilds in plant-microbe interactions and may aid rhizoengineering approaches for replanting impacted mangrove areas.

  6. Risk of Spontaneous Bacterial Peritonitis Associated With Gastric Acid Suppression

    PubMed Central

    Chang, Shy-Shin; Lai, Chih-Cheng; Lee, Meng-tse Gabriel; Lee, Yu-Chien; Tsai, Yi-Wen; Hsu, Wan-Ting; Lee, Chien-Chang

    2015-01-01

    Abstract The primary objective of this study was to determine the association between the use of gastric acid suppressants (GAS) and the risk of developing spontaneous bacterial peritonitis (SBP) in patients with advanced liver cirrhosis (LC). A case–control study nested within a cohort of 480,000 representatives of Taiwan National Health Insurance beneficiaries was carried out. A case was matched with 100 controls on age, gender, and index date of SBP diagnosis. GAS use was identified from the 1-year period before the index date. Conditional logistic regression analysis was used to adjust for various unbalanced covariates between users and nonusers of GAS. A total of 947 cases of SBP were identified among the 86,418 patients with advanced LC. A significant increased risk of developing SBP was found to be associated with current (within 30 days), and recent (within 30–90 day) use of 2 different classes of GAS: proton pump inhibitors (PPIs) and histamine 2 receptor antagonists (H2RAs). The confounder adjusted rate ratio (aRR) for the current use of PPIs was 2.77 (95%CI: 1.90–4.04) and H2RAs was 2.62 (95%CI: 2.00–3.42). The risk of SBP attenuated for the recent use of PPIs (aRR: 2.20, 95%CI: 1.60–3.02) or H2RAs (aRR: 1.72, 95%CI: 1.25–2.37). In addition, sensitivity analysis using hospitalized SBP as the primary outcome showed a similar risk for the current use of PPIs (aRR, 3.24; 95%CI: 2.08–5.05) and H2RAs (aRR 2.43; 95%CI 1.71–3.46). Furthermore, higher cumulative days of gastric acid suppression were associated with a higher risk of SBP (trend P < 0.0001). To conclude, exposure to GAS was associated with an increased risk of SBP in patients with advanced LC. The association was more pronounced in current PPI users compared with nonusers. PMID:26039135

  7. Impact of microfluidic processing on bacterial ribonucleic acid expression

    PubMed Central

    Gandi, Senthil Kumar; Watson, David; Kersaudy-Kerhoas, Maïwenn; Bachmann, Till; Bridle, Helen

    2015-01-01

    Bacterial transcriptomics is widely used to investigate gene regulation, bacterial susceptibility to antibiotics, host-pathogen interactions, and pathogenesis. Transcriptomics is crucially dependent on suitable methods to isolate and detect bacterial RNA. Microfluidics offer ways of creating integrated point-of-care systems, analysing a sample from preparation, and RNA isolation to detection. A critical requirement for on-chip diagnostics to deliver on their promise is that mRNA expression is not altered via microfluidic sample processing. This article investigates the impact of the use of microfluidics upon RNA expression of bacteria isolated from blood, a key step towards proving the suitability of such systems for further development. PMID:26045727

  8. Bacterial Diversity and Community Structure in Two Bornean Nepenthes Species with Differences in Nitrogen Acquisition Strategies.

    PubMed

    Sickel, Wiebke; Grafe, T Ulmar; Meuche, Ivonne; Steffan-Dewenter, Ingolf; Keller, Alexander

    2016-05-01

    Carnivorous plants of the genus Nepenthes have been studied for over a century, but surprisingly little is known about associations with microorganisms. The two species Nepenthes rafflesiana and Nepenthes hemsleyana differ in their pitcher-mediated nutrient sources, sequestering nitrogen from arthropod prey and arthropods as well as bat faeces, respectively. We expected bacterial communities living in the pitchers to resemble this diet difference. Samples were taken from different parts of the pitchers (leaf, peristome, inside, outside, digestive fluid) of both species. Bacterial communities were determined using culture-independent high-throughput amplicon sequencing. Bacterial richness and community structure were similar in leaves, peristomes, inside and outside walls of both plant species. Regarding digestive fluids, bacterial richness was higher in N. hemsleyana than in N. rafflesiana. Additionally, digestive fluid communities were highly variable in structure, with strain-specific differences in community composition between replicates. Acidophilic taxa were mostly of low abundance, except the genus Acidocella, which strikingly reached extremely high levels in two N. rafflesiana fluids. In N. hemsleyana fluid, some taxa classified as vertebrate gut symbionts as well as saprophytes were enriched compared to N. rafflesiana, with saprophytes constituting potential competitors for nutrients. The high variation in community structure might be caused by a number of biotic and abiotic factors. Nitrogen-fixing bacteria were present in both study species, which might provide essential nutrients to the plant at times of low prey capture and/or rare encounters with bats. PMID:26790863

  9. Influence of the acid type in the production of chitosan films reinforced with bacterial nanocellulose.

    PubMed

    Velásquez-Cock, J; Ramírez, E; Betancourt, S; Putaux, J-L; Osorio, M; Castro, C; Gañán, P; Zuluaga, R

    2014-08-01

    Chitosan films reinforced with bacterial cellulose (BC) nanoribbons were studied to understand the influence of acid (acetic and lactic acids) on the reinforcing effect. For both acids, the maximum concentration of the reinforcing constituent was 5wt% with respect to the dry weight of chitosan. The infrared spectra, mechanical properties, morphology and antimicrobial activity of the films were analyzed. The results showed a difference between the acids in their behavior and effect on the reinforcement, with a tensile strength of 12.3MPa for the acetic acid films and 3.3MPa for the lactic acid films. Additionally, the bacterial inhibition tests were shown to be positive for the lactic acid films and negative for the acetic acid films. Therefore, exchanging the acid used in these films may be desirable for certain applications. PMID:24875317

  10. Nucleic acid relationships among Acholeplasma species.

    PubMed Central

    Aulakh, G S; Stephens, E B; Rose, D L; Tully, J G; Barile, M F

    1983-01-01

    3H-labeled Acholeplasma DNA probes were generated in vitro by the nick-translation method and used to determine the nucleotide sequence homology among the type strains of the eight currently recognized species of Acholeplasma. Very little nucleotide sequence homology (less than or equal to 18%) was found among the eight species, with heteroduplexes showing at least 12% or more mismatching as determined by thermal elution midpoints. The small amount of nucleotide sequence homology among the eight species indicates that these species are quite distinct and are not closely related to each other genomically. PMID:6826524

  11. Assessment of Bacterial Communities in Thirteen Species of Laboratory-Cultured Domestic Mites (Acari: Acaridida).

    PubMed

    Hubert, Jan; Kopecky, Jan; Sagova-Mareckova, Marketa; Nesvorna, Marta; Zurek, Ludek; Erban, Tomas

    2016-08-01

    House dust mites (HDMs) and stored-product mites (SPMs) of various species inhabit human homes and stored agricultural products. These mites are carriers and hosts of microorganisms that enable their survival. The bacteriome from 13 species of SPMs and HDMs was analyzed and compared by 454 pyrosequencing of partial 16S rRNA gene amplicons. Altogether 128,052 sequences were obtained and assigned to 71 operational taxonomic units (OTUs) at the 97% identity level. The number of sequences in the OTUs between species of mites ranged from 6 to 31 in the individual mite species. We did not find any significant effect of diet or evolutionary origin of mites or their interaction on the composition of the mite bacteriome. In mite species with low bacterial diversity, the bacterial communities were dominated by potential symbiotic or parasitic bacteria, i.e., Cardinium in Dermatophagoides farinae (Hughes, 1961) and Aeroglyphus robustus (Banks 1906) and the enteric bacteria Erwinia in Blomia tropicalis Van Bronswijk, de Cock & Oshima, 1974 and Xenorhabdus in Tyroborus lini (Oudemans, 1924). Among the bacterial species identified, Staphylococcus, Bacillus, Kocuria, Brevibacterium, Corynebacterium, and Brachybacterium likely serve as food sources for the mites. The domestic acaridid mites carried high numbers of various bacteria that are potential threats to human health. These results contribute to the general understanding of the ecology of mite adaptation to human-made habitats. PMID:27122496

  12. Species sorting and neutral processes are both important during the initial assembly of bacterial communities

    PubMed Central

    Langenheder, Silke; Székely, Anna J

    2011-01-01

    Many studies have shown that species sorting, that is, the selection by local environmental conditions is important for the composition and assembly of bacterial communities. On the other hand, there are other studies that could show that bacterial communities are neutrally assembled. In this study, we implemented a microcosm experiment with the aim to determine, at the same time, the importance of species sorting and neutral processes for bacterial community assembly during the colonisation of new, that is, sterile, habitats, by atmospheric bacteria. For this we used outdoor microcosms, which contained sterile medium from three different rock pools representing different environmental conditions, which were seeded by rainwater bacteria. We found some evidence for neutral assembly processes, as almost every 4th taxon growing in the microcosms was also detectable in the rainwater sample irrespective of the medium. Most of these taxa belonged to widespread families with opportunistic growth strategies, such as the Pseudomonadaceae and Comamonadaceae, indicating that neutrally assembled taxa may primarily be generalists. On the other hand, we also found evidence for species sorting, as one out of three media selected a differently composed bacterial community. Species sorting effects were relatively weak and established themselves via differences in relative abundance of generalists among the different media, as well as media-specific occurrences of a few specific taxa. In summary, our results suggest that neutral and species sorting processes interact during the assembly of bacterial communities and that their importance may differ depending on how many generalists and specialists are present in a community. PMID:21270841

  13. Bacterial production of free fatty acids from freshwater macroalgal cellulose

    PubMed Central

    Hoovers, Spencer W.; Marner, Wesley D.; Brownson, Amy K.; Lennen, Rebecca M.; Wittkopp, Tyler M.; Yoshitani, Jun; Zulkifly, Shahrizim; Graham, Linda E.; Chaston, Sheena D.; McMahon, Katherine D.

    2013-01-01

    The predominant strategy for using algae to produce biofuels relies on the overproduction of lipids in microalgae with subsequent conversion to biodiesel (methyl-esters) or green diesel (alkanes). Conditions that both optimize algal growth and lipid accumulation rarely overlap, and differences in growth rates can lead to wild species outcompeting the desired lipid-rich strains. Here, we demonstrate an alternative strategy in which cellulose contained in the cell walls of multicellular algae is used as a feedstock for cultivating biofuel-producing micro-organisms. Cellulose was extracted from an environmental sample of Cladophora glomerata-dominated periphyton that was collected from Lake Mendota, WI, USA. The resulting cellulose cake was hydrolyzed by commercial enzymes to release fermentable glucose. The hydrolysis mixture was used to formulate an undefined medium that was able to support the growth, without supplementation, of a free fatty acid (FFA)-overproducing strain of Escherichia coli (Lennen et. al 2010). To maximize free fatty acid production from glucose, an isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible vector was constructed to express the Umbellularia californica acyl–acyl carrier protein (ACP) thioesterase. Thioesterase expression was optimized by inducing cultures with 50 μM IPTG. Cell density and FFA titers from cultures grown on algae-based media reached 50% of those (~90 μg/mL FFA) cultures grown on rich Luria–Bertani broth supplemented with 0.2% glucose. In comparison, cultures grown in two media based on AFEX-pretreated corn stover generated tenfold less FFA than cultures grown in algae-based media. This study demonstrates that macroalgal cellulose is a potential carbon source for the production of biofuels or other microbially synthesized compounds. PMID:21643704

  14. Plants of the fynbos biome harbour host species-specific bacterial communities.

    PubMed

    Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel

    2016-08-01

    The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth. PMID:27190163

  15. Cuticles of European and American lobsters harbor diverse bacterial species and differ in disease susceptibility

    PubMed Central

    Whitten, Miranda M A; Davies, Charlotte E; Kim, Anita; Tlusty, Michael; Wootton, Emma C; Chistoserdov, Andrei; Rowley, Andrew F

    2014-01-01

    Diseases of lobster shells have a significant impact on fishing industries but the risk of disease transmission between different lobster species has yet to be properly investigated. This study compared bacterial biofilm communities from American (Homarus americanus) and European lobsters (H. gammarus), to assess both healthy cuticle and diseased cuticle during lesion formation. Culture-independent molecular techniques revealed diversity in the bacterial communities of cuticle biofilms both within and between the two lobster species, and identified three bacterial genera associated with shell lesions plus two putative beneficial bacterial species (detected exclusively in healthy cuticle or healing damaged cuticle). In an experimental aquarium shared between American and European lobsters, heterospecific transmission of potentially pathogenic bacteria appeared to be very limited; however, the claws of European lobsters were more likely to develop lesions when reared in the presence of American lobsters. Aquarium biofilms were also examined but revealed no candidate pathogens for environmental transmission. Aquimarina sp. ‘homaria’ (a potential pathogen associated with a severe epizootic form of shell disease) was detected at a much higher prevalence among American than European lobsters, but its presence correlated more with exacerbation of existing lesions rather than with lesion initiation. PMID:24817518

  16. Intestinal Bacterial Flora and Transit Time of Three Neotropical Bat Species

    PubMed Central

    Klite, P. D.

    1965-01-01

    Klite, P. D. (Middle America Research Unit, Balboa Heights, Canal Zone). Intestinal bacterial flora and transit time of three neotropical bat species. J. Bacteriol. 90:375–379. 1965.—Quantitative studies on the intestinal bacterial flora of three neotropical bat species revealed the following average bacterial populations: Molossus major, 104.8 bacteria per intestinal contents; Carollia perspicillata, 103.3; Chilonycteris rubiginosa, 103.9. In comparison, laboratory mice had an average of 109.7 bacteria per intestinal contents. Of 236 bacterial isolates obtained from 60 bats, bacteria of the Klebsiella-Aerobacter-Serratia group were found most frequently, followed by enterococci and Proteus spp. Bacteria of eight other groups were less frequently recovered. A large intestine, cecum, or appendix was absent in all three bat species, and the intestinal length was one-third to one-fifth of that in a mouse of comparable weight. The transit time through the short bat intestine was 15 min. The possible relationship of these unusual anatomical and physiological phenomena to the ability of Histoplasma capsulatum to survive in bat feces is discussed. PMID:14329450

  17. Diazotrophic potential among bacterial communities associated with wild and cultivated Agave species.

    PubMed

    Desgarennes, Damaris; Garrido, Etzel; Torres-Gomez, Miryam J; Peña-Cabriales, Juan J; Partida-Martinez, Laila P

    2014-12-01

    Agaves are major biotic resources in arid and semi-arid ecosystems. Despite their ecological, economical and cultural relevance, many aspects of the microbial communities associated with agaves are still unknown. Here, we investigated the bacterial communities associated with two Agave species by 16S rRNA- Denaturing gradient gel electrophoresis fingerprinting and sequencing. We also evaluated the effects of biotic and abiotic factors in the structure of the bacterial communities. In parallel, we isolated and characterized diazotrophic bacteria associated with agaves, as Agave soils are characterized by their low nitrogen content. Our results demonstrate that in Agave, the structure of prokaryotic assemblages was mostly influenced by the community group, where the soil, episphere, and endosphere were clearly distinct. Proteobacteria (γ and α), Actinobacteria, and Acidobacteria were the dominant phyla. Bacterial communities in the episphere of agaves were mainly influenced by the host species, whereas in the endosphere were affected by the season. Fifteen bacterial taxa were common and abundant in the endosphere of both Agave species during the dry season. Notably, some of the confirmed diazotrophic strains belonged to this group, suggesting a possible beneficial role in planta. PMID:25314594

  18. Massive Infection of Seabird Ticks with Bacterial Species Related to Coxiella burnetii

    PubMed Central

    Dietrich, Muriel; Lebarbenchon, Camille; Jaeger, Audrey; Le Rouzic, Céline; Bastien, Matthieu; Lagadec, Erwan; McCoy, Karen D.; Pascalis, Hervé; Le Corre, Matthieu; Dellagi, Koussay; Tortosa, Pablo

    2014-01-01

    Seabird ticks are known reservoirs of bacterial pathogens of medical importance; however, ticks parasitizing tropical seabirds have received less attention than their counterparts from temperate and subpolar regions. Recently, Rickettsia africae was described to infect seabird ticks of the western Indian Ocean and New Caledonia, constituting the only available data on bacterial pathogens associated with tropical seabird tick species. Here, we combined a pyrosequencing-based approach with a classical molecular analysis targeting bacteria of potential medical importance in order to describe the bacterial community in two tropical seabird ticks, Amblyomma loculosum and Carios (Ornithodoros) capensis. We also investigated the patterns of prevalence and host specificity within the biogeographical context of the western Indian Ocean islands. The bacterial community of the two tick species was characterized by a strong dominance of Coxiella and Rickettsia. Our data support a strict Coxiella-host tick specificity, a pattern resembling the one found for Rickettsia spp. in the same two seabird tick species. Both the high prevalence and stringent host tick specificity suggest that these bacteria may be tick symbionts with probable vertical transmission. Detailed studies of the pathogenicity of these bacteria will now be required to determine whether horizontal transmission can occur and to clarify their status as potential human pathogens. More generally, our results show that the combination of next generation sequencing with targeted detection/genotyping approaches proves to be efficient in poorly investigated fields where research can be considered to be starting from scratch. PMID:24657860

  19. Identification of household bacterial community and analysis of species shared with human microbiome.

    PubMed

    Jeon, Yoon-Seong; Chun, Jongsik; Kim, Bong-Soo

    2013-11-01

    Microbial populations in indoor environments, where we live and eat, are important for public health. Various bacterial species reside in the kitchen, and refrigerators, the major means of food storage within kitchens, can be a direct source of food borne illness. Therefore, the monitoring of microbiota in the refrigerator is important for food safety. We investigated and compared bacterial communities that reside in the vegetable compartment of the refrigerator and on the seat of the toilet, which is recognized as highly colonized by microorganisms, in ten houses using high-throughput sequencing. Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes were predominant in refrigerator and toilet samples. However, Proteobacteria was more abundant in the refrigerator, and Firmicutes was more abundant in the toilet. These household bacterial communities were compared with those of human skin and gut to identify potential sources of household bacteria. Bacterial communities from refrigerators and toilets shared more species in common with human skin than gut. Opportunistic pathogens, including Propionibacterium acnes, Bacteroides vulgatus, and Staphylococcus epidermidis, were identified as species shared with human skin and gut microbiota. This approach can provide a general background of the household microbiota and a potential method of source-tracking for public health purposes. PMID:23743600

  20. Heavy metals species affect fungal-bacterial synergism during the bioremediation of fluoranthene.

    PubMed

    Ma, Xiao-Kui; Ding, Ning; Peterson, Eric Charles; Daugulis, Andrew J

    2016-09-01

    The co-occurrence of polycyclic aromatic hydrocarbons (PAHs) with heavy metals (HMs) is very common in contaminated soils, but the influence of HMs on fungal-bacterial synergism during PAH bioremediation has not been investigated. The bioremediation of fluoranthene-contaminated sand using co-cultures of Acremonium sp. P0997 and Bacillus subtilis showed increases of 109.4 and 9.8 % in degradation compared to pure bacterial and fungal cultures, respectively, removing 64.1 ± 1.4 % fluoanthene in total. The presence of Cu(2+) reduced fluoranthene removal to 53.7 ± 1.7 %, while inhibiting bacterial growth, and reducing translocation of bacteria on fungal hyphae by 49.5 %, in terms of the bacterial translocation ratio. Cu(2+) reduced bacterial diffusion by 46.8 and 31.9 %, as reflected by D (a bulk random motility diffusional coefficient) and D eff (the effective one-dimensional diffusion coefficient) compared to the control without HM supplementation, respectively. However, Mn(2+) resulted in a 78.2 ± 1.9 % fluoranthene degradation, representing an increase of 21.9 %, while enhancing bacterial growth and bacterial translocation on fungal hyphae, showing a 12.0 % increase in translocation ratio, with no observable impact on D and D eff. Hence, the presence of HMs has been shown to affect fungal-bacterial synergism in PAH degradation, and this effect differs with HM species. PMID:27178182

  1. Bacterial communities associated with the pitcher fluids of three Nepenthes (Nepenthaceae) pitcher plant species growing in the wild.

    PubMed

    Chou, Lee Yiung; Clarke, Charles M; Dykes, Gary A

    2014-10-01

    Nepenthes pitcher plants produce modified jug-shaped leaves to attract, trap and digest insect prey. We used 16S rDNA cloning and sequencing to compare bacterial communities in pitcher fluids of each of three species, namely Nepenthes ampullaria, Nepenthes gracilis and Nepenthes mirabilis, growing in the wild. In contrast to previous greenhouse-based studies, we found that both opened and unopened pitchers harbored bacterial DNA. Pitchers of N. mirabilis had higher bacterial diversity as compared to other Nepenthes species. The composition of the bacterial communities could be different between pitcher types for N. mirabilis (ANOSIM: R = 0.340, p < 0.05). Other Nepenthes species had similar bacterial composition between pitcher types. SIMPER showed that more than 50 % of the bacterial taxa identified from the open pitchers of N. mirabilis were not found in other groups. Our study suggests that bacteria in N. mirabilis are divided into native and nonnative groups. PMID:25005571

  2. Coral-Associated Bacterial Diversity Is Conserved across Two Deep-Sea Anthothela Species

    PubMed Central

    Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C.; Clostio, Rachel W.; Brooke, Sandra D.; Ross, Steve W.

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4–V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont. PMID:27092120

  3. Coral-associated bacterial diversity is conserved across two deep-sea Anthothela species

    USGS Publications Warehouse

    Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C; Clostio, Rachel W; Brooke, Sandra D.; Ross, Steve W.

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4-V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont.

  4. Coral-Associated Bacterial Diversity Is Conserved across Two Deep-Sea Anthothela Species.

    PubMed

    Lawler, Stephanie N; Kellogg, Christina A; France, Scott C; Clostio, Rachel W; Brooke, Sandra D; Ross, Steve W

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4-V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont. PMID:27092120

  5. Bacterial-biota dynamics of eight bryophyte species from different ecosystems

    PubMed Central

    Koua, Faisal Hammad Mekky; Kimbara, Kazuhide; Tani, Akio

    2014-01-01

    Despite the importance of bryophyte-associated microorganisms in various ecological aspects including their crucial roles in the soil-enrichment of organic mass and N2 fixation, nonetheless, little is known about the microbial diversity of the bryophyte phyllospheres (epi-/endophytes). To get insights into bacterial community structures and their dynamics on the bryophyte habitats in different ecosystems and their potential biological roles, we utilized the 16S rRNA gene PCR-DGGE and subsequent phylogenetic analyses to investigate the bacterial community of eight bryophyte species collected from three distinct ecosystems from western Japan. Forty-two bacterial species belonging to γ-proteobacteria and Firmicutes with 71.4% and 28.6%, respectively, were identified among 90 DGGE gel band population. These DGGE-bands were assigned to 13 different genera with obvious predomination the genus Clostridium with 21.4% from the total bacterial community. These analyses provide new insights into bryophyte-associated bacteria and their relations to the ecosystems. PMID:25737654

  6. Bacterial-biota dynamics of eight bryophyte species from different ecosystems.

    PubMed

    Koua, Faisal Hammad Mekky; Kimbara, Kazuhide; Tani, Akio

    2015-03-01

    Despite the importance of bryophyte-associated microorganisms in various ecological aspects including their crucial roles in the soil-enrichment of organic mass and N2 fixation, nonetheless, little is known about the microbial diversity of the bryophyte phyllospheres (epi-/endophytes). To get insights into bacterial community structures and their dynamics on the bryophyte habitats in different ecosystems and their potential biological roles, we utilized the 16S rRNA gene PCR-DGGE and subsequent phylogenetic analyses to investigate the bacterial community of eight bryophyte species collected from three distinct ecosystems from western Japan. Forty-two bacterial species belonging to γ-proteobacteria and Firmicutes with 71.4% and 28.6%, respectively, were identified among 90 DGGE gel band population. These DGGE-bands were assigned to 13 different genera with obvious predomination the genus Clostridium with 21.4% from the total bacterial community. These analyses provide new insights into bryophyte-associated bacteria and their relations to the ecosystems. PMID:25737654

  7. Bacterial production and transformation of dissolved neutral sugars and amino acids in seawater

    NASA Astrophysics Data System (ADS)

    Jørgensen, L.; Lechtenfeld, O.; Benner, R.; Middelboe, M.; Stedmon, C. A.

    2014-04-01

    Dissolved organic matter (DOM) in the ocean consists of a heterogeneous mixture of molecules, most of which are of unknown origin. Neutral sugars and amino acids are among the few recognizable biomolecules in DOM, and the molecular composition of these biomolecules is shaped primarily by biological production and degradation processes. This study provides insight into the bioavailability of biomolecules as well as the chemical composition of DOM produced by bacteria. The molecular compositions of neutral sugars and amino acids were investigated in DOM produced by bacteria and in DOM remaining after long-term bacterial degradation. Results from bioassay incubations (32 days) with natural and artificial seawater, indicate that the molecular compositions following bacterial degradation are not strongly influenced by the initial substrate or bacterial community. The molecular composition of neutral sugars released by bacteria was characterized by a high glucose content (47 mol%) and heterogeneous contributions from other neutral sugars (3-14 mol%). DOM remaining after bacterial degradation was characterized by a high galactose content (33 mol%), followed by glucose (22 mol%) and the remaining neutral sugars (7-11 mol%). The ratio of D-amino acids to L-amino acids increased during the experiments as a response to bacterial degradation, and after 32 days the D/L ratios of aspartic acid, glutamic acid, serine and alanine reached around 0.79, 0.32, 0.30 and 0.51 in all treatments, respectively. The striking similarity in neutral sugar and amino acid compositions between natural and artificial seawater samples, suggests that the microbial carbon pump also applies for neutral sugars and amino acids and that bacterially-produced biomolecules persist for long periods in the ocean.

  8. Modular riboswitch toolsets for synthetic genetic control in diverse bacterial species.

    PubMed

    Robinson, Christopher J; Vincent, Helen A; Wu, Ming-Cheng; Lowe, Phillip T; Dunstan, Mark S; Leys, David; Micklefield, Jason

    2014-07-30

    Ligand-dependent control of gene expression is essential for gene functional analysis, target validation, protein production, and metabolic engineering. However, the expression tools currently available are difficult to transfer between species and exhibit limited mechanistic diversity. Here we demonstrate how the modular architecture of purine riboswitches can be exploited to develop orthogonal and chimeric switches that are transferable across diverse bacterial species, modulating either transcription or translation, to provide tunable activation or repression of target gene expression, in response to synthetic non-natural effector molecules. Our novel riboswitch-ligand pairings are shown to regulate physiologically important genes required for bacterial motility in Escherichia coli and cell morphology in Bacillus subtilis. These findings are relevant for future gene function studies and antimicrobial target validation, while providing new modular and orthogonal regulatory components for deployment in synthetic biology regimes. PMID:24971878

  9. Genome-wide survey of codons under diversifying selection in a highly recombining bacterial species, Helicobacter pylori

    PubMed Central

    Yahara, Koji; Furuta, Yoshikazu; Morimoto, Shinpei; Kikutake, Chie; Komukai, Sho; Matelska, Dorota; Dunin-Horkawicz, Stanisław; Bujnicki, Janusz M.; Uchiyama, Ikuo; Kobayashi, Ichizo

    2016-01-01

    Selection has been a central issue in biology in eukaryotes as well as prokaryotes. Inference of selection in recombining bacterial species, compared with clonal ones, has been a challenge. It is not known how codons under diversifying selection are distributed along the chromosome or among functional categories or how frequently such codons are subject to mutual homologous recombination. Here, we explored these questions by analysing genes present in >90% among 29 genomes of Helicobacter pylori, one of the bacterial species with the highest mutation and recombination rates. By a method for recombining sequences, we identified codons under diversifying selection (dN/dS > 1), which were widely distributed and accounted for ∼0.2% of all the codons of the genome. The codons were enriched in genes of host interaction/cell surface and genome maintenance (DNA replication, recombination, repair, and restriction modification system). The encoded amino acid residues were sometimes found adjacent to critical catalytic/binding residues in protein structures. Furthermore, by estimating the intensity of homologous recombination at a single nucleotide level, we found that these codons appear to be more frequently subject to recombination. We expect that the present study provides a new approach to population genomics of selection in recombining prokaryotes. PMID:26961370

  10. No role for bacterially produced salicylic Acid in rhizobacterial induction of systemic resistance in Arabidopsis.

    PubMed

    Ran, L X; van Loon, L C; Bakker, P A H M

    2005-11-01

    ABSTRACT The role of bacterially produced salicylic acid (SA) in the induction of systemic resistance in plants by rhizobacteria is far from clear. The strong SA producer Pseudomonas fluorescens WCS374r induces resistance in radish but not in Arabidopsis thaliana, whereas application of SA leads to induction of resistance in both plant species. In this study, we compared P. fluorescens WCS374r with three other SA-producing fluorescent Pseudomonas strains, P. fluorescens WCS417r and CHA0r, and P. aeruginosa 7NSK2 for their abilities to produce SA under different growth conditions and to induce systemic resistance in A. thaliana against bacterial speck, caused by P. syringae pv. tomato. All strains produced SA in vitro, varying from 5 fg cell(-1) for WCS417r to >25 fg cell(-1) for WCS374r. Addition of 200 muM FeCl(3) to standard succinate medium abolished SA production in all strains. Whereas the incubation temperature did not affect SA production by WCS417r and 7NSK2, strains WCS374r and CHA0r produced more SA when grown at 33 instead of 28 degrees C. WCS417r, CHA0r, and 7NSK2 induced systemic resistance apparently associated with their ability to produce SA, but WCS374r did not. Conversely, a mutant of 7NSK2 unable to produce SA still triggered induced systemic resistance (ISR). The possible involvement of SA in the induction of resistance was evaluated using SA-nonaccumulating transgenic NahG plants. Strains WCS417r, CHA0r, and 7NSK2 induced resistance in NahG Arabidopsis. Also, WCS374r, when grown at 33 or 36 degrees C, triggered ISR in these plants, but not in ethylene-insensitive ein2 or in non-plant pathogenesis- related protein-expressing npr1 mutant plants, irrespective of the growth temperature of the bacteria. These results demonstrate that, whereas WCS374r can be manipulated to trigger ISR in Arabidopsis, SA is not the primary determinant for the induction of systemic resistance against bacterial speck disease by this bacterium. Also, for the other

  11. Effects of viruses on bacterial functions under contrasting nutritional conditions for four species of bacteria isolated from Hong Kong waters

    NASA Astrophysics Data System (ADS)

    Liu, Hao; Yuan, Xiangcheng; Xu, Jie; Harrison, Paul J.; He, Lei; Yin, Kedong

    2015-09-01

    Free living viruses are ubiquitous in marine waters and concentrations are usually several times higher than the bacterial abundance. These viruses are capable of lysing host bacteria and therefore, play an important role in the microbial loop in oligotrophic waters. However, few studies have been conducted to compare the role of viruses in regulating bacterial abundance and heterotrophic activities between natural oligotrophic waters and anthropogenic influenced eutrophic waters. In this study, we examined viral effects on bacterial functions of four single bacterial species incubated with natural viral assemblages in seawater samples from eutrophic and oligotrophic waters. The viral-lysis of bacteria was significantly higher in eutrophic than oligotrophic waters. This suggests that viruses were capable of controlling bacterial abundance, respiration and production in the eutrophic waters. Cellular bacterial respiration and production was higher with viruses than without viruses, which was more evident in the oligotrophic waters. These results indicate that viruses can slow down bacterial consumption of oxygen and reduce bacteria-induced eutrophication effects in anthropogenic eutrophic waters, but switch to the role of sustaining the bacterial population when nutrients are limiting. There were bacterial species differences in resisting viral attack, which can influence the dominance and biodiversity of bacterial species in coastal waters.

  12. Effects of viruses on bacterial functions under contrasting nutritional conditions for four species of bacteria isolated from Hong Kong waters

    PubMed Central

    Liu, Hao; Yuan, Xiangcheng; Xu, Jie; Harrison, Paul J.; He, Lei; Yin, Kedong

    2015-01-01

    Free living viruses are ubiquitous in marine waters and concentrations are usually several times higher than the bacterial abundance. These viruses are capable of lysing host bacteria and therefore, play an important role in the microbial loop in oligotrophic waters. However, few studies have been conducted to compare the role of viruses in regulating bacterial abundance and heterotrophic activities between natural oligotrophic waters and anthropogenic influenced eutrophic waters. In this study, we examined viral effects on bacterial functions of four single bacterial species incubated with natural viral assemblages in seawater samples from eutrophic and oligotrophic waters. The viral-lysis of bacteria was significantly higher in eutrophic than oligotrophic waters. This suggests that viruses were capable of controlling bacterial abundance, respiration and production in the eutrophic waters. Cellular bacterial respiration and production was higher with viruses than without viruses, which was more evident in the oligotrophic waters. These results indicate that viruses can slow down bacterial consumption of oxygen and reduce bacteria-induced eutrophication effects in anthropogenic eutrophic waters, but switch to the role of sustaining the bacterial population when nutrients are limiting. There were bacterial species differences in resisting viral attack, which can influence the dominance and biodiversity of bacterial species in coastal waters. PMID:26404394

  13. [Determination of 16S rRNA gene sequence for a new ANAMMOX bacterial species].

    PubMed

    Zu, Bo; Zhang, Dai-jun; Yan, Qing

    2008-02-01

    The anaerobic ammonium oxidation (ANAMMOX) activity of the sludge was about 9.84 x 10(-4) mg x (mg x h)(-1) by measuring the simultaneous consumption of ammonium and nitrite under anoxic conditions in the batch tests. The consumption of NO2(-) -N and NH4+ -N was 1.311 for ANAMMOX bacteria. The partial 16S rDNA sequence was obtained by using molecule biology methods. Crude DNA of the total bacteria in granular sludge from EGSB reactor was extracted and purified. Then, PCR amplification by using specific primer, clone and sequence determination was performed. ANAMMOX bacterial species(anaerobic ammonium-oxidizing Planctomycete cquenviron-1) which was enrichment cultivated from EGSB reactor were the same genera with Candidatus "Anammoxoglobus propionicus" and Candidatus "Jettenia asiatica" by analyzing phylogenetic tree. The maximum identities of anaerobic ammonium-oxidizing Planctomycete cquenviron-1 with other ANAMMOX bacterial species was about 93%. The results showed that a new ANAMMOX bacterial species which was enrichment cultivated from EGSB reactor was found and anaerobic ammonium-oxidizing Planctomycete cquenviron-1 was denominated. PMID:18613522

  14. RT-PCR-DGGE Analysis to Elucidate the Dominant Bacterial Species of Industrial Spanish-Style Green Table Olive Fermentations.

    PubMed

    Benítez-Cabello, Antonio; Bautista-Gallego, Joaquín; Garrido-Fernández, Antonio; Rantsiou, Kalliopi; Cocolin, Luca; Jiménez-Díaz, Rufino; Arroyo-López, Francisco N

    2016-01-01

    This paper describes the dominant bacterial species metabolically active through the industrial production of Spanish-style Manzanilla and Gordal olives. For this purpose, samples (brines and fruits) obtained at 0, 15, and 90 fermentation days were analyzed by a culture-independent approach to determine viable cells by reverse transcription of RNA and further PCR-DGGE analysis, detecting at least 7 different species. Vibrio vulnificus, Lactobacillus plantarum group, and Lactobacillus parafarraginis were present in samples from both cultivars; Lactobacillus sanfranciscensis and Halolactobacillus halophilus were detected only in Gordal samples, while Staphylococcus sp. was exclusively found at the onset of Manzanilla fermentations. Physicochemical data showed a typical fermentation profile while scanning electron microscopy confirmed the in situ biofilm formation on the olive epidermis. Different Bacillus, Staphylococcus, and Enterococcus species, not detected during the fermentation process, were also found in the solid marine salt used by the industry for preparation of brines. Elucidation of these non-lactic acid bacteria species role during fermentation is then an appealingly challenge, particularly regarding safety issues. PMID:27582739

  15. RT-PCR–DGGE Analysis to Elucidate the Dominant Bacterial Species of Industrial Spanish-Style Green Table Olive Fermentations

    PubMed Central

    Benítez-Cabello, Antonio; Bautista-Gallego, Joaquín; Garrido-Fernández, Antonio; Rantsiou, Kalliopi; Cocolin, Luca; Jiménez-Díaz, Rufino; Arroyo-López, Francisco N.

    2016-01-01

    This paper describes the dominant bacterial species metabolically active through the industrial production of Spanish-style Manzanilla and Gordal olives. For this purpose, samples (brines and fruits) obtained at 0, 15, and 90 fermentation days were analyzed by a culture-independent approach to determine viable cells by reverse transcription of RNA and further PCR-DGGE analysis, detecting at least 7 different species. Vibrio vulnificus, Lactobacillus plantarum group, and Lactobacillus parafarraginis were present in samples from both cultivars; Lactobacillus sanfranciscensis and Halolactobacillus halophilus were detected only in Gordal samples, while Staphylococcus sp. was exclusively found at the onset of Manzanilla fermentations. Physicochemical data showed a typical fermentation profile while scanning electron microscopy confirmed the in situ biofilm formation on the olive epidermis. Different Bacillus, Staphylococcus, and Enterococcus species, not detected during the fermentation process, were also found in the solid marine salt used by the industry for preparation of brines. Elucidation of these non-lactic acid bacteria species role during fermentation is then an appealingly challenge, particularly regarding safety issues. PMID:27582739

  16. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  17. Bacterial Communities in Acidic and Circumneutral Streams †

    PubMed Central

    Palumbo, Anthony V.; Bogle, Mary Anna; Turner, Ralph R.; Elwood, Jerry W.; Mulholland, Patrick J.

    1987-01-01

    The relationship between pH and the abundance and activity of bacteria in streams was examined as part of a study of the effect of acidification on stream communities. Of the bacterial communities examined, the epilithic community appeared to be the most significantly affected by acidification. Microbial biomass, as quantified by measuring the ATP level, on rock surfaces was significantly correlated with pH. Also, bacterial production by the epilithic bacteria, indicated by incorporation of tritiated thymidine into DNA, was always higher at high-pH sites than at low-pH sites of the same stream order and elevation. Bacterioplankton concentrations varied between 0.53 × 105 and 9.42 × 105 cells · ml−1 in the first- to fourth-order streams examined. The bacterioplankton concentration in one sample from a spring was 0.17 × 105 cells · ml−1. Bacterioplankton concentrations were not correlated with pH but were significantly correlated with seston concentrations. The correlation with seston is a result of increases in particle-associated bacteria at high seston concentrations. The proportion of bacterioplankton attached to particles varied from 0 to 70%. Bacterial numbers and production in the sediments were significantly correlated with the organic content of the sediment rather than with the pH of the overlying water. Thus, reduced abundance and activity of bacteria as a result of acidification could be detected only for the relatively active community on rock surfaces; this community was exposed to the low pH because of the unbuffered nature of its environment. PMID:16347283

  18. Unified Theory of Bacterial Sialometabolism: How and Why Bacteria Metabolize Host Sialic Acids

    PubMed Central

    Vimr, Eric R.

    2013-01-01

    Sialic acids are structurally diverse nine-carbon ketosugars found mostly in humans and other animals as the terminal units on carbohydrate chains linked to proteins or lipids. The sialic acids function in cell-cell and cell-molecule interactions necessary for organismic development and homeostasis. They not only pose a barrier to microorganisms inhabiting or invading an animal mucosal surface, but also present a source of potential carbon, nitrogen, and cell wall metabolites necessary for bacterial colonization, persistence, growth, and, occasionally, disease. The explosion of microbial genomic sequencing projects reveals remarkable diversity in bacterial sialic acid metabolic potential. How bacteria exploit host sialic acids includes a surprisingly complex array of metabolic and regulatory capabilities that is just now entering a mature research stage. This paper attempts to describe the variety of bacterial sialometabolic systems by focusing on recent advances at the molecular and host-microbe-interaction levels. The hope is that this focus will provide a framework for further research that holds promise for better understanding of the metabolic interplay between bacterial growth and the host environment. An ability to modify or block this interplay has already yielded important new insights into potentially new therapeutic approaches for modifying or blocking bacterial colonization or infection. PMID:23724337

  19. Bacterial community structure in freshwater springs infested with the invasive plant species Hydrilla verticillata

    PubMed Central

    Gordon-Bradley, N.; Li, N.

    2015-01-01

    The phylogenetic composition and physiological profiles of bacterial communities in freshwater springs were evaluated during the blooming and non-blooming stages of the invasive plant species, Hydrilla verticillata. Community-level physiological profiles (CLPPs) and pyrosequencing of 16S rRNA gene amplicons were used to study potential Hydrilla mediated shifts in the physiological potential and phylogenetic composition of the bacterial community in infested systems. The results of CLPP revealed that the microbes in the Hydrilla invaded sites utilized less substrates during blooming periods than during nonblooming periods of the plant. Spearman’s rank correlation analysis showed some relationships between the relative abundances of bacterial taxa and the Biolog substrate utilization pattern. The relative abundance of the identified taxa showed some striking differences based on the blooming status of Hydrilla and to a lesser extent on site variation. The relative abundance of Actinobacteria, Bacteriodetes, and Verrucomicrobia was generally higher during Hydrilla blooms, while Deltaproteobacteria was generally higher during non-blooming stages of Hydrilla. The detected genera also varied based on the blooming stages of the plant. Based on the findings, it appears that Hydrilla alters the phylogenetic composition and structure of the bacterial community during the blooming stage. PMID:26207069

  20. Allophanate hydrolase, not urease, functions in bacterial cyanuric acid metabolism.

    PubMed

    Cheng, Gang; Shapir, Nir; Sadowsky, Michael J; Wackett, Lawrence P

    2005-08-01

    Growth substrates containing an s-triazine ring are typically metabolized by bacteria to liberate 3 mol of ammonia via the intermediate cyanuric acid. Over a 25-year period, a number of original research papers and reviews have stated that cyanuric acid is metabolized in two steps to the 2-nitrogen intermediate urea. In the present study, allophanate, not urea, was shown to be the 2-nitrogen intermediate in cyanuric acid metabolism in all the bacteria examined. Six different experimental results supported this conclusion: (i) synthetic allophanate was shown to readily decarboxylate to form urea under acidic extraction and chromatography conditions used in previous studies; (ii) alkaline extraction methods were used to stabilize and detect allophanate in bacteria actively metabolizing cyanuric acid; (iii) the kinetic course of allophanate formation and disappearance was consistent with its being an intermediate in cyanuric acid metabolism, and no urea was observed in those experiments; (iv) protein extracts from cells grown on cyanuric acid contained allophanate hydrolase activity; (v) genes encoding the enzymes AtzE and AtzF, which produce and hydrolyze allophanate, respectively, were found in several cyanuric acid-metabolizing bacteria; and (vi) TrzF, an AtzF homolog found in Enterobacter cloacae strain 99, was cloned, expressed in Escherichia coli, and shown to have allophanate hydrolase activity. In addition, we have observed that there are a large number of genes homologous to atzF and trzF distributed in phylogenetically distinct bacteria. In total, the data indicate that s-triazine metabolism in a broad class of bacteria proceeds through allophanate via allophanate hydrolase, rather than through urea using urease. PMID:16085834

  1. Potential core species and satellite species in the bacterial community within the rabbit caecum

    PubMed Central

    Monteils, Valérie; Cauquil, Laurent; Combes, Sylvie; Godon, Jean-Jacques; Gidenne, Thierry

    2008-01-01

    A bacteria library was constructed from the caecum of a rabbit maintained under standard conditions. The complete gene 16S rRNA gene was sequenced. The 228 clones obtained were distributed in 70 operational taxonomic units (OTUs). The large majority of the OTUs were composed of one or two clones and seven OTUs contained half of the sequences. Fourteen sequences had high similarity to the sequence already registered in databases (threshold of 97%). Only one of these sequences has been identified as Variovorax sp. (99% identity). Units were distributed mainly (94%) in the Firmicutes phylum. Three sequences were related to Bacteroidetes. Nine clusters were defined in the phylogenic tree. A great diversity of caecal bacteria of the rabbit was shown. Half of the sequences generated in this library were distributed in the phylogenetic tree near the sequences characterized previously in rabbit caecum (potential core species), and the other half of the sequences were well separated (satellite species). PMID:19049656

  2. Inhibition of bacterial activity in acid mine drainage

    NASA Astrophysics Data System (ADS)

    Singh, Gurdeep; Bhatnagar, Miss Mridula

    1988-12-01

    Acid mine drainage water give rise to rapid growth and activity of an iron- and sulphur- oxidizing bacterium Thiobacillus ferrooxidians which greatly accelerate acid producing reactions by oxidation of pyrite material associated with coal and adjoining strata. The role of this bacterium in production of acid mine drainage is described. This study presents the data which demonstrate the inhibitory effect of certain organic acids, sodium benzoate, sodium lauryl sulphate, quarternary ammonium compounds on the growth of the acidophilic aerobic autotroph Thiobacillus ferrooxidians. In each experiment, 10 milli-litres of laboratory developed culture of Thiobacillus ferrooxidians was added to 250 milli-litres Erlenmeyer flask containing 90 milli-litres of 9-k media supplemented with FeSO4 7H2O and organic compounds at various concentrations. Control experiments were also carried out. The treated and untreated (control) samples analysed at various time intervals for Ferrous Iron and pH levels. Results from this investigation showed that some organic acids, sodium benzoate, sodium lauryl sulphate and quarternary ammonium compounds at low concentration (10-2 M, 10-50 ppm concentration levels) are effective bactericides and able to inhibit and reduce the Ferrous Iron oxidation and acidity formation by inhibiting the growth of Thiobacillus ferrooxidians is also discussed and presented

  3. A New Species of Pristionchus (Rhabditida: Diplogastridae) and Its Bacterial Symbiont from Yixing, China

    PubMed Central

    Li, Pengpeng; Dai, Chensheng; Bao, Haoran; Chen, Long; Gao, Di; Wang, Guoxiang; Wang, Jin; Wang, Hui; Yedid, Gabriel; Zhang, Keyun

    2015-01-01

    A new nematode species, Pristionchus entomophilus n. sp., was collected during a soil sample survey in Yixing of Jiangsu province, eastern China. P. entomophilus n. sp. is distinguished by its unique characteristics. This new species is mainly hermaphroditic, with males seldom found. The new nematode has a similar body length but has much narrower body width compared with P. pacificus. Its body is covered with longitudinal ridges: 12 ridges on head, 13 or 14 ridges in the middle, 11 and 7 ridges in front and rear of the anus, respectively. The eurystomatous form mouth includes a triangular dorsal tooth, a large claw-like right subventral tooth, and a row of five ventral denticles placed opposite the dorsal tooth. Only eight pairs of genital papillae and a pair of phasmids are present in the tail of the male as the sixth pair of papillae having seemingly been degenerated and lost. Molecular phylogenetic trees based on 18S rDNA confirmed that the new species belongs to the genus Pristionchus and is most closely related to P. pacificus. Moreover, the new species was found to be occasionally associated with the entomopathogenic bacterial strain 09FLYB1 of Serratia nematodophila and be able to stably transfer the bacterial strain for several generations. PMID:26527840

  4. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  5. Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo

    PubMed Central

    McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda

    2016-01-01

    ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099

  6. Intra- and inter-species interactions within biofilms of important foodborne bacterial pathogens.

    PubMed

    Giaouris, Efstathios; Heir, Even; Desvaux, Mickaël; Hébraud, Michel; Møretrø, Trond; Langsrud, Solveig; Doulgeraki, Agapi; Nychas, George-John; Kačániová, Miroslava; Czaczyk, Katarzyna; Ölmez, Hülya; Simões, Manuel

    2015-01-01

    A community-based sessile life style is the normal mode of growth and survival for many bacterial species. Under such conditions, cell-to-cell interactions are inevitable and ultimately lead to the establishment of dense, complex and highly structured biofilm populations encapsulated in a self-produced extracellular matrix and capable of coordinated and collective behavior. Remarkably, in food processing environments, a variety of different bacteria may attach to surfaces, survive, grow, and form biofilms. Salmonella enterica, Listeria monocytogenes, Escherichia coli, and Staphylococcus aureus are important bacterial pathogens commonly implicated in outbreaks of foodborne diseases, while all are known to be able to create biofilms on both abiotic and biotic surfaces. Particularly challenging is the attempt to understand the complexity of inter-bacterial interactions that can be encountered in such unwanted consortia, such as competitive and cooperative ones, together with their impact on the final outcome of these communities (e.g., maturation, physiology, antimicrobial resistance, virulence, dispersal). In this review, up-to-date data on both the intra- and inter-species interactions encountered in biofilms of these pathogens are presented. A better understanding of these interactions, both at molecular and biophysical levels, could lead to novel intervention strategies for controlling pathogenic biofilm formation in food processing environments and thus improve food safety. PMID:26347727

  7. Bacterial colonization and extinction on marine aggregates: stochastic model of species presence and abundance

    PubMed Central

    Kramer, Andrew M; Lyons, M Maille; Dobbs, Fred C; Drake, John M

    2013-01-01

    Organic aggregates provide a favorable habitat for aquatic microbes, are efficiently filtered by shellfish, and may play a major role in the dynamics of aquatic pathogens. Quantifying this role requires understanding how pathogen abundance in the water and aggregate size interact to determine the presence and abundance of pathogen cells on individual aggregates. We build upon current understanding of the dynamics of bacteria and bacterial grazers on aggregates to develop a model for the dynamics of a bacterial pathogen species. The model accounts for the importance of stochasticity and the balance between colonization and extinction. Simulation results suggest that while colonization increases linearly with background density and aggregate size, extinction rates are expected to be nonlinear on small aggregates in a low background density of the pathogen. Under these conditions, we predict lower probabilities of pathogen presence and reduced abundance on aggregates compared with predictions based solely on colonization. These results suggest that the importance of aggregates to the dynamics of aquatic bacterial pathogens may be dependent on the interaction between aggregate size and background pathogen density, and that these interactions are strongly influenced by ecological interactions and pathogen traits. The model provides testable predictions and can be a useful tool for exploring how species-specific differences in pathogen traits may alter the effect of aggregates on disease transmission. PMID:24340173

  8. Intra- and inter-species interactions within biofilms of important foodborne bacterial pathogens

    PubMed Central

    Giaouris, Efstathios; Heir, Even; Desvaux, Mickaël; Hébraud, Michel; Møretrø, Trond; Langsrud, Solveig; Doulgeraki, Agapi; Nychas, George-John; Kačániová, Miroslava; Czaczyk, Katarzyna; Ölmez, Hülya; Simões, Manuel

    2015-01-01

    A community-based sessile life style is the normal mode of growth and survival for many bacterial species. Under such conditions, cell-to-cell interactions are inevitable and ultimately lead to the establishment of dense, complex and highly structured biofilm populations encapsulated in a self-produced extracellular matrix and capable of coordinated and collective behavior. Remarkably, in food processing environments, a variety of different bacteria may attach to surfaces, survive, grow, and form biofilms. Salmonella enterica, Listeria monocytogenes, Escherichia coli, and Staphylococcus aureus are important bacterial pathogens commonly implicated in outbreaks of foodborne diseases, while all are known to be able to create biofilms on both abiotic and biotic surfaces. Particularly challenging is the attempt to understand the complexity of inter-bacterial interactions that can be encountered in such unwanted consortia, such as competitive and cooperative ones, together with their impact on the final outcome of these communities (e.g., maturation, physiology, antimicrobial resistance, virulence, dispersal). In this review, up-to-date data on both the intra- and inter-species interactions encountered in biofilms of these pathogens are presented. A better understanding of these interactions, both at molecular and biophysical levels, could lead to novel intervention strategies for controlling pathogenic biofilm formation in food processing environments and thus improve food safety. PMID:26347727

  9. Rumen bacterial communities shift across a lactation in Holstein, Jersey and Holstein × Jersey dairy cows and correlate to rumen function, bacterial fatty acid composition and production parameters.

    PubMed

    Bainbridge, Melissa L; Cersosimo, Laura M; Wright, André-Denis G; Kraft, Jana

    2016-05-01

    Rumen bacteria form a dynamic, complex, symbiotic relationship with their host, degrading forages to provide volatile fatty acids (VFA) and other substrates as energy to the animal. The objectives were to characterize rumen bacteria in three genetic lines of primiparous dairy cattle, Holstein (HO,n= 7), Jersey (JE,n= 8), and HO × JE crossbreeds (CB,n= 7) across a lactation [3, 93, 183 and 273 days in milk (DIM)] and correlate these factors with VFA, bacterial cell membrane fatty acids (FA), and animal production (i.e. milk yield). This study employed Illumina MiSeq (v. 3) to investigate rumen bacterial communities and gas-liquid chromatography/mass spectroscopy to identify bacterial membrane FA. Lactation stage had a prominent effect on rumen bacterial communities, whereas genetics had a lesser effect on rumen bacteria. The FA composition of bacterial cell membranes was affected by both lactation stage and genetics. Few correlations existed between VFA and bacterial communities; however, moderate correlations occurred between milk yield, protein percentage, fat yield and rumen bacterial communities. Positive correlations were found between branched-chain FA (BCFA) in bacterial cell membranes and bacterial genera. In conclusion, bacterial communities and their FA compositions are more affected by stage of lactation than by genetics of dairy cow. PMID:26985012

  10. Species-specific diversity of novel bacterial lineages and differential abundance of predicted pathways for toxic compound degradation in scorpion gut microbiota.

    PubMed

    Bolaños, Luis M; Rosenblueth, Mónica; Castillo-Ramírez, Santiago; Figuier-Huttin, Gilles; Martínez-Romero, Esperanza

    2016-05-01

    Scorpions are considered 'living fossils' that have conserved ancestral anatomical features and have adapted to numerous habitats. However, their gut microbiota diversity has not been studied. Here, we characterized the gut microbiota of two scorpion species, Vaejovis smithi and Centruroides limpidus. Our results indicate that scorpion gut microbiota is species-specific and that food deprivation reduces bacterial diversity. 16S rRNA gene phylogenetic analysis revealed novel bacterial lineages showing a low level of sequence identity to any known bacteria. Furthermore, these novel bacterial lineages were each restricted to a different scorpion species. Additionally, our results of the predicted metagenomic profiles revealed a core set of pathways that were highly abundant in both species, and mostly related to amino acid, carbohydrate, vitamin and cofactor metabolism. Notably, the food-deprived V. smithi shotgun metagenome matched almost completely the metabolic features of the prediction. Finally, comparisons among predicted metagenomic profiles showed that toxic compound degradation pathways were more abundant in recently captured C. limpidus scorpions. This study gives a first insight into the scorpion gut microbiota and provides a reference for future studies on the gut microbiota from other arachnid species. PMID:26058415

  11. Fatty acid and sterol composition of three phytomonas species.

    PubMed

    Nakamura, C V; Waldow, L; Pelegrinello, S R; Ueda-Nakamura, T; Filho, B A; Filho, B P

    1999-01-01

    Fatty acid and sterol analysis were performed on Phytomonas serpens and Phytomonas sp. grown in chemically defined and complex medium, and P. françai cultivated in complex medium. The three species of the genus Phytomonas had qualitatively identical fatty acid patterns. Oleic, linoleic, and linolenic were the major unsaturated fatty acids. Miristic and stearic were the major saturated fatty acids. Ergosterol was the only sterol isolated from Phytmonas sp. and P. serpens grown in a sterol-free medium, indicating that it was synthesized de novo. When P. françai that does not grow in defined medium was cultivated in a complex medium, cholesterol was the only sterol detected. The fatty acids and sterol isolated from Phytomonas sp. and P. serpens grown in a chemically defined lipid-free medium indicated that they were able to biosynthesize fatty acids and ergosterol from acetate or from acetate precursors such as glucose or threonine. PMID:10446013

  12. Host and Environmental Specificity in Bacterial Communities Associated to Two Highly Invasive Marine Species (Genus Asparagopsis)

    PubMed Central

    Aires, Tânia; Serrão, Ester A.; Engelen, Aschwin H.

    2016-01-01

    As habitats change due to global and local pressures, population resilience, and adaptive processes depend not only on their gene pools but also on their associated bacteria communities. The hologenome can play a determinant role in adaptive evolution of higher organisms that rely on their bacterial associates for vital processes. In this study, we focus on the associated bacteria of the two most invasive seaweeds in southwest Iberia (coastal mainland) and nearby offshore Atlantic islands, Asparagopsis taxiformis and Asparagopsis armata. Bacterial communities were characterized using 16S rRNA barcoding through 454 next generation sequencing and exploratory shotgun metagenomics to provide functional insights and a backbone for future functional studies. The bacterial community composition was clearly different between the two species A. taxiformis and A. armata and between continental and island habitats. The latter was mainly due to higher abundances of Acidimicrobiales, Sphingomonadales, Xanthomonadales, Myxococcales, and Alteromonadales on the continent. Metabolic assignments for these groups contained a higher number of reads in functions related to oxidative stress and resistance to toxic compounds, more precisely heavy metals. These results are in agreement with their usual association with hydrocarbon degradation and heavy-metals detoxification. In contrast, A. taxiformis from islands contained more bacteria related to oligotrophic environments which might putatively play a role in mineralization of dissolved organic matter. The higher number of functional assignments found in the metagenomes of A. taxiformis collected from Cape Verde Islands suggest a higher contribution of bacteria to compensate nutrient limitation in oligotrophic environments. Our results show that Asparagopsis-associated bacterial communities have host-specificity and are modulated by environmental conditions. Whether this environmental effect reflects the host's selective requirements or

  13. Host and Environmental Specificity in Bacterial Communities Associated to Two Highly Invasive Marine Species (Genus Asparagopsis).

    PubMed

    Aires, Tânia; Serrão, Ester A; Engelen, Aschwin H

    2016-01-01

    As habitats change due to global and local pressures, population resilience, and adaptive processes depend not only on their gene pools but also on their associated bacteria communities. The hologenome can play a determinant role in adaptive evolution of higher organisms that rely on their bacterial associates for vital processes. In this study, we focus on the associated bacteria of the two most invasive seaweeds in southwest Iberia (coastal mainland) and nearby offshore Atlantic islands, Asparagopsis taxiformis and Asparagopsis armata. Bacterial communities were characterized using 16S rRNA barcoding through 454 next generation sequencing and exploratory shotgun metagenomics to provide functional insights and a backbone for future functional studies. The bacterial community composition was clearly different between the two species A. taxiformis and A. armata and between continental and island habitats. The latter was mainly due to higher abundances of Acidimicrobiales, Sphingomonadales, Xanthomonadales, Myxococcales, and Alteromonadales on the continent. Metabolic assignments for these groups contained a higher number of reads in functions related to oxidative stress and resistance to toxic compounds, more precisely heavy metals. These results are in agreement with their usual association with hydrocarbon degradation and heavy-metals detoxification. In contrast, A. taxiformis from islands contained more bacteria related to oligotrophic environments which might putatively play a role in mineralization of dissolved organic matter. The higher number of functional assignments found in the metagenomes of A. taxiformis collected from Cape Verde Islands suggest a higher contribution of bacteria to compensate nutrient limitation in oligotrophic environments. Our results show that Asparagopsis-associated bacterial communities have host-specificity and are modulated by environmental conditions. Whether this environmental effect reflects the host's selective requirements or

  14. Melatonin reduces bacterial translocation and apoptosis in trinitrobenzene sulphonic acid-induced colitis of rats

    PubMed Central

    Akcan, Alper; Kucuk, Can; Sozuer, Erdogan; Esel, Duygu; Akyildiz, Hizir; Akgun, Hulya; Muhtaroglu, Sabahattin; Aritas, Yucel

    2008-01-01

    AIM: To investigate the effects of exogenous melatonin on bacterial translocation and apoptosis in a rat ulcerative colitis model. METHODS: Rats were randomly assigned to three groups: groupI: control, group II: experimental colitis, group III: colitis plus melatonin treatment. On d 11 after colitis, plasma tumor necrosis factor-α, portal blood endotoxin levels, colon tissue myeloperoxidase and caspase-3 activity were measured. Bacterial translocation was quantified by blood, lymph node, liver and spleen culture. RESULTS: We observed a significantly reduced incidence of bacterial translocation to the liver, spleen, mesenteric lymph nodes, portal and systemic blood in animals treated with melatonin. Treatment with melatonin significantly decreased the caspase-3 activity in colonic tissues compared to that in trinitrobenzene sulphonic acid- treated rats (16.11 ± 2.46 vs 32.97 ± 3.91, P < 0.01). CONCLUSION: Melatonin has a protective effect on bacterial translocation and apoptosis. PMID:18240350

  15. Diagnosis of bacterial vaginosis by a new multiplex peptide nucleic acid fluorescence in situ hybridization method

    PubMed Central

    Machado, António; Castro, Joana; Cereija, Tatiana; Almeida, Carina

    2015-01-01

    Bacterial vaginosis (BV) is one of most common vaginal infections. However, its diagnosis by classical methods reveals low specificity. Our goal was to evaluate the accuracy diagnosis of 150 vaginal samples with research gold standard methods and our Peptide Nucleic Acid (PNA) probes by Fluorescence in situ Hybridization (FISH) methodology. Also, we described the first PNA-FISH methodology for BV diagnosis, which provides results in approximately 3 h. The results showed a sensitivity of 84.6% (95% confidence interval (CI), from 64.3 to 95.0%) and a specificity of 97.6% (95% CI [92.6–99.4%]), demonstrating the higher specificity of the PNA-FISH method and showing false positive results in BV diagnosis commonly obtained by the classical methods. This methodology combines the specificity of PNA probes for Lactobacillus species and G. vaginalis visualization and the calculation of the microscopic field by Nugent score, allowing a trustful evaluation of the bacteria present in vaginal microflora and avoiding the occurrence of misleading diagnostics. Therefore, the PNA-FISH methodology represents a valuable alternative for BV diagnosis. PMID:25737820

  16. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  17. Diagnosis of bacterial vaginosis by a new multiplex peptide nucleic acid fluorescence in situ hybridization method.

    PubMed

    Machado, António; Castro, Joana; Cereija, Tatiana; Almeida, Carina; Cerca, Nuno

    2015-01-01

    Bacterial vaginosis (BV) is one of most common vaginal infections. However, its diagnosis by classical methods reveals low specificity. Our goal was to evaluate the accuracy diagnosis of 150 vaginal samples with research gold standard methods and our Peptide Nucleic Acid (PNA) probes by Fluorescence in situ Hybridization (FISH) methodology. Also, we described the first PNA-FISH methodology for BV diagnosis, which provides results in approximately 3 h. The results showed a sensitivity of 84.6% (95% confidence interval (CI), from 64.3 to 95.0%) and a specificity of 97.6% (95% CI [92.6-99.4%]), demonstrating the higher specificity of the PNA-FISH method and showing false positive results in BV diagnosis commonly obtained by the classical methods. This methodology combines the specificity of PNA probes for Lactobacillus species and G. vaginalis visualization and the calculation of the microscopic field by Nugent score, allowing a trustful evaluation of the bacteria present in vaginal microflora and avoiding the occurrence of misleading diagnostics. Therefore, the PNA-FISH methodology represents a valuable alternative for BV diagnosis. PMID:25737820

  18. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  19. Evolution in an oncogenic bacterial species with extreme genome plasticity: Helicobacter pylori East Asian genomes

    PubMed Central

    2011-01-01

    Background The genome of Helicobacter pylori, an oncogenic bacterium in the human stomach, rapidly evolves and shows wide geographical divergence. The high incidence of stomach cancer in East Asia might be related to bacterial genotype. We used newly developed comparative methods to follow the evolution of East Asian H. pylori genomes using 20 complete genome sequences from Japanese, Korean, Amerind, European, and West African strains. Results A phylogenetic tree of concatenated well-defined core genes supported divergence of the East Asian lineage (hspEAsia; Japanese and Korean) from the European lineage ancestor, and then from the Amerind lineage ancestor. Phylogenetic profiling revealed a large difference in the repertoire of outer membrane proteins (including oipA, hopMN, babABC, sabAB and vacA-2) through gene loss, gain, and mutation. All known functions associated with molybdenum, a rare element essential to nearly all organisms that catalyzes two-electron-transfer oxidation-reduction reactions, appeared to be inactivated. Two pathways linking acetyl~CoA and acetate appeared intact in some Japanese strains. Phylogenetic analysis revealed greater divergence between the East Asian (hspEAsia) and the European (hpEurope) genomes in proteins in host interaction, specifically virulence factors (tipα), outer membrane proteins, and lipopolysaccharide synthesis (human Lewis antigen mimicry) enzymes. Divergence was also seen in proteins in electron transfer and translation fidelity (miaA, tilS), a DNA recombinase/exonuclease that recognizes genome identity (addA), and DNA/RNA hybrid nucleases (rnhAB). Positively selected amino acid changes between hspEAsia and hpEurope were mapped to products of cagA, vacA, homC (outer membrane protein), sotB (sugar transport), and a translation fidelity factor (miaA). Large divergence was seen in genes related to antibiotics: frxA (metronidazole resistance), def (peptide deformylase, drug target), and ftsA (actin-like, drug target

  20. Bacterial growth rates are influenced by cellular characteristics of individual species when immersed in electromagnetic fields.

    PubMed

    Tessaro, Lucas W E; Murugan, Nirosha J; Persinger, Michael A

    2015-03-01

    Previous studies have shown that exposure to extremely low-frequency electromagnetic fields (ELF-EMFs) have negative effects on the rate of growth of bacteria. In the present study, two Gram-positive and two Gram-negative species were exposed to six magnetic field conditions in broth cultures. Three variations of the 'Thomas' pulsed frequency-modulated pattern; a strong-static "puck" magnet upwards of 5000G in intensity; a pair of these magnets rotating opposite one another at ∼30rpm; and finally a strong dynamic magnetic field generator termed the 'Resonator' with an average intensity of 250μT were used. Growth rate was discerned by optical density (OD) measurements every hour at 600nm. ELF-EMF conditions significantly affected the rates of growth of the bacterial cultures, while the two static magnetic field conditions were not statistically significant. Most interestingly, the 'Resonator' dynamic magnetic field increased the rates of growth of three species (Staphylococcus epidermidis, Staphylococcus aureus, and Escherichia coli), while slowing the growth of one (Serratia marcescens). We suggest that these effects are due to individual biophysical characteristics of the bacterial species. PMID:25721476

  1. Isolation and identification of bacterial endophytes from pharmaceutical agarwood-producing Aquilaria species

    PubMed Central

    Bhore, Subhash J.; Preveena, Jagadesan; Kandasamy, Kodi I.

    2013-01-01

    Background: Resins and gums are used in traditional medicine and do have potential applications in pharmacy and medicine. Agarwood is the fragrant resinous wood, which is an important commodity from Aquilaria species and has been used as a sedative, analgesic, and digestive in traditional medicine. Endophytic bacteria are potentially important in producing pharmaceutical compounds found in the plants. Hence, it was important to understand which types of endophytic bacteria are associated with pharmaceutical agarwood-producing Aquilaria species. Objective: This study was undertaken to isolate and identify endophytic bacteria associated with agarwood-producing seven (7) Aquilaria species from Malaysia. Materials and Methods: Botanical samples of seven Aquilaria species were collected, and endophytic bacteria were isolated from surface-sterilized-tissue samples. The 16S rRNA gene fragments were amplified using PCR method, and endophytic bacterial isolates (EBIs) were identified based on 16S rRNA gene sequence similarity based method. Results: Culturable, 77 EBIs were analyzed, and results of 16S rRNA gene sequences analysis suggest that 18 different types of endophytic bacteria are associated with (seven) Aquilaria species. From 77 EBIs, majority (36.4%) of the isolates were of Bacillus pumilus. Conclusion: These findings indicate that agarwood-producing Aquilaria species are harboring 18 different types of culturable endophytic bacteria. PMID:23798890

  2. Intrauterine bacterial inoculation and level of dietary methionine alter amino acid metabolism in nulliparous yearling ewes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using an intrauterine bacterial inoculation method, our objective was to determine the effects of acute sepsis and level of dietary metabolizable-methionine on splanchnic metabolism of amino acids in ewes. Twenty-five nulliparous yearling Rambouillet-cross ewes (initial BW = 65.1 ± 0.6 kg), surgical...

  3. Effect of washing broiler carcasses in potassium hydroxide and lauric acid on native bacterial flora

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Experiments were conducted to examine the bactericidal effect of potassium hydroxide (KOH) and lauric acid (LA) on the native bacterial flora of broiler carcasses. Carcasses were placed in solutions of 1.0% KOH and 2.0 % LA or in distilled water (control) and washed by shaking for 1 min on a mechani...

  4. Spray washing carcasses with alkaline solutions of lauric acid to reduce bacterial contamination

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ability of lauric acid (LA)-potassium hydroxide (KOH) solutions to reduce carcass bacterial contamination was examined. Skin of carcasses was inoculated with a cecal paste containing antibiotic resistant strains of Escherichia coli, Salmonella Typhimirum, and Campylobacter coli. In one trial, in...

  5. Role of lauric acid-potassium hydroxide concentration on bacterial contamination of spray washed broiler carcasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A series of experiments were conducted to examine reductions in bacterial contamination of broiler carcasses washed in a spray cabinet with various concentrations of lauric acid (LA)-potassium hydroxide (KOH) solutions. Fifty eviscerated carcasses and 5 ceca were obtained from the processing line of...

  6. Screening of species-specific lactic acid bacteria for veal calves multi-strain probiotic adjuncts.

    PubMed

    Ripamonti, Barbara; Agazzi, Alessandro; Bersani, Carla; De Dea, Paola; Pecorini, Chiara; Pirani, Silvia; Rebucci, Raffaella; Savoini, Giovanni; Stella, Simone; Stenico, Alberta; Tirloni, Erica; Domeneghini, Cinzia

    2011-06-01

    The selection of promising specific species of lactic acid bacteria with potential probiotic characteristics is of particular interest in producing multi species-specific probiotic adjuncts in veal calves rearing. The aim of the present work was to select and evaluate in vitro the functional activity of lactic acid bacteria, Bifidobacterium longum and Bacillus coagulans strains isolated from veal calves in order to assess their potential use as multi species-specific probiotics for veal calves. For this purpose, bacterial strains isolated from faeces collected from 40 healthy 50-day-calves, were identified by RiboPrinter and 16s rRNA gene sequence. The most frequent strains belonged to the species B. longum, Streptococcus bovis, Lactobacillus animalis and Streptococcus macedonicus. Among these, 7 strains were chosen for testing their probiotic characteristics in vitro. Three strains, namely L. animalis SB310, Lactobacillus paracasei subsp. paracasei SB137 and B. coagulans SB117 showed varying individual but promising capabilities to survive in the gastrointestinal tract, to adhere, to produce antimicrobial compounds. These three selected species-specific bacteria demonstrated in vitro, both singularly and mixed, the functional properties needed for their use as potential probiotics in veal calves. PMID:21619939

  7. Chromosomal and extrachromosomal deoxyribonucleic acid from four bacterial endosymbionts derived from stock 51 of Paramecium tetraurelia.

    PubMed Central

    Dilts, J A

    1977-01-01

    Four variant lines of stock 51 kappa (Paramecium tetraurelia) were screened for the presence of covalently closed circular (CCC) deoxyribonucleic acid (DNA). Stock 51m43 kappa, a nonkiller resistant to 51 killing, contained four classes of CCC DNA: 2.9 X 10(7), 9.7 X 10(7), and 11.8 X 10(7) daltons. The buoyant densities of 51m43 kappa chromosomal and CCC DNA were 1.700 and 1.698 g/cm3, respectively. Stock 51m43 pi, a sensitive nonkiller, contained two CCC species: 0.3 X 10(7) and 4.4 X 10(7) daltons. The buoyant densities of both the chromosomal and CCC DNA were 1.694 to 1.695 g/cm3. Three sizes of CCC DNA were found in 51m1 pi: 0.3 X 10(7), 2.3 X 10(7), and 4.5 X 10(7) daltons. The buoyant densities of both the chromosoaml DNA and the CC DNA were 1.694 to 1.695 g/cm3. It is not known whether 51m1 kappa, a sensitive spinner killer, contains CCC DNA. The buoyant density of its chromosomal DNA was 1.703 g/cm3. Of the four variant lines, only 51m43 kappa appears to be a mutant of 51 kappa. The chromosomal and CCC DNAs of 51m43 kappa have the same buoyant densities as those of 51 kappa; in addition 51m43 kappa contain a CCC molecule the same size as that found in 51 kappa (2.8 x 10(7) daltons). The three other lines are probably bacterial species that are distinct from 51 kappa and which, at one time, were co-inhabitants with 51 kappa in stock 51 paramecia. PMID:838691

  8. Photoinactivation of Eight Health-Relevant Bacterial Species: Determining the Importance of the Exogenous Indirect Mechanism.

    PubMed

    Maraccini, Peter A; Wenk, Jannis; Boehm, Alexandria B

    2016-05-17

    It is presently unknown to what extent the endogenous direct, endogenous indirect, and exogenous indirect mechanisms contribute to bacterial photoinactivation in natural surface waters. In this study, we investigated the importance of the exogenous indirect mechanism by conducting photoinactivation experiments with eight health-relevant bacterial species (Bacteroides thetaiotaomicron, Campylobacter jejuni, Enterococcus faecalis, Escherichia coli K12, E. coli O157:H7, Salmonella enterica serovar Typhimurium LT2, Staphylococcus aureus, and Streptococcus bovis). We used three synthetic photosensitizers (methylene blue, rose bengal, and nitrite) and two model natural photosensitizers (Suwannee River natural organic matter and dissolved organic matter isolated from a wastewater treatment wetland) that generated singlet oxygen and hydroxyl radical. B. thetaiotaomicron had larger first order rate constants than all other organisms under all conditions tested. The presence of the synthetic photosensitizers generally enhanced photoinactivation of Gram-positive facultative anaerobes (Ent. faecalis, Staph. aureus, and Strep. bovis). Among Gram-negative bacteria, only methylene blue with E. coli K12 and rose bengal with C. jejuni showed an enhancing effect. The presence of model natural photosensitizers either reduced or did not affect photoinactivation rate constants. Our findings highlight the importance of the cellular membrane and photosensitizer properties in modulating the contribution of the exogenous indirect mechanism to the overall bacterial photoinactivation. PMID:27121126

  9. Characterization of initial events in bacterial surface colonization by two Pseudomonas species using image analysis.

    PubMed

    Mueller, R F; Characklis, W G; Jones, W L; Sears, J T

    1992-05-01

    The processes leading to bacterial colonization on solid-water interfaces are adsorption, desorption, growth, and erosion. These processes have been measured individually in situ in a flowing system in real time using image analysis. Four different substrata (copper, silicon, 316 stainless-steel and glass) and 2 different bacterial species (Pseudomonas aeruginosa and Pseudomonas fluorescens) were used in the experiments. The flow was laminar (Re = 1.4) and the shear stress was kept constant during all experiments at 0.75 N m(-2). The surface roughness varied among the substrata from 0.002 microm (for silicon) to 0.015 microm (for copper). Surface free energies varied from 25.1 dynes cm(-1) for silicon to 31.2 dynes cm(-1) for copper. Cell curface hydrophobicity, reported as hydrocarbon partitioning values, ranged from 0.67 for Ps. fluorescens to 0.97 for Ps. aeruginosa.The adsorption rate coefficient varied by as much as a factor of 10 among the combinations of bacterial strain and substratum material, and was positively correlated with surface free energy, the surface roughness of the substratum, and the hydrophobicity of the cells. The probability of desorption decreased with increasing surface free energy and surface roughness of the substratum. Cell growth was inhibited on copper, but replication of cells overlying an initial cell layer was observed with increased exposure time to the cell-containing bulk water. A mathematical model describing cell accumulation on a substratum is presented. PMID:18600919

  10. Biosynthesis of Jasmonic Acid by Several Plant Species 1

    PubMed Central

    Vick, Brady A.; Zimmerman, Don C.

    1984-01-01

    Six plant species metabolized 18O-labeled 12-oxo-cis,cis-10,15-phytodienoic acid (12-oxo-PDA) to short chain cyclic fatty acids. The plant species were corn (Zea mays L.), eggplant (Solanum melongena L.), flax (Linum usitatissimum L.), oat (Avena sativa L.), sunflower (Helianthus annuus L.), and wheat (Triticum aestivum L.). Among the products was jasmonic acid, a natural plant constituent with growth-regulating properties. The pathway is the same as the one recently reported by us for jasmonic acid synthesis in Vicia faba L. pericarp. First, the ring double bond of 12-oxo-PDA is saturated; then β-oxidation enzymes remove six carbons from the carboxyl side chain of the ring. Substrate specificity studies indicated that neither the stereochemistry of the side chain at carbon 13 of 12-oxo-PDA nor the presence of the double bond at carbon 15 was crucial for either enzyme step. The presence of enzymes which convert 12-oxo-PDA to jasmonic acid in several plant species indicates that this may be a general metabolic pathway in plants. PMID:16663643

  11. Analysis of Bacterial Diversity During Acetic Acid Fermentation of Tianjin Duliu Aged Vinegar by 454 Pyrosequencing.

    PubMed

    Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye

    2015-08-01

    The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process. PMID:25903266

  12. Seasonal changes in nitrogen-cycle gene abundances and in bacterial communities in acidic forest soils.

    PubMed

    Jung, Jaejoon; Yeom, Jinki; Han, Jiwon; Kim, Jisun; Park, Woojun

    2012-06-01

    The abundance of genes related to the nitrogen biogeochemical cycle and the microbial community in forest soils (bacteria, archaea, fungi) were quantitatively analyzed via real-time PCR using 11 sets of specific primers amplifying nifH, bacterial amoA, archaeal amoA, narG, nirS, nirK, norB, nosZ, bacterial 16S rRNA gene, archaeal 16S rRNA gene, and the ITS sequence of fungi. Soils were sampled from Bukhan Mountain from September of 2010 to July of 2011 (7 times). Bacteria were the predominant microbial community in all samples. However, the abundance of archaeal amoA was greater than bacterial amoA throughout the year. The abundances of nifH, nirS, nirK, and norB genes changed in a similar pattern, while narG and nosZ appeared in sensitive to the environmental changes. Clone libraries of bacterial 16S rRNA genes were constructed from summer and winter soil samples and these revealed that Acidobacteria was the most predominant phylum in acidic forest soil environments in both samples. Although a specific correlation of environmental factor and gene abundance was not verified by principle component analysis, our data suggested that the combination of biological, physical, and chemical characteristics of forest soils created distinct conditions favoring the nitrogen biogeochemical cycle and that bacterial communities in undisturbed acidic forest soils were quite stable during seasonal change. PMID:22752898

  13. Bacterial species involved in the conversion of dietary flavonoids in the human gut.

    PubMed

    Braune, Annett; Blaut, Michael

    2016-05-01

    The gut microbiota plays a crucial role in the conversion of dietary flavonoids and thereby affects their health-promoting effects in the human host. The identification of the bacteria involved in intestinal flavonoid conversion has gained increasing interest. This review summarizes available information on the so far identified human intestinal flavonoid-converting bacterial species and strains as well as their enzymes catalyzing the underlying reactions. The majority of described species involved in flavonoid transformation are capable of carrying out the O-deglycosylation of flavonoids. Other bacteria cleave the less common flavonoid-C-glucosides and/or further degrade the aglycones of flavonols, flavanonols, flavones, flavanones, dihydrochalcones, isoflavones and monomeric flavan-3-ols. To increase the currently limited knowledge in this field, identification of flavonoid-converting bacteria should be continued using culture-dependent screening or isolation procedures and molecular approaches based on sequence information of the involved enzymes. PMID:26963713

  14. Individual growth detection of bacterial species in an in vitro oral polymicrobial biofilm model.

    PubMed

    Tabenski, L; Maisch, T; Santarelli, F; Hiller, K-A; Schmalz, G

    2014-11-01

    Most in vitro studies on the antibacterial effects of antiseptics have used planktonic bacteria in monocultures. However, this study design does not reflect the in vivo situation in oral cavities harboring different bacterial species that live in symbiotic relationships in biofilms. The aim of this study was to establish a simple in vitro polymicrobial model consisting of only three bacterial strains of different phases of oral biofilm formation to simulate in vivo oral conditions. Therefore, we studied the biofilm formation of Actinomyces naeslundii (An), Fusobacterium nucleatum (Fn), and Enterococcus faecalis (Ef) on 96-well tissue culture plates under static anaerobic conditions using artificial saliva according to the method established by Pratten et al. that was supplemented with 1 g l(-1) sucrose. Growth was separately determined for each bacterial strain after incubation periods of up to 72 h by means of quantitative real-time polymerase chain reaction and live/dead staining. Presence of an extracellular polymeric substance (EPS) was visualized by Concanavalin A staining. Increasing incubation times of up to 72 h showed adhesion and propagation of the bacterial strains with artificial saliva formulation. An and Ef had significantly higher growth rates than Fn. Live/dead staining showed a median of 49.9 % (range 46.0-53.0 %) of living bacteria after 72 h of incubation, and 3D fluorescence microscopy showed a three-dimensional structure containing EPS. An in vitro oral polymicrobial biofilm model was established to better simulate oral conditions and had the advantage of providing the well-controlled experimental conditions of in vitro testing. PMID:25119373

  15. Isotope composition of sulphate in acid mine drainage as measure of bacterial oxidation

    USGS Publications Warehouse

    Taylor, B.E.; Wheeler, M.C.; Nordstrom, D.K.

    1984-01-01

    The formation of acid waters by oxidation of pyrite-bearing ore deposits, mine tailing piles, and coal measures is a complex biogeochemical process and is a serious environmental problem. We have studied the oxygen and sulphur isotope geochemistry of sulphides, sulphur, sulphate and water in the field and in experiments to identify sources of oxygen and reaction mechanisms of sulphate formation. Here we report that the oxygen isotope composition of sulphate in acid mine drainage shows a large variation due to differing proportions of atmospheric- and water-derived oxygen from both chemical and bacterially-mediated oxidation. 18O-enrichment of sulphate results from pyrite oxidation facilitated by Thiobacillus ferrooxidans in aerated environments. Oxygen isotope analysis may therefore be useful in monitoring the effectiveness of abatement programmes designed to inhibit bacterial oxidation. Sulphur isotopes show no significant fractionation between pyrite and sulphate, indicating the quantitative insignificance of intermediate oxidation states of sulphur under acid conditions. ?? 1984 Nature Publishing Group.

  16. Bacterial Species and Biochemical Characteristic Investigations of Nostoc flagelliforme Concentrates during its Storage.

    PubMed

    Yue, Lifang; Lv, Hexin; Zhen, Jing; Jiang, Shengping; Jia, Shiru; Shen, Shigang; Gao, Lu; Dai, Yujie

    2016-04-28

    Preservation of fresh algae plays an important role in algae seed subculture and aquaculture. The determination and examination of the changes of cell viability, composition, and bacterial species during storage would help to take suitable preservation methods to prolong the preservation time of fresh algae. Nostoc flagelliforme is a kind of edible cyanobacterium with important herbal and dietary values. This article investigated the changes of bacterial species and biochemical characteristics of fresh N. flagelliforme concentrate during natural storage. It was found that the viability of cells decreased along with the storage time. Fourteen bacteria strains in the algae concentrate were identified by PCR-DGGE and were grouped into four phyla, including Cyanobacteria, Firmicutes, Proteobacteria, and Bacteroidetes. Among them, Enterococcus viikkiensis may be a concern in the preservation. Eleven volatile organic compounds were identified from N. flagelliforme cells, in which geosmin could be treated as an indicator of the freshness of N. flagelliforme. The occurrence of indole compound may be an indicator of the degradation of cells. PMID:26699749

  17. Spatial and Temporal Features of the Growth of a Bacterial Species Colonizing the Zebrafish Gut

    PubMed Central

    Jemielita, Matthew; Taormina, Michael J.; Burns, Adam R.; Hampton, Jennifer S.; Rolig, Annah S.; Guillemin, Karen

    2014-01-01

    ABSTRACT The vertebrate intestine is home to microbial ecosystems that play key roles in host development and health. Little is known about the spatial and temporal dynamics of these microbial communities, limiting our understanding of fundamental properties, such as their mechanisms of growth, propagation, and persistence. To address this, we inoculated initially germ-free zebrafish larvae with fluorescently labeled strains of an Aeromonas species, representing an abundant genus in the zebrafish gut. Using light sheet fluorescence microscopy to obtain three-dimensional images spanning the gut, we quantified the entire bacterial load, as founding populations grew from tens to tens of thousands of cells over several hours. The data yield the first ever measurements of the growth kinetics of a microbial species inside a live vertebrate intestine and show dynamics that robustly fit a logistic growth model. Intriguingly, bacteria were nonuniformly distributed throughout the gut, and bacterial aggregates showed considerably higher growth rates than did discrete individuals. The form of aggregate growth indicates intrinsically higher division rates for clustered bacteria, rather than surface-mediated agglomeration onto clusters. Thus, the spatial organization of gut bacteria both relative to the host and to each other impacts overall growth kinetics, suggesting that spatial characterizations will be an important input to predictive models of host-associated microbial community assembly. PMID:25516613

  18. Differential bioavailability of soil-sorbed naphthalene to two bacterial species.

    PubMed Central

    Guerin, W F; Boyd, S A

    1992-01-01

    Prediction of the fate of hydrophobic organic contaminants in soils is complicated by the competing processes of sorption and biodegradation. To test the hypothesis that sorbed naphthalene is unavailable to degradative microorganisms, we developed a simple kinetic method to examine the rates and extents of naphthalene degradation in soil-free and soil-containing systems in a comparison of two bacterial species. The method is predicated on the first-order dependence of the initial mineralization rate on the naphthalene concentration when the latter is below the Michaelis-Menten half-saturation constant (Km) for naphthalene for the organism under study. Rates and extents of mineralization were estimated by nonlinear regression analysis of data by using both a simple first-order model and a three-parameter, coupled degradation-desorption model described for the first time here. Bioavailability assays with two bacterial species (Pseudomonas putida ATCC 17484 and a gram-negative soil isolate, designated NP-Alk) gave dramatically different results. For NP-Alk, sorption limited both the rate and extent of naphthalene mineralization, in accordance with values predicted on the basis of the equilibrium aqueous-phase naphthalene concentrations. For strain 17484, both the rates and extents of naphthalene mineralization exceeded the predicted values and resulted in enhanced rates of naphthalene desorption from the soils. We conclude that there are important organism-specific properties which make generalizations regarding the bioavailability of sorbed substrates inappropriate. PMID:1599237

  19. Effects of jasmonic acid, ethylene, and salicylic acid signaling on the rhizosphere bacterial community of Arabidopsis thaliana.

    PubMed

    Doornbos, Rogier F; Geraats, Bart P J; Kuramae, Eiko E; Van Loon, L C; Bakker, Peter A H M

    2011-04-01

    Systemically induced resistance is a promising strategy to control plant diseases, as it affects numerous pathogens. However, since induced resistance reduces one or both growth and activity of plant pathogens, the indigenous microflora may also be affected by an enhanced defensive state of the plant. The aim of this study was to elucidate how much the bacterial rhizosphere microflora of Arabidopsis is affected by induced systemic resistance (ISR) or systemic acquired resistance (SAR). Therefore, the bacterial microflora of wild-type plants and plants affected in their defense signaling was compared. Additionally, ISR was induced by application of methyl jasmonate and SAR by treatment with salicylic acid or benzothiadiazole. As a comparative model, we also used wild type and ethylene-insensitive tobacco. Some of the Arabidopsis genotypes affected in defense signaling showed altered numbers of culturable bacteria in their rhizospheres; however, effects were dependent on soil type. Effects of plant genotype on rhizosphere bacterial community structure could not be related to plant defense because chemical activation of ISR or SAR had no significant effects on density and structure of the rhizosphere bacterial community. These findings support the notion that control of plant diseases by elicitation of systemic resistance will not significantly affect the resident soil bacterial microflora. PMID:21171889

  20. Simultaneous Extraction of Viral and Bacterial Nucleic Acids for Molecular Diagnostic Applications

    PubMed Central

    Kajiura, Lauren N.; Stewart, Scott D.; Dresios, John; Uyehara, Catherine F. T.

    2015-01-01

    Molecular detection of microbial pathogens in clinical samples requires the application of efficient sample lysis protocols and subsequent extraction and isolation of their nucleic acids. Here, we describe a simple and time-efficient method for simultaneous extraction of genomic DNA from gram-positive and -negative bacteria, as well as RNA from viral agents present in a sample. This method compared well with existing bacterial- and viral-specialized extraction protocols, worked reliably on clinical samples, and was not pathogen specific. This method may be used to extract DNA and RNA concurrently from viral and bacterial pathogens present in a sample and effectively detect coinfections in routine clinical diagnostics. PMID:26543438

  1. Comparative genomics of non-pseudomonal bacterial species colonising paediatric cystic fibrosis patients

    PubMed Central

    Ormerod, Kate L.; George, Narelle M.; Fraser, James A.; Wainwright, Claire

    2015-01-01

    The genetic disorder cystic fibrosis is a life-limiting condition affecting ∼70,000 people worldwide. Targeted, early, treatment of the dominant infecting species, Pseudomonas aeruginosa, has improved patient outcomes; however, there is concern that other species are now stepping in to take its place. In addition, the necessarily long-term antibiotic therapy received by these patients may be providing a suitable environment for the emergence of antibiotic resistance. To investigate these issues, we employed whole-genome sequencing of 28 non-Pseudomonas bacterial strains isolated from three paediatric patients. We did not find any trend of increasing antibiotic resistance (either by mutation or lateral gene transfer) in these isolates in comparison with other examples of the same species. In addition, each isolate contained a virulence gene repertoire that was similar to other examples of the relevant species. These results support the impaired clearance of the CF lung not demanding extensive virulence for survival in this habitat. By analysing serial isolates of the same species we uncovered several examples of strain persistence. The same strain of Staphylococcus aureus persisted for nearly a year, despite administration of antibiotics to which it was shown to be sensitive. This is consistent with previous studies showing antibiotic therapy to be inadequate in cystic fibrosis patients, which may also explain the lack of increasing antibiotic resistance over time. Serial isolates of two naturally multi-drug resistant organisms, Achromobacter xylosoxidans and Stenotrophomonas maltophilia, revealed that while all S. maltophilia strains were unique, A. xylosoxidans persisted for nearly five years, making this a species of particular concern. The data generated by this study will assist in developing an understanding of the non-Pseudomonas species associated with cystic fibrosis. PMID:26401445

  2. Comparative genomics of non-pseudomonal bacterial species colonising paediatric cystic fibrosis patients.

    PubMed

    Ormerod, Kate L; George, Narelle M; Fraser, James A; Wainwright, Claire; Hugenholtz, Philip

    2015-01-01

    The genetic disorder cystic fibrosis is a life-limiting condition affecting ∼70,000 people worldwide. Targeted, early, treatment of the dominant infecting species, Pseudomonas aeruginosa, has improved patient outcomes; however, there is concern that other species are now stepping in to take its place. In addition, the necessarily long-term antibiotic therapy received by these patients may be providing a suitable environment for the emergence of antibiotic resistance. To investigate these issues, we employed whole-genome sequencing of 28 non-Pseudomonas bacterial strains isolated from three paediatric patients. We did not find any trend of increasing antibiotic resistance (either by mutation or lateral gene transfer) in these isolates in comparison with other examples of the same species. In addition, each isolate contained a virulence gene repertoire that was similar to other examples of the relevant species. These results support the impaired clearance of the CF lung not demanding extensive virulence for survival in this habitat. By analysing serial isolates of the same species we uncovered several examples of strain persistence. The same strain of Staphylococcus aureus persisted for nearly a year, despite administration of antibiotics to which it was shown to be sensitive. This is consistent with previous studies showing antibiotic therapy to be inadequate in cystic fibrosis patients, which may also explain the lack of increasing antibiotic resistance over time. Serial isolates of two naturally multi-drug resistant organisms, Achromobacter xylosoxidans and Stenotrophomonas maltophilia, revealed that while all S. maltophilia strains were unique, A. xylosoxidans persisted for nearly five years, making this a species of particular concern. The data generated by this study will assist in developing an understanding of the non-Pseudomonas species associated with cystic fibrosis. PMID:26401445

  3. Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography.

    PubMed

    Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

    2016-01-01

    The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach

  4. Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography

    PubMed Central

    Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

    2016-01-01

    The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach

  5. Waste Workers' Exposure to Airborne Fungal and Bacterial Species in the Truck Cab and During Waste Collection.

    PubMed

    Madsen, Anne Mette; Alwan, Taif; Ørberg, Anders; Uhrbrand, Katrine; Jørgensen, Marie Birk

    2016-07-01

    A large number of people work with garbage collection, and exposure to microorganisms is considered an occupational health problem. However, knowledge on microbial exposure at species level is limited. The aim of the study was to achieve knowledge on waste collectors' exposure to airborne inhalable fungal and bacterial species during waste collection with focus on the transport of airborne microorganisms into the truck cab. Airborne microorganisms were collected with samplers mounted in the truck cab, on the workers' clothes, and outdoors. Fungal and bacterial species were quantified and identified. The study showed that the workers were exposed to between 112 and 4.8×10(4) bacteria m(-3) air and 326 and 4.6×10(4) fungi m(-3) air. The personal exposures to bacteria and fungi were significantly higher than the concentrations measured in the truck cabs and in the outdoor references. On average, the fungal and bacterial concentrations in truck cabs were 111 and 7.7 times higher than outdoor reference measurements. In total, 23 fungal and 38 bacterial species were found and identified. Most fungal species belonged to the genus Penicillium and in total 11 Penicillium species were found. Identical fungal species were often found both in a personal sample and in the same person's truck cab, but concentrations were on average 27 times higher in personal samples. Concentrations of fungal and bacterial species found only in the personal samples were lower than concentrations of species also found in truck cabs. Skin-related bacteria constituted a large fraction of bacterial isolates found in personal and truck cab samples. In total, six Staphylococcus species were found. In outdoor samples, no skin-related bacteria were found. On average, concentrations of bacterial species found both in the truck cab and personal samples were 77 times higher in personal samples than in truck cab samples. In conclusion, high concentrations of fungi were found in truck cabs, but the highest

  6. Waste Workers’ Exposure to Airborne Fungal and Bacterial Species in the Truck Cab and During Waste Collection

    PubMed Central

    Madsen, Anne Mette; Alwan, Taif; Ørberg, Anders; Uhrbrand, Katrine; Jørgensen, Marie Birk

    2016-01-01

    A large number of people work with garbage collection, and exposure to microorganisms is considered an occupational health problem. However, knowledge on microbial exposure at species level is limited. The aim of the study was to achieve knowledge on waste collectors’ exposure to airborne inhalable fungal and bacterial species during waste collection with focus on the transport of airborne microorganisms into the truck cab. Airborne microorganisms were collected with samplers mounted in the truck cab, on the workers’ clothes, and outdoors. Fungal and bacterial species were quantified and identified. The study showed that the workers were exposed to between 112 and 4.8×104 bacteria m−3 air and 326 and 4.6×104 fungi m−3 air. The personal exposures to bacteria and fungi were significantly higher than the concentrations measured in the truck cabs and in the outdoor references. On average, the fungal and bacterial concentrations in truck cabs were 111 and 7.7 times higher than outdoor reference measurements. In total, 23 fungal and 38 bacterial species were found and identified. Most fungal species belonged to the genus Penicillium and in total 11 Penicillium species were found. Identical fungal species were often found both in a personal sample and in the same person’s truck cab, but concentrations were on average 27 times higher in personal samples. Concentrations of fungal and bacterial species found only in the personal samples were lower than concentrations of species also found in truck cabs. Skin-related bacteria constituted a large fraction of bacterial isolates found in personal and truck cab samples. In total, six Staphylococcus species were found. In outdoor samples, no skin-related bacteria were found. On average, concentrations of bacterial species found both in the truck cab and personal samples were 77 times higher in personal samples than in truck cab samples. In conclusion, high concentrations of fungi were found in truck cabs, but the

  7. Evaluation of toxic effects of several carboxylic acids on bacterial growth by toxicodynamic modelling

    PubMed Central

    2011-01-01

    Background Effects of organic acids on microbial fermentation are commonly tested in investigations about metabolic behaviour of bacteria. However, they typically provide only descriptive information without modelling the influence of acid concentrations on bacterial kinetics. Results We developed and applied a mathematical model (secondary model) to capture the toxicological effects of those chemicals on kinetic parameters that define the growth of bacteria in batch cultures. Thus, dose-response kinetics were performed with different bacteria (Leuconostoc mesenteroides, Carnobacterium pisicola, Escherichia coli, Bacillus subtilis and Listonella anguillarum) exposed at increasing concentrations of individual carboxylic acids (formic, acetic, propionic, butyric and lactic). In all bioassays the acids affected the maximum bacterial load (Xm) and the maximum growth rate (vm) but only in specific cases the lag phase (λ) was modified. Significance of the parameters was always high and in all fermentations the toxicodynamic equation was statistically consistent and had good predictability. The differences between D and L-lactic acid effects were significant for the growth of E. coli, L. mesenteroides and C. piscicola. In addition, a global parameter (EC50,τ) was used to compare toxic effects and provided a realistic characterization of antimicrobial agents using a single value. Conclusions The effect of several organic acids on the growth of different bacteria was accurately studied and perfectly characterized by a bivariate equation which combines the basis of dose-response theory with microbial growth kinetics (secondary model). The toxicity of carboxylic acids was lower with the increase of the molecular weight of these chemicals. PMID:22118421

  8. Dancing for Food in the Deep Sea: Bacterial Farming by a New Species of Yeti Crab

    PubMed Central

    Thurber, Andrew R.; Jones, William J.; Schnabel, Kareen

    2011-01-01

    Vent and seep animals harness chemosynthetic energy to thrive far from the sun's energy. While symbiont-derived energy fuels many taxa, vent crustaceans have remained an enigma; these shrimps, crabs, and barnacles possess a phylogenetically distinct group of chemosynthetic bacterial epibionts, yet the role of these bacteria has remained unclear. We test whether a new species of Yeti crab, which we describe as Kiwa puravida n. sp, farms the epibiotic bacteria that it grows on its chelipeds (claws), chelipeds that the crab waves in fluid escaping from a deep-sea methane seep. Lipid and isotope analyses provide evidence that epibiotic bacteria are the crab's main food source and K. puravida n. sp. has highly-modified setae (hairs) on its 3rd maxilliped (a mouth appendage) which it uses to harvest these bacteria. The ε- and γ- proteobacteria that this methane-seep species farms are closely related to hydrothermal-vent decapod epibionts. We hypothesize that this species waves its arm in reducing fluid to increase the productivity of its epibionts by removing boundary layers which may otherwise limit carbon fixation. The discovery of this new species, only the second within a family described in 2005, stresses how much remains undiscovered on our continental margins. PMID:22140426

  9. Strain-level bacterial identification by CeO2-catalyzed MALDI-TOF MS fatty acid analysis and comparison to commercial protein-based methods

    PubMed Central

    Cox, C. R.; Jensen, K. R.; Saichek, N. R.; Voorhees, K. J.

    2015-01-01

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has emerged as a rapid approach for clinical bacterial identification. However, current protein-based commercial bacterial ID methods fall short when differentiating closely related species/strains. To address this shortcoming, we employed CeO2-catalyzed fragmentation of lipids to produce fatty acids using the energy inherent to the MALDI laser as a novel alternative to protein profiling. Fatty acid profiles collected from Enterobacteriaceae, Acinetobacter, and Listeria using CeO2-catalyzed metal oxide laser ionization (MOLI MS), processed by principal component analysis, and validated by leave–one-out cross-validation (CV), showed 100% correct classification at the species level and 98% at the strain level. In comparison, protein profile data from the same bacteria yielded 32%, 54% and 67% mean species-level accuracy using two MALDI-TOF MS platforms, respectively. In addition, several pathogens were misidentified by protein profiling as non-pathogens and vice versa. These results suggest novel CeO2-catalyzed lipid fragmentation readily produced (i) taxonomically tractable fatty acid profiles by MOLI MS, (ii) highly accurate bacterial classification and (iii) consistent strain-level ID for bacteria that were routinely misidentified by protein-based methods. PMID:26190224

  10. Spatial and Species Variations in Bacterial Communities Associated with Corals from the Red Sea as Revealed by Pyrosequencing

    PubMed Central

    Lee, On On; Yang, Jiangke; Bougouffa, Salim; Wang, Yong; Batang, Zenon; Tian, Renmao; Al-Suwailem, Abdulaziz

    2012-01-01

    Microbial associations with corals are common and are most likely symbiotic, although their diversity and relationships with environmental factors and host species remain unclear. In this study, we adopted a 16S rRNA gene tag-pyrosequencing technique to investigate the bacterial communities associated with three stony Scleractinea and two soft Octocorallia corals from three locations in the Red Sea. Our results revealed highly diverse bacterial communities in the Red Sea corals, with more than 600 ribotypes detected and up to 1,000 species estimated from a single coral species. Altogether, 21 bacterial phyla were recovered from the corals, of which Gammaproteobacteria was the most dominant group, and Chloroflexi, Chlamydiae, and the candidate phylum WS3 were reported in corals for the first time. The associated bacterial communities varied greatly with location, where environmental conditions differed significantly. Corals from disturbed areas appeared to share more similar bacterial communities, but larger variations in community structures were observed between different coral species from pristine waters. Ordination methods identified salinity and depth as the most influential parameters affecting the abundance of Vibrio, Pseudoalteromonas, Serratia, Stenotrophomonas, Pseudomonas, and Achromobacter in the corals. On the other hand, bacteria such as Chloracidobacterium and Endozoicomonas were more sensitive to the coral species, suggesting that the host species type may be influential in the associated bacterial community, as well. The combined influences of the coral host and environmental factors on the associated microbial communities are discussed. This study represents the first comparative study using tag-pyrosequencing technology to investigate the bacterial communities in Red Sea corals. PMID:22865078

  11. Epidemiology of urinary tract infections, bacterial species and resistances in primary care in France.

    PubMed

    Malmartel, A; Ghasarossian, C

    2016-03-01

    General practitioners often have to manage urinary tract infections (UTI) with probabilistic treatments, although bacterial resistances are increasing. Therefore, the French Society of Infectious Diseases published new guidelines in 2014. The aim of this study was to investigate the bacterial epidemiology of UTI in the general population in primary care and analyse risk factors for Escherichia coli resistance to antibiotics. A cross-sectional study was conducted in 12 ambulatory laboratories. Patients over 18 years of age coming for urinalysis were included. Risk factors for UTI were collected using a questionnaire and the laboratory records. Bacteria meeting criteria for UTI were analysed. A positive urinalysis was found in 1119 patients, corresponding to 1125 bacterial isolates. The bacterial species were: E. coli (73 %), Enterococcus spp. (7 %), Klebsiella spp. (6 %), Proteus spp. (4 %), Staphylococcus spp. (3 %) and Pseudomonas spp. (2 %). Regardless of the bacteria, the most common resistance was that to co-trimoxazole: 27 % (95 % confidence interval [CI] = [0.24; 0.30]), followed by ofloxacin resistance: 16 % [0.14; 0.18]. Escherichia coli resistances to co-trimoxazole, ofloxacin, cefixime, nitrofurantoin and fosfomycin were, respectively, 25.5 % [0.23; 0.28], 17 % [0.14; 0.20], 5.6 % [0.04; 0.07], 2.2 % [0.01; 0.03] and 1.2 % [0.005; 0.02]. Independent risk factors for E. coli resistance to ofloxacin were age over 85 years (odds ratio [OR] = 3.08; [1.61; 5.87]) and a history of UTI in the last 6 months (OR = 2.34; [1.54; 3.52]). Our findings support the guidelines recommending fluoroquinolone sparing. The scarcity of E. coli resistance to fosfomycin justifies its use as a first-line treatment in acute cystitis. These results should be reassessed in a few years to identify changes in the bacterial epidemiology of UTI. PMID:26740324

  12. Spatial Organization of Dual-Species Bacterial Aggregates on Leaf Surfaces

    PubMed Central

    Monier, J.-M.; Lindow, S. E.

    2005-01-01

    The spatial organization of cells within bacterial aggregates on leaf surfaces was determined for pair-wise mixtures of three different bacterial species commonly found on leaves, Pseudomonas syringae, Pantoea agglomerans, and Pseudomonas fluorescens. Cells were coinoculated onto bean plants and allowed to grow under moist conditions, and the resulting aggregates were examined in situ by epifluorescence microscopy. Each bacterial strain could be localized because it expressed either the green or the cyan fluorescent protein constitutively, and the viability of individual cells was assessed by propidium iodide staining. Each pair of bacterial strains that was coinoculated onto leaves formed mixed aggregates. The degree of segregation of cells in mixed aggregates differed between the different coinoculated pairs of strains and was higher in mixtures of P. fluorescens A506 and P. agglomerans 299R and mixtures of P. syringae B728a and P. agglomerans 299R than in mixtures of two isogenic strains of P. agglomerans 299R. The fractions of the total cell population that were dead in mixed and monospecific aggregates of a gfp-marked strain of P. agglomerans 299R and a cfp-marked strain of P. agglomerans 299R, or of P. fluorescens A506 and P. agglomerans 299R, were similar. However, the proportion of dead cells in mixed aggregates of P. syringae B728a and P. agglomerans 299R was significantly higher (13.2% ± 8.2%) than that in monospecific aggregates of these two strains (1.6% ± 0.7%), and it increased over time. While dead cells in such mixed aggregates were preferentially found at the interface between clusters of cells of these strains, cells of these two strains located at the interface did not exhibit equal probabilities of mortality. After 9 days of incubation, about 77% of the P. agglomerans 299R cells located at the interface were dead, while only about 24% of the P. syringae B728a cells were dead. The relevance of our results to understanding bacterial interactions

  13. Protozoan, Bacterial, and Volatile Fatty Acid Changes Associated with Feeding Tylosin

    PubMed Central

    Satapathy, N.; Purser, D. B.

    1967-01-01

    Tylosin was fed to two of six wethers for 79 days, to a second two for only 28 days, and not at all to a third pair (controls). The addition of tylosin to the daily feed resulted in a rapid twofold increase in protozoal concentration and a change in the composition or characteristics, or both, of the bacterial population. The results indicate that the bacterial population was modified to the extent of about 80%. Total acid concentrations were initially depressed but appeared to be greater than those in control animals at the termination of the experiment. Deletion of tylosin from the ration resulted in a rapid decrease in protozoal concentrations, whereas changes in the bacterial population did not occur for a further 30 days. PMID:16349756

  14. Bacterial d-amino acid oxidases: Recent findings and future perspectives

    PubMed Central

    Takahashi, Shouji; Abe, Katsumasa; Kera, Yoshio

    2015-01-01

    D-Amino acid oxidase (DAO) is a flavin enzyme that catalyzes the oxidative deamination of d-amino acids. This enzyme has been studied extensively both biochemically and structurally as a model for the oxidase-dehydrogenase class of flavoproteins. This enzyme also has various applications, such as the determination of d-amino acids and production of building blocks for a number of pharmaceuticals. DAO has been found mainly in eukaryotic organisms and has been suggested to play a significant role in various cellular processes, one of which includes neurotransmission in the human brain. In contrast, this enzyme has not been identified in prokaryotic organisms. Some studies have recently identified and characterized DAO enzyme in some actinobacteria. In addition, a genome database search reveals a wide distribution of DAO homologous genes in this bacterial group. The bacterial DAOs characterized so far have certain distinct properties in comparison to eukaryotic DAOs. These enzymes also exhibit some important applicable properties, suggesting that bacteria could be used as a source for obtaining novel and useful DAOs. The physiological function of bacterial DAO have been proposed to include the degradation of non-canonical d-amino acids released from cell wall, but is still largely unknown and need to be studied in depth. PMID:25996186

  15. A Duplex PCR-Based Assay for Measuring the Amount of Bacterial Contamination in a Nucleic Acid Extract from a Culture of Free-Living Protists

    PubMed Central

    Marron, Alan O.; Akam, Michael; Walker, Giselle

    2013-01-01

    Background Cultures of heterotrophic protists often require co-culturing with bacteria to act as a source of nutrition. Such cultures will contain varying levels of intrinsic bacterial contamination that can interfere with molecular research and cause problems with the collection of sufficient material for sequencing. Measuring the levels of bacterial contamination for the purposes of molecular biology research is non-trivial, and can be complicated by the presence of a diverse bacterial flora, or by differences in the relative nucleic acid yield per bacterial or eukaryotic cell. Principal Findings Here we describe a duplex PCR-based assay that can be used to measure the levels of contamination from marine bacteria in a culture of loricate choanoflagellates. By comparison to a standard culture of known target sequence content, the assay can be used to quantify the relative proportions of bacterial and choanoflagellate material in DNA or RNA samples extracted from a culture. We apply the assay to compare methods of purifying choanoflagellate cultures prior to DNA extraction, to determine their effectiveness in reducing bacterial contamination. Together with measurements of the total nucleic acid concentration, the assay can then be used as the basis for determining the absolute amounts of choanoflagellate DNA or RNA present in a sample. Conclusions The assay protocol we describe here is a simple and relatively inexpensive method of measuring contamination levels in nucleic acid samples. This provides a new way to establish quantification and purification protocols for molecular biology and genomics in novel heterotrophic protist species. Guidelines are provided to develop a similar protocol for use with any protistan culture. This assay method is recommended where qPCR equipment is unavailable, where qPCR is not viable because of the nature of the bacterial contamination or starting material, or where prior sequence information is insufficient to develop q

  16. Changes in ruminal bacterial community composition following feeding of alfalfa ensiled with a lactic acid bacterial inoculant.

    PubMed

    Mohammed, R; Stevenson, D M; Beauchemin, K A; Muck, R E; Weimer, P J

    2012-01-01

    Some silage inoculants help to improve silage quality and promote an increase in milk production, possibly through altering the rumen microflora. We hypothesized that rumen bacterial community composition (BCC) would be different in cows fed alfalfa ensiled with the inoculant Lactobacillus plantarum MTD/1 (LP) compared with those fed alfalfa ensiled without the inoculant (Ctrl). Eight ruminally cannulated Holstein cows were allotted to 2 diets (Ctrl or LP) in a double crossover design with four 28-d periods. Diets were formulated to contain (% dry matter basis) 28.0% neutral detergent fiber and 16.2% crude protein, and contained alfalfa silage, 50.9; corn silage, 20.6; high-moisture shelled corn, 21.4; soy hulls, 4.7; plus minerals and vitamins, 2.4. Ruminal digesta were collected just before feeding on 3 consecutive days near the end of each period, and were separated into solid and liquid phases. Microbial DNA was extracted from each phase, amplified by PCR using domain-level bacterial primers, and subjected to automated ribosomal intergenic spacer analysis. The pH was 4.56 and 4.86 and the lactate-to-acetate ratio 9.8 and 4.4, respectively, for the treated and untreated alfalfa silages. Dry matter intakes and milk production data were not influenced by diets but showed a cow effect. Total volatile fatty acids (mM) tended to be greater for LP compared with Ctrl. Individual volatile fatty acids were not influenced by diets but showed a significant cow effect. Ruminal acetate (mol/100 mol) and acetate-to-propionate ratio were lower and propionate (mol/100 mol) greater for the 2 milk fat-depressed (MFD; <3.2% fat content) cows compared with the other 6 cows. Correspondence analysis of the 265 peaks in the automated ribosomal intergenic spacer analysis profile across the 188 samples revealed that the first 2 components contributed 7.1 and 3.8% to the total variation in the profile. The ordination points representing the liquid and solid phases clustered separately

  17. Relationship between the Presence of Bartonella Species and Bacterial Loads in Cats and Cat Fleas (Ctenocephalides felis) under Natural Conditions

    PubMed Central

    Gutiérrez, Ricardo; Nachum-Biala, Yaarit

    2015-01-01

    Cats are considered the main reservoir of three zoonotic Bartonella species: Bartonella henselae, Bartonella clarridgeiae, and Bartonella koehlerae. Cat fleas (Ctenocephalides felis) have been experimentally demonstrated to be a competent vector of B. henselae and have been proposed as the potential vector of the two other Bartonella species. Previous studies have reported a lack of association between the Bartonella species infection status (infected or uninfected) and/or bacteremia levels of cats and the infection status of the fleas they host. Nevertheless, to date, no study has compared the quantitative distributions of these bacteria in both cats and their fleas under natural conditions. Thus, the present study explored these relationships by identifying and quantifying the different Bartonella species in both cats and their fleas. Therefore, EDTA-blood samples and fleas collected from stray cats were screened for Bartonella bacteria. Bacterial loads were quantified by high-resolution melt real-time quantitative PCR assays. The results indicated a moderate correlation between the Bartonella bacterial loads in the cats and their fleas when both were infected with the same Bartonella species. Moreover, a positive effect of the host infection status on the Bartonella bacterial loads of the fleas was observed. Conversely, the cat bacterial loads were not affected by the infection status of their fleas. Our results suggest that the Bartonella bacterial loads of fleas are positively affected by the presence of the bacteria in their feline host, probably by multiple acquisitions/accumulation and/or multiplication events. PMID:26070666

  18. Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer

    USGS Publications Warehouse

    Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.

    2009-01-01

    Background: Phylogeographic reconstruction of some bacterial populations is hindered by low diversity coupled with high levels of lateral gene transfer. A comparison of recombination levels and diversity at seven housekeeping genes for eleven bacterial species, most of which are commonly cited as having high levels of lateral gene transfer shows that the relative contributions of homologous recombination versus mutation for Burkholderia pseudomallei is over two times higher than for Streptococcus pneumoniae and is thus the highest value yet reported in bacteria. Despite the potential for homologous recombination to increase diversity, B. pseudomallei exhibits a relative lack of diversity at these loci. In these situations, whole genome genotyping of orthologous shared single nucleotide polymorphism loci, discovered using next generation sequencing technologies, can provide very large data sets capable of estimating core phylogenetic relationships. We compared and searched 43 whole genome sequences of B. pseudomallei and its closest relatives for single nucleotide polymorphisms in orthologous shared regions to use in phylogenetic reconstruction. Results: Bayesian phylogenetic analyses of >14,000 single nucleotide polymorphisms yielded completely resolved trees for these 43 strains with high levels of statistical support. These results enable a better understanding of a separate analysis of population differentiation among >1,700 B. pseudomallei isolates as defined by sequence data from seven housekeeping genes. We analyzed this larger data set for population structure and allele sharing that can be attributed to lateral gene transfer. Our results suggest that despite an almost panmictic population, we can detect two distinct populations of B. pseudomallei that conform to biogeographic patterns found in many plant and animal species. That is, separation along Wallace's Line, a biogeographic boundary between Southeast Asia and Australia. Conclusion: We describe an

  19. Bacterial community compositions in sediment polluted by perfluoroalkyl acids (PFAAs) using Illumina high-throughput sequencing.

    PubMed

    Sun, Yajun; Wang, Tieyu; Peng, Xiawei; Wang, Pei; Lu, Yonglong

    2016-06-01

    The characterization of bacterial community compositions and the change in perfluoroalkyl acids (PFAAs) along a natural river distribution system were explored in the present study. Illumina high-throughput sequencing was used to explore bacterial community diversity and structure in sediment polluted by PFAAs from the Xiaoqing River, the area with concentrated fluorochemical facilities in China. The concentration of PFAAs was in the range of 8.44-465.60 ng/g dry weight (dw) in sediment. Perfluorooctanoic acid (PFOA) was the dominant PFAA in all samples, which accounted for 94.2 % of total PFAAs. High-level PFOA could lead to an obvious increase in relative abundance of Proteobacteria, ε-Proteobacteria, Thiobacillus, and Sulfurimonas and the decrease in relative abundance of other bacteria. Redundancy analysis revealed that PFOA played an important role in the formation of bacterial community, and PFOA at higher concentration could reduce the diversity of bacterial community. When the concentration of PFOA was below 100 ng/g dw in sediment, no significant effect on microbial community structure was observed. Thiobacillus and Sulfurimonas were positively correlated with the concentration of PFOA, suggesting that both genera were resistant to PFOA contamination. PMID:26780047

  20. Life history correlates of fecal bacterial species richness in a wild population of the blue tit Cyanistes caeruleus

    PubMed Central

    Benskin, Clare McW H; Rhodes, Glenn; Pickup, Roger W; Mainwaring, Mark C; Wilson, Kenneth; Hartley, Ian R

    2015-01-01

    Very little is known about the normal gastrointestinal flora of wild birds, or how it might affect or reflect the host's life-history traits. The aim of this study was to survey the species richness of bacteria in the feces of a wild population of blue tits Cyanistes caeruleus and to explore the relationships between bacterial species richness and various life-history traits, such as age, sex, and reproductive success. Using PCR-TGGE, 55 operational taxonomic units (OTUs) were identified in blue tit feces. DNA sequencing revealed that the 16S rRNA gene was amplified from a diverse range of bacteria, including those that shared closest homology with Bacillus licheniformis, Campylobacter lari, Pseudomonas spp., and Salmonella spp. For adults, there was a significant negative relationship between bacterial species richness and the likelihood of being detected alive the following breeding season; bacterial richness was consistent across years but declined through the breeding season; and breeding pairs had significantly more similar bacterial richness than expected by chance alone. Reduced adult survival was correlated with the presence of an OTU most closely resembling C. lari; enhanced adult survival was associated with an OTU most similar to Arthrobacter spp. For nestlings, there was no significant change in bacterial species richness between the first and second week after hatching, and nestlings sharing the same nest had significantly more similar bacterial richness. Collectively, these results provide compelling evidence that bacterial species richness was associated with several aspects of the life history of their hosts. PMID:25750710

  1. PLANT MICROBIOME. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa.

    PubMed

    Lebeis, Sarah L; Paredes, Sur Herrera; Lundberg, Derek S; Breakfield, Natalie; Gehring, Jase; McDonald, Meredith; Malfatti, Stephanie; Glavina del Rio, Tijana; Jones, Corbin D; Tringe, Susannah G; Dangl, Jeffery L

    2015-08-21

    Immune systems distinguish "self" from "nonself" to maintain homeostasis and must differentially gate access to allow colonization by potentially beneficial, nonpathogenic microbes. Plant roots grow within extremely diverse soil microbial communities but assemble a taxonomically limited root-associated microbiome. We grew isogenic Arabidopsis thaliana mutants with altered immune systems in a wild soil and also in recolonization experiments with a synthetic bacterial community. We established that biosynthesis of, and signaling dependent on, the foliar defense phytohormone salicylic acid is required to assemble a normal root microbiome. Salicylic acid modulates colonization of the root by specific bacterial families. Thus, plant immune signaling drives selection from the available microbial communities to sculpt the root microbiome. PMID:26184915

  2. Bacterial species and their associations with acute and chronic mastitis in suckler ewes.

    PubMed

    Smith, E M; Willis, Z N; Blakeley, M; Lovatt, F; Purdy, K J; Green, L E

    2015-10-01

    Acute mastitis in suckler ewes is often detected because of systemic signs such as anorexia or lameness, whereas chronic mastitis, characterized by intramammary abscesses with no systemic disease, is typically detected when ewes are inspected before mating. The aims of the current study were to identify the species and strains of culturable bacteria associated with acutely diseased, chronically diseased, and unaffected mammary glands to investigate whether species and strains vary by state. To investigate acute mastitis, 28 milk samples were obtained from both glands of 14 ewes with acute mastitis in one gland only. To investigate chronic mastitis, 16 ovine udders were obtained from 2 abattoirs; milk was aspirated from the 32 glands where possible, and the udders were sectioned to expose intramammary abscesses, which were swab sampled. All milk and swab samples were cultured aerobically. In total, 37 bacterial species were identified, 4 from acute mastitis, 26 from chronic mastitis, and 8 from apparently healthy glands. In chronic mastitis, the overall coincidence index of overlap of species detected in intramammary abscesses and milk was 0.60, reducing to 0.36 within individual glands, indicating a high degree of species overlap in milk and abscesses overall, but less overlap within specific glands. Staphylococcus aureus was detected frequently in all sample types; it was isolated from 10/14 glands with acute mastitis. In 5 ewes, closely related strains were present in both affected and unaffected glands. In chronic mastitis, closely related Staphylococcus aureus strains were detected in milk and abscesses from the same gland. PMID:26277313

  3. Three R's of bacterial evolution: how replication, repair, and recombination frame the origin of species.

    PubMed

    Brown, E W; LeClerc, J E; Kotewicz, M L; Cebula, T A

    2001-01-01

    The genetic diversity of bacteria results not only from errors in DNA replication and repair but from horizontal exchange and recombination of DNA sequences from similar and disparate species as well. New individuals carrying adaptive changes are thus being spawned constantly among the population at large. When new selection pressures appear, these are the individuals that survive, at the expense of the general population, to forge new populations. Depending on the severity and uniqueness of the selection pressure, this could lead to new speciation. It is becoming more and more evident that, as nucleotide sequences of numerous loci from many bacterial strains continue to amass, horizontal transfer has played a key role in configuring the Escherichia coli chromosome. Here, we examine views, both old and new, for the role of recombination in the evolution of bacterial chromosomes. We present novel phylogenetic evidence for horizontal transfer of three genes involved in DNA replication and repair (mutS, uvrD, and polA). These data reveal a prominent role for horizontal transfer in the evolution of genes known to play a key role in the fidelity of DNA replication and, thus, ultimate survival of the organism. Our data underscore that recombination plays both a diversifying and a homogenizing role in defining the structure of the E. coli genome. PMID:11746762

  4. Goniothalamus Species: A Source of Drugs for the Treatment of Cancers and Bacterial Infections?

    PubMed Central

    2007-01-01

    Irrespective of the presence of cytotoxic acetogenins and styryl-lactones in the genus Goniothalamus, only 22 species in the genus Goniothalamus, out of 160 species (13.7%) have so far been investigated. In an effort to promote further research on the genus Goniothalamus which could represent a source of drugs for the treatment of cancers and bacterial infections, this work offers a broad analysis of current knowledge on Goniothalamus species. Therefore, it includes (i) taxonomy (ii) botanical description (iii) traditional medicinal uses and (iv) phytochemical and pharmacological studies. We discuss the molecular mechanisms of actions of acetogenins and styryl-lactones, with some emphasis on the possible involvement of protein kinase, Bax and TRAIL receptors in the cytotoxic effects of styryl-lactones. We also report (v) the growth inhibition of several nosocomial bacteria by Goniothalamus. scortechinii. The crude methanol extract of G. scortechinii showed a good and broad spectrum of antibacterial activity against both Gram-negative and Gram-positive bacteria. PMID:17965760

  5. Goniothalamus species: a source of drugs for the treatment of cancers and bacterial infections?

    PubMed

    Wiart, Christophe

    2007-09-01

    Irrespective of the presence of cytotoxic acetogenins and styryl-lactones in the genus Goniothalamus, only 22 species in the genus Goniothalamus, out of 160 species (13.7%) have so far been investigated. In an effort to promote further research on the genus Goniothalamus which could represent a source of drugs for the treatment of cancers and bacterial infections, this work offers a broad analysis of current knowledge on Goniothalamus species. Therefore, it includes (i) taxonomy (ii) botanical description (iii) traditional medicinal uses and (iv) phytochemical and pharmacological studies. We discuss the molecular mechanisms of actions of acetogenins and styryl-lactones, with some emphasis on the possible involvement of protein kinase, Bax and TRAIL receptors in the cytotoxic effects of styryl-lactones. We also report (v) the growth inhibition of several nosocomial bacteria by Goniothalamus. scortechinii. The crude methanol extract of G. scortechinii showed a good and broad spectrum of antibacterial activity against both Gram-negative and Gram-positive bacteria. PMID:17965760

  6. Long-term maintenance of species-specific bacterial microbiota in the basal metazoan Hydra

    PubMed Central

    Fraune, Sebastian; Bosch, Thomas C. G.

    2007-01-01

    Epithelia in animals are colonized by complex communities of microbes. Although a topic of long-standing interest, understanding the evolution of the microbial communities and their role in triggering innate immune responses has resisted analysis. Cnidaria are among the simplest animals at the tissue grade of organization. To obtain a better understanding of the microbiota associated with phylogenetically ancient epithelia, we have identified the epibiotic and endosymbiotic bacteria of two species of the cnidarian Hydra on the basis of rRNA comparisons. We analyzed individuals of Hydra oligactis and Hydra vulgaris from both laboratory cultures and the wild. We discovered that individuals from both species differ greatly in their bacterial microbiota. Although H. vulgaris polyps have a quite diverse microbiota, H. oligactis appears to be associated with only a limited number of microbes; some of them were found, unexpectedly, to be endosymbionts. Surprisingly, the microfauna showed similar characteristics in individuals of cultures maintained in the laboratory for >30 years and polyps directly isolated from the wild. The significant differences in the microbial communities between the two species and the maintenance of specific microbial communities over long periods of time strongly indicate distinct selective pressures imposed on and within the epithelium. Our analysis suggests that the Hydra epithelium actively selects and shapes its microbial community. PMID:17664430

  7. Surviving Chytridiomycosis: Differential Anti-Batrachochytrium dendrobatidis Activity in Bacterial Isolates from Three Lowland Species of Atelopus

    PubMed Central

    Flechas, Sandra V.; Sarmiento, Carolina; Cárdenas, Martha E.; Medina, Edgar M.; Restrepo, Silvia; Amézquita, Adolfo

    2012-01-01

    In the Neotropics, almost every species of the stream-dwelling harlequin toads (genus Atelopus) have experienced catastrophic declines. The persistence of lowland species of Atelopus could be explained by the lower growth rate of Batrachochytrium dendrobatidis (Bd) at temperatures above 25°C. We tested the complementary hypothesis that the toads' skin bacterial microbiota acts as a protective barrier against the pathogen, perhaps delaying or impeding the symptomatic phase of chytridiomycosis. We isolated 148 cultivable bacterial strains from three lowland Atelopus species and quantified the anti-Bd activity through antagonism assays. Twenty-six percent (38 strains representing 12 species) of the bacteria inhibited Bd growth and just two of them were shared among the toad species sampled in different localities. Interestingly, the strongest anti-Bd activity was measured in bacteria isolated from A. elegans, the only species that tested positive for the pathogen. The cutaneous bacterial microbiota is thus likely a fitness-enhancing trait that may (adaptation) or not (exaptation) have appeared because of natural selection mediated by chytridiomycosis. Our findings reveal bacterial strains for development of local probiotic treatments against chytridiomycosis and also shed light on the mechanisms behind the frog-bacteria-pathogen interaction. PMID:22970314

  8. Surviving chytridiomycosis: differential anti-Batrachochytrium dendrobatidis activity in bacterial isolates from three lowland species of Atelopus.

    PubMed

    Flechas, Sandra V; Sarmiento, Carolina; Cárdenas, Martha E; Medina, Edgar M; Restrepo, Silvia; Amézquita, Adolfo

    2012-01-01

    In the Neotropics, almost every species of the stream-dwelling harlequin toads (genus Atelopus) have experienced catastrophic declines. The persistence of lowland species of Atelopus could be explained by the lower growth rate of Batrachochytrium dendrobatidis (Bd) at temperatures above 25 °C. We tested the complementary hypothesis that the toads' skin bacterial microbiota acts as a protective barrier against the pathogen, perhaps delaying or impeding the symptomatic phase of chytridiomycosis. We isolated 148 cultivable bacterial strains from three lowland Atelopus species and quantified the anti-Bd activity through antagonism assays. Twenty-six percent (38 strains representing 12 species) of the bacteria inhibited Bd growth and just two of them were shared among the toad species sampled in different localities. Interestingly, the strongest anti-Bd activity was measured in bacteria isolated from A. elegans, the only species that tested positive for the pathogen. The cutaneous bacterial microbiota is thus likely a fitness-enhancing trait that may (adaptation) or not (exaptation) have appeared because of natural selection mediated by chytridiomycosis. Our findings reveal bacterial strains for development of local probiotic treatments against chytridiomycosis and also shed light on the mechanisms behind the frog-bacteria-pathogen interaction. PMID:22970314

  9. Structure-Activity Relationships of Antimicrobial Gallic Acid Derivatives from Pomegranate and Acacia Fruit Extracts against Potato Bacterial Wilt Pathogen.

    PubMed

    Farag, Mohamed A; Al-Mahdy, Dalia A; Salah El Dine, Riham; Fahmy, Sherifa; Yassin, Aymen; Porzel, Andrea; Brandt, Wolfgang

    2015-06-01

    Bacterial wilts of potato, tomato, pepper, and or eggplant caused by Ralstonia solanacearum are among the most serious plant diseases worldwide. In this study, the issue of developing bactericidal agents from natural sources against R. solanacearum derived from plant extracts was addressed. Extracts prepared from 25 plant species with antiseptic relevance in Egyptian folk medicine were screened for their antimicrobial properties against the potato pathogen R. solancearum by using the disc-zone inhibition assay and microtitre plate dilution method. Plants exhibiting notable antimicrobial activities against the tested pathogen include extracts from Acacia arabica and Punica granatum. Bioactivity-guided fractionation of A. arabica and P. granatum resulted in the isolation of bioactive compounds 3,5-dihydroxy-4-methoxybenzoic acid and gallic acid, in addition to epicatechin. All isolates displayed significant antimicrobial activities against R. solanacearum (MIC values 0.5-9 mg/ml), with 3,5-dihydroxy-4-methoxybenzoic acid being the most effective one with a MIC value of 0.47 mg/ml. We further performed a structure-activity relationship (SAR) study for the inhibition of R. solanacearum growth by ten natural, structurally related benzoic acids. PMID:26080741

  10. Southern leaf blight disease severity is correlated with decreased maize leaf epiphytic bacterial species richness and the phyllosphere bacterial diversity decline is enhanced by nitrogen fertilization

    PubMed Central

    Manching, Heather C.; Balint-Kurti, Peter J.; Stapleton, Ann E.

    2014-01-01

    Plant leaves are inhabited by a diverse group of microorganisms that are important contributors to optimal growth. Biotic and abiotic effects on plant growth are usually studied in controlled settings examining response to variation in single factors and in field settings with large numbers of variables. Multi-factor experiments with combinations of stresses bridge this gap, increasing our understanding of the genotype-environment-phenotype functional map for the host plant and the affiliated epiphytic community. The maize inbred B73 was exposed to single and combination abiotic and the biotic stress treatments: low nitrogen fertilizer and high levels of infection with southern leaf blight (causal agent Cochliobolus heterostrophus). Microbial epiphyte samples were collected at the vegetative early-season phase and species composition was determined using 16S ribosomal intergenic spacer analysis. Plant traits and level of southern leaf blight disease were measured late-season. Bacterial diversity was different among stress treatment groups (P < 0.001). Lower species richness—alpha diversity—was correlated with increased severity of southern leaf blight disease when disease pressure was high. Nitrogen fertilization intensified the decline in bacterial alpha diversity. While no single bacterial ribotype was consistently associated with disease severity, small sets of ribotypes were good predictors of disease levels. Difference in leaf bacterial-epiphyte diversity early in the season were correlated with plant disease severity, supporting further tests of microbial epiphyte-disease correlations for use in predicting disease progression. PMID:25177328

  11. Isolation and Identification of a New Tetrodotoxin-Producing Bacterial Species, Raoultella terrigena, from Hong Kong Marine Puffer Fish Takifugu niphobles

    PubMed Central

    Yu, Vincent Chung-Him; Yu, Peter Hoi-Fu; Ho, Kin-Chung; Lee, Fred Wang-Fat

    2011-01-01

    Puffer fish, Takifugu niphobles, collected from the Hong Kong coastal waters were screened for tetrodotoxin-producing bacteria. A Gram-negative, non-acid-fast, non-sporing and rod shaped bacterial strain (designated as gutB01) was isolated from the intestine of the puffer fish and was shown to produce tetrodotoxin (TTX). Based on the Microbial Identification (MIDI) and 16S-23S rDNA internal transcribed spacer (ITS) phylogenetic analysis, the strain was identified as Raoultella terrigena. The TTX production ability of the strain was confirmed by mouse bioassay, ELISA and mass spectrometry (MALDI-TOF). Our results reiterate that the TTX found in puffer fish was likely produced by the associated bacteria and TTX are widely produced amongst a diversity of bacterial species. PMID:22163191

  12. Bacterial species associated with traditional starter cultures used for fermented bamboo shoot production in Manipur state of India.

    PubMed

    Jeyaram, K; Romi, W; Singh, Th Anand; Devi, A Ranjita; Devi, S Soni

    2010-09-30

    Soidon is a non-salted acidic fermented food prepared from the succulent bamboo shoot tip of Schizostachyum capitatum Munro by using a traditional liquid starter called "soidon mahi" in Manipur state of India. In this study, 163 bacterial isolates associated with this starter samples were identified and their population distribution was investigated by amplified ribosomal DNA restriction analysis (ARDRA), 16S rDNA sequencing and randomly amplified polymorphic DNA (RAPD) analysis. This acidic starter (pH 4.5+/-0.15) was dominated by a characteristic association of Bacillus and lactic acid bacteria (LAB) together. The population distribution of dominant species were Bacillus subtilis 29.3%, Bacillus cereus 35.7%, Bacillus pumilus 2.6%, Lactobacillus brevis 9.6%, Lactobacillus plantarum 5.1%, Carnobacterium sp. 11.9%, Enterococcus faecium 1.2% and Pseudomonas fluorescens 4.6%. Alarming population load (10(6)-10(7)cfu/ml) of B. cereus in 87% of starter samples studied should raise concern regarding biosafety of soidon consumption. PCR amplification of 16S-23S rDNA intergenic transcribed spacer (ITS) region and ITS-RFLP profiles revealed a high diversity with eight subgroups in B. subtilis, five subgroups in B. cereus and three subgroups in L. brevis isolates. The most abundant B. subtilis subgroup IB.1 distributed in most of the samples showed very less clonal variability during RAPD analysis. The molecular methods used in this study identified the dominant strains of Bacillus and LAB distributed in most of the starter samples. These dominant strains of B. subtilis, L. brevis and L. plantarum would allow for developing a defined starter culture for the production of quality soidon. PMID:20696489

  13. Coevolution between Stop Codon Usage and Release Factors in Bacterial Species.

    PubMed

    Wei, Yulong; Wang, Juan; Xia, Xuhua

    2016-09-01

    Three stop codons in bacteria represent different translation termination signals, and their usage is expected to depend on their differences in translation termination efficiency, mutation bias, and relative abundance of release factors (RF1 decoding UAA and UAG, and RF2 decoding UAA and UGA). In 14 bacterial species (covering Proteobacteria, Firmicutes, Cyanobacteria, Actinobacteria and Spirochetes) with cellular RF1 and RF2 quantified, UAA is consistently over-represented in highly expressed genes (HEGs) relative to lowly expressed genes (LEGs), whereas UGA usage is the opposite even in species where RF2 is far more abundant than RF1. UGA usage relative to UAG increases significantly with PRF2 [=RF2/(RF1 + RF2)] as expected from adaptation between stop codons and their decoders. PRF2 is > 0.5 over a wide range of AT content (measured by PAT3 as the proportion of AT at third codon sites), but decreases rapidly toward zero at the high range of PAT3 This explains why bacterial lineages with high PAT3 often have UGA reassigned because of low RF2. There is no indication that UAG is a minor stop codon in bacteria as claimed in a recent publication. The claim is invalid because of the failure to apply the two key criteria in identifying a minor codon: (1) it is least preferred by HEGs (or most preferred by LEGs) and (2) it corresponds to the least abundant decoder. Our results suggest a more plausible explanation for why UAA usage increases, and UGA usage decreases, with PAT3, but UAG usage remains low over the entire PAT3 range. PMID:27297468

  14. Pathogenic Bacterial Species Associated with Endodontic Infection Evade Innate Immune Control by Disabling Neutrophils

    PubMed Central

    Matsui, Aritsune; Jin, Jun-O; Johnston, Christopher D.; Yamazaki, Hajime; Houri-Haddad, Yael

    2014-01-01

    Endodontic infections, in which oral bacteria access the tooth pulp chamber, are common and do not resolve once established. To investigate the effects of these infections on the innate immune response, we established a mouse subcutaneous chamber model, where a mixture of four oral pathogens commonly associated with these infections (endodontic pathogens [EP]), i.e., Fusobacterium nucleatum, Streptococcus intermedius, Parvimonas micra, and Prevotella intermedia, was inoculated into subcutaneously implanted titanium chambers. Cells that infiltrated the chamber after these infections were primarily neutrophils; however, these neutrophils were unable to control the infection. Infection with a nonpathogenic oral bacterial species, Streptococcus mitis, resulted in well-controlled infection, with bacterial numbers reduced by 4 to 5 log units after 7 days. Propidium iodide (PI) staining of the chamber neutrophils identified three distinct populations: neutrophils from EP-infected chambers were intermediate in PI staining, while cells in chambers from mice infected with S. mitis were PI positive (apoptotic) or negative (live). Strikingly, neutrophils from EP-infected chambers were severely impaired in their ability to phagocytose and to generate reactive oxygen species in vitro after removal from the chamber compared to cells from S. mitis-infected chambers. The mechanism of neutrophil impairment was necrotic cell death as determined by morphological analyses. P. intermedia alone could induce a similar neutrophil phenotype. We conclude that the endodontic pathogens, particularly P. intermedia, can efficiently disable and kill infiltrating neutrophils, allowing these infections to become established. These results can help explain the persistence of endodontic infections and demonstrate a new virulence mechanism associated with P. intermedia. PMID:25024367

  15. Coevolution between Stop Codon Usage and Release Factors in Bacterial Species

    PubMed Central

    Wei, Yulong; Wang, Juan; Xia, Xuhua

    2016-01-01

    Three stop codons in bacteria represent different translation termination signals, and their usage is expected to depend on their differences in translation termination efficiency, mutation bias, and relative abundance of release factors (RF1 decoding UAA and UAG, and RF2 decoding UAA and UGA). In 14 bacterial species (covering Proteobacteria, Firmicutes, Cyanobacteria, Actinobacteria and Spirochetes) with cellular RF1 and RF2 quantified, UAA is consistently over-represented in highly expressed genes (HEGs) relative to lowly expressed genes (LEGs), whereas UGA usage is the opposite even in species where RF2 is far more abundant than RF1. UGA usage relative to UAG increases significantly with PRF2 [=RF2/(RF1 + RF2)] as expected from adaptation between stop codons and their decoders. PRF2 is > 0.5 over a wide range of AT content (measured by PAT3 as the proportion of AT at third codon sites), but decreases rapidly toward zero at the high range of PAT3. This explains why bacterial lineages with high PAT3 often have UGA reassigned because of low RF2. There is no indication that UAG is a minor stop codon in bacteria as claimed in a recent publication. The claim is invalid because of the failure to apply the two key criteria in identifying a minor codon: (1) it is least preferred by HEGs (or most preferred by LEGs) and (2) it corresponds to the least abundant decoder. Our results suggest a more plausible explanation for why UAA usage increases, and UGA usage decreases, with PAT3, but UAG usage remains low over the entire PAT3 range. PMID:27297468

  16. Diverse Bacterial PKS Sequences Derived From Okadaic Acid-Producing Dinoflagellates

    PubMed Central

    Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S.

    2008-01-01

    Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum. PMID:18728765

  17. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    PubMed Central

    Lui, Clarissa; Cady, Nathaniel C.; Batt, Carl A.

    2009-01-01

    The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform. PMID:22412335

  18. The Influence of Time and Plant Species on the Composition of the Decomposing Bacterial Community in a Stream Ecosystem.

    PubMed

    Wymore, Adam S; Liu, Cindy M; Hungate, Bruce A; Schwartz, Egbert; Price, Lance B; Whitham, Thomas G; Marks, Jane C

    2016-05-01

    Foliar chemistry influences leaf decomposition, but little is known about how litter chemistry affects the assemblage of bacterial communities during decomposition. Here we examined relationships between initial litter chemistry and the composition of the bacterial community in a stream ecosystem. We incubated replicated genotypes of Populus fremontii and P. angustifolia leaf litter that differ in percent tannin and lignin, then followed changes in bacterial community composition during 28 days of decomposition using 16S rRNA gene-based pyrosequencing. Using a nested experimental design, the majority of variation in bacterial community composition was explained by time (i.e., harvest day) (R(2) = 0.50). Plant species, nested within harvest date, explained a significant but smaller proportion of the variation (R(2) = 0.03). Significant differences in community composition between leaf species were apparent at day 14, but no significant differences existed among genotypes. Foliar chemistry correlated significantly with community composition at day 14 (r = 0.46) indicating that leaf litter with more similar phytochemistry harbor bacterial communities that are alike. Bacteroidetes and β-proteobacteria dominated the bacterial assemblage on decomposing leaves, and Verrucomicrobia and α- and δ-proteobacteria became more abundant over time. After 14 days, bacterial diversity diverged significantly between leaf litter types with fast-decomposing P. fremontii hosting greater richness than slowly decomposing P. angustifolia; however, differences were no longer present after 28 days in the stream. Leaf litter tannin, lignin, and lignin: N ratios all correlated negatively with diversity. This work shows that the bacterial community on decomposing leaves in streams changes rapidly over time, influenced by leaf species via differences in genotype-level foliar chemistry. PMID:26879940

  19. Both Leaf Properties and Microbe-Microbe Interactions Influence Within-Species Variation in Bacterial Population Diversity and Structure in the Lettuce (Lactuca Species) Phyllosphere▿

    PubMed Central

    Hunter, Paul J.; Hand, Paul; Pink, David; Whipps, John M.; Bending, Gary D.

    2010-01-01

    Morphological and chemical differences between plant genera influence phyllosphere microbial populations, but the factors driving within-species variation in phyllosphere populations are poorly understood. Twenty-six lettuce accessions were used to investigate factors controlling within-species variation in phyllosphere bacterial populations. Morphological and physiochemical characteristics of the plants were compared, and bacterial community structure and diversity were investigated using terminal restriction fragment length polymorphism (T-RFLP) profiling and 16S rRNA gene clone libraries. Plant morphology and levels of soluble carbohydrates, calcium, and phenolic compounds (which have long been associated with plant responses to biotic stress) were found to significantly influence bacterial community structure. Clone libraries from three representative accessions were found to be significantly different in terms of both sequence differences and the bacterial genera represented. All three libraries were dominated by Pseudomonas species and the Enterobacteriaceae family. Significant differences in the relative proportions of genera in the Enterobacteriaceae were detected between lettuce accessions. Two such genera (Erwinia and Enterobacter) showed significant variation between the accessions and revealed microbe-microbe interactions. We conclude that both leaf surface properties and microbial interactions are important in determining the structure and diversity of the phyllosphere bacterial community. PMID:20952648

  20. Mutations in y-aminobutyric acid (GABA) transaminase genes in plants or Pseudomonas syringae reduce bacterial virulence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pseudomonas syringae pv. tomato DC3000 is a bacterial pathogen of Arabidopsis and tomato that grows in the apoplast. The non-protein amino acid '-amino butyric acid (GABA) is produced by Arabidopsis and tomato and is the most abundant amino acid in the apoplastic fluid of tomato. The DC3000 genome h...

  1. Protein, cell and bacterial response to atmospheric pressure plasma grafted hyaluronic acid on poly(methylmethacrylate).

    PubMed

    D'Sa, Raechelle A; Raj, Jog; Dickinson, Peter J; McMahon, M Ann S; McDowell, David A; Meenan, Brian J

    2015-11-01

    Hyaluronic acid (HA) has been immobilised on poly(methyl methacrylate) (PMMA) surfaces using a novel dielectric barrier discharge (DBD) plasma process for the purposes of repelling protein, cellular and bacterial adhesion in the context of improving the performance of ophthalmic devices. Grafting was achieved by the following steps: (1) treatment of the PMMA with a DBD plasma operating at atmospheric pressure, (2) amine functionalisation of the activated polymer surface by exposure to a 3-aminopropyltrimethoxysilane (APTMS) linker molecule and (3) reaction of HA with the surface bound amine. The mechanism and effectiveness of the grafting process was verified by surface analysis. XPS data indicates that the APTMS linker molecule binds to PMMA via the Si-O chemistry and has the required pendant amine moiety. The carboxylic acid moiety on HA then binds with this -NH2 group via standard carbodiimide chemistry. ToF-SIMS confirms the presence of a coherent HA layer the microstructure of which is verified by AFM. The plasma grafted HA coating surfaces showed a pronounced decrease in protein and cellular adhesion when tested with bovine serum albumin and human corneal epithelial cells, respectively. The ability of these coatings to resist bacterial adhesion was established using Staphylococcus aureus NTC8325. Interestingly, the coatings did not repel bacterial adhesion, indicating that the mechanism of adhesion of bacterial cells is different to that for the surface interactions of mammalian cells. It is proposed that this difference is a consequence of the specific HA conformation that occurs under the conditions employed here. Hence, it is apparent that the microstructure/architecture of the HA coatings is an important factor in fabricating surfaces intended to repel proteins, mammalian and bacterial cells. PMID:26449450

  2. [Fatty acids in different edible fish species from Mexico].

    PubMed

    Castro González, María Isabel; Rodríguez, Ana Gabriela Maafs; Galindo Gómez, Carlos

    2013-12-01

    Different biotic and abiotic factors determine the fatty acid (FA) composition of fish tissues and organs. This information is useful for humans due to the fact that fish consumption is associated with health benefits. The aim of the present study was to identify the variation in the concentration of fatty acids, according to different factors, among ten edible marine fish species in Mexico, collected from June to December 2009 in the largest fish market in Mexico City: Euthynnus alletteratus, Sciaenops ocellatus, Bairdiella chrysoura, Sphyraena guachancho, Symphurus elongatus, Istiophorus platypterus, Ophichthus rex, Eugerres plumieri, Eucinostomus entomelas and Oreochromrnis mossambicus. Lipid content was gravimetrically quantified, the fatty acids were determined using a gas chromatograph and the results were statistically analyzed. Total lipid content ranged from 0.93 to 1.95 g/100 g in E. entomelas and O. urolepis hornorum, respectively. E. alletteratus, B. chrysoura, S. elongatus, I. platypterus, O. rex and E. plumieri presented the following order in FA concentration: Polyunsaturated FA (PUFA)>Saturated FA (SFA)>Monounsaturated FA (MUFA). S. ocellatus, S. guachancho and E. entomelas presented SFA>PUFA>MUFA; and only O. mossambicus presented SFA>MUFA>PUFA. O. mossambicus had the highest concentration (mg/100 g) of SFA (559.40) and MUFA (442.60), while B. chrysoura presented the highest content (mg/100 g) of PUFA (663.03), n-3 PUFA (514.03), EPA+DHA (506.10) and n-6 PUFA (145.80). Biotic and abiotic factors of the analyzed fish significantly influenced their FA concentration. Subtropical species presented 42.1% more EPA+DHA than tropical specie. Values presented here will vary according to the changes in the ecosystem and characteristics of each fish species, however the information generated in the present study is useful for improving fish consumption recommendations. PMID:24432548

  3. Effect of different concentrations of acetic, citric, and propionic acid dipping solutions on bacterial contamination of raw chicken skin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial contamination of raw, processed poultry may include spoilage bacteria and foodborne pathogens. We evaluated different combinations of organic acid (OA) wash solutions for their ability to reduce bacterial contamination of raw chicken skin and to inhibit growth of spoilage bacteria and path...

  4. Host species and developmental stage, but not host social structure, affects bacterial community structure in socially polymorphic bees.

    PubMed

    McFrederick, Quinn S; Wcislo, William T; Hout, Michael C; Mueller, Ulrich G

    2014-05-01

    Social transmission and host developmental stage are thought to profoundly affect the structure of bacterial communities associated with honey bees and bumble bees, but these ideas have not been explored in other bee species. The halictid bees Megalopta centralis and M. genalis exhibit intrapopulation social polymorphism, which we exploit to test whether bacterial communities differ by host social structure, developmental stage, or host species. We collected social and solitary Megalopta nests and sampled bees and nest contents from all stages of host development. To survey these bacterial communities, we used 16S rRNA gene 454 pyrosequencing. We found no effect of social structure, but found differences by host species and developmental stage. Wolbachia prevalence differed between the two host species. Bacterial communities associated with different developmental stages appeared to be driven by environmentally acquired bacteria. A Lactobacillus kunkeei clade bacterium that is consistently associated with other bee species was dominant in pollen provisions and larval samples, but less abundant in mature larvae and pupae. Foraging adults appeared to often reacquire L. kunkeei clade bacteria, likely while foraging at flowers. Environmental transmission appears to be more important than social transmission for Megalopta bees at the cusp between social and solitary behavior. PMID:24579829

  5. Influences of Plant Species, Season and Location on Leaf Endophytic Bacterial Communities of Non-Cultivated Plants.

    PubMed

    Ding, Tao; Melcher, Ulrich

    2016-01-01

    Bacteria are known to be associated endophytically with plants. Research on endophytic bacteria has identified their importance in food safety, agricultural production and phytoremediation. However, the diversity of endophytic bacterial communities and the forces that shape their compositions in non-cultivated plants are largely uncharacterized. In this study, we explored the diversity, community structure, and dynamics of endophytic bacteria in different plant species in the Tallgrass Prairie Preserve of northern Oklahoma, USA. High throughput sequencing of amplified segments of bacterial rDNA from 81 samples collected at four sampling times from five plant species at four locations identified 335 distinct OTUs at 97% sequence similarity, representing 16 phyla. Proteobacteria was the dominant phylum in the communities, followed by the phyla Bacteriodetes and Actinobacteria. Bacteria from four classes of Proteobacteria were detected with Alphaproteobacteria as the dominant class. Analysis of molecular variance revealed that host plant species and collecting date had significant influences on the compositions of the leaf endophytic bacterial communities. The proportion of Alphaproteobacteria was much higher in the communities from Asclepias viridis than from other plant species and differed from month to month. The most dominant bacterial groups identified in LDA Effect Size analysis showed host-specific patterns, indicating mutual selection between host plants and endophytic bacteria and that leaf endophytic bacterial compositions were dynamic, varying with the host plant's growing season in three distinct patterns. In summary, next generation sequencing has revealed variations in the taxonomic compositions of leaf endophytic bacterial communities dependent primarily on the nature of the plant host species. PMID:26974817

  6. Influences of Plant Species, Season and Location on Leaf Endophytic Bacterial Communities of Non-Cultivated Plants

    PubMed Central

    Ding, Tao; Melcher, Ulrich

    2016-01-01

    Bacteria are known to be associated endophytically with plants. Research on endophytic bacteria has identified their importance in food safety, agricultural production and phytoremediation. However, the diversity of endophytic bacterial communities and the forces that shape their compositions in non-cultivated plants are largely uncharacterized. In this study, we explored the diversity, community structure, and dynamics of endophytic bacteria in different plant species in the Tallgrass Prairie Preserve of northern Oklahoma, USA. High throughput sequencing of amplified segments of bacterial rDNA from 81 samples collected at four sampling times from five plant species at four locations identified 335 distinct OTUs at 97% sequence similarity, representing 16 phyla. Proteobacteria was the dominant phylum in the communities, followed by the phyla Bacteriodetes and Actinobacteria. Bacteria from four classes of Proteobacteria were detected with Alphaproteobacteria as the dominant class. Analysis of molecular variance revealed that host plant species and collecting date had significant influences on the compositions of the leaf endophytic bacterial communities. The proportion of Alphaproteobacteria was much higher in the communities from Asclepias viridis than from other plant species and differed from month to month. The most dominant bacterial groups identified in LDA Effect Size analysis showed host-specific patterns, indicating mutual selection between host plants and endophytic bacteria and that leaf endophytic bacterial compositions were dynamic, varying with the host plant’s growing season in three distinct patterns. In summary, next generation sequencing has revealed variations in the taxonomic compositions of leaf endophytic bacterial communities dependent primarily on the nature of the plant host species. PMID:26974817

  7. Linking regional variation of epibiotic bacterial diversity and trophic ecology in a new species of Kiwaidae (Decapoda, Anomura) from East Scotia Ridge (Antarctica) hydrothermal vents.

    PubMed

    Zwirglmaier, Katrin; Reid, William D K; Heywood, Jane; Sweeting, Christopher J; Wigham, Benjamin D; Polunin, Nicholas V C; Hawkes, Jeff A; Connelly, Douglas P; Pearce, David; Linse, Katrin

    2015-02-01

    We analyzed the diversity of bacterial epibionts and trophic ecology of a new species of Kiwa yeti crab discovered at two hydrothermal vent fields (E2 and E9) on the East Scotia Ridge (ESR) in the Southern Ocean using a combination of 454 pyrosequencing, Sanger sequencing, and stable isotope analysis. The Kiwa epibiont communities were dominated by Epsilon- and Gammaproteobacteria. About 454 sequencing of the epibionts on 15 individual Kiwa specimen revealed large regional differences between the two hydrothermal vent fields: at E2, the bacterial community on the Kiwa ventral setae was dominated (up to 75%) by Gammaproteobacteria, whereas at E9 Epsilonproteobacteria dominated (up to 98%). Carbon stable isotope analysis of both Kiwa and the bacterial epibionts also showed distinct differences between E2 and E9 in mean and variability. Both stable isotope and sequence data suggest a dominance of different carbon fixation pathways of the epibiont communities at the two vent fields. At E2, epibionts were putatively fixing carbon via the Calvin-Benson-Bassham and reverse tricarboxylic acid cycle, while at E9 the reverse tricarboxylic acid cycle dominated. Co-varying epibiont diversity and isotope values at E2 and E9 also present further support for the hypothesis that epibionts serve as a food source for Kiwa. PMID:25515351

  8. Linking regional variation of epibiotic bacterial diversity and trophic ecology in a new species of Kiwaidae (Decapoda, Anomura) from East Scotia Ridge (Antarctica) hydrothermal vents

    PubMed Central

    Zwirglmaier, Katrin; Reid, William D K; Heywood, Jane; Sweeting, Christopher J; Wigham, Benjamin D; Polunin, Nicholas V C; Hawkes, Jeff A; Connelly, Douglas P; Pearce, David; Linse, Katrin

    2015-01-01

    We analyzed the diversity of bacterial epibionts and trophic ecology of a new species of Kiwa yeti crab discovered at two hydrothermal vent fields (E2 and E9) on the East Scotia Ridge (ESR) in the Southern Ocean using a combination of 454 pyrosequencing, Sanger sequencing, and stable isotope analysis. The Kiwa epibiont communities were dominated by Epsilon- and Gammaproteobacteria. About 454 sequencing of the epibionts on 15 individual Kiwa specimen revealed large regional differences between the two hydrothermal vent fields: at E2, the bacterial community on the Kiwa ventral setae was dominated (up to 75%) by Gammaproteobacteria, whereas at E9 Epsilonproteobacteria dominated (up to 98%). Carbon stable isotope analysis of both Kiwa and the bacterial epibionts also showed distinct differences between E2 and E9 in mean and variability. Both stable isotope and sequence data suggest a dominance of different carbon fixation pathways of the epibiont communities at the two vent fields. At E2, epibionts were putatively fixing carbon via the Calvin-Benson-Bassham and reverse tricarboxylic acid cycle, while at E9 the reverse tricarboxylic acid cycle dominated. Co-varying epibiont diversity and isotope values at E2 and E9 also present further support for the hypothesis that epibionts serve as a food source for Kiwa. PMID:25515351

  9. Phenotypic and genotypic characterization of lactic acid bacteria isolated from raw goat milk and effect of farming practices on the dominant species of lactic acid bacteria.

    PubMed

    Tormo, Hélène; Ali Haimoud Lekhal, Djamila; Roques, C

    2015-10-01

    Lactic acid bacteria, in particular Lactococcus lactis, play a decisive role in the cheese making process and more particularly in lactic cheeses which are primarily produced on goat dairy farms. The objective of this study was therefore to identify the main lactic acid bacteria found in raw goats' milk from three different regions in France and evaluate if certain farming practices have an effect on the distribution of species of lactic acid bacteria in the various milk samples. Identification at genus or species level was carried out using phenotypic tests and genotypic methods including repetitive element REP-PCR, species-specific PCR and 16S rRNA gene sequencing. The distribution of the main bacterial species in the milk samples varied depending on farms and their characteristics. Out of the 146 strains identified, L. lactis was the dominant species (60% of strains), followed by Enterococcus (38%) of which Enterococcus faecalis and Enterococcus faecium. Within the species L. lactis, L. lactis subsp lactis was detected more frequently than L. lactis subsp cremoris (74% vs. 26%). The predominance of L. lactis subsp cremoris was linked to geographical area studied. It appears that the animals' environment plays a role in the balance between the dominance of L. lactis and enterococci in raw goats' milk. The separation between the milking parlor and the goat shed (vs no separation) and only straw in the bedding (vs straw and hay) seems to promote L. lactis in the milk (vs enterococci). PMID:26082325

  10. Superhydrophobic poly(L-lactic acid) surface as potential bacterial colonization substrate

    PubMed Central

    2011-01-01

    Hydrophobicity is a very important surface property and there is a growing interest in the production and characterization of superhydrophobic surfaces. Accordingly, it was recently shown how to obtain a superhydrophobic surface using a simple and cost-effective method on a polymer named poly(L-lactic acid) (PLLA). To evaluate the ability of such material as a substrate for bacterial colonization, this work assessed the capability of different bacteria to colonize a biomimetic rough superhydrophobic (SH) PLLA surface and also a smooth hydrophobic (H) one. The interaction between these surfaces and bacteria with different morphologies and cell walls was studied using one strain of Staphylococcus aureus and one of Pseudomonas aeruginosa. Results showed that both bacterial strains colonized the surfaces tested, although significantly higher numbers of S. aureus cells were found on SH surfaces comparing to H ones. Moreover, scanning electron microscopy images showed an extracellular matrix produced by P. aeruginosa on SH PLLA surfaces, indicating that this bacterium is able to form a biofilm on such substratum. Bacterial removal through lotus leaf effect was also tested, being more efficient on H coupons than on SH PLLA ones. Overall, the results showed that SH PLLA surfaces can be used as a substrate for bacterial colonization and, thus, have an exceptional potential for biotechnology applications. PMID:22018163

  11. Bacterial community assemblages associated with the phyllosphere, dermosphere, and rhizosphere of tree species of the Atlantic forest are host taxon dependent.

    PubMed

    Lambais, Marcio R; Lucheta, Adriano R; Crowley, David E

    2014-10-01

    Bacterial communities associated with tree canopies have been shown to be specific to their plant hosts, suggesting that plant species-specific traits may drive the selection of microbial species that comprise their microbiomes. To further examine the degree to which the plant taxa drive the assemblage of bacterial communities in specific plant microenvironments, we evaluated bacterial community structures associated with the phyllosphere, dermosphere, and rhizosphere of seven tree species representing three orders, four families and four genera of plants from a pristine Dense Ombrophilous Atlantic forest in Brazil, using a combination of PCR-DGGE of 16S rRNA genes and clone library sequencing. Results indicated that each plant species selected for distinct bacterial communities in the phyllosphere, dermosphere, and rhizosphere, and that the bacterial community structures are significantly related to the plant taxa, at the species, family, and order levels. Further characterization of the bacterial communities of the phyllosphere and dermosphere of the tree species showed that they were inhabited predominantly by species of Gammaproteobacteria, mostly related to Pseudomonas. In contrast, the rhizosphere bacterial communities showed greater species richness and evenness, and higher frequencies of Alphaproteobacteria and Acidobacteria Gp1. With individual tree species each selecting for their specific microbiomes, these findings greatly increase our estimates of the bacterial species richness in tropical forests and provoke questions concerning the ecological functions of the microbial communities that exist on different plant parts. PMID:24889284

  12. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family.

    PubMed

    Broussard, Tyler C; Miller, Darcie J; Jackson, Pamela; Nourse, Amanda; White, Stephen W; Rock, Charles O

    2016-03-18

    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

  13. Synthesis of a novel acrylated abietic acid-g-bacterial cellulose hydrogel by gamma irradiation.

    PubMed

    Abeer, Muhammad Mustafa; Amin, Mohd Cairul Iqbal Mohd; Lazim, Azwan Mat; Pandey, Manisha; Martin, Claire

    2014-09-22

    Acrylated abietic acid (acrylated AbA) and acrylated abietic acid-grafted bacterial cellulose pH sensitive hydrogel (acrylated AbA-g-BC) were prepared by a one-pot synthesis. The successful dimerization of acrylic acid (AA) and abietic acid (AbA) and grafting of the dimer onto bacterial cellulose (BC) was confirmed by 13C solid state NMR as well as FT-IR. X-ray diffraction analysis showed characteristic peaks for AbA and BC; further, there was no effect of increasing amorphous AA content on the overall crystallinity of the hydrogel. Differential scanning calorimetry revealed a glass transition temperature of 80°C. Gel fraction and swelling studies gave insight into the features of the hydrogel, suggesting that it was suitable for future applications such as drug delivery. Scanning electron microscopy observations showed an interesting interpenetrating network within the walls of hydrogel samples with the lowest levels of AA and gamma radiation doses. Cell viability test revealed that the synthesized hydrogel is safe for future use in biomedical applications. PMID:24906785

  14. Lactic Acid Bacterial Starter Culture with Antioxidant and γ-Aminobutyric Acid Biosynthetic Activities Isolated from Flatfish-Sikhae Fermentation.

    PubMed

    Won, Yeong Geol; Yu, Hyun-Hee; Chang, Young-Hyo; Hwang, Han-Joon

    2015-12-01

    The aim of this study is to select a lactic acid bacterial strain as a starter culture for flatfish-Sikhae fermentation and to evaluate its suitability for application in a food system. Four strains of lactic acid bacteria isolated from commercial flatfish-Sikhae were identified and selected as starter culture candidates through investigation of growth rates, salt tolerance, food safety, and functional properties such as antioxidative and antimicrobial activities. The fermentation properties of the starter candidates were also examined in food systems prepared with these strains (candidate batch) in comparison with a spontaneous fermentation process without starter culture (control batch) at 15°C. The results showed that the candidate YG331 batch had better fermentation properties such as viable cell count, pH, and acidity than the other experimental batches, including the control batch. The results are expressed according to selection criteria based on a preliminary sensory evaluation and physiochemical investigation. Also, only a small amount of histamine was detected with the candidate YG331 batch. The radical scavenging activity of the candidate batches was better compared with the control batch, and especially candidate YG331 batch showed the best radical scavenging activity. Also, we isolated another starter candidate (identified as Lactobacillus brevis PM03) with γ-aminobutyric acid (GABA)-producing activity from commercial flatfish-Sikhae products. The sensory scores of the candidate YG331 batch were better than those of the other experimental batches in terms of flavor, color, and overall acceptance. In this study, we established selection criteria for the lactic acid bacterial starter for the flatfish-Sikhae production and finally selected candidate YG331 as the most suitable starter. PMID:26348620

  15. Trophic complexity in aqueous systems: bacterial species richness and protistan predation regulate dissolved organic carbon and dissolved total nitrogen removal.

    PubMed

    Saleem, Muhammad; Fetzer, Ingo; Harms, Hauke; Chatzinotas, Antonis

    2016-02-24

    Loading of water bodies with dissolved organic carbon (DOC) and dissolved total nitrogen (DTN) affects their integrity and functioning. Microbial interactions mitigate the negative effects of high nutrient loads in these ecosystems. Despite numerous studies on how biodiversity mediates ecosystem functions, whether and how diversity and complexity of microbial food webs (horizontal, vertical) and the underlying ecological mechanisms influence nutrient removal has barely been investigated. Using microbial microcosms accommodating systematic combinations of prey (bacteria) and predator (protists) species, we showed that increasing bacterial richness improved the extent and reliability of DOC and DTN removal. Bacterial diversity drove nutrient removal either due to species foraging physiology or functional redundancy, whereas protistan diversity affected nutrient removal through bacterial prey resource partitioning and changing nutrient balance in the system. Our results demonstrate that prey-predator diversity and trophic interactions interactively determine nutrient contents, thus implying the vital role of microbial trophic complexity as a biological buffer against DOC and DTN. PMID:26888033

  16. Wild plant species growing closely connected in a subalpine meadow host distinct root-associated bacterial communities

    PubMed Central

    Aleklett, Kristin; Leff, Jonathan W.; Fierer, Noah

    2015-01-01

    Plant roots are known to harbor large and diverse communities of bacteria. It has been suggested that plant identity can structure these root-associated communities, but few studies have specifically assessed how the composition of root microbiota varies within and between plant species growing under natural conditions. We assessed the community composition of endophytic and epiphytic bacteria through high throughput sequencing using 16S rDNA derived from root tissues collected from a population of a wild, clonal plant (Orange hawkweed–Pilosella aurantiaca) as well as two neighboring plant species (Oxeye daisy–Leucanthemum vulgare and Alsike clover–Trifolium hybridum). Our first goal was to determine if plant species growing in close proximity, under similar environmental conditions, still hosted unique root microbiota. Our results showed that plants of different species host distinct bacterial communities in their roots. In terms of community composition, Betaproteobacteria (especially the family Oxalobacteraceae) were found to dominate in the root microbiota of L. vulgare and T. hybridum samples, whereas the root microbiota of P. aurantiaca had a more heterogeneous distribution of bacterial abundances where Gammaproteobacteria and Acidobacteria occupied a larger portion of the community. We also explored the extent of individual variance within each plant species investigated, and found that in the plant species thought to have the least genetic variance among individuals (P. aurantiaca) still hosted just as diverse microbial communities. Whether all plant species host their own distinct root microbiota and plants more closely related to each other share more similar bacterial communities still remains to be fully explored, but among the plants examined in this experiment there was no trend that the two species belonging to the same family shared more similarities in terms of bacterial community composition. PMID:25755932

  17. Wild plant species growing closely connected in a subalpine meadow host distinct root-associated bacterial communities.

    PubMed

    Aleklett, Kristin; Leff, Jonathan W; Fierer, Noah; Hart, Miranda

    2015-01-01

    Plant roots are known to harbor large and diverse communities of bacteria. It has been suggested that plant identity can structure these root-associated communities, but few studies have specifically assessed how the composition of root microbiota varies within and between plant species growing under natural conditions. We assessed the community composition of endophytic and epiphytic bacteria through high throughput sequencing using 16S rDNA derived from root tissues collected from a population of a wild, clonal plant (Orange hawkweed-Pilosella aurantiaca) as well as two neighboring plant species (Oxeye daisy-Leucanthemum vulgare and Alsike clover-Trifolium hybridum). Our first goal was to determine if plant species growing in close proximity, under similar environmental conditions, still hosted unique root microbiota. Our results showed that plants of different species host distinct bacterial communities in their roots. In terms of community composition, Betaproteobacteria (especially the family Oxalobacteraceae) were found to dominate in the root microbiota of L. vulgare and T. hybridum samples, whereas the root microbiota of P. aurantiaca had a more heterogeneous distribution of bacterial abundances where Gammaproteobacteria and Acidobacteria occupied a larger portion of the community. We also explored the extent of individual variance within each plant species investigated, and found that in the plant species thought to have the least genetic variance among individuals (P. aurantiaca) still hosted just as diverse microbial communities. Whether all plant species host their own distinct root microbiota and plants more closely related to each other share more similar bacterial communities still remains to be fully explored, but among the plants examined in this experiment there was no trend that the two species belonging to the same family shared more similarities in terms of bacterial community composition. PMID:25755932

  18. Host Species and Environmental Effects on Bacterial Communities Associated with Drosophila in the Laboratory and in the Natural Environment

    PubMed Central

    Staubach, Fabian; Baines, John F.; Künzel, Sven; Bik, Elisabeth M.; Petrov, Dmitri A.

    2013-01-01

    The fruit fly Drosophila is a classic model organism to study adaptation as well as the relationship between genetic variation and phenotypes. Although associated bacterial communities might be important for many aspects of Drosophila biology, knowledge about their diversity, composition, and factors shaping them is limited. We used 454-based sequencing of a variable region of the bacterial 16S ribosomal RNA gene to characterize the bacterial communities associated with wild and laboratory Drosophila isolates. In order to specifically investigate effects of food source and host species on bacterial communities, we analyzed samples from wild Drosophila melanogaster and D. simulans collected from a variety of natural substrates, as well as from adults and larvae of nine laboratory-reared Drosophila species. We find no evidence for host species effects in lab-reared flies; instead, lab of origin and stochastic effects, which could influence studies of Drosophila phenotypes, are pronounced. In contrast, the natural Drosophila–associated microbiota appears to be predominantly shaped by food substrate with an additional but smaller effect of host species identity. We identify a core member of this natural microbiota that belongs to the genus Gluconobacter and is common to all wild-caught flies in this study, but absent from the laboratory. This makes it a strong candidate for being part of what could be a natural D. melanogaster and D. simulans core microbiome. Furthermore, we were able to identify candidate pathogens in natural fly isolates. PMID:23967097

  19. Oceanobacillus endoradicis sp. nov., an endophytic bacterial species isolated from the root of Paris polyphylla Smith var. yunnanensis.

    PubMed

    Yang, Ling-Ling; Tang, Shu-Kun; Chu, Xiao; Jiang, Zhao; Xu, Li-Hua; Zhi, Xiao-Yang

    2016-07-01

    A bacterial strain, py1294(T), isolated from a root of Paris polyphylla Smith var. yunnanensis collected from Yunnan province, southwest China, was characterised by using a polyphasic approach to clarify its taxonomic position. Strain py1294(T) was found to be Gram-positive, aerobic, spore-forming, peritrichous flagella and rod shaped. Growth was found to occur in the presence of 0-8 % (w/v) NaCl (optimum 1-3 %), at pH 6.5-9.5 (optimum 8.0) and at 10-42 °C (optimum 30 °C). The major cellular fatty acids were identified as anteiso-C15:0, anteiso-C17:0, iso-C16:0 and iso-C14:0. The predominant quinone was identified as MK-7 and a minor amount of MK-6 was detected. The diagnostic polar lipids were diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The cell wall peptidoglycan was found to contain meso-diaminopimelic acid. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain py1294(T) forms a well-supported clade with Oceanobacillus damuensis PT-20(T) (97.9 % sequence similarity) within the genus Oceanobacillus, although it also shares a high sequence similarity with Ornithinibacillus contaminans (97.5 %). Crucially, the DNA-DNA relatedness value between strain py1294(T) and O. damuensis PT-20(T) was 29.7 ± 3.2 %. The G+C content was determined to be 42.3 mol%. On the basis of the phylogenetic and phenotypic data, a novel species Oceanobacillus endoradicis sp. nov. is proposed, with py1294(T) (=DSM 100726(T) = KCTC 33731(T)) as the type strain. PMID:27059624

  20. Accuracy, reproducibility, and interpretation of fatty acid methyl ester profiles of model bacterial communities

    USGS Publications Warehouse

    Kidd, Haack S.; Garchow, H.; Odelson, D.A.; Forney, L.J.; Klug, M.J.

    1994-01-01

    We determined the accuracy and reproducibility of whole-community fatty acid methyl ester (FAME) analysis with two model bacterial communities differing in composition by using the Microbial ID, Inc. (MIDI), system. The biomass, taxonomic structure, and expected MIDI-FAME profiles under a variety of environmental conditions were known for these model communities a priori. Not all members of each community could be detected in the composite profile because of lack of fatty acid 'signatures' in some isolates or because of variations (approximately fivefold) in fatty acid yield across taxa. MIDI- FAME profiles of replicate subsamples of a given community were similar in terms of fatty acid yield per unit of community dry weight and relative proportions of specific fatty acids. Principal-components analysis (PCA) of MIDI-FAME profiles resulted in a clear separation of the two different communities and a clustering of replicates of each community from two separate experiments on the first PCA axis. The first PCA axis accounted for 57.1% of the variance in the data and was correlated with fatty acids that varied significantly between communities and reflected the underlying community taxonomic structure. On the basis of our data, community fatty acid profiles can be used to assess the relative similarities and differences of microbial communities that differ in taxonomic composition. However, detailed interpretation of community fatty acid profiles in terms of biomass or community taxonomic composition must be viewed with caution until our knowledge of the quantitative and qualitative distribution of fatty acids over a wide variety of taxa and the effects of growth conditions on fatty acid profiles is more extensive.

  1. Biotechnological production of caffeic acid by bacterial cytochrome P450 CYP199A2.

    PubMed

    Furuya, Toshiki; Arai, Yuka; Kino, Kuniki

    2012-09-01

    Caffeic acid is a biologically active molecule that has various beneficial properties, including antioxidant, anticancer, and anti-inflammatory activities. In this study, we explored the catalytic potential of a bacterial cytochrome P450, CYP199A2, for the biotechnological production of caffeic acid. When the CYP199A2 enzyme was reacted with p-coumaric acid, it stoichiometrically produced caffeic acid. The crystal structure of CYP199A2 shows that Phe at position 185 is situated directly above, and only 6.35 Å from, the heme iron. This F185 residue was replaced with hydrophobic or hydroxylated amino acids using site-directed mutagenesis to create mutants with novel and improved catalytic properties. In whole-cell assays with the known substrate of CYP199A2, 2-naphthoic acid, only the wild-type enzyme hydroxylated 2-naphthoic acid at the C-7 and C-8 positions, whereas all of the active F185 mutants exhibited a preference for C-5 hydroxylation. Interestingly, several F185 mutants (F185V, F185L, F185I, F185G, and F185A mutants) also acquired the ability to hydroxylate cinnamic acid, which was not hydroxylated by the wild-type enzyme. These results demonstrate that F185 is an important residue that controls the regioselectivity and the substrate specificity of CYP199A2. Furthermore, Escherichia coli cells expressing the F185L mutant exhibited 5.5 times higher hydroxylation activity for p-coumaric acid than those expressing the wild-type enzyme. By using the F185L whole-cell catalyst, the production of caffeic acid reached 15 mM (2.8 g/liter), which is the highest level so far attained in biotechnological production of this compound. PMID:22729547

  2. Isolation of bacterial cellulose nanocrystalline from pineapple peel waste: Optimization of acid concentration in the hydrolysis method

    NASA Astrophysics Data System (ADS)

    Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik

    2016-02-01

    Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.

  3. Tree phyllosphere bacterial communities: exploring the magnitude of intra- and inter-individual variation among host species

    PubMed Central

    Messier, Christian; Kembel, Steven W.

    2016-01-01

    Background The diversity and composition of the microbial community of tree leaves (the phyllosphere) varies among trees and host species and along spatial, temporal, and environmental gradients. Phyllosphere community variation within the canopy of an individual tree exists but the importance of this variation relative to among-tree and among-species variation is poorly understood. Sampling techniques employed for phyllosphere studies include picking leaves from one canopy location to mixing randomly selected leaves from throughout the canopy. In this context, our goal was to characterize the relative importance of intra-individual variation in phyllosphere communities across multiple species, and compare this variation to inter-individual and interspecific variation of phyllosphere epiphytic bacterial communities in a natural temperate forest in Quebec, Canada. Methods We targeted five dominant temperate forest tree species including angiosperms and gymnosperms: Acer saccharum, Acer rubrum, Betula papyrifera, Abies balsamea and Picea glauca. For one randomly selected tree of each species, we sampled microbial communities at six distinct canopy locations: bottom-canopy (1–2 m height), the four cardinal points of mid-canopy (2–4 m height), and the top-canopy (4–6 m height). We also collected bottom-canopy leaves from five additional trees from each species. Results Based on an analysis of bacterial community structure measured via Illumina sequencing of the bacterial 16S gene, we demonstrate that 65% of the intra-individual variation in leaf bacterial community structure could be attributed to the effect of inter-individual and inter-specific differences while the effect of canopy location was not significant. In comparison, host species identity explains 47% of inter-individual and inter-specific variation in leaf bacterial community structure followed by individual identity (32%) and canopy location (6%). Discussion Our results suggest that individual

  4. 2-hydroxyisocaproic acid is fungicidal for Candida and Aspergillus species.

    PubMed

    Sakko, M; Moore, C; Novak-Frazer, L; Rautemaa, V; Sorsa, T; Hietala, P; Järvinen, A; Bowyer, P; Tjäderhane, L; Rautemaa, R

    2014-04-01

    The amino acid derivative 2-hydroxyisocaproic acid (HICA) is a nutritional additive used to increase muscle mass. Low levels can be detected in human plasma as a result of leucine metabolism. It has broad antibacterial activity but its efficacy against pathogenic fungi is not known. The aim was to test the efficacy of HICA against Candida and Aspergillus species. Efficacy of HICA against 19 clinical and reference isolates representing five Candida and three Aspergillus species with variable azole antifungal sensitivity profiles was tested using a microdilution method. The concentrations were 18, 36 and 72 mg ml(-1) . Growth was determined spectrophotometrically for Candida isolates and by visual inspection for Aspergillus isolates, viability was tested by culture and impact on morphology by microscopy. HICA of 72 mg ml(-1) was fungicidal against all Candida and Aspergillus fumigatus and Aspergillus terreus isolates. Lower concentrations were fungistatic. Aspergillus flavus was not inhibited by HICA. HICA inhibited hyphal formation in susceptible Candida albicans and A. fumigatus isolates and affected cell wall integrity. In conclusion, HICA has broad antifungal activity against Candida and Aspergillus at concentrations relevant for topical therapy. As a fungicidal agent with broad-spectrum bactericidal activity, it may be useful in the topical treatment of multispecies superficial infections. PMID:24125484

  5. Red and infrared laser therapy inhibits in vitro growth of major bacterial species that commonly colonize skin ulcers.

    PubMed

    de Sousa, Natanael Teixeira Alves; Gomes, Rosana Caetano; Santos, Marcos Ferracioli; Brandino, Hugo Evangelista; Martinez, Roberto; de Jesus Guirro, Rinaldo Roberto

    2016-04-01

    Low-level laser therapy (LLLT) is used in chronic wounds due to its healing effects. However, bacterial species may colonize these wounds and the optimal parameters for effective bacterial inhibition are not clear. The aim of this study was to analyze the effect of LLLT on bacterial growth in vitro. Bacterial strains including Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa were suspended in saline solution at a concentration of 10(3) cells/ml and exposed to laser irradiation at wavelengths of 660, 830, and 904 nm at fluences of 0 (control), 3, 6, 12, 18, and 24 J/cm(2). An aliquot of the irradiated suspension was spread on the surface of petri plates and incubated at 37 °C for quantification of colony-forming unit after 24, 48, and 72 h. Laser irradiation inhibited the growth of S. aureus at all wavelengths and fluences higher than 12 J/cm(2), showing a strong correlation between increase in fluence and bacterial inhibition. However, for P. aeruginosa, LLLT inhibited growth at all wavelengths only at a fluence of 24 J/cm(2). E. coli had similar growth inhibition at a wavelength of 830 nm at fluences of 3, 6, 12, and 24 J/cm(2). At wavelengths of 660 and 904 nm, growth inhibition was only observed at fluences of 12 and 18 J/cm(2), respectively. LLLT inhibited bacterial growth at all wavelengths, for a maximum of 72 h after irradiation, indicating a correlation between bacterial species, fluence, and wavelength. PMID:26886585

  6. Production of D-lactic acid by bacterial fermentation of rice starch.

    PubMed

    Fukushima, Kazuki; Sogo, Kazuaki; Miura, Shigenobu; Kimura, Yoshiharu

    2004-11-20

    D-Lactic acid was synthesized by the fermentation of rice starch using microorganisms. Two species: Lactobacillus delbrueckii and Sporolactobacillus inulinus were found to be active in producing D-lactic acid of high optical purity after an intensive screening test for D-lactic acid bacteria using glucose as substrate. Rice powder used as the starch source was hydrolyzed with a combination of enzymes: alpha-amylase, beta-amylase, and pullulanase to obtain rice saccharificate consisting of maltose as the main component. Its average gross yield was 82.5%. Of the discovered D-lactic acid bacteria, only Lactobacillus delbrueckii could ferment both maltose and the rice saccharificate. After optimizing the fermentation of the rice saccharificate using this bacterium, pilot scale fermentation was conducted to convert the rice saccharificate into D-lactic acid with a D-content higher than 97.5% in a yield of 70%. With this yield, the total yield of D-lactic acid from brown rice was estimated to be 47%, which is almost equal to the L-lactic acid yield from corn. The efficient synthesis of D-lactic acid can open a way to the large scale application of high-melting poly(lactic acid) that is a stereocomplex of poly(L-lactide) and poly(D-lactide). Schematic representation of the production of D-lactic acid starting from brown rice as described here. PMID:15529396

  7. Ecological drift and local exposures drive enteric bacterial community differences within species of Galápagos iguanas.

    PubMed

    Lankau, Emily W; Hong, Pei-Ying; Mackie, Roderick I

    2012-04-01

    Diet strongly influences the intestinal microbial communities through species sorting. Alternatively, these communicates may differ because of chance variation in local microbial exposures or species losses among allopatric host populations (i.e. ecological drift). We investigated how these forces shape enteric communities of Galápagos marine and land iguanas. Geographically proximate populations shared more similar communities within a host ecotype, suggesting a role for ecological drift during host colonization of the islands. Additionally, evidence of taxa sharing between proximate heterospecific host populations suggests that contemporary local exposures also influence the gut community assembly. While selective forces such as host-bacterial interactions or dietary differences are dominant drivers of intestinal community differences among hosts, historical and contemporary processes of ecological drift may lead to differences in bacterial composition within a host species. Whether such differences in community structure translate into geographic variation in benefits derived from these intimate microbial communities remains to be explored. PMID:22369350

  8. Development of species-specific primers for detection of Streptococcus mutans in mixed bacterial samples

    PubMed Central

    Chen, Zhou; Saxena, Deepak; Caufield, Page W.; Ge, Yao; Wang, Minqi; Li, Yihong

    2009-01-01

    Streptococcus mutans is the major microbial pathogen associated with dental caries in children. The objectives of this study were to design and evaluate species-specific primers for the identification of S. mutans. Validation of the best primer set, Sm479F/R, was performed using 7 S. mutans reference strains, 48 ATCC non-S. mutans strains, 92 S. mutans clinical isolates, DNA samples of S. mutans-S. sobrinus or S. mutans-S. sanguinis, and mixed bacterial DNA of saliva samples from 33 18-month-old children. All of the S. mutans samples tested positive, and no PCR products were amplified from members of the other streptococci or non-streptococci strains examined. The lowest detection level for PCR was 10−2 nanograms of S. mutans DNA (approximately 4.6 × 103 copies) in the test samples. The results of our study suggest that the Sm479F/R primer pair is highly specific and sensitive for identification of S. mutans in either purified or mixed DNA samples. PMID:17521362

  9. Composition of the Cutaneous Bacterial Community in Japanese Amphibians: Effects of Captivity, Host Species, and Body Region.

    PubMed

    Sabino-Pinto, Joana; Bletz, Molly Catherine; Islam, Mohammed Mafizul; Shimizu, Norio; Bhuju, Sabin; Geffers, Robert; Jarek, Michael; Kurabayashi, Atsushi; Vences, Miguel

    2016-08-01

    The cutaneous microbiota plays a significant role in the biology of their vertebrate hosts, and its composition is known to be influenced both by host and environment, with captive conditions often altering alpha diversity. Here, we compare the cutaneous bacterial communities of 61 amphibians (both wild and captive) from Hiroshima, Japan, using high-throughput amplicon sequencing of a segment of the 16S rRNA gene. The majority of these samples came from a captive breeding facility at Hiroshima University where specimens from six species are maintained under highly standardized conditions for several generations. This allowed to identify host effects on the bacterial communities under near identical environmental conditions in captivity. We found the structure of the cutaneous bacterial community significantly differing between wild and captive individuals of newts, Cynops pyrrhogaster, with a higher alpha diversity found in the wild individuals. Community structure also showed distinct patterns when comparing different species of amphibians kept under highly similar conditions, revealing an intrinsic host effect. Bacterial communities of dorsal vs. ventral skin surfaces did not significantly differ in most species, but a trend of higher alpha diversity on the ventral surface was found in Oriental fire-bellied toads, Bombina orientalis. This study confirms the cutaneous microbiota of amphibians as a highly dynamic system influenced by a complex interplay of numerous factors. PMID:27278778

  10. Rapid fluorometric quantification of bacterial cells using Redsafe nucleic acid stain

    PubMed Central

    Khalili, Ehsan; Hosseini, Vahid; Solhi, Roya; Aminian, Mahdi

    2015-01-01

    Background and Objectives: Numerous procedures in biology and medicine require the counting of cells. Direct enumeration of Colony Forming Units (CFUs) is time-consuming and dreary accurate cell counting on plates with high numbers of CFUs is error prone. In this study we report a new indirect cell counting method that was developed based on the use of Redsafe fluorometric assay. The usefulness of Redsafe, a nucleic acid stain, in liquid medium is based on the binding of the fluorescent dye to DNA. Materials and Methods: Redsafe fluorometric assay was evaluated in comparison with MTT colorimetric assay as a colourimetric assay for enumeration of bacterial cells. Results: Obtained results showed that fluorometric assay threshold for LB grown E. coli is 6×104 CFU/ml. Redsafe fluorescent assay can be used as a rapid and inexpensive method for bacterial enumeration and quantification with increased sensitivity. Conclusion: The sensitivity of the Redsafe fluorometric assay for detection and enumeration of bacterial cells was 2-log-unit more than that was observed for the MTT assay. PMID:26885332

  11. Gardnerella vaginalis outcompetes 29 other bacterial species isolated from patients with bacterial vaginosis, using in an in vitro biofilm formation model.

    PubMed

    Alves, Patrícia; Castro, Joana; Sousa, Cármen; Cereija, Tatiana B; Cerca, Nuno

    2014-08-15

    Despite the worldwide prevalence of bacterial vaginosis (BV), its etiology is still unknown. Although BV has been associated with the presence of biofilm, the ability of BV-associated bacteria to form biofilms is still largely unknown. Here, we isolated 30 BV-associated species and characterized their virulence, using an in vitro biofilm formation model. Our data suggests that Gardnerella vaginalis had the highest virulence potential, as defined by higher initial adhesion and cytotoxicity of epithelial cells, as well as the greater propensity to form a biofilm. Interestingly, we also demonstrated that most of the BV-associated bacteria had a tendency to grow as biofilms. PMID:24596283

  12. Stereospecificity of reactions catalyzed by bacterial D-amino acid transaminase.

    PubMed

    Martínez del Pozo, A; Merola, M; Ueno, H; Manning, J M; Tanizawa, K; Nishimura, K; Soda, K; Ringe, D

    1989-10-25

    The spectral shift from 420 to 338 nm when pure bacterial D-amino acid transaminase binds D-amino acid substrates is also exhibited in part by high concentrations of L-amino acids (L-alanine and L-glutamate) but not by simple dicarboxylic acids or monoamines. Slow processing of L-alanine to D-alanine was observed both by coupled enzymatic assays using D-amino acid oxidase and by high pressure liquid chromatography analysis employing an optically active chromophore (Marfey's reagent). When the acceptor for L-alanine was alpha-ketoglutarate, D-glutamate was also formed. This minor activity of the transaminase involved both homologous (L-alanine and D-alanine) and heterologous (L-alanine and D-glutamate) substrate pairs and was a function of the nature of the keto acid acceptor. In the presence of alpha-ketoisovalerate, DL-alanine was almost completely processed to D-valine; within the limits of the assay no L-valine was detected. With alpha-ketoisocaproate, 90% of the DL-alanine was converted to D-leucine. In the mechanism of this transaminase reaction, there may be more stereoselective constraints for the protonation of the quinonoid intermediate during the second half-reaction of the transamination reaction, i.e. the donation of the amino group from the pyridoxamine 5'-phosphate coenzyme to a second keto acid acceptor, than during removal of the alpha proton in the initial steps of the reaction pathway. Thus, with this D-amino acid transaminase, the discrete steps of transamination ensure fidelity of the stereospecificity of reaction pathway. PMID:2808352

  13. Bacterial production of conjugated linoleic and linolenic Acid in foods: a technological challenge.

    PubMed

    Gorissen, Lara; Leroy, Frédéric; De Vuyst, Luc; De Smet, Stefaan; Raes, Katleen

    2015-01-01

    Conjugated linoleic acid (CLA) and conjugated linolenic acid (CLNA) isomers are present in foods derived from ruminants as a result of the respective linoleic acid (LA) and α-linolenic acid (LNA) metabolism by ruminal microorganisms and in animals' tissues. CLA and CLNA have isomer-specific, health-promoting properties, including anticarcinogenic, antiatherogenic, anti-inflammatory, and antidiabetic activity, as well as the ability to reduce body fat. Besides ruminal microorganisms, such as Butyrivibrio fibrisolvens, many food-grade bacteria, such as bifidobacteria, lactic acid bacteria (LAB), and propionibacteria, are able to convert LA and LNA to CLA and CLNA, respectively. Linoleate isomerase activity, responsible for this conversion, is strain-dependent and probably related to the ability of the producer strain to tolerate the toxic effects of LA and LNA. Since natural concentrations of CLA and CLNA in ruminal food products are relatively low to exert their health benefits, food-grade bacteria with linoleate isomerase activity could be used as starter or adjunct cultures to develop functional fermented dairy and meat products with increased levels of CLA and CLNA or included in fermented products as probiotic cultures. However, results obtained so far are below expectations due to technological bottlenecks. More research is needed to assess if bacterial production kinetics can be increased and can match food processing requirements. PMID:24915316

  14. Dissolved total hydrolyzable enantiomeric amino acids in precipitation: Implications on bacterial contributions to atmospheric organic matter

    NASA Astrophysics Data System (ADS)

    Yan, Ge; Kim, Guebuem; Kim, Jeonghyun; Jeong, Yu-Sik; Kim, Young Il

    2015-03-01

    We analyzed dissolved organic carbon (DOC), dissolved organic nitrogen (DON), and dissolved enantiomeric amino acids in precipitation samples collected at two sites in Korea over a one-year period. The average concentrations of DOC, DON, and total hydrolyzable amino acids at Seoul (an inland urban area) were lower than those at Uljin (a coastal rural area). The different bulk compositions of dissolved organic matter (DOM) at these two sites (reflected by qualitative indicators) were mainly attributed to differences in contributing sources. The D-enantiomers of four individual amino acids (aspartic acid, glutamic acid, serine, and alanine) were ubiquitously present, with average enantiomeric (D/L) ratios of 0.34, 0.26, 0.21, and 0.61 for Seoul, and 0.18, 0.11, 0.09, and 0.31 for Uljin, respectively. The much higher D/L ratios observed at Seoul than at Uljin might result from more advanced diagenetic stages as well as higher contributions from bacteria inhabiting terrestrial environments. The C- and N-normalized yields of D-alanine in DOM of our samples were found to be comparable to literature values reported for aquatic systems, where a significant portion of DOM was suggested to be of bacterial origin. Our study suggests that bacteria and their remnants might constitute an important fraction of OM in the atmosphere, contributing significantly to the quality of atmospheric OM and its post-depositional bioavailability in the surface ecosystems.

  15. Biodegradable water absorbent synthesized from bacterial poly(amino acid)s.

    PubMed

    Kunioka, Masao

    2004-03-15

    Biodegradable hydrogels prepared by gamma-irradiation from microbial poly(amino acid)s have been studied. pH-Sensitive hydrogels were prepared by the gamma-irradiation of poly(gamma-glutamic acid) (PGA) produced by Bacillus subtilis and poly(epsilon-lysine) (PL) produced by Streptomyces albulus in aqueous solutions. When the gamma-irradiation dose was 19 kGy or more, and the concentration of PGA in water was 2 wt.-% or more, transparent hydrogels could be produced. For the 19 kGy dose, the produced hydrogel was very weak, however, the specific water content (wt. of absorbed water/wt. of dry hydrogel) of this PGA hydrogel was approximately 3,500. The specific water content decreased to 200, increasing when the gamma-irradiation dose was over 100 kGy. Under acid conditions or upon the addition of electrolytes, the PGA hydrogels shrunk. The PGA hydrogel was pH-sensitive and the change in the volume of the hydrogel depended on the pH value outside the hydrogel in the swelling medium. This PGA hydrogel was hydrodegradable and biodegradable. A new novel purifier reagent (coagulant), made from the PGA hydrogels, for contaminated turbid water has been found and developed by Japanese companies. A very small amount of this coagulant (only 2 ppm in turbid water) with poly(aluminum chloride) can be used for the purification of turbid water. A PL aqueous solution also can change into a hydrogel by gamma-irradiation. The specific water content of the PL hydrogel ranged from 20 to 160 depending on the preparation conditions. Under acid conditions, the PL hydrogel swelled because of the ionic repulsion of the protonated amino groups in the PL molecules. The rate of enzymatic degradation of the respective PL hydrogels by a neutral protease was much faster than the rate of simple hydrolytic degradation. PMID:15468223

  16. Re-engineering nalidixic acid's chemical scaffold: A step towards the development of novel anti-tubercular and anti-bacterial leads for resistant pathogens.

    PubMed

    Peraman, Ramalingam; Varma, Raghu Veer; Reddy, Y Padmanabha

    2015-10-01

    Occurrence of antibacterial and antimycobacterial resistance stimulated a thrust to discover new drugs for infectious diseases. Herein we report the work on re-engineering nalidixic acid's chemical scaffold for newer leads. Stepwise clubbing of quinoxaline, 1,2,4-triazole/1,3,4-oxadiazole with nalidixic acid yielded better compounds. Compounds were screened against ciprofloxacin resistant bacteria and Mycobacterium tuberculosis H37Rv species. Results were obtained as minimum inhibitory concentration, it was evident that molecule with quinoxaline linked azide as side chain served as antitubercular lead (<6.25 μg/ml) whilst molecule with oxadiazole or triazole linked quinoxaline side chain served as anti-bacterial lead. Few compounds were significantly active against Escherichia coli and Proteus vulgaris with MIC less than 0.06 μg/ml and relatively potent than ciprofloxacin. No true compound was potentially active against Salmonella species as compared to amoxicillin. PMID:26277407

  17. Inhaled hyaluronic acid as ancillary treatment in children with bacterial acute rhinopharyngitis.

    PubMed

    Varricchio, A; Capasso, M; Avvisati, F; Varricchio, A M; De Lucia, A; Brunese, F P; Ciprandi, G

    2014-01-01

    Acute rhinopharyngitis (ARP) is the most common upper respiratory infection in children and represents a social problem for both the pharmaco-economic impact and a burden for the family. Topical antibiotic therapy is usually effective in bacterial ARP, but ancillary treatment might improve its efficacy. Hyaluronic acid (HA) is a promising molecule that has been recently proposed in upper respiratory disorders. Therefore, the purpose of this study was to evaluate the effects of ancillary HA treatment in children with bacterial ARP. Globally, 51 children (27 males, mean age 5.9 ± 2.1 years) with bacterial ARP were enrolled in the study. At baseline, children were randomly assigned to the treatment with: 125 mg of thiamphenicol diluted in 4 mL of saline isotonic solution twice daily (group A) or with 125 mg of thiamphenicol plus 4 ml of sodium hyaluronate 0.2% plus xylitol 5% (Aluneb, Sakura Italia) twice daily (group B) administered by the nasal device Rinowash (Airliquide Medical System, Italy) and connected to an aerosol nebulizer with pneumatic compressor (1.5 bar per 5 L/min) Nebula (Airliquide Medical System, Italy), for 10 days. sVAS, nasopharyngeal spotting, neutrophils and bacteria were assessed at baseline and after the treatment. Both treatments induced significant reduction of symptom perception, spotting, neutrophil and bacteria count. However, thiamphenicol plus HA was able to significantly induce a greater effect on sVAS (p=0.006), neutrophil count (p=0.01), and bacteria count (p=0.0003) than thiamphenicol alone. In conclusion, this study provides the first evidence that intranasal HA, as ancillary treatment, may be able to improve topical antibiotic efficacy in children with bacterial ARP. PMID:25316142

  18. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities.

    PubMed

    Huete-Stauffer, Tamara M; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  19. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities

    PubMed Central

    Huete-Stauffer, Tamara M.; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G.

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  20. Analysis of mycolic acid cleavage products and cellular fatty acids of Mycobacterium species by capillary gas chromatography.

    PubMed

    Lambert, M A; Moss, C W; Silcox, V A; Good, R C

    1986-04-01

    After growth and experimental conditions were established, the mycolic acid cleavage products, constituent fatty acids, and alcohols of representative strains of Mycobacterium tuberculosis, M. smegmatis, M. fortuitum complex, M. kansasii, M. gordonae, and M. avium complex were determined by capillary gas chromatography. Reproducible cleavage of mycolic acid methyl esters to tetracosanoic (24:0) or hexacosanoic (26:0) acid methyl esters was achieved by heating the sample in a high-temperature muffle furnace. The major constituent fatty acids in all species were hexadecanoic (16:0) and octadecenoic (18:1 omega 9-c, oleic) acids. With the exception of M. gordonae, 10-methyloctadecanoic acid was found in all species; moreover, M. gordonae was the only species tested which contained 2-methyltetradecanoic acid. M. kansasii was characterized by the presence of 2,4-dimethyltetradecanoic acid, M. avium complex by 2-eicosanol, and M. tuberculosis by 26:0 mycolic acid cleavage product. The mycolic acid cleavage product in the other five species tested was 24:0. Although a limited number of strains and species were tested, preliminary results indicate that this gas chromatographic method can be used to characterize mycobacterial cultures by their mycolic acid cleavage products and constituent fatty acid and alcohol content. PMID:3084554

  1. Algal and Bacterial Activities in Acidic (pH 3) Strip Mine Lakes

    PubMed Central

    Gyure, Ruth A.; Konopka, Allan; Brooks, Austin; Doemel, William

    1987-01-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H2S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H2S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by [14C]glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake. PMID:16347430

  2. Effect of acidic electrolyzed water-induced bacterial inhibition and injury in live clam (Venerupis philippinarum) and mussel (Mytilus edulis).

    PubMed

    Al-Qadiri, Hamzah M; Al-Holy, Murad A; Shiroodi, Setareh Ghorban; Ovissipour, Mahmoudreza; Govindan, Byju N; Al-Alami, Nivin; Sablani, Shyam S; Rasco, Barbara

    2016-08-16

    The effect of acidic electrolyzed water (AEW) on inactivating Escherichia coli O104:H4, Listeria monocytogenes, Aeromonas hydrophila, Vibrio parahaemolyticus and Campylobacter jejuni in laboratory contaminated live clam (Venerupis philippinarum) and mussel (Mytilus edulis) was investigated. The initial levels of bacterial contamination were: in clam 4.9 to 5.7log10CFU/g, and in mussel 5.1 to 5.5log10CFU/g. Two types of AEW were used for treatment time intervals of 1 and 2h: strong (SAEW) with an available chlorine concentration (ACC) of 20mg/L, pH=3.1, and an oxidation-reduction potential (ORP) of 1150mV, and weak (WAEW) at ACC of 10mg/L, pH=3.55 and ORP of 950mV. SAEW and WAEW exhibited significant inhibitory activity against inoculated bacteria in both shellfish species with significant differences compared to saline solutions treatments (1-2% NaCl) and untreated controls (0h). SAEW showed the largest inhibitory activity, the extent of reduction (log10CFU/g) ranged from 1.4-1.7 for E. coli O104:H4; 1.0-1.6 for L. monocytogenes; 1.3-1.6 for A. hydrophila; 1.0-1.5 for V. parahaemolyticus; and 1.5-2.2 for C. jejuni in both types of shellfish. In comparison, significantly (P<0.05) lower inhibitory effect of WAEW was achieved compared to SAEW, where the extent of reduction (log10CFU/g) ranged from 0.7-1.1 for E. coli O104:H4; 0.6-0.9 for L. monocytogenes; 0.6-1.3 for A. hydrophila; 0.7-1.3 for V. parahaemolyticus; and 0.8-1.9 for C. jejuni in both types of shellfish. Among all bacterial strains examined in this study, AEW induced less bacterial injury (~0.1-1.0log10CFU/g) and more inactivation effect. This study revealed that AEW (10-20mg/L ACC) could be used to reduce bacterial contamination in live clam and mussel, which may help control possible unhygienic practices during production and processing of shellfish without apparent changes in the quality of the shellfish. PMID:27208583

  3. Salicylic acid signaling inhibits apoplastic reactive oxygen species signaling

    PubMed Central

    2014-01-01

    Background Reactive oxygen species (ROS) are used by plants as signaling molecules during stress and development. Given the amount of possible challenges a plant face from their environment, plants need to activate and prioritize between potentially conflicting defense signaling pathways. Until recently, most studies on signal interactions have focused on phytohormone interaction, such as the antagonistic relationship between salicylic acid (SA)-jasmonic acid and cytokinin-auxin. Results In this study, we report an antagonistic interaction between SA signaling and apoplastic ROS signaling. Treatment with ozone (O3) leads to a ROS burst in the apoplast and induces extensive changes in gene expression and elevation of defense hormones. However, Arabidopsis thaliana dnd1 (defense no death1) exhibited an attenuated response to O3. In addition, the dnd1 mutant displayed constitutive expression of defense genes and spontaneous cell death. To determine the exact process which blocks the apoplastic ROS signaling, double and triple mutants involved in various signaling pathway were generated in dnd1 background. Simultaneous elimination of SA-dependent and SA-independent signaling components from dnd1 restored its responsiveness to O3. Conversely, pre-treatment of plants with SA or using mutants that constitutively activate SA signaling led to an attenuation of changes in gene expression elicited by O3. Conclusions Based upon these findings, we conclude that plants are able to prioritize the response between ROS and SA via an antagonistic action of SA and SA signaling on apoplastic ROS signaling. PMID:24898702

  4. Inter-species interconnections in acid mine drainage microbial communities

    PubMed Central

    Comolli, Luis R.; Banfield, Jill F.

    2014-01-01

    Metagenomic studies are revolutionizing our understanding of microbes in the biosphere. They have uncovered numerous proteins of unknown function in tens of essentially unstudied lineages that lack cultivated representatives. Notably, few of these microorganisms have been visualized, and even fewer have been described ultra-structurally in their essentially intact, physiologically relevant states. Here, we present cryogenic transmission electron microscope (cryo-TEM) 2D images and 3D tomographic datasets for archaeal species from natural acid mine drainage (AMD) microbial communities. Ultrastructural findings indicate the importance of microbial interconnectedness via a range of mechanisms, including direct cytoplasmic bridges and pervasive pili. The data also suggest a variety of biological structures associated with cell-cell interfaces that lack explanation. Some may play roles in inter-species interactions. Interdependences amongst the archaea may have confounded prior isolation efforts. Overall, the findings underline knowledge gaps related to archaeal cell components and highlight the likely importance of co-evolution in shaping microbial lineages. PMID:25120533

  5. Organ- and species-specific biological activity of rosmarinic acid.

    PubMed

    Iswandana, R; Pham, B T; van Haaften, W T; Luangmonkong, T; Oosterhuis, D; Mutsaers, H A M; Olinga, P

    2016-04-01

    Rosmarinic acid (RA), a compound found in several plant species, has beneficial properties, including anti-inflammatory and antibacterial effects. We investigated the toxicity, anti-inflammatory, and antifibrotic effects of RA using precision-cut liver slices (PCLS) and precision-cut intestinal slices (PCIS) prepared from human, mouse, and rat tissue. PCLS and PCIS were cultured up to 48h in the absence or presence of RA. Gene expression of the inflammatory markers: IL-6, IL-8/CXCL1/KC, and IL-1β, as well as the fibrosis markers: pro-collagen 1a1, heat shock protein 47, α-smooth muscle actin, fibronectin (Fn2) and plasminogen activator inhibitor-1 (PAI-1) were evaluated by qPCR. RA was only toxic in murine PCIS. RA failed to mitigate the inflammatory response in most models, while it clearly reduced IL-6 and CXCL1/KC gene expression in murine PCIS at non-toxic concentrations. With regard to fibrosis, RA decreased the gene levels of Fn2 and PAI-1 in murine PCLS, and Fn2 in murine PCIS. Yet, no effect was observed on the gene expression of fibrosis markers in human and rat PCIS. In conclusion, we observed clear organ- and species-specific effects of RA. RA had little influence on inflammation. However, our study further establishes RA as a potential candidate for the treatment of liver fibrosis. PMID:26804033

  6. Survival of selected bacterial species in sterilized activated carbon filters and biological activated carbon filters.

    PubMed Central

    Rollinger, Y; Dott, W

    1987-01-01

    The survival of selected hygienically relevant bacterial species in activated carbon (AC) filters on a bench scale was investigated. The results revealed that after inoculation of the test strains the previously sterilized AC absorbed all bacteria (10(6) to 10(7)). After a period of 6 to 13 days without countable bacteria in the effluent, the numbers of Escherichia coli, Pseudomonas aeruginosa, and Pseudomonas putida increased up to 10(4) to 10(5) CFU/ml of effluent and 10(6) to 10(7) CFU/g of AC. When Klebsiella pneumoniae and Streptococcus faecalis were used, no growth in filters could be observed. The numbers of E. coli, P. aeruginosa, and P. putida, however, decreased immediately and showed no regrowth in nonsterile AC from a filter which had been continuously connected to running tap water for 2 months. Under these conditions an autochthonous microflora developed on the carbon surface which could be demonstrated by scanning electron microscopy and culturing methods (heterotrophic plate count). These bacteria reduced E. coli, P. aeruginosa, and P. putida densities in the effluent by a factor of more than 10(5) within 1 to 5 days. The hypothesis that antagonistic substances of the autochthonous microflora were responsible for the elimination of the artificial contamination could not be confirmed because less than 1% of the isolates of the autochthonous microflora were able to produce such substances as indicated by in vitro tests. Competition for limiting nutrients was thought to be the reason for the observed effects. PMID:3579281

  7. Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.

    2012-07-01

    Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.

  8. Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.

    PubMed

    Kaul, Tiffany K; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V; Kapahi, Pankaj; Gill, Matthew S

    2014-01-01

    The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit. PMID:24475206

  9. Development of a bacterial bioassay for atrazine and cyanuric acid detection

    PubMed Central

    Hua, Anna; Gueuné, Hervé; Cregut, Mickaël; Thouand, Gérald; Durand, Marie-José

    2015-01-01

    The s-triazine herbicides are compounds which can disseminate into soils and water. Due to their toxic effects on living organisms, their concentrations in drinking water are legislated by WHO recommendations. Here we have developed for the first time, to the best of our knowledge, an alternative method for physicochemical quantification using two bioluminescent bacterial biosensors: E. coli SM003 for cyanuric acid detection and E. coli SM004 for both atrazine and cyanuric acid detection. The concentration of cyanuric acid detection for E. coli SM003 ranges from 7.83 μM to 2.89 mM, and for E. coli SM004 ranges from 0.22 to 15 μM. Moreover, atrazine detection by E. coli SM004 ranges from 1.08 to 15 μM. According to WHO recommendations, the cyanuric acid detection range is sensitive enough to discriminate between polluted and drinking water. Nevertheless, the detection of atrazine by E. coli SM004 is only applicable for high concentrations of contaminants. PMID:25852669

  10. A bacterial strain with a unique quadruplet codon specifying non-native amino acids.

    PubMed

    Chatterjee, Abhishek; Lajoie, Marc J; Xiao, Han; Church, George M; Schultz, Peter G

    2014-08-18

    The addition of noncanonical amino acids to the genetic code requires unique codons not assigned to the 20 canonical amino acids. Among the 64 triplet codons, only the three nonsense "stop" codons have been used to encode non-native amino acids. Use of quadruplet "frame-shift" suppressor codons provides an abundant alternative but suffers from low suppression efficiency as a result of competing recognition of their first three bases by endogenous host tRNAs or release factors. Deletion of release factor 1 in a genomically recoded strain of E. coli (E. coli C321), in which all endogenous amber stop codons (UAG) are replaced with UAA, abolished UAG mediated translation termination. Here we show that a Methanocaldococcus jannaschii-derived frame-shift suppressor tRNA/aminoacyl-tRNA synthetase pair enhanced UAGN suppression efficiency in this recoded bacterial strain. These results demonstrate that efficient quadruplet codons for encoding non-native amino acids can be generated by eliminating competing triplet codon recognition at the ribosome. PMID:24867343

  11. Utilization of corncob acid hydrolysate for bacterial cellulose production by Gluconacetobacter xylinus.

    PubMed

    Huang, Chao; Yang, Xiao-Yan; Xiong, Lian; Guo, Hai-Jun; Luo, Jun; Wang, Bo; Zhang, Hai-Rong; Lin, Xiao-Qing; Chen, Xin-De

    2015-02-01

    In this study, corncob acid hydrolysate was used as a substrate for bacterial cellulose (BC) production by Gluconacetobacter xylinus. After 2 weeks' static fermentation, a BC yield of 4 g/L could be obtained. Both effects of medium composition and fermentation condition on the BC production were evaluated. Most extra substrates (carbon and nitrogen sources) except mannitol, butyric acid, and levulinic acid showed no effect on the improvement of BC yield. Fermentation condition including fermentation mode, inoculation concentration, and initial pH showed certain influence on the BC yield and thus should be well controlled. The analysis by field emission scanning electron microscope (FE-SEM), Fourier transform infrared spectroscopy (FTIR), and X-ray diffraction (XRD) showed that the BC sample had obvious nano-network structure, clear functional groups that were found in cellulose, and relatively high crystallinity and crystallinity index value. Moreover, the BC sample had great water-holding capacity. Overall, corncob acid hydrolysate could be one promising substrate for BC production. PMID:25422061

  12. Molecular species of diacylglycerols and triacylglycerols containing dihydroxy fatty acids in castor oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The identification of four molecular species of diacylglycerols and eight molecular species of triacylglycerols containing dihydroxy fatty acids in castor oil was reported. The structures of the three dihydroxy fatty acids were proposed as 11,12-dihydroxy-9-octadecenoic acid, 11,12-dihydroxy-9,13-oc...

  13. Molecular and Ecological Evidence for Species Specificity and Coevolution in a Group of Marine Algal-Bacterial Symbioses

    PubMed Central

    Ashen, Jon B.; Goff, Lynda J.

    2000-01-01

    The phylogenetic relationships of bacterial symbionts from three gall-bearing species in the marine red algal genus Prionitis (Rhodophyta) were inferred from 16S rDNA sequence analysis and compared to host phylogeny also inferred from sequence comparisons (nuclear ribosomal internal-transcribed-spacer region). Gall formation has been described previously on two species of Prionitis, P. lanceolata (from central California) and P. decipiens (from Peru). This investigation reports gall formation on a third related host, Prionitis filiformis. Phylogenetic analyses based on sequence comparisons place the bacteria as a single lineage within the Roseobacter grouping of the α subclass of the division Proteobacteria (99.4 to 98.25% sequence identity among phylotypes). Comparison of symbiont and host molecular phylogenies confirms the presence of three gall-bearing algal lineages and is consistent with the hypothesis that these red seaweeds and their bacterial symbionts are coevolving. The species specificity of these associations was investigated in nature by whole-cell hybridization of gall bacteria and in the laboratory by using cross-inoculation trials. Whole-cell in situ hybridization confirmed that a single bacterial symbiont phylotype is present in galls on each host. In laboratory trials, bacterial symbionts were incapable of inducing galls on alternate hosts (including two non-gall-bearing species). Symbiont-host specificity in Prionitis gall formation indicates an effective ecological separation between these closely related symbiont phylotypes and provides an example of a biological context in which to consider the organismic significance of 16S rDNA sequence variation. PMID:10877801

  14. Comparative Inter-Species Pharmacokinetics of Phenoxyacetic Acid Herbicides and Related Organic Acids. Evidence that the Dog is Not a Relevant Species for Evaluation of Human Health Risk.

    SciTech Connect

    Timchalk, Chuck

    2004-07-15

    Phenoxyacetic acids including 2,4-dichlorophenoxyacetic acid (2,4-D) and 4-chloro-2-methylphenoxyacetic acid (MCPA) are widely utilized organic acid herbicides that have undergone extensive toxicity and pharmacokinetic analyses. The dog is particularly susceptible to the toxicity of phenoxyacetic acids and related organic acids relative to other species. Active renal clearance mechanisms for organic acids are ubiquitous in mammalian species, and thus a likely mechanism responsible for the increased sensitivity of the dog to these agents is linked to a lower capacity to secrete organic acids from the kidney. Using published data describing the pharmacokinetics of phenoxyacetic and structurally related organic acids in a variety of species including humans, inter-species comparative pharmacokinetics were evaluated using allometic parameter scaling. For both 2,4-D and MCPA the dog plasma half-life (t1/2) and renal clearance (Clr; ml hr-1) rates did not scale as a function of body weight across species; whereas for all other species evaluated, including humans, these pharmacokinetic parameters reasonably scaled. This exceptional response in the dog is clearly illustrated by comparing the plasma t1/2 at comparable doses of 2,4-D and MCPA, across several species. At a dosage of 5 mg/kg, in dogs the plasma t1/2 for 2,4-D and MCPA were {approx}92 - 106 hr and 63 hr, respectively, which is substantially longer than in the rat ({approx}1 and 6 hr, respectively) or in humans (12 and 11 hr, respectively). This longer t1/2, and slower elimination in the dog, results in substantially higher body burdens of these organic acids, at comparable doses, relative to other species. Although these results indicate the important role of renal transport clearance mechanisms as determinants of the clearance and potential toxicity outcomes of phenoxyacetic acid herbicides across several species, other contributing mechanisms such as reabsorption from the renal tubules is highly likely. These

  15. Limitations to estimating bacterial cross-species transmission using genetic and genomic markers: inferences from simulation modeling

    PubMed Central

    Benavides, Julio A; Cross, Paul C; Luikart, Gordon; Creel, Scott

    2014-01-01

    Cross-species transmission (CST) of bacterial pathogens has major implications for human health, livestock, and wildlife management because it determines whether control actions in one species may have subsequent effects on other potential host species. The study of bacterial transmission has benefitted from methods measuring two types of genetic variation: variable number of tandem repeats (VNTRs) and single nucleotide polymorphisms (SNPs). However, it is unclear whether these data can distinguish between different epidemiological scenarios. We used a simulation model with two host species and known transmission rates (within and between species) to evaluate the utility of these markers for inferring CST. We found that CST estimates are biased for a wide range of parameters when based on VNTRs and a most parsimonious reconstructed phylogeny. However, estimations of CST rates lower than 5% can be achieved with relatively low bias using as low as 250 SNPs. CST estimates are sensitive to several parameters, including the number of mutations accumulated since introduction, stochasticity, the genetic difference of strains introduced, and the sampling effort. Our results suggest that, even with whole-genome sequences, unbiased estimates of CST will be difficult when sampling is limited, mutation rates are low, or for pathogens that were recently introduced. PMID:25469159

  16. Gas phase acidity measurement of local acidic groups in multifunctional species: controlling the binding sites in hydroxycinnamic acids.

    PubMed

    Guerrero, Andres; Baer, Tomas; Chana, Antonio; González, Javier; Dávalos, Juan Z

    2013-07-01

    The applicability of the extended kinetic method (EKM) to determine the gas phase acidities (GA) of different deprotonable groups within the same molecule was tested by measuring the acidities of cinnamic, coumaric, and caffeic acids. These molecules differ not only in the number of acidic groups but in their nature, intramolecular distances, and calculated GAs. In order to determine independently the GA of groups within the same molecule using the EKM, it is necessary to selectively prepare pure forms of the hydrogen-bound heterodimer. In this work, the selectivity was achieved by the use of solvents of different vapor pressure (water and acetonitrile), as well as by variation of the drying temperature in the ESI source, which affected the production of heterodimers with different solvation energies and gas-phase dissociation energies. A particularly surprising finding is that the calculated solvation enthalpies of water and the aprotic acetonitrile are essentially identical, and that the different gas-phase products generated are apparently the result of their different vapor pressures, which affects the drying mechanism. This approach for the selective preparation of heterodimers, which is based on the energetics, appears to be quite general and should prove useful for other studies that require the selective production of heterodimers in ESI sources. The experimental results were supported by density functional theory (DFT) calculations of both gas-phase and solvated species. The experimental thermochemical parameters (deprotonation ΔG, ΔH, and ΔS) are in good agreement with the calculated values for the monofunctional cinnamic acid, as well as the multifunctional coumaric and caffeic acids. The measured GA for cinnamic acid is 334.5 ± 2.0 kcal/mol. The measured acidities for the COOH and OH groups of coumaric and caffeic acids are 332.7 ± 2.0, 318.7 ± 2.1, 332.2 ± 2.0, and 317.3 ± 2.2 kcal/mol, respectively. PMID:23799241

  17. Species diversity and relative abundance of lactic acid bacteria in the milk of rhesus monkeys (Macaca mulatta)

    PubMed Central

    Jin, L.; Hinde, K.; Tao, L.

    2013-01-01

    Background Mother’s milk is a source of bacteria that influences the development of the infant commensal gut microbiota. To date, the species diversity and relative abundance of lactic acid bacteria in the milk of non-human primates have not been described. Methods Milk samples were aseptically obtained from 54 female rhesus monkeys (Macaca mulatta) at peak lactation. Following GM17 and MRS agar plating, single bacterial colonies were isolated based on difference in morphotypes, then grouped based on whole-cell protein profiles on SDS–PAGE. Bacterial DNA was isolated and the sequence the 16S rRNA gene was analyzed. Results A total of 106 strains of 19 distinct bacterial species, belonging to five genera, Bacillus, Enterococcus, Lactobacillus, Pediococcus, and Streptococcus, were identified. Conclusions Maternal gut and oral commensal bacteria may be translocated to the mammary gland during lactation and present in milk. This pathway can be an important source of commensal bacteria to the infant gut and oral cavity. PMID:20946146

  18. The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species

    PubMed Central

    McGraw, Joseph E.; Jensen, Brittany J.; Bishop, Sydney S.; Lokken, James P.; Dorff, Kellen J.; Ripley, Michael P.; Munro, James B.

    2015-01-01

    Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. PMID:26497452

  19. The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species.

    PubMed

    Dailey, Frank E; McGraw, Joseph E; Jensen, Brittany J; Bishop, Sydney S; Lokken, James P; Dorff, Kellen J; Ripley, Michael P; Munro, James B

    2016-01-01

    Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. PMID:26497452

  20. Reactive oxygen species in peripheral blood and sputum neutrophils during bacterial and nonbacterial acute exacerbation of chronic obstructive pulmonary disease.

    PubMed

    Vaitkus, Mindaugas; Lavinskiene, Simona; Barkauskiene, Diana; Bieksiene, Kristina; Jeroch, Jolanta; Sakalauskas, Raimundas

    2013-12-01

    Chronic airway inflammation can be mediated by an enhanced neutrophil oxidative burst. However, the role of bacteria in the pathogenesis of chronic obstructive pulmonary disease (COPD) exacerbations is highly controversial. The aim of this study was to evaluate the production of reactive oxygen species (ROS) in peripheral blood and sputum neutrophils during bacterial and nonbacterial acute exacerbations of COPD (AECOPD). A total of 40 patients with AECOPD, 10 healthy nonsmokers, and 10 "healthy" smokers were enrolled into the study. Peripheral blood and sputum samples were obtained during exacerbation and after recovery. Neutrophils were isolated by high-density gradient centrifugation and magnetic separation. ROS production by neutrophils was investigated after stimulation with phorbol-myristate-acetate and Staphylococcus aureus bacteria. ROS production by neutrophils was assessed as the mean fluorescent intensity using a flow cytometer. IL-8 levels in serum and induced sputum were determinant by ELISA. Spontaneous ROS production was significantly higher in neutrophils from the patients with bacterial AECOPD as compared with nonbacterial AECOPD and stable COPD (P <0.05). ROS production stimulated with PMA and with Staphylococcus aureus was significantly higher in neutrophils isolated from the patients with bacterial AECOPD as compared with nonbacterial and stable COPD (P <0.05). The serum and induced sputum IL-8 levels were significantly increased in the patients with bacterial AECOPD than nonbacterial AECOPD, stable COPS, and "healthy" smokers and nonsmokers (P <0.05) and higher in the induced sputum as the compared with serum in all studied groups (P <0.05). Enlarge CRP level was documented during AECOPD than in all other groups (P <0.05). A markedly increased ROS production in sputum neutrophils during bacterial AECOPD shows an inflammatory response reflecting enhanced local inflammation, which can be mediated by bacterial colonization. PMID:23872721

  1. Seasonal changes in dominant bacterial taxa from acidic peatlands of the Atlantic Rain Forest.

    PubMed

    Etto, Rafael Mazer; Cruz, Leonardo Magalhães; da Conceição Jesus, Ederson; Galvão, Carolina Weigert; Galvão, Franklin; de Souza, Emanuel Maltempi; de Oliveira Pedrosa, Fábio; Reynaud Steffens, Maria Berenice

    2014-09-01

    The acidic peatlands of southern Brazil are essential for maintenance of the Atlantic Rain Forest, one of the 25 hot-spots of biodiversity in the world. While these ecosystems are closely linked to conservation issues, their microbial community ecology and composition remain unknown. In this work, histosol samples were collected from three acidic peatland regions during dry and rainy seasons and their chemical and microbial characteristics were evaluated. Culturing and culture-independent approaches based on SSU rRNA gene pyrosequencing were used to survey the bacterial community and to identify environmental factors affecting the biodiversity and microbial metabolic potential of the Brazilian peatlands. All acidic peatlands were dominated by the Acidobacteria phylum (56-22%) followed by Proteobacteria (28-12%). The OTU richness of these phyla and the abundance of their Gp1, Gp2, Gp3, Gp13, Rhodospirillales and Caulobacteriales members varied according to the period of collection and significantly correlated with the rainy season. However, despite changes in acidobacterial and proteobacterial communities, rainfall did not affect the microbial metabolic potential of the southern Brazilian Atlantic Rain Forest peatlands, as judged by the metabolic capabilities of the microbial community. PMID:24893336

  2. Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

    PubMed

    Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

    2015-07-01

    The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells. PMID:25940300

  3. Antagonistic effects of α-tocopherol and ursolic acid on model bacterial membranes.

    PubMed

    Broniatowski, Marcin; Flasiński, Michał; Hąc-Wydro, Katarzyna

    2015-10-01

    α-tocopherol (Toc), the most active component of vitamin E can exert antagonistic effects disabling the therapy of cancers and bacterial infections. Such antagonisms were observed also between Toc and bioactive pentacyclic triterpenes (PT) exhibiting anticancer and antibacterial properties. Both Toc and PT are water-insoluble membrane active substances. Thus, our idea was to emulate their interactions with model Escherichia coli membranes. E. coli inner membranes were selected for the experiments because their lipid composition is quite simple and well characterized and the two main components are phosphatidylethanolamine and phosphatidylglycerol. As a model of E. coli membranes we applied Langmuir monolayers formed by the E. coli total extract of polar lipids (Etotal) as well as by the main lipid components: phosphatidylethanolamine (POPE) and phosphatidylglycerol (ECPG). The antagonistic effects of ursolic acid (Urs) and Toc were investigated with the application of ternary Langmuir monolayers formed by Urs, Toc and one of the phospholipids POPE or ECPG. Our studies indicated that the affinities of Urs and Toc towards the POPE molecule are comparable; whereas there are profound differences in the interactions of Urs and Toc with ECPG. Thus, the model experiments prove that in the case of E. coli membrane, the differences in the interactions between Urs and Toc with the anionic bacterial phosphatidylglycerol can be the key factor responsible for the antagonistic effects observed between PT and Toc in vivo. PMID:26003534

  4. Viability and Effects on Bacterial Proteins by Oral Rinses with Hypochlorous Acid as Active Ingredient.

    PubMed

    Castillo, Diana Marcela; Castillo, Yormaris; Delgadillo, Nathaly Andrea; Neuta, Yineth; Jola, Johana; Calderón, Justo Leonardo; Lafaurie, Gloria Inés

    2015-10-01

    This study investigated the effect of hypochlorous acid (HOCl) rinses and chlorhexidine (CHX) on the bacterial viability of S. mutans, A. israelii, P. gingivalis, A. actinomycetemcomitans, E. corrodens, C. rectus, K. oxytoca, K. pneumoniae and E. cloacae. The percentage of live bacteria was tested by fluorescence method using Live/Dead kit(r) and BacLight (Molecular Probes(r)) and compared between groups by the Kruskal-Wallis and U Mann-Whitney tests with Bonferroni correction (p value<0.012). The effect of HOCl and CHX on total proteins of P. gingivalis and S. mutans was determined by SDS-PAGE. CHX showed a higher efficacy than HOCl against S. mutans, A. israelii, E. corrodens and E. cloacae (p<0.001) while HOCl was more effective than CHX against P. gingivalis, A. actinomycetemcomitans, C. rectus and K. oxytoca (p=0.001). CHX and HOCl had similar efficacy against K. pneumoniae. Proteins of P. gingivalis and S. mutans were affected similarly by HOCl and CHX. HOCl reduced the bacterial viability especially in periodontopathic bacteria, which may support its use in the control of subgingival biofilm in periodontal patients. PMID:26647939

  5. The effect of ionizing radiation on amino acids and bacterial spores in different geo- and cosmochemical environments

    NASA Astrophysics Data System (ADS)

    Kminek, Gerhard

    In this thesis I have investigated the impact of ionizing radiation from the environment on the stability of bacterial spores and amino acids. I measured the radiolysis constant of amino acids and the inactivation constant of bacterial spores. To put these results in the context of a natural setting, I have selected four different cases and calculated the radiation environment for meteorites, the Martian subsurface, terrestrial halite fluid inclusions, and fossil bones. Bacterial spores exhibit a remarkable resistance to adverse environments and are the best example for the long-term survival of life forms. On a molecular level, amino acids are of particular interest because of their importance in biochemistry and their stability in the environment. The significance of amino acids, however, goes back to a time before life existed. The exogenous delivery of amino acids by meteorites might have been essential to provide the required supply of organic molecules for the origin of life on the Earth. There is one common threat, however, to the preservation of amino acids and bacterial spores in all known terrestrial and extraterrestrial environments: ionizing radiation. Amino acids in meteorites are exposed to radiation from internal radioactivity and space radiation. I show that this radiation decomposes substantial amounts of amino acids over time, indicating a higher exogenous delivery of amino acids to the early Earth. The total radiodecomposition since the synthesis of amino acids is between 23 and 68%. Radiodecomposition induces a certain fractionation in favor of smaller amino acids. Fossil bones show a post-mortem uranium uptake. My results suggest a substantial radiodecomposition of amino acids on a 10 million year time scale. Age determination based on racemization of amino acids will be affected in fossil bones that are older than 1--30 million years. My results on the stability of bacterial spores in halite fluid inclusions and on Mars suggest that radiation

  6. Bacterial GRAS domain proteins throw new light on gibberellic acid response mechanisms

    PubMed Central

    Zhang, Dapeng; Iyer, Lakshminarayan M.; Aravind, L.

    2012-01-01

    Summary: Gibberellic acids (GAs) are key plant hormones, regulating various aspects of growth and development, which have been at the center of the ‘green revolution’. GRAS family proteins, the primary players in GA signaling pathways, remain poorly understood. Using sequence-profile searches, structural comparisons and phylogenetic analysis, we establish that the GRAS family first emerged in bacteria and belongs to the Rossmann fold methyltransferase superfamily. All bacterial and a subset of plant GRAS proteins are likely to function as small-molecule methylases. The remaining plant versions have lost one or more AdoMet (SAM)-binding residues while preserving their substrate-binding residues. We predict that GRAS proteins might either modify or bind small molecules such as GAs or their derivatives. Contact: aravind@ncbi.nlm.nih.gov Supplementary Information: Supplementary Material for this article is available at Bioinformatics online. PMID:22829623

  7. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites.

    PubMed

    Koh, Ara; De Vadder, Filipe; Kovatcheva-Datchary, Petia; Bäckhed, Fredrik

    2016-06-01

    A compelling set of links between the composition of the gut microbiota, the host diet, and host physiology has emerged. Do these links reflect cause-and-effect relationships, and what might be their mechanistic basis? A growing body of work implicates microbially produced metabolites as crucial executors of diet-based microbial influence on the host. Here, we will review data supporting the diverse functional roles carried out by a major class of bacterial metabolites, the short-chain fatty acids (SCFAs). SCFAs can directly activate G-coupled-receptors, inhibit histone deacetylases, and serve as energy substrates. They thus affect various physiological processes and may contribute to health and disease. PMID:27259147

  8. Polymeric Cryogel-Based Boronate Affinity Chromatography for Separation of Ribonucleic Acid from Bacterial Extracts.

    PubMed

    Shakya, Akhilesh Kumar; Srivastava, Akshay; Kumar, Ashok

    2015-01-01

    Three-dimensional monolithic columns are preferred stationary phase in column chromatography. Conventional columns based on silica or particles are efficient in bioseparation though associated with limitations of nonspecific interaction and uneven porosity that causes high mass transfer resistance for the movement of big molecules. Cryogels as a monolith column have shown promising application in bioseparation. Cryogels column can be synthesized in the form of a monolith at sub-zero temperature through gelation of pre-synthesized polymers or polymerization of monomers. Cryogels are macroporous and mechanically stable materials. They have open interconnected micron-sized pores with a wide range of porosity (10-200 μm). Current protocol demonstrated the ability of poly(hydroxymethyl methacrylate)-co-vinylphenyl boronic acid p(HEMA-co-VPBA) cryogel matrix for selective separation of RNA from the bacterial crude extract. PMID:26623972

  9. Inhibition of acidic mine drainage using anti-bacterial substances. Technical report (Final)

    SciTech Connect

    Sherrard, J.H.; Kavanaugh, R.G.; Stroebel, P.S.; Stallard, M.L.

    1990-04-01

    Laboratory experiments were carried out to evaluate the effectiveness of antibacterial substances and antibiotics against Thiobacillus ferrooxidans, the organism responsible for bacterial mediated acidic mine drainage. Twenty-two antibiotics and two antibacterial substances were evaluated. The most promising compound, N-Serve, was evaluated further in column studies. A column study was completed using coal mine waste and hard rock mine waste spoils. Eight columns containing 7 kg of each spoil were established using varying concentrations of N-Serve applied to the spoils. The columns were leached once a week with one inch of rain (distilled water). Effluent was collected and monitored for water quality parameters. Only the highest N-Serve dose produced column leachates significantly better in quality than that of the control columns.

  10. Stabilization of polynuclear plutonium(IV) species by humic acid

    NASA Astrophysics Data System (ADS)

    Marsac, Rémi; Banik, Nidhu Lal; Marquardt, Christian Michael; Kratz, Jens Volker

    2014-04-01

    Although the formation of tetravalent plutonium (Pu(IV)) polymers with natural organic matter was previously observed by spectroscopy, there is no quantitative evidence of such reaction in batch experiments. In the present study, Pu(IV) interaction with humic acid (HA) was investigated at pH 1.8, 2.5 and 3, as a function of HA concentration and for Pu total concentration equal to 6 × 10-8 M. The finally measured Pu(IV) concentrations ([Pu(IV)]eq) are below Pu(IV) solubility limit. Pu(IV)-HA interaction can be explained by the complexation of Pu(IV) monomers by HA up to [Pu(IV)]eq ∼ 10-8 M. However, the slope of the log-log Pu(IV)-HA binding isotherm changes from ∼0.7 to ∼3.5 for higher [Pu(IV)]eq than ∼10-8 M and at any pH. This result suggests the stabilization of hydrolyzed polymeric Pu(IV) species by HA, with a 4:1 Pu:HA stoichiometry. This confirms, for the first time, previous observations made by spectroscopy in concentrated systems. The humic-ion binding model, Model VII, was introduced into the geochemical speciation program PHREEQC and was used to simulate Pu(IV) monomers binding to HA. The simulations are consistent with other tetravalent actinides-HA binding data from literature. The stabilization of a Pu tetramer (Pu4(OH)88+) by HA was proposed to illustrate the present experimental results for [Pu(IV)]eq > 10-8 M. Predictive simulations of Pu(IV) apparent solubility due to HA show that the chosen Pu(IV)-polymer has no impact for pH > 4. However, the comparison between these predictions and recent spectroscopic results suggest that more hydrolyzed polymeric Pu(IV) species can be stabilized by HA at pH > 4. Polymeric Pu(IV)-HA species might significantly enhance Pu(IV) apparent solubility due to humics, which support a colloid-facilitated transport of this low solubility element.

  11. Raman and surface-enhanced Raman spectroscopy of amino acids and nucleotide bases for target bacterial vibrational mode identification

    NASA Astrophysics Data System (ADS)

    Guicheteau, Jason; Argue, Leanne; Hyre, Aaron; Jacobson, Michele; Christesen, Steven D.

    2006-05-01

    Raman and surface-enhanced Raman spectroscopy (SERS) studies of bacteria have reported a wide range of vibrational mode assignments associated with biological material. We present Raman and SER spectra of the amino acids phenylalanine, tyrosine, tryptophan, glutamine, cysteine, alanine, proline, methionine, asparagine, threonine, valine, glycine, serine, leucine, isoleucine, aspartic acid and glutamic acid and the nucleic acid bases adenosine, guanosine, thymidine, and uridine to better characterize biological vibrational mode assignments for bacterial target identification. We also report spectra of the bacteria Bacillus globigii, Pantoea agglomerans, and Yersinia rhodei along with band assignments determined from the reference spectra obtained.

  12. Fragmented Lactic Acid Bacterial Cells Activate Peroxisome Proliferator-Activated Receptors and Ameliorate Dyslipidemia in Obese Mice.

    PubMed

    Nakamura, Futoshi; Ishida, Yu; Sawada, Daisuke; Ashida, Nobuhisa; Sugawara, Tomonori; Sakai, Manami; Goto, Tsuyoshi; Kawada, Teruo; Fujiwara, Shigeru

    2016-03-30

    Recent studies suggest that peroxisome proliferator-activated receptor (PPAR) activation ameliorates metabolic disorders, including dyslipidemia. To identify an effective PPAR agonist, we screened the in vitro PPARα/γ activation ability of organic solvent extracts from food-oriented bacterial strains belonging to 5 genera and 32 species, including lactic acid bacteria, and of these, Lactobacillus amylovorus CP1563 demonstrated the highest PPARα/γ agonist activity. We also found that physical fragmentation of the strain could substitute organic solvent extraction for the expression of CP1563 activity in vitro. For functional food manufacturing, we selected the fragmented CP1563 and conducted subsequent animal experiments. In an obese mouse model, we found that treatment with fragmented CP1563 for 12 weeks decreased the levels of low-density lipoprotein (LDL)-cholesterol and triglyceride in plasma, significantly decreased the atherosclerosis index, and increased the plasma high-density lipoprotein (HDL)-cholesterol level. Thus, we conclude that fragmented CP1563 may be a candidate for the prevention and treatment of dyslipidemia. PMID:26927959

  13. Screening of marine bacterial producers of polyunsaturated fatty acids and optimisation of production.

    PubMed

    Abd El Razak, Ahmed; Ward, Alan C; Glassey, Jarka

    2014-02-01

    Water samples from three different environments including Mid Atlantic Ridge, Red Sea and Mediterranean Sea were screened in order to isolate new polyunsaturated fatty acids (PUFAs) bacterial producers especially eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Two hundred and fifty-one isolates were screened for PUFA production and among them the highest number of producers was isolated from the Mid-Atlantic Ridge followed by the Red Sea while no producers were found in the Mediterranean Sea samples. The screening strategy included a simple colourimetric method followed by a confirmation via GC/MS. Among the tested producers, an isolate named 66 was found to be a potentially high PUFA producer producing relatively high levels of EPA in particular. A Plackett-Burman statistical design of experiments was applied to screen a wide number of media components identifying glycerol and whey as components of a production medium. The potential low-cost production medium was optimised by applying a response surface methodology to obtain the highest productivity converting industrial by-products into value-added products. The maximum achieved productivity of EPA was 20 mg/g, 45 mg/l, representing 11% of the total fatty acids, which is approximately five times more than the amount produced prior to optimisation. The production medium composition was 10.79 g/l whey and 6.87 g/l glycerol. To our knowledge, this is the first investigation of potential bacteria PUFA producers from Mediterranean and Red Seas providing an evaluation of a colourimetric screening method as means of rapid screening of a large number of isolates. PMID:24292901

  14. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor.

    PubMed

    Esfandiari, Leyla; Wang, Siqing; Wang, Siqi; Banda, Anisha; Lorenzini, Michael; Kocharyan, Gayane; Monbouquette, Harold G; Schmidt, Jacob J

    2016-01-01

    A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli) 16S rRNA at 10 fM, which corresponds to ~100-1000 colony forming units/mL (CFU/mL) depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD) of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids. PMID:27455337

  15. Effect of multiple washing in salicylic acid on the bacterial flora of the skin of processed broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Experiments were conducted to determine changes in the bacterial flora of the skin of processed broilers after each of five consecutive washings in solutions of the keratolytic agent, salicylic acid. Skin samples from commercially processed broiler carcasses were divided into 3 groups and washed in ...

  16. Effect of various concentrations of potassium hydroxide and lauric acid on native bacterial flora of broiler carcasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Experiments were conducted to determine the bactericidal effect of various concentrations of potassium hydroxide (KOH)-lauric acid (LA) solutions on the native bacterial flora of broiler carcasses. A mixture of 1.0% KOH and 2.0% LA (wt/vol) was prepared, and then filter sterilized by passage through...

  17. Independent studies using deep sequencing resolve the same set of core bacterial species dominating gut communities of honey bees.

    PubMed

    Sabree, Zakee L; Hansen, Allison K; Moran, Nancy A

    2012-01-01

    Starting in 2003, numerous studies using culture-independent methodologies to characterize the gut microbiota of honey bees have retrieved a consistent and distinctive set of eight bacterial species, based on near identity of the 16S rRNA gene sequences. A recent study [Mattila HR, Rios D, Walker-Sperling VE, Roeselers G, Newton ILG (2012) Characterization of the active microbiotas associated with honey bees reveals healthier and broader communities when colonies are genetically diverse. PLoS ONE 7(3): e32962], using pyrosequencing of the V1-V2 hypervariable region of the 16S rRNA gene, reported finding entirely novel bacterial species in honey bee guts, and used taxonomic assignments from these reads to predict metabolic activities based on known metabolisms of cultivable species. To better understand this discrepancy, we analyzed the Mattila et al. pyrotag dataset. In contrast to the conclusions of Mattila et al., we found that the large majority of pyrotag sequences belonged to clusters for which representative sequences were identical to sequences from previously identified core species of the bee microbiota. On average, they represent 95% of the bacteria in each worker bee in the Mattila et al. dataset, a slightly lower value than that found in other studies. Some colonies contain small proportions of other bacteria, mostly species of Enterobacteriaceae. Reanalysis of the Mattila et al. dataset also did not support a relationship between abundances of Bifidobacterium and of putative pathogens or a significant difference in gut communities between colonies from queens that were singly or multiply mated. Additionally, consistent with previous studies, the dataset supports the occurrence of considerable strain variation within core species, even within single colonies. The roles of these bacteria within bees, or the implications of the strain variation, are not yet clear. PMID:22829932

  18. Independent Studies Using Deep Sequencing Resolve the Same Set of Core Bacterial Species Dominating Gut Communities of Honey Bees

    PubMed Central

    Sabree, Zakee L.; Hansen, Allison K.; Moran, Nancy A.

    2012-01-01

    Starting in 2003, numerous studies using culture-independent methodologies to characterize the gut microbiota of honey bees have retrieved a consistent and distinctive set of eight bacterial species, based on near identity of the 16S rRNA gene sequences. A recent study [Mattila HR, Rios D, Walker-Sperling VE, Roeselers G, Newton ILG (2012) Characterization of the active microbiotas associated with honey bees reveals healthier and broader communities when colonies are genetically diverse. PLoS ONE 7(3): e32962], using pyrosequencing of the V1–V2 hypervariable region of the 16S rRNA gene, reported finding entirely novel bacterial species in honey bee guts, and used taxonomic assignments from these reads to predict metabolic activities based on known metabolisms of cultivable species. To better understand this discrepancy, we analyzed the Mattila et al. pyrotag dataset. In contrast to the conclusions of Mattila et al., we found that the large majority of pyrotag sequences belonged to clusters for which representative sequences were identical to sequences from previously identified core species of the bee microbiota. On average, they represent 95% of the bacteria in each worker bee in the Mattila et al. dataset, a slightly lower value than that found in other studies. Some colonies contain small proportions of other bacteria, mostly species of Enterobacteriaceae. Reanalysis of the Mattila et al. dataset also did not support a relationship between abundances of Bifidobacterium and of putative pathogens or a significant difference in gut communities between colonies from queens that were singly or multiply mated. Additionally, consistent with previous studies, the dataset supports the occurrence of considerable strain variation within core species, even within single colonies. The roles of these bacteria within bees, or the implications of the strain variation, are not yet clear. PMID:22829932

  19. Topological characterization of a bacterial cellulose-acrylic acid polymeric matrix.

    PubMed

    Halib, N; Mohd Amin, M C I; Ahmad, I; Abrami, M; Fiorentino, S; Farra, R; Grassi, G; Musiani, F; Lapasin, R; Grassi, M

    2014-10-01

    This paper focuses on the micro- and nano-topological organization of a hydrogel, constituted by a mixture of bacterial cellulose and acrylic acid, and intended for biomedical applications. The presence of acrylic acid promotes the formation of two interpenetrated continuous phases: the primary "pores phase" (PP) containing only water and the secondary "polymeric network phase" (PNP) constituted by the polymeric network swollen by the water. Low field Nuclear Magnetic Resonance (LF NMR), rheology, Scanning Electron Microscopy (SEM) and release tests were used to determine the characteristics of the two phases. In particular, we found that this system is a strong hydrogel constituted by 81% (v/v) of PP phase the remaining part being occupied by the PNP phase. Pores diameters span in the range 10-100 μm, the majority of them (85%) falling in the range 30-90 μm. The high PP phase tortuosity indicates that big pores are not directly connected to each other, but their connection is realized by a series of interconnected small pores that rend the drug path tortuous. The PNP is characterized by a polymer volume fraction around 0.73 while mesh size is around 3 nm. The theoretical interpretation of the experimental data coming from the techniques panel adopted, yielded to the micro- and nano-organization of our hydrogel. PMID:24932712

  20. Effects of Abiotic Factors on the Phylogenetic Diversity of Bacterial Communities in Acidic Thermal Springs▿

    PubMed Central

    Mathur, Jayanti; Bizzoco, Richard W.; Ellis, Dean G.; Lipson, David A.; Poole, Alexander W.; Levine, Richard; Kelley, Scott T.

    2007-01-01

    Acidic thermal springs offer ideal environments for studying processes underlying extremophile microbial diversity. We used a carefully designed comparative analysis of acidic thermal springs in Yellowstone National Park to determine how abiotic factors (chemistry and temperature) shape acidophile microbial communities. Small-subunit rRNA gene sequences were PCR amplified, cloned, and sequenced, by using evolutionarily conserved bacterium-specific primers, directly from environmental DNA extracted from Amphitheater Springs and Roaring Mountain sediment samples. Energy-dispersive X-ray spectroscopy, X-ray diffraction, and colorimetric assays were used to analyze sediment chemistry, while an optical emission spectrometer was used to evaluate water chemistry and electronic probes were used to measure the pH, temperature, and Eh of the spring waters. Phylogenetic-statistical analyses found exceptionally strong correlations between bacterial community composition and sediment mineral chemistry, followed by weaker but significant correlations with temperature gradients. For example, sulfur-rich sediment samples contained a high diversity of uncultured organisms related to Hydrogenobaculum spp., while iron-rich sediments were dominated by uncultured organisms related to a diverse array of gram-positive iron oxidizers. A detailed analysis of redox chemistry indicated that the available energy sources and electron acceptors were sufficient to support the metabolic potential of Hydrogenobaculum spp. and iron oxidizers, respectively. Principal-component analysis found that two factors explained 95% of the genetic diversity, with most of the variance attributable to mineral chemistry and a smaller fraction attributable to temperature. PMID:17220248

  1. Effects of abiotic factors on the phylogenetic diversity of bacterial communities in acidic thermal springs.

    PubMed

    Mathur, Jayanti; Bizzoco, Richard W; Ellis, Dean G; Lipson, David A; Poole, Alexander W; Levine, Richard; Kelley, Scott T

    2007-04-01

    Acidic thermal springs offer ideal environments for studying processes underlying extremophile microbial diversity. We used a carefully designed comparative analysis of acidic thermal springs in Yellowstone National Park to determine how abiotic factors (chemistry and temperature) shape acidophile microbial communities. Small-subunit rRNA gene sequences were PCR amplified, cloned, and sequenced, by using evolutionarily conserved bacterium-specific primers, directly from environmental DNA extracted from Amphitheater Springs and Roaring Mountain sediment samples. Energy-dispersive X-ray spectroscopy, X-ray diffraction, and colorimetric assays were used to analyze sediment chemistry, while an optical emission spectrometer was used to evaluate water chemistry and electronic probes were used to measure the pH, temperature, and E(h) of the spring waters. Phylogenetic-statistical analyses found exceptionally strong correlations between bacterial community composition and sediment mineral chemistry, followed by weaker but significant correlations with temperature gradients. For example, sulfur-rich sediment samples contained a high diversity of uncultured organisms related to Hydrogenobaculum spp., while iron-rich sediments were dominated by uncultured organisms related to a diverse array of gram-positive iron oxidizers. A detailed analysis of redox chemistry indicated that the available energy sources and electron acceptors were sufficient to support the metabolic potential of Hydrogenobaculum spp. and iron oxidizers, respectively. Principal-component analysis found that two factors explained 95% of the genetic diversity, with most of the variance attributable to mineral chemistry and a smaller fraction attributable to temperature. PMID:17220248

  2. Bacterial utilization of L-sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-08-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of

  3. Bacterial Utilization of L-sugars and D-amino Acids

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-01-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084

  4. Enterobacter morus sp. nov., a novel Enterobacter species associated with bacterial wilt on mulberry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A mulberry pathogenetic bacterial strain R18-2T isolated from the diseased mulberry root was analyzed by a polyphasic taxonomic study. Comparative 16S rRNA gene sequence analysis combined with rpoB gene sequence analysis allocated the strain R18-2T to the genus Enterobacter. The strain was Gram nega...

  5. 'Lascolabacter vaginalis' strain KHD1, a new bacterial species cultivated from human female genital tract.

    PubMed

    Diop, K; Mediannikov, O; Fournier, P-E; Raoult, D; Bretelle, F; Fenollar, F

    2016-09-01

    We present the major characteristics of 'Lascolabacter vaginalis' strain KHD1 (= CSUR P0109 = DSM 101752), a new member of the family Prevotellaceae that was cultivated from a vaginal sample of a 33-year-old woman with bacterial vaginosis. PMID:27358744

  6. Reactive Oxygen Species Mediated Bacterial Biofilm Inhibition via Zinc Oxide Nanoparticles and Their Statistical Determination

    PubMed Central

    Dwivedi, Sourabh; Wahab, Rizwan; Khan, Farheen; Mishra, Yogendra K.; Musarrat, Javed; Al-Khedhairy, Abdulaziz A.

    2014-01-01

    The formation of bacterial biofilm is a major challenge in clinical applications. The main aim of this study is to describe the synthesis, characterization and biocidal potential of zinc oxide nanoparticles (NPs) against bacterial strain Pseudomonas aeruginosa. These nanoparticles were synthesized via soft chemical solution process in a very short time and their structural properties have been investigated in detail by using X-ray diffraction and transmission electron microscopy measurements. In this work, the potential of synthesized ZnO-NPs (∼10–15 nm) has been assessed in-vitro inhibition of bacteria and the formation of their biofilms was observed using the tissue culture plate assays. The crystal violet staining on biofilm formation and its optical density revealed the effect on biofilm inhibition. The NPs at a concentration of 100 µg/mL significantly inhibited the growth of bacteria and biofilm formation. The biofilm inhibition by ZnO-NPs was also confirmed via bio-transmission electron microscopy (Bio-TEM). The Bio-TEM analysis of ZnO-NPs treated bacteria confirmed the deformation and damage of cells. The bacterial growth in presence of NPs concluded the bactericidal ability of NPs in a concentration dependent manner. It has been speculated that the antibacterial activity of NPs as a surface coating material, could be a feasible approach for controlling the pathogens. Additionally, the obtained bacterial solution data is also in agreement with the results from statistical analytical methods. PMID:25402188

  7. Acute toxicity of peracetic acid to various fish species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Peracetic acid (PAA; also called peroxyacetic acid) is a promising disinfectant in the US aquaculture industry to control parasites and fungus. It is a stabilized mixture of acetic acid and hydrogen peroxide that does not leave dangerous residues in the environment when it breaks down as most compo...

  8. Dietary supplementation of usnic acid, an antimicrobial compound in lichens, does not affect rumen bacterial diversity or density in reindeer.

    PubMed

    Glad, Trine; Barboza, Perry; Mackie, Roderick I; Wright, André-Denis G; Brusetti, Lorenzo; Mathiesen, Svein D; Sundset, Monica A

    2014-06-01

    Reindeer (Rangifer tarandus tarandus) may include large proportions of lichens in their winter diet. These dietary lichens are rich in phenolic secondary compounds, the most well-known being the antimicrobial usnic acid. Previous studies have shown that reindeer host rumen bacteria resistant to usnic acid and that usnic acid is quickly detoxified in their rumen. In the present study, reindeer (n = 3) were sampled before, during, and after usnic acid supplementation to determine the effect on their rumen microbial ecology. Ad libitum intake of usnic acid averaged up to 278 mg/kg body mass. Population densities of rumen bacteria and methanogenic archaea determined by real-time PCR, ranged from 1.36 × 10(9) to 11.8 × 10(9) and 9.0 × 10(5) to 1.35 × 10(8) cells/g wet weight, respectively, and the two populations did not change significantly during usnic acid supplementation (repeated measures ANOVA) or vary significantly between the rumen liquid and particle fraction (paired t test). Rumen bacterial community structure determined by denaturing gradient gel electrophoresis did not change in response to intake of usnic acid. Firmicutes (38.7 %) and Bacteriodetes (27.4 %) were prevalent among the 16S rRNA gene sequences (n = 62) from the DGGE gels, but representatives of the phyla Verrucomicrobia (14.5 %) and Proteobacteria (1.6 %) were also detected. Rapid detoxification of the usnic acid or resistance to usnic acid may explain why the diversity of the dominant bacterial populations and the bacterial density in the reindeer rumen does not change during usnic acid supplementation. PMID:24509720

  9. Quantitative thermodynamic predication of interactions between nucleic acid and non-nucleic acid species using Microsoft excel.

    PubMed

    Zou, Jiaqi; Li, Na

    2013-09-01

    Proper design of nucleic acid sequences is crucial for many applications. We have previously established a thermodynamics-based quantitative model to help design aptamer-based nucleic acid probes by predicting equilibrium concentrations of all interacting species. To facilitate customization of this thermodynamic model for different applications, here we present a generic and easy-to-use platform to implement the algorithm of the model with Microsoft(®) Excel formulas and VBA (Visual Basic for Applications) macros. Two Excel spreadsheets have been developed: one for the applications involving only nucleic acid species, the other for the applications involving both nucleic acid and non-nucleic acid species. The spreadsheets take the nucleic acid sequences and the initial concentrations of all species as input, guide the user to retrieve the necessary thermodynamic constants, and finally calculate equilibrium concentrations for all species in various bound and unbound conformations. The validity of both spreadsheets has been verified by comparing the modeling results with the experimental results on nucleic acid sequences reported in the literature. This Excel-based platform described here will allow biomedical researchers to rationalize the sequence design of nucleic acid probes using the thermodynamics-based modeling even without relevant theoretical and computational skills. PMID:23849929

  10. Regulation of host weight gain and lipid metabolism by bacterial bile acid modification in the gut.

    PubMed

    Joyce, Susan A; MacSharry, John; Casey, Patrick G; Kinsella, Michael; Murphy, Eileen F; Shanahan, Fergus; Hill, Colin; Gahan, Cormac G M

    2014-05-20

    Alterations in the gastrointestinal microbiota have been implicated in obesity in mice and humans, but the key microbial functions influencing host energy metabolism and adiposity remain to be determined. Despite an increased understanding of the genetic content of the gastrointestinal microbiome, functional analyses of common microbial gene sets are required. We established a controlled expression system for the parallel functional analysis of microbial alleles in the murine gut. Using this approach we show that bacterial bile salt hydrolase (BSH) mediates a microbe-host dialogue that functionally regulates host lipid metabolism and plays a profound role in cholesterol metabolism and weight gain in the host. Expression of cloned BSH enzymes in the gastrointestinal tract of gnotobiotic or conventionally raised mice significantly altered plasma bile acid signatures and regulated transcription of key genes involved in lipid metabolism (Pparγ, Angptl4), cholesterol metabolism (Abcg5/8), gastrointestinal homeostasis (RegIIIγ), and circadian rhythm (Dbp, Per1/2) in the liver or small intestine. High-level expression of BSH in conventionally raised mice resulted in a significant reduction in host weight gain, plasma cholesterol, and liver triglycerides, demonstrating the overall impact of elevated BSH activity on host physiology. In addition, BSH activity in vivo varied according to BSH allele group, indicating that subtle differences in activity can have significant effects on the host. In summary, we demonstrate that bacterial BSH activity significantly impacts the systemic metabolic processes and adiposity in the host and represents a key mechanistic target for the control of obesity and hypercholesterolemia. PMID:24799697

  11. Reversible Bacterial Adhesion on Mixed Poly(dimethylaminoethyl methacrylate)/Poly(acrylamidophenyl boronic acid) Brush Surfaces.

    PubMed

    Xiong, Xinhong; Wu, Zhaoqiang; Yu, Qian; Xue, Lulu; Du, Jun; Chen, Hong

    2015-11-10

    A simple and versatile method for the preparation of surfaces to control bacterial adhesion is described. Substrates were first treated with two catechol-based polymerization initiators, one for thermal initiation and one for visible-light photoinitiation. Graft polymerization in sequence of dimethylaminoethyl methacrylate (DMAEMA) and 3-acrylamidebenzene boronic acid (BA) from the surface-bound initiators to form mixed polymer brushes on the substrate was then carried out. The PDMAEMA grafts were thermally initiated and the PBA grafts were visible-light-photoinitiated. Gold, poly(vinyl chloride) (PVC), and poly(dimethylsiloxane) (PDMS) were used as model substrates. X-ray photoelectron spectroscopy (XPS), Fourier transform infrared (FT-IR), and ellipsometry analysis confirmed the successful grafting of PDMAEMA/PBA mixed brushes. We demonstrated that the resulting surfaces showed charge-reversal properties in response to change of pH. The transition in surface charge at a specific pH allowed the surface to be reversibly switched from bacteria-adhesive to bacteria-resistant. At pH 4.5, below the isoelectric points (IEP, pH 5.3) of the mixed brushes, the surfaces are positively charged and the negatively charged Gram-positive S. aureus adheres at high density (2.6 × 10(6) cells/cm(2)) due to attractive electrostatic interactions. Subsequently, upon increasing the pH to 9.0 to give negatively charged polymer brush surface, ∼90% of the adherent bacteria are released from the surface, presumably due to repulsive electrostatic interactions. This approach provides a simple method for the preparation of surfaces on which bacterial adhesion can be controlled and is applicable to a wide variety of substrates. PMID:26509287

  12. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    SciTech Connect

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-10-23

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  13. Multilocus sequence analysis of xanthomonads causing bacterial spot of tomato and pepper plants reveals strains generated by recombination among species and recent global spread of Xanthomonas gardneri.

    PubMed

    Timilsina, Sujan; Jibrin, Mustafa O; Potnis, Neha; Minsavage, Gerald V; Kebede, Misrak; Schwartz, Allison; Bart, Rebecca; Staskawicz, Brian; Boyer, Claudine; Vallad, Gary E; Pruvost, Olivier; Jones, Jeffrey B; Goss, Erica M

    2015-02-01

    Four Xanthomonas species are known to cause bacterial spot of tomato and pepper, but the global distribution and genetic diversity of these species are not well understood. A collection of bacterial spot-causing strains from the Americas, Africa, Southeast Asia, and New Zealand were characterized for genetic diversity and phylogenetic relationships using multilocus sequence analysis of six housekeeping genes. By examining strains from different continents, we found unexpected phylogeographic patterns, including the global distribution of a single multilocus haplotype of X. gardneri, possible regional differentiation in X. vesicatoria, and high species diversity on tomato in Africa. In addition, we found evidence of multiple recombination events between X. euvesicatoria and X. perforans. Our results indicate that there have been shifts in the species composition of bacterial spot pathogen populations due to the global spread of dominant genotypes and that recombination between species has generated genetic diversity in these populations. PMID:25527544

  14. Bacterial delta-aminolevulinic acid synthase activity is not essential for leghemoglobin formation in the soybean/Bradyrhizobium japonicum symbiosis

    SciTech Connect

    Guerinot, M.L.; Chelm, B.K.

    1986-03-01

    Previous studies of legume nodules have indicated that formation of the heme moiety of leghemoglobin is a function of the bacterial symbiont. The authors now show that a hemA mutant of Bradyrhizobium japonicum that cannot carry out the first step in heme biosynthesis forms fully effective nodules on soybeans. The bacterial mutant strain was constructed by first isolated the wild-type hemA gene encoding delta-aminolevulinic acid synthase (EC 2.3.1.37) from a cosmid library, using a fragment of the Rhizobium meliloti hemA gene as a hybridization probe. A deletion of the hemA gene region, generated in vitro, then was used to construct the analogous chromosomal mutation by gene-directed mutagenesis. The mutant strain had no delta-aminolevulinic acid synthase activity and was unable to grow in minimal medium unless delta-aminolevulinic acid was added. Despite its auxotrophy, the mutant strain incited nodules that appeared normal, contained heme, and were capable of high levels of acetylene reduction. These results rule out bacterial delta-aminolevulinic acid synthase activity as the exclusive source of delta-aminolevulinic acid for heme formation in soybean nodules.

  15. Use of poly(lactic acid) amendments to promote the bacterial fixation of metals in zinc smelter tailings.

    PubMed

    Edenborn, H M

    2004-04-01

    The ability of poly(lactic acid) (PLA) to serve as a long-term source of lactic acid for bacterial sulfate reduction activity in zinc smelter tailings was investigated. Solid PLA polymers mixed in water hydrolyzed abiotically to release lactic acid into solution over an extended period of time. The addition of both PLA and gypsum was required for indigenous bacteria to lower redox potential, raise pH, and stimulate sulfate reduction activity in highly oxidized smelter tailings after one year of treatment. Bioavailable cadmium, copper, lead and zinc were all lowered significantly in PLA/gypsum treated soil, but PLA amendments alone increased the bioavailability of lead, nickel and zinc. Similar PLA amendments may be useful in constructed wetlands and reactive barrier walls for the passive treatment of mine drainage, where enhanced rates of bacterial sulfate reduction are desirable. PMID:14693443

  16. Comparative genomics of the bacterial genus Streptococcus illuminates evolutionary implications of species groups.

    PubMed

    Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; Klenk, Hans-Peter; Li, Wen-Jun

    2014-01-01

    Members of the genus Streptococcus within the phylum Firmicutes are among the most diverse and significant zoonotic pathogens. This genus has gone through considerable taxonomic revision due to increasing improvements of chemotaxonomic approaches, DNA hybridization and 16S rRNA gene sequencing. It is proposed to place the majority of streptococci into "species groups". However, the evolutionary implications of species groups are not clear presently. We use comparative genomic approaches to yield a better understanding of the evolution of Streptococcus through genome dynamics, population structure, phylogenies and virulence factor distribution of species groups. Genome dynamics analyses indicate that the pan-genome size increases with the addition of newly sequenced strains, while the core genome size decreases with sequential addition at the genus level and species group level. Population structure analysis reveals two distinct lineages, one including Pyogenic, Bovis, Mutans and Salivarius groups, and the other including Mitis, Anginosus and Unknown groups. Phylogenetic dendrograms show that species within the same species group cluster together, and infer two main clades in accordance with population structure analysis. Distribution of streptococcal virulence factors has no obvious patterns among the species groups; however, the evolution of some common virulence factors is congruous with the evolution of species groups, according to phylogenetic inference. We suggest that the proposed streptococcal species groups are reasonable from the viewpoints of comparative genomics; evolution of the genus is congruent with the individual evolutionary trajectories of different species groups. PMID:24977706

  17. Comparative Genomics of the Bacterial Genus Streptococcus Illuminates Evolutionary Implications of Species Groups

    PubMed Central

    Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; Klenk, Hans-Peter; Li, Wen-Jun

    2014-01-01

    Members of the genus Streptococcus within the phylum Firmicutes are among the most diverse and significant zoonotic pathogens. This genus has gone through considerable taxonomic revision due to increasing improvements of chemotaxonomic approaches, DNA hybridization and 16S rRNA gene sequencing. It is proposed to place the majority of streptococci into “species groups”. However, the evolutionary implications of species groups are not clear presently. We use comparative genomic approaches to yield a better understanding of the evolution of Streptococcus through genome dynamics, population structure, phylogenies and virulence factor distribution of species groups. Genome dynamics analyses indicate that the pan-genome size increases with the addition of newly sequenced strains, while the core genome size decreases with sequential addition at the genus level and species group level. Population structure analysis reveals two distinct lineages, one including Pyogenic, Bovis, Mutans and Salivarius groups, and the other including Mitis, Anginosus and Unknown groups. Phylogenetic dendrograms show that species within the same species group cluster together, and infer two main clades in accordance with population structure analysis. Distribution of streptococcal virulence factors has no obvious patterns among the species groups; however, the evolution of some common virulence factors is congruous with the evolution of species groups, according to phylogenetic inference. We suggest that the proposed streptococcal species groups are reasonable from the viewpoints of comparative genomics; evolution of the genus is congruent with the individual evolutionary trajectories of different species groups. PMID:24977706

  18. On the nature and origin of acidic species in petroleum. 1. Detailed acid type distribution in a California crude oil.

    SciTech Connect

    Tomczyk, N. A.; Winans, R. E.; Shinn, J. H.; Robinson, R. C.; Chemistry; Chevron Research and Technology Co.

    2001-11-21

    Acidity in crude oils has long been a problem for refining. Knowledge of the detailed chemical composition of the acids responsible for corrosion can facilitate identification of problem crude oils and potentially lead to improved processing options for corrosive oils. A highly aerobically biodegraded crude from the San Joaquin Valley, which has a long history of causing corrosion problems during refining, was the subject of this study. The oil was first extracted with base, then acidified and extracted with petroleum ether. A portion of the resulting acid fraction was methylated. The unmethylated extract was analyzed by FTIR, NMR, and the methylated sample was analyzed by high-resolution mass spectrometry (HRMS). Over 96% of the ions observed in HRMS have been assigned reliable formulas. Considerably greater functionality is seen in this sample than would be presumed from the 'naphthenic acid' title typically assigned to these species. Although over 60% of the compounds contained two or more oxygens, compounds containing only oxygen heteroatoms accounted for less than 10% of the acidic compounds identified. Approximately one-half of the species contained nitrogen and about one-fourth contained sulfur. It is believed that microbial degradation is a major source of these acidic components. It was also observed that acid species with higher degrees of heteroatom substitution generally also had a higher degree of saturation than those species having less heteroatoms, possibly due to impeded migration of highly substituted, less-saturated species.

  19. Rhizosphere bacterial carbon turnover is higher in nucleic acids than membrane lipids: implications for understanding soil carbon cycling

    PubMed Central

    Malik, Ashish A.; Dannert, Helena; Griffiths, Robert I.; Thomson, Bruce C.; Gleixner, Gerd

    2015-01-01

    Using a pulse chase 13CO2 plant labeling experiment we compared the flow of plant carbon into macromolecular fractions of rhizosphere soil microorganisms. Time dependent 13C dilution patterns in microbial cellular fractions were used to calculate their turnover time. The turnover times of microbial biomolecules were found to vary: microbial RNA (19 h) and DNA (30 h) turned over fastest followed by chloroform fumigation extraction-derived soluble cell lysis products (14 days), while phospholipid fatty acids (PLFAs) had the slowest turnover (42 days). PLFA/NLFA 13C analyses suggest that both mutualistic arbuscular mycorrhizal and saprophytic fungi are dominant in initial plant carbon uptake. In contrast, high initial 13C enrichment in RNA hints at bacterial importance in initial C uptake due to the dominance of bacterial derived RNA in total extracts of soil RNA. To explain this discrepancy, we observed low renewal rate of bacterial lipids, which may therefore bias lipid fatty acid based interpretations of the role of bacteria in soil microbial food webs. Based on our findings, we question current assumptions regarding plant-microbe carbon flux and suggest that the rhizosphere bacterial contribution to plant assimilate uptake could be higher. This highlights the need for more detailed quantitative investigations with nucleic acid biomarkers to further validate these findings. PMID:25914679

  20. Rapid detection method for fusaric acid-producing species of Fusarium by PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusaric acid is a mycotoxin produced by species of the fungus Fusarium and can act synergistically with other Fusarium toxins. In order to develop a specific detection method for fusaric acid-producing fungus, PCR prim¬ers were designed to amplify FUB10, a transcription factor gene in fusaric acid ...

  1. Assessment of oil content and fatty acid composition variability in two economically important Hibiscus species.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Hibiscus genus encompasses more than 300 species, but kenaf (H. cannabinus L.) and roselle (H. sabdariffa L.) are the two most economically important species within the genus. Seeds from these two Hibiscus species contain a relatively high amount of oil with two unusual fatty acids: dihydrosterc...

  2. Acyl Carrier Protein Synthases from Gram-Negative, Gram-Positive, and Atypical Bacterial Species: Biochemical and Structural Properties and Physiological Implications

    PubMed Central

    McAllister, Kelly A.; Peery, Robert B.; Zhao, Genshi

    2006-01-01

    Acyl carrier protein (ACP) synthase (AcpS) catalyzes the transfer of the 4′-phosphopantetheine moiety from coenzyme A (CoA) onto a serine residue of apo-ACP, resulting in the conversion of apo-ACP to the functional holo-ACP. The holo form of bacterial ACP plays an essential role in mediating the transfer of acyl fatty acid intermediates during the biosynthesis of fatty acids and phospholipids. AcpS is therefore an attractive target for therapeutic intervention. In this study, we have purified and characterized the AcpS enzymes from Escherichia coli, Streptococcus pneumoniae, and Mycoplasma pneumoniae, which exemplify gram-negative, gram-positive, and atypical bacteria, respectively. Our gel filtration column chromatography and cross-linking studies demonstrate that the AcpS enzyme from M. pneumoniae, like E. coli enzyme, exhibits a homodimeric structure, but the enzyme from S. pneumoniae exhibits a trimeric structure. Our biochemical studies show that the AcpS enzymes from M. pneumoniae and S. pneumoniae can utilize both short- and long-chain acyl CoA derivatives but prefer long-chain CoA derivatives as substrates. On the other hand, the AcpS enzyme from E. coli can utilize short-chain CoA derivatives but not the long-chain CoA derivatives tested. Finally, our biochemical studies show that M. pneumoniae AcpS is kinetically a very sluggish enzyme compared with those from E. coli and S. pneumoniae. Together, the results of these studies show that the AcpS enzymes from different bacterial species exhibit different native structures and substrate specificities with regard to the utilization of CoA and its derivatives. These findings suggest that AcpS from different microorganisms plays a different role in cellular physiology. PMID:16788183

  3. Magnetic resonance tells microbiology where to go; bacterial teichoic acid protects liquid water at sub-zero temperatures

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Wickham, Jason R.; Eastman, Margaret A.; Harrison, William; Pereira, Mark P.; Brown, Eric D.

    2008-08-01

    Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, although, with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as high salt concentration (brine veins) and adhesion to particulates or ice crystal defects. Teichoic acid is a phosphodiester polymer ubiquitous in Gram positive bacteria, composing 50% of the mass of the bacterial cell wall and excreted into the extracellular space of biofilm communities. We have found that when bound to the peptidoglycan cell wall (wall teichoic acid) or as a free molecule (lipoteichoic acid), teichoic acid is surrounded by liquid water at temperatures significantly below freezing. Using solid-state NMR, we are unable to collect 31P CPMAS spectra for frozen solutions of lipoteichoic acid at temperatures above -60 °C. For wall teichoic acid in D2O, signals are not seen above -30 °C. These results can be explained by the presence of liquid water, which permits rapid molecular motion to remove 1H/31P dipolar coupling. 2H quadrupole echo NMR spectroscopy reveals that both liquid and solid water are present. We suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.

  4. Rosmarinic acid is a homoserine lactone mimic produced by plants that activates a bacterial quorum-sensing regulator.

    PubMed

    Corral-Lugo, Andrés; Daddaoua, Abdelali; Ortega, Alvaro; Espinosa-Urgel, Manuel; Krell, Tino

    2016-01-01

    Quorum sensing is a bacterial communication mechanism that controls genes, enabling bacteria to live as communities, such as biofilms. Homoserine lactone (HSL) molecules function as quorum-sensing signals for Gram-negative bacteria. Plants also produce previously unidentified compounds that affect quorum sensing. We identified rosmarinic acid as a plant-derived compound that functioned as an HSL mimic. In vitro assays showed that rosmarinic acid bound to the quorum-sensing regulator RhlR of Pseudomonas aeruginosa PAO1 and competed with the bacterial ligand N-butanoyl-homoserine lactone (C4-HSL). Furthermore, rosmarinic acid stimulated a greater increase in RhlR-mediated transcription in vitro than that of C4-HSL. In P. aeruginosa, rosmarinic acid induced quorum sensing-dependent gene expression and increased biofilm formation and the production of the virulence factors pyocyanin and elastase. Because P. aeruginosa PAO1 infection induces rosmarinic acid secretion from plant roots, our results indicate that rosmarinic acid secretion is a plant defense mechanism to stimulate a premature quorum-sensing response. P. aeruginosa is a ubiquitous pathogen that infects plants and animals; therefore, identification of rosmarinic acid as an inducer of premature quorum-sensing responses may be useful in agriculture and inform human therapeutic strategies. PMID:26732761

  5. Fatty acid composition of six Centaurea species growing in Konya, Turkey.

    PubMed

    Tekeli, Yener; Sezgin, Mehmet; Aktumsek, Abdurrahman; Ozmen Guler, Gokalp; Aydin Sanda, Murad

    2010-12-01

    In this study, fatty acid compositions of six Centaurea species growing in the Konya region were determined. The fatty acid composition of Centaurea balsamita, Centaurea calolepis, Centaurea carduiformis subsp. carduiformis, Centaurea cariensis subsp. maculiceps, C. cariensis subsp. microlepis and Centaurea iberica were analysed. Four species of these six Centaurea are endemic to Turkey. The endemic Centaurea species are C. calolepis, C. carduiformis subsp. carduiformis, C. cariensis subsp. maculiceps and C. cariensis subsp. microlepis. Generally, C 18:2 ω6 linoleic acid, C 16:0 palmitic acid, C 18:3 ω3 linolenic acid and C 18:1 oleic acid were found to be the major fatty acids in all species. Polyunsaturated fatty acids (PUFAs) were found in higher amounts than saturated fatty acids and monounsaturated fatty acids in all species. PUFAs were determined at 55.10%, 50.25%, 51.41%, 41.02%, 46.18% and 58.80% in C. balsamita, C. calolepis, C. carduiformis subsp. carduiformis, C. cariensis subsp. maculiceps, C. cariensis subsp. microlepis and C. iberica, respectively. PMID:21108113

  6. Honey Bees Avoid Nectar Colonized by Three Bacterial Species, But Not by a Yeast Species, Isolated from the Bee Gut

    PubMed Central

    Good, Ashley P.; Gauthier, Marie-Pierre L.; Vannette, Rachel L.; Fukami, Tadashi

    2014-01-01

    The gut microflora of the honey bee, Apis mellifera, is receiving increasing attention as a potential determinant of the bees’ health and their efficacy as pollinators. Studies have focused primarily on the microbial taxa that appear numerically dominant in the bee gut, with the assumption that the dominant status suggests their potential importance to the bees’ health. However, numerically minor taxa might also influence the bees’ efficacy as pollinators, particularly if they are not only present in the gut, but also capable of growing in floral nectar and altering its chemical properties. Nonetheless, it is not well understood whether honey bees have any feeding preference for or against nectar colonized by specific microbial species. To test whether bees exhibit a preference, we conducted a series of field experiments at an apiary using synthetic nectar inoculated with specific species of bacteria or yeast that had been isolated from the bee gut, but are considered minor components of the gut microflora. These species had also been found in floral nectar. Our results indicated that honey bees avoided nectar colonized by the bacteria Asaia astilbes, Erwinia tasmaniensis, and Lactobacillus kunkeei, whereas the yeast Metschnikowia reukaufii did not affect the feeding preference of the insects. Our results also indicated that avoidance of bacteria-colonized nectar was caused not by the presence of the bacteria per se, but by the chemical changes to nectar made by the bacteria. These findings suggest that gut microbes may not only affect the bees’ health as symbionts, but that some of the microbes may possibly affect the efficacy of A. mellifera as pollinators by altering nectar chemistry and influencing their foraging behavior. PMID:24466119

  7. Christensenella timonensis, a new bacterial species isolated from the human gut.

    PubMed

    Ndongo, S; Dubourg, G; Khelaifia, S; Fournier, P-E; Raoult, D

    2016-09-01

    We propose a new species, Christensenella timonensis, strain Marseille-P2437(T) (CSUR P2437(T)), which was isolated from gut microbiota of a 66-year-old patient as a part of culturomics study. C. timonensis represents the second species isolated within the Christensenella genus. PMID:27408737

  8. Dihydrolipoic but not alpha-lipoic acid affects susceptibility of eukaryotic cells to bacterial invasion.

    PubMed

    Bozhokina, Ekaterina; Khaitlina, Sofia; Gamaley, Irina

    2015-05-01

    Sensitivity of eukaryotic cells to facultative pathogens can depend on physiological state of host cells. Previously we have shown that pretreatment of HeLa cells with N-acetylcysteine (NAC) makes the cells 2-3-fold more sensitive to invasion by the wild-type Serratia grimesii and recombinant Escherichia coli expressing gene of actin-specific metalloprotease grimelysin [1]. To evaluate the impact of chemically different antioxidants, in the present work we studied the effects of α-Lipoic acid (LA) and dihydrolipoic acid (DHLA) on efficiency of S. grimesii and recombinant E. coli expressing grimelysin gene to penetrate into HeLa and CaCo cells. Similarly to the effect of NAC, pretreatment of HeLa and CaCo cells with 0.6 or 1.25 mM DHLA increased the entry of grimelysin producing bacteria by a factor of 2.5 and 3 for the wild-type S. grimesii and recombinant E. coli, respectively. In contrast, pretreatment of the cells with 0.6 or 1.25 mM LA did not affect the bacteria uptake. The increased invasion of HeLa and CaCo cells correlated with the enhanced expression of E-cadherin and β-catenin genes, whereas expression of these genes in the LA-treated cells was not changed. Comparison of these results suggests that it is sulfhydryl group of DHLA that promotes efficient modification of cell properties assisting bacterial uptake. We assume that the NAC- and DHLA-induced stimulation of the E-cadherin-catenin pathway contributes to the increased internalization of the grimelysin producing bacteria within transformed cells. PMID:25817791

  9. Antiparasitic activity of prenylated benzoic acid derivatives from Piper species.

    PubMed

    Flores, Ninoska; Jiménez, Ignacio A; Giménez, Alberto; Ruiz, Grace; Gutiérrez, David; Bourdy, Genevieve; Bazzocchi, Isabel L

    2009-03-01

    Fractionation of dichloromethane extracts from the leaves of Piper heterophyllum and P. aduncum afforded three prenylated hydroxybenzoic acids, 3-[(2E,6E,10E)-11-carboxy-3,7,15-trimethyl-2,6,10,14-hexadecatetraenyl)-4,5-dihydroxybenzoic acid, 3-[(2E,6E,10E)-11-carboxy-13-hydroxy-3,7,15-trimethyl-2,6,10,14-hexadecatetraenyl]-4,5-dihydroxybenzoic acid and 3-[(2E,6E,10E)-11-carboxy-14-hydroxy-3,7,15-trimethyl-2,6,10,15-hexadecatetraenyl]-4,5-dihydroxybenzoic acid, along with the known compounds, 4,5-dihydroxy-3-(E,E,E-11-formyl-3,7,15-trimethyl-hexadeca-2,6,10,14-tetraenyl)benzoic acid (arieianal), 3,4-dihydroxy-5-(E,E,E-3,7,11,15-tetramethyl-hexadeca-2,6,10,14-tetraenyl)benzoic acid, 4-hydroxy-3-(E,E,E-3,7,11,15-tetramethyl-hexadeca-2,6,10,14-tetraenyl)benzoic acid, 3-(3,7-dimethyl-2,6-octadienyl)-4-methoxy-benzoic acid, 4-hydroxy-3-(3,7-dimethyl-2,6-octadienyl)benzoic acid and 4-hydroxy-3-(3-methyl-1-oxo-2-butenyl)-5-(3-methyl-2-butenyl)benzoic acid. Their structures were elucidated on the basis of spectroscopic data, including homo- and heteronuclear correlation NMR experiments (COSY, HSQC and HMBC) and comparison with data reported in the literature. Riguera ester reactions and optical rotation measurements established the compounds as racemates. The antiparasitic activity of the compounds were tested against three strains of Leishmania spp., Trypanosoma cruzi and Plasmodium falciparum. The results showed that 3-(3,7-dimethyl-2,6-octadienyl)-4-methoxy-benzoic acid exhibited potent and selective activity against L. braziliensis (IC(50) 6.5 microg/ml), higher that pentamidine used as control. Moreover, 3-[(2E,6E,10E)-11-carboxy-3,7,15-trimethyl- 2,6,10,14-hexadecatetraenyl)-4,5-dihydroxybenzoic acid and 4-hydroxy-3-(3-methyl-1-oxo-2-butenyl)-5-(3-methyl-2-butenyl)benzoic acid showed moderate antiplasmodial (IC(50) 3.2 microg/ml) and trypanocidal (16.5 microg/ml) activities, respectively. PMID:19361822

  10. The FXR agonist obeticholic acid prevents gut barrier dysfunction and bacterial translocation in cholestatic rats.

    PubMed

    Verbeke, Len; Farre, Ricard; Verbinnen, Bert; Covens, Kris; Vanuytsel, Tim; Verhaegen, Jan; Komuta, Mina; Roskams, Tania; Chatterjee, Sagnik; Annaert, Pieter; Vander Elst, Ingrid; Windmolders, Petra; Trebicka, Jonel; Nevens, Frederik; Laleman, Wim

    2015-02-01

    Bacterial translocation (BTL) drives pathogenesis and complications of cirrhosis. Farnesoid X-activated receptor (FXR) is a key transcription regulator in hepatic and intestinal bile metabolism. We studied potential intestinal FXR dysfunction in a rat model of cholestatic liver injury and evaluated effects of obeticholic acid (INT-747), an FXR agonist, on gut permeability, inflammation, and BTL. Rats were gavaged with INT-747 or vehicle during 10 days after bile-duct ligation and then were assessed for changes in gut permeability, BTL, and tight-junction protein expression, immune cell recruitment, and cytokine expression in ileum, mesenteric lymph nodes, and spleen. Auxiliary in vitro BTL-mimicking experiments were performed with Transwell supports. Vehicle-treated bile duct-ligated rats exhibited decreased FXR pathway expression in both jejunum and ileum, in association with increased gut permeability through increased claudin-2 expression and related to local and systemic recruitment of natural killer cells resulting in increased interferon-γ expression and BTL. After INT-747 treatment, natural killer cells and interferon-γ expression markedly decreased, in association with normalized permeability selectively in ileum (up-regulated claudin-1 and occludin) and a significant reduction in BTL. In vitro, interferon-γ induced increased Escherichia coli translocation, which remained unaffected by INT-747. In experimental cholestasis, FXR agonism improved ileal barrier function by attenuating intestinal inflammation, leading to reduced BTL and thus demonstrating a crucial protective role for FXR in the gut-liver axis. PMID:25592258

  11. Metatranscriptomic analysis of lactic acid bacterial gene expression during kimchi fermentation.

    PubMed

    Jung, Ji Young; Lee, Se Hee; Jin, Hyun Mi; Hahn, Yoonsoo; Madsen, Eugene L; Jeon, Che Ok

    2013-05-15

    Barcode-based 16S rRNA gene pyrosequencing showed that the kimchi microbiome was dominated by six lactic acid bacteria (LAB), Leuconostoc (Lc.) mesenteroides, Lactobacillus (Lb.) sakei, Weissella (W.) koreensis, Lc. gelidum, Lc. carnosum, and Lc. gasicomitatum. Therefore, we used completed genome sequences of representatives of these bacteria to investigate metatranscriptomic gene-expression profiles during kimchi fermentation. Total mRNA was extracted from kimchi samples taken at five time points during a 29 day-fermentation. Nearly all (97.7%) of the metagenome sequences that were recruited on all LAB genomes of GenBank mapped onto the six LAB strains; this high coverage rate indicated that this approach for assessing processes carried out by the kimchi microbiome was valid. Expressed mRNA sequences (as cDNA) were determined using Illumina GA IIx. Assignment of mRNA sequences to metabolic genes using MG-RAST revealed the prevalence of carbohydrate metabolism and lactic acid fermentation. The mRNA sequencing reads were mapped onto genomes of the six LAB strains, which showed that Lc. mesenteroides was most active during the early-stage fermentation, whereas gene expression by Lb. sakei and W. koreensis was high during later stages. However, gene expression by Lb. sakei decreased rapidly at 25 days of fermentation, which was possibly caused by bacteriophage infection of the Lactobacillus species. Many genes related to carbohydrate transport and hydrolysis and lactate fermentation were actively expressed, which indicated typical heterolactic acid fermentation. Mannitol dehydrogenase-encoding genes (mdh) were identified from all Leuconostoc species and especially Lc. mesenteroides, which harbored three copies (two copies on chromosome and one copy on plasmid) of mdh with different expression patterns. These results contribute to knowledge of the active populations and gene expression in the LAB community responsible for an important fermentation process. PMID

  12. Content of essential polyunsaturated fatty acids in three canned fish species.

    PubMed

    Gladyshev, Michail I; Sushchik, Nadezhda N; Makhutova, Olesia N; Kalachova, Galina S

    2009-05-01

    Three canned fish species--Pacific saury (Cololabis saira), Pacific herring (Clupea harengus) and Baltic sprat (Sprattus sprattus)--most common and popular in Russia, were analyzed for fatty acids. Special attention was paid to long-chain essential polyunsaturated fatty acids: eicosapentaenoic acid (20:5omega3) and docosahexaenoic acid (22:6omega3). Sums of eicosapentaenoic acid and docosahexaenoic acid in saury, herring and sprat were, on average, 2.42, 1.80 and 1.43 g/100 g product, respectively. Contents of these essential acids in all the canned fish species were found to be very high compared with many other fish reported in the available literature. All the canned fish appeared to be highly valuable products for human nutrition concerning the content of eicosapentaenoic and docosahexaenoic acids. PMID:18608541

  13. A survey on species and prevalence rate of bacterial agents isolated from cockroaches in three hospitals.

    PubMed

    Zarchi, Ali Akbar Karimi; Vatani, Hadi

    2009-04-01

    The presence of cockroaches has health implications, such as nosocomial infection, as the insects move freely from areas within and around hospitals that may harbor pathogenic organisms. The goals of the present study were to determine species of bacteria isolated from cockroaches found in three Tehran hospitals, and to determine distribution of potential vectors by species and sex. The study is descriptive laboratory research. A total of 305 cockroaches from three species were trapped and identified: Periplaneta americana (65.6%), Blatella germanica (12.1%), and Blatta orientalis (22.3%). From these potential vectors, 19 species of bacteria were isolated and identified. After transportation of cockroaches to the laboratory, separation of the whole-homogenized suspension of each species was carried out. Identification of the isolated bacteria was performed according to Burgey's Manual of Determinative Bacteriology, 9th Edition. The most common species of bacteria isolated from cockroaches were Escherichia coli, Streptococcus Group D, Bacillus spp., Klebsiella pneumoniae, and Proteus vulgaris. No statistical significance was found between sex and species of cockroach carrying bacteria (p > 0.05), but significance was found for sex in Citrobacter freundii, Staphylococcus aureus, and Streptococcus non-group A&B (p < 0.05). PMID:18973441

  14. Development of a small-scale bioreactor method to monitor the molecular diversity and environmental impacts of bacterial biofilm communities from an acid mine drainage impacted creek.

    PubMed

    Cole, Michael; Wrubel, Joshua; Henegan, Patricia; Janzen, Christopher; Holt, Jack; Tobin, Tammy

    2011-10-01

    Shamokin Creek is a tributary of the Susquehanna River in central Pennsylvania that is heavily impacted by the acid mine drainage (AMD) caused by the oxidation of pyrite from the region's extensive anthracite coal mining industry. Recent studies have begun to characterize the microbial communities present in this and other AMD-impacted waters, but varying environmental conditions have complicated attempts to determine the ecological impacts of individual bacterial species within these communities. This study developed a small-scale biofilm reactor protocol that allowed us to simultaneously monitor the development of bacterial biofilm communities in AMD-impacted creek collected water using terminal restriction fragment length polymorphism (T-RFLP) analysis of 16S rRNA genes, while assessing the impacts that the developing biofilms were having on water quality. Our analysis confirmed that the diversity and composition of these small in situ biofilm communities could be monitored using molecular methods, and indicated the possible presence of many taxa frequently found in AMD environments, including Sulfobacillus, Nitrospira, Desulfovibrio, Geobacter, and Leptothrix species. A significant increase in the total sulfate was observed in the bioreactor, and as most likely due to the accumulation of sulfur-oxidizing bacteria such as Sulfobacillus in the biofilms. This system will allow us to study the microbial ecology of Shamokin Creek through controlled experiments that will ultimately integrate microscopic, molecular, physiological and chemical analyses, and that can be utilized to develop more effective and cost-efficient environmental remediation techniques for AMD-impacted areas. PMID:21821067

  15. The potential of spectral and hyperspectral-imaging techniques for bacterial detection in food: A case study on lactic acid bacteria.

    PubMed

    Foca, Giorgia; Ferrari, Carlotta; Ulrici, Alessandro; Sciutto, Giorgia; Prati, Silvia; Morandi, Stefano; Brasca, Milena; Lavermicocca, Paola; Lanteri, Silvia; Oliveri, Paolo

    2016-06-01

    Official methods for the detection of bacteria are based on culture techniques. These methods have limitations such as time consumption, cost, detection limits and the impossibility to analyse a large number of samples. For these reasons, the development of rapid, low-cost and non-destructive analytical methods is a task of growing interest. In the present study, the capability of spectral and hyperspectral techniques to detect bacterial surface contamination was investigated preliminarily on gel cultures, and subsequently on sliced cooked ham. In more detail, two species of lactic acid bacteria (LAB) were considered, namely Lactobacillus curvatus and Lactobacillus sakei, both of which are responsible for common alterations in sliced cooked ham. Three techniques were investigated, with different equipment, respectively: a macroscopic hyperspectral scanner operating in the NIR (10,470-5880cm(-1)) region, a FT-NIR spectrophotometer equipped with a transmission arm as the sampling tool, working in the 12,500-5800cm(-1) region, and a FT-MIR microscopy operating in the 4000-675cm(-1) region. Multivariate exploratory data analysis, in particular principal component analysis (PCA), was applied in order to extract useful information from original data and from hyperspectrograms. The results obtained demonstrate that the spectroscopic and imaging techniques investigated can represent an effective and sensitive tool to detect surface bacterial contamination in samples and, in particular, to recognise species to which bacteria belong. PMID:27130097

  16. Rapid determination of dipicolinic acid in the spores of Clostridium species by gas-liquid chromatography.

    PubMed Central

    Tabor, M W; MacGee, J; Holland, J W

    1976-01-01

    A gas-liquid chromatographic procedure has been developed to quantitate dipicolinic acid in bacterial spores. The culture, washed from a plate, was hydrolyzed with acid containing the internal standard, pyridine-2,4-dicarboxylate, and then extracted into methyl isobutyl ketone. The internal standard and dipicolinic acid were then extracted into a small volume of trimethylphenylammonium hydroxide. Injection of the resultant quaternary ammonium salts into a gas chromatograph yielded, via thermal decomposition, the methyl ester derivatives of the dipicolinic acid and the internal standard. The amount of dipicolinic acid in the sample was determined from a standard curve. The method was sensitive to 100 ng of dipicolinic acid per sample and was 1,000 to 5,000 times more sensitive than the commonly used methods. Preparation of the sample required less than 1.5 h and less than 15 min of the analyst's time. PMID:942206

  17. Shifts in bacterial communities of two caribbean reef-building coral species affected by white plague disease

    PubMed Central

    Cárdenas, Anny; Rodriguez-R, Luis M; Pizarro, Valeria; Cadavid, Luis F; Arévalo-Ferro, Catalina

    2012-01-01

    Coral reefs are deteriorating at an alarming rate mainly as a consequence of the emergence of coral diseases. The white plague disease (WPD) is the most prevalent coral disease in the southwestern Caribbean, affecting dozens of coral species. However, the identification of a single causal agent has proved problematic. This suggests more complex etiological scenarios involving alterations in the dynamic interaction between environmental factors, the coral immune system and the symbiotic microbial communities. Here we compare the microbiome of healthy and WPD-affected corals from the two reef-building species Diploria strigosa and Siderastrea siderea collected at the Tayrona National Park in the Caribbean of Colombia. Microbiomes were analyzed by combining culture-dependent methods and pyrosequencing of 16S ribosomal DNA (rDNA) V5-V6 hypervariable regions. A total of 20 410 classifiable 16S rDNA sequences reads were obtained including all samples. No significant differences in operational taxonomic unit diversity were found between healthy and affected tissues; however, a significant increase of Alphaproteobacteria and a concomitant decrease in the Beta- and Gammaproteobacteria was observed in WPD-affected corals of both species. Significant shifts were also observed in the orders Rhizobiales, Caulobacteriales, Burkholderiales, Rhodobacterales, Aleteromonadales and Xanthomonadales, although they were not consistent between the two coral species. These shifts in the microbiome structure of WPD-affected corals suggest a loss of community-mediated growth control mechanisms on bacterial populations specific for each holobiont system. PMID:21955993

  18. A short-term mineral amendment impacts the mineral weathering bacterial communities in an acidic forest soil.

    PubMed

    Lepleux, C; Uroz, S; Collignon, C; Churin, J-L; Turpault, M-P; Frey-Klett, P

    2013-09-01

    Mineral amendment (i.e. calcium, phosphorous, potassium and/or magnesium) is a management practice used in forestry to improve nutrient availability and recover soil fertility, especially in nutrient-poor forest ecosystems. However, whether this amendment can lead to modifications of the soil characteristics and an improvement in tree growth, and its impact on the soil bacterial communities, especially the mineral weathering bacterial communities, remains poorly documented. In this study, we investigated the short-term impact of a mineral amendment on the taxonomic and functional structure of the mineral weathering bacterial communities. To do this, a plantation of four-year old oak (Quercus petraea) trees amended with or without dolomite [CaMg(CO3)2] was established in the experimental forest site of Breuil-Chenue, which is characterized by an acidic soil and a low availability of calcium and magnesium. Three years after amendment, soil samples were used to isolate bacteria as well as to determine the soil characteristics and the metabolic potentials of these soil microbial communities. Based on a bioassay for quantifying the solubilisation of inorganic phosphorous, we demonstrate that the bacterial isolates coming from the non-amended bulk soil were significantly more efficient than those from the amended bulk soil. No difference was observed between the bacterial isolates coming from the amended and non-amended rhizospheres. Notably, the taxonomic analyses revealed a dominance of bacterial isolates belonging to the Burkholderia genus in both samples. Overall, our results suggest that the bioavailability of nutritive cations into soil impacts the distribution and the efficacy of mineral weathering bacterial communities coming from the soil but not those coming from the rhizosphere. PMID:23583355

  19. Synthesis of new chalcone derivatives containing a rhodanine-3-acetic acid moiety with potential anti-bacterial activity.

    PubMed

    Chen, Zhen-Hua; Zheng, Chang-Ji; Sun, Liang-Peng; Piao, Hu-Ri

    2010-12-01

    With an intention to synergize the anti-bacterial activity of chalcones and rhodanine-3-acetic acid, several hybrid compounds possessing chalcone and rhodanine-3-acetic acid moieties were synthesized and tested for their anti-bacterial activity. Some compounds presented great anti-microbial activities against Gram-positive bacteria (including the multidrug-resistant clinical isolates). This class of compounds presented high potency against Staphylococcus aureus, among which the derivatives 5k with a MIC of 2 μg/mL was as active as the standard drug (norfloxacin) and less active than oxacillin. Compounds 5a-s did not inhibit the growth of Gram-negative bacteria Escherichia coli CCARM 1924 or E. coli CCARM 1356 at 64 μg/mL. PMID:20889240

  20. Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis.

    PubMed

    Nanson, Jeffrey D; Forwood, Jade K

    2015-01-01

    Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections. PMID:26539719

  1. Fatty-Acid Composition of Seeds and Chemotaxonomic Evaluation of Sixteen Sapindaceae Species.

    PubMed

    Coutinho, Diogenes J Gusmão; Barbosa, Mariana O; Silva, Rejane M; da Silva, Suzene I; de Oliveira, Antonio Fernando M

    2015-08-01

    Circumscriptions for the Sapindaceae family and its infrafamilial relationships have been widely discussed. Certain groups are highly morphologically similar; thus, it is difficult to identify certain taxa. DNA Analyses have also indicated complex phylogenetic relationships, and it is difficult to relate such analyses to morphological data. Given the above concerns, this study aimed to investigate the fatty-acid profiles of the seed oils of 16 Sapindaceae species belonging to five tribes and to evaluate their potential chemotaxonomic significance. In total, eleven fatty acids were identified, and eicosenoic acid predominated in nine species. Multivariate analyses (principal component and cluster analyses) of the fatty-acid profiles of the seed oils allowed to separate them in two major clusters. The first cluster, characterized by oils with high eicosenoic acid levels, included all species belonging to the Paullinieae tribe (Cardiospermum, Paullinia, and Serjania species). In the second main cluster, the chemical similarity of the oils was lower, and the species belonged to different tribes. Nevertheless, the tree investigated Allophylus species (Thouinieae tribe) constituted a separate subcluster. Thus, the results showed that the fatty-acid composition of the seed oils of Sapindaceae species provide chemotaxonomic support for the separation of the Paullinieae tribe from the other tribes studied. PMID:26265579

  2. Interspecific Transfer of Bacterial Endosymbionts between Tsetse Fly Species: Infection Establishment and Effect on Host Fitness▿

    PubMed Central

    Weiss, Brian L. ; Mouchotte, Rosa; Rio, Rita V. M.; Wu, Yi-neng; Wu, Zheyang; Heddi, Abdelaziz; Aksoy, Serap

    2006-01-01

    Tsetse flies (Glossina spp.) can harbor up to three distinct species of endosymbiotic bacteria that exhibit unique modes of transmission and evolutionary histories with their host. Two mutualist enterics, Wigglesworthia and Sodalis, are transmitted maternally to tsetse flies' intrauterine larvae. The third symbiont, from the genus Wolbachia, parasitizes developing oocytes. In this study, we determined that Sodalis isolates from several tsetse fly species are virtually identical based on a phylogenetic analysis of their ftsZ gene sequences. Furthermore, restriction fragment-length polymorphism analysis revealed little variation in the genomes of Sodalis isolates from tsetse fly species within different subgenera (Glossina fuscipes fuscipes and Glossina morsitans morsitans). We also examined the impact on host fitness of transinfecting G. fuscipes fuscipes and G. morsitans morsitans flies with reciprocal Sodalis strains. Tsetse flies cleared of their native Sodalis symbionts were successfully repopulated with the Sodalis species isolated from a different tsetse fly species. These transinfected flies effectively transmitted the novel symbionts to their offspring and experienced no detrimental fitness effects compared to their wild-type counterparts, as measured by longevity and fecundity. Quantitative PCR analysis revealed that transinfected flies maintained their Sodalis populations at densities comparable to those in flies harboring native symbionts. Our ability to transinfect tsetse flies is indicative of Sodalis ' recent evolutionary history with its tsetse fly host and demonstrates that this procedure may be used as a means of streamlining future paratransgenesis experiments. PMID:16950907

  3. Genetic Evidence for Bacterial Chemolithoautotrophy Based on the Reductive Tricarboxylic Acid Cycle in Groundwater Systems

    PubMed Central

    Alfreider, Albin; Vogt, Carsten

    2012-01-01

    Geologically and chemically distinct aquifers were screened for the presence of two genes coding for key enzymes of the reverse tricarboxylic acid (rTCA) cycle in autotrophic bacteria, 2-oxoglutarate : ferredoxin oxidoreductase (oorA) and the beta subunit of ATP citrate lyase enzymes (aclB). From 42 samples investigated, aclB genes were detected in two and oorA genes in six samples retrieved from polluted and sulfidic aquifers. aclB genes were represented by a single phylotype of almost identical sequences closely affiliated with chemolithoautotrophic Sulfurimonas species. In contrast, sequences analysis of oorA genes revealed diverse phylotypes mainly related to sequences from cultivation-independent studies. PMID:22791056

  4. Species sorting and seasonal dynamics primarily shape bacterial communities in the Upper Mississippi River.

    PubMed

    Staley, Christopher; Gould, Trevor J; Wang, Ping; Phillips, Jane; Cotner, James B; Sadowsky, Michael J

    2015-02-01

    Bacterial community structure (BCS) in freshwater ecosystems varies seasonally and due to physicochemical gradients, but metacommunity structure of a major river remains understudied. Here we characterize the BCS along the Mississippi River and contributing rivers in Minnesota over three years using Illumina next-generation sequencing, to determine how changes in environmental conditions as well as inputs from surrounding land and confluences impacted community structure. Contributions of sediment to water microbial diversity were also evaluated. Long-term variation in community membership was observed, and significant shifts in relative abundances of major freshwater taxa, including α-Proteobacteria, Burkholderiales, and Actinomycetales, were observed due to temporal and spatial variations. Environmental parameters (e.g. temperature, rainfall, and nutrient concentrations) primarily contributed to differences in phyla abundances (88% of variance), with minimal influence from spatial distance alone (<1% of variance). Furthermore, an annually-recurrent BCS was observed in late summer, further suggesting that seasonal dynamics strongly influence community composition. Sediment communities differed from those in the water, but contributed up to 50% to community composition in the water column. Among water sampling sites, 34% showed significant variability in BCS of replicate samples indicating variability among riverine communities due to heterogeneity in the water column. Results of this study highlight the need for a better understanding of spatial and temporal variations in riverine bacterial diversity associated with physicochemical gradients and reveal how communities in sediments, and potentially other environmental reservoirs, impact waterborne BCS. Techniques used in this study may prove useful to determine sources of microbes from sediments and soils to waterways, which will facilitate best management practices and total maximum daily load determinations

  5. CAP-D3 Promotes Bacterial Clearance in Human Intestinal Epithelial Cells by Repressing Expression of Amino Acid Transporters

    PubMed Central

    Kemp, Jacqueline R.; Nickerson, Kourtney P.; Deutschman, Emily; Kim, Yeojung; West, Gail; Sadler, Tammy; Stylianou, Eleni; Krokowski, Dawid; Hatzoglou, Maria; de la Motte, Carol; Rubin, Brian P.; Fiocchi, Claudio

    2015-01-01

    BACKGROUND & AIMS Defects in colonic epithelial barrier defenses are associated with ulcerative colitis (UC). The proteins that regulate bacterial clearance in the colonic epithelium have not been completely identified. The chromosome-associated protein D3 (dCAP-D3), regulates responses to bacterial infection. We examined whether CAP-D3 promotes bacterial clearance in human colonic epithelium. METHODS Clearance of Salmonella or adherent-invasive Escherichia coli LF82 was assessed by gentamycin protection assays in HT-29 and Caco-2 cells expressing small hairpin RNAs against CAP-D3. We used immunoblot assays to measure levels of CAP-D3 in colonic epithelial cells from patients with UC and healthy individuals (controls). RNA sequencing identified genes activated by CAP-D3. We analyzed the roles of CAP-D3 target genes in bacterial clearance using gentamycin protection and immunofluorescence assays and studies with pharmacologic inhibitors. RESULTS CAP-D3 expression was reduced in colonic epithelial cells from patients with active UC. Reduced CAP-D3 expression decreased autophagy and impaired intracellular bacterial clearance by HT-29 and Caco-2 colonic epithelial cells. Lower levels of CAP-D3 increased transcription of genes encoding SLC7A5 and SLC3A2, whose products heterodimerize to form an amino acid transporter in HT-29 cells following bacterial infection; levels of SLC7A5–SLC3A2 were increased in tissues from patients with UC, compared with controls. Reduced CAP-D3 in HT-29 cells resulted in earlier recruitment of SLC7A5 to Salmonella-containing vacuoles, increased activity of mTORC1, and increased survival of bacteria. Inhibition of SLC7A5–SLC3A2 or mTORC1 activity rescued the bacterial clearance defects of CAP-D3– deficient cells. CONCLUSIONS CAP-D3 downregulates transcription of genes that encode amino acid transporters (SLC7A5 and SLC3A2) to promote bacterial autophagy by colon epithelial cells. Levels of CAP-D3 protein are reduced in patients with

  6. Amoeba host-Legionella synchronization of amino acid auxotrophy and its role in bacterial adaptation and pathogenic evolution

    PubMed Central

    Price, Christopher T. D.; Richards, Ashley M.; Von Dwingelo, Juanita E.; Samara, Hala A.; Kwaik, Yousef Abu

    2013-01-01

    Summary Legionella pneumophila, the causative agent of Legionnaires’ disease, invades and proliferates within a diverse range of free-living amoeba in the environment but upon transmission to humans the bacteria hijack alveolar macrophages. Intracellular proliferation of L. pneumophila in two evolutionarily distant hosts is facilitated by bacterial exploitation of conserved host processes that are targeted by bacterial protein effectors injected into the host cell. A key aspect of microbe-host interaction is microbial extraction of nutrients from the host but understanding of this is still limited. AnkB functions as a nutritional virulence factor and promotes host proteasomal degradation of polyubiquitinated proteins generating gratuitous levels of limiting host cellular amino acids. L. pneumophila is auxotrophic for several amino acids including cysteine, which is a metabolically preferred source of carbon and energy during intracellular proliferation, but is limiting in both amoebae and humans. We propose that synchronization of bacterial amino acids auxotrophy with the host is a driving force in pathogenic evolution and nutritional adaptation of L. pneumophila and other intracellular bacteria to life within the host cell. Understanding microbial strategies of nutrient generation and acquisition in the host will provide novel antimicrobial strategies to disrupt pathogen access to essential sources of carbon and energy. PMID:24112119

  7. Two UDP-glucuronic acid decarboxylases involved in the biosynthesis of a bacterial exopolysaccharide in Paenibacillus elgii.

    PubMed

    Li, Ou; Qian, Chao-Dong; Zheng, Dao-Qiong; Wang, Pin-Mei; Liu, Yu; Jiang, Xin-Hang; Wu, Xue-Chang

    2015-04-01

    Xylose is described as a component of bacterial exopolysaccharides in only a limited number of bacterial strains. A bacterial strain, Paenibacillus elgii, B69 was shown to be efficient in producing a xylose-containing exopolysaccharide. Sequence analysis was performed to identify the genes encoding the uridine diphosphate (UDP)-glucuronic acid decarboxylase required for the synthesis of UDP-xylose, the precursor of the exopolysaccharide. Two sequences, designated as Peuxs1 and Peuxs2, were found as the candidate genes for such enzymes. The activities of the UDP-glucuronic acid decarboxylases were proven by heterologous expression and real-time nuclear magnetic resonance analysis. The intracellular activity and effect of these genes on the synthesis of exopolysaccharide were further investigated by developing a thymidylate synthase based knockout system. This system was used to substitute the conventional antibiotic resistance gene system in P. elgii, a natural multi-antibiotic resistant strain. Results of intracellular nucleotide sugar analysis showed that the intracellular UDP-xylose and UDP-glucuronic acid levels were affected in Peuxs1 or Peuxs2 knockout strains. The knockout of either Peuxs1 or Peuxs2 reduced the polysaccharide production and changed the monosaccharide ratio. No polysaccharide was found in the Peuxs1/Peuxs2 double knockout strain. Our results show that P. elgii can be efficient in forming UDP-xylose, which is then used for the synthesis of xylose-containing exopolysaccharide. PMID:25573472

  8. Antimicrobial and immune modulatory effects of lactic acid and short chain fatty acids produced by vaginal microbiota associated with eubiosis and bacterial vaginosis

    PubMed Central

    Aldunate, Muriel; Srbinovski, Daniela; Hearps, Anna C.; Latham, Catherine F.; Ramsland, Paul A.; Gugasyan, Raffi; Cone, Richard A.; Tachedjian, Gilda

    2015-01-01

    Lactic acid and short chain fatty acids (SCFAs) produced by vaginal microbiota have reported antimicrobial and immune modulatory activities indicating their potential as biomarkers of disease and/or disease susceptibility. In asymptomatic women of reproductive-age the vaginal microbiota is comprised of lactic acid-producing bacteria that are primarily responsible for the production of lactic acid present at ~110 mM and acidifying the vaginal milieu to pH ~3.5. In contrast, bacterial vaginosis (BV), a dysbiosis of the vaginal microbiota, is characterized by decreased lactic acid-producing microbiota and increased diverse anaerobic bacteria accompanied by an elevated pH>4.5. BV is also characterized by a dramatic loss of lactic acid and greater concentrations of mixed SCFAs including acetate, propionate, butyrate, and succinate. Notably women with lactic acid-producing microbiota have more favorable reproductive and sexual health outcomes compared to women with BV. Regarding the latter, BV is associated with increased susceptibility to sexually transmitted infections (STIs) including HIV. In vitro studies demonstrate that lactic acid produced by vaginal microbiota has microbicidal and virucidal activities that may protect against STIs and endogenous opportunistic bacteria as well as immune modulatory properties that require further characterization with regard to their effects on the vaginal mucosa. In contrast, BV-associated SCFAs have far less antimicrobial activity with the potential to contribute to a pro-inflammatory vaginal environment. Here we review the composition of lactic acid and SCFAs in respective states of eubiosis (non-BV) or dysbiosis (BV), their effects on susceptibility to bacterial/viral STIs and whether they have inherent microbicidal/virucidal and immune modulatory properties. We also explore their potential as biomarkers for the presence and/or increased susceptibility to STIs. PMID:26082720

  9. The diterpenoid ent-16-kauren-19-oic acid acts as an uncoupler of the bacterial respiratory chain.

    PubMed

    Torres-Bustos, Janet; Farías, Leonardo; Urzúa, Alejandro; Mendoza, Leonora; Wilkens, Marcela

    2009-06-01

    ent-16-Kauren-19-oic acid is a bacteriolytic diterpenoid present in the resin of the medicinal plant Pseudognaphalium vira vira. The compound and its methyl ester showed strong activity against gram-positive bacteria, whereas the derivative 3beta-hydroxy-ent-kauren-19-oic acid was inactive against all assayed bacteria at the maximal concentration used (250 microg/mL). The bacteriolytic effect of ent-16-kauren-19-oic acid (5 microg/mL) was confirmed with cultures of Bacillus cereus and Staphylococcus aureus, whereas the methyl derivative (12 microg/mL) showed only a bacteriostatic effect. Both compounds stimulated oxygen consumption and proton conduction of whole cells, as reflected by an abrupt increase in the extracellular pH. These results indicate that ent-16-kauren-19-oic acid acts as a respiratory chain uncoupler, and that this function is strongly affected by minor structural substitutions, suggesting a tight activity-structure relationship. The ultimate effect of the uncoupling mechanism demonstrated by ent-16-kauren-19-oic acid is bacterial lysis. The disruption of the bacterial membrane integrity caused by the diterpenoid compound was determined using SYTOX Green stain and visualized by fluorescence microscopy. PMID:19296427

  10. Improving survival of probiotic bacteria using bacterial poly-γ-glutamic acid.

    PubMed

    Bhat, A R; Irorere, V U; Bartlett, T; Hill, D; Kedia, G; Charalampopoulos, D; Nualkaekul, S; Radecka, I

    2015-03-01

    A major hurdle in producing a useful probiotic food product is bacterial survival during storage and ingestion. The aim of this study was to test the effect of γ-PGA immobilisation on the survival of probiotic bacteria when stored in acidic fruit juice. Fruit juices provide an alternative means of probiotic delivery, especially to lactose intolerant individuals. In addition, the survival of γ-PGA-immobilised cells in simulated gastric juice was also assessed. Bifidobacteria strains (Bifidobacteria longum, Bifidobacteria breve), immobilised on 2.5% γ-PGA, survived significantly better (P<0.05) in orange and pomegranate juice for 39 and 11 days respectively, compared to free cells. However, cells survived significantly better (P<0.05) when stored in orange juice compared to pomegranate juice. Moreover, both strains, when protected with 2.5% γ-PGA, survived in simulated gastric juice (pH2.0) with a marginal reduction (<0.47 log CFU/ml) or no significant reduction in viable cells after 4h, whereas free cells died within 2h. In conclusion, this research indicates that γ-PGA can be used to protect Bifidobacteria cells in fruit juice, and could also help improve the survival of cells as they pass through the harsh conditions of the gastrointestinal tract (GIT). Following our previous report on the use of γ-PGA as a cryoprotectant for probiotic bacteria, this research further suggests that γ-PGA could be used to improve probiotic survival during the various stages of preparation, storage and ingestion of probiotic cells. PMID:25506798

  11. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  12. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, an d analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: (1) to assess the potential terrorist threat to U.S. agricultural crops, (2) to determine whether suitable assays exist to monitor that threat, and (3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  13. Aminomethylphosphonic acid accumulation in plant species treated with glyphosate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aminomethylphosphonic acid (AMPA) is the most frequently detected metabolite of glyphosate in plants. Greenhouse studies were conducted to determine the glyphosate I50 values (rate required to cause a 50% reduction in plant growth) and to quantify AMPA and shikimate concentrations in selected legum...

  14. Respiratory CO(2) as Carbon Source for Nocturnal Acid Synthesis at High Temperatures in Three Species Exhibiting Crassulacean Acid Metabolism.

    PubMed

    Winter, K; Schröppel-Meier, G; Caldwell, M M

    1986-06-01

    TEMPERATURE EFFECTS ON NOCTURNAL CARBON GAIN AND NOCTURNAL ACID ACCUMULATION WERE STUDIED IN THREE SPECIES OF PLANTS EXHIBITING CRASSULACEAN ACID METABOLISM: Mamillaria woodsii, Opuntia vulgaris, and Kalanchoë daigremontiana. Under conditions of high soil moisture, nocturnal CO(2) gain and acid accumulation had temperature optima at 15 to 20 degrees C. Between 5 and 15 degrees C, uptake of atmospheric CO(2) largely accounted for acid accumulation. At higher tissue temperatures, acid accumulation exceeded net carbon gain indicating that acid synthesis was partly due to recycling of respiratory CO(2). When plants were kept in CO(2)-free air, acid accumulation based on respiratory CO(2) was highest at 25 to 35 degrees C. Net acid synthesis occurred up to 45 degrees C, although the nocturnal carbon balance became largely negative above 25 to 35 degrees C. Under conditions of water stress, net CO(2) exchange and nocturnal acid accumulation were reduced. Acid accumulation was proportionally more decreased at low than at high temperatures. Acid accumulation was either similar over the whole temperature range (5-45 degrees C) or showed an optimum at high temperatures, although net carbon balance became very negative with increasing tissue temperatures. Conservation of carbon by recycling respiratory CO(2) was temperature dependent. At 30 degrees C, about 80% of the dark respiratory CO(2) was conserved by dark CO(2) fixation, in both well irrigated and water stressed plants. PMID:16664827

  15. Colloidal precipitates related to Acid Mine Drainage: bacterial diversity and micro fungi-heavy metal interactions

    NASA Astrophysics Data System (ADS)

    Lucchetti, G.; Carbone, C.; Consani, S.; Zotti, M.; Di Piazza, S.; Pozzolini, M.; Giovine, M.

    2015-12-01

    In Acid Mine Drainage (AMD) settings colloidal precipitates control the mobility of Potential Toxic Elements (PTEs). Mineral-contaminant relationships (i.e. adsorption, ion-exchange, desorption) are rarely pure abiotic processes. Microbes, mainly bacteria and microfungi, can catalyze several reactions modifying the element speciation, as well as the bioavailability of inorganic pollutants. Soil, sediments, and waters heavily polluted with PTEs through AMD processes are a potential reservoir of extremophile bacteria and fungi exploitable for biotechnological purposes. Two different AMD related colloids, an ochraceous precipitate (deposited in weakly acidic conditions, composed by nanocrystalline goethite) and a greenish-blue precipitate (deposited at near-neutral pH, composed by allophane + woodwardite) were sampled. The aims of this work were to a) characterize the mycobiota present in these colloidal minerals by evaluating the presence of alive fungal propagules and extracting bacteria DNA; b) verify the fungal strains tolerance, and bioaccumulation capability on greenish-blue and ZnSO4 enriched media; c) evaluate potential impact of bacteria in the system geochemistry. The preliminary results show an interesting and selected mycobiota able to survive under unfavourable environmental conditions. A significant number of fungal strains were isolated in pure culture. Among them, species belonging to Penicillium and Trichoderma genera were tested on both greenish-blue and ZnSO4 enriched media. The results show a significant tolerance and bioaccumulation capability to some PTEs. The same colloidal precipitates were processed to extract bacteria DNA by using a specific procedure developed for sediments. The results give a good yield of nucleic acids and a positive PCR amplification of 16S rDNA accomplished the first step for future metagenomic analyses.

  16. "Bacillus mediterraneensis," a new bacterial species isolated from human gut microbiota.

    PubMed

    Alou, M T; Fournier, P-E; Raoult, D

    2016-07-01

    We present a brief description of "Bacillus mediterraneensis" strain Marseille-P2366(T) (= CSUR P2366 = DSM 102091), a new species isolated from the gastrointestinal tract of a healthy 13-month-old boy from Senegal. PMID:27330818

  17. Cytotoxic responses to 405nm light exposure in mammalian and bacterial cells: Involvement of reactive oxygen species.

    PubMed

    Ramakrishnan, Praveen; Maclean, Michelle; MacGregor, Scott J; Anderson, John G; Grant, M Helen

    2016-06-01

    Light at wavelength 405 nm is an effective bactericide. Previous studies showed that exposing mammalian cells to 405 nm light at 36 J/cm(2) (a bactericidal dose) had no significant effect on normal cell function, although at higher doses (54 J/cm(2)), mammalian cell death became evident. This research demonstrates that mammalian and bacterial cell toxicity induced by 405 nm light exposure is accompanied by reactive oxygen species production, as detected by generation of fluorescence from 6-carboxy-2',7'-dichlorodihydrofluorescein diacetate. As indicators of the resulting oxidative stress in mammalian cells, a decrease in intracellular reduced glutathione content and a corresponding increase in the efflux of oxidised glutathione were observed from 405 nm light treated cells. The mammalian cells were significantly protected from dying at 54 J/cm(2) in the presence of catalase, which detoxifies H2O2. Bacterial cells were significantly protected by sodium pyruvate (H2O2 scavenger) and by a combination of free radical scavengers (sodium pyruvate, dimethyl thiourea (OH scavenger) and catalase) at 162 and 324 J/cm(2). Results therefore suggested that the cytotoxic mechanism of 405 nm light in mammalian cells and bacteria could be oxidative stress involving predominantly H2O2 generation, with other ROS contributing to the damage. PMID:26916085

  18. Bacterial wilt resistance in tomato, pepper, and eggplant: genetic resources respond to diverse strains in the Ralstonia solanacearum species complex.

    PubMed

    Lebeau, A; Daunay, M-C; Frary, A; Palloix, A; Wang, J-F; Dintinger, J; Chiroleu, F; Wicker, E; Prior, P

    2011-01-01

    Bacterial wilt, caused by strains belonging to the Ralstonia solanacearum species complex, inflicts severe economic losses in many crops worldwide. Host resistance remains the most effective control strategy against this disease. However, wilt resistance is often overcome due to the considerable variation among pathogen strains. To help breeders circumvent this problem, we assembled a worldwide collection of 30 accessions of tomato, eggplant and pepper (Core-TEP), most of which are commonly used as sources of resistance to R. solanacearum or for mapping quantitative trait loci. The Core-TEP lines were challenged with a core collection of 12 pathogen strains (Core-Rs2) representing the phylogenetic diversity of R. solanacearum. We observed six interaction phenotypes, from highly susceptible to highly resistant. Intermediate phenotypes resulted from the plants' ability to tolerate latent infections (i.e., bacterial colonization of vascular elements with limited or no wilting). The Core-Rs2 strains partitioned into three pathotypes on pepper accessions, five on tomato, and six on eggplant. A "pathoprofile" concept was developed to characterize the strain clusters, which displayed six virulence patterns on the whole set of Core-TEP host accessions. Neither pathotypes nor pathoprofiles were phylotype specific. Pathoprofiles with high aggressiveness were mainly found in strains from phylotypes I, IIB, and III. One pathoprofile included a strain that overcame almost all resistance sources. PMID:20795852

  19. Intra-Species Bacterial Quorum Sensing Studied at Single Cell Level in a Double Droplet Trapping System

    PubMed Central

    Bai, Yunpeng; Patil, Santoshkumar N.; Bowden, Steven D.; Poulter, Simon; Pan, Jie; Salmond, George P. C.; Welch, Martin; Huck, Wilhelm T. S.; Abell, Chris

    2013-01-01

    In this paper, we investigated the intra-species bacterial quorum sensing at the single cell level using a double droplet trapping system. Escherichia coli transformed to express the quorum sensing receptor protein, LasR, were encapsulated in microdroplets that were positioned adjacent to microdroplets containing the autoinducer, N-(3-oxododecanoyl)- l-homoserine lactone (OdDHL). Functional activation of the LasR protein by diffusion of the OdDHL across the droplet interface was measured by monitoring the expression of green fluorescent protein (GFP) from a LasR-dependent promoter. A threshold concentration of OdDHL was found to induce production of quorum-sensing associated GFP by E. coli. Additionally, we demonstrated that LasR-dependent activation of GFP expression was also initiated when the adjacent droplets contained single E. coli transformed with the OdDHL synthase gene, LasI, representing a simple quorum sensing circuit between two droplets. PMID:23698779

  20. Biochemical changes induced by salt stress in halotolerant bacterial isolates are media dependent as well as species specific.

    PubMed

    Joghee, Nidhya Nadarajan; Jayaraman, Gurunathan

    2016-01-01

    Halophilic bacteria respond to salt stress by regulating the cytosolic pools of organic solutes to achieve osmotic equilibrium. In order to understand the metabolic regulation of these organic solutes, for the first time, we have investigated the effect of salt on growth and biochemical changes in four major moderately halophilic bacterial strains isolated from a saltern region of the Kumta coast, India. The strains under study were Halomonas hydrothermalis VITP9, Bacillus aquimaris VITP4, Planococcus maritimus VITP21, and Virgibacillus dokdonensis VITP14, which exhibited similar salt tolerance (0% to 10% w/v NaCl) with optimal growth at 5% w/v NaCl. Biochemical analysis showed that the total intracellular organic solutes increased significantly with increasing NaCl concentration in the growth medium, and the compositions of the solutes were dependent on the type of strain and also on the nutrient richness of the growth medium. Glutamic acid levels increased in all the strains under salt stress, indicating the significance of glutamic acid as the anionic counterpart of K(+)/Na(+) ions and precursor for other synthesized nitrogenous osmolytes. Though initial studies were performed with thin-layer chromatography, mass spectrometry was used to identify the major solutes accumulated by the strains under salt stress, such as proline (VITP4), ectoine (VITP14 and VITP9), and sugars (VITP21) under minimal medium and glycine betaine (by all the strains under study) under complex growth medium conditions. Such comparative study on the stress-dependent metabolic differences of different microbes, under identical experimental condition, helps to identify possible bacterial sources for the production of industrially important solutes. PMID:25286020

  1. Biodegradation of free cyanide by bacterial species isolated from cyanide-contaminated artisanal gold mining catchment area in Burkina Faso.

    PubMed

    Razanamahandry, Lovasoa Christine; Andrianisa, Harinaivo Anderson; Karoui, Hela; Kouakou, Koffi Marcelin; Yacouba, Hamma

    2016-08-01

    Soil and water samples were collected from a watershed in Burkina Faso where illegal artisanal gold extraction using cyanidation occurs. The samples were used to evaluate cyanide contamination and the presence of cyanide degrading bacteria (CDB). Free cyanide (F-CN) was detected in all samples, with concentrations varying from 0.023 to 0.9 mg kg(-1), and 0.7-23 μg L(-1) in the soil and water samples, respectively. Potential CDB also were present in the samples. To test the effective F-CN degradation capacity of the isolated CDB species, the species were cultivated in growth media containing 40, 60 or 80 mg F-CN L(-1), with or without nutrients, at pH 9.5 and at room temperature. More than 95% of F-CN was degraded within 25 h, and F-CN degradation was associated with bacterial growth and ammonium production. However, initial concentrations of F-CN higher than 100 mg L(-1) inhibited bacterial growth and cyanide degradation. Abiotic tests showed that less than 3% of F-CN was removed by volatilization. Thus, the degradation of F-CN occurred predominately by biological mechanisms, and such mechanisms are recommended for remediation of contaminated soil and water. The bacteria consortium used in the experiment described above exist in a Sahelian climate, which is characterized by a long hot and dry season. Because the bacteria are already adapted to the local climate conditions and show the potential for cyanide biodegradation, further applicability to other contaminated areas in West Africa, where illegal gold cyanidation is widespread, should be explored. PMID:27209555

  2. Diversity of bacterial species in the nasal cavity of sheep in the highlands of Ethiopia and first report of Histophilus somni in the country.

    PubMed

    Tesfaye, Biruk; Sisay Tessema, Tesfaye; Tefera, Genene

    2013-06-01

    A study was conducted to isolate bacterial species/pathogens from the nasal cavity of apparently healthy and pneumonic sheep. Nasal swabs were collected aseptically, transported in tryptose soya broth and incubated for 24 h. Then, each swab was streaked onto chocolate and blood agar for culture. Bacterial species were identified following standard bacteriological procedures. Accordingly, a total of 1,556 bacteria were isolated from 960 nasal swabs collected from three different highland areas of Ethiopia, namely Debre Berhan, Asella, and Gimba. In Debre Berhan, 140 Mannheimia haemolytica, 81 Histophilus somni, 57 Staphylococcus species, and 52 Bibersteinia trehalosi were isolated. While from Gimba M. haemolytica, Staphylococcus, Streptococcus, and H. somni were isolated at rates of 25.2, 15.9, 11.4, and 5.9 %, respectively, of the total 647 bacterial species. In Asella from 352 bacterial species isolated, 93 (26.4 %) were M. haemolytica, 48 (13.6 %) were Staphylococcus species, 26 (7.4 %) were B. trehalosi, and 17 (4.8 %) H. somni were recognized. Further identification and characterization using BIOLOG identification system Enterococcus avium and Sphingomonas sanguinis were identified at 100 % probability, while, H. somni and Actinobacillus lignerisii were suggested by the system. The study showed that a variety of bacterial species colonize the nasal cavity of the Ethiopian highland sheep with variable proportion between healthy and pneumonic ones. To our knowledge, this is the first report on isolation of H. somni, an important pathogen in cattle, from the respiratory tract of a ruminant species in the country. PMID:23328945

  3. Multifactorial Competition and Resistance in a Two-Species Bacterial System

    PubMed Central

    Khare, Anupama; Tavazoie, Saeed

    2015-01-01

    Microorganisms exist almost exclusively in interactive multispecies communities, but genetic determinants of the fitness of interacting bacteria, and accessible adaptive pathways, remain uncharacterized. Here, using a two-species system, we studied the antagonism of Pseudomonas aeruginosa against Escherichia coli. Our unbiased genome-scale approach enabled us to identify multiple factors that explained the entire antagonism observed. We discovered both forms of ecological competition–sequestration of iron led to exploitative competition, while phenazine exposure engendered interference competition. We used laboratory evolution to discover adaptive evolutionary trajectories in our system. In the presence of P. aeruginosa toxins, E. coli populations showed parallel molecular evolution and adaptive convergence at the gene-level. The multiple resistance pathways discovered provide novel insights into mechanisms of toxin entry and activity. Our study reveals the molecular complexity of a simple two-species interaction, an important first-step in the application of systems biology to detailed molecular dissection of interactions within native microbiomes. PMID:26647077

  4. Organic acids and selected nitrogen species for ABLE-3

    NASA Technical Reports Server (NTRS)

    Talbot, Robert W.

    1991-01-01

    The NASA Global Tropospheric Experiment (GTE) executed airborne science missions aboard the NASA Wallops Electra (NA429) in the North American high latitude (greater than 45 deg North) atmosphere during Jul. to Aug. 1988 and Jul. to Aug. 1990. These missions were part of GTE's Atmospheric Boundary Layer Experiment (ABLE). The 1988 mission , ABLE-3A, examined the ecosystems of Alaska as a source and/or sink for important tropospheric gases and particles, and gained new information on the chemical composition of the Arctic atmosphere during the summertime. During 1990 the second high latitude mission, ABLE-3B, focused on the Hudson Bay Lowland and Labrador regions of Canada. Both of these missions provided benchmark data sets on atmosphere biosphere exchange and atmospheric chemistry over largely uninhabited regions of North America. In support of the GTE/ABLE-3A and -3B field missions, the University of New Hampshire flew instrumentation aboard the Wallops Electra research aircraft to provide measurements of the trace gases nitric (HNO3), formic (HCOOH), and acetic (CH3COOH) acid. In addition, measurements were conducted to determine the major water soluble ionic composition of the atmospheric aerosol. For ABLE-3B, groundbased measurements of the acidic trace gases were also performed from the NASA micrometerological tower situated at Schefferville, Laborador. These measurements were aimed at assessing dry deposition of acidic gases to the taiga ecosystem in the Laborador region of Canada.

  5. Characterization of a Single Magnetotactic Bacterial Species from Devil's Bathtub, Mendon Ponds Park, Honeoye Falls, NY

    NASA Astrophysics Data System (ADS)

    Wagner, C.; Tarduno, J. A.; Stein, A.; Sia, E.

    2015-12-01

    Magnetotactic bacteria (MTB) belong to a lineage of prokaryotic bacteria that synthesize magnetosomes, single domain magnetic particles (typically magnetite or greigite) with an average size of 50 nanometers. MTB utilize magnetosomes through magnetotaxis, the alignment and movement along magnetic field lines to navigate towards preferred environmental conditions. MTB are sensitive to different environments and are thought to exhibit varying magnetosome morphologies, compositions, sizes, and quantities in regards to the environments which they inhabit. These characteristics allow MTB and magnetofossils (preserved magnetosomes) to be used as modern/paleoenvironmental recorders and biomarkers for environmental change(s). Devil's Bathtub (Mendon Ponds Park, Honeoye Falls, NY) is a meromictic glacial kettle pond surrounded by deciduous tree cover. Here we examine one species of MTB based on prominence of this particular morphology at this locale. Magnetotaxis and morphology of this species have been observed using light microscopy. Micrographs have also been taken using Transmission Electron Microscopy (TEM) to verify cell morphology and to determine magnetosome morphology. TEM and magnetic hysteresis measurements were done to find and test the composition of magnetosomes. In this study we also focus on DNA sequencing and characterization of this MTB, as there are few MTB species which have been DNA sequenced successfully. Data from these experiments are directly applicable to this up-and-coming area of research as it will aid in the understanding and correlation of magnetosome and magnetofossils with environmental characteristics.

  6. Differential interaction of bacterial species from the Burkholderia cepacia complex with human airway epithelial cells.

    PubMed

    Moura, Jane A; Cristina de Assis, Maria; Ventura, Grasiella C; Saliba, Alessandra M; Gonzaga, Luiz; Si-Tahar, Mustapha; Marques, Elizabeth de A; Plotkowski, Maria Cristina

    2008-01-01

    To increase knowledge of the pathogenic potential of the Burkholderia cepacia complex (BCC), we investigated the effects of reference strains of the nine BCC species on human bronchial epithelial cells in vitro. B. multivorans exhibited the highest rates of adherence to and internalization by host cells. Two out of three clinical isolates recovered from cystic fibrosis patients confirmed the B. multivorans high adhesiveness. All four B. multivorans isolates exhibited an aggregated pattern of adherence but any of them expressed cable pili. When bacteria were centrifuged onto cell cultures to circumvent their poor adhesiveness, B. pyrrocinia exhibited the highest internalization rate, followed by B. multivorans. The percentages of apoptotic cells in cultures infected with B. cepacia, B. multivorans, B. cenocepacia (subgroups IIIA and IIIB), B. stabilis and B. vietnamiensis were significantly higher than in control non-infected cultures. All nine BCC species triggered a similar release of the inflammatory cytokine IL-8, that was not reduced by cell treatment with cytochalasin D. Hence, our data demonstrate, for the first time, that all BCC species exhibit a similar ability to induce the expression of host immune mediators whereas they differ on their ability to adhere to, invade and kill airway epithelial cells. PMID:18068390

  7. Polyunsaturated fatty acids in the psychrophilic bacterium Shewanella gelidimarina ACAM 456T: molecular species analysis of major phospholipids and biosynthesis of eicosapentaenoic acid.

    PubMed

    Nichols, D S; Nichols, P D; Russell, N J; Davies, N W; McMeekin, T A

    1997-08-16

    The production of eicosapentaenoic acid [20:5omega3; EPA] from Shewanella gelidimarina (ACAM 456T) was investigated with respect to growth temperature and growth on sole carbon sources. The percentage and quantitative yield of EPA remained relatively constant at all growth temperatures within or below the optimal growth temperature region. At higher growth temperatures, these values decreased greatly. Growth on differing sole carbon sources also influenced the percentage and amount of EPA produced, with the fatty acid composition influenced by provision of potential acyl chain primers as sole carbon sources. The highest amounts of EPA occurred from growth on propionic acid and L-leucine respectively, while the highest percentage of EPA occurred from growth on L-proline. Monounsaturated fatty acid components and EPA were concentrated in phosphatidylglycerol (PG), while the proportion of branched-chain fatty acids was elevated in phosphatidylethanolamine (PE); the two major phospholipid classes. Specific associations of EPA with other acyl chains were identified within cellular phospholipid classes. The association of EPA with 17:1 and 18:0 acyl chains in phospholipid species was specific to PG, whereas the association of EPA with i13:0/13:0 and 14:0/i14:0 was specific to PE. Such acyl chain 'tailoring' is indicative of the important role of EPA in bacterial membrane adaptive responses. EPA was also a large component (22%) of a non-esterified fatty acid (NEFA) fraction within the total lipid extract of the bacterium. This may point toward a particular role of NEFA in polyunsaturated fatty acid (PUFA) metabolism. The formation of EPA was investigated by labelling with L-[U-14C]serine and sodium [1-14C]acetate. The accumulation of radiolabel within unsaturated intermediates (di-, tri- and tetraunsaturated fractions) was low, indicating a rapid formation and derivatisation of these components. Similar results were found for the unsaturated fatty acid fractions of both

  8. Species differences in the conjugation of 4-hydroxy-3-methoxyphenylethanol with glucuronic acid and sulphuric acid.

    PubMed

    Wong, K P

    1976-07-15

    The biosynthesis of the glucuronide and sulphate conjugates of 4-hydroxy-3-methoxyphenylethanol was demonstrated in vitro by using the high-speed supernatant and microsomal fractions of liver respectively. These two conjugates were also produced simultaneously by using the post-mitochondrial fraction of rat, rabbit or guinea-pig liver. In contrast only the glucuronide was synthesized by human liver and only the sulphate by mouse and cat livers. Neither of these conjugates was formed by the kidney or the small or large intestine of the rat. A high sulphate-conjugating activity was observed in mouse kidney; the rate of sulphation of 4-hydroxy-3-methoxyphenylethanol with kidney homogenate and high-speed supernatant preparations was 1.8 times greater than with liver preparations. The sulpho-conjugates of 4-hydroxy-3-methoxyphenylethanol and 4-hydroxy-3-methoxy-phenylglycol were also formed by enzyme preparations of rabbit adrenal and rat brain; the glycol was the better substrate in the latter system. Mouse brain did not possess any sulphotransferase activity. For the conjugation of 4-hydroxy-3-methoxyphenylethanol by rabbit liver, the Km for UDP-glucuronic acid was 0.22 mM and that for Na2SO4 was 3.45 mM. The sulphotransferase has a greater affinity for 4-hydroxy-3-methoxyphenyl-ethanol than has glucuronyltransferase, as indicated by their respective Km values of 0.036 and 1.3 mM. It was concluded that sulphate conjugation of 4-hydroxy-3-methoxyphenylethanol predominates in most species of animals. PMID:9078

  9. Lipid content and fatty acid composition of 11 species of Queensland (Australia) fish.

    PubMed

    Belling, G B; Abbey, M; Campbell, J H; Campbell, G R

    1997-06-01

    The fatty acid composition of 11 species of fish caught of the northeast coast of Australia was determined. No fatty acid profiles have been previously published for fish from this area nor for nine of these species. Although the percentage of polyunsaturated fatty acid (PUFA) was the same as the calculated average for Australian fish (42.3%), the percentage of n-3 fatty acids was lower (24.4 +/- 5.4% vs. 30.7 +/- 10.1%) and the n-6 fatty acids higher (16.5 +/- 4.5% vs. 11.2 +/- 5.9%), P < 0.001 in each case. The major n-3 PUFA were docosahexaenoic (15.6 +/- 6.3%) and eicosapentaenoic acid (4.3 +/- 1.1%) while the major n-6 PUFA were arachidonic (8.3 +/- 3.2%) and n-6 docosatetraenoic acid (3.1 +/- 1.3%). The second-most abundant class of fatty acid was the saturates (31.6 +/- 3.5%) while the monounsaturates accounted for 17.4 +/- 4.3% of the total fatty acids. The monounsaturate with the highest concentration was octadecenoic acid (11.8 +/- 2.6%). There was a positive correlation between the total lipid content and saturated and monounsaturated fatty acids (r = 0.675 and 0.567, respectively) and a negative correlation between the total lipid content and PUFA (r = 0.774). PMID:9208391

  10. Comparison of tryptophan biosynthetic operon regulation in different Gram-positive bacterial species.

    PubMed

    Gutiérrez-Preciado, Ana; Yanofsky, Charles; Merino, Enrique

    2007-09-01

    The tryptophan biosynthetic operon has been widely used as a model system for studying transcription regulation. In Bacillus subtilis, the trp operon is primarily regulated by a tryptophan-activated RNA-binding protein, TRAP. Here we show that in many other Gram-positive species the trp operon is regulated differently, by tRNA(Trp) sensing by the RNA-based T-box mechanism, with T-boxes arranged in tandem. Our analyses reveal an apparent relationship between trp operon organization and the specific regulatory mechanism(s) used. PMID:17555843

  11. Adaptive acid tolerance response of Vibrio parahaemolyticus as affected by acid adaptation conditions, growth phase, and bacterial strains.

    PubMed

    Chiang, Ming-Lun; Chou, Cheng-Chun; Chen, Hsi-Chia; Tseng, Yu-Ting; Chen, Ming-Ju

    2012-08-01

    Vibrio parahaemolyticus strain 690 was isolated from gastroenteritis patients. Its thermal and ethanol stress responses have been reported in our previous studies. In this study, we further investigated the effects of various acid adaptation conditions including pH (5.0-6.0) and time (30-90 min) on the acid tolerance in different growth phases of V. parahaemolyticus 690. Additionally, the adaptive acid tolerance among different V. parahaemolyticus strains was compared. Results indicated that the acid tolerance of V. parahaemolyticus 690 was significantly increased after acid adaptation at pH 5.5 and 6.0 for 30-90 min. Among the various acid adaptation conditions examined, V. parahaemolyticus 690 acid-adapted at pH 5.5 for 90 min exhibited the highest acid tolerance. The acid adaptation also influenced the acid tolerance of V. parahaemolyticus 690 in different growth phases with late-exponential phase demonstrating the greatest acid tolerance response (ATR) than other phases. Additionally, the results also showed that the induction of adaptive ATR varied with different strains of V. parahaemolyticus. An increase in acid tolerance of V. parahaemolyticus was observed after prior acid adaptation in five strains (556, 690, BCRC 13023, BCRC 13025, and BCRC 12864), but not in strains 405 and BCRC 12863. PMID:22827515

  12. Exposure of two upland plant species to acidic fogs.

    PubMed

    Ashenden, T W; Rafarel, C R; Bell, S A

    1991-01-01

    A system is described for exposing large numbers of plants to acidic fogs. The system allows low volumes of treatment solutions to be provided at particle sizes chiefly in the 5-30 microm range (equivalent to fog/cloud droplets). Plants of Poa alpina L. and Epilobium brunnescens were propagated from material collected in Snowdonia, North Wales and exposed to fog treatments at pH values of 2.5, 3.5, 4.5 and 5.6. There were 3 x 4 h exposures per week which provided a total of 6 mm deposition. Supplementary watering was with pH 4.5 simulated acid rain (24 mm per week). After 21 weeks, there was increased lowering and a greater dry weight for plants of E. brunnescens exposed to the pH 2.5 fog in comparison with other treatments. Also, the plants used assimilated material to form shoots rather than roots. A similar increase in dry weight accumulation in the pH 2.5 treatment was found in P. alpina after 63 weeks but this was not associated with changes in assimilate partitioning. PMID:15092062

  13. Iron transformations induced by an acid-tolerant Desulfosporosinus species.

    PubMed

    Bertel, Doug; Peck, John; Quick, Thomas J; Senko, John M

    2012-01-01

    The mineralogical transformations of Fe phases induced by an acid-tolerant, Fe(III)- and sulfate-reducing bacterium, Desulfosporosinus sp. strain GBSRB4.2 were evaluated under geochemical conditions associated with acid mine drainage-impacted systems (i.e., low pH and high Fe concentrations). X-ray powder diffractometry coupled with magnetic analysis by first-order reversal curve diagrams were used to evaluate mineral phases produced by GBSRB4.2 in media containing different ratios of Fe(II) and Fe(III). In medium containing Fe predominately in the +II oxidation state, ferrimagnetic, single-domain greigite (Fe₃S₄) was formed, but the addition of Fe(III) inhibited greigite formation. In media that contained abundant Fe(III) [as schwertmannite; Fe₈O₈(OH)₆SO₄ · nH₂O], the activities of strain GBSRB4.2 enhanced the transformation of schwertmannite to goethite (α-FeOOH), due to the increased pH and Fe(II) concentrations that resulted from the activities of GBSRB4.2. PMID:22038606

  14. Iron Transformations Induced by an Acid-Tolerant Desulfosporosinus Species

    PubMed Central

    Bertel, Doug; Peck, John; Quick, Thomas J.

    2012-01-01

    The mineralogical transformations of Fe phases induced by an acid-tolerant, Fe(III)- and sulfate-reducing bacterium, Desulfosporosinus sp. strain GBSRB4.2 were evaluated under geochemical conditions associated with acid mine drainage-impacted systems (i.e., low pH and high Fe concentrations). X-ray powder diffractometry coupled with magnetic analysis by first-order reversal curve diagrams were used to evaluate mineral phases produced by GBSRB4.2 in media containing different ratios of Fe(II) and Fe(III). In medium containing Fe predominately in the +II oxidation state, ferrimagnetic, single-domain greigite (Fe3S4) was formed, but the addition of Fe(III) inhibited greigite formation. In media that contained abundant Fe(III) [as schwertmannite; Fe8O8(OH)6SO4 · nH2O], the activities of strain GBSRB4.2 enhanced the transformation of schwertmannite to goethite (α-FeOOH), due to the increased pH and Fe(II) concentrations that resulted from the activities of GBSRB4.2. PMID:22038606

  15. Effect of temperature on bacterial species diversity in thermophilic solid-waste composting.

    PubMed Central

    Strom, P F

    1985-01-01

    Continuously thermophilic composting was examined with a 4.5-liter reactor placed in an incubator maintained at representative temperatures. Feed was a mixture of dried table scraps and shredded newspaper wetted to 55% moisture. One run at 49 degrees C (run A) employed a 1:4 feed-to-compost ratio, while the other runs used a 10:1 ratio and were incubated at 50, 55, 60, or 65 degrees C. Due to self-heating, internal temperatures of the composting mass were 0 to 7 degrees C hotter than the incubator. Two full-scale composting plants (at Altoona, Pa., and Leicester, England) were also examined. Plate counts per gram (dry weight) on Trypticase soy broth (BBL Microbiology Systems) with 2% agar ranged from 0.7 X 10(9) to 5.3 X 10(9) for laboratory composting and 0.02 X 10(9) to 7.4 X 10(9) for field composting. Fifteen taxa were isolated, including 10 of genus Bacillus, which dominated all samples except that from run A. Species diversity decreased markedly in laboratory composting at 60 degrees C and above, but was similar for the three runs incubated at 49, 50, and 55 degrees C. The maximum desirable composting temperature based on species diversity is thus 60 degrees C, the same as that previously recommended based on measures of the rate of decomposition. PMID:4083885

  16. Impacts of silver nanoparticles on bacterial species B. subtilis and E. coli and the major crop plant Z. mays

    NASA Astrophysics Data System (ADS)

    Doody, Michael A.

    This thesis examines the impacts of citrate-coated silver nanoparticles (c-AgNPs) on two species of bacteria (Bacillus subtilis and Escherichia coli), the major crop plant Zea mays, and the beneficial plant-microbe relationship between Z. mays and B. subtilis. AgNPs are an increasing component of antimicrobial consumer, industrial, and military products. This has led to widespread scientific concern for the ecological safety outside their intended use. An overview of their history, use, and toxicity was used to inform the design of experiments and resulting data. Growth inhibition and sub-lethal toxic effects were used to assess the effects of c-AgNP exposure to bacteria. Similar analytical methods were used to quantify the response of Z. mays to c-AgNP exposure. Results showed that exposure to c-AgNP significantly reduced the growth of bacterial populations and alters their growth kinetics. Z. mays experienced significant sub-lethal effects due to exposure, including reduced root length and biomass, and hyper-accumulated Ag in root tissues. Beneficial interactions between B. subtilis and Z. mays were reduced as both species suffered sub-lethal effects of exposure to c-AgNPs.

  17. Parallel Mutations Result in a Wide Range of Cooperation and Community Consequences in a Two-Species Bacterial Consortium.

    PubMed

    Douglas, Sarah M; Chubiz, Lon M; Harcombe, William R; Ytreberg, F Marty; Marx, Christopher J

    2016-01-01

    Multi-species microbial communities play a critical role in human health, industry, and waste remediation. Recently, the evolution of synthetic consortia in the laboratory has enabled adaptation to be addressed in the context of interacting species. Using an engineered bacterial consortium, we repeatedly evolved cooperative genotypes and examined both the predictability of evolution and the phenotypes that determine community dynamics. Eight Salmonella enterica serovar Typhimurium strains evolved methionine excretion sufficient to support growth of an Escherichia coli methionine auxotroph, from whom they required excreted growth substrates. Non-synonymous mutations in metA, encoding homoserine trans-succinylase (HTS), were detected in each evolved S. enterica methionine cooperator and were shown to be necessary for cooperative consortia growth. Molecular modeling was used to predict that most of the non-synonymous mutations slightly increase the binding affinity for HTS homodimer formation. Despite this genetic parallelism and trend of increasing protein binding stability, these metA alleles gave rise to a wide range of phenotypic diversity in terms of individual versus group benefit. The cooperators with the highest methionine excretion permitted nearly two-fold faster consortia growth and supported the highest fraction of E. coli, yet also had the slowest individual growth rates compared to less cooperative strains. Thus, although the genetic basis of adaptation was quite similar across independent origins of cooperative phenotypes, quantitative measurements of metabolite production were required to predict either the individual-level growth consequences or how these propagate to community-level behavior. PMID:27617746

  18. Isolation and characterization of a novel violacein-like pigment producing psychrotrophic bacterial species Janthinobacterium svalbardensis sp. nov.

    PubMed

    Ambrožič Avguštin, Jerneja; Žgur Bertok, Darja; Kostanjšek, Rok; Avguštin, Gorazd

    2013-04-01

    A bacterial strain designated JA-1, related to Janthinobacterium lividum, was isolated from glacier ice samples from the island Spitsbergen in the Arctic. The strain was tested for phenotypic traits and the most prominent appeared to be the dark red brown to black pigmentation different from the violet pigment of Janthinobacterium, Chromobacterium and Iodobacter. Phylogenetic analysis based on 16S rRNA gene sequences and DNA-DNA hybridization tests showed that strain JA-1 belongs to the genus Janthinobacterium but represents a novel lineage distinct from the two known species of this genus, J. lividum and Janthinobacterium agaricidamnosum. The DNA G + C content of strain JA-1 was determined to be 62.3 mol %. The isolate is a psychrotrophic Gram negative bacterium, rod-shaped with rounded ends, containing intracellular inclusions and one polar flagellum. On the basis of the presented results strain JA-1 is proposed as the type strain of a novel species of the genus Janthinobacterium, for which the name Janthinobacterium svalbardensis sp. nov. is proposed (JA-1(T) = DSM 25734, ZIM B637). PMID:23192307

  19. Bacterial Species-Specific Activity of a Fluoroquinolone against Two Closely Related Pasteurellaceae with Similar MICs: Differential In Vitro Inoculum Effects and In Vivo Efficacies

    PubMed Central

    Lhermie, Guillaume; El Garch, Farid; Toutain, Pierre-Louis; Ferran, Aude A.; Bousquet-Mélou, Alain

    2015-01-01

    We investigated the antimicrobial activity of a fluoroquinolone against two genetically close bacterial species belonging to the Pasteurellaceae family. Time-kill experiments were used to measure the in vitro activity of marbofloxacin against two strains of Mannheimia haemolytica and Pasteurella multocida with similar MICs. We observed that marbofloxacin was equally potent against 105 CFU/mL inocula M. haemolytica and P. multocida. However, an inoculum effect was observed with P. multocida, meaning that marbofloxacin activity was decreased against a 108 CFU/mL inoculum, whereas no inoculum effect was observed with M. haemolytica. Marbofloxacin activity was also tested in a lung infection model with immunocompromised mice intratracheally infected with 109 CFU of each bacteria. At the same dose, the clinical and bacteriological outcomes were much better for mice infected with M. haemolytica than for those infected with P. multocida. Moreover, bacteriological eradication was obtained with a lower marbofloxacin dose for mice infected with M. haemolytica. Our results suggest that the differential in vivo marbofloxacin efficacy observed with the two bacterial species of similar MIC could be explained by a differential inoculum effect. Consequently, MICs determined on 105 CFU inocula were not predictive of the differences in antibiotic efficacies against high bacterial inocula of closely related bacterial strains. These results could stimulate further investigations on bacterial species-specific antibiotic doses in a clinical setting. PMID:26506096

  20. Bacterial Species-Specific Activity of a Fluoroquinolone against Two Closely Related Pasteurellaceae with Similar MICs: Differential In Vitro Inoculum Effects and In Vivo Efficacies.

    PubMed

    Lhermie, Guillaume; El Garch, Farid; Toutain, Pierre-Louis; Ferran, Aude A; Bousquet-Mélou, Alain

    2015-01-01

    We investigated the antimicrobial activity of a fluoroquinolone against two genetically close bacterial species belonging to the Pasteurellaceae family. Time-kill experiments were used to measure the in vitro activity of marbofloxacin against two strains of Mannheimia haemolytica and Pasteurella multocida with similar MICs. We observed that marbofloxacin was equally potent against 105 CFU/mL inocula M. haemolytica and P. multocida. However, an inoculum effect was observed with P. multocida, meaning that marbofloxacin activity was decreased against a 108 CFU/mL inoculum, whereas no inoculum effect was observed with M. haemolytica. Marbofloxacin activity was also tested in a lung infection model with immunocompromised mice intratracheally infected with 109 CFU of each bacteria. At the same dose, the clinical and bacteriological outcomes were much better for mice infected with M. haemolytica than for those infected with P. multocida. Moreover, bacteriological eradication was obtained with a lower marbofloxacin dose for mice infected with M. haemolytica. Our results suggest that the differential in vivo marbofloxacin efficacy observed with the two bacterial species of similar MIC could be explained by a differential inoculum effect. Consequently, MICs determined on 105 CFU inocula were not predictive of the differences in antibiotic efficacies against high bacterial inocula of closely related bacterial strains. These results could stimulate further investigations on bacterial species-specific antibiotic doses in a clinical setting. PMID:26506096

  1. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    PubMed Central

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-01-01

    While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution. PMID:26527268

  2. Acetylation of bacterial cellulose catalyzed by citric acid: Use of reaction conditions for tailoring the esterification extent.

    PubMed

    Ávila Ramírez, Jhon Alejandro; Gómez Hoyos, Catalina; Arroyo, Silvana; Cerrutti, Patricia; Foresti, María Laura

    2016-11-20

    Bacterial cellulose (BC) nanoribbons were partially acetylated by a simple direct solvent-free route catalyzed by citric acid. The assay of reaction conditions within chosen intervals (i.e. esterification time (0.5-7h), catalyst content (0.08-1.01mmol/mmol AGU), and temperature (90-140°C)), illustrated the flexibility of the methodology proposed, with reaction variables which can be conveniently manipulated to acetylate BC to the required degree of substitution (DS) within the 0.20-0.73 interval. Within this DS interval, characterization results indicated a surface-only process in which acetylated bacterial cellulose with tunable DS, preserved fibrous structure and increased hydrophobicity could be easily obtained. The feasibility of reusing the catalyst/excess acylant in view of potential scale-up was also illustrated. PMID:27561540

  3. [In vivo study of bacterial invasion in root planed and citric acid treated radicular surfaces of periodontally involved human teeth].

    PubMed

    Ito, K; Arai, N; Otogoto, J; Murai, S

    1989-06-01

    The purpose of this study was to investigate whether plaque bacteria invade the exposed radicular dentin after root planing or chemical root treatment in vivo. Eighteen caries-free human periodontally involved teeth with hopeless prognoses were studied. Fourteen teeth were scaled and root planed with hand curette type scalers. The proximal surface of each treated tooth was designated as the RP surface. The remaining half of the proximal surface was treated with citric acid (pH 1.0) for 3 minutes and was designated as the CA surface. Four untreated teeth served as controls. After 4 weeks, the teeth were extracted, and were processed for light microscopy and for scanning electron microscopy concerning bacterial invasion into the supragingival radicular dentin. The following results were obtained. 1. Radicular cementum was present on most untreated tooth surfaces. However, bacteria were never seen in the dentinal tubules. 2. Bacterial invasion into the dentinal tubules was observed in five of the 10 proximal surfaces (50% of the RP surfaces) and in nine of the 10 proximal surfaces (90% of the CA surfaces). 3. The depth (9.5 +/- 24.1 microns vs 84.6 +/- 136.3 microns) and percentage (0.8 +/- 2.1% vs 20.3 +/- 17.3%) of bacterial invasion in the dentinal tubules of the RP surfaces was lower than that of the CA surfaces. 4. Cocci and short rods were present in the supragingival dentinal tubules. 5. Since CA surfaces may accelerate bacterial invasion the citric acid treatment might be harmful in patients with inadequate plaque control. PMID:2700200

  4. An X-ray Absorption Fine Structure study of Au adsorbed onto the non-metabolizing cells of two soil bacterial species

    SciTech Connect

    Song, Zhen; Kenney, Janice P.L.; Fein, Jeremy B.; Bunker, Bruce A.

    2015-02-09

    Gram-positive and Gram-negative bacterial cells can remove Au from Au(III)-chloride solutions, and the extent of removal is strongly pH dependent. In order to determine the removal mechanisms, X-ray Absorption Fine Structure (XAFS) spectroscopy experiments were conducted on non-metabolizing biomass of Bacillus subtilis and Pseudomonas putida with fixed Au(III) concentrations over a range of bacterial concentrations and pH values. X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) data on both bacterial species indicate that more than 90% of the Au atoms on the bacterial cell walls were reduced to Au(I). In contrast to what has been observed for Au(III) interaction with metabolizing bacterial cells, no Au(0) or Au-Au nearest neighbors were observed in our experimental systems. All of the removed Au was present as adsorbed bacterial surface complexes. For both species, the XAFS data suggest that although Au-chloride-hydroxide aqueous complexes dominate the speciation of Au in solution, Au on the bacterial cell wall is characterized predominantly by binding of Au atoms to sulfhydryl functional groups and amine and/or carboxyl functional groups, and the relative importance of the sulfhydryl groups increases with increasing pH and with decreasing Au loading. The XAFS data for both microorganism species suggest that adsorption is the first step in the formation of Au nanoparticles by bacteria, and the results enhance our ability to account for the behavior of Au in bacteria-bearing geologic systems.

  5. An X-ray Absorption Fine Structure study of Au adsorbed onto the non-metabolizing cells of two soil bacterial species

    NASA Astrophysics Data System (ADS)

    Song, Zhen; Kenney, Janice P. L.; Fein, Jeremy B.; Bunker, Bruce A.

    2012-06-01

    Gram-positive and Gram-negative bacterial cells can remove Au from Au(III)-chloride solutions, and the extent of removal is strongly pH dependent. In order to determine the removal mechanisms, X-ray Absorption Fine Structure (XAFS) spectroscopy experiments were conducted on non-metabolizing biomass of Bacillus subtilis and Pseudomonas putida with fixed Au(III) concentrations over a range of bacterial concentrations and pH values. X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) data on both bacterial species indicate that more than 90% of the Au atoms on the bacterial cell walls were reduced to Au(I). In contrast to what has been observed for Au(III) interaction with metabolizing bacterial cells, no Au(0) or Au-Au nearest neighbors were observed in our experimental systems. All of the removed Au was present as adsorbed bacterial surface complexes. For both species, the XAFS data suggest that although Au-chloride-hydroxide aqueous complexes dominate the speciation of Au in solution, Au on the bacterial cell wall is characterized predominantly by binding of Au atoms to sulfhydryl functional groups and amine and/or carboxyl functional groups, and the relative importance of the sulfhydryl groups increases with increasing pH and with decreasing Au loading. The XAFS data for both microorganism species suggest that adsorption is the first step in the formation of Au nanoparticles by bacteria, and the results enhance our ability to account for the behavior of Au in bacteria-bearing geologic systems.

  6. Increasing the dynamic control space of mammalian transcription devices by combinatorial assembly of homologous regulatory elements from different bacterial species.

    PubMed

    Bacchus, William; Weber, Wilfried; Fussenegger, Martin

    2013-01-01

    Prokaryotic transcriptional regulatory elements are widely utilized building blocks for constructing regulatory genetic circuits adapted for mammalian cells and have found their way into a broad range of biotechnological applications. Prokaryotic transcriptional repressors, fused to eukaryotic transactivation or repression domains, compose the transcription factor, which binds and adjusts transcription from chimeric promoters containing the repressor-specific operator sequence. Escherichia coli and Chlamydia trachomatis share common features in the regulatory mechanism of the biosynthesis of l-tryptophan. The repressor protein TrpR of C. trachomatis regulates the trpRBA operon and the TrpR of E. coli regulates the trpEDCBA operon, both requiring l-tryptophan as a co-repressor. Fusion of these bacterial repressors to the VP16 transactivation domain of Herpes simplex virus creates synthetic transactivators that could bind and activate chimeric promoters, assembled by placing repressor-specific operator modules adjacent to a minimal promoter, in an l-tryptophan-adjustable manner. Combinations of different transactivator and promoter variants from the same or different bacterial species resulted in a multitude of regulatory systems where l-tryptophan regulation properties, background noise, and maximal gene expression levels were significantly diverse. Different l-tryptophan analogues showed diverse regulatory capacity depending on the promoter/transactivator combination. We believe the systems approach to rationally choose promoters, transactivators and inducer molecules, to obtain desired and predefined genetic expression dynamics and control profiles, will significantly advance the design of new regulatory circuits as well as improving already existing ones. PMID:23178502

  7. Estimates of Soil Bacterial Ribosome Content and Diversity Are Significantly Affected by the Nucleic Acid Extraction Method Employed.

    PubMed

    Wüst, Pia K; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf; Overmann, Jörg

    2016-05-01

    Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particularActinobacteriaandProteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137

  8. Structure-Activity Relationship of Amino Acid Tunable Lipidated Norspermidine Conjugates: Disrupting Biofilms with Potent Activity against Bacterial Persisters.

    PubMed

    Konai, Mohini M; Adhikary, Utsarga; Samaddar, Sandip; Ghosh, Chandradhish; Haldar, Jayanta

    2015-12-16

    The emergence of bacterial resistance and biofilm associated infections has created a challenging situation in global health. In this present state of affairs where conventional antibiotics are falling short of being able to provide a solution to these problems, development of novel antibacterial compounds possessing the twin prowess of antibacterial and antibiofilm efficacy is imperative. Herein, we report a library of amino acid tunable lipidated norspermidine conjugates that were prepared by conjugating both amino acids and fatty acids with the amine functionalities of norspermidine through amide bond formation. These lipidated conjugates displayed potent antibacterial activity against various planktonic Gram-positive and Gram-negative bacteria including drug-resistant superbugs such as methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus faecium, and β-lactam-resistant Klebsiella pneumoniae. This class of nontoxic and fast-acting antibacterial molecules (capable of killing bacteria within 15 min) did not allow bacteria to develop resistance against them after several passages. Most importantly, an optimized compound in the series was also capable of killing metabolically inactive persisters and stationary phase bacteria. Additionally, this compound was capable of disrupting the preformed biofilms of S. aureus and E. coli. Therefore, this class of antibacterial conjugates have potential in tackling the challenging situation posed by both bacterial resistance as well as drug tolerance due to biofilm formation. PMID:26452096

  9. Comparative analysis of midgut bacterial communities in three aedine mosquito species from dengue-endemic and non-endemic areas of Rajasthan, India.

    PubMed

    Charan, S S; Pawar, K D; Gavhale, S D; Tikhe, C V; Charan, N S; Angel, B; Joshi, V; Patole, M S; Shouche, Y S

    2016-09-01

    Dengue viruses are transmitted to humans through the bites of infected female aedine mosquitoes. Differences in the composition and structure of bacterial communities in the midguts of mosquitoes may affect the vector's ability to transmit the disease. To investigate and analyse the role of midgut bacterial communities in viral transmission, midgut bacteria from three species, namely Stegomyia aegypti (= Aedes aegypti), Fredwardsius vittatus (= Aedes vittatus) and Stegomyia albopicta (= Aedes albopictus) (all: Diptera: Culicidae), from dengue-endemic and non-endemic areas of Rajasthan, India were compared. Construction and analyses of six 16S rRNA gene libraries indicated that Serratia spp.-related phylotypes dominated all clone libraries of the three mosquito species from areas in which dengue is not endemic. In dengue-endemic areas, phylotypes related to Aeromonas, Enhydrobacter spp. and uncultivated bacterium dominated the clone libraries of S. aegypti, F. vittatus and S. albopicta, respectively. Diversity indices analysis and real-time TaqMan polymerase chain reaction assays showed bacterial diversity and abundance in the midguts of S. aegypti to be higher than in the other two species. Significant differences observed among midgut bacterial communities of the three mosquito species from areas in which dengue is and is not endemic, respectively, may be related to the vectorial capacity of mosquitoes to carry dengue viruses and, hence, to the prevalence of disease in some areas. PMID:27094337

  10. Benzoic acid derivatives from Piper species and their antiparasitic activity.

    PubMed

    Flores, Ninoska; Jiménez, Ignacio A; Giménez, Alberto; Ruiz, Grace; Gutiérrez, David; Bourdy, Genevieve; Bazzocchi, Isabel L

    2008-09-01

    Piper glabratum and P. acutifolium were analyzed for their content of main secondary constituents, affording nine new benzoic acid derivatives (1, 2, 4, 5, 7, and 10-13), in addition to four known compounds (3, 6, 8, and 9). Their structures were elucidated on the basis of spectroscopic data. Riguera ester reactions and optical rotation measurements established the new compounds as racemates. In the search for antiparasitic agents, the compounds were evaluated in vitro against the promastigote forms of Leishmania spp., Trypanosoma cruzi, and Plasmodium falciparum. Among the evaluated compounds, methyl 3,4-dihydroxy-5-(3'-methyl-2'-butenyl)benzoate (7) exhibited leishmanicidal effect (IC50 13.8-18.5 microg/mL) against the three Leishmania strains used, and methyl 3,4-dihydroxy-5-(2-hydroxy-3-methylbutenyl)benzoate (1), methyl 4-hydroxy-3-(2-hydroxy-3-methyl-3-butenyl)benzoate (3), and methyl 3,4-dihydroxy-5-(3-methyl-2-butenyl) benzoate (7) showed significant trypanocidal activity, with IC50 values of 16.4, 15.6, and 18.5 microg/mL, respectively. PMID:18712933

  11. Uptake of gaseous nitrous acid (HONO) by several plant species

    NASA Astrophysics Data System (ADS)

    Schimang, Ralf; Folkers, Achim; Kleffmann, Jörg; Kleist, Einhard; Miebach, Marco; Wildt, Jürgen

    Uptake of gaseous nitrous acid (HONO) by sunflower ( Heliantus annuus L. var. gigantheus), tobacco ( Nicotiana tabacum L. var. Bel W3), castor ( Rhicinus communis L. var. Carmencita), and birch ( Betula pendula L.) was studied under controlled conditions in a continuously stirred tank reactor. Exposing plants to HONO at concentrations between 60 ppt and 10 ppb led to significant uptake by the plants. The uptake was proportional to HONO concentrations and linearly related to stomatal conductivity. HONO losses at the cuticle were of minor importance. Our data imply a quick metabolism of HONO and it is concluded that the uptake of HONO by plants is only limited by diffusion of HONO through the plants stomata. Comparing results from measurements with and without plants in the chamber it is furthermore concluded that a compensation point for HONO uptake is below 20 ppt if it exists at all. Heterogeneous formation of HONO by reactions of NO 2 on the plant surfaces was either not effective or compensated by the stomatal uptake of HONO. The data of the present study imply that plant surfaces represent a sink for HONO. Therefore, it was concluded that processes on plant surfaces cannot explain HONO formation on ground surfaces as observed in field studies.

  12. Comparative Genomics between Two Xenorhabdus bovienii Strains Highlights Differential Evolutionary Scenarios within an Entomopathogenic Bacterial Species

    PubMed Central

    Bisch, Gaëlle; Ogier, Jean-Claude; Médigue, Claudine; Rouy, Zoé; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2016-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Within Xenorhabdus bovienii species, the X. bovienii CS03 strain (Xb CS03) is nonvirulent when directly injected into lepidopteran insects, and displays a low virulence when associated with its Steinernema symbiont. The genome of Xb CS03 was sequenced and compared with the genome of a virulent strain, X. bovienii SS-2004 (Xb SS-2004). The genome size and content widely differed between the two strains. Indeed, Xb CS03 had a large genome containing several specific loci involved in the inhibition of competitors, including a few NRPS-PKS loci (nonribosomal peptide synthetases and polyketide synthases) producing antimicrobial molecules. Consistently, Xb CS03 had a greater antimicrobial activity than Xb SS-2004. The Xb CS03 strain contained more pseudogenes than Xb SS-2004. Decay of genes involved in the host invasion and exploitation (toxins, invasins, or extracellular enzymes) was particularly important in Xb CS03. This may provide an explanation for the nonvirulence of the strain when injected into an insect host. We suggest that Xb CS03 and Xb SS-2004 followed divergent evolutionary scenarios to cope with their peculiar life cycle. The fitness strategy of Xb CS03 would involve competitor inhibition, whereas Xb SS-2004 would quickly and efficiently kill the insect host. Hence, Xenorhabdus strains would have widely divergent host exploitation strategies, which impact their genome structure. PMID:26769959

  13. Survival of added bacterial species and metabolism of toxic compounds in natural environments

    SciTech Connect

    King, V.M.

    1987-01-01

    Bacteria able to degrade either 2,4-dichlorophenol (DCP) or phenanthrene (PHEN) were isolated from polluted freshwater environments. Two isolates able to degrade each compound were tested for mineralization with a sensitive /sup 14/C assay and for survival in lake water and sewage using a selective medium. One DCP isolate was identified as Alcaligenes paradoxus and the other as Alcaligenes sp. One PHEN isolate was identified as Pseudomonas fluorescens and the other as Pseudomonas sp. All four isolates survived and grew in sterile environments which indicated that starvation would not be a factor in survival of these strains. The number of organisms declined immediately in number in nonsterile lake water. However, they did survive or even grow in nonsterile sewage for a short period before declining in number. Biotic factors appeared to be influential for survival and mineralization of target compounds in many environments. The removal of protozoa, which prey on bacteria, improved survival of the added cells, but had no influence on the mineralization of 10 ..mu..g DCP/L. In comparison, degradation of 10 and 25 mg DCP/L stopped after a few days. Yeast nitrogen base appeared to overcome the lack of nutrient regeneration, a function attributed to protozoa. The additional nutrients increased toxicant mineralization, especially when seeded with appropriate species. Thus, protozoa may limit growth of added cells but appear to be needed for mineralization of higher concentrations of DCP.

  14. Attenuated Virulence and Genomic Reductive Evolution in the Entomopathogenic Bacterial Symbiont Species, Xenorhabdus poinarii

    PubMed Central

    Ogier, Jean-Claude; Pagès, Sylvie; Bisch, Gaëlle; Chiapello, Hélène; Médigue, Claudine; Rouy, Zoé; Teyssier, Corinne; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2014-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Unlike other Xenorhabdus species, Xenorhabdus poinarii is avirulent when injected into insects in the absence of its nematode host. We sequenced the genome of the X. poinarii strain G6 and the closely related but virulent X. doucetiae strain FRM16. G6 had a smaller genome (500–700 kb smaller) than virulent Xenorhabdus strains and lacked genes encoding potential virulence factors (hemolysins, type 5 secretion systems, enzymes involved in the synthesis of secondary metabolites, and toxin–antitoxin systems). The genomes of all the X. poinarii strains analyzed here had a similar small size. We did not observe the accumulation of pseudogenes, insertion sequences or decrease in coding density usually seen as a sign of genomic erosion driven by genetic drift in host-adapted bacteria. Instead, genome reduction of X. poinarii seems to have been mediated by the excision of genomic blocks from the flexible genome, as reported for the genomes of attenuated free pathogenic bacteria and some facultative mutualistic bacteria growing exclusively within hosts. This evolutionary pathway probably reflects the adaptation of X. poinarii to specific host. PMID:24904010

  15. Comparative Genomics between Two Xenorhabdus bovienii Strains Highlights Differential Evolutionary Scenarios within an Entomopathogenic Bacterial Species.

    PubMed

    Bisch, Gaëlle; Ogier, Jean-Claude; Médigue, Claudine; Rouy, Zoé; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2016-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Within Xenorhabdus bovienii species, the X. bovienii CS03 strain (Xb CS03) is nonvirulent when directly injected into lepidopteran insects, and displays a low virulence when associated with its Steinernema symbiont. The genome of Xb CS03 was sequenced and compared with the genome of a virulent strain, X. bovienii SS-2004 (Xb SS-2004). The genome size and content widely differed between the two strains. Indeed, Xb CS03 had a large genome containing several specific loci involved in the inhibition of competitors, including a few NRPS-PKS loci (nonribosomal peptide synthetases and polyketide synthases) producing antimicrobial molecules. Consistently, Xb CS03 had a greater antimicrobial activity than Xb SS-2004. The Xb CS03 strain contained more pseudogenes than Xb SS-2004. Decay of genes involved in the host invasion and exploitation (toxins, invasins, or extracellular enzymes) was particularly important in Xb CS03. This may provide an explanation for the nonvirulence of the strain when injected into an insect host. We suggest that Xb CS03 and Xb SS-2004 followed divergent evolutionary scenarios to cope with their peculiar life cycle. The fitness strategy of Xb CS03 would involve competitor inhibition, whereas Xb SS-2004 would quickly and efficiently kill the insect host. Hence, Xenorhabdus strains would have widely divergent host exploitation strategies, which impact their genome structure. PMID:26769959

  16. Stochastic pumping of ions based on colored noise in bacterial channels under acidic stress.

    PubMed

    López, M Lidón; Queralt-Martín, María; Alcaraz, Antonio

    2016-07-21

    Fluctuation-driven ion transport can be obtained in bacterial channels with the aid of different types of colored noise including the biologically relevant Lorentzian one. Using the electrochemical rectification of the channel current as a ratchet mechanism we observe transport of ions up to their concentration gradient under conditions similar to that met in vivo, namely moderate pH gradients and asymmetrically charged lipid membranes. We find that depending on the direction of the concentration gradient the channel can pump either cations or anions from the diluted side to the concentrated one. We discuss the possible relevance of this phenomenon for the pH homeostasis of bacterial cells. PMID:27349445

  17. Response of key soil parameters during compost-assisted phytostabilization in extremely acidic tailings: effect of plant species.

    PubMed

    Solís-Dominguez, Fernando A; White, Scott A; Hutter, Travis Borrillo; Amistadi, Mary Kay; Root, Robert A; Chorover, Jon; Maier, Raina M

    2012-01-17

    Phytostabilization of mine tailings acts to mitigate both eolian dispersion and water erosion events which can disseminate barren tailings over large distances. This technology uses plants to establish a vegetative cover to permanently immobilize contaminants in the rooting zone, often requiring addition of an amendment to assist plant growth. Here we report the results of a greenhouse study that evaluated the ability of six native plant species to grow in extremely acidic (pH ∼ 2.5) metalliferous (As, Pb, Zn: 2000-3000 mg kg(-1)) mine tailings from Iron King Mine Humboldt Smelter Superfund site when amended with a range of compost concentrations. Results revealed that three of the six plant species tested (buffalo grass, mesquite, and catclaw acacia) are good candidates for phytostabilization at an optimum level of 15% compost (w/w) amendment showing good growth and minimal shoot accumulation of metal(loid)s. A fourth candidate, quailbush, also met all criteria except for exceeding the domestic animal toxicity limit for shoot accumulation of zinc. A key finding of this study was that the plant species that grew most successfully on these tailings significantly influenced key tailings parameters; direct correlations between plant biomass and both increased tailings pH and neutrophilic heterotrophic bacterial counts were observed. We also observed decreased iron oxidizer counts and decreased bioavailability of metal(loid)s mainly as a result of compost amendment. Taken together, these results suggest that the phytostabilization process reduced tailings toxicity as well as the potential for metal(loid) mobilization. This study provides practical information on plant and tailings characteristics that is critically needed for successful implementation of assisted phytostabilization on acidic, metalliferous mine tailings sites. PMID:22191663

  18. Response of Key Soil Parameters During Compost-Assisted Phytostabilization in Extremely Acidic Tailings: Effect of Plant Species

    PubMed Central

    Solís-Dominguez, Fernando A.; White, Scott A.; Hutter, Travis Borrillo; Amistadi, Mary Kay; Root, Robert A.; Chorover, Jon; Maier, Raina M.

    2012-01-01

    Phytostabilization of mine tailings acts to mitigate both eolian dispersion and water erosion events which can disseminate barren tailings over large distances. This technology uses plants to establish a vegetative cover to permanently immobilize contaminants in the rooting zone, often requiring addition of an amendment to assist plant growth. Here we report the results of a greenhouse study that evaluated the ability of six native plant species to grow in extremely acidic (pH ~ 2.5) metalliferous (As, Pb, Zn: 2000–3000 mg kg−1) mine tailings from Iron King Mine Humboldt Smelter Superfund site when amended with a range of compost concentrations. Results revealed that three of the six plant species tested (buffalo grass, mesquite, and catclaw acacia) are good candidates for phytostabilization at an optimum level of 15% compost (w/w) amendment showing good growth and minimal shoot accumulation of metal(loid)s. A fourth candidate, quailbush, also met all criteria except for exceeding the domestic animal toxicity limit for shoot accumulation of zinc. A key finding of this study was that the plant species that grew most successfully on these tailings significantly influenced key tailings parameters; direct correlations between plant biomass and both increased tailings pH and neutrophilic heterotrophic bacterial counts were observed. We also observed decreased iron oxidizer counts and decreased bioavailability of metal(loid)s mainly as a result of compost amendment. Taken together, these results suggest that the phytostabilization process reduced tailings toxicity as well as the potential for metal(loid) mobilization. This study provides practical information on plant and tailings characteristics that is critically needed for successful implementation of assisted phytostabilization on acidic, metalliferous mine tailings sites. PMID:22191663

  19. Synthesis of new chalcone derivatives bearing 2,4-thiazolidinedione and benzoic acid moieties as potential anti-bacterial agents.

    PubMed

    Liu, Xiao-Fang; Zheng, Chang-Ji; Sun, Liang-Peng; Liu, Xue-Kun; Piao, Hu-Ri

    2011-08-01

    A series of chalcone derivatives bearing the 2,4-thiazolidinedione and benzoic acid moieties (8a-s) were synthesized, characterized, and evaluated for their anti-bacterial activity. Among the tested compounds, the most effective were 8a, 8h, 8k, 8n and 8q with MIC value in the range of 0.5-4 μg/mL against six Gram-positive bacteria (including multidrug-resistant clinical isolates). None of the compounds exhibited any activity against the Gram-negative bacteria Escherichia coli 1356 and E. coli 1682 at 64 μg/mL. PMID:21624712

  20. Stochastic pumping of ions based on colored noise in bacterial channels under acidic stress

    NASA Astrophysics Data System (ADS)

    López, M. Lidón; Queralt-Martín, María; Alcaraz, Antonio

    2016-07-01

    Fluctuation-driven ion transport can be obtained in bacterial channels with the aid of different types of colored noise including the biologically relevant Lorentzian one. Using the electrochemical rectification of the channel current as a ratchet mechanism we observe transport of ions up to their concentration gradient under conditions similar to that met in vivo, namely moderate pH gradients and asymmetrically charged lipid membranes. We find that depending on the direction of the concentration gradient the channel can pump either cations or anions from the diluted side to the concentrated one. We discuss the possible relevance of this phenomenon for the pH homeostasis of bacterial cells.Fluctuation-driven ion transport can be obtained in bacterial channels with the aid of different types of colored noise including the biologically relevant Lorentzian one. Using the electrochemical rectification of the channel current as a ratchet mechanism we observe transport of ions up to their concentration gradient under conditions similar to that met in vivo, namely moderate pH gradients and asymmetrically charged lipid membranes. We find that depending on the direction of the concentration gradient the channel can pump either cations or anions from the diluted side to the concentrated one. We discuss the possible relevance of this phenomenon for the pH homeostasis of bacterial cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02638a

  1. Amino acid sequence alignment of bacterial and mammalian pancreatic serine proteases based on topological equivalences.

    PubMed

    James, M N; Delbaere, L T; Brayer, G D

    1978-06-01

    The three-dimensional structures of the bacterial serine proteases SGPA, SGPB, and alpha-lytic protease have been compared with those of the pancreatic enzymes alpha-chymotrypsin and elastase. This comparison shows that approximately 60% (55-64%) of the alpha-carbon atom positions of the bacterial serine proteases are topologically equivalent to the alpha-carbon atom positions of the pancreatic enzymes. The corresponding value for a comparison of the bacterial enzymes among themselves is approximately 84%. The results of these topological comparisons have been used to deduce an experimentally sound sequence alignment for these several enzymes. This alignment shows that there is extensive tertiary structural homology among the bacteria and pancreatic enzymes without significant primary sequence identity (less than 21%). The acquisition of a zymogen function by the pancreatic enzymes is accompanied by two major changes to the bacterial enzymes' architecture: an insertion of 9 residues to increase the length of the N-terminal loop, and one of 12 residues to a loop near the activation salt bridge. In addition, in these two enzyme families, the methionine loop (residues 164-182) adopts very different comformations which are associated with their altered substrate specificities. PMID:96920

  2. Effects of acid precipitation on reproduction in alpine plant species. [Erythronium grandiflorum; Aquilegia caerulea

    SciTech Connect

    McKenna, M.A.; Hille-Salgueiro, M.; Musselman, R.C. Dept. of Agriculture, Fort Collins, CO )

    1990-01-01

    A series of experiments were designed to determine the impact of acid rain on plant reproductive processes, a critical component of a species life history. Research was carried out in herbaceous alpine communities at the USDA (United States Department of Agriculture) Forest Service Glacier Lakes Ecosystem Experiments Site in the Snowy Mts. of Wyoming. A range of species were surveyed to monitor the sensitivity of pollen to acidification during germination and growth, and all species demonstrated reduced in vitro pollen germination in acidified media. Field pollinations were carried out in Erythronium grandiflorum and Aquilegia caerulea to determine the reproductive success of plants exposed to simulated ambient precipitation (pH 5.6) or simulated acid precipitation (pH 3.6) prior to pollination. In Erythronium, no differences were observed in seed set and seed weight of fruits resulting from the two pollination treatments. In Aquilegia, fruits resulting from the acid spray treatment produced fewer seeds and lighter seeds.

  3. Voice Prosthetic Biofilm Formation and Candida Morphogenic Conversions in Absence and Presence of Different Bacterial Strains and Species on Silicone-Rubber

    PubMed Central

    van der Mei, Henny C.; Buijssen, Kevin J. D. A.; van der Laan, Bernard F. A. M.; Ovchinnikova, Ekatarina; Geertsema-Doornbusch, Gésinda I.; Atema-Smit, Jelly; van de Belt-Gritter, Betsy; Busscher, Henk J.

    2014-01-01

    Morphogenic conversion of Candida from a yeast to hyphal morphology plays a pivotal role in the pathogenicity of Candida species. Both Candida albicans and Candida tropicalis, in combination with a variety of different bacterial strains and species, appear in biofilms on silicone-rubber voice prostheses used in laryngectomized patients. Here we study biofilm formation on silicone-rubber by C. albicans or C. tropicalis in combination with different commensal bacterial strains and lactobacillus strains. In addition, hyphal formation in C. albicans and C. tropicalis, as stimulated by Rothia dentocariosa and lactobacilli was evaluated, as clinical studies outlined that these bacterial strains have opposite results on the clinical life-time of silicone-rubber voice prostheses. Biofilms were grown during eight days in a silicone-rubber tube, while passing the biofilms through episodes of nutritional feast and famine. Biofilms consisting of combinations of C. albicans and a bacterial strain comprised significantly less viable organisms than combinations comprising C. tropicalis. High percentages of Candida were found in biofilms grown in combination with lactobacilli. Interestingly, L. casei, with demonstrated favorable effects on the clinical life-time of voice prostheses, reduced the percentage hyphal formation in Candida biofilms as compared with Candida biofilms grown in absence of bacteria or grown in combination with R. dentocariosa, a bacterial strain whose presence is associated with short clinical life-times of voice prostheses. PMID:25111806

  4. Possible evidence of amide bond formation between sinapinic acid and lysine-containing bacterial proteins by matrix-assisted laser desorption/ionization (MALDI) at 355 nm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We previously reported the apparent formation of matrix adducts of 3,5-dimethoxy-4-hydroxy-cinnamic acid (sinapinic acid or SA) via covalent attachment to disulfide bond-containing proteins (HdeA, HdeB and YbgS) from bacterial cell lysates ionized by matrix-assisted laser desorption/ionization (MALD...

  5. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome

    PubMed Central

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns

    2016-01-01

    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of ribosome splitting and the stoichiometry of GTP hydrolysis by EF-G at varying concentrations of FA, EF-G and RRF. These mean times together with previous data on uninhibited ribosome recycling were used to clarify the mechanism of FA inhibition of ribosome splitting. The biochemical data on FA inhibition of translocation and recycling were used to model the growth inhibitory effect of FA on bacterial populations. We conclude that FA inhibition of translocation provides the dominant cause of bacterial growth reduction, but that FA inhibition of ribosome recycling may contribute significantly to FA-induced expression of short regulatory open reading frames, like those involved in FA resistance. PMID:27001509

  6. Characterization of Fe(II) oxidizing bacterial activities and communities at two acidic Appalachian coalmine drainage-impacted sites

    SciTech Connect

    Senko, John M.; Wanjugi, Pauline; Lucas, Melanie; Bruns, Mary Ann; Burgos, William D.

    2008-06-12

    We characterized the microbiologically mediated oxidative precipitation of Fe(II) from coalminederived acidic mine drainage (AMD) along flow-paths at two sites in northern Pennsylvania. At the Gum Boot site, dissolved Fe(II) was efficiently removed from AMD whereas minimal Fe(II) removal occurred at the Fridays-2 site. Neither site received human intervention to treat the AMD. Culturable Fe(II) oxidizing bacteria were most abundant at sampling locations along the AMD flow path corresponding to greatest Fe(II) removal and where overlying water contained abundant dissolved O2. Rates of Fe(II) oxidation determined in laboratory-based sediment incubations were also greatest at these sampling locations. Ribosomal RNA intergenic spacer analysis and sequencing of partial 16S rRNA genes recovered from sediment bacterial communities revealed similarities among populations at points receiving regular inputs of Fe(II)-rich AMD and provided evidence for the presence of bacterial lineages capable of Fe(II) oxidation. A notable difference between bacterial communities at the two sites was the abundance of Chloroflexi-affiliated 16S rRNA gene sequences in clone libraries derived from the Gum Boot sediments. Our results suggest that inexpensive and reliable AMD treatment strategies can be implemented by mimicking the conditions present at the Gum Boot field site.

  7. Introduction of a bacterial acetyl-CoA synthesis pathway improves lactic acid production in Saccharomyces cerevisiae.

    PubMed

    Song, Ji-Yoon; Park, Joon-Song; Kang, Chang Duk; Cho, Hwa-Young; Yang, Dongsik; Lee, Seunghyun; Cho, Kwang Myung

    2016-05-01

    Acid-tolerant Saccharomyces cerevisiae was engineered to produce lactic acid by expressing heterologous lactate dehydrogenase (LDH) genes, while attenuating several key pathway genes, including glycerol-3-phosphate dehydrogenase1 (GPD1) and cytochrome-c oxidoreductase2 (CYB2). In order to increase the yield of lactic acid further, the ethanol production pathway was attenuated by disrupting the pyruvate decarboxylase1 (PDC1) and alcohol dehydrogenase1 (ADH1) genes. Despite an increase in lactic acid yield, severe reduction of the growth rate and glucose consumption rate owing to the absence of ADH1 caused a considerable decrease in the overall productivity. In Δadh1 cells, the levels of acetyl-CoA, a key precursor for biologically applicable components, could be insufficient for normal cell growth. To increase the cellular supply of acetyl-CoA, we introduced bacterial acetylating acetaldehyde dehydrogenase (A-ALD) enzyme (EC 1.2.1.10) genes into the lactic acid-producing S. cerevisiae. Escherichia coli-derived A-ALD genes, mhpF and eutE, were expressed and effectively complemented the attenuated acetaldehyde dehydrogenase (ALD)/acetyl-CoA synthetase (ACS) pathway in the yeast. The engineered strain, possessing a heterologous acetyl-CoA synthetic pathway, showed an increased glucose consumption rate and higher productivity of lactic acid fermentation. The production of lactic acid was reached at 142g/L with production yield of 0.89g/g and productivity of 3.55gL(-1)h(-1) under fed-batch fermentation in bioreactor. This study demonstrates a novel approach that improves productivity of lactic acid by metabolic engineering of the acetyl-CoA biosynthetic pathway in yeast. PMID:26384570

  8. Properties and substrate specificities of the phenylalanyl-transfer-ribonucleic acid synthetases of Aesculus species

    PubMed Central

    Anderson, J. W.; Fowden, L.

    1970-01-01

    1. Phenylalanyl-tRNA synthetases have been partially purified from cotyledons of seeds of Aesculus californica, which contains 2-amino-4-methylhex-4-enoic acid, and from four other species of Aesculus that do not contain this amino acid. The A. californica preparation was free from other aminoacyl-tRNA synthetases, and the contaminating synthetase activity in preparations from A. hippocastanum was decreased to acceptable limits by conducting assays of pyrophosphate exchange activity in 0.5m-potassium chloride. 2. The phenylalanyl-tRNA synthetase from each species activated 2-amino-4-methylhex-4-enoic acid with Km 30–40 times that for phenylalanine. The maximum velocity for 2-amino-4-methylhex-4-enoic acid was only 30% of that for phenylalanine with the A. californica enzyme, but the maximum velocities for the two substrates were identical for the other four species. 3. 2-Amino-4-methylhex-4-enoic acid was not found in the protein of A. californica, so discrimination against this amino acid probably occurs in the step of transfer to tRNA, though subcellular localization, or subsequent steps of protein synthesis could be involved. 4. Crotylglycine, methallylglycine, ethallylglycine, 2-aminohex-4,5-dienoic acid, 2-amino-5-methylhex-4-enoic acid, 2-amino-4-methylhex-4-enoic acid, β-(thien-2-yl)alanine, β-(pyrazol-1-yl)alanine, phenylserine and m-fluorophenylalanine were substrates for pyrophosphate exchange catalysed by the phenylalanyl-tRNA synthetases of A. californica or A. hippocastanum. Allylglycine, phenylglycine and 2-amino-4-phenylbutyric acid were inactive. PMID:5493504

  9. The cockroach Blattella germanica obtains nitrogen from uric acid through a metabolic pathway shared with its bacterial endosymbiont.

    PubMed

    Patiño-Navarrete, Rafael; Piulachs, Maria-Dolors; Belles, Xavier; Moya, Andrés; Latorre, Amparo; Peretó, Juli

    2014-07-01

    Uric acid stored in the fat body of cockroaches is a nitrogen reservoir mobilized in times of scarcity. The discovery of urease in Blattabacterium cuenoti, the primary endosymbiont of cockroaches, suggests that the endosymbiont may participate in cockroach nitrogen economy. However, bacterial urease may only be one piece in the entire nitrogen recycling process from insect uric acid. Thus, in addition to the uricolytic pathway to urea, there must be glutamine synthetase assimilating the released ammonia by the urease reaction to enable the stored nitrogen to be metabolically usable. None of the Blattabacterium genomes sequenced to date possess genes encoding for those enzymes. To test the host's contribution to the process, we have sequenced and analysed Blattella germanica transcriptomes from the fat body. We identified transcripts corresponding to all genes necessary for the synthesis of uric acid and its catabolism to urea, as well as for the synthesis of glutamine, asparagine, proline and glycine, i.e. the amino acids required by the endosymbiont. We also explored the changes in gene expression with different dietary protein levels. It appears that the ability to use uric acid as a nitrogen reservoir emerged in cockroaches after its age-old symbiotic association with bacteria. PMID:25079497

  10. Population genetics and phylogenetic inference in bacterial molecular systematics: the roles of migration and recombination in Bradyrhizobium species cohesion and delineation.

    PubMed

    Vinuesa, Pablo; Silva, Claudia; Werner, Dietrich; Martínez-Romero, Esperanza

    2005-01-01

    A combination of population genetics and phylogenetic inference methods was used to delineate Bradyrhizobium species and to uncover the evolutionary forces acting at the population-species interface of this bacterial genus. Maximum-likelihood gene trees for atpD, glnII, recA, and nifH loci were estimated for diverse strains from all but one of the named Bradyrhizobium species, and three unnamed "genospecies," including photosynthetic isolates. Topological congruence and split decomposition analyses of the three housekeeping loci are consistent with a model of frequent homologous recombination within but not across lineages, whereas strong evidence was found for the consistent lateral gene transfer across lineages of the symbiotic (auxiliary) nifH locus, which grouped strains according to their hosts and not by their species assignation. A well resolved Bayesian species phylogeny was estimated from partially congruent glnII+recA sequences, which is highly consistent with the actual taxonomic scheme of the genus. Population-level analyses of isolates from endemic Canarian genistoid legumes based on REP-PCR genomic fingerprints, allozyme and DNA polymorphism analyses revealed a non-clonal and slightly epidemic population structure for B. canariense isolates of Canarian and Moroccan origin, uncovered recombination and migration as significant evolutionary forces providing the species with internal cohesiveness, and demonstrated its significant genetic differentiation from B. japonicum, its sister species, despite their sympatry and partially overlapped ecological niches. This finding provides strong evidence for the existence of well delineated species in the bacterial world. The results and approaches used herein are discussed in the context of bacterial species concepts and the evolutionary ecology of (brady)rhizobia. PMID:15579380

  11. Bacterial Profiling Reveals Novel “Ca. Neoehrlichia”, Ehrlichia, and Anaplasma Species in Australian Human-Biting Ticks

    PubMed Central

    Gofton, Alexander W.; Doggett, Stephen; Ratchford, Andrew; Oskam, Charlotte L.; Paparini, Andrea; Ryan, Una; Irwin, Peter

    2015-01-01

    In Australia, a conclusive aetiology of Lyme disease-like illness in human patients remains elusive, despite growing numbers of people presenting with symptoms attributed to tick bites. In the present study, we surveyed the microbial communities harboured by human-biting ticks from across Australia to identify bacteria that may contribute to this syndrome. Universal PCR primers were used to amplify the V1-2 hyper-variable region of bacterial 16S rRNA genes in DNA samples from individual Ixodes holocyclus (n = 279), Amblyomma triguttatum (n = 167), Haemaphysalis bancrofti (n = 7), and H. longicornis (n = 7) ticks. The 16S amplicons were sequenced on the Illumina MiSeq platform and analysed in USEARCH, QIIME, and BLAST to assign genus and species-level taxonomies. Nested PCR and Sanger sequencing were used to confirm the NGS data and further analyse novel findings. All 460 ticks were negative for Borrelia spp. by both NGS and nested PCR analysis. Two novel “Candidatus Neoehrlichia” spp. were identified in 12.9% of I. holocyclus ticks. A novel Anaplasma sp. was identified in 1.8% of A. triguttatum ticks, and a novel Ehrlichia sp. was identified in both A. triguttatum (1.2%) ticks and a single I. holocyclus (0.6%) tick. Further phylogenetic analysis of novel “Ca. Neoehrlichia”, Anaplasma and Ehrlichia based on 1,265 bp 16S rRNA gene sequences suggests that these are new species. Determining whether these newly discovered organisms cause disease in humans and animals, like closely related bacteria do abroad, is of public health importance and requires further investigation. PMID:26709826

  12. Antimicrobial activity of plant essential oils against bacterial and fungal species involved in food poisoning and/or food decay.

    PubMed

    Lixandru, Brînduşa-Elena; Drăcea, Nicoleta Olguţa; Dragomirescu, Cristiana Cerasella; Drăgulescu, Elena Carmina; Coldea, Ileana Luminiţa; Anton, Liliana; Dobre, Elena; Rovinaru, Camelia; Codiţă, Irina

    2010-01-01

    The currative properties of aromatic and medicinal plants have been recognized since ancient times and, more recently, the antimicrobial activity of plant essential oils has been used in several applications, including food preservation. The purpose of this study was to create directly comparable, quantitative data on the antimicrobial activity of some plant essential oils prepared in the National Institute of Research-Development for Chemistry and Petrochemistry, Bucharest to be used for the further development of food packaging technology, based on their antibacterial and antifungal activity. The essential oils extracted from thyme (Thymus vulgaris L.), basil (Ocimum basilicum L.), coriander (Coriandrum sativum L.), rosemary (Rosmarinus officinalis L.), sage (Salvia officinalis L.), fennel (Foeniculum vulgare L.), spearmint (Mentha spicata L.) and carraway (Carum carvi L.) were investigated for their antimicrobial activity against eleven different bacterial and three fungal strains belonging to species reported to be involved in food poisoning and/or food decay: S. aureus ATCC 25923, S. aureus ATCC 6538, S. aureus ATCC 25913, E. coli ATCC 25922, E. coli ATCC 35218, Salmonella enterica serovar Enteritidis Cantacuzino Institute Culture Collection (CICC) 10878, Listeria monocytogenes ATCC 19112, Bacillus cereus CIP 5127, Bacillus cereus ATCC 11778, Candida albicans ATCC 10231, Aspergillus niger ATCC 16404, Penicillium spp. CICC 251 and two E. coli and Salmonella enterica serovar Enteritidis clinical isolates. The majority of the tested essential oils exibited considerable inhibitory capacity against all the organisms tested, as supported by growth inhibition zone diameters, MICs and MBC's. Thyme, coriander and basil oils proved the best antibacterial activity, while thyme and spearmint oils better inhibited the fungal species. PMID:21462837

  13. Docosahexaenoic Acid, Inflammation, and Bacterial Dysbiosis in Relation to Periodontal Disease, Inflammatory Bowel Disease, and the Metabolic Syndrome

    PubMed Central

    Tabbaa, Maria; Golubic, Mladen; Roizen, Michael F.; Bernstein, Adam M.

    2013-01-01

    Docosahexaenoic acid (DHA), a long-chain omega-3 polyunsaturated fatty acid, has been used to treat a range of different conditions, including periodontal disease (PD) and inflammatory bowel disease (IBD). That DHA helps with these oral and gastrointestinal diseases in which inflammation and bacterial dysbiosis play key roles, raises the question of whether DHA may assist in the prevention or treatment of other inflammatory conditions, such as the metabolic syndrome, which have also been linked with inflammation and alterations in normal host microbial populations. Here we review established and investigated associations between DHA, PD, and IBD. We conclude that by beneficially altering cytokine production and macrophage recruitment, the composition of intestinal microbiota and intestinal integrity, lipopolysaccharide- and adipose-induced inflammation, and insulin signaling, DHA may be a key tool in the prevention of metabolic syndrome. PMID:23966110

  14. Foxp3(+) T cells regulate immunoglobulin a selection and facilitate diversification of bacterial species responsible for immune homeostasis.

    PubMed

    Kawamoto, Shimpei; Maruya, Mikako; Kato, Lucia M; Suda, Wataru; Atarashi, Koji; Doi, Yasuko; Tsutsui, Yumi; Qin, Hongyan; Honda, Kenya; Okada, Takaharu; Hattori, Masahira; Fagarasan, Sidonia

    2014-07-17

    Foxp3(+) T cells play a critical role for the maintenance of immune tolerance. Here we show that in mice, Foxp3(+) T cells contributed to diversification of gut microbiota, particularly of species belonging to Firmicutes. The control of indigenous bacteria by Foxp3(+) T cells involved regulatory functions both outside and inside germinal centers (GCs), consisting of suppression of inflammation and regulation of immunoglobulin A (IgA) selection in Peyer's patches, respectively. Diversified and selected IgAs contributed to maintenance of diversified and balanced microbiota, which in turn facilitated the expansion of Foxp3(+) T cells, induction of GCs, and IgA responses in the gut through a symbiotic regulatory loop. Thus, the adaptive immune system, through cellular and molecular components that are required for immune tolerance and through the diversification as well as selection of antibody repertoire, mediates host-microbial symbiosis by controlling the richness and balance of bacterial communities required for homeostasis. PMID:25017466

  15. Self-assembled poly(ethylene glycol)-co-acrylic acid microgels to inhibit bacterial colonization of synthetic surfaces.

    PubMed

    Wang, Qichen; Uzunoglu, Emel; Wu, Yong; Libera, Matthew

    2012-05-01

    We explored the use of self-assembled microgels to inhibit the bacterial colonization of synthetic surfaces both by modulating surface cell adhesiveness at length scales comparable to bacterial dimensions (∼1 μm) and by locally storing/releasing an antimicrobial. Poly(ethylene glycol) [PEG] and poly(ethylene glycol)-co-acrylic acid [PEG-AA] microgels were synthesized by suspension photopolymerization. Consistent with macroscopic gels, a pH dependence of both zeta potential and hydrodynamic diameter was observed in AA-containing microgels but not in pure PEG microgels. The microgels were electrostatically deposited onto poly(l-lysine) (PLL) primed silicon to form submonolayer surface coatings. The microgel surface density could be controlled via the deposition time and the microgel concentration in the parent suspension. In addition to their intrinsic antifouling properties, after deposition, the microgels could be loaded with a cationic antimicrobial peptide (L5) because of favorable electrostatic interactions. Loading was significantly higher in PEG-AA microgels than in pure PEG microgels. The modification of PLL-primed Si by unloaded PEG-AA microgels reduced the short-term (6 h) S. epidermidis surface colonization by a factor of 2, and the degree of inhibition increased when the average spacing between microgels was reduced. Postdeposition L5 peptide loading into microgels further reduced bacterial colonization to the extent that, after 10 h of S. epidermidis culture in tryptic soy broth, the colonization of L5-loaded PEG-AA microgel-modified Si was comparable to the very small level of colonization observed on macroscopic PEG gel controls. The fact that these microgels can be deposited by a nonline-of-sight self-assembly process and hinder bacterial colonization opens the possibility of modifying the surfaces of topographically complex biomedical devices and reduces the rate of biomaterial-associated infection. PMID:22519439

  16. Effect of 2-hydroxy-4-methylthio-butanoic acid on ruminal fermentation, bacterial distribution, digestibility, and performance of lactating dairy cows.

    PubMed

    Lee, C; Oh, J; Hristov, A N; Harvatine, K; Vazquez-Anon, M; Zanton, G I

    2015-02-01

    The objective of this experiment was to test the effect of a Met analog, 2-hydroxy-4-methylthio-butanoic acid (HMTBa), on ruminal fermentation and microbial protein synthesis, nutrient digestibility, urinary N losses, and performance of dairy cows. Eight multiparous lactating Holstein dairy cows were assigned to 4 levels of HMTBa [0 (control), 0.05, 0.10, and 0.15% (dry matter basis)] in a replicated 4×4 Latin square trial. Experimental periods were 28 d, including 21 d for adaptation. Ruminal ammonia and microbial N were labeled through a 6-d intraruminal infusion of (15)NH4Cl, and microbial protein synthesis in the rumen was estimated using the reticular sampling technique. Treatment had no effect on dry matter intake (28.4 to 29.8kg/d), milk yield (44.1 to 45.3kg/d), feed efficiency, and milk composition. Total-tract apparent digestibility of nutrients was generally not affected by treatment, except digestibility of crude protein and starch decreased quadratically with HMTBa supplementation. Fecal, but not urinary, and total excreta N losses were increased quadratically by HMTBa. Ruminal pH, ammonia concentration, protozoal counts, and the major volatile fatty acids were not affected by treatment. Microbial N outflow from the rumen was linearly increased by HMTBa. 2-Hydroxy-4-methylthio-butanoic acid linearly increased the proportion of Fecalibacterium and quadratically decreased the proportion of Eubacterium in ruminal contents. Of the individual bacterial species, HMTBa increased or tended to increase Prevotella loescheii and Prevotella oralis. 2-Hydroxy-4-methylthio-butanoic acid linearly increased the concentration (and yield) of 15:0 in milk fat. In the conditions of this crossover experiment, HMTBa had no effect on feed intake and performance of dairy cows, decreased dietary crude protein digestibility, and increased microbial N outflow from the rumen. PMID:25434334

  17. Response of citrus and other selected plant species to simulated HCL - acid rain

    NASA Technical Reports Server (NTRS)

    Knott, W. M.; Heagle, A. S.

    1980-01-01

    Mature valencia orange trees were sprayed with hydrochloric acid solutions (pH 7.8, 2.0, 1.0, and 0.5) in the field at the full bloom stage and at one month after fruit set. Potted valencia orange and dwarf citrus trees, four species of plants native to Merritt Island, and four agronomic species were exposed to various pH levels of simulated acid rain under controlled conditions. The acid rain was generated from dilutions of hydrochloric acid solutions or by passing water through an exhaust generated by burning solid rocket fuel. The plants were injured severely at pH levels below 1.0, but showed only slight injury at pH levels of 2.0 and above. Threshold injury levels were between 2.0 and 3.0 pH. The sensitivity of the different plant species to acid solutions was similar. Foliar injury symptoms were representative of acid rain including necrosis of young tissue, isolated necrotic spots or patches, and leaf abscission. Mature valencia orange trees sprayed with concentrations of 1.0 pH and 0.5 pH in the field had reduced fruit yields for two harvests after the treatment. All experimental trees were back to full productivity by the third harvest after treatment.

  18. Comparison of sterols and fatty acids in two species of Ganoderma

    PubMed Central

    2012-01-01

    Background Two species of Ganoderma, G. sinense and G. lucidum, are used as Lingzhi in China. Howerver, the content of triterpenoids and polysaccharides, main actives compounds, are significant different, though the extracts of both G. lucidum and G. sinense have antitumoral proliferation effect. It is suspected that other compounds contribute to their antitumoral activity. Sterols and fatty acids have obvious bioactivity. Therefore, determination and comparison of sterols and fatty acids is helpful to elucidate the active components of Lingzhi. Results Ergosterol, a specific component of fungal cell membrane, was rich in G. lucidum and G. sinense. But its content in G. lucidum (median content 705.0 μg·g-1, range 189.1-1453.3 μg·g-1, n = 19) was much higher than that in G. sinense (median content 80.1 μg·g-1, range 16.0-409.8 μg·g-1, n = 13). Hierarchical clustering analysis based on the content of ergosterol showed that 32 tested samples of Ganoderma were grouped into two main clusters, G. lucidum and G. sinense. Hierarchical clustering analysis based on the contents of ten fatty acids showed that two species of Ganoderma had no significant difference though two groups were also obtained. The similarity of two species of Ganoderma in fatty acids may be related to their antitumoral proliferation effect. Conclusions The content of ergosterol is much higher in G. lucidum than in G. sinense. Palmitic acid, linoleic acid, oleic acid, stearic acid are main fatty acids in Ganoderma and their content had no significant difference between G. lucidum and G. sinense, which may contribute to their antitumoral proliferation effect. PMID:22293530

  19. Growth and acid production of Candida species in human saliva supplemented with glucose.

    PubMed

    Samaranayake, L P; Hughes, A; Weetman, D A; MacFarlane, T W

    1986-05-01

    Growth characteristic and acid production of oral isolates of Candida albicans and Candida glabrata in glucose supplemented and glucose-free, pooled, human whole saliva were examined. Both Candida species exhibited sigmoidal growth curves in batch cultures of mixed saliva, supplemented with glucose. The growth of Candida in saliva was accompanied by a rapid decline in pH from 7.5 to 3.2 over 48 h and the major acidic components initiating and sustaining this pH drop were pyruvates and acetates. These acidic metabolites may play an important role in the pathogenesis of oral Candida infections. PMID:3091791

  20. Bacterial poly(hydroxyalkanoates) as a source of chiral hydroxyalkanoic acids.

    PubMed

    Ren, Qun; Grubelnik, Andreas; Hoerler, Mirjam; Ruth, Katinka; Hartmann, René; Felber, Helene; Zinn, Manfred

    2005-01-01

    Polyhydroxyalkanoates (PHA) are polyesters of various hydroxyalkanoates accumulated in numerous bacteria. All of the monomeric units of PHA are enantiomerically pure and in R-configuration. R-Hydroxyalkanoic acids can be widely used as chiral starting materials in fine chemical, pharmaceutical and medical industries. In this study, we established an efficient method for the production of chiral hydroxyalkanoic acid monomers from PHA. Pseudomonas putida cells containing PHA were resuspended in phosphate buffer at different pH. We observed that the optimal initial pH for intracellular PHA degradation and monomer release was at pH 8-11 with pH 11 as the best. At initial pH 11, PHA containing 3-hydroxyoctanoic acid and 3-hydroxyhexanoic acid was degraded with an efficiency of over 90% (w/w) in 9 h, and the yield of the corresponding monomers was also over 90%. Under the same conditions, unsaturated monomers were also effectively produced from PHA containing 3-hydroxy-6-heptenoic acid, 3-hydroxy-8-nonenoic acid, and 3-hydroxy-10-undecenoic acid. The monomers (e.g., 3-hydroxyoctanoic acid) were further isolated using solid phase extraction and purified on reversed phase semipreparative liquid chromatography. We confirmed that the purified 3-hydroxyoctanoic acid monomer has exclusively the R-configuration. PMID:16004474

  1. Identification of ellagic acid derivatives in methanolic extracts from Qualea species.

    PubMed

    Nasser, Ana L M; Carli, Camila B A; Rodrigues, Clenilson M; Maia, Danielle C G; Carlos, Iracilda Z; Eberlin, Marcos N; Hiruma-Lima, Clélia A; Vilegas, Wagner

    2008-01-01

    The methanolic extract from the barks of the medicinal plant Qualea parviflora (Vochysiaceae) was fractionated by column chromatography over silica gel followed by gel permeation over Sephadex LH-20 to give 3,3'-di-O-methylellagic acid-4-O-beta-D-glucopyranoside (1), 3-O-methylellagic acid-4'-O-alpha-L-rhamnopyranoside (2), 3,3',4-tri-O-methylellagic acid-4'-O-beta-D-glucopyranoside (3), and 3,3'-di-O-methylellagic acid (4), together with triterpenes and saponins. We also performed comparative analyses among this species and Q. grandiflora and Q. multiflora using high-pressure liquid chromatography. The biological assays showed that, when compared to the standard ellagic acid, compounds 1-4 are less cytotoxic but have a lower capacity of stimulating murine peritoneal macrophages to release nitric oxide and tumoural-alpha necrose factor. PMID:19227825

  2. Selective adsorption of benzoic acid species on patterned OH/Si(100) surface

    SciTech Connect

    Ihm, Kyuwook; Han, Jin Hee; Kim, Bongsoo; Chung, Sukmin; Hwang, Chan-Cuk; Kang, Tai-Hee; Kim, Ki-Jeong; Jung, Yu Jin; An, Ki-Seok

    2006-08-15

    It has recently been observed that benzoic acid strongly reacts with OH group on the silicon surface. Here, by defining the area in which OH group is adsorbed on the Si surface, the selective adsorption of benzoic acid species was attempted. The patterned OH/Si surface was prepared by irradiating the zeroth order beam from the bending magnet of the synchrotron facility through the gold mesh placed in front of the OH/Si sample. For discerning the selectively adsorbed molecule by x-ray photoelectron emission microscopy (X-PEEM) at N k edge, 4-nitrobenzoic acid was utilized instead of benzoic acid. Near edge x-ray absorption fine structure spectra at carbon and oxygen k edges were in good accord with the previous results obtained from the benzoic acid system. The X-PEEM images around N k edge clearly showed that the molecules adsorb only on the area in which OH groups remain.

  3. Evidence for the Involvement of Xenobiotic-responsive Nuclear Receptors in Transcriptional Effects Upon Perfluoroalkyl Acid Exposure in Diverse Species.

    EPA Science Inventory

    Humans and other species have detectable body burdens of a number of perfluorinated alkyl acids (PFAA) including perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS). In mouse and rat liver these compounds elicit transcriptional and phenotypic effects similar to pe...

  4. Evidence for the Involvement of Xenobiotic-response Nuclear Receptors in Transcriptional Effects Upon Perfluroroalkyl Acid Exposure in Diverse Species

    EPA Science Inventory

    Humans and ecological species have been found to have detectable body burdens of a number of perfluorinated alkyl acids (PFAA) including perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS). In mouse and rat liver these compounds elicit transcriptional and phenotyp...

  5. Acid mist and ozone effects on the leaf chemistry of two western conifer species

    NASA Technical Reports Server (NTRS)

    Westman, Walter E.; Temple, Patrick J.

    1989-01-01

    The effects of ozone and acid-mist exposures on the leaf chemistry of Jeffrey pine and giant sequoia seedlings grown in filtered-air greenhouses were investigated. Acid-mist treatments (pH 4.1, 3.4, 2.7, or 2.0) were administered for 3 h, and ozone exposures (0, 0.10, and 0.20 microliter/liter), which followed acid-mist treatments, for 4 h, each for three days a week for six to nine weeks. It was found that seedlings were more susceptible to acid-mist and acid mist/ozone combinations, than to ozone alone. Acid mist treatment resulted in higher levels of nitrogen and sulfur (both present in acid mist) as well as Na. Leaves of giant sequoia exhibited increased K and decreased Mn, while Jeffrey pine showed increases in Fe and Mn. In sequoia leaves, concentrations of Ca, Mg, and Ba decreased. Acid treatment also reduced chlorophyll b concentrations in both conifer species. Extensive changes induced by acid mist are consistent with earlier observations of changes in spectral reflectance of conifer seedlings observed after three weeks of fumigation.

  6. Vanadate inhibition of fungal phyA and bacterial appA2 histidine acid phosphatases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The fungal PhyA protein, which was first identified as an acid optimum phosphomonoesterase (EC 3.1.3.8), could also serve as a vanadate haloperoxidase (EC 1.11.1.10) provided the acid phosphatase activity is shutdown by vanadate. To understand how vanadate inhibits both phytate and pNPP degrading ac...

  7. In vitro pollen responses of two birch species to acidity and temperature

    SciTech Connect

    Hughes, R.N.; Cox, R.M.

    1993-10-01

    Paper birch (Betula papyrifera Marsh.) and mountain paper birch (Betula cordifolia Regel) near the Bay of Fundy coast frequently intercept acidic advection marine fogs. Chemical deposition by these fogs is thought to be a factor contributing to the observed foliar browning symptoms associated with a marked deterioration of these trees in the area. In vitro experiments were performed to test whether pollen germination in these two birch species would be affected by acidity at levels routinely found in the fog. The combined effect of temperature with acidity was also examined. Pollen germination in both species was inhibited below pH 5.6 (P < 0.0001) and the effect of incubation temperature was also significant (P < 0.01) in both species. There was no difference in in vitro pollen germination between species (P > 0.05) in response to acidity, based on combined data from 12 trees of each; the optimum germination temperature was 22{degrees}C for B. papyrifera and 21{degrees}C for B. cordifolia.

  8. TISSUE DISTRIBUTION OF ARSENIC SPECIES IN MICE CHRONICALLY EXPOSED TO METHYLARSONOUS ACID

    EPA Science Inventory

    The metabolism of inorganic arsenic (iAs) in humans yields toxic and carcinogenic methyl-As (MAs) and dimethyl-As (DMAs) intermediates. Methylarsonous acid (MAsIII) is the most acutely toxic species of characterized iAs metabolites. Here, we examined the concentrations of As spec...

  9. TISSUE DISTRIBUTION OF ARSENIC SPECIES IN MICE CHRONICALLY EXPOSED TO ARSENITE OR METHYLARSONOUS ACID

    EPA Science Inventory

    e metabolism of inorganic arsenic (iAs) in humans yields toxic and carcinogenic methyl-As (MAs) and dimethyl-As (DMAs) intermediates. Methylarsonous acid (MAsIII) is the most acutely toxic species among known iAs metabolites. In this study, we examined the concentrations of As sp...

  10. Salicylic Acid Improved In Viro Meristem Regeneration and Salt Tolerance in Two Hibiscus Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salicylic acid (SA) has been reported to induce abiotic stress, including salt tolerance in plants. The objective of this study was to determine whether application of various exogenous SA concentrations to in vitro grown meristem shoots could induce salt tolerance in two Hibiscus species. The effec...

  11. High contents of very long-chain polyunsaturated fatty acids in different moss species.

    PubMed

    Beike, Anna K; Jaeger, Carsten; Zink, Felix; Decker, Eva L; Reski, Ralf

    2014-02-01

    Polyunsaturated fatty acids (PUFAs) are important cellular compounds with manifold biological functions. Many PUFAs are essential for the human diet and beneficial for human health. In this study, we report on the high amounts of very long-chain (vl) PUFAs (≥C₂₀) such as arachidonic acid (AA) in seven moss species. These species were established in axenic in vitro culture, as a prerequisite for comparative metabolic studies under highly standardized laboratory conditions. In the model organism Physcomitrella patens, tissue-specific differences in the fatty acid compositions between the filamentous protonema and the leafy gametophores were observed. These metabolic differences correspond with differential gene expression of fatty acid desaturase (FADS)-encoding genes in both developmental stages, as determined via microarray analyses. Depending on the developmental stage and the species, AA amounts for 6-31 %, respectively, of the total fatty acids. Subcellular localization of the corresponding FADS revealed the endoplasmic reticulum as the cellular compartment for AA synthesis. Our results show that vlPUFAs are highly abundant metabolites in mosses. Standardized cultivation techniques using photobioreactors along with the availability of the P. patens genome sequence and the high rate of homologous recombination are the basis for targeted metabolic engineering in moss. The potential of producing vlPUFAs of interest from mosses will be highlighted as a promising area in plant biotechnology. PMID:24170342

  12. Preserving the distribution of inorganic arsenic species in groundwater and acid mine drainage samples.

    PubMed

    Bednar, A J; Garbarino, J R; Ranville, J F; Wildeman, T R

    2002-05-15

    The distribution of inorganic arsenic species must be preserved in the field to eliminate changes caused by metal oxyhydroxide precipitation, photochemical oxidation, and redox reactions. Arsenic species sorb to iron and manganese oxyhydroxide precipitates, and arsenite can be oxidized to arsenate by photolytically produced free radicals in many sample matrices. Several preservatives were evaluated to minimize metal oxyhydroxide precipitation, such as inorganic acids and ethylenediaminetetraacetic acid (EDTA). EDTA was found to work best for all sample matrices tested. Storing samples in opaque polyethylene bottles eliminated the effects of photochemical reactions. The preservation technique was tested on 71 groundwater and six acid mine drainage samples. Concentrations in groundwater samples reached 720 microg-As/L for arsenite and 1080 microg-As/L for arsenate, and acid mine drainage samples reached 13 000 microg-As/L for arsenite and 3700 microg-As/L for arsenate. The arsenic species distribution in the samples ranged from 0 to 90% arsenite. The stability of the preservation technique was established by comparing laboratory arsenic speciation results for samples preserved in the field to results for subsamples speciated onsite. Statistical analyses indicated that the difference between arsenite and arsenate concentrations for samples preserved with EDTA in opaque bottles and field speciation results were analytically insignificant. The percentage change in arsenite:arsenate ratios for a preserved acid mine drainage sample and groundwater sample during a 3-month period was -5 and +3%, respectively. PMID:12038832

  13. Biotransformation of volatile fatty acids by oleaginous and non-oleaginous yeast species.

    PubMed

    Kolouchová, Irena; Schreiberová, Olga; Sigler, Karel; Masák, Jan; Řezanka, Tomáš

    2015-11-01

    The possibility of utilizing volatile fatty acids (VFA)-containing waste substrates from biotechnological and industrial processes was investigated by cultivating both oleaginous (Candida sp., Rhodotorula glutinis, Trichosporon cutaneum, Yarrowia lipolytica) and non-oleaginous (Kluyveromyces polysporus, Saccharomyces cerevisiae, Torulaspora delbrueckii) yeast species on acetic acid, propionic acid and a combination of either acid with glucose as carbon and energy sources. Both oleaginous and non-oleaginous yeasts grew on VFA. Oleaginous yeasts accumulated lipids to 15-48% of dry cell weight, non-oleaginous yeasts also grew on VFA and showed comparable biomass yields but the lipid content was only 2-5%. Biomass and lipid yield increased in cultivations on VFA plus glucose. The lipid composition was comparable to plant-derived oils and therefore might be exploitable in biodiesel production; nearly all species, when cultured on propionate, showed a high content of the desirable odd-chain unsaturated FA, especially 17:1 acid. This study points at the wide array of possible applications of many yeasts, even non-oleaginous strains, for biovalorization of industrial wastes. Despite their low lipid content these species are useful because they can readily utilize VFA from waste products and, since they are not biologically hazardous, their biomass can be afterwards used, e.g. as livestock fodder. PMID:26323601

  14. Lipophosphoglycan and secreted acid phosphatase of Leishmania tropica share species-specific epitopes.

    PubMed

    Jaffe, C L; Perez, L; Schnur, L F

    1990-06-01

    Several species-specific monoclonal antibodies (T11, T13-T15) which only react with Leishmania tropica, recognize phosphorlated carbohydrate epitopes on lipophosphoglycan and the structurally related molecule, phosphoglycan, which is shed by promastigotes into spent culture medium. During immunoaffinity isolation of [32P]orthophosphate-labeled phosphoglycan on monoclonal antibody T15 conjugated to Sepharose 4B, a high-Mr component (approx. 200,000) was co-purified. The latter material is metabolically labeled with [35S]methionine and [3H]glucosamine. This glycoprotein was separated from phosphoglycan by chromatography on lentil lectin resin. The glycoprotein exhibited a L-tatrate-sensitive acid phosphatase activity, typical of secreted acid phosphatase (EC 3.1.3.2) from Leishmania. Monospecific antibodies to Leishmania donovani-secreted acid phosphatase selectively precipitated the L. tropica enzyme from immunoaffinity purified mixtures of the two antigens, and monoclonal antibodies to lipophosphoglycan precipitate the pure enzyme. Species-specific monoclonal antibodies to L. major lipophosphoglycan also recognized both L. tropica antigens. Treatment of the acid phosphatase with periodate or phosphodiesterase I abolished binding by the monoclonal antibodies to the pure enzyme. These results demonstrate that the two major secreted glycoconjugates of Leishmania tropica, the lipophosphoglycan and the acid phosphatase, share species-specific phosphorylated carbohydrate epitope(s). PMID:1697935

  15. Palladium nanoparticles synthesized by reducing species generated during a successive acidic/alkaline treatment of sucrose

    NASA Astrophysics Data System (ADS)

    Amornkitbamrung, Lunjakorn; Pienpinijtham, Prompong; Thammacharoen, Chuchaat; Ekgasit, Sanong

    2014-03-01

    Uniform spherical palladium nanoparticles with an average particle size of 4.3 ± 0.5 nm were successfully synthesized by reducing H2PdCl4 with intermediates in situ generated during a successive acidic/alkaline treatment of sucrose. A successive acidic/alkaline treatment plays an important role on converting the non-reducing sucrose into efficient reducing species containing aldehyde functionality. The Benedict's test corroborates the development and vanishing of the in situ generated reducing species upon prolonged degradation. An increase in alkalinity drastically improves the reduction efficiency. ATR FT-IR spectroscopy indicated spontaneous development of carboxylate after the alkaline treatment. Under the employed condition, small organic species with carbonyl groups (aldehyde, acid, and acid salt) were generated through the sucrose degradation before being oxidized to carbonate after an hour of the treatment. Sucrose was completely decomposed into carbonate after a 24-h successive acidic/alkaline treatment. The synthesized palladium nanoparticles express a good catalytic activity in the decolorization process of Congo red by sodium borohydride.

  16. The Bacterial Fermentation Product Butyrate Influences Epithelial Signaling via Reactive Oxygen Species-Mediated Changes in Cullin-1 Neddylation1

    PubMed Central

    Kumar, Amrita; Wu, Huixia; Collier-Hyams, Lauren S.; Kwon, Young-Man; Hanson, Jason M.; Neish, Andrew S.

    2010-01-01

    The human enteric flora plays a significant role in intestinal health and disease. Populations of enteric bacteria can inhibit the NF-κB pathway by blockade of IκB-α ubiquitination, a process catalyzed by the E3-SCFβ-TrCP ubiquitin ligase. The activity of this ubiquitin ligase is regulated via covalent modification of the Cullin-1 subunit by the ubiquitin-like protein NEDD8. We previously reported that interaction of viable commensal bacteria with mammalian intestinal epithelial cells resulted in a rapid and reversible generation of reactive oxygen species (ROS) that modulated neddylation of Cullin-1 and resulted in suppressive effects on the NF-κB pathway. Herein, we demonstrate that butyrate and other short chain fatty acids supplemented to model human intestinal epithelia in vitro and human tissue ex vivo results in loss of neddylated Cul-1 and show that physiological concentrations of butyrate modulate the ubiquitination and degradation of a target of the E3-SCFβ-TrCP ubiquitin ligase, the NF-κB inhibitor IκB-α. Mechanistically, we show that physiological concentrations of butyrate induces reactive oxygen species that transiently alters the intracellular redox balance and results in inactivation of the NEDD8-conjugating enzyme Ubc12 in a manner similar to effects mediated by viable bacteria. Because the normal flora produces significant amounts of butyrate and other short chain fatty acids, these data provide a functional link between a natural product of the intestinal normal flora and important epithelial inflammatory and proliferative signaling pathways. PMID:19109186

  17. Bile acid binding capacity of fish protein hydrolysates from discard species of the West Mediterranean Sea.

    PubMed

    Pérez-Gálvez, Raúl; García-Moreno, Pedro J; Morales-Medina, Rocío; Guadix, Antonio; Guadix, Emilia M

    2015-04-01

    Fish protein hydrolysates (FPH), produced from the six main discard species from the West Mediterranean Sea (sardine, horse mackerel, axillary seabream, bogue, small-spotted catshark and blue whiting) were tested for their bile acid binding capacity. This capacity is directly linked to the ability to inhibit bile reabsorption in the ileum and therefore to lower cholesterol levels in the bloodstream. From each species, FPH were obtained by three different enzymatic treatments employing two serine endoproteases (subtilisin and trypsin) sequentially or in combination. The results show statistically significant differences among the fish species, attaining interesting average values of bile acid binding capacity for blue whiting (27.32% relative to cholestyramine on an equal protein basis) and horse mackerel (27.42% relative to cholestyramine on an equal protein basis). The enzymatic treatments did not significantly affect the ability of a given species to bind bile acids. These results are similar to other protein sources, such as soy protein or casein, of proven hypocholesterolemic effect. It can be concluded that fish protein hydrolysates from these discard species are suitable as ingredients in the formulation of cholesterol-lowering supplements. PMID:25756593

  18. Acidic fog and temperature effects on stigmatic receptivity in two birch species

    SciTech Connect

    Hughes, R.N.; Cox, R.M.

    1994-07-01

    Factorial assays were performed to determine the effects of simulated acid fog (SAF) and temperature on stigmatic receptivity in two birch species. Excised reproductive branches were sampled from representative individuals of mountain paper birch (Betula cordifolia Regel.) and paper birch (Betula papyrifera Marsh.) in populations adjacent to the Bay of Fundy, New Brunswick, Canada. Since 1979 these trees have exhibited branch dieback in association with abnormal foliar browning symptoms. This browning has been linked with acidity and nitrate deposited by fog, which is frequent in the area. In general, experimental results indicated that pollen germination increased with temperature, but pH effects were less obvious. Similarly, pollen tube growth responded positively to temperature and was little affected by fog acidity. ANOVA tests indicated a significant difference (P < 0.05) between species in their pollen germination response only at 12{degrees}C, and not at the other three temperatures tested. For pollen tube growth, significant differences between species (P < 0.05) were demonstrated at 12 and 22{degrees}C. A significant pH effect was demonstrated at 27{degrees}C for germination, while pH effects on tube growth were significant at 27 and 12{degrees}C (P < 0.01). A response surface regression analysis indicated that acidity significantly affected pollen germination in mountain paper birch (P < 0.001) but not in paper birch. Temperature was not a significant factor for in vivo pollen germination in either species. For pollen tube growth, however, temperature was more important than pH and produced highly significant effects in both species (P < 0.001). Acidity was also a significant factor in pollen tube growth for paper birch. 39 refs., 4 figs., 3 tabs.

  19. The Generalist Inside the Specialist: Gut Bacterial Communities of Two Insect Species Feeding on Toxic Plants Are Dominated by Enterococcus sp.

    PubMed Central

    Vilanova, Cristina; Baixeras, Joaquín; Latorre, Amparo; Porcar, Manuel

    2016-01-01

    Some specialist insects feed on plants rich in secondary compounds, which pose a major selective pressure on both the phytophagous and the gut microbiota. However, microbial communities of toxic plant feeders are still poorly characterized. Here, we show the bacterial communities of the gut of two specialized Lepidoptera, Hyles euphorbiae and Brithys crini, which exclusively feed on latex-rich Euphorbia sp. and alkaloid-rich Pancratium maritimum, respectively. A metagenomic analysis based on high-throughput sequencing of the 16S rRNA gene revealed that the gut microbiota of both insects is dominated by the phylum Firmicutes, and especially by the common gut inhabitant Enterococcus sp. Staphylococcus sp. are also found in H. euphorbiae though to a lesser extent. By scanning electron microscopy, we found a dense ring-shaped bacterial biofilm in the hindgut of H. euphorbiae, and identified the most prominent bacterium in the biofilm as Enterococcus casseliflavus through molecular techniques. Interestingly, this species has previously been reported to contribute to the immobilization of latex-like molecules in the larvae of Spodoptera litura, a highly polyphagous lepidopteran. The E. casseliflavus strain was isolated from the gut and its ability to tolerate natural latex was tested under laboratory conditions. This fact, along with the identification of less frequent bacterial species able to degrade alkaloids and/or latex, suggest a putative role of bacterial communities in the tolerance of specialized insects to their toxic diet. PMID:27446044

  20. Solving the supply of resveratrol tetramers from Papua New Guinean rainforest anisoptera species that inhibit bacterial type III secretion systems.

    PubMed

    Davis, Rohan A; Beattie, Karren D; Xu, Min; Yang, Xinzhou; Yin, Sheng; Holla, Harish; Healy, Peter C; Sykes, Melissa; Shelper, Todd; Avery, Vicky M; Elofsson, Mikael; Sundin, Charlotta; Quinn, Ronald J

    2014-12-26

    The supply of (-)-hopeaphenol (1) was achieved via enzymatic biotransformation in order to provide material for preclinical investigation. High-throughput screening of a prefractionated natural product library aimed to identify compounds that inhibit the bacterial virulence type III secretion system (T3SS) identified several fractions derived from two Papua New Guinean Anisoptera species, showing activity against Yersinia pseudotuberculosis outer proteins E and H (YopE and YopH). Bioassay-directed isolation from the leaves of A. thurifera, and similarly A. polyandra, resulted in three known resveratrol tetramers, (-)-hopeaphenol (1), vatalbinoside A (2), and vaticanol B (3). Compounds 1-3 displayed IC50 values of 8.8, 12.5, and 9.9 μM in a luminescent reporter-gene assay (YopE) and IC50 values of 2.9, 4.5, and 3.3 μM in an enzyme-based YopH assay, respectively, which suggested that they could potentially act against the T3SS in Yersinia. The structures of 1-3 were confirmed through a combination of spectrometric, chemical methods, and single-crystal X-ray structure determinations of the natural product 1 and the permethyl ether analogue of 3. The enzymatic hydrolysis of the β-glycoside 2 to the aglycone 1 was achieved through biotransformation using the endogenous leaf enzymes. This significantly enhanced the yield of the target bioactive natural product from 0.08% to 1.3% and facilitates ADMET studies of (-)-hopeaphenol (1). PMID:25405587

  1. Polyunsaturated fatty acids in various macroalgal species from north Atlantic and tropical seas

    PubMed Central

    2011-01-01

    Background In this study the efficacy of using marine macroalgae as a source for polyunsaturated fatty acids, which are associated with the prevention of inflammation, cardiovascular diseases and mental disorders, was investigated. Methods The fatty acid (FA) composition in lipids from seven sea weed species from the North Sea (Ulva lactuca, Chondrus crispus, Laminaria hyperborea, Fucus serratus, Undaria pinnatifida, Palmaria palmata, Ascophyllum nodosum) and two from tropical seas (Caulerpa taxifolia, Sargassum natans) was determined using GCMS. Four independent replicates were taken from each seaweed species. Results Omega-3 (n-3) and omega-6 (n-6) polyunsaturated fatty acids (PUFAs), were in the concentration range of 2-14 mg/g dry matter (DM), while total lipid content ranged from 7-45 mg/g DM. The n-9 FAs of the selected seaweeds accounted for 3%-56% of total FAs, n-6 FAs for 3%-32% and n-3 FAs for 8%-63%. Red and brown seaweeds contain arachidonic (C20:4, n-6) and/or eicosapentaenoic acids (EPA, C20:5, n-3), the latter being an important "fish" FA, as major PUFAs while in green seaweeds these values are low and mainly C16 FAs were found. A unique observation is the presence of another typical "fish" fatty acid, docosahexaenoic acid (DHA, C22:6, n-3) at ≈ 1 mg/g DM in S. natans. The n-6: n-3 ratio is in the range of 0.05-2.75 and in most cases below 1.0. Environmental effects on lipid-bound FA composition in seaweed species are discussed. Conclusion Marine macroalgae form a good, durable and virtually inexhaustible source for polyunsaturated fatty acids with an (n-6) FA: (n-3) FA ratio of about 1.0. This ratio is recommended by the World Health Organization to be less than 10 in order to prevent inflammatory, cardiovascular and nervous system disorders. Some marine macroalgal species, like P. palmata, contain high proportions of the "fish fatty acid" eicosapentaenoic acid (EPA, C20:5, n-3), while in S. natans also docosahexaenoic acid (DHA, C22:6, n-3) was

  2. Acid mist and ozone effects on the leaf chemistry of two western conifer species.

    PubMed

    Westman, W E; Temple, P J

    1989-01-01

    Seedlings of Jeffrey pine (Pinus jeffreyi) and giant sequoia (Sequoiadendron gigantea) were more susceptible to leaf chemical changes following exposure to acid mist (pH 3.4-2.0) or acid mist/ozone combinations, than to ozone alone (0.1-0.2 microl/litre), when plants were exposed to alternating doses of these pollutants for 6-9 weeks. Under acid mist treatment, leaves exhibited higher levels of nitrogen and sulfur, two elements applied in acid mist. In addition, levels of foliar sodium, and, in the case of giant sequia, potassium, as well, increased under acid mist treatment. Iron and manganese were also mobilized, resulting in significant increases in these elements in pine, and decreases in manganese in giant sequoia foliage. The acid treatment also reduced chlorophyll b concentrations in pine, and, to a less significant extent, in giant sequoia. Calcium, magnesium, barium and strontium were differentially accumulated in giant sequoia compared to Jeffrey pine. Under acid mist treatment, all of these elements (except strontium) declined in concentration in giant sequoia, with calcium showing the most significant trend. The more extensive changes in leaf chemistry induced by acid mist are consistent with earlier observations of significant changes in spectral reflectance of these seedlings after 3 weeks of fumigation. Limited foliage samples collected from these two species in 1985 and 1986 in Sequoia/Kings Canyon National Parks in the southern Sierra Nevada do not in themselves indicate any clearcut or severe effects of ozone alone on leaf chemistry of these species, but a mild influence of nitrate-laden acid deposition, possibly in combination with ozone, is consistent with the rise in nitrogen and lignin levels in Jeffrey pine on sites observed to have moderate visible injury symptoms. No firm conclusions about effects of pollutants on leaf chemistry in these field sites is possible without further study. PMID:15092463

  3. Characterization of non-discriminating tetramethylammonium hydroxide-induced thermochemolysis-capillary gas chromatography-mass spectrometry as a method for profiling fatty acids in bacterial biomasses.

    PubMed

    Poerschmann, Juergen; Parsi, Ziba; Górecki, Tadeusz; Augustin, Juergen

    2005-04-15

    Thermochemolysis using tetramethylammonium hydroxide (TMAH) as a method for profiling fatty acids (FAs) as methyl esters (FAMEs) was studied with respect to discrimination of bacterial fatty acid patterns in Gram-negative Pseudomonas putida in comparison with patterns obtained by classical preparation schemes (pressurized solvent extraction, alkaline saponification). A new, non-discriminating pyrolysis approach was used in these experiments. In this method, pyrolysis is carried out inside a deactivated stainless steel capillary constituting a part of the column train. This approach made it possible to distinguish analyte discrimination brought about by (i) the pyrolyzer set-up in conventional pyrolysis and (ii) chemical thermochemolysis reaction itself. Our results showed no significant discrimination for saturated, monounsaturated and cyclopropane FAs when using thermochemolysis temperatures up to 550 degrees C with the non-discriminating, capacitive-discharged based approach. Likewise, the cis/trans ratio of monounsaturated FAs was preserved. This is in sharp contrast to conventional pyrolysis systems (both Curie-point or flash pyrolyzers) using much longer thermochemolysis times. When using these systems, artificial monounsaturated FAMEs were formed during heat treatment resulting in biased species identification/classification. Hydroxy-FAs, chiefly bound covalently in lipopolysaccharides, could be almost quantitatively liberated by TMAH using non-discriminating pyrolysis (beyond 90%), whereas the recoveries were lower with conventional approaches. The new method makes it possible to profile fatty acids in very small amounts of both solid and liquid samples without significant sample preparation. This was exemplified by the results of TMAH-thermochemolysis of a fermentation broth taken from an in situ bioremediation reactor to monitor enhanced natural attenuation processes, and tomato roots which were subjected to cellulolytic bacteria attacks (Streptomyces

  4. Identification of Bacterial Cell Wall Lyases via Pseudo Amino Acid Composition

    PubMed Central

    Tang, Hua; Li, Wen-Chao; Wu, Hao; Ding, Hui

    2016-01-01

    Owing to the abuse of antibiotics, drug resistance of pathogenic bacteria becomes more and more serious. Therefore, it is interesting to develop a more reasonable way to solve this issue. Because they can destroy the bacterial cell structure and then kill the infectious bacterium, the bacterial cell wall lyases are suitable candidates of antibacteria sources. Thus, it is urgent to develop an accurate and efficient computational method to predict the lyases. Based on the consideration, in this paper, a set of objective and rigorous data was collected by searching through the Universal Protein Resource (the UniProt database), whereafter a feature selection technique based on the analysis of variance (ANOVA) was used to acquire optimal feature subset. Finally, the support vector machine (SVM) was used to perform prediction. The jackknife cross-validated results showed that the optimal average accuracy of 84.82% was achieved with the sensitivity of 76.47% and the specificity of 93.16%. For the convenience of other scholars, we built a free online server called Lypred. We believe that Lypred will become a practical tool for the research of cell wall lyases and development of antimicrobial agents. PMID:27437396

  5. Identification of Bacterial Cell Wall Lyases via Pseudo Amino Acid Composition.

    PubMed

    Chen, Xin-Xin; Tang, Hua; Li, Wen-Chao; Wu, Hao; Chen, Wei; Ding, Hui; Lin, Hao

    2016-01-01

    Owing to the abuse of antibiotics, drug resistance of pathogenic bacteria becomes more and more serious. Therefore, it is interesting to develop a more reasonable way to solve this issue. Because they can destroy the bacterial cell structure and then kill the infectious bacterium, the bacterial cell wall lyases are suitable candidates of antibacteria sources. Thus, it is urgent to develop an accurate and efficient computational method to predict the lyases. Based on the consideration, in this paper, a set of objective and rigorous data was collected by searching through the Universal Protein Resource (the UniProt database), whereafter a feature selection technique based on the analysis of variance (ANOVA) was used to acquire optimal feature subset. Finally, the support vector machine (SVM) was used to perform prediction. The jackknife cross-validated results showed that the optimal average accuracy of 84.82% was achieved with the sensitivity of 76.47% and the specificity of 93.16%. For the convenience of other scholars, we built a free online server called Lypred. We believe that Lypred will become a practical tool for the research of cell wall lyases and development of antimicrobial agents. PMID:27437396

  6. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    SciTech Connect

    Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.

    2014-07-01

    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.

  7. Acetic Acid Acts as a Volatile Signal To Stimulate Bacterial Biofilm Formation

    PubMed Central

    Chen, Yun; Gozzi, Kevin; Yan, Fang

    2015-01-01

    ABSTRACT Volatiles are small air-transmittable chemicals with diverse biological activities. In this study, we showed that volatiles produced by the bacterium Bacillus subtilis had a profound effect on biofilm formation of neighboring B. subtilis cells that grew in proximity but were physically separated. We further demonstrated that one such volatile, acetic acid, is particularly potent in stimulating biofilm formation. Multiple lines of genetic evidence based on B. subtilis mutants that are defective in either acetic acid production or transportation suggest that B. subtilis uses acetic acid as a metabolic signal to coordinate the timing of biofilm formation. Lastly, we investigated how B. subtilis cells sense and respond to acetic acid in regulating biofilm formation. We showed the possible involvement of three sets of genes (ywbHG, ysbAB, and yxaKC), all encoding putative holin-antiholin-like proteins, in cells responding to acetic acid and stimulating biofilm formation. All three sets of genes were induced by acetate. A mutant with a triple mutation of those genes showed a severe delay in biofilm formation, whereas a strain overexpressing ywbHG showed early and robust biofilm formation. Results of our studies suggest that B. subtilis and possibly other bacteria use acetic acid as a metabolic signal to regulate biofilm formation as well as a quorum-sensing-like airborne signal to coordinate the timing of biofilm formation by physically separated cells in the community. PMID:26060272

  8. Lactic acid and trisodium phosphate treatment of lamb breast to reduce bacterial contamination.

    PubMed

    Ramirez, A J; Acuff, G R; Lucia, L M; Savell, J W

    2001-09-01

    Lactic acid and trisodium phosphate (TSP) were evaluated for the ability to reduce Escherichia coli and aerobic plate counts (APCs) on lamb breasts that were inoculated with a lamb fecal paste. A 90-s water rinse was applied followed by either a 9-s (55 degrees C) 2% lactic acid spray, a 60-s (55 degrees C) 12% TSP dip, or a combined treatment of both lactic acid and TSP treatments. Lactic acid reduced E. coli and APCs by 1.6 log10/cm2, and TSP caused a 1.8-log10/cm2 reduction in E. coli and a 0.7-log10/cm2 reduction in APCs. Combined reductions by the lactic acid spray followed by the TSP dip were 1.8 and 1.5 log10/cm2 for E. coli and APCs, respectively. Lactic acid and trisodium phosphate, used alone or in combination, were effective in reducing numbers of E. coli and could be useful as pathogen intervention steps in lamb slaughter processing. PMID:11563525

  9. Oligotyping reveals differences between gut microbiomes of free-ranging sympatric Namibian carnivores (Acinonyx jubatus, Canis mesomelas) on a bacterial species-like level

    PubMed Central

    Menke, Sebastian; Wasimuddin; Meier, Matthias; Melzheimer, Jörg; Mfune, John K. E.; Heinrich, Sonja; Thalwitzer, Susanne; Wachter, Bettina; Sommer, Simone

    2014-01-01

    Recent gut microbiome studies in model organisms emphasize the effects of intrinsic and extrinsic factors on the variation of the bacterial composition and its impact on the overall health status of the host. Species occurring in the same habitat might share a similar microbiome, especially if they overlap in ecological and behavioral traits. So far, the natural variation in microbiomes of free-ranging wildlife species has not been thoroughly investigated. The few existing studies exploring microbiomes through 16S rRNA gene reads clustered sequencing reads into operational taxonomic units (OTUs) based on a similarity threshold (e.g., 97%). This approach, in combination with the low resolution of target databases, generally limits the level of taxonomic assignments to the genus level. However, distinguishing natural variation of microbiomes in healthy individuals from “abnormal” microbial compositions that affect host health requires knowledge of the “normal” microbial flora at a high taxonomic resolution. This gap can now be addressed using the recently published oligotyping approach, which can resolve closely related organisms into distinct oligotypes by utilizing subtle nucleotide variation. Here, we used Illumina MiSeq to sequence amplicons generated from the V4 region of the 16S rRNA gene to investigate the gut microbiome of two free-ranging sympatric Namibian carnivore species, the cheetah (Acinonyx jubatus) and the black-backed jackal (Canis mesomelas). Bacterial phyla with proportions >0.2% were identical for both species and included Firmicutes, Fusobacteria, Bacteroidetes, Proteobacteria and Actinobacteria. At a finer taxonomic resolution, black-backed jackals exhibited 69 bacterial taxa with proportions ≥0.1%, whereas cheetahs had only 42. Finally, oligotyping revealed that shared bacterial taxa consisted of distinct oligotype profiles. Thus, in contrast to 3% OTUs, oligotyping can detect fine-scale taxonomic differences between microbiomes

  10. Oligotyping reveals differences between gut microbiomes of free-ranging sympatric Namibian carnivores (Acinonyx jubatus, Canis mesomelas) on a bacterial species-like level.

    PubMed

    Menke, Sebastian; Wasimuddin; Meier, Matthias; Melzheimer, Jörg; Mfune, John K E; Heinrich, Sonja; Thalwitzer, Susanne; Wachter, Bettina; Sommer, Simone

    2014-01-01

    Recent gut microbiome studies in model organisms emphasize the effects of intrinsic and extrinsic factors on the variation of the bacterial composition and its impact on the overall health status of the host. Species occurring in the same habitat might share a similar microbiome, especially if they overlap in ecological and behavioral traits. So far, the natural variation in microbiomes of free-ranging wildlife species has not been thoroughly investigated. The few existing studies exploring microbiomes through 16S rRNA gene reads clustered sequencing reads into operational taxonomic units (OTUs) based on a similarity threshold (e.g., 97%). This approach, in combination with the low resolution of target databases, generally limits the level of taxonomic assignments to the genus level. However, distinguishing natural variation of microbiomes in healthy individuals from "abnormal" microbial compositions that affect host health requires knowledge of the "normal" microbial flora at a high taxonomic resolution. This gap can now be addressed using the recently published oligotyping approach, which can resolve closely related organisms into distinct oligotypes by utilizing subtle nucleotide variation. Here, we used Illumina MiSeq to sequence amplicons generated from the V4 region of the 16S rRNA gene to investigate the gut microbiome of two free-ranging sympatric Namibian carnivore species, the cheetah (Acinonyx jubatus) and the black-backed jackal (Canis mesomelas). Bacterial phyla with proportions >0.2% were identical for both species and included Firmicutes, Fusobacteria, Bacteroidetes, Proteobacteria and Actinobacteria. At a finer taxonomic resolution, black-backed jackals exhibited 69 bacterial taxa with proportions ≥0.1%, whereas cheetahs had only 42. Finally, oligotyping revealed that shared bacterial taxa consisted of distinct oligotype profiles. Thus, in contrast to 3% OTUs, oligotyping can detect fine-scale taxonomic differences between microbiomes. PMID

  11. Proximate and fatty acid composition of some commercially important fish species from the Sinop region of the Black Sea.

    PubMed

    Kocatepe, Demet; Turan, Hülya

    2012-06-01

    The proximate and fatty acid compositions of the commercially important fish species (Engraulis encrasicolus, Alosa alosa, Belone belone, Scorpaena porcus, Pomatomus saltatrix, Mullus barbatus) from the Sinop region of the Black Sea were examined. The fat contents ranged from 1.26% (for scorpion fish) to 18.12% (for shad). The protein contents were min 14.54% (for red mullet) and maximum 20.26% (for belone). The fatty acid compositions of the fish ranged from 27.83 to 35.91% for saturated fatty acids, 19.50-33.80% for monounsaturated fatty acids and 15.25-40.02% for polyunsaturated fatty acids. Among the saturated fatty acids, palmitic acid (16:0) (17.75-22.20%) was the dominant fatty acid for all the fish species. As a second saturated fatty acid, myristic acid (14:0) was observed in four of the fish species and its content ranged from 4.72 to 7.31%. Whereas, for the other two fish species, the second saturated fatty acid was stearic acid (18:0) ranging between 4.54 and 10.64%. Among the monounsaturated fatty acids, those occurring in the highest proportions were oleic acid (18:1n-9c) (11.67-22.45%) and palmitoleic acid (16:1) (4.50-9.40%). Docosahexaenoic acid (22:6n-3) (5.41-28.52%), eicosapentaenoic acid (20:5n-3) (4.68-11.06) and linoleic acid (18:2n-6) (1.38-3.49%) were dominant polyunsaturated fatty acids, respectively. All the species, in particular the belone, the anchovy and the shad had high levels of the n-3 series. PMID:22322400

  12. A cross-sectional survey of bacterial species in plaque from client owned dogs with healthy gingiva, gingivitis or mild periodontitis.

    PubMed

    Davis, Ian J; Wallis, Corrin; Deusch, Oliver; Colyer, Alison; Milella, Lisa; Loman, Nick; Harris, Stephen

    2013-01-01

    Periodontal disease is the most widespread oral disease in dogs which if left untreated results in significant pain to the pet and loss of dentition. The objective of this study was to identify bacterial species in canine plaque that are significantly associated with health, gingivitis and mild periodontitis (<25% attachment loss). In this survey subgingival plaque samples were collected from 223 dogs with healthy gingiva, gingivitis and mild periodontitis with 72 to 77 samples per health status. DNA was extracted from the plaque samples and subjected to PCR amplification of the V1-V3 region of the 16S rDNA. Pyrosequencing of the PCR amplicons identified a total of 274 operational taxonomic units after bioinformatic and statistical analysis. Porphyromonas was the most abundant genus in all disease stages, particularly in health along with Moraxella and Bergeyella. Peptostreptococcus, Actinomyces, and Peptostreptococcaceae were the most abundant genera in mild periodontitis. Logistic regression analysis identified species from each of these genera that were significantly associated with health, gingivitis or mild periodontitis. Principal component analysis showed distinct community profiles in health and disease. The species identified show some similarities with health and periodontal disease in humans but also major differences. In contrast to human, healthy canine plaque was found to be dominated by Gram negative bacterial species whereas Gram positive anaerobic species predominate in disease. The scale of this study surpasses previously published research and enhances our understanding of the bacterial species present in canine subgingival plaque and their associations with health and early periodontal disease. PMID:24349448

  13. Synthesis, characterization, solubility and stability studies of hydrate cocrystal of antitubercular Isoniazid with antioxidant and anti-bacterial Protocatechuic acid

    NASA Astrophysics Data System (ADS)

    Mashhadi, Syed Muddassir Ali; Yunus, Uzma; Bhatti, Moazzam Hussain; Ahmed, Imtiaz; Tahir, Muhammad Nawaz

    2016-08-01

    Isoniazid is an important component used in "triple therapy" to combat tuberculosis. It has reduced Tabletting formulations stability. Anti-oxidants are obligatory to counter oxidative stress, pulmonary inflammation, and free radical burst from macrophages caused in tuberculosis and other diseases. In the present study a hydrate cocrystal of Isoniazid with anti-oxidant and anti-inflammatory and anti-bacterial Protocatechuic acid (3,4-dihydroxybenzoic acid) in 1:1 is reported. This Cocrystal may have improved tabletting stability and anti-oxidant properties. Cocrystal structure analysis confirmed the existence of pyridine-carboxylic acid synthon in the Cocrystal. Other synthons of different graph sets involving Nsbnd H···O and Osbnd H···N bonds are formed between hydrazide group of isoniazid and coformer. Solubility studies reve