Science.gov

Sample records for acid bacterial species

  1. Comparative Study of Bacterial Communities in Nepenthes Pitchers and Their Correlation to Species and Fluid Acidity.

    PubMed

    Kanokratana, Pattanop; Mhuanthong, Wuttichai; Laothanachareon, Thanaporn; Tangphatsornruang, Sithichoke; Eurwilaichitr, Lily; Kruetreepradit, Trongtham; Mayes, Shawn; Champreda, Verawat

    2016-08-01

    Pitchers are specialized digestive organs of carnivorous plants which evolved for trapping prey and represent a unique environment harboring hidden diversity of unexplored microbes forming transient hydrolytic microcosms. In this study, the diversity of bacterial communities in the pitcher fluids of seven local Nepenthes found in Thailand was assessed by tagged 16S ribosomal RNA (rRNA) gene amplicon sequencing on an Ion PGM™ platform. A total of 1,101,000 filtered sequences were obtained which were taxonomically classified into 20 phyla, 48 classes, 72 orders, 153 families, and 442 genera while the remainder (1.43 %) could not be assigned to any existing taxa. Proteobacteria represented the predominant members in closed pitchers and more diversified bacterial taxa particularly Bacteriodetes and Actinobacteria, showed increasing abundance in open pitchers containing insect bodies. Principal coordinate analysis revealed that distribution of bacterial taxa was not significantly related to the Nepenthes species but strongly correlated to the pH of the pitcher fluids (pH 1.7-6.7). Acidicella was a highly dominant bacterial genus in acidic pitcher fluids while Dyella and Mycobacterium were also common genera in most pitchers. A unique microbial community structure was found in Nepenthes ampullaria which could reflect their adaptation to digest leaf litter, in addition to insect prey. The work revealed the highly unexplored nature of bacterial microcosms in Nepenthes pitcher fluids and provides insights into their community structure in this unique ecological system. PMID:27287538

  2. Peracetic Acid Treatment Generates Potent Inactivated Oral Vaccines from a Broad Range of Culturable Bacterial Species

    PubMed Central

    Moor, Kathrin; Wotzka, Sandra Y.; Toska, Albulena; Diard, Médéric; Hapfelmeier, Siegfried; Slack, Emma

    2016-01-01

    Our mucosal surfaces are the main sites of non-vector-borne pathogen entry, as well as the main interface with our commensal microbiota. We are still only beginning to understand how mucosal adaptive immunity interacts with commensal and pathogenic microbes to influence factors such as infectivity, phenotypic diversity, and within-host evolution. This is in part due to difficulties in generating specific mucosal adaptive immune responses without disrupting the mucosal microbial ecosystem itself. Here, we present a very simple tool to generate inactivated mucosal vaccines from a broad range of culturable bacteria. Oral gavage of 1010 peracetic acid-inactivated bacteria induces high-titer-specific intestinal IgA in the absence of any measurable inflammation or species invasion. As a proof of principle, we demonstrate that this technique is sufficient to provide fully protective immunity in the murine model of invasive non-typhoidal Salmonellosis, even in the face of severe innate immune deficiency. PMID:26904024

  3. Peracetic Acid Treatment Generates Potent Inactivated Oral Vaccines from a Broad Range of Culturable Bacterial Species.

    PubMed

    Moor, Kathrin; Wotzka, Sandra Y; Toska, Albulena; Diard, Médéric; Hapfelmeier, Siegfried; Slack, Emma

    2016-01-01

    Our mucosal surfaces are the main sites of non-vector-borne pathogen entry, as well as the main interface with our commensal microbiota. We are still only beginning to understand how mucosal adaptive immunity interacts with commensal and pathogenic microbes to influence factors such as infectivity, phenotypic diversity, and within-host evolution. This is in part due to difficulties in generating specific mucosal adaptive immune responses without disrupting the mucosal microbial ecosystem itself. Here, we present a very simple tool to generate inactivated mucosal vaccines from a broad range of culturable bacteria. Oral gavage of 10(10) peracetic acid-inactivated bacteria induces high-titer-specific intestinal IgA in the absence of any measurable inflammation or species invasion. As a proof of principle, we demonstrate that this technique is sufficient to provide fully protective immunity in the murine model of invasive non-typhoidal Salmonellosis, even in the face of severe innate immune deficiency.

  4. Peracetic Acid Treatment Generates Potent Inactivated Oral Vaccines from a Broad Range of Culturable Bacterial Species.

    PubMed

    Moor, Kathrin; Wotzka, Sandra Y; Toska, Albulena; Diard, Médéric; Hapfelmeier, Siegfried; Slack, Emma

    2016-01-01

    Our mucosal surfaces are the main sites of non-vector-borne pathogen entry, as well as the main interface with our commensal microbiota. We are still only beginning to understand how mucosal adaptive immunity interacts with commensal and pathogenic microbes to influence factors such as infectivity, phenotypic diversity, and within-host evolution. This is in part due to difficulties in generating specific mucosal adaptive immune responses without disrupting the mucosal microbial ecosystem itself. Here, we present a very simple tool to generate inactivated mucosal vaccines from a broad range of culturable bacteria. Oral gavage of 10(10) peracetic acid-inactivated bacteria induces high-titer-specific intestinal IgA in the absence of any measurable inflammation or species invasion. As a proof of principle, we demonstrate that this technique is sufficient to provide fully protective immunity in the murine model of invasive non-typhoidal Salmonellosis, even in the face of severe innate immune deficiency. PMID:26904024

  5. Bacterial responses to reactive chlorine species.

    PubMed

    Gray, Michael J; Wholey, Wei-Yun; Jakob, Ursula

    2013-01-01

    Hypochlorous acid (HOCl), the active ingredient of household bleach, is the most common disinfectant in medical, industrial, and domestic use and plays an important role in microbial killing in the innate immune system. Given the critical importance of the antimicrobial properties of chlorine to public health, it is surprising how little is known about the ways in which bacteria sense and respond to reactive chlorine species (RCS). Although the literature on bacterial responses to reactive oxygen species (ROS) is enormous, work addressing bacterial responses to RCS has begun only recently. Transcriptomic and proteomic studies now provide new insights into how bacteria mount defenses against this important class of antimicrobial compounds. In this review, we summarize the current knowledge, emphasizing the overlaps between RCS stress responses and other more well-characterized bacterial defense systems, and identify outstanding questions that represent productive avenues for future research. PMID:23768204

  6. The enteric bacterial metabolite propionic acid alters brain and plasma phospholipid molecular species: further development of a rodent model of autism spectrum disorders

    PubMed Central

    2012-01-01

    Gastrointestinal symptoms and altered blood phospholipid profiles have been reported in patients with autism spectrum disorders (ASD). Most of the phospholipid analyses have been conducted on the fatty acid composition of isolated phospholipid classes following hydrolysis. A paucity of information exists on how the intact phospholipid molecular species are altered in ASD. We applied ESI/MS to determine how brain and blood intact phospholipid species were altered during the induction of ASD-like behaviors in rats following intraventricular infusions with the enteric bacterial metabolite propionic acid. Animals were infused daily for 8 days, locomotor activity assessed, and animals killed during the induced behaviors. Propionic acid infusions increased locomotor activity. Lipid analysis revealed treatment altered 21 brain and 30 blood phospholipid molecular species. Notable alterations were observed in the composition of brain SM, diacyl mono and polyunsaturated PC, PI, PS, PE, and plasmalogen PC and PE molecular species. These alterations suggest that the propionic acid rat model is a useful tool to study aberrations in lipid metabolism known to affect membrane fluidity, peroxisomal function, gap junction coupling capacity, signaling, and neuroinflammation, all of which may be associated with the pathogenesis of ASD. PMID:22747852

  7. Evidence of novel plant-species specific ammonia oxidizing bacterial clades in acidic South African fynbos soils.

    PubMed

    Ramond, Jean-Baptiste; Lako, Joseph D W; Stafford, William H L; Tuffin, Marla I; Cowan, Don A

    2015-08-01

    Ammonia-oxidizing bacteria (AOB) are essential in the biogeochemical cycling of nitrogen as they catalyze the rate-limiting oxidation of ammonia into nitrite. Since their first isolation in the late 19th century, chemolithoautotrophic AOBs have been identified in a wide range of natural (e.g., soils, sediments, estuarine, and freshwaters) and man created or impacted habitats (e.g., wastewater treatment plants and agricultural soils). However, little is known on the plant-species association of AOBs, particularly in the nutrient-starved fynbos terrestrial biome. In this study, we evaluated the diversity of AOBs in the plant canopy of three South African fynbos-specific plant species, namely Leucadendron xanthoconus, Leucospermum truncatulum and Leucadendron microcephalum, through the construction of amoA-gene clone libraries. Our results clearly demonstrate that plant-species specific and monophyletic AOB clades are present in fynbos canopy soils.

  8. Lactic acid bacterial cell factories for gamma-aminobutyric acid.

    PubMed

    Li, Haixing; Cao, Yusheng

    2010-11-01

    Gamma-aminobutyric acid is a non-protein amino acid that is widely present in organisms. Several important physiological functions of gamma-aminobutyric acid have been characterized, such as neurotransmission, induction of hypotension, diuretic effects, and tranquilizer effects. Many microorganisms can produce gamma-aminobutyric acid including bacteria, fungi and yeasts. Among them, gamma-aminobutyric acid-producing lactic acid bacteria have been a focus of research in recent years, because lactic acid bacteria possess special physiological activities and are generally regarded as safe. They have been extensively used in food industry. The production of lactic acid bacterial gamma-aminobutyric acid is safe and eco-friendly, and this provides the possibility of production of new naturally fermented health-oriented products enriched in gamma-aminobutyric acid. The gamma-aminobutyric acid-producing species of lactic acid bacteria and their isolation sources, the methods for screening of the strains and increasing their production, the enzymatic properties of glutamate decarboxylases and the relative fundamental research are reviewed in this article. And the potential applications of gamma-aminobutyric acid-producing lactic acid bacteria were also referred to.

  9. Cryoprotection from bacterial teichoic acid

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Harrison, William; Kirkpatrick, Karl; Brown, Eric D.

    2009-08-01

    Recent studies from our lab demonstrated that teichoic acid is surrounded by liquid water at -40 °C. The size and shape of the liquid water pockets has been visualized with fluorescence microscopy images of aqueous Rhodamine- B solutions. The long, thin channels surround ice crystals with a size of 5-20 microns. Subsequent studies show that B. subtilis Gram-positive bacteria are sequestered into large pockets without added teichoic acid. Here, the ice crystals are orders of manitude larger. When bacteria are mixed with teichoic acid solutions, the distribution of bacteria changes dramatically. The smaller ice crystals allow the bacteria to align in the thin channels of liquid water seen with teichoic acid only. The role of teichoic acid in the freeze tolerance was examined with live/dead fluorescence assays of bacteria mixed with teichoic acid. These quantitative assays were used to determine if teichoic acid acts in a synergetic fashion to enhance the survivability of E. coli, a gram-negative species which lacks teichoic acid. Additionally, we have obtained B. subtilis mutants lacking wall-associated teichoic acids to evaluate cryoprotection compared to the wild-type strain.

  10. A 2,4-dichlorophenoxyacetic acid degradation plasmid pM7012 discloses distribution of an unclassified megaplasmid group across bacterial species.

    PubMed

    Sakai, Yoriko; Ogawa, Naoto; Shimomura, Yumi; Fujii, Takeshi

    2014-03-01

    Analysis of the complete nucleotide sequence of plasmid pM7012 from 2,4-dichlorophenoxyacetic-acid (2,4-D)-degrading bacterium Burkholderia sp. M701 revealed that the plasmid had 582 142 bp, with 541 putative protein-coding sequences and 39 putative tRNA genes for the transport of the standard 20 aa. pM7012 contains sequences homologous to the regions involved in conjugal transfer and plasmid maintenance found in plasmids byi_2p from Burkholderia sp. YI23 and pBVIE01 from Burkholderia sp. G4. No relaxase gene was found in any of these plasmids, although genes for a type IV secretion system and type IV coupling proteins were identified. Plasmids with no relaxase gene have been classified as non-mobile plasmids. However, nucleotide sequences with a high level of similarity to the genes for plasmid transfer, plasmid maintenance, 2,4-D degradation and arsenic resistance contained on pM7012 were also detected in eight other megaplasmids (~600 or 900 kb) found in seven Burkholderia strains and a strain of Cupriavidus, which were isolated as 2,4-D-degrading bacteria in Japan and the United States. These results suggested that the 2,4-D degradation megaplasmids related to pM7012 are mobile and distributed across various bacterial species worldwide, and that the plasmid group could be distinguished from known mobile plasmid groups.

  11. Eradication of bacterial species via photosensitization

    NASA Astrophysics Data System (ADS)

    Golding, Paul S.; Maddocks, L.; King, Terence A.; Drucker, D. B.

    1999-02-01

    Photosensitization and inactivation efficacy of three bacterial species: Prevotella nigrescens, Staphylococcus aureus and Escherichia coli have been investigated. Samples of Staphylococcus aureus and Escherichia coli were treated with the triphenylmethane dye malachite green isothiocyanate and exposed to light from a variety of continuous and pulsed light sauces at a wavelength of approximately 630 nm. Inactivation of the Gram-positive species Staphylococcus aureus was found to increase with radiation dose, whilst Gram-negative Escherichia coli was resistant to such treatment. Samples of the pigmented species Prevotella nigrescens were found to be inactivated by exposure to light alone. The mechanism of photosensitization and inactivation of Staphylococcus aureus with malachite green isothiocyanate is addressed. The possible roles of the excited triplet state of the photosensitizer, the involvement of molecular oxygen, and the bacterial cell wall are discussed. Photosensitization may provide a way of eliminating naturally pigmented species responsible for a variety of infections, including oral diseases such as gingivitis and periodontitis.

  12. Inhibitory effects on bacterial growth and beta-ketoacyl-ACP reductase by different species of maple leaf extracts and tannic acid.

    PubMed

    Wu, Dan; Wu, Xiao-Dong; You, Xue-Fu; Ma, Xiao-Feng; Tian, Wei-Xi

    2010-01-01

    It is important to develop new antibiotics aimed at novel targets. The investigation found that the leaf extracts from five maples (Acer platanoides, Acer campestre, Acer rubrum, Acer saccharum and Acer truncatum Bunge collected in Denmark, Canada and China) and their component tannic acid displayed antibacterial ability against 24 standard bacteria strains with the minimum inhibitory concentration of 0.3-8.0 mg/mL. Unlike the standard antibiotic levofloxacin (LFX), these samples inhibited Gram-positive bacteria more effectively than they inhibited Gram-negative bacteria. These samples effectively inhibited two antidrug bacterial strains. The results show that these samples inhibit bacteria by a different mechanism from LFX. These samples potently inhibited b-ketoacyl-ACP reductase (FabG), which is an important enzyme in bacterial fatty acid synthesis. Tannic acid showed the strongest inhibition on FabG with a half inhibition concentration of 0.78 microM (0.81 microg/mL). Furthermore, tannic acid and two maple leaf extracts showed time-dependent irreversible inhibition of FabG. These three samples also exhibited better inhibition on bacteria. It is suggested that FabG is the antibacteria target of maple leaf extracts and tannic acid, and both reversible and irreversible inhibitions of FabG are important for the antibacterial effect.

  13. Identification and ecology of bacterial communities associated with necroses of three cactus species.

    PubMed

    Foster, J L; Fogleman, J C

    1993-01-01

    To compare the bacterial communities residing in necrotic tissues of columnar cacti of the Sonoran Desert, isolates from 39 organ pipe, 19 saguaro, and 16 senita cacti were obtained. The isolates were clustered into 28 conspecific groups on the basis of their fatty acid profiles. The distributions of the individual bacterial isolates varied among cactus species. Seven of the 28 species groups were unique to a particular cactus species, whereas 8 species groups were found in all three cacti. The effective number of bacterial species for each cactus species was positively correlated with both the chemical complexity and glucose concentration of the plant tissues. The effective number of bacterial species and bacterial distribution patterns were compared with those known for communities of cactophilic yeasts. The observed bacterial distribution patterns are most likely due to differences in the chemical compositions of the three cactus species. PMID:8439142

  14. Bacterial Community Diversity Harboured by Interacting Species.

    PubMed

    Bili, Mikaël; Cortesero, Anne Marie; Mougel, Christophe; Gauthier, Jean Pierre; Ermel, Gwennola; Simon, Jean Christophe; Outreman, Yannick; Terrat, Sébastien; Mahéo, Frédérique; Poinsot, Denis

    2016-01-01

    All animals are infected by microbial partners that can be passengers or residents and influence many biological traits of their hosts. Even if important factors that structure the composition and abundance of microbial communities within and among host individuals have been recently described, such as diet, developmental stage or phylogeny, few studies have conducted cross-taxonomic comparisons, especially on host species related by trophic relationships. Here, we describe and compare the microbial communities associated with the cabbage root fly Delia radicum and its three major parasitoids: the two staphylinid beetles Aleochara bilineata and A. bipustulata and the hymenopteran parasitoid Trybliographa rapae. For each species, two populations from Western France were sampled and microbial communities were described through culture independent methods (454 pyrosequencing). Each sample harbored at least 59 to 261 different bacterial phylotypes but was strongly dominated by one or two. Microbial communities differed markedly in terms of composition and abundance, being mainly influenced by phylogenetic proximity but also geography to a minor extent. Surprisingly, despite their strong trophic interaction, parasitoids shared a very low proportion of microbial partners with their insect host. Three vertically transmitted symbionts from the genus Wolbachia, Rickettsia, and Spiroplasma were found in this study. Among them, Wolbachia and Spiroplasma were found in both the cabbage fly and at least one of its parasitoids, which could result from horizontal transfers through trophic interactions. Phylogenetic analysis showed that this hypothesis may explain some but not all cases. More work is needed to understand the dynamics of symbiotic associations within trophic network and the effect of these bacterial communities on the fitness of their hosts. PMID:27258532

  15. Bacterial Community Diversity Harboured by Interacting Species

    PubMed Central

    Bili, Mikaël; Cortesero, Anne Marie; Mougel, Christophe; Gauthier, Jean Pierre; Ermel, Gwennola; Simon, Jean Christophe; Outreman, Yannick; Terrat, Sébastien; Mahéo, Frédérique; Poinsot, Denis

    2016-01-01

    All animals are infected by microbial partners that can be passengers or residents and influence many biological traits of their hosts. Even if important factors that structure the composition and abundance of microbial communities within and among host individuals have been recently described, such as diet, developmental stage or phylogeny, few studies have conducted cross-taxonomic comparisons, especially on host species related by trophic relationships. Here, we describe and compare the microbial communities associated with the cabbage root fly Delia radicum and its three major parasitoids: the two staphylinid beetles Aleochara bilineata and A. bipustulata and the hymenopteran parasitoid Trybliographa rapae. For each species, two populations from Western France were sampled and microbial communities were described through culture independent methods (454 pyrosequencing). Each sample harbored at least 59 to 261 different bacterial phylotypes but was strongly dominated by one or two. Microbial communities differed markedly in terms of composition and abundance, being mainly influenced by phylogenetic proximity but also geography to a minor extent. Surprisingly, despite their strong trophic interaction, parasitoids shared a very low proportion of microbial partners with their insect host. Three vertically transmitted symbionts from the genus Wolbachia, Rickettsia, and Spiroplasma were found in this study. Among them, Wolbachia and Spiroplasma were found in both the cabbage fly and at least one of its parasitoids, which could result from horizontal transfers through trophic interactions. Phylogenetic analysis showed that this hypothesis may explain some but not all cases. More work is needed to understand the dynamics of symbiotic associations within trophic network and the effect of these bacterial communities on the fitness of their hosts. PMID:27258532

  16. Bacterial Lipoteichoic Acid Enhances Cryosurvival

    PubMed Central

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Scull, Erin; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2015-01-01

    Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. We show that lipoteichoic acid (LTA), a biopolymer in the cell wall of Gram-positive bacteria, can be added to B. subtilis cultures and increase freeze tolerance. At 1% w/v, LTA enables a 50% survival rate, similar to the results obtained with 1% w/v glycerol as measured with the resazurin cell viability assay. In the absence of added LTA or glycerol, a very small number of B. subtilis cells survive freezing. This suggests that an innate freeze tolerance mechanism exists. While cryoprotection can be provided by extracellular polymeric substances (EPS), our data demonstrate a role for LTA in cryoprotection. Currently, the exact mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. However, low temperature microscopy data show small ice crystals aligned along channels of liquid water. Our observations suggest that teichoic acids could protect liquid water within biofilms and planktonic bacteria, augmenting the role of brine while also raising the possibility for survival without brine present. PMID:25477208

  17. BACTERIAL OXIDATION OF DIPICOLINIC ACID I.

    PubMed Central

    Arima, Kei; Kobayashi, Yasuo

    1962-01-01

    Arima, Kei (University of Tokyo, Tokyo, Japan) and Yasuo Kobayashi. Bacterial oxidation of dipicolinic acid. I. Isolation of microorganisms, their culture conditions, and end products. J. Bacteriol. 84:759–764. 1962.—In a study of the metabolic pathway(s) of dipicolinic acid (DPA) in microorganisms, 436 strains of soil microorganisms were isolated by use of an enrichment culture technique. Most of them were bacteria, and one of them, Achromobacter, which had the strongest DPA-oxidizing activity, was used for the following experiments. In DPA-free medium, the enzymes which oxidize DPA were not produced. The best culture condition for enzyme production and cell growth was: Nutrient Broth supplemented with 0.1% DPA, 30 C, and 20 hr of shake culture. End products were oxalic acid, NH3, and CO2. Oxalic acid was not oxidized further by this bacterium. The over-all reaction equation of DPA oxidation was determined. PMID:16561964

  18. Bacterial Cyanuric Acid Hydrolase for Water Treatment

    PubMed Central

    Yeom, Sujin; Mutlu, Baris R.; Aksan, Alptekin

    2015-01-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  19. Bacterial Cyanuric Acid Hydrolase for Water Treatment.

    PubMed

    Yeom, Sujin; Mutlu, Baris R; Aksan, Alptekin; Wackett, Lawrence P

    2015-10-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  20. Bacterial Cyanuric Acid Hydrolase for Water Treatment.

    PubMed

    Yeom, Sujin; Mutlu, Baris R; Aksan, Alptekin; Wackett, Lawrence P

    2015-10-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation.

  1. Total Biosynthesis of Legionaminic Acid, a Bacterial Sialic Acid Analogue.

    PubMed

    Hassan, Mohamed I; Lundgren, Benjamin R; Chaumun, Michael; Whitfield, Dennis M; Clark, Brady; Schoenhofen, Ian C; Boddy, Christopher N

    2016-09-19

    Legionaminic acid, Leg5,7Ac2 , a nonulosonic acid like 5-acetamido neuraminic acid (Neu5Ac, sialic acid), is found in cell surface glycoconjugates of bacteria including the pathogens Campylobacter jejuni, Acinetobacter baumanii and Legionella pneumophila. The presence of Leg5,7Ac2 has been correlated with virulence in humans by mechanisms that likely involve subversion of the host's immune system or interactions with host cell surfaces due to its similarity to Neu5Ac. Investigation into its role in bacterial physiology and pathogenicity is limited as there are no effective sources of it. Herein, we construct a de novo Leg5,7Ac2 biosynthetic pathway by combining multiple metabolic modules from three different microbial sources (Saccharomyces cerevisiae, C. jejuni, and L. pneumophila). Over-expression of this de novo pathway in Escherichia coli that has been engineered to lack two native catabolic pathways, enables significant quantities of Leg5,7Ac2 (≈120 mg L(-1) of culture broth) to be produced. Pure Leg5,7Ac2 could be isolated and converted into CMP-activated sugar for biochemical applications and a phenyl thioglycoside for chemical synthesis applications. This first total biosynthesis provides an essential source of Leg5,7Ac2 enabling study of its role in prokaryotic and eukaryotic glycobiology. PMID:27538580

  2. Bacterial species dominance within a binary culture biofilm.

    PubMed Central

    Banks, M K; Bryers, J D

    1991-01-01

    Studies with two species of bacteria, Pseudomonas putida and Hyphomicrobium sp. strain ZV620, were carried out to evaluate the overall net rate of accumulation of biofilm, the biofilm species composition, and individual species shear-related removal rates. Bacterial cells of either or both species were deposited onto glass or biofilm surfaces to initiate multispecies biofilms. Subsequent biofilm development was carried out under known conditions of nutrient concentration and laminar flow. Establishment of a depositing organism in a biofilm composed of another species was found to be a function of the relative growth rates of the bacterial species. In the case of simultaneous species deposition and subsequent binary culture development, the faster-growing organisms rapidly became the dominant biofilm species, but the slower-growing organisms remained established within the biofilm and continued to increase in numbers over time. The results also indicated that the rate of cell removal by fluid shear for a species was a function of biofilm cell number only if the species concentration was uniform with depth; in essence, only the upper layers of the biofilm were sheared off. PMID:1892387

  3. Bladder surface mucin. Its antibacterial effect against various bacterial species.

    PubMed Central

    Parsons, C. L.; Mulholland, S. G.

    1978-01-01

    We previously reported the results of quantitative and histochemical studies implicating the surface mucin of the bladder mucosa as an important antibacterial defense mechanism, which functions by preventing bacteria from adhering to the bladder wall. We call the mucin "anti-adherence factor" and we feel this is a previously undocumented role for mucin as a type of host antibacterial defense. These experiments were conduced with Escherichia coli. In an effort to determine whether the anti-adherence ability of the vesical mucin was a generalized phenomenon, we repeated these studies using unrelated bacterial species, including E coli, Klebsiella pneumoniae, and Staphylococcus aureus. The ability of the vesical mucosa to resist bacterial adherence to its surface was found to be independent of the bacterial species that was investigated. PMID:362941

  4. Penicillin amidohydrolase productivity of locally isolated bacterial species.

    PubMed

    Mahmood, Z A; Shaikh, D; Zoha, S M

    1991-01-01

    Penicillin amidohydrolase productivity of four locally isolated bacterial species is described. Organisms were identified as Escherichia coli, Pseudomonas aeruginosa, Sarcina lutea and Bacillus megaterium. Highest enzyme productivity of 3.2 U/mL with a corresponding dry cell mass of 4.5 g/L was recorded from S. lutea. PMID:1821869

  5. Prevalent bacterial species and novel phylotypes in advanced noma lesions.

    PubMed

    Paster, B J; Falkler Jr, W A; Enwonwu, C O; Idigbe, E O; Savage, K O; Levanos, V A; Tamer, M A; Ericson, R L; Lau, C N; Dewhirst, F E

    2002-06-01

    The purpose of this study was to determine the bacterial diversity in advanced noma lesions using culture-independent molecular methods. 16S ribosomal DNA bacterial genes from DNA isolated from advanced noma lesions of four Nigerian children were PCR amplified with universally conserved primers and spirochetal selective primers and cloned into Escherichia coli. Partial 16S rRNA sequences of approximately 500 bases from 212 cloned inserts were used initially to determine species identity or closest relatives by comparison with sequences of known species or phylotypes. Nearly complete sequences of approximately 1,500 bases were obtained for most of the potentially novel species. A total of 67 bacterial species or phylotypes were detected, 25 of which have not yet been grown in vitro. Nineteen of the species or phylotypes, including Propionibacterium acnes, Staphylococcus spp., and the opportunistic pathogens Stenotrophomonas maltophilia and Ochrobactrum anthropi were detected in more than one subject. Other known species that were detected included Achromobacter spp., Afipia spp., Brevundimonas diminuta, Capnocytophaga spp., Cardiobacterium sp., Eikenella corrodens, Fusobacterium spp., Gemella haemoylsans, and Neisseria spp. Phylotypes that were unique to noma infections included those in the genera Eubacterium, Flavobacterium, Kocuria, Microbacterium, and Porphyromonas and the related Streptococcus salivarius and genera Sphingomonas and TREPONEMA: Since advanced noma lesions are infections open to the environment, it was not surprising to detect species not commonly associated with the oral cavity, e.g., from soil. Several species previously implicated as putative pathogens of noma, such as spirochetes and Fusobacterium spp., were detected in at least one subject. However, due to the limited number of available noma subjects, it was not possible at this time to associate specific species with the disease.

  6. Influence of Multiple Bacterial Populations on Phenanthrene Degradation, Bacterial Cell Elution, and Species Distribution

    NASA Astrophysics Data System (ADS)

    Patterson, B. M.; Brusseau, M. L.; Maier, R. M.; Frye, R.

    2001-05-01

    A single set of degradation coefficients is typically used when representing biodegradation in contaminant transport models. Implicit to this approach is the assumption that only a single degrading isolate exists, or that the entire community of degraders more typically present in natural systems has a uniform, constant growth rate and affinity for the contaminant. This assumption was evaluated through a miscible displacement experiment conducted using a column packed with a soil containing an indigenous microbial community comprised of 24 identified phenanthrene-degrading isolates. Results produced oscillating phenanthrene concentrations in the column effluent, indicating potential competitive interactions among the isolates. A second series of experiments, conducted in a simplified system comprised of sand and 1,2, or 3 indigenous isolates, examined the effects of species interactions on phenanthrene degradation and bacterial cell elution. Bacterial growth rates, density of cells within the column, and bacterial distribution were also evaluated. Results show single bacterial species produced relatively stable cell elution and phenanthrene concentrations in the effluent. Conversely, the behavior in the multiple species systems indicated synergistic and antagonistic interactions occurred among the species. These results illustrate that the dynamics of heterogeneous microbial communities should be considered when evaluating contaminant biodegradation and transport in subsurface systems.

  7. Attached bacterial populations shared by four species of aquatic angiosperms.

    PubMed

    Crump, Byron C; Koch, Evamaria W

    2008-10-01

    Symbiotic relationships between microbes and plants are common and well studied in terrestrial ecosystems, but little is known about such relationships in aquatic environments. We compared the phylogenetic diversities of leaf- and root-attached bacteria from four species of aquatic angiosperms using denaturing gradient gel electrophoresis (DGGE) and DNA sequencing of PCR-amplified 16S rRNA genes. Plants were collected from three beds in Chesapeake Bay at sites characterized as freshwater (Vallisneria americana), brackish (Potomogeton perfoliatus and Stuckenia pectinata), and marine (Zostera marina). DGGE analyses showed that bacterial communities were very similar for replicate samples of leaves from canopy-forming plants S. pectinata and P. perfoliatus and less similar for replicate samples of leaves from meadow-forming plants Z. marina and V. americana and of roots of all species. In contrast, bacterial communities differed greatly among plant species and between leaves and roots. DNA sequencing identified 154 bacterial phylotypes, most of which were restricted to single plant species. However, 12 phylotypes were found on more than one plant species, and several of these phylotypes were abundant in clone libraries and represented the darkest bands in DGGE banding patterns. Root-attached phylotypes included relatives of sulfur-oxidizing Gammaproteobacteria and sulfate-reducing Deltaproteobacteria. Leaf-attached phylotypes included relatives of polymer-degrading Bacteroidetes and phototrophic Alphaproteobacteria. Also, leaves and roots of three plant species hosted relatives of methylotrophic Betaproteobacteria belonging to the family Methylophilaceae. These results suggest that aquatic angiosperms host specialized communities of bacteria on their surfaces, including several broadly distributed and potentially mutualistic bacterial populations.

  8. Panamanian frog species host unique skin bacterial communities

    PubMed Central

    Belden, Lisa K.; Hughey, Myra C.; Rebollar, Eria A.; Umile, Thomas P.; Loftus, Stephen C.; Burzynski, Elizabeth A.; Minbiole, Kevin P. C.; House, Leanna L.; Jensen, Roderick V.; Becker, Matthew H.; Walke, Jenifer B.; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N.

    2015-01-01

    Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont

  9. Panamanian frog species host unique skin bacterial communities.

    PubMed

    Belden, Lisa K; Hughey, Myra C; Rebollar, Eria A; Umile, Thomas P; Loftus, Stephen C; Burzynski, Elizabeth A; Minbiole, Kevin P C; House, Leanna L; Jensen, Roderick V; Becker, Matthew H; Walke, Jenifer B; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N

    2015-01-01

    Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont

  10. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  11. The bacterial species dilemma and the genomic–phylogenetic species concept

    PubMed Central

    Staley, James T

    2006-01-01

    The number of species of Bacteria and Archaea (ca 5000) is surprisingly small considering their early evolution, genetic diversity and residence in all ecosystems. The bacterial species definition accounts in part for the small number of named species. The primary procedures required to identify new species of Bacteria and Archaea are DNA–DNA hybridization and phenotypic characterization. Recently, 16S rRNA gene sequencing and phylogenetic analysis have been applied to bacterial taxonomy. Although 16S phylogeny is arguably excellent for classification of Bacteria and Archaea from the Domain level down to the family or genus, it lacks resolution below that level. Newer approaches, including multilocus sequence analysis, and genome sequence and microarray analyses, promise to provide necessary information to better understand bacterial speciation. Indeed, recent data using these approaches, while meagre, support the view that speciation processes may occur at the subspecies level within ecological niches (ecovars) and owing to biogeography (geovars). A major dilemma for bacterial taxonomists is how to incorporate this new information into the present hierarchical system for classification of Bacteria and Archaea without causing undesirable confusion and contention. This author proposes the genomic–phylogenetic species concept (GPSC) for the taxonomy of prokaryotes. The aim is twofold. First, the GPSC would provide a conceptual and testable framework for bacterial taxonomy. Second, the GPSC would replace the burdensome requirement for DNA hybridization presently needed to describe new species. Furthermore, the GPSC is consistent with the present treatment at higher taxonomic levels. PMID:17062409

  12. Cutaneous bacterial species from Lithobates catesbeianus can inhibit pathogenic dermatophytes.

    PubMed

    Lauer, Antje; Hernandez, Trang

    2015-04-01

    Antibiotics are being successfully used to fight many infectious diseases caused by pathogenic microorganisms. However, new infectious diseases are continuously being identified, and some known pathogens are becoming resistant against known antibiotics. Furthermore, many antifungals are causing serious side effects in long-term treatments of patients, and many skin infections caused by dermatophytes are difficult to cure. The beneficial roles of resident cutaneous microbiota to inhibit pathogenic microorganisms have been shown for many vertebrate species. Microbial symbionts on the amphibian skin for example can be a source of powerful antimicrobial metabolites that can protect amphibians against diseases, such as chytridiomycosis, caused by a fungal pathogen. In this research, we investigated whether cutaneous bacterial species isolated from Lithobates catesbeianus (North American bullfrog), an invasive amphibian species that is resistant to chytridiomycosis, produce secondary metabolites that can be used to inhibit the growth of three species of dermatophytes (Microsporum gypseum, Epidermophyton floccosum, and Trichophyton mentagrophytes) which are known to cause topical or subdermal skin infections in humans. Strongly anti-dermatophyte bacterial species that belonged to the Bacillaceae, Streptomycetaceae, Pseudomonadaceae, Xanthomonadaceae, Aeromonadaceae, and Enterobacteriaceae were identified. This research has provided evidence of the presence of cutaneous anti-dermatophyte bacteria from L. catesbeianus which might provide a basis for health care providers to experiment with new antifungals in the future. PMID:25431089

  13. Comparison of Rapid Methods for Analysis of Bacterial Fatty Acids

    PubMed Central

    Moss, C. Wayne; Lambert, M. A.; Merwin, W. H.

    1974-01-01

    When rapid gas-liquid chromatography methods for determination of bacterial fatty acids were compared, results showed that saponification was required for total fatty acid analysis. Transesterification with boron-trihalide reagents (BF3-CH3OH, BCl3-CH3OH) caused extensive degradation of cyclopropane acids and was less effective than saponification in releasing cellular hydroxy fatty acids. Digestion of cells with tetramethylammonium hydroxide was unsatisfactory because of extraneous gas-liquid chromatography peaks and because of lower recovery of branched-chain and hydroxy fatty acids. A simple, rapid saponification procedure which can be used for total cellular fatty acid analysis of freshly grown cells is described. PMID:4844271

  14. Temporal changes in species interactions in simple aquatic bacterial communities

    PubMed Central

    2012-01-01

    Background Organisms modify their environment and in doing so change the quantity and possibly the quality of available resources. Due to the two-way relationship between organisms and their resource environment, and the complexity it brings to biological communities, measuring species interactions reliably in any biological system is a challenging task. As the resource environment changes, the intensity and even the sign of interactions may vary in time. We used Serratia marcescens and Novosphingobium capsulatum bacteria to study how the interaction between resource environment and organisms influence the growth of the bacterial species during circa 200 generations. We used a sterile-filtering method to measure how changes in resource environment are reflected in growth rates of the two species. Results Changes in the resource environment caused complex time and species composition-dependent effects on bacterial growth performance. Variation in the quality of the growth medium indicated existence of temporally fluctuating within-species facilitation and inhibition, and between-species asymmetric facilitation. Conclusions The interactions between the community members could not be fully predicted based only on the knowledge of the growth performance of each member in isolation. Growth dynamics in sterile-filtered samples of the conditioned growth medium can reveal both biologically meaningful changes in resource availability and temporally changing facilitative resource-mediated interactions between study species. This is the first study we are aware of where the filter-sterilization – growth assay method is applied to study the effect of long-term changes in the environment on species interactions. PMID:22984961

  15. The bacterial species definition in the genomic era

    PubMed Central

    Konstantinidis, Konstantinos T; Ramette, Alban; Tiedje, James M

    2006-01-01

    The bacterial species definition, despite its eminent practical significance for identification, diagnosis, quarantine and diversity surveys, remains a very difficult issue to advance. Genomics now offers novel insights into intra-species diversity and the potential for emergence of a more soundly based system. Although we share the excitement, we argue that it is premature for a universal change to the definition because current knowledge is based on too few phylogenetic groups and too few samples of natural populations. Our analysis of five important bacterial groups suggests, however, that more stringent standards for species may be justifiable when a solid understanding of gene content and ecological distinctiveness becomes available. Our analysis also reveals what is actually encompassed in a species according to the current standards, in terms of whole-genome sequence and gene-content diversity, and shows that this does not correspond to coherent clusters for the environmental Burkholderia and Shewanella genera examined. In contrast, the obligatory pathogens, which have a very restricted ecological niche, do exhibit clusters. Therefore, the idea of biologically meaningful clusters of diversity that applies to most eukaryotes may not be universally applicable in the microbial world, or if such clusters exist, they may be found at different levels of distinction. PMID:17062412

  16. Patterns of Gut Bacterial Colonization in Three Primate Species

    PubMed Central

    McKenney, Erin A.; Rodrigo, Allen; Yoder, Anne D.

    2015-01-01

    Host fitness is impacted by trillions of bacteria in the gastrointestinal tract that facilitate development and are inextricably tied to life history. During development, microbial colonization primes the gut metabolism and physiology, thereby setting the stage for adult nutrition and health. However, the ecological rules governing microbial succession are poorly understood. In this study, we examined the relationship between host lineage, captive diet, and life stage and gut microbiota characteristics in three primate species (infraorder, Lemuriformes). Fecal samples were collected from captive lemur mothers and their infants, from birth to weaning. Microbial DNA was extracted and the v4 region of 16S rDNA was sequenced on the Illumina platform using protocols from the Earth Microbiome Project. Here, we show that colonization proceeds along different successional trajectories in developing infants from species with differing dietary regimes and ecological profiles: frugivorous (fruit-eating) Varecia variegata, generalist Lemur catta, and folivorous (leaf-eating) Propithecus coquereli. Our analyses reveal community membership and succession patterns consistent with previous studies of human infants, suggesting that lemurs may serve as a useful model of microbial ecology in the primate gut. Each lemur species exhibits distinct species-specific bacterial diversity signatures correlating to life stages and life history traits, implying that gut microbial community assembly primes developing infants at species-specific rates for their respective adult feeding strategies. PMID:25970595

  17. Wall teichoic acid structure governs horizontal gene transfer between major bacterial pathogens.

    PubMed

    Winstel, Volker; Liang, Chunguang; Sanchez-Carballo, Patricia; Steglich, Matthias; Munar, Marta; Bröker, Barbara M; Penadés, Jose R; Nübel, Ulrich; Holst, Otto; Dandekar, Thomas; Peschel, Andreas; Xia, Guoqing

    2013-01-01

    Mobile genetic elements (MGEs) encoding virulence and resistance genes are widespread in bacterial pathogens, but it has remained unclear how they occasionally jump to new host species. Staphylococcus aureus clones exchange MGEs such as S. aureus pathogenicity islands (SaPIs) with high frequency via helper phages. Here we report that the S. aureus ST395 lineage is refractory to horizontal gene transfer (HGT) with typical S. aureus but exchanges SaPIs with other species and genera including Staphylococcus epidermidis and Listeria monocytogenes. ST395 produces an unusual wall teichoic acid (WTA) resembling that of its HGT partner species. Notably, distantly related bacterial species and genera undergo efficient HGT with typical S. aureus upon ectopic expression of S. aureus WTA. Combined with genomic analyses, these results indicate that a 'glycocode' of WTA structures and WTA-binding helper phages permits HGT even across long phylogenetic distances thereby shaping the evolution of Gram-positive pathogens.

  18. Bacterial defluorination of 4-fluoroglutamic acid.

    PubMed

    Donnelly, Clár; Murphy, Cormac D

    2007-12-01

    Fluorinated amino acids are used as enzyme inhibitors, mechanistic probes and in the production of pharmacologically active peptides. Because enantiomerically pure 4-fluoroglutamate is difficult to prepare, the selective degradation of the L-isomer is a potentially convenient method of obtaining D-4-fluoroglutamate from the racemate. In this paper, we describe our investigations on the degradation of 4-fluoroglutamate by bacteria. Fluoride ion was detected in resting-cell cultures of a number of bacteria that were incubated with racemic 4-fluoroglutamate. Analysis of the culture supernatants by chiral gas chromatography-mass spectrometry revealed that only the L-isomer was degraded. The degradation of 4-fluoroglutamate was also examined in cell-free extracts of Streptomyces cattleya and Proteus mirabilis, and it was observed that equimolar concentrations of fluoride ion and ammonia were generated. The activity was located in the soluble fraction of cell extracts, thus is not related to the L-2-amino-4-chloro-4-pentenoic acid dehydrochlorinase previously identified in membrane fractions of P. mirabilis.

  19. Amino Acid-Based Zwitterionic Polymer Surfaces Highly Resist Long-Term Bacterial Adhesion.

    PubMed

    Liu, Qingsheng; Li, Wenchen; Wang, Hua; Newby, Bi-Min Zhang; Cheng, Fang; Liu, Lingyun

    2016-08-01

    The surfaces or coatings that can effectively suppress bacterial adhesion in the long term are of critical importance for biomedical applications. Herein, a group of amino acid-based zwitterionic polymers (pAAZ) were investigated for their long-term resistance to bacterial adhesion. The polymers were derived from natural amino acids including serine, ornithine, lysine, aspartic acid, and glutamic acid. The pAAZ brushes were grafted on gold via the surface-initiated photoiniferter-mediated polymerization (SI-PIMP). Results show that the pAAZ coatings highly suppressed adsorption from the undiluted human serum and plasma. Long-term bacterial adhesion on these surfaces was investigated, using two kinds of representative bacteria [Gram-positive Staphylococcus epidermidis and Gram-negative Pseudomonas aeruginosa] as the model species. Results demonstrate that the pAAZ surfaces were highly resistant to bacterial adhesion after culturing for 1, 5, 9, or even 14 days, representing at least 95% reduction at all time points compared to the control unmodified surfaces. The bacterial accumulation on the pAAZ surfaces after 9 or 14 days was even lower than on the surfaces grafted with poly[poly(ethyl glycol) methyl ether methacrylate] (pPEGMA), one of the most common antifouling materials known to date. The pAAZ brushes also exhibited excellent structural stability in phosphate-buffered saline after incubation for 4 weeks. The bacterial resistance and stability of pAAZ polymers suggest they have good potential to be used for those applications where long-term suppression to bacterial attachment is desired. PMID:27397718

  20. Bacterial Communities of Two Ubiquitous Great Barrier Reef Corals Reveals Both Site- and Species-Specificity of Common Bacterial Associates

    PubMed Central

    Kvennefors, E. Charlotte E.; Sampayo, Eugenia; Ridgway, Tyrone; Barnes, Andrew C.; Hoegh-Guldberg, Ove

    2010-01-01

    Background Coral-associated bacteria are increasingly considered to be important in coral health, and altered bacterial community structures have been linked to both coral disease and bleaching. Despite this, assessments of bacterial communities on corals rarely apply sufficient replication to adequately describe the natural variability. Replicated data such as these are crucial in determining potential roles of bacteria on coral. Methodology/Principal Findings Denaturing Gradient Gel Electrophoresis (DGGE) of the V3 region of the 16S ribosomal DNA was used in a highly replicated approach to analyse bacterial communities on both healthy and diseased corals. Although site-specific variations in the bacterial communities of healthy corals were present, host species-specific bacterial associates within a distinct cluster of gamma-proteobacteria could be identified, which are potentially linked to coral health. Corals affected by “White Syndrome” (WS) underwent pronounced changes in their bacterial communities in comparison to healthy colonies. However, the community structure and bacterial ribotypes identified in diseased corals did not support the previously suggested theory of a bacterial pathogen as the causative agent of the syndrome. Conclusions/Significance This is the first study to employ large numbers of replicated samples to assess the bacterial communities of healthy and diseased corals, and the first culture-independent assessment of bacterial communities on WS affected Acroporid corals on the GBR. Results indicate that a minimum of 6 replicate samples are required in order to draw inferences on species, spatial or health-related changes in community composition, as a set of clearly distinct bacterial community profiles exist in healthy corals. Coral bacterial communities may be both site and species specific. Furthermore, a cluster of gamma-proteobacterial ribotypes may represent a group of specific common coral and marine invertebrate associates

  1. Progress in lactic acid bacterial phage research

    PubMed Central

    2014-01-01

    Research on lactic acid bacteria (LAB) has advanced significantly over the past number of decades and these developments have been driven by the parallel advances in technologies such as genomics, bioinformatics, protein expression systems and structural biology, combined with the ever increasing commercial relevance of this group of microorganisms. Some of the more significant and impressive outputs have been in the domain of bacteriophage-host interactions which provides a prime example of the cutting-edge model systems represented by LAB research. Here, we present a retrospective overview of the key advances in LAB phage research including phage-host interactions and co-evolution. We describe how in many instances this knowledge can be pivotal in creating real improvements in the application of LAB cultures in commercial practice. PMID:25185514

  2. Nucleic acid detection technologies and marker molecules in bacterial diagnostics.

    PubMed

    Scheler, Ott; Glynn, Barry; Kurg, Ants

    2014-05-01

    There is a growing need for quick and reliable methods for microorganism detection and identification worldwide. Although traditional culture-based technologies are trustworthy and accurate at a relatively low cost, they are also time- and labor-consuming and are limited to culturable bacteria. Those weaknesses have created a necessity for alternative technologies that are capable for faster and more precise bacterial identification from medical, food or environmental samples. The most common current approach is to analyze the nucleic acid component of analyte solution and determine the bacterial composition according to the specific nucleic acid profiles that are present. This review aims to give an up-to-date overview of different nucleic acid target sequences and respective analytical technologies.

  3. Validation of hierarchical cluster analysis for identification of bacterial species using 42 bacterial isolates

    NASA Astrophysics Data System (ADS)

    Ghebremedhin, Meron; Yesupriya, Shubha; Luka, Janos; Crane, Nicole J.

    2015-03-01

    Recent studies have demonstrated the potential advantages of the use of Raman spectroscopy in the biomedical field due to its rapidity and noninvasive nature. In this study, Raman spectroscopy is applied as a method for differentiating between bacteria isolates for Gram status and Genus species. We created models for identifying 28 bacterial isolates using spectra collected with a 785 nm laser excitation Raman spectroscopic system. In order to investigate the groupings of these samples, partial least squares discriminant analysis (PLSDA) and hierarchical cluster analysis (HCA) was implemented. In addition, cluster analyses of the isolates were performed using various data types consisting of, biochemical tests, gene sequence alignment, high resolution melt (HRM) analysis and antimicrobial susceptibility tests of minimum inhibitory concentration (MIC) and degree of antimicrobial resistance (SIR). In order to evaluate the ability of these models to correctly classify bacterial isolates using solely Raman spectroscopic data, a set of 14 validation samples were tested using the PLSDA models and consequently the HCA models. External cluster evaluation criteria of purity and Rand index were calculated at different taxonomic levels to compare the performance of clustering using Raman spectra as well as the other datasets. Results showed that Raman spectra performed comparably, and in some cases better than, the other data types with Rand index and purity values up to 0.933 and 0.947, respectively. This study clearly demonstrates that the discrimination of bacterial species using Raman spectroscopic data and hierarchical cluster analysis is possible and has the potential to be a powerful point-of-care tool in clinical settings.

  4. Extensive Identification of Bacterial Riboflavin Transporters and Their Distribution across Bacterial Species

    PubMed Central

    Merino, Enrique; Bonomi, Hernán Ruy; Goldbaum, Fernando Alberto; García-Angulo, Víctor Antonio

    2015-01-01

    Riboflavin, the precursor for the cofactors flavin mononucleotide (FMN) and flavin adenine dinucleotide, is an essential metabolite in all organisms. While the functions for de novo riboflavin biosynthesis and riboflavin import may coexist in bacteria, the extent of this co-occurrence is undetermined. The RibM, RibN, RfuABCD and the energy-coupling factor-RibU bacterial riboflavin transporters have been experimentally characterized. In addition, ImpX, RfnT and RibXY are proposed as riboflavin transporters based on positional clustering with riboflavin biosynthetic pathway (RBP) genes or conservation of the FMN riboswitch regulatory element. Here, we searched for the FMN riboswitch in bacterial genomes to identify genes encoding riboflavin transporters and assessed their distribution among bacteria. Two new putative riboflavin transporters were identified: RibZ in Clostridium and RibV in Mesoplasma florum. Trans-complementation of an Escherichia coli riboflavin auxotroph strain confirmed the riboflavin transport activity of RibZ from Clostridium difficile, RibXY from Chloroflexus aurantiacus, ImpX from Fusobacterium nucleatum and RfnT from Ochrobactrum anthropi. The analysis of the genomic distribution of all known bacterial riboflavin transporters revealed that most occur in species possessing the RBP and that some bacteria may even encode functional riboflavin transporters from two different families. Our results indicate that some species possess ancestral riboflavin transporters, while others possess transporters that appear to have evolved recently. Moreover, our data suggest that unidentified riboflavin transporters also exist. The present study doubles the number of experimentally characterized riboflavin transporters and suggests a specific, non-accessory role for these proteins in riboflavin-prototrophic bacteria. PMID:25938806

  5. Reverse Transcriptase-PCR Analysis of Bacterial rRNA for Detection and Characterization of Bacterial Species in Arthritis Synovial Tissue

    PubMed Central

    Kempsell, Karen E.; Cox, Charles J.; Hurle, Michael; Wong, Anthony; Wilkie, Scott; Zanders, Edward D.; Gaston, J. S. Hill; Crowe, J. Scott

    2000-01-01

    Onset of rheumatoid arthritis (RA) is widely believed to be preceded by exposure to some environmental trigger such as bacterial infectious agents. The influence of bacteria on RA disease onset or pathology has to date been controversial, due to inconsistencies between groups in the report of bacterial species isolated from RA disease tissue. Using a modified technique of reverse transcriptase-PCR amplification, we have detected bacterial rRNA in the synovial tissue of late-stage RA and non-RA arthritis controls. This may be suggestive of the presence of live bacteria. Sequencing of cloned complementary rDNA (crDNA) products revealed a number of bacterial sequences in joint tissue from each patient, and from these analyses a comprehensive profile of the organisms present was compiled. This revealed a number of different organisms in each patient, some of which are common to both RA and non-RA controls and are probably opportunistic colonizers of previously diseased tissue and others which are unique species. These latter organisms may be candidates for a specific role in disease pathology and require further investigation to exclude them as causative agents in the complex bacterial millieu. In addition, many of the detected bacterial species have not been identified previously from synovial tissue or fluid from arthritis patients. These may not be easily cultivable, since they were not revealed in previous studies using conventional in vitro bacterial culture methods. In situ hybridization analyses have revealed the joint-associated bacterial rRNA to be both intra- and extracellular. The role of viable bacteria or their nucleic acids as triggers in disease onset or pathology in either RA or non-RA arthritis controls is unclear and requires further investigation. PMID:10992514

  6. Bacterial community composition associated with freshwater algae: species specificity vs. dependency on environmental conditions and source community.

    PubMed

    Eigemann, Falk; Hilt, Sabine; Salka, Ivette; Grossart, Hans-Peter

    2013-03-01

    We studied bacterial associations with the green alga Desmodesmus armatus and the diatom Stephanodiscus minutulus under changing environmental conditions and bacterial source communities, to evaluate whether bacteria-algae associations are species-specific or more generalized and determined by external factors. Axenic and xenic algae were incubated in situ with and without allelopathically active macrophytes, and in the laboratory with sterile and nonsterile lake water and an allelochemical, tannic acid (TA). Bacterial community composition (BCC) of algae-associated bacteria was analyzed by denaturing gradient gel electrophoresis (DGGE), nonmetric multidimensional scaling, cluster analyses, and sequencing of DGGE bands. BCC of xenic algal cultures of both species were not significantly affected by changes in their environment or bacterial source community, except in the case of TA additions. Species-specific interactions therefore appear to overrule the effects of environmental conditions and source communities. The BCC of xenic and axenic D. armatus cultures subjected to in situ bacterial colonization, however, had lower similarities (ca. 55%), indicating that bacterial precolonization is a strong factor for bacteria-algae associations irrespective of environmental conditions and source community. Our findings emphasize the ecological importance of species-specific bacteria-algae associations with important repercussions for other processes, such as the remineralization of nutrients, and organic matter dynamics.

  7. Comparative fatty acid composition of four Sargassum species (Fucales, Phaeophyta)

    NASA Astrophysics Data System (ADS)

    Wu, Xiang-Chun; Lu, Bao-Ren; Tseng, C. K.

    1995-12-01

    Fatty acid composition of four Sargassum species from Qingdao and Shidao, Shandong Province was investigated. 16:0 (palmitic acid) was the major saturated fatty acid. C18 and C20 were the main polyunsaturated fatty acids (PUFAs). Arachidonic acid and eicosapentaenoic acid predominated among polyenoic acids in all the algal species examined, except for Sargassum sp. which had low concentration of eicosapentaenoic acid.

  8. Whole-genome sequence comparison as a method for improving bacterial species definition.

    PubMed

    Zhang, Wen; Du, Pengcheng; Zheng, Han; Yu, Weiwen; Wan, Li; Chen, Chen

    2014-01-01

    We compared pairs of 1,226 bacterial strains with whole genome sequences and calculated their average nucleotide identity (ANI) between genomes to determine whether whole genome comparison can be directly used for bacterial species definition. We found that genome comparisons of two bacterial strains from the same species (SGC) have a significantly higher ANI than those of two strains from different species (DGC), and that the ANI between the query and the reference genomes can be used to determine whether two genomes come from the same species. Bacterial species definition based on ANI with a cut-off value of 0.92 matched well (81.5%) with the current bacterial species definition. The ANI value was shown to be consistent with the standard for traditional bacterial species definition, and it could be used in bacterial taxonomy for species definition. A new bioinformatics program (ANItools) was also provided in this study for users to obtain the ANI value of any two bacterial genome pairs (http://genome.bioinfo-icdc.org/). This program can match a query strain to all bacterial genomes, and identify the highest ANI value of the strain at the species, genus and family levels respectively, providing valuable insights for species definition.

  9. Bacterial Associates of Two Caribbean Coral Species Reveal Species-Specific Distribution and Geographic Variability

    PubMed Central

    Moss, Anthony G.; Chadwick, Nanette E.; Liles, Mark R.

    2012-01-01

    Scleractinian corals harbor microorganisms that form dynamic associations with the coral host and exhibit substantial genetic and ecological diversity. Microbial associates may provide defense against pathogens and serve as bioindicators of changing environmental conditions. Here we describe the bacterial assemblages associated with two of the most common and phylogenetically divergent reef-building corals in the Caribbean, Montastraea faveolata and Porites astreoides. Contrasting life history strategies and disease susceptibilities indicate potential differences in their microbiota and immune function that may in part drive changes in the composition of coral reef communities. The ribotype structure and diversity of coral-associated bacteria within the surface mucosal layer (SML) of healthy corals were assessed using denaturing gradient gel electrophoresis (DGGE) fingerprinting and 454 bar-coded pyrosequencing. Corals were sampled at disparate Caribbean locations representing various levels of anthropogenic impact. We demonstrate here that M. faveolata and P. astreoides harbor distinct, host-specific bacteria but that specificity varies by species and site. P. astreoides generally hosts a bacterial assemblage of low diversity that is largely dominated by one bacterial genus, Endozoicomonas, within the order Oceanospirillales. The bacterial assemblages associated with M. faveolata are significantly more diverse and exhibit higher specificity at the family level than P. astreoides assemblages. Both corals have more bacterial diversity and higher abundances of disease-related bacteria at sites closer to the mainland than at those furthest away. The most diverse bacterial taxa and highest relative abundance of disease-associated bacteria were seen for corals near St. Thomas, U.S. Virgin Islands (USVI) (2.5 km from shore), and the least diverse taxa and lowest relative abundance were seen for corals near our most pristine site in Belize (20 km from shore). We conclude

  10. Bacterial communities and species-specific associations with the mucus of Brazilian coral species.

    PubMed

    Carlos, Camila; Torres, Tatiana T; Ottoboni, Laura M M

    2013-01-01

    We investigated the existence of species-specific associations between Brazilian coral species and bacteria. Pyrosequencing of the V3 region of the 16S rDNA was used to analyze the taxonomic composition of bacterial communities associated with the mucus of four coral species (Madracis decactis, Mussismilia hispida, Palythoa caribaeorum, and Tubastraea coccinea) in two seasons (winter and summer), which were compared with the surrounding water and sediment. The microbial communities found in samples of mucus, water, and sediment differed according to the composition and relative frequency of OTUs. The coral mucus community seemed to be more stable and resistant to seasonal variations, compared to the water and sediment communities. There was no influence of geographic location on the composition of the communities. The sediment community was extremely diverse and might act as a "seed bank" for the entire environment. Species-specific OTUs were found in P. caribaeorum, T. coccinea, and M. hispida. PMID:23567936

  11. Bacterial communities and species-specific associations with the mucus of Brazilian coral species

    PubMed Central

    Carlos, Camila; Torres, Tatiana T.; Ottoboni, Laura M. M.

    2013-01-01

    We investigated the existence of species-specific associations between Brazilian coral species and bacteria. Pyrosequencing of the V3 region of the 16S rDNA was used to analyze the taxonomic composition of bacterial communities associated with the mucus of four coral species (Madracis decactis, Mussismilia hispida, Palythoa caribaeorum, and Tubastraea coccinea) in two seasons (winter and summer), which were compared with the surrounding water and sediment. The microbial communities found in samples of mucus, water, and sediment differed according to the composition and relative frequency of OTUs. The coral mucus community seemed to be more stable and resistant to seasonal variations, compared to the water and sediment communities. There was no influence of geographic location on the composition of the communities. The sediment community was extremely diverse and might act as a "seed bank" for the entire environment. Species-specific OTUs were found in P. caribaeorum, T. coccinea, and M. hispida. PMID:23567936

  12. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors

    PubMed Central

    Getino, María; Fernández-López, Raúl; Palencia-Gándara, Carolina; Campos-Gómez, Javier; Sánchez-López, Jose M.; Martínez, Marta; Fernández, Antonio; de la Cruz, Fernando

    2016-01-01

    Bacterial conjugation is the main mechanism for the dissemination of multiple antibiotic resistance in human pathogens. This dissemination could be controlled by molecules that interfere with the conjugation process. A search for conjugation inhibitors among a collection of 1,632 natural compounds, identified tanzawaic acids A and B as best hits. They specially inhibited IncW and IncFII conjugative systems, including plasmids mobilized by them. Plasmids belonging to IncFI, IncI, IncL/M, IncX and IncH incompatibility groups were targeted to a lesser extent, whereas IncN and IncP plasmids were unaffected. Tanzawaic acids showed reduced toxicity in bacterial, fungal or human cells, when compared to synthetic conjugation inhibitors, opening the possibility of their deployment in complex environments, including natural settings relevant for antibiotic resistance dissemination. PMID:26812051

  13. Bacterial communities of two parthenogenetic aphid species cocolonizing two host plants across the Hawaiian Islands.

    PubMed

    Jones, Ryan T; Bressan, Alberto; Greenwell, April M; Fierer, Noah

    2011-12-01

    Aphids (Hemiptera: Aphididae) have been the focus of several studies with respect to their interactions with inherited symbionts, but bacterial communities of most aphid species are still poorly characterized. In this research, we used bar-coded pyrosequencing to characterize bacterial communities in aphids. Specifically, we examined the diversity of bacteria in two obligately parthenogenetic aphid species (the melon aphid, Aphis gossypii, and the cardamom aphid, Pentalonia caladii) cocolonizing two plant species (taro, Colocasia esculenta, and ginger, Alpinia purpurata) across four Hawaiian Islands (Hawaii, Kauai, Maui, and Oahu). Results from this study revealed that heritable symbionts dominated the bacterial communities for both aphid species. The bacterial communities differed significantly between the two species, and A. gossypii harbored a more diverse bacterial community than P. caladii. The bacterial communities also differed across aphid populations sampled from the different islands; however, communities did not differ between aphids collected from the two host plants. PMID:21965398

  14. Rosacea, Reactive Oxygen Species, and Azelaic Acid

    PubMed Central

    2009-01-01

    Rosacea is a common skin condition thought to be primarily an inflammatory disorder. Neutrophils, in particular, have been implicated in the inflammation associated with rosacea and mediate many of their effects through the release of reactive oxygen species. Recently, the role of reactive oxygen species in the pathophysiology of rosacea has been recognized. Many effective agents for rosacea, including topical azelaic acid and topical metronidazole, have anti-inflammatory properties. in-vitro models have demonstrated the potent antioxidant effects of azelaic acid, providing a potential mechanistic explanation for its efficacy in the treatment of rosacea. PMID:20967185

  15. Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species

    PubMed Central

    Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao

    2016-01-01

    Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species. PMID:27630804

  16. Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species.

    PubMed

    Kandi, Venkataramana; Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao

    2016-01-01

    Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species. PMID:27630804

  17. Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species

    PubMed Central

    Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao

    2016-01-01

    Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species.

  18. Biomimetic/Optical Sensors for Detecting Bacterial Species

    NASA Technical Reports Server (NTRS)

    Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth

    2006-01-01

    Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites

  19. Method for construction of bacterial strains with increased succinic acid production

    DOEpatents

    Donnelly, Mark I.; Sanville-Millard, Cynthia; Chatterjee, Ranjini

    2000-01-01

    A fermentation process for producing succinic acid is provided comprising selecting a bacterial strain that does not produce succinic acid in high yield, disrupting the normal regulation of sugar metabolism of said bacterial strain, and combining the mutant bacterial strain and selected sugar in anaerobic conditions to facilitate production of succinic acid. Also provided is a method for changing low yield succinic acid producing bacteria to high yield succinic acid producing bacteria comprising selecting a bacterial strain having a phosphotransferase system and altering the phosphotransferase system so as to allow the bacterial strain to simultaneously metabolize different sugars.

  20. What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira.

    PubMed

    Fouts, Derrick E; Matthias, Michael A; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L; Haake, David A; Haft, Daniel H; Hartskeerl, Rudy; Ko, Albert I; Levett, Paul N; Matsunaga, James; Mechaly, Ariel E; Monk, Jonathan M; Nascimento, Ana L T; Nelson, Karen E; Palsson, Bernhard; Peacock, Sharon J; Picardeau, Mathieu; Ricaldi, Jessica N; Thaipandungpanit, Janjira; Wunder, Elsio A; Yang, X Frank; Zhang, Jun-Jie; Vinetz, Joseph M

    2016-02-01

    Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic

  1. What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira.

    PubMed

    Fouts, Derrick E; Matthias, Michael A; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L; Haake, David A; Haft, Daniel H; Hartskeerl, Rudy; Ko, Albert I; Levett, Paul N; Matsunaga, James; Mechaly, Ariel E; Monk, Jonathan M; Nascimento, Ana L T; Nelson, Karen E; Palsson, Bernhard; Peacock, Sharon J; Picardeau, Mathieu; Ricaldi, Jessica N; Thaipandungpanit, Janjira; Wunder, Elsio A; Yang, X Frank; Zhang, Jun-Jie; Vinetz, Joseph M

    2016-02-01

    Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic

  2. What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira

    PubMed Central

    Fouts, Derrick E.; Matthias, Michael A.; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E.; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L.; Haake, David A.; Haft, Daniel H.; Hartskeerl, Rudy; Ko, Albert I.; Levett, Paul N.; Matsunaga, James; Mechaly, Ariel E.; Monk, Jonathan M.; Nascimento, Ana L. T.; Nelson, Karen E.; Palsson, Bernhard; Peacock, Sharon J.; Picardeau, Mathieu; Ricaldi, Jessica N.; Thaipandungpanit, Janjira; Wunder, Elsio A.; Yang, X. Frank; Zhang, Jun-Jie; Vinetz, Joseph M.

    2016-01-01

    Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade’s refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic

  3. Identification of bacterial species by untargeted NMR spectroscopy of the exo-metabolome.

    PubMed

    Palama, T L; Canard, I; Rautureau, G J P; Mirande, C; Chatellier, S; Elena-Herrmann, B

    2016-08-01

    Identification of bacterial species is a crucial bottleneck for clinical diagnosis of infectious diseases. Quick and reliable identification is a key factor to provide suitable antibiotherapies and avoid the development of multiple-drug resistance. We propose a novel nuclear magnetic resonance (NMR)-based metabolomics strategy for rapid discrimination and identification of several bacterial species that relies on untargeted metabolic profiling of supernatants from bacterial culture media. We show that six bacterial species (Gram negative: Escherichia coli, Pseudomonas aeruginosa, Proteus mirabilis; Gram positive: Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus saprophyticus) can be well discriminated from multivariate statistical analysis, opening new prospects for NMR applications to microbial clinical diagnosis. PMID:27349704

  4. Co-habiting amphibian species harbor unique skin bacterial communities in wild populations

    PubMed Central

    McKenzie, Valerie J; Bowers, Robert M; Fierer, Noah; Knight, Rob; Lauber, Christian L

    2012-01-01

    Although all plant and animal species harbor microbial symbionts, we know surprisingly little about the specificity of microbial communities to their hosts. Few studies have compared the microbiomes of different species of animals, and fewer still have examined animals in the wild. We sampled four pond habitats in Colorado, USA, where multiple amphibian species were present. In total, 32 amphibian individuals were sampled from three different species including northern leopard frogs (Lithobates pipiens), western chorus frogs (Pseudacris triseriata) and tiger salamanders (Ambystoma tigrinum). We compared the diversity and composition of the bacterial communities on the skin of the collected individuals via barcoded pyrosequencing of the 16S rRNA gene. Dominant bacterial phyla included Acidobacteria, Actinobacteria, Bacteriodetes, Cyanobacteria, Firmicutes and Proteobacteria. In total, we found members of 18 bacterial phyla, comparable to the taxonomic diversity typically found on human skin. Levels of bacterial diversity varied strongly across species: L. pipiens had the highest diversity; A. tigrinum the lowest. Host species was a highly significant predictor of bacterial community similarity, and co-habitation within the same pond was not significant, highlighting that the skin-associated bacterial communities do not simply reflect those bacterial communities found in their surrounding environments. Innate species differences thus appear to regulate the structure of skin bacterial communities on amphibians. In light of recent discoveries that some bacteria on amphibian skin have antifungal activity, our finding suggests that host-specific bacteria may have a role in the species-specific resistance to fungal pathogens. PMID:21955991

  5. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

    PubMed Central

    Alonzo, Francis

    2016-01-01

    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

  6. Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco.

    PubMed

    Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Juergen

    2013-11-01

    Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance.

  7. Catecholamines and in vitro growth of pathogenic bacteria: enhancement of growth varies greatly among bacterial species

    NASA Technical Reports Server (NTRS)

    Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald

    2003-01-01

    The purpose of this study was to examine the effects of catecholamines on in vitro growth of a range of bacterial species, including anaerobes. Bacteria tested included: Porphyromonas gingivalis, Bacteriodes fragilis, Shigella boydii, Shigella sonnie, Enterobacter Sp, and Salmonella choleraesuis. The results of the current study indicated that supplementation of bacterial cultures in minimal medium with norepinephrine or epinephrine did not result in increased growth of bacteria. Positive controls involving treatment of Escherichia coli with catecholamines did result in increased growth of that bacterial species. The results of the present study extend previous observations that showed differential capability of catecholamines to enhance bacterial growth in vitro.

  8. Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar.

    PubMed

    Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng

    2016-05-01

    Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites.

  9. Lactic acid bacterial extract as a biogenic mineral growth modifier

    NASA Astrophysics Data System (ADS)

    Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal

    2009-04-01

    The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.

  10. Assessing the complex sponge microbiota: core, variable and species-specific bacterial communities in marine sponges

    PubMed Central

    Schmitt, Susanne; Tsai, Peter; Bell, James; Fromont, Jane; Ilan, Micha; Lindquist, Niels; Perez, Thierry; Rodrigo, Allen; Schupp, Peter J; Vacelet, Jean; Webster, Nicole; Hentschel, Ute; Taylor, Michael W

    2012-01-01

    Marine sponges are well known for their associations with highly diverse, yet very specific and often highly similar microbiota. The aim of this study was to identify potential bacterial sub-populations in relation to sponge phylogeny and sampling sites and to define the core bacterial community. 16S ribosomal RNA gene amplicon pyrosequencing was applied to 32 sponge species from eight locations around the world's oceans, thereby generating 2567 operational taxonomic units (OTUs at the 97% sequence similarity level) in total and up to 364 different OTUs per sponge species. The taxonomic richness detected in this study comprised 25 bacterial phyla with Proteobacteria, Chloroflexi and Poribacteria being most diverse in sponges. Among these phyla were nine candidate phyla, six of them found for the first time in sponges. Similarity comparison of bacterial communities revealed no correlation with host phylogeny but a tropical sub-population in that tropical sponges have more similar bacterial communities to each other than to subtropical sponges. A minimal core bacterial community consisting of very few OTUs (97%, 95% and 90%) was found. These microbes have a global distribution and are probably acquired via environmental transmission. In contrast, a large species-specific bacterial community was detected, which is represented by OTUs present in only a single sponge species. The species-specific bacterial community is probably mainly vertically transmitted. It is proposed that different sponges contain different bacterial species, however, these bacteria are still closely related to each other explaining the observed similarity of bacterial communities in sponges in this and previous studies. This global analysis represents the most comprehensive study of bacterial symbionts in sponges to date and provides novel insights into the complex structure of these unique associations. PMID:21993395

  11. Species Specific Bacterial Spore Detection Using Lateral-Flow Immunoassay with DPA-Triggered Tb Luminescence

    NASA Technical Reports Server (NTRS)

    Ponce, Adrian

    2003-01-01

    A method of detecting bacterial spores incorporates (1) A method of lateral-flow immunoassay in combination with (2) A method based on the luminescence of Tb3+ ions to which molecules of dipicolinic acid (DPA) released from the spores have become bound. The present combination of lateral-flow immunoassay and DPA-triggered Tb luminescence was developed as a superior alternative to a prior lateral-flow immunoassay method in which detection involves the visual observation and/or measurement of red light scattered from colloidal gold nanoparticles. The advantage of the present combination method is that it affords both (1) High selectivity for spores of the species of bacteria that one seeks to detect (a characteristic of lateral-flow immunoassay in general) and (2) Detection sensitivity much greater (by virtue of the use of DPA-triggered Tb luminescence instead of gold nanoparticles) than that of the prior lateral-flow immunoassay method

  12. Resource-dependent attenuation of species interactions during bacterial succession

    PubMed Central

    Rivett, Damian W; Scheuerl, Thomas; Culbert, Christopher T; Mombrikotb, Shorok B; Johnstone, Emma; Barraclough, Timothy G; Bell, Thomas

    2016-01-01

    Bacterial communities are vital for many economically and ecologically important processes. The role of bacterial community composition in determining ecosystem functioning depends critically on interactions among bacterial taxa. Several studies have shown that, despite a predominance of negative interactions in communities, bacteria are able to display positive interactions given the appropriate evolutionary or ecological conditions. We were interested in how interspecific interactions develop over time in a naturalistic setting of low resource supply rates. We assembled aquatic bacterial communities in microcosms and assayed the productivity (respiration and growth) and substrate degradation while tracking community composition. The results demonstrated that while bacterial communities displayed strongly negative interactions during the early phase of colonisation and acclimatisation to novel biotic and abiotic factors, this antagonism declined over time towards a more neutral state. This was associated with a shift from use of labile substrates in early succession to use of recalcitrant substrates later in succession, confirming a crucial role of resource dynamics in linking interspecific interactions with ecosystem functioning. PMID:26894447

  13. Amazonian dark Earth and plant species from the Amazon region contribute to shape rhizosphere bacterial communities.

    PubMed

    Barbosa Lima, Amanda; Cannavan, Fabiana Souza; Navarrete, Acacio Aparecido; Teixeira, Wenceslau Geraldes; Kuramae, Eiko Eurya; Tsai, Siu Mui

    2015-05-01

    Amazonian Dark Earths (ADE) or Terra Preta de Índio formed in the past by pre-Columbian populations are highly sustained fertile soils supported by microbial communities that differ from those extant in adjacent soils. These soils are found in the Amazon region and are considered as a model soil when compared to the surrounding and background soils. The aim of this study was to assess the effects of ADE and its surrounding soil on the rhizosphere bacterial communities of two leguminous plant species that frequently occur in the Amazon region in forest sites (Mimosa debilis) and open areas (Senna alata). Bacterial community structure was evaluated using terminal restriction fragment length polymorphism (T-RFLP) and bacterial community composition by V4 16S rRNA gene region pyrosequencing. T-RFLP analysis showed effect of soil types and plant species on rhizosphere bacterial community structure. Differential abundance of bacterial phyla, such as Acidobacteria, Actinobacteria, Verrucomicrobia, and Firmicutes, revealed that soil type contributes to shape the bacterial communities. Furthermore, bacterial phyla such as Firmicutes and Nitrospira were mostly influenced by plant species. Plant roots influenced several soil chemical properties, especially when plants were grown in ADE. These results showed that differences observed in rhizosphere bacterial community structure and composition can be influenced by plant species and soil fertility due to variation in soil attributes. PMID:25103911

  14. Crustose coralline algal species host distinct bacterial assemblages on their surfaces.

    PubMed

    Sneed, Jennifer M; Ritson-Williams, Raphael; Paul, Valerie J

    2015-11-01

    Crustose coralline algae (CCA) are important components of many marine ecosystems. They aid in reef accretion and stabilization, create habitat for other organisms, contribute to carbon sequestration and are important settlement substrata for a number of marine invertebrates. Despite their ecological importance, little is known about the bacterial communities associated with CCA or whether differences in bacterial assemblages may have ecological implications. This study examined the bacterial communities on four different species of CCA collected in Belize using bacterial tag-encoded FLX amplicon pyrosequencing of the V1-V3 region of the 16S rDNA. CCA were dominated by Alphaproteobacteria, Gammaproteobacteria and Actinomycetes. At the operational taxonomic unit (OTU) level, each CCA species had a unique bacterial community that was significantly different from all other CCA species. Hydrolithon boergesenii and Titanoderma prototypum, CCA species that facilitate larval settlement in multiple corals, had higher abundances of OTUs related to bacteria that inhibit the growth and/or biofilm formation of coral pathogens. Fewer coral larvae settle on the surfaces of Paragoniolithon solubile and Porolithon pachydermum. These CCA species had higher abundances of OTUs related to known coral pathogens and cyanobacteria. Coral larvae may be able to use the observed differences in bacterial community composition on CCA species to assess the suitability of these substrata for settlement and selectively settle on CCA species that contain beneficial bacteria. PMID:25918832

  15. "Lachnoclostridium bouchesdurhonense," a new bacterial species isolated from human gut microbiota.

    PubMed

    Amadou, T; Hosny, M; La Scola, B; Cassir, N

    2016-09-01

    We report the main characteristics of "Lachnoclostridium bouchesdurhonense" strain AT5(T) (=CSUR P2181), a new bacterial species isolated from the gut microbiota of an obese patient from Marseille. PMID:27493758

  16. 'Lachnoclostridium massiliosenegalense', a new bacterial species isolated from the human gut microbiota.

    PubMed

    Tidjani Alou, M; Lagier, J-C; La Scola, B; Cassir, N

    2016-11-01

    We report the main characteristics of 'Lachnoclostridium massiliosenegalense' strain mt23(T) (=CSUR P299 =DSM 102084), a new bacterial species isolated from the gut microbiota of a healthy young girl from Senegal. PMID:27595004

  17. 'Lachnoclostridium massiliosenegalense', a new bacterial species isolated from the human gut microbiota.

    PubMed

    Tidjani Alou, M; Lagier, J-C; La Scola, B; Cassir, N

    2016-11-01

    We report the main characteristics of 'Lachnoclostridium massiliosenegalense' strain mt23(T) (=CSUR P299 =DSM 102084), a new bacterial species isolated from the gut microbiota of a healthy young girl from Senegal.

  18. Effects of Host Plant Factors on the Bacterial Communities Associated with Two Whitefly Sibling Species

    PubMed Central

    Su, Ming-Ming; Guo, Lei; Tao, Yun-Li; Zhang, You-Jun; Wan, Fang-Hao; Chu, Dong

    2016-01-01

    Background Although discrepancy in the specific traits and ecological characteristics of Bemisia tabaci between species are partially attributed to the B. tabaci-associated bacteria, the factors that affect the diversity of B. tabaci-associated bacteria are not well-understood. We used the metagenomic approach to characterize the B. tabaci-associated bacterial community because the approach is an effective tool to identify the bacteria. Methodology and Results To investigate the effects of the host plant and a virus, tomato yellow leaf curl virus (TYLCV), on the bacterial communities of B. tabaci sibling species B and Q, we analyzed the bacterial communities associated with whitefly B and Q collected from healthy cotton, healthy tomato, and TYLCV-infected tomato. The analysis used miseq-based sequencing of a variable region of the bacterial 16S rDNA gene. For the bacteria associated with B. tabaci, we found that the influence of the host plant species was greater than that of the whitefly cryptic species. With further analysis of host plants infected with the TYLCV, the virus had no significant effects on the B. tabaci-associated bacterial community. Conclusions The effects of different plant hosts and TYLCV-infection on the diversity of B. tabaci-associated bacterial communities were successfully analyzed in this study. To explain why B. tabaci sibling species with different host ranges differ in performance, the analysis of the bacterial community may be essential to the explanation. PMID:27008327

  19. Diversity and spatiotemporal dynamics of bacterial communities: physicochemical and other drivers along an acid mine drainage.

    PubMed

    Volant, Aurélie; Bruneel, Odile; Desoeuvre, Angélique; Héry, Marina; Casiot, Corinne; Bru, Noëlle; Delpoux, Sophie; Fahy, Anne; Javerliat, Fabien; Bouchez, Olivier; Duran, Robert; Bertin, Philippe N; Elbaz-Poulichet, Françoise; Lauga, Béatrice

    2014-10-01

    Deciphering the biotic and abiotic factors that control microbial community structure over time and along an environmental gradient is a pivotal question in microbial ecology. Carnoulès mine (France), which is characterized by acid waters and very high concentrations of arsenic, iron, and sulfate, provides an excellent opportunity to study these factors along the pollution gradient of Reigous Creek. To this end, biodiversity and spatiotemporal distribution of bacterial communities were characterized using T-RFLP fingerprinting and high-throughput sequencing. Patterns of spatial and temporal variations in bacterial community composition linked to changes in the physicochemical conditions suggested that species-sorting processes were at work in the acid mine drainage. Arsenic, temperature, and sulfate appeared to be the most important factors that drove the composition of bacterial communities along this continuum. Time series investigation along the pollution gradient also highlighted habitat specialization for some major members of the community (Acidithiobacillus and Thiomonas), dispersal for Acidithiobacillus, and evidence of extinction/re-thriving processes for Gallionella. Finally, pyrosequencing revealed a broader phylogenetic range of taxa than previous clone library-based diversity. Overall, our findings suggest that in addition to environmental filtering processes, additional forces (dispersal, birth/death events) could operate in AMD community.

  20. Bacterial control on the structure of As-Fe oxy-hydroxides in acid mine drainage.

    NASA Astrophysics Data System (ADS)

    Morin, G.; Lebrun, S.; Juillot, F.; Casiot, C.; Bruneel, O.; Belin, S.; Proux, O.; Brown, G. E.; Guyot, F.; Calas, G.

    2004-12-01

    Nano-crystalline or amorphous iron oxy-hydroxides are kinetically favored with respect to stable crystalline phases in low temperature environments. Therefore, they frequently occur as transient phases in Earth's surface environments. They exhibit very-high surface areas (few 100 cm2/g) and thus play a key role in the geochemical cycles of minor and trace elements, including toxic elements as arsenic. Natural low-temperature iron oxides also potentially host biological signatures since they can form through various biologically driven reactions. In the present communication, we compare the mineralogy and crystal chemistry of biogenic As-rich iron precipitates synthesized using various acidophilic bacterial strain isolated from an exceptionally arsenic-rich acid mine drainage [1]. XAS, XRD, SEM and TEM investigation of these highly reactive nano-minerals obtained in controlled conditions allows to better constrain their mechanisms of formation. Our data show that the enzymatic oxidation of Fe(II) and/or As(III) play a key role in controlling the nature of the mineral species precipitating in acid mine drainage. We show that the nature of mineral species forming from solutions can be directly determined by the metabolic activity of specific bacterial strains. This influence is thought to be primarily indirect, bacteria controlling the rate of Fe(II) and As(III) oxidation reactions, which in turn leads to various Fe(III) and As(V) super-saturation conditions. These latter parameters are crucial in controlling the structure of nano-crystalline As-Fe low temperature minerals. 1- Morin et al. (2003) Bacterial formation of tooeleite and mixed As(III)/(V)-Fe(III) gels in the Carnoulès acid mine drainage, France. A XANES, XRD and SEM study. Environ. Sci. and Technol. 37,1705-1712.

  1. An uncooked vegan diet shifts the profile of human fecal microflora: computerized analysis of direct stool sample gas-liquid chromatography profiles of bacterial cellular fatty acids.

    PubMed Central

    Peltonen, R; Ling, W H; Hänninen, O; Eerola, E

    1992-01-01

    The effect of an uncooked extreme vegan diet on fecal microflora was studied by direct stool sample gas-liquid chromatography (GLC) of bacterial cellular fatty acids and by quantitative bacterial culture by using classical microbiological techniques of isolation, identification, and enumeration of different bacterial species. Eighteen volunteers were divided randomly into two groups. The test group received an uncooked vegan diet for 1 month and a conventional diet of mixed Western type for the other month of the study. The control group consumed a conventional diet throughout the study period. Stool samples were collected. Bacterial cellular fatty acids were extracted directly from the stool samples and measured by GLC. Computerized analysis of the resulting fatty acid profiles was performed. Such a profile represents all bacterial cellular fatty acids in a sample and thus reflects its microflora and can be used to detect changes, differences, or similarities of bacterial flora between individual samples or sample groups. GLC profiles changed significantly in the test group after the induction and discontinuation of the vegan diet but not in the control group at any time, whereas quantitative bacterial culture did not detect any significant change in fecal bacteriology in either of the groups. The results suggest that an uncooked extreme vegan diet alters the fecal bacterial flora significantly when it is measured by direct stool sample GLC of bacterial fatty acids. PMID:1482187

  2. Confocal Raman microscopy for identification of bacterial species in biofilms

    NASA Astrophysics Data System (ADS)

    Beier, Brooke D.; Quivey, Robert G.; Berger, Andrew J.

    2011-03-01

    Implemented through a confocal microscope, Raman spectroscopy has been used to distinguish between biofilm samples of two common oral bacteria species, Streptococcus sanguinis and mutans, which are associated with healthy and cariogenic plaque, respectively. Biofilms of these species are studied as a model of dental plaque. A prediction model has been calibrated and validated using pure biofilms. This model has been used to identify the species of transferred and dehydrated samples (much like a plaque scraping) as well as hydrated biofilms in situ. Preliminary results of confocal Raman mapping of species in an intact two-species biofilm will be shown.

  3. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily.

    PubMed

    Matsunaga, James; Barocchi, Michele A; Croda, Julio; Young, Tracy A; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A; Reis, Mitermayer G; Riley, Lee W; Haake, David A; Ko, Albert I

    2003-08-01

    Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudogene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019

  4. Bacterial Communities of Diverse Drosophila Species: Ecological Context of a Host–Microbe Model System

    PubMed Central

    Bhatnagar, Srijak; Eisen, Jonathan A.; Kopp, Artyom

    2011-01-01

    Drosophila melanogaster is emerging as an important model of non-pathogenic host–microbe interactions. The genetic and experimental tractability of Drosophila has led to significant gains in our understanding of animal–microbial symbiosis. However, the full implications of these results cannot be appreciated without the knowledge of the microbial communities associated with natural Drosophila populations. In particular, it is not clear whether laboratory cultures can serve as an accurate model of host–microbe interactions that occur in the wild, or those that have occurred over evolutionary time. To fill this gap, we characterized natural bacterial communities associated with 14 species of Drosophila and related genera collected from distant geographic locations. To represent the ecological diversity of Drosophilids, examined species included fruit-, flower-, mushroom-, and cactus-feeders. In parallel, wild host populations were compared to laboratory strains, and controlled experiments were performed to assess the importance of host species and diet in shaping bacterial microbiome composition. We find that Drosophilid flies have taxonomically restricted bacterial communities, with 85% of the natural bacterial microbiome composed of only four bacterial families. The dominant bacterial taxa are widespread and found in many different host species despite the taxonomic, ecological, and geographic diversity of their hosts. Both natural surveys and laboratory experiments indicate that host diet plays a major role in shaping the Drosophila bacterial microbiome. Despite this, the internal bacterial microbiome represents only a highly reduced subset of the external bacterial communities, suggesting that the host exercises some level of control over the bacteria that inhabit its digestive tract. Finally, we show that laboratory strains provide only a limited model of natural host–microbe interactions. Bacterial taxa used in experimental studies are rare or absent in

  5. Salicylic acid is not a bacterial siderophore: a theoretical study.

    PubMed

    Chipperfield, J R; Ratledge, C

    2000-06-01

    Using a newly available program for calculating the concentrations and speciation of various ions (Pettit, LD & Powell KJ, 'SolEq' Academic Software, 1999), we have calculated that at pH 7 the amount of free Fe(III) present in an aqueous solution is 1.4 x 10(-9) M and not 10(-18) M as is usually quoted. In the presence of salicylic acid, included in the calculations at 10(-4) M, the solubility of Fe(III) is increased to only 9.8 x 10(-9) M suggesting that salicylate is unable to act as a siderophore although it is produced as an extracellular product by several bacterial genera when grown iron deficiently. In the presence of 40 mM phosphate, the soluble Fe(III) concentration is decreased by 10(4) at pH 7 and again this is hardly affected by the presence of salicylate. Thus, for microorganisms grown either in vitro or in vivo, salicylate is unlikely to function as a iron solubilizing agent. The same conclusions may also apply to 2,3-dihydroxybenzoic acid.

  6. [Advances in the progress of anti-bacterial biofilms properties of acetic acid].

    PubMed

    Gao, Xinxin; Jin, Zhenghua; Chen, Xinxin; Yu, Jia'ao

    2016-06-01

    Bacterial biofilms are considered to be the hindrance in the treatment of chronic wound, because of their tolerance toward antibiotics and other antimicrobial agents. They also have strong ability to escape from the host immune attack. Acetic acid, as a kind of organic weak acid, can disturb the biofilms by freely diffusing through the bacterial biofilms and bacterial cell membrane structure. Then the acid dissociates to release the hydrogen ions, leading to the disorder of the acid-base imbalance, change of protein conformation, and the degradation of the DNA within the membranes. This paper reviews the literature on the characteristics and treatment strategies of the bacterial biofilms and the acetic acid intervention on them, so as to demonstrate the roles acetic acid may play in the treatment of chronic wound, and thus provide a convincing treatment strategy for this kind of disease. PMID:27321493

  7. [Advances in the progress of anti-bacterial biofilms properties of acetic acid].

    PubMed

    Gao, Xinxin; Jin, Zhenghua; Chen, Xinxin; Yu, Jia'ao

    2016-06-01

    Bacterial biofilms are considered to be the hindrance in the treatment of chronic wound, because of their tolerance toward antibiotics and other antimicrobial agents. They also have strong ability to escape from the host immune attack. Acetic acid, as a kind of organic weak acid, can disturb the biofilms by freely diffusing through the bacterial biofilms and bacterial cell membrane structure. Then the acid dissociates to release the hydrogen ions, leading to the disorder of the acid-base imbalance, change of protein conformation, and the degradation of the DNA within the membranes. This paper reviews the literature on the characteristics and treatment strategies of the bacterial biofilms and the acetic acid intervention on them, so as to demonstrate the roles acetic acid may play in the treatment of chronic wound, and thus provide a convincing treatment strategy for this kind of disease.

  8. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03

    PubMed Central

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-01-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l-1. The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters. PMID:25253925

  9. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03.

    PubMed

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-05-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l(-1). The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters.

  10. Bacterial genomic epidemiology, from local outbreak characterization to species-history reconstruction

    PubMed Central

    Gaiarsa, Stefano; De Marco, Leone; Comandatore, Francesco; Marone, Piero; Bandi, Claudio; Sassera, Davide

    2015-01-01

    Bacteriology has embraced the next-generation sequencing revolution, swiftly moving from the time of single genome sequencing to the age of genomic epidemiology. Hundreds and now even thousands of genomes are being sequenced for single bacterial species, allowing unprecedented levels of resolution and insight in the evolution and epidemic diffusion of the main bacterial pathogens. Here, we present a review of some of the most recent and groundbreaking studies in this field. PMID:26878934

  11. In Silico Phylogenetic Analysis and Molecular Modelling Study of 2-Haloalkanoic Acid Dehalogenase Enzymes from Bacterial and Fungal Origin

    PubMed Central

    Satpathy, Raghunath; Konkimalla, V. B.; Ratha, Jagnyeswar

    2016-01-01

    2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA), conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K) and aspartate (D) residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models. PMID:26880911

  12. [Effects of cinnamic acid on bacterial DNA polymorphism in rhizosphere soil of cucumber under NaCl stress].

    PubMed

    Liu, Jing; Wu, Feng-Zhi; Yang, Yang; Liu, Shou-Wei; Pan, Kai

    2010-03-01

    By using PCR-DGGE technique, this paper studied the effects of different concentration (0, 25, 50, 100, and 200 mg x kg(-1) soil) cinnamic acid on the bacterial DNA polymorphism in rhizosphere soil of cucumber seedlings under the stress of 292.5 and 585 mg NaCl x kg(-1) soil. At all growth stages of cucumber seedlings, treatment 50 mg x kg(-1) of cinnamic acid had the similar band numbers and band gray scales in DGGE profiles to treatment 0 mg x kg(-1) of cinnamic acid, but the diversity index, richness index, and evenness index were the highest; while in treatments 100 and 200 mg x kg(-1) soil of cinnamic acid, the band numbers and band gray scales decreased, and the diversity index, richness index, and evenness index were lower. Our results demonstrated that low concentration cinnamic acid relieved the salt stress on soil microbes, while high concentration cinnamic acid aggravated the stress. The cloning and sequencing results showed that the main bacterial groups affected by salt stress were uncultured bacterial species, alpha-Proteobacteria, beta-proteobacteria, and gamma-proteobacteria, and a few were Firmicutes, Acidobacteria, and Actinobacteria.

  13. Synthetic riboswitches that induce gene expression in diverse bacterial species.

    PubMed

    Topp, Shana; Reynoso, Colleen M K; Seeliger, Jessica C; Goldlust, Ian S; Desai, Shawn K; Murat, Dorothée; Shen, Aimee; Puri, Aaron W; Komeili, Arash; Bertozzi, Carolyn R; Scott, June R; Gallivan, Justin P

    2010-12-01

    We developed a series of ligand-inducible riboswitches that control gene expression in diverse species of Gram-negative and Gram-positive bacteria, including human pathogens that have few or no previously reported inducible expression systems. We anticipate that these riboswitches will be useful tools for genetic studies in a wide range of bacteria. PMID:20935124

  14. Clostridium algifaecis sp. nov., an anaerobic bacterial species from decomposing algal scum.

    PubMed

    Wu, Yu-Fan; Zheng, Hui; Wu, Qing-Long; Yang, Hong; Liu, Shuang-Jiang

    2014-11-01

    Two anaerobic bacterial strains, MB9-7(T) and MB9-9, were isolated from decomposing algal scum and were characterized using a polyphasic approach. Phylogenetic analysis of 16S rRNA gene sequences showed that strains MB9-7(T) and MB9-9 are closely related to each other (99.7% similarity) and they are also closely related to Clostridium tyrobutyricum (96.5%). The two strains were Gram-stain positive and rod-shaped. Growth occurred at 20-45 °C, at pH 4.0-8.0 and at NaCl concentrations of up to 2% (w/v). Acid was produced from glucose, xylose and mannose. Products of fermentation in PYG medium were mainly butyrate, acetate, carbon dioxide and hydrogen. The predominant cellular fatty acids were C(14:0) and C(16:0). The cellular polar lipids comprised phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine, two glycolipids, one phospholipid, one aminophospholipid and two aminolipids. The DNA G+C contents of strain MB9-7(T) and MB9-9 were 27.9 and 28.7 mol%, respectively. These results support the assignment of the new isolates to the genus Clostridium and also distinguish them from other species of the genus Clostridium. Hence, it is proposed that strains MB9-7(T) and MB9-9 represent a novel species of the genus Clostridium, with the suggested name Clostridium algifaecis sp. nov. The type strain is MB9-7(T) ( =CGMCC 1.5188(T) =DSM 28783(T)).

  15. Effect of Organic Matter Decomposition Level on Bacterial Species Diversity and Composition in Relationship to Pythium Damping-Off Severity

    PubMed Central

    Boehm, M. J.; Madden, L. V.; Hoitink, H. A. J.

    1993-01-01

    Rhizosphere bacteria were isolated from root tip segments of cucumber seedlings grown in a suppressive, slightly decomposed light-colored peat mix, a conducive, more decomposed dark-colored peat mix, and a suppressive dark peat mix amended with composted hardwood bark. The bacteria were identified by a gas chromatographic fatty acid methyl ester analysis. The total number of taxa recovered from a single root tip segment ranged from 9 to 18. No single taxon predominated on all root tip segments harvested from any of the mixes. The highest relative population density reached by a given taxon on any root tip segment was 45%. Hill's first and second diversity numbers, the modified Hill's ratio, and Hurlbert's rarefaction method, which were used as measures of species diversity, indicated that the organic matter decomposition level of the potting mixes did not affect bacterial species diversity. Bray-Curtis polar ordination and Dice resemblance functions, however, indicated that the organic matter decomposition level of a mix significantly influenced the composition of bacterial species in the rhizosphere. Pseudomonas spp. and other taxa capable of inducing suppression of pythium damping-off predominated in the suppressive mixes. These organisms were absent from the conducive mix, in which Arthrobacter and Bacillus spp. predominated. Although effective bacterial biocontrol agents were isolated from both the suppressive mixes and the conducive mix, the majority were isolated from the less decomposed suppressive mixes. Finally, the efficacy of strains was significantly greater in the slightly decomposed light peat mix than in the decomposed dark peat mix. Natural disease suppression within these mixes was associated with the organic matter decomposition level and the bacterial species compositions of the mixes. PMID:16349117

  16. Effect of organic matter decomposition level on bacterial species diversity and composition in relationship to pythium damping-off severity.

    PubMed

    Boehm, M J; Madden, L V; Hoitink, H A

    1993-12-01

    Rhizosphere bacteria were isolated from root tip segments of cucumber seedlings grown in a suppressive, slightly decomposed light-colored peat mix, a conducive, more decomposed dark-colored peat mix, and a suppressive dark peat mix amended with composted hardwood bark. The bacteria were identified by a gas chromatographic fatty acid methyl ester analysis. The total number of taxa recovered from a single root tip segment ranged from 9 to 18. No single taxon predominated on all root tip segments harvested from any of the mixes. The highest relative population density reached by a given taxon on any root tip segment was 45%. Hill's first and second diversity numbers, the modified Hill's ratio, and Hurlbert's rarefaction method, which were used as measures of species diversity, indicated that the organic matter decomposition level of the potting mixes did not affect bacterial species diversity. Bray-Curtis polar ordination and Dice resemblance functions, however, indicated that the organic matter decomposition level of a mix significantly influenced the composition of bacterial species in the rhizosphere. Pseudomonas spp. and other taxa capable of inducing suppression of pythium damping-off predominated in the suppressive mixes. These organisms were absent from the conducive mix, in which Arthrobacter and Bacillus spp. predominated. Although effective bacterial biocontrol agents were isolated from both the suppressive mixes and the conducive mix, the majority were isolated from the less decomposed suppressive mixes. Finally, the efficacy of strains was significantly greater in the slightly decomposed light peat mix than in the decomposed dark peat mix. Natural disease suppression within these mixes was associated with the organic matter decomposition level and the bacterial species compositions of the mixes. PMID:16349117

  17. [Purification and characterization of thermostable amylases from two bacterial species].

    PubMed

    Dong, Yongcun; Liu, Yang; Chen, Yuanyuan; Niu, Dandan; Zhang, Liang; Shi, Guiyang; Wang, Zhengxiang

    2008-02-01

    Two thermophilic bacterial isolates, strain 173 and strain 174, with raw starch-digesting activities were selected from thermophilic bacteria growing in hot spring of Tengchong County, Yunnan Province, China. By amplification, sequencing and alignment analysis of 16S ribosomal DNAs, they were identified as members of genus Geobacillus. In shaker flask culture Geobacillus sp. 173 produced 14.5 U/mL amylase and for Geobacillus sp. 174 with 12.9 U/mL. Both amylases were purified by starch absorption-desorption and chromatograph. The amylases from strain 173 and strain 174 purified to about 50 and 29 folds were respectively achieved with an overall yield of 34% and 41%. The maximum gelatinized-starch-digesting activity of the purified amylases were at 70 degrees C and pH 5.0 - 5.5. The high raw-starch-digesting activity of these enzymes were observed at 50 degrees C - 60 degrees C (from strain 173) and 40 degrees C - 60 degrees C (from strain 174). Both enzymes were not sensitive to ions including mental ions (Na+, K+, Mg2+, Ca2+, Mn2+, Zn2+) and others (EDTA, Citrate), but were slightly inhibited by ions such as Co2+, Cu2+ for amylase from strain 173 and Cu2+ for amylase from strain 174. Both enzyme had specificity of starch substrates.

  18. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species

    PubMed Central

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-01-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species. PMID:26884157

  19. Inactivation of CRISPR-Cas systems by anti-CRISPR proteins in diverse bacterial species.

    PubMed

    Pawluk, April; Staals, Raymond H J; Taylor, Corinda; Watson, Bridget N J; Saha, Senjuti; Fineran, Peter C; Maxwell, Karen L; Davidson, Alan R

    2016-01-01

    CRISPR-Cas systems provide sequence-specific adaptive immunity against foreign nucleic acids(1,2). They are present in approximately half of all sequenced prokaryotes(3) and are expected to constitute a major barrier to horizontal gene transfer. We previously described nine distinct families of proteins encoded in Pseudomonas phage genomes that inhibit CRISPR-Cas function(4,5). We have developed a bioinformatic approach that enabled us to discover additional anti-CRISPR proteins encoded in phages and other mobile genetic elements of diverse bacterial species. We show that five previously undiscovered families of anti-CRISPRs inhibit the type I-F CRISPR-Cas systems of both Pseudomonas aeruginosa and Pectobacterium atrosepticum, and a dual specificity anti-CRISPR inactivates both type I-F and I-E CRISPR-Cas systems. Mirroring the distribution of the CRISPR-Cas systems they inactivate, these anti-CRISPRs were found in species distributed broadly across the phylum Proteobacteria. Importantly, anti-CRISPRs originating from species with divergent type I-F CRISPR-Cas systems were able to inhibit the two systems we tested, highlighting their broad specificity. These results suggest that all type I-F CRISPR-Cas systems are vulnerable to inhibition by anti-CRISPRs. Given the widespread occurrence and promiscuous activity of the anti-CRISPRs described here, we propose that anti-CRISPRs play an influential role in facilitating the movement of DNA between prokaryotes by breaching the barrier imposed by CRISPR-Cas systems. PMID:27573108

  20. Electrochemical gating of tricarboxylic acid cycle in electricity-producing bacterial cells of Shewanella.

    PubMed

    Matsuda, Shoichi; Liu, Huan; Kouzuma, Atsushi; Watanabe, Kazuya; Hashimoto, Kazuhito; Nakanishi, Shuji

    2013-01-01

    Energy-conversion systems mediated by bacterial metabolism have recently attracted much attention, and therefore, demands for tuning of bacterial metabolism are increasing. It is widely recognized that intracellular redox atmosphere which is generally tuned by dissolved oxygen concentration or by appropriate selection of an electron acceptor for respiration is one of the important factors determining the bacterial metabolism. In general, electrochemical approaches are valuable for regulation of redox-active objects. However, the intracellular redox conditions are extremely difficult to control electrochemically because of the presence of insulative phospholipid bilayer membranes. In the present work, the limitation can be overcome by use of the bacterial genus Shewanella, which consists of species that are able to respire via cytochromes abundantly expressed in their outer-membrane with solid-state electron acceptors, including anodes. The electrochemical characterization and the gene expression analysis revealed that the activity of tricarboxylic acid (TCA) cycle in Shewanella cells can be reversibly gated simply by changing the anode potential. Importantly, our present results for Shewanella cells cultured in an electrochemical system under poised potential conditions showed the opposite relationship between the current and electron acceptor energy level, and indicate that this unique behavior originates from deactivation of the TCA cycle in the (over-)oxidative region. Our result obtained in this study is the first demonstration of the electrochemical gating of TCA cycle of living cells. And we believe that our findings will contribute to a deeper understanding of redox-dependent regulation systems in living cells, in which the intracellular redox atmosphere is a critical factor determining the regulation of various metabolic and genetic processes.

  1. Effect of species, breed, and age on bacterial load in bovine and bubaline semen

    PubMed Central

    Sannat, Chandrahas; Nair, Ajit; Sahu, S. B.; Sahasrabudhe, S. A.; Kumar, Ashish; Gupta, Amit Kumar; Shende, R. K.

    2015-01-01

    Aim: The present study was conducted to investigate the effect of species, breed and age on bacterial load in fresh and frozen semen of Cattle and Buffalo bull. Materials and Methods: Present study covered 56 cow and 10 buffalo bulls stationed at Central Semen Station Anjora, Durg (Chhattisgarh). Impact of breeds on bacterial load in semen was assessed using six breeds of cattle viz. Sahiwal, Gir, Red Sindhi, Tharparkar, Jersey and Holstein Friesian (HF) cross. Cow bulls were categorized into four different groups based on their age (<4 years, 4-5 years, 5-6 years and > 6 years) to study variation among age groups. Bacterial load was measured in fresh and frozen semen samples from these bulls using the standard plate count (SPC) method and count was expressed as colony forming unit (CFU) per ml of semen. Results: Higher bacterial load was reported in fresh (2.36 × 104 ± 1943 CFU/ml) and frozen (1.00 × 10 ± 90 CFU/ml) semen of cow bulls as compared to buffalo bulls (1.95 × 104 ± 2882 and 7.75 × 102 ± 160 CFU/ml in fresh and frozen semen, respectively). Jersey bull showed significantly higher bacterial count (p < 0.05) both in fresh (4.07 × 104 ± 13927 CFU/ml) and frozen (1.92 × 103 ± 178 CFU/ml) semen followed by HF cross, Sahiwal, Gir, Red Sindhi and Tharparkar bull. Bulls aged < 4 years and more than 6 years yielded increased bacterial load in their semen. Although a minor variation was reported between species and among age groups, no significant differences were measured. Conclusion: Bacterial load in semen did not differ significantly between species and age groups; however significant variation was reported among different breeds. Bulls of Jersey breed showed significantly higher bacterial load in semen as compared to the crossbred and indigenous bull. PMID:27047115

  2. Risk of Spontaneous Bacterial Peritonitis Associated With Gastric Acid Suppression

    PubMed Central

    Chang, Shy-Shin; Lai, Chih-Cheng; Lee, Meng-tse Gabriel; Lee, Yu-Chien; Tsai, Yi-Wen; Hsu, Wan-Ting; Lee, Chien-Chang

    2015-01-01

    Abstract The primary objective of this study was to determine the association between the use of gastric acid suppressants (GAS) and the risk of developing spontaneous bacterial peritonitis (SBP) in patients with advanced liver cirrhosis (LC). A case–control study nested within a cohort of 480,000 representatives of Taiwan National Health Insurance beneficiaries was carried out. A case was matched with 100 controls on age, gender, and index date of SBP diagnosis. GAS use was identified from the 1-year period before the index date. Conditional logistic regression analysis was used to adjust for various unbalanced covariates between users and nonusers of GAS. A total of 947 cases of SBP were identified among the 86,418 patients with advanced LC. A significant increased risk of developing SBP was found to be associated with current (within 30 days), and recent (within 30–90 day) use of 2 different classes of GAS: proton pump inhibitors (PPIs) and histamine 2 receptor antagonists (H2RAs). The confounder adjusted rate ratio (aRR) for the current use of PPIs was 2.77 (95%CI: 1.90–4.04) and H2RAs was 2.62 (95%CI: 2.00–3.42). The risk of SBP attenuated for the recent use of PPIs (aRR: 2.20, 95%CI: 1.60–3.02) or H2RAs (aRR: 1.72, 95%CI: 1.25–2.37). In addition, sensitivity analysis using hospitalized SBP as the primary outcome showed a similar risk for the current use of PPIs (aRR, 3.24; 95%CI: 2.08–5.05) and H2RAs (aRR 2.43; 95%CI 1.71–3.46). Furthermore, higher cumulative days of gastric acid suppression were associated with a higher risk of SBP (trend P < 0.0001). To conclude, exposure to GAS was associated with an increased risk of SBP in patients with advanced LC. The association was more pronounced in current PPI users compared with nonusers. PMID:26039135

  3. Bacterial community in sclerotia of Cenococcum species and soil in sub-alpine forest, central Japan

    NASA Astrophysics Data System (ADS)

    Nonoyama, Y.; Narisawa, K.; Ohta, H.; Watanabe, M.

    2009-04-01

    Species of Cenococcum, ectomycorrhizal fungi, may be particularly abundant in cold- or nutrient-stressed habitats. The fungus is easily recognized by its jet-black hyphae, and distinct compact masses of fungal mycelium called sclerotia. They are hard, black, comparatively smooth and mostly spherical. Sclerotia are formed in rhizosphere and can provide sufficient inoculums for several years. The purpose of this study is to investigate bacterial community inside sclerotia, with an interest on contribution of sclerotia to microbial diversity in rhizosphere. To investigate bacterial community inside of the fungal sclerotia by 16S rDNA gene clone library, several hundred of sclerotia (ca. 1g) were collected from sub-alpine forest soil in central Japan. Furthermore, three sclerotium grains were applied to investigate internal bacteria community by culture method. The isolated bacterial strains were then proceeded to determine their 16S rDNA partial sequences. The predominant group determined by clone library analysis of 16S ribosomal RNA genes with DNA from the sclerotia was Acidobacteria in both sclerotia and soil. Bacterial community of sclerotia showed higher diversity compared to soil. On the contrary, bacterial flora isolated from single sclerotium differed each other. Additionally, the bacterial community was composed by limited species of related genus.

  4. Identification of different bacterial species in biofilms using confocal Raman microscopy

    NASA Astrophysics Data System (ADS)

    Beier, Brooke D.; Quivey, Robert G.; Berger, Andrew J.

    2010-11-01

    Confocal Raman microspectroscopy is used to discriminate between different species of bacteria grown in biofilms. Tests are performed using two bacterial species, Streptococcus sanguinis and Streptococcus mutans, which are major components of oral plaque and of particular interest due to their association with healthy and cariogenic plaque, respectively. Dehydrated biofilms of these species are studied as a simplified model of dental plaque. A prediction model based on principal component analysis and logistic regression is calibrated using pure biofilms of each species and validated on pure biofilms grown months later, achieving 96% accuracy in prospective classification. When biofilms of the two species are partially mixed together, Raman-based identifications are achieved within ~2 μm of the boundaries between species with 97% accuracy. This combination of spatial resolution and predication accuracy should be suitable for forming images of species distributions within intact two-species biofilms.

  5. Speedy speciation in a bacterial microcosm: new species can arise as frequently as adaptations within a species.

    PubMed

    Koeppel, Alexander F; Wertheim, Joel O; Barone, Laura; Gentile, Nicole; Krizanc, Danny; Cohan, Frederick M

    2013-06-01

    Microbiologists are challenged to explain the origins of enormous numbers of bacterial species worldwide. Contributing to this extreme diversity may be a simpler process of speciation in bacteria than in animals and plants, requiring neither sexual nor geographical isolation between nascent species. Here, we propose and test a novel hypothesis for the extreme diversity of bacterial species-that splitting of one population into multiple ecologically distinct populations (cladogenesis) may be as frequent as adaptive improvements within a single population's lineage (anagenesis). We employed a set of experimental microcosms to address the relative rates of adaptive cladogenesis and anagenesis among the descendants of a Bacillus subtilis clone, in the absence of competing species. Analysis of the evolutionary trajectories of genetic markers indicated that in at least 7 of 10 replicate microcosm communities, the original population founded one or more new, ecologically distinct populations (ecotypes) before a single anagenetic event occurred within the original population. We were able to support this inference by identifying putative ecotypes formed in these communities through differences in genetic marker association, colony morphology and microhabitat association; we then confirmed the ecological distinctness of these putative ecotypes in competition experiments. Adaptive mutations leading to new ecotypes appeared to be about as common as those improving fitness within an existing ecotype. These results suggest near parity of anagenesis and cladogenesis rates in natural populations that are depauperate of bacterial diversity.

  6. Antibiofilm Activity, Compound Characterization, and Acute Toxicity of Extract from a Novel Bacterial Species of Paenibacillus

    PubMed Central

    Alasil, Saad Musbah; Omar, Rahmat; Yusof, Mohd Yasim

    2014-01-01

    The effectiveness of many antimicrobial agents is currently decreasing; therefore, it is important to search for alternative therapeutics. Our study was carried out to assess the in vitro antibiofilm activity using microtiter plate assay, to characterize the bioactive compounds using Ultra Performance Liquid Chromatography-Diode Array Detection and Liquid Chromatography-Mass Spectrometry and to test the oral acute toxicity on Sprague Dawley rats of extract derived from a novel bacterial species of Paenibacillus strain 139SI. Our results indicate that the crude extract and its three identified compounds exhibit strong antibiofilm activity against a broad range of clinically important pathogens. Three potential compounds were identified including an amino acid antibiotic C8H20N3O4P (MW 253.237), phospholipase A2 inhibitor C21H36O5 (MW 368.512), and an antibacterial agent C14H11N3O2 (MW 253.260). The acute toxicity test indicates that the mortality rate among all rats was low and that the biochemical parameters, hematological profile, and histopathology examination of liver and kidneys showed no significant differences between experimental groups (P > 0.05). Overall, our findings suggest that the extract and its purified compounds derived from novel Paenibacillus sp. are nontoxic exhibiting strong antibiofilm activity against Gram-positive and Gram-negative pathogens that can be useful towards new therapeutic management of biofilm-associated infections. PMID:24790603

  7. Assessing variation in bacterial composition between the rhizospheres of two mangrove tree species

    NASA Astrophysics Data System (ADS)

    Gomes, Newton C. M.; Cleary, Daniel F. R.; Pires, Ana C. C.; Almeida, Adelaide; Cunha, Angela; Mendonça-Hagler, Leda C. S.; Smalla, Kornelia

    2014-02-01

    This study aimed to determine to what extent roots from the common mangrove tree species Avicennia schaueriana and Laguncularia racemosa are able to impose a selective force on the composition of sediment bacterial communities in mangrove intertidal sediments using barcoded pyrosequencing analysis of 16S rRNA gene fragments (V4 hyper-variable region). The novel results showed that root systems of A. schaueriana and L. racemosa are associated with increased bacterial dominance, lower richness and compositional shifts of sediment bacterial communities. The proportion of OTUs (operational taxonomc units) belonging to the orders Rhizobiales and Vibrionales were enriched in rhizosphere samples from both plant species and sulphur-reducing bacteria (SRB) belonging to the order Desulfobacterales and Desulfuromonadales were enriched in the rhizosphere of A. schaueriana. In addition, Clostridium and Vibrio populations were more abundant in different mangrove rhizospheres. A. schaueriana and L. racemosa roots appear to be able to impose a selective force on the composition of mangrove sediment bacterial communities and this phenomenon appears to be plant species specific. Our findings provide new insights into the potential ecological roles of bacterial guilds in plant-microbe interactions and may aid rhizoengineering approaches for replanting impacted mangrove areas.

  8. Blooms of Single Bacterial Species in a Coastal Lagoon of the Southwestern Atlantic Ocean

    PubMed Central

    Piccini, Claudia; Conde, Daniel; Alonso, Cecilia; Sommaruga, Ruben; Pernthaler, Jakob

    2006-01-01

    We investigated seasonal differences in community structure and activity (leucine incorporation) of the planktonic bacterial assemblage in the freshwater and brackish-water zones of a shallow coastal lagoon of the southwestern Atlantic Ocean. Alphaproteobacteria formed the dominant microbial group in both zones throughout the sampling period. After an intrusion of marine water, members of the SAR11 lineage became abundant in the brackish-water zone. These bacteria were apparently distributed over the lagoon during the following months until they constituted almost 30% of all prokaryotic cells at both sampling sites. At the first sampling date (March 2003) a single alphaproteobacterial species unrelated to SAR11, Sphingomonas echinoides, dominated the microbial assemblages in both zones of the lagoon concomitantly with a bloom of filamentous cyanobacteria. Pronounced maxima of leucine incorporation were observed once in each zone of the lagoon. In the freshwater zone, this highly active microbial assemblage was a mix of the typical bacteria lineages expected in aquatic systems. By contrast, a single bacterial genotype with >99% similarity to the facultative pathogen gammaproteobacterial species Stenotrophomonas maltophilia formed >90% of the bacterial assemblage (>107 cell ml−1) in the brackish-water zone at the time point of highest bacterial leucine incorporation. Moreover, these bacteria were equally dominant, albeit less active, in the freshwater zone. Thus, the pelagic zone of the studied lagoon harbored repeated short-term blooms of single bacterial species. This finding may have consequences for environmental protection. PMID:17021206

  9. Enzymatic degradation of polygalacturonic acid by Yersinia and Klebsiella species in relation to clinical laboratory procedures.

    PubMed

    Starr, M P; Chatterjee, A K; Starr, P B; Buchanan, G E

    1977-10-01

    As scored by several specified plating procedures, clinical and environmental strains of Yersinia enterocolitica, Yersinia pseudotuberculosis, and Klebsiella pneumoniae "Oxytocum" showed detectable, albeit generally weak, ability to digest polygalacturonic (pectic) acid. None of these bacterial strains had the vigorous and rapid pectolytic activity on these polygalacturonic acid-containing media that is typical of soft-rot Erwinia species, although some of the Oxytocum strains came fairly close. Analyses of the pectolytic enzyme contents of the cells and culture supernatants of the Yersinia and Klebsiella species revealed that readily detectable quantities of cell-bound polygalacturonic acid trans-eliminase and hydrolytic polygalacturonase were formed by the Yersinia and Klebsiella species; however, the total units of enzyme activity produced by these bacteria were, in general, lower than were produced by soft-rot Erwinia species. Furthermore, unlike the situation in soft-rot Erwinia cultures, these pectolytic enzymes of Yersinia and Klebsiella species were not excreted rapidly and massively into the growth medium. Cultures of other enterobacteria (Citrobacter species, Enterobacter species, Erwinia amylovora, Erwinia herbicola, Escherichia coli, Proteus species, Salmonella typhimurium, and Serratia marcescens) showed no pectolytic ability whatsoever by any of the plating procedures used and (to the extent they were so examined) produced no pectolytic enzymes detectable either in their cells or culture supernatants. This slow or weak release of pectolytic enzymes by Yersinia and Klebsiella species has a bearing on clinical laboratory procedures suitable for detecting their pectolytic activity; methods adequate for this purpose are detailed.

  10. Enzymatic Degradation of Polygalacturonic Acid by Yersinia and Klebsiella Species in Relation to Clinical Laboratory Procedures

    PubMed Central

    Starr, Mortimer P.; Chatterjee, Arun K.; Starr, Phoebe B.; Buchanan, Gordon E.

    1977-01-01

    As scored by several specified plating procedures, clinical and environmental strains of Yersinia enterocolitica, Yersinia pseudotuberculosis, and Klebsiella pneumoniae “Oxytocum” showed detectable, albeit generally weak, ability to digest polygalacturonic (pectic) acid. None of these bacterial strains had the vigorous and rapid pectolytic activity on these polygalacturonic acid-containing media that is typical of soft-rot Erwinia species, although some of the Oxytocum strains came fairly close. Analyses of the pectolytic enzyme contents of the cells and culture supernatants of the Yersinia and Klebsiella species revealed that readily detectable quantities of cell-bound polygalacturonic acid trans-eliminase and hydrolytic polygalacturonase were formed by the Yersinia and Klebsiella species; however, the total units of enzyme activity produced by these bacteria were, in general, lower than were produced by soft-rot Erwinia species. Furthermore, unlike the situation in soft-rot Erwinia cultures, these pectolytic enzymes of Yersinia and Klebsiella species were not excreted rapidly and massively into the growth medium. Cultures of other enterobacteria (Citrobacter species, Enterobacter species, Erwinia amylovora, Erwinia herbicola, Escherichia coli, Proteus species, Salmonella typhimurium, and Serratia marcescens) showed no pectolytic ability whatsoever by any of the plating procedures used and (to the extent they were so examined) produced no pectolytic enzymes detectable either in their cells or culture supernatants. This slow or weak release of pectolytic enzymes by Yersinia and Klebsiella species has a bearing on clinical laboratory procedures suitable for detecting their pectolytic activity; methods adequate for this purpose are detailed. PMID:334794

  11. Influence of the acid type in the production of chitosan films reinforced with bacterial nanocellulose.

    PubMed

    Velásquez-Cock, J; Ramírez, E; Betancourt, S; Putaux, J-L; Osorio, M; Castro, C; Gañán, P; Zuluaga, R

    2014-08-01

    Chitosan films reinforced with bacterial cellulose (BC) nanoribbons were studied to understand the influence of acid (acetic and lactic acids) on the reinforcing effect. For both acids, the maximum concentration of the reinforcing constituent was 5wt% with respect to the dry weight of chitosan. The infrared spectra, mechanical properties, morphology and antimicrobial activity of the films were analyzed. The results showed a difference between the acids in their behavior and effect on the reinforcement, with a tensile strength of 12.3MPa for the acetic acid films and 3.3MPa for the lactic acid films. Additionally, the bacterial inhibition tests were shown to be positive for the lactic acid films and negative for the acetic acid films. Therefore, exchanging the acid used in these films may be desirable for certain applications.

  12. Bacterial Communities in the Rhizospheres of Three Mangrove Tree Species from Beilun Estuary, China

    PubMed Central

    Wu, Peng; Xiong, Xiaofei; Xu, Zhanzhou; Lu, Chuqian; Cheng, Hao; Lyu, Xiangli; Zhang, Jinghuai; He, Wei; Deng, Wei; Lyu, Yihua; Lou, Quansheng; Hong, Yiguo; Fang, Hongda

    2016-01-01

    The bacterial communities played important roles in the high productivity mangrove ecosystem. In this study, we investigated the vertical distributions of rhizosphere bacteria from three mangrove species (Bruguiera gymnorrhiza, Kandelia candel and Aegiceras corniculatum) in Beilun Estuary, China using high throughput DNA pyrosequencing of the 16S rRNA gene. Phylogenetic analysis showed that bacterial communities from mangrove rhizosphere sediments were dominated by Proteobacteria (mostly Deltaproteobacteria and Gammaproteobacteria), followed by Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. However, the ANOVA analysis on Shannon and Chao1 indices indicated that bacterial communities among sediments of the three mangrove species varied more strongly than the sampling depths. In addition, the PCA result demonstrated that the bacterial communities could be separated into three groups according to the mangrove species. Moreover, the dominated orders Rhodospirillales, GCA004 and envOPS12 were significantly different among sediments of the three mangrove species. The results of this study provided valuable information about the distribution feature of rhizosphere bacteria from Chinese mangrove plants and shed insights into biogeochemical transformations driven by bacteria in rhizosphere sediments. PMID:27695084

  13. Bacterial Diversity and Community Structure in Two Bornean Nepenthes Species with Differences in Nitrogen Acquisition Strategies.

    PubMed

    Sickel, Wiebke; Grafe, T Ulmar; Meuche, Ivonne; Steffan-Dewenter, Ingolf; Keller, Alexander

    2016-05-01

    Carnivorous plants of the genus Nepenthes have been studied for over a century, but surprisingly little is known about associations with microorganisms. The two species Nepenthes rafflesiana and Nepenthes hemsleyana differ in their pitcher-mediated nutrient sources, sequestering nitrogen from arthropod prey and arthropods as well as bat faeces, respectively. We expected bacterial communities living in the pitchers to resemble this diet difference. Samples were taken from different parts of the pitchers (leaf, peristome, inside, outside, digestive fluid) of both species. Bacterial communities were determined using culture-independent high-throughput amplicon sequencing. Bacterial richness and community structure were similar in leaves, peristomes, inside and outside walls of both plant species. Regarding digestive fluids, bacterial richness was higher in N. hemsleyana than in N. rafflesiana. Additionally, digestive fluid communities were highly variable in structure, with strain-specific differences in community composition between replicates. Acidophilic taxa were mostly of low abundance, except the genus Acidocella, which strikingly reached extremely high levels in two N. rafflesiana fluids. In N. hemsleyana fluid, some taxa classified as vertebrate gut symbionts as well as saprophytes were enriched compared to N. rafflesiana, with saprophytes constituting potential competitors for nutrients. The high variation in community structure might be caused by a number of biotic and abiotic factors. Nitrogen-fixing bacteria were present in both study species, which might provide essential nutrients to the plant at times of low prey capture and/or rare encounters with bats. PMID:26790863

  14. Phosphoenolpyruvate:glycose phosphotransferase system in species of Vibrio, a widely distributed marine bacterial genus.

    PubMed Central

    Meadow, N D; Revuelta, R; Chen, V N; Colwell, R R; Roseman, S

    1987-01-01

    The genus Vibrio is one of the most common and widely distributed groups of marine bacteria. Studies on the physiology of marine Vibrio species were initiated by examining 15 species for the bacterial phosphoenolpyruvate:glycose phosphotransferase system (PTS). All species tested contained a PTS analogous to the glucose-specific (IIGlc) system in enteric bacteria. Crude extracts of the cells showed immunological cross-reactivity with antibodies to enzyme I, HPr, and IIIGlc from Salmonella typhimurium when assayed by the rocket-line method. Toluene-permeabilized cells of 11 species were tested and were active in phosphorylating methyl alpha-D-glucoside with phosphoenolpyruvate but not ATP as the phosphoryl donor. Membranes from 10 species were assayed, and they phosphorylated methyl alpha-D-glucoside when supplemented with a phospho-IIIGlc-generating system composed of homogeneous proteins from enteric bacteria. Toluene-permeabilized cells and membranes of seven species were assayed, as were phosphorylated fructose and 2-deoxyglucose. IIIGlc was isolated from Vibrio fluvialis and was active in phosphorylating methyl alpha-D-glucoside when supplemented with a phospho-HPr-generating system composed of homogeneous proteins from Escherichia coli and membranes from either E. coli or V. fluvialis. These results show that the bacterial PTS is widely distributed in the marine environment and that it is likely to have a significant role in marine bacterial physiology and in the marine ecosystem. Images PMID:3667518

  15. Bacterial production of free fatty acids from freshwater macroalgal cellulose

    PubMed Central

    Hoovers, Spencer W.; Marner, Wesley D.; Brownson, Amy K.; Lennen, Rebecca M.; Wittkopp, Tyler M.; Yoshitani, Jun; Zulkifly, Shahrizim; Graham, Linda E.; Chaston, Sheena D.; McMahon, Katherine D.

    2013-01-01

    The predominant strategy for using algae to produce biofuels relies on the overproduction of lipids in microalgae with subsequent conversion to biodiesel (methyl-esters) or green diesel (alkanes). Conditions that both optimize algal growth and lipid accumulation rarely overlap, and differences in growth rates can lead to wild species outcompeting the desired lipid-rich strains. Here, we demonstrate an alternative strategy in which cellulose contained in the cell walls of multicellular algae is used as a feedstock for cultivating biofuel-producing micro-organisms. Cellulose was extracted from an environmental sample of Cladophora glomerata-dominated periphyton that was collected from Lake Mendota, WI, USA. The resulting cellulose cake was hydrolyzed by commercial enzymes to release fermentable glucose. The hydrolysis mixture was used to formulate an undefined medium that was able to support the growth, without supplementation, of a free fatty acid (FFA)-overproducing strain of Escherichia coli (Lennen et. al 2010). To maximize free fatty acid production from glucose, an isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible vector was constructed to express the Umbellularia californica acyl–acyl carrier protein (ACP) thioesterase. Thioesterase expression was optimized by inducing cultures with 50 μM IPTG. Cell density and FFA titers from cultures grown on algae-based media reached 50% of those (~90 μg/mL FFA) cultures grown on rich Luria–Bertani broth supplemented with 0.2% glucose. In comparison, cultures grown in two media based on AFEX-pretreated corn stover generated tenfold less FFA than cultures grown in algae-based media. This study demonstrates that macroalgal cellulose is a potential carbon source for the production of biofuels or other microbially synthesized compounds. PMID:21643704

  16. Speedy speciation in a bacterial microcosm: new species can arise as frequently as adaptations within a species

    PubMed Central

    Koeppel, Alexander F; Wertheim, Joel O; Barone, Laura; Gentile, Nicole; Krizanc, Danny; Cohan, Frederick M

    2013-01-01

    Microbiologists are challenged to explain the origins of enormous numbers of bacterial species worldwide. Contributing to this extreme diversity may be a simpler process of speciation in bacteria than in animals and plants, requiring neither sexual nor geographical isolation between nascent species. Here, we propose and test a novel hypothesis for the extreme diversity of bacterial species—that splitting of one population into multiple ecologically distinct populations (cladogenesis) may be as frequent as adaptive improvements within a single population's lineage (anagenesis). We employed a set of experimental microcosms to address the relative rates of adaptive cladogenesis and anagenesis among the descendants of a Bacillus subtilis clone, in the absence of competing species. Analysis of the evolutionary trajectories of genetic markers indicated that in at least 7 of 10 replicate microcosm communities, the original population founded one or more new, ecologically distinct populations (ecotypes) before a single anagenetic event occurred within the original population. We were able to support this inference by identifying putative ecotypes formed in these communities through differences in genetic marker association, colony morphology and microhabitat association; we then confirmed the ecological distinctness of these putative ecotypes in competition experiments. Adaptive mutations leading to new ecotypes appeared to be about as common as those improving fitness within an existing ecotype. These results suggest near parity of anagenesis and cladogenesis rates in natural populations that are depauperate of bacterial diversity. PMID:23364353

  17. Species sorting and neutral processes are both important during the initial assembly of bacterial communities

    PubMed Central

    Langenheder, Silke; Székely, Anna J

    2011-01-01

    Many studies have shown that species sorting, that is, the selection by local environmental conditions is important for the composition and assembly of bacterial communities. On the other hand, there are other studies that could show that bacterial communities are neutrally assembled. In this study, we implemented a microcosm experiment with the aim to determine, at the same time, the importance of species sorting and neutral processes for bacterial community assembly during the colonisation of new, that is, sterile, habitats, by atmospheric bacteria. For this we used outdoor microcosms, which contained sterile medium from three different rock pools representing different environmental conditions, which were seeded by rainwater bacteria. We found some evidence for neutral assembly processes, as almost every 4th taxon growing in the microcosms was also detectable in the rainwater sample irrespective of the medium. Most of these taxa belonged to widespread families with opportunistic growth strategies, such as the Pseudomonadaceae and Comamonadaceae, indicating that neutrally assembled taxa may primarily be generalists. On the other hand, we also found evidence for species sorting, as one out of three media selected a differently composed bacterial community. Species sorting effects were relatively weak and established themselves via differences in relative abundance of generalists among the different media, as well as media-specific occurrences of a few specific taxa. In summary, our results suggest that neutral and species sorting processes interact during the assembly of bacterial communities and that their importance may differ depending on how many generalists and specialists are present in a community. PMID:21270841

  18. Extremophiles in Mineral Sulphide Heaps: Some Bacterial Responses to Variable Temperature, Acidity and Solution Composition

    PubMed Central

    Watling, Helen R.; Shiers, Denis W.; Collinson, David M.

    2015-01-01

    In heap bioleaching, acidophilic extremophiles contribute to enhanced metal extraction from mineral sulphides through the oxidation of Fe(II) and/or reduced inorganic sulphur compounds (RISC), such as elemental sulphur or mineral sulphides, or the degradation of organic compounds derived from the ore, biota or reagents used during mineral processing. The impacts of variable solution acidity and composition, as well as temperature on the three microbiological functions have been examined for up to four bacterial species found in mineral sulphide heaps. The results indicate that bacteria adapt to sufficiently high metal concentrations (Cu, Ni, Co, Zn, As) to allow them to function in mineral sulphide heaps and, by engaging alternative metabolic pathways, to extend the solution pH range over which growth is sustained. Fluctuating temperatures during start up in sulphide heaps pose the greatest threat to efficient bacterial colonisation. The large masses of ores in bioleaching heaps mean that high temperatures arising from sulphide oxidation are hard to control initially, when the sulphide content of the ore is greatest. During that period, mesophilic and moderately thermophilic bacteria are markedly reduced in both numbers and activity. PMID:27682094

  19. Extremophiles in Mineral Sulphide Heaps: Some Bacterial Responses to Variable Temperature, Acidity and Solution Composition.

    PubMed

    Watling, Helen R; Shiers, Denis W; Collinson, David M

    2015-07-09

    In heap bioleaching, acidophilic extremophiles contribute to enhanced metal extraction from mineral sulphides through the oxidation of Fe(II) and/or reduced inorganic sulphur compounds (RISC), such as elemental sulphur or mineral sulphides, or the degradation of organic compounds derived from the ore, biota or reagents used during mineral processing. The impacts of variable solution acidity and composition, as well as temperature on the three microbiological functions have been examined for up to four bacterial species found in mineral sulphide heaps. The results indicate that bacteria adapt to sufficiently high metal concentrations (Cu, Ni, Co, Zn, As) to allow them to function in mineral sulphide heaps and, by engaging alternative metabolic pathways, to extend the solution pH range over which growth is sustained. Fluctuating temperatures during start up in sulphide heaps pose the greatest threat to efficient bacterial colonisation. The large masses of ores in bioleaching heaps mean that high temperatures arising from sulphide oxidation are hard to control initially, when the sulphide content of the ore is greatest. During that period, mesophilic and moderately thermophilic bacteria are markedly reduced in both numbers and activity.

  20. Extremophiles in Mineral Sulphide Heaps: Some Bacterial Responses to Variable Temperature, Acidity and Solution Composition

    PubMed Central

    Watling, Helen R.; Shiers, Denis W.; Collinson, David M.

    2015-01-01

    In heap bioleaching, acidophilic extremophiles contribute to enhanced metal extraction from mineral sulphides through the oxidation of Fe(II) and/or reduced inorganic sulphur compounds (RISC), such as elemental sulphur or mineral sulphides, or the degradation of organic compounds derived from the ore, biota or reagents used during mineral processing. The impacts of variable solution acidity and composition, as well as temperature on the three microbiological functions have been examined for up to four bacterial species found in mineral sulphide heaps. The results indicate that bacteria adapt to sufficiently high metal concentrations (Cu, Ni, Co, Zn, As) to allow them to function in mineral sulphide heaps and, by engaging alternative metabolic pathways, to extend the solution pH range over which growth is sustained. Fluctuating temperatures during start up in sulphide heaps pose the greatest threat to efficient bacterial colonisation. The large masses of ores in bioleaching heaps mean that high temperatures arising from sulphide oxidation are hard to control initially, when the sulphide content of the ore is greatest. During that period, mesophilic and moderately thermophilic bacteria are markedly reduced in both numbers and activity.

  1. Differing Daphnia magna assimilation efficiencies for terrestrial, bacterial, and algal carbon and fatty acids.

    PubMed

    Taipale, Sami J; Brett, Michael T; Hahn, Martin W; Martin-Creuzburg, Dominik; Yeung, Sean; Hiltunen, Minna; Strandberg, Ursula; Kankaala, Paula

    2014-02-01

    There is considerable interest in the pathways by which carbon and growth-limiting elemental and biochemical nutrients are supplied to upper trophic levels. Fatty acids and sterols are among the most important molecules transferred across the plant-animal interface of food webs. In lake ecosystems, in addition to phytoplankton, bacteria and terrestrial organic matter are potential trophic resources for zooplankton, especially in those receiving high terrestrial organic matter inputs. We therefore tested carbon, nitrogen, and fatty acid assimilation by the crustacean Daphnia magna when consuming these resources. We fed Daphnia with monospecific diets of high-quality (Cryptomonas marssonii) and intermediate-quality (Chlamydomonas sp. and Scenedesmus gracilis) phytoplankton species, two heterotrophic bacterial strains, and particles from the globally dispersed riparian grass, Phragmites australis, representing terrestrial particulate organic carbon (t-POC). We also fed Daphnia with various mixed diets, and compared Daphnia fatty acid, carbon, and nitrogen assimilation across treatments. Our results suggest that bacteria were nutritionally inadequate diets because they lacked sterols and polyunsaturated omega-3 and omega-6 (omega-3 and omega-6) fatty acids (PUFAs). However, Daphnia were able to effectively use carbon and nitrogen from Actinobacteria, if their basal needs for essential fatty acids and sterols were met by phytoplankton. In contrast to bacteria, t-POC contained sterols and omega-6 and omega-3 fatty acids, but only at 22%, 1.4%, and 0.2% of phytoplankton levels, respectively, which indicated that t-POC food quality was especially restricted with regard to omega-3 PUFAs. Our results also showed higher assimilation of carbon than fatty acids from t-POC and bacteria into Daphnia, based on stable-isotope and fatty acids analysis, respectively. A relatively high (>20%) assimilation of carbon and fatty acids from t-POC was observed only when the proportion of t

  2. Massive Infection of Seabird Ticks with Bacterial Species Related to Coxiella burnetii

    PubMed Central

    Dietrich, Muriel; Lebarbenchon, Camille; Jaeger, Audrey; Le Rouzic, Céline; Bastien, Matthieu; Lagadec, Erwan; McCoy, Karen D.; Pascalis, Hervé; Le Corre, Matthieu; Dellagi, Koussay; Tortosa, Pablo

    2014-01-01

    Seabird ticks are known reservoirs of bacterial pathogens of medical importance; however, ticks parasitizing tropical seabirds have received less attention than their counterparts from temperate and subpolar regions. Recently, Rickettsia africae was described to infect seabird ticks of the western Indian Ocean and New Caledonia, constituting the only available data on bacterial pathogens associated with tropical seabird tick species. Here, we combined a pyrosequencing-based approach with a classical molecular analysis targeting bacteria of potential medical importance in order to describe the bacterial community in two tropical seabird ticks, Amblyomma loculosum and Carios (Ornithodoros) capensis. We also investigated the patterns of prevalence and host specificity within the biogeographical context of the western Indian Ocean islands. The bacterial community of the two tick species was characterized by a strong dominance of Coxiella and Rickettsia. Our data support a strict Coxiella-host tick specificity, a pattern resembling the one found for Rickettsia spp. in the same two seabird tick species. Both the high prevalence and stringent host tick specificity suggest that these bacteria may be tick symbionts with probable vertical transmission. Detailed studies of the pathogenicity of these bacteria will now be required to determine whether horizontal transmission can occur and to clarify their status as potential human pathogens. More generally, our results show that the combination of next generation sequencing with targeted detection/genotyping approaches proves to be efficient in poorly investigated fields where research can be considered to be starting from scratch. PMID:24657860

  3. Diazotrophic potential among bacterial communities associated with wild and cultivated Agave species.

    PubMed

    Desgarennes, Damaris; Garrido, Etzel; Torres-Gomez, Miryam J; Peña-Cabriales, Juan J; Partida-Martinez, Laila P

    2014-12-01

    Agaves are major biotic resources in arid and semi-arid ecosystems. Despite their ecological, economical and cultural relevance, many aspects of the microbial communities associated with agaves are still unknown. Here, we investigated the bacterial communities associated with two Agave species by 16S rRNA- Denaturing gradient gel electrophoresis fingerprinting and sequencing. We also evaluated the effects of biotic and abiotic factors in the structure of the bacterial communities. In parallel, we isolated and characterized diazotrophic bacteria associated with agaves, as Agave soils are characterized by their low nitrogen content. Our results demonstrate that in Agave, the structure of prokaryotic assemblages was mostly influenced by the community group, where the soil, episphere, and endosphere were clearly distinct. Proteobacteria (γ and α), Actinobacteria, and Acidobacteria were the dominant phyla. Bacterial communities in the episphere of agaves were mainly influenced by the host species, whereas in the endosphere were affected by the season. Fifteen bacterial taxa were common and abundant in the endosphere of both Agave species during the dry season. Notably, some of the confirmed diazotrophic strains belonged to this group, suggesting a possible beneficial role in planta. PMID:25314594

  4. Massive infection of seabird ticks with bacterial species related to Coxiella burnetii.

    PubMed

    Wilkinson, David A; Dietrich, Muriel; Lebarbenchon, Camille; Jaeger, Audrey; Le Rouzic, Céline; Bastien, Matthieu; Lagadec, Erwan; McCoy, Karen D; Pascalis, Hervé; Le Corre, Matthieu; Dellagi, Koussay; Tortosa, Pablo

    2014-06-01

    Seabird ticks are known reservoirs of bacterial pathogens of medical importance; however, ticks parasitizing tropical seabirds have received less attention than their counterparts from temperate and subpolar regions. Recently, Rickettsia africae was described to infect seabird ticks of the western Indian Ocean and New Caledonia, constituting the only available data on bacterial pathogens associated with tropical seabird tick species. Here, we combined a pyrosequencing-based approach with a classical molecular analysis targeting bacteria of potential medical importance in order to describe the bacterial community in two tropical seabird ticks, Amblyomma loculosum and Carios (Ornithodoros) capensis. We also investigated the patterns of prevalence and host specificity within the biogeographical context of the western Indian Ocean islands. The bacterial community of the two tick species was characterized by a strong dominance of Coxiella and Rickettsia. Our data support a strict Coxiella-host tick specificity, a pattern resembling the one found for Rickettsia spp. in the same two seabird tick species. Both the high prevalence and stringent host tick specificity suggest that these bacteria may be tick symbionts with probable vertical transmission. Detailed studies of the pathogenicity of these bacteria will now be required to determine whether horizontal transmission can occur and to clarify their status as potential human pathogens. More generally, our results show that the combination of next generation sequencing with targeted detection/genotyping approaches proves to be efficient in poorly investigated fields where research can be considered to be starting from scratch.

  5. Cuticles of European and American lobsters harbor diverse bacterial species and differ in disease susceptibility.

    PubMed

    Whitten, Miranda M A; Davies, Charlotte E; Kim, Anita; Tlusty, Michael; Wootton, Emma C; Chistoserdov, Andrei; Rowley, Andrew F

    2014-06-01

    Diseases of lobster shells have a significant impact on fishing industries but the risk of disease transmission between different lobster species has yet to be properly investigated. This study compared bacterial biofilm communities from American (Homarus americanus) and European lobsters (H. gammarus), to assess both healthy cuticle and diseased cuticle during lesion formation. Culture-independent molecular techniques revealed diversity in the bacterial communities of cuticle biofilms both within and between the two lobster species, and identified three bacterial genera associated with shell lesions plus two putative beneficial bacterial species (detected exclusively in healthy cuticle or healing damaged cuticle). In an experimental aquarium shared between American and European lobsters, heterospecific transmission of potentially pathogenic bacteria appeared to be very limited; however, the claws of European lobsters were more likely to develop lesions when reared in the presence of American lobsters. Aquarium biofilms were also examined but revealed no candidate pathogens for environmental transmission. Aquimarina sp. 'homaria' (a potential pathogen associated with a severe epizootic form of shell disease) was detected at a much higher prevalence among American than European lobsters, but its presence correlated more with exacerbation of existing lesions rather than with lesion initiation. PMID:24817518

  6. Cuticles of European and American lobsters harbor diverse bacterial species and differ in disease susceptibility

    PubMed Central

    Whitten, Miranda M A; Davies, Charlotte E; Kim, Anita; Tlusty, Michael; Wootton, Emma C; Chistoserdov, Andrei; Rowley, Andrew F

    2014-01-01

    Diseases of lobster shells have a significant impact on fishing industries but the risk of disease transmission between different lobster species has yet to be properly investigated. This study compared bacterial biofilm communities from American (Homarus americanus) and European lobsters (H. gammarus), to assess both healthy cuticle and diseased cuticle during lesion formation. Culture-independent molecular techniques revealed diversity in the bacterial communities of cuticle biofilms both within and between the two lobster species, and identified three bacterial genera associated with shell lesions plus two putative beneficial bacterial species (detected exclusively in healthy cuticle or healing damaged cuticle). In an experimental aquarium shared between American and European lobsters, heterospecific transmission of potentially pathogenic bacteria appeared to be very limited; however, the claws of European lobsters were more likely to develop lesions when reared in the presence of American lobsters. Aquarium biofilms were also examined but revealed no candidate pathogens for environmental transmission. Aquimarina sp. ‘homaria’ (a potential pathogen associated with a severe epizootic form of shell disease) was detected at a much higher prevalence among American than European lobsters, but its presence correlated more with exacerbation of existing lesions rather than with lesion initiation. PMID:24817518

  7. Intestinal Bacterial Flora and Transit Time of Three Neotropical Bat Species

    PubMed Central

    Klite, P. D.

    1965-01-01

    Klite, P. D. (Middle America Research Unit, Balboa Heights, Canal Zone). Intestinal bacterial flora and transit time of three neotropical bat species. J. Bacteriol. 90:375–379. 1965.—Quantitative studies on the intestinal bacterial flora of three neotropical bat species revealed the following average bacterial populations: Molossus major, 104.8 bacteria per intestinal contents; Carollia perspicillata, 103.3; Chilonycteris rubiginosa, 103.9. In comparison, laboratory mice had an average of 109.7 bacteria per intestinal contents. Of 236 bacterial isolates obtained from 60 bats, bacteria of the Klebsiella-Aerobacter-Serratia group were found most frequently, followed by enterococci and Proteus spp. Bacteria of eight other groups were less frequently recovered. A large intestine, cecum, or appendix was absent in all three bat species, and the intestinal length was one-third to one-fifth of that in a mouse of comparable weight. The transit time through the short bat intestine was 15 min. The possible relationship of these unusual anatomical and physiological phenomena to the ability of Histoplasma capsulatum to survive in bat feces is discussed. PMID:14329450

  8. Diazotrophic potential among bacterial communities associated with wild and cultivated Agave species.

    PubMed

    Desgarennes, Damaris; Garrido, Etzel; Torres-Gomez, Miryam J; Peña-Cabriales, Juan J; Partida-Martinez, Laila P

    2014-12-01

    Agaves are major biotic resources in arid and semi-arid ecosystems. Despite their ecological, economical and cultural relevance, many aspects of the microbial communities associated with agaves are still unknown. Here, we investigated the bacterial communities associated with two Agave species by 16S rRNA- Denaturing gradient gel electrophoresis fingerprinting and sequencing. We also evaluated the effects of biotic and abiotic factors in the structure of the bacterial communities. In parallel, we isolated and characterized diazotrophic bacteria associated with agaves, as Agave soils are characterized by their low nitrogen content. Our results demonstrate that in Agave, the structure of prokaryotic assemblages was mostly influenced by the community group, where the soil, episphere, and endosphere were clearly distinct. Proteobacteria (γ and α), Actinobacteria, and Acidobacteria were the dominant phyla. Bacterial communities in the episphere of agaves were mainly influenced by the host species, whereas in the endosphere were affected by the season. Fifteen bacterial taxa were common and abundant in the endosphere of both Agave species during the dry season. Notably, some of the confirmed diazotrophic strains belonged to this group, suggesting a possible beneficial role in planta.

  9. Disentangling the interactions between photochemical and bacterial degradation of dissolved organic matter: amino acids play a central role.

    PubMed

    Amado, André M; Cotner, James B; Cory, Rose M; Edhlund, Betsy L; McNeill, Kristopher

    2015-04-01

    Photochemical and bacterial degradation are important pathways to carbon mineralization and can be coupled in dissolved organic matter (DOM) decomposition. However, details of several mechanisms of the coupled photochemical and biological processing of DOM remain too poorly understood to achieve accurate predictions of the impact of these processes on DOM fate and reactivity. The aim of this study was to evaluate how photochemical degradation of amino acids affects bacterial metabolism and whether or not photochemical degradation of DOM competes for amino acids with biological processes. We examined the interactions between photochemical and bacterial degradation dynamics using a mixture of 18 amino acids and examined their dynamics and turnover rates within a larger pool of allochthonous or autochthonous DOM. We observed that photochemical exposure of DOM containing amino acids led to delayed biomass production (even though the final biomass did not differ), most likely due to a need for upregulation of biosynthetic pathways for amino acids that were damaged by photochemically produced reactive oxygen species (ROS). This response was most pronounced in bacterial communities where the abundance of photosensitive amino acids was highest (amended treatments and autochthonous DOM) and least pronounced when the abundance of these amino acids was low (unamended and allochthonous DOM), likely because these bacteria already had these biosynthetic pathways functioning. We observed both a cost and benefit associated with photochemical exposure of DOM. We observed a cost associated with photochemically produced ROS that partially degrade key amino acids and a benefit associated with an increase in the availability of other compounds in the DOM. Bacteria growing on DOM sources that are low in labile amino acids, such as those in terrestrially influenced environments, experience more of the benefits associated with photochemical exposure, whereas bacteria growing in more amino

  10. Coral-Associated Bacterial Diversity Is Conserved across Two Deep-Sea Anthothela Species.

    PubMed

    Lawler, Stephanie N; Kellogg, Christina A; France, Scott C; Clostio, Rachel W; Brooke, Sandra D; Ross, Steve W

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4-V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont. PMID:27092120

  11. Coral-associated bacterial diversity is conserved across two deep-sea Anthothela species

    USGS Publications Warehouse

    Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C; Clostio, Rachel W; Brooke, Sandra D.; Ross, Steve W.

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4-V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont.

  12. Coral-Associated Bacterial Diversity Is Conserved across Two Deep-Sea Anthothela Species

    PubMed Central

    Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C.; Clostio, Rachel W.; Brooke, Sandra D.; Ross, Steve W.

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4–V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont. PMID:27092120

  13. Coral-Associated Bacterial Diversity Is Conserved across Two Deep-Sea Anthothela Species.

    PubMed

    Lawler, Stephanie N; Kellogg, Christina A; France, Scott C; Clostio, Rachel W; Brooke, Sandra D; Ross, Steve W

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4-V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont.

  14. Bacterial-biota dynamics of eight bryophyte species from different ecosystems.

    PubMed

    Koua, Faisal Hammad Mekky; Kimbara, Kazuhide; Tani, Akio

    2015-03-01

    Despite the importance of bryophyte-associated microorganisms in various ecological aspects including their crucial roles in the soil-enrichment of organic mass and N2 fixation, nonetheless, little is known about the microbial diversity of the bryophyte phyllospheres (epi-/endophytes). To get insights into bacterial community structures and their dynamics on the bryophyte habitats in different ecosystems and their potential biological roles, we utilized the 16S rRNA gene PCR-DGGE and subsequent phylogenetic analyses to investigate the bacterial community of eight bryophyte species collected from three distinct ecosystems from western Japan. Forty-two bacterial species belonging to γ-proteobacteria and Firmicutes with 71.4% and 28.6%, respectively, were identified among 90 DGGE gel band population. These DGGE-bands were assigned to 13 different genera with obvious predomination the genus Clostridium with 21.4% from the total bacterial community. These analyses provide new insights into bryophyte-associated bacteria and their relations to the ecosystems. PMID:25737654

  15. Bacterial production and transformation of dissolved neutral sugars and amino acids in seawater

    NASA Astrophysics Data System (ADS)

    Jørgensen, L.; Lechtenfeld, O.; Benner, R.; Middelboe, M.; Stedmon, C. A.

    2014-04-01

    Dissolved organic matter (DOM) in the ocean consists of a heterogeneous mixture of molecules, most of which are of unknown origin. Neutral sugars and amino acids are among the few recognizable biomolecules in DOM, and the molecular composition of these biomolecules is shaped primarily by biological production and degradation processes. This study provides insight into the bioavailability of biomolecules as well as the chemical composition of DOM produced by bacteria. The molecular compositions of neutral sugars and amino acids were investigated in DOM produced by bacteria and in DOM remaining after long-term bacterial degradation. Results from bioassay incubations (32 days) with natural and artificial seawater, indicate that the molecular compositions following bacterial degradation are not strongly influenced by the initial substrate or bacterial community. The molecular composition of neutral sugars released by bacteria was characterized by a high glucose content (47 mol%) and heterogeneous contributions from other neutral sugars (3-14 mol%). DOM remaining after bacterial degradation was characterized by a high galactose content (33 mol%), followed by glucose (22 mol%) and the remaining neutral sugars (7-11 mol%). The ratio of D-amino acids to L-amino acids increased during the experiments as a response to bacterial degradation, and after 32 days the D/L ratios of aspartic acid, glutamic acid, serine and alanine reached around 0.79, 0.32, 0.30 and 0.51 in all treatments, respectively. The striking similarity in neutral sugar and amino acid compositions between natural and artificial seawater samples, suggests that the microbial carbon pump also applies for neutral sugars and amino acids and that bacterially-produced biomolecules persist for long periods in the ocean.

  16. Routine phenotypic identification of bacterial species of the family Pasteurellaceae isolated from animals.

    PubMed

    Dousse, Florence; Thomann, Andreas; Brodard, Isabelle; Korczak, Bozena M; Schlatter, Yvonne; Kuhnert, Peter; Miserez, Raymond; Frey, Joachim

    2008-11-01

    Pasteurellaceae are bacteria with an important role as primary or opportunistic, mainly respiratory, pathogens in domestic and wild animals. Some species of Pasteurellaceae cause severe diseases with high economic losses in commercial animal husbandry and are of great diagnostic concern. Because of new data on the phylogeny of Pasteurellaceae, their taxonomy has recently been revised profoundly, thus requiring an improved phenotypic differentiation procedure to identify the individual species of this family. A new and simplified procedure to identify species of Actinobacillus, Avibacterium, Gallibacterium, Haemophilus, Mannheimia, Nicoletella, and Pasteurella, which are most commonly isolated from clinical samples of diseased animals in veterinary diagnostic laboratories, is presented in the current study. The identification procedure was evaluated with 40 type and reference strains and with 267 strains from routine diagnostic analysis of various animal species, including 28 different bacterial species. Type, reference, and field strains were analyzed by 16S ribosomal RNA (rrs) and rpoB gene sequencing for unambiguous species determination as a basis to evaluate the phenotypic differentiation schema. Primary phenotypic differentiation is based on beta-nicotinamide adenine dinucleotide (beta-NAD) dependence and hemolysis, which are readily determined on the isolation medium. The procedure divides the 28 species into 4 groups for which particular biochemical reactions were chosen to identify the bacterial species. The phenotypic identification procedure allowed researchers to determine the species of 240 out of 267 field strains. The procedure is an easy and cost-effective system for the rapid identification of species of the Pasteurellaceae family isolated from clinical specimens of animals. PMID:18987220

  17. Modular riboswitch toolsets for synthetic genetic control in diverse bacterial species.

    PubMed

    Robinson, Christopher J; Vincent, Helen A; Wu, Ming-Cheng; Lowe, Phillip T; Dunstan, Mark S; Leys, David; Micklefield, Jason

    2014-07-30

    Ligand-dependent control of gene expression is essential for gene functional analysis, target validation, protein production, and metabolic engineering. However, the expression tools currently available are difficult to transfer between species and exhibit limited mechanistic diversity. Here we demonstrate how the modular architecture of purine riboswitches can be exploited to develop orthogonal and chimeric switches that are transferable across diverse bacterial species, modulating either transcription or translation, to provide tunable activation or repression of target gene expression, in response to synthetic non-natural effector molecules. Our novel riboswitch-ligand pairings are shown to regulate physiologically important genes required for bacterial motility in Escherichia coli and cell morphology in Bacillus subtilis. These findings are relevant for future gene function studies and antimicrobial target validation, while providing new modular and orthogonal regulatory components for deployment in synthetic biology regimes. PMID:24971878

  18. Genome-wide survey of codons under diversifying selection in a highly recombining bacterial species, Helicobacter pylori

    PubMed Central

    Yahara, Koji; Furuta, Yoshikazu; Morimoto, Shinpei; Kikutake, Chie; Komukai, Sho; Matelska, Dorota; Dunin-Horkawicz, Stanisław; Bujnicki, Janusz M.; Uchiyama, Ikuo; Kobayashi, Ichizo

    2016-01-01

    Selection has been a central issue in biology in eukaryotes as well as prokaryotes. Inference of selection in recombining bacterial species, compared with clonal ones, has been a challenge. It is not known how codons under diversifying selection are distributed along the chromosome or among functional categories or how frequently such codons are subject to mutual homologous recombination. Here, we explored these questions by analysing genes present in >90% among 29 genomes of Helicobacter pylori, one of the bacterial species with the highest mutation and recombination rates. By a method for recombining sequences, we identified codons under diversifying selection (dN/dS > 1), which were widely distributed and accounted for ∼0.2% of all the codons of the genome. The codons were enriched in genes of host interaction/cell surface and genome maintenance (DNA replication, recombination, repair, and restriction modification system). The encoded amino acid residues were sometimes found adjacent to critical catalytic/binding residues in protein structures. Furthermore, by estimating the intensity of homologous recombination at a single nucleotide level, we found that these codons appear to be more frequently subject to recombination. We expect that the present study provides a new approach to population genomics of selection in recombining prokaryotes. PMID:26961370

  19. Assessing the viability of bacterial species in drinking water by combined cellular and molecular analyses.

    PubMed

    Kahlisch, Leila; Henne, Karsten; Gröbe, Lothar; Brettar, Ingrid; Höfle, Manfred G

    2012-02-01

    The question which bacterial species are present in water and if they are viable is essential for drinking water safety but also of general relevance in aquatic ecology. To approach this question we combined propidium iodide/SYTO9 staining ("live/dead staining" indicating membrane integrity), fluorescence-activated cell sorting (FACS) and community fingerprinting for the analysis of a set of tap water samples. Live/dead staining revealed that about half of the bacteria in the tap water had intact membranes. Molecular analysis using 16S rRNA and 16S rRNA gene-based single-strand conformation polymorphism (SSCP) fingerprints and sequencing of drinking water bacteria before and after FACS sorting revealed: (1) the DNA- and RNA-based overall community structure differed substantially, (2) the community retrieved from RNA and DNA reflected different bacterial species, classified as 53 phylotypes (with only two common phylotypes), (3) the percentage of phylotypes with intact membranes or damaged cells were comparable for RNA- and DNA-based analyses, and (4) the retrieved species were primarily of aquatic origin. The pronounced difference between phylotypes obtained from DNA extracts (dominated by Betaproteobacteria, Bacteroidetes, and Actinobacteria) and from RNA extracts (dominated by Alpha-, Beta-, Gammaproteobacteria, Bacteroidetes, and Cyanobacteria) demonstrate the relevance of concomitant RNA and DNA analyses for drinking water studies. Unexpected was that a comparable fraction (about 21%) of phylotypes with membrane-injured cells was observed for DNA- and RNA-based analyses, contradicting the current understanding that RNA-based analyses represent the actively growing fraction of the bacterial community. Overall, we think that this combined approach provides an interesting tool for a concomitant phylogenetic and viability analysis of bacterial species of drinking water.

  20. Colonization of the upper genital tract by vaginal bacterial species in non-pregnant women

    PubMed Central

    MITCHELL, Caroline M.; HAICK, Anoria; NKWOPARA, Evangelyn; GARCIA, Rochelle; RENDI, Mara; AGNEW, Kathy; FREDRICKS, David N.; ESCHENBACH, David

    2016-01-01

    Objective Evaluate upper genital tract (UGT) presence of vaginal bacterial species using sensitive molecular methods capable of detecting fastidious bacterial vaginosis (BV)-associated bacteria. Study Design Vaginal swabs were collected prior to hysterectomy. The excised uterus was sterilely opened and swabs collected from endometrium and upper endocervix. DNA was tested in 11 quantitative PCR (qPCR) assays for 12 bacterial species: Lactobacillus iners, L. crispatus, L. jensenii, Gardnerella vaginalis, Atopobium vaginae, Megasphaera spp., Prevotella spp., Leptotrichia/Sneathia, BVAB1, BVAB2, BVAB3 and a broad-range16S rRNA gene assay. Endometrial fluid was tested with Luminex and ELISA for cytokines and defensins, and tissue for gene expression of defensins and cathelicidin. Results We enrolled 58 women: mean age 43 + 7 years, mostly white (n = 46; 79%) and BV-negative (n = 43; 74%). By species-specific qPCR, 55 (95%) had UGT colonization with at least one species (n = 52), or were positive by 16S PCR (n = 3). The most common species were L. iners (45% UGT, 61% vagina), Prevotella spp. (33% UGT, 76% vagina) and L. crispatus (33% UGT, 56% vagina). Median quantities of bacteria in the UGT were lower than vaginal levels by 2–4 log10 rRNA gene copies/swab. There were no differences in endometrial inflammatory markers between women with no bacteria, Lactobacillus only or any BV-associated species in the UGT. Conclusion Our data suggest that the endometrial cavity is not sterile in most women undergoing hysterectomy, and that the presence of low levels of bacteria in the uterus is not associated with significant inflammation. PMID:25524398

  1. Loline alkaloid production by fungal endophytes of Fescue species select for particular epiphytic bacterial microflora

    PubMed Central

    Roberts, Elizabeth; Lindow, Steven

    2014-01-01

    The leaves of fescue grasses are protected from herbivores by the production of loline alkaloids by the mutualist fungal endophytes Neotyphodium sp. or Epichloë sp. Most bacteria that reside on the leaf surface of such grasses can consume these defensive chemicals. Loline-consuming bacteria are rare on the leaves of other plant species. Several bacterial species including Burkholderia ambifaria recovered from tall fescue could use N-formyl loline as a sole carbon and nitrogen source in culture and achieved population sizes that were about eightfold higher when inoculated onto plants harboring loline-producing fungal endophytes than on plants lacking such endophytes or which were colonized by fungal variants incapable of loline production. In contrast, mutants of B. ambifaria and other bacterial species incapable of loline catabolism achieved similarly low population sizes on tall fescue colonized by loline-producing Neotyphodium sp. and on plants lacking this endophytic fungus. Lolines that are released onto the surface of plants benefiting from a fungal mutualism thus appear to be a major resource that can be exploited by epiphytic bacteria, thereby driving the establishment of a characteristic bacterial community on such plants. PMID:24108329

  2. Effects of viruses on bacterial functions under contrasting nutritional conditions for four species of bacteria isolated from Hong Kong waters.

    PubMed

    Liu, Hao; Yuan, Xiangcheng; Xu, Jie; Harrison, Paul J; He, Lei; Yin, Kedong

    2015-01-01

    Free living viruses are ubiquitous in marine waters and concentrations are usually several times higher than the bacterial abundance. These viruses are capable of lysing host bacteria and therefore, play an important role in the microbial loop in oligotrophic waters. However, few studies have been conducted to compare the role of viruses in regulating bacterial abundance and heterotrophic activities between natural oligotrophic waters and anthropogenic influenced eutrophic waters. In this study, we examined viral effects on bacterial functions of four single bacterial species incubated with natural viral assemblages in seawater samples from eutrophic and oligotrophic waters. The viral-lysis of bacteria was significantly higher in eutrophic than oligotrophic waters. This suggests that viruses were capable of controlling bacterial abundance, respiration and production in the eutrophic waters. Cellular bacterial respiration and production was higher with viruses than without viruses, which was more evident in the oligotrophic waters. These results indicate that viruses can slow down bacterial consumption of oxygen and reduce bacteria-induced eutrophication effects in anthropogenic eutrophic waters, but switch to the role of sustaining the bacterial population when nutrients are limiting. There were bacterial species differences in resisting viral attack, which can influence the dominance and biodiversity of bacterial species in coastal waters. PMID:26404394

  3. Effects of viruses on bacterial functions under contrasting nutritional conditions for four species of bacteria isolated from Hong Kong waters

    PubMed Central

    Liu, Hao; Yuan, Xiangcheng; Xu, Jie; Harrison, Paul J.; He, Lei; Yin, Kedong

    2015-01-01

    Free living viruses are ubiquitous in marine waters and concentrations are usually several times higher than the bacterial abundance. These viruses are capable of lysing host bacteria and therefore, play an important role in the microbial loop in oligotrophic waters. However, few studies have been conducted to compare the role of viruses in regulating bacterial abundance and heterotrophic activities between natural oligotrophic waters and anthropogenic influenced eutrophic waters. In this study, we examined viral effects on bacterial functions of four single bacterial species incubated with natural viral assemblages in seawater samples from eutrophic and oligotrophic waters. The viral-lysis of bacteria was significantly higher in eutrophic than oligotrophic waters. This suggests that viruses were capable of controlling bacterial abundance, respiration and production in the eutrophic waters. Cellular bacterial respiration and production was higher with viruses than without viruses, which was more evident in the oligotrophic waters. These results indicate that viruses can slow down bacterial consumption of oxygen and reduce bacteria-induced eutrophication effects in anthropogenic eutrophic waters, but switch to the role of sustaining the bacterial population when nutrients are limiting. There were bacterial species differences in resisting viral attack, which can influence the dominance and biodiversity of bacterial species in coastal waters. PMID:26404394

  4. Effects of viruses on bacterial functions under contrasting nutritional conditions for four species of bacteria isolated from Hong Kong waters

    NASA Astrophysics Data System (ADS)

    Liu, Hao; Yuan, Xiangcheng; Xu, Jie; Harrison, Paul J.; He, Lei; Yin, Kedong

    2015-09-01

    Free living viruses are ubiquitous in marine waters and concentrations are usually several times higher than the bacterial abundance. These viruses are capable of lysing host bacteria and therefore, play an important role in the microbial loop in oligotrophic waters. However, few studies have been conducted to compare the role of viruses in regulating bacterial abundance and heterotrophic activities between natural oligotrophic waters and anthropogenic influenced eutrophic waters. In this study, we examined viral effects on bacterial functions of four single bacterial species incubated with natural viral assemblages in seawater samples from eutrophic and oligotrophic waters. The viral-lysis of bacteria was significantly higher in eutrophic than oligotrophic waters. This suggests that viruses were capable of controlling bacterial abundance, respiration and production in the eutrophic waters. Cellular bacterial respiration and production was higher with viruses than without viruses, which was more evident in the oligotrophic waters. These results indicate that viruses can slow down bacterial consumption of oxygen and reduce bacteria-induced eutrophication effects in anthropogenic eutrophic waters, but switch to the role of sustaining the bacterial population when nutrients are limiting. There were bacterial species differences in resisting viral attack, which can influence the dominance and biodiversity of bacterial species in coastal waters.

  5. Effects of viruses on bacterial functions under contrasting nutritional conditions for four species of bacteria isolated from Hong Kong waters.

    PubMed

    Liu, Hao; Yuan, Xiangcheng; Xu, Jie; Harrison, Paul J; He, Lei; Yin, Kedong

    2015-01-01

    Free living viruses are ubiquitous in marine waters and concentrations are usually several times higher than the bacterial abundance. These viruses are capable of lysing host bacteria and therefore, play an important role in the microbial loop in oligotrophic waters. However, few studies have been conducted to compare the role of viruses in regulating bacterial abundance and heterotrophic activities between natural oligotrophic waters and anthropogenic influenced eutrophic waters. In this study, we examined viral effects on bacterial functions of four single bacterial species incubated with natural viral assemblages in seawater samples from eutrophic and oligotrophic waters. The viral-lysis of bacteria was significantly higher in eutrophic than oligotrophic waters. This suggests that viruses were capable of controlling bacterial abundance, respiration and production in the eutrophic waters. Cellular bacterial respiration and production was higher with viruses than without viruses, which was more evident in the oligotrophic waters. These results indicate that viruses can slow down bacterial consumption of oxygen and reduce bacteria-induced eutrophication effects in anthropogenic eutrophic waters, but switch to the role of sustaining the bacterial population when nutrients are limiting. There were bacterial species differences in resisting viral attack, which can influence the dominance and biodiversity of bacterial species in coastal waters.

  6. [Finding of the bacterial species Edwardsiella tarda in the aquarium fish Betta splendens].

    PubMed

    Vladík, P; Prouza, A; Vítovec, J

    1983-01-01

    A case of the mass occurrence of a disease in the aquarium fish species Betta splendens is described; morphologically the disease was characterized by the finding of large dermal changes located mainly in the dorsal part and by miliary granulomata in liver, spleen and kidneys. The granulomata consisted of epitheloid light cells with centrally located necrosis. Gram-negative bacteria with morphological and biochemical characteristics corresponding to the bacterial species Edwardsiella tarda were isolated from the kidneys, liver and from the dermal lesion. The characteristics of the strains isolated by us were compared with the reference Edwardsiella strain (Bth 1/64) obtained from the Czechoslovak collection of type cultures, Prague.

  7. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  8. Bacterial Communities in Acidic and Circumneutral Streams †

    PubMed Central

    Palumbo, Anthony V.; Bogle, Mary Anna; Turner, Ralph R.; Elwood, Jerry W.; Mulholland, Patrick J.

    1987-01-01

    The relationship between pH and the abundance and activity of bacteria in streams was examined as part of a study of the effect of acidification on stream communities. Of the bacterial communities examined, the epilithic community appeared to be the most significantly affected by acidification. Microbial biomass, as quantified by measuring the ATP level, on rock surfaces was significantly correlated with pH. Also, bacterial production by the epilithic bacteria, indicated by incorporation of tritiated thymidine into DNA, was always higher at high-pH sites than at low-pH sites of the same stream order and elevation. Bacterioplankton concentrations varied between 0.53 × 105 and 9.42 × 105 cells · ml−1 in the first- to fourth-order streams examined. The bacterioplankton concentration in one sample from a spring was 0.17 × 105 cells · ml−1. Bacterioplankton concentrations were not correlated with pH but were significantly correlated with seston concentrations. The correlation with seston is a result of increases in particle-associated bacteria at high seston concentrations. The proportion of bacterioplankton attached to particles varied from 0 to 70%. Bacterial numbers and production in the sediments were significantly correlated with the organic content of the sediment rather than with the pH of the overlying water. Thus, reduced abundance and activity of bacteria as a result of acidification could be detected only for the relatively active community on rock surfaces; this community was exposed to the low pH because of the unbuffered nature of its environment. PMID:16347283

  9. Unified Theory of Bacterial Sialometabolism: How and Why Bacteria Metabolize Host Sialic Acids

    PubMed Central

    Vimr, Eric R.

    2013-01-01

    Sialic acids are structurally diverse nine-carbon ketosugars found mostly in humans and other animals as the terminal units on carbohydrate chains linked to proteins or lipids. The sialic acids function in cell-cell and cell-molecule interactions necessary for organismic development and homeostasis. They not only pose a barrier to microorganisms inhabiting or invading an animal mucosal surface, but also present a source of potential carbon, nitrogen, and cell wall metabolites necessary for bacterial colonization, persistence, growth, and, occasionally, disease. The explosion of microbial genomic sequencing projects reveals remarkable diversity in bacterial sialic acid metabolic potential. How bacteria exploit host sialic acids includes a surprisingly complex array of metabolic and regulatory capabilities that is just now entering a mature research stage. This paper attempts to describe the variety of bacterial sialometabolic systems by focusing on recent advances at the molecular and host-microbe-interaction levels. The hope is that this focus will provide a framework for further research that holds promise for better understanding of the metabolic interplay between bacterial growth and the host environment. An ability to modify or block this interplay has already yielded important new insights into potentially new therapeutic approaches for modifying or blocking bacterial colonization or infection. PMID:23724337

  10. RT-PCR-DGGE Analysis to Elucidate the Dominant Bacterial Species of Industrial Spanish-Style Green Table Olive Fermentations.

    PubMed

    Benítez-Cabello, Antonio; Bautista-Gallego, Joaquín; Garrido-Fernández, Antonio; Rantsiou, Kalliopi; Cocolin, Luca; Jiménez-Díaz, Rufino; Arroyo-López, Francisco N

    2016-01-01

    This paper describes the dominant bacterial species metabolically active through the industrial production of Spanish-style Manzanilla and Gordal olives. For this purpose, samples (brines and fruits) obtained at 0, 15, and 90 fermentation days were analyzed by a culture-independent approach to determine viable cells by reverse transcription of RNA and further PCR-DGGE analysis, detecting at least 7 different species. Vibrio vulnificus, Lactobacillus plantarum group, and Lactobacillus parafarraginis were present in samples from both cultivars; Lactobacillus sanfranciscensis and Halolactobacillus halophilus were detected only in Gordal samples, while Staphylococcus sp. was exclusively found at the onset of Manzanilla fermentations. Physicochemical data showed a typical fermentation profile while scanning electron microscopy confirmed the in situ biofilm formation on the olive epidermis. Different Bacillus, Staphylococcus, and Enterococcus species, not detected during the fermentation process, were also found in the solid marine salt used by the industry for preparation of brines. Elucidation of these non-lactic acid bacteria species role during fermentation is then an appealingly challenge, particularly regarding safety issues. PMID:27582739

  11. RT-PCR–DGGE Analysis to Elucidate the Dominant Bacterial Species of Industrial Spanish-Style Green Table Olive Fermentations

    PubMed Central

    Benítez-Cabello, Antonio; Bautista-Gallego, Joaquín; Garrido-Fernández, Antonio; Rantsiou, Kalliopi; Cocolin, Luca; Jiménez-Díaz, Rufino; Arroyo-López, Francisco N.

    2016-01-01

    This paper describes the dominant bacterial species metabolically active through the industrial production of Spanish-style Manzanilla and Gordal olives. For this purpose, samples (brines and fruits) obtained at 0, 15, and 90 fermentation days were analyzed by a culture-independent approach to determine viable cells by reverse transcription of RNA and further PCR-DGGE analysis, detecting at least 7 different species. Vibrio vulnificus, Lactobacillus plantarum group, and Lactobacillus parafarraginis were present in samples from both cultivars; Lactobacillus sanfranciscensis and Halolactobacillus halophilus were detected only in Gordal samples, while Staphylococcus sp. was exclusively found at the onset of Manzanilla fermentations. Physicochemical data showed a typical fermentation profile while scanning electron microscopy confirmed the in situ biofilm formation on the olive epidermis. Different Bacillus, Staphylococcus, and Enterococcus species, not detected during the fermentation process, were also found in the solid marine salt used by the industry for preparation of brines. Elucidation of these non-lactic acid bacteria species role during fermentation is then an appealingly challenge, particularly regarding safety issues. PMID:27582739

  12. Concordance of bacterial communities of two tick species and blood of their shared rodent host.

    PubMed

    Rynkiewicz, Evelyn C; Hemmerich, Chris; Rusch, Douglas B; Fuqua, Clay; Clay, Keith

    2015-05-01

    High-throughput sequencing is revealing that most macro-organisms house diverse microbial communities. Of particular interest are disease vectors whose microbiome could potentially affect pathogen transmission and vector competence. We investigated bacterial community composition and diversity of the ticks Dermacentor variabilis (n = 68) and Ixodes scapularis (n = 15) and blood of their shared rodent host, Peromyscus leucopus (n = 45) to quantify bacterial diversity and concordance. The 16S rRNA gene was amplified from genomic DNA from field-collected tick and rodent blood samples, and 454 pyrosequencing was used to elucidate their bacterial communities. After quality control, over 300 000 sequences were obtained and classified into 118 operational taxonomic units (OTUs, clustered at 97% similarity). Analysis of rarefied communities revealed that the most abundant OTUs were tick species-specific endosymbionts, Francisella and Rickettsia, and the commonly flea-associated bacterium Bartonella in rodent blood. An Arsenophonus and additional Francisella endosymbiont were also present in D. variabilis samples. Rickettsia was found in both tick species but not in rodent blood, suggesting that it is not transmitted during feeding. Bartonella was present in larvae and nymphs of both tick species, even those scored as unengorged. Relatively, few OTUs (e.g. Bartonella, Lactobacillus) were found in all sample types. Overall, bacterial communities from each sample type were significantly different and highly structured, independent of their dominant OTUs. Our results point to complex microbial assemblages inhabiting ticks and host blood including infectious agents, tick-specific endosymbionts and environmental bacteria that could potentially affect arthropod-vectored disease dynamics. PMID:25847197

  13. Concordance of bacterial communities of two tick species and blood of their shared rodent host.

    PubMed

    Rynkiewicz, Evelyn C; Hemmerich, Chris; Rusch, Douglas B; Fuqua, Clay; Clay, Keith

    2015-05-01

    High-throughput sequencing is revealing that most macro-organisms house diverse microbial communities. Of particular interest are disease vectors whose microbiome could potentially affect pathogen transmission and vector competence. We investigated bacterial community composition and diversity of the ticks Dermacentor variabilis (n = 68) and Ixodes scapularis (n = 15) and blood of their shared rodent host, Peromyscus leucopus (n = 45) to quantify bacterial diversity and concordance. The 16S rRNA gene was amplified from genomic DNA from field-collected tick and rodent blood samples, and 454 pyrosequencing was used to elucidate their bacterial communities. After quality control, over 300 000 sequences were obtained and classified into 118 operational taxonomic units (OTUs, clustered at 97% similarity). Analysis of rarefied communities revealed that the most abundant OTUs were tick species-specific endosymbionts, Francisella and Rickettsia, and the commonly flea-associated bacterium Bartonella in rodent blood. An Arsenophonus and additional Francisella endosymbiont were also present in D. variabilis samples. Rickettsia was found in both tick species but not in rodent blood, suggesting that it is not transmitted during feeding. Bartonella was present in larvae and nymphs of both tick species, even those scored as unengorged. Relatively, few OTUs (e.g. Bartonella, Lactobacillus) were found in all sample types. Overall, bacterial communities from each sample type were significantly different and highly structured, independent of their dominant OTUs. Our results point to complex microbial assemblages inhabiting ticks and host blood including infectious agents, tick-specific endosymbionts and environmental bacteria that could potentially affect arthropod-vectored disease dynamics.

  14. Inhibition of bacterial activity in acid mine drainage

    NASA Astrophysics Data System (ADS)

    Singh, Gurdeep; Bhatnagar, Miss Mridula

    1988-12-01

    Acid mine drainage water give rise to rapid growth and activity of an iron- and sulphur- oxidizing bacterium Thiobacillus ferrooxidians which greatly accelerate acid producing reactions by oxidation of pyrite material associated with coal and adjoining strata. The role of this bacterium in production of acid mine drainage is described. This study presents the data which demonstrate the inhibitory effect of certain organic acids, sodium benzoate, sodium lauryl sulphate, quarternary ammonium compounds on the growth of the acidophilic aerobic autotroph Thiobacillus ferrooxidians. In each experiment, 10 milli-litres of laboratory developed culture of Thiobacillus ferrooxidians was added to 250 milli-litres Erlenmeyer flask containing 90 milli-litres of 9-k media supplemented with FeSO4 7H2O and organic compounds at various concentrations. Control experiments were also carried out. The treated and untreated (control) samples analysed at various time intervals for Ferrous Iron and pH levels. Results from this investigation showed that some organic acids, sodium benzoate, sodium lauryl sulphate and quarternary ammonium compounds at low concentration (10-2 M, 10-50 ppm concentration levels) are effective bactericides and able to inhibit and reduce the Ferrous Iron oxidation and acidity formation by inhibiting the growth of Thiobacillus ferrooxidians is also discussed and presented

  15. Bacterial community structure in freshwater springs infested with the invasive plant species Hydrilla verticillata

    PubMed Central

    Gordon-Bradley, N.; Li, N.

    2015-01-01

    The phylogenetic composition and physiological profiles of bacterial communities in freshwater springs were evaluated during the blooming and non-blooming stages of the invasive plant species, Hydrilla verticillata. Community-level physiological profiles (CLPPs) and pyrosequencing of 16S rRNA gene amplicons were used to study potential Hydrilla mediated shifts in the physiological potential and phylogenetic composition of the bacterial community in infested systems. The results of CLPP revealed that the microbes in the Hydrilla invaded sites utilized less substrates during blooming periods than during nonblooming periods of the plant. Spearman’s rank correlation analysis showed some relationships between the relative abundances of bacterial taxa and the Biolog substrate utilization pattern. The relative abundance of the identified taxa showed some striking differences based on the blooming status of Hydrilla and to a lesser extent on site variation. The relative abundance of Actinobacteria, Bacteriodetes, and Verrucomicrobia was generally higher during Hydrilla blooms, while Deltaproteobacteria was generally higher during non-blooming stages of Hydrilla. The detected genera also varied based on the blooming stages of the plant. Based on the findings, it appears that Hydrilla alters the phylogenetic composition and structure of the bacterial community during the blooming stage. PMID:26207069

  16. Rumen bacterial communities shift across a lactation in Holstein, Jersey and Holstein × Jersey dairy cows and correlate to rumen function, bacterial fatty acid composition and production parameters.

    PubMed

    Bainbridge, Melissa L; Cersosimo, Laura M; Wright, André-Denis G; Kraft, Jana

    2016-05-01

    Rumen bacteria form a dynamic, complex, symbiotic relationship with their host, degrading forages to provide volatile fatty acids (VFA) and other substrates as energy to the animal. The objectives were to characterize rumen bacteria in three genetic lines of primiparous dairy cattle, Holstein (HO, n = 7), Jersey (JE, n = 8), and HO × JE crossbreeds (CB, n = 7) across a lactation [3, 93, 183 and 273 days in milk (DIM)] and correlate these factors with VFA, bacterial cell membrane fatty acids (FA), and animal production (i.e. milk yield). This study employed Illumina MiSeq (v. 3) to investigate rumen bacterial communities and gas-liquid chromatography/mass spectroscopy to identify bacterial membrane FA. Lactation stage had a prominent effect on rumen bacterial communities, whereas genetics had a lesser effect on rumen bacteria. The FA composition of bacterial cell membranes was affected by both lactation stage and genetics. Few correlations existed between VFA and bacterial communities; however, moderate correlations occurred between milk yield, protein percentage, fat yield and rumen bacterial communities. Positive correlations were found between branched-chain FA (BCFA) in bacterial cell membranes and bacterial genera. In conclusion, bacterial communities and their FA compositions are more affected by stage of lactation than by genetics of dairy cow. PMID:26985012

  17. Potential core species and satellite species in the bacterial community within the rabbit caecum

    PubMed Central

    Monteils, Valérie; Cauquil, Laurent; Combes, Sylvie; Godon, Jean-Jacques; Gidenne, Thierry

    2008-01-01

    A bacteria library was constructed from the caecum of a rabbit maintained under standard conditions. The complete gene 16S rRNA gene was sequenced. The 228 clones obtained were distributed in 70 operational taxonomic units (OTUs). The large majority of the OTUs were composed of one or two clones and seven OTUs contained half of the sequences. Fourteen sequences had high similarity to the sequence already registered in databases (threshold of 97%). Only one of these sequences has been identified as Variovorax sp. (99% identity). Units were distributed mainly (94%) in the Firmicutes phylum. Three sequences were related to Bacteroidetes. Nine clusters were defined in the phylogenic tree. A great diversity of caecal bacteria of the rabbit was shown. Half of the sequences generated in this library were distributed in the phylogenetic tree near the sequences characterized previously in rabbit caecum (potential core species), and the other half of the sequences were well separated (satellite species). PMID:19049656

  18. A New Species of Pristionchus (Rhabditida: Diplogastridae) and Its Bacterial Symbiont from Yixing, China

    PubMed Central

    Li, Pengpeng; Dai, Chensheng; Bao, Haoran; Chen, Long; Gao, Di; Wang, Guoxiang; Wang, Jin; Wang, Hui; Yedid, Gabriel; Zhang, Keyun

    2015-01-01

    A new nematode species, Pristionchus entomophilus n. sp., was collected during a soil sample survey in Yixing of Jiangsu province, eastern China. P. entomophilus n. sp. is distinguished by its unique characteristics. This new species is mainly hermaphroditic, with males seldom found. The new nematode has a similar body length but has much narrower body width compared with P. pacificus. Its body is covered with longitudinal ridges: 12 ridges on head, 13 or 14 ridges in the middle, 11 and 7 ridges in front and rear of the anus, respectively. The eurystomatous form mouth includes a triangular dorsal tooth, a large claw-like right subventral tooth, and a row of five ventral denticles placed opposite the dorsal tooth. Only eight pairs of genital papillae and a pair of phasmids are present in the tail of the male as the sixth pair of papillae having seemingly been degenerated and lost. Molecular phylogenetic trees based on 18S rDNA confirmed that the new species belongs to the genus Pristionchus and is most closely related to P. pacificus. Moreover, the new species was found to be occasionally associated with the entomopathogenic bacterial strain 09FLYB1 of Serratia nematodophila and be able to stably transfer the bacterial strain for several generations. PMID:26527840

  19. Cold temperature decreases bacterial species richness in nitrogen-removing bioreactors treating inorganic mine waters.

    PubMed

    Karkman, A; Mattila, K; Tamminen, M; Virta, M

    2011-12-01

    Explosives used in mining, such as ammonium nitrate fuel oil (ANFO), can cause eutrophication of the surrounding environment by leakage of ammonium and nitrate from undetonated material that is not properly treated. Cold temperatures in mines affect nitrogen removal from water when such nutrients are treated with bioreactors in situ. In this study we identified bacteria in the bioreactors and studied the effect of temperature on the bacterial community. The bioreactors consisted of sequential nitrification and denitrification units running at either 5 or 10°C. One nitrification bioreactor running at 5°C was fed with salt spiked water. From the nitrification bioreactors, sequences from both ammonia- and nitrite-oxidizing bacteria were identified, but the species were distinct at different temperatures. The main nitrifiers in the lower temperature were closely related to the genera Nitrosospira and Candidatus Nitrotoga. 16S rRNA gene sequences closely related to halotolerant Nitrosomonas eutropha were found only from the salt spiked nitrification bioreactor. At 10°C the genera Nitrosomonas and Nitrospira were the abundant nitrifiers. The results showed that bacterial species richness estimates were low, <150 operational taxonomic units (OTUs), in all bioreactor clone libraries, when sequences were assigned to operational taxonomic units at an evolutionary distance of 0.03. The only exception was the nitrification bioreactor running at 10°C where species richness was higher, >300 OTUs. Species richness was lower in bioreactors running at 5°C compared to those operating at 10°C.

  20. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  1. Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo

    PubMed Central

    McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda

    2016-01-01

    ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099

  2. Bacterial colonization and extinction on marine aggregates: stochastic model of species presence and abundance

    PubMed Central

    Kramer, Andrew M; Lyons, M Maille; Dobbs, Fred C; Drake, John M

    2013-01-01

    Organic aggregates provide a favorable habitat for aquatic microbes, are efficiently filtered by shellfish, and may play a major role in the dynamics of aquatic pathogens. Quantifying this role requires understanding how pathogen abundance in the water and aggregate size interact to determine the presence and abundance of pathogen cells on individual aggregates. We build upon current understanding of the dynamics of bacteria and bacterial grazers on aggregates to develop a model for the dynamics of a bacterial pathogen species. The model accounts for the importance of stochasticity and the balance between colonization and extinction. Simulation results suggest that while colonization increases linearly with background density and aggregate size, extinction rates are expected to be nonlinear on small aggregates in a low background density of the pathogen. Under these conditions, we predict lower probabilities of pathogen presence and reduced abundance on aggregates compared with predictions based solely on colonization. These results suggest that the importance of aggregates to the dynamics of aquatic bacterial pathogens may be dependent on the interaction between aggregate size and background pathogen density, and that these interactions are strongly influenced by ecological interactions and pathogen traits. The model provides testable predictions and can be a useful tool for exploring how species-specific differences in pathogen traits may alter the effect of aggregates on disease transmission. PMID:24340173

  3. Intra- and inter-species interactions within biofilms of important foodborne bacterial pathogens

    PubMed Central

    Giaouris, Efstathios; Heir, Even; Desvaux, Mickaël; Hébraud, Michel; Møretrø, Trond; Langsrud, Solveig; Doulgeraki, Agapi; Nychas, George-John; Kačániová, Miroslava; Czaczyk, Katarzyna; Ölmez, Hülya; Simões, Manuel

    2015-01-01

    A community-based sessile life style is the normal mode of growth and survival for many bacterial species. Under such conditions, cell-to-cell interactions are inevitable and ultimately lead to the establishment of dense, complex and highly structured biofilm populations encapsulated in a self-produced extracellular matrix and capable of coordinated and collective behavior. Remarkably, in food processing environments, a variety of different bacteria may attach to surfaces, survive, grow, and form biofilms. Salmonella enterica, Listeria monocytogenes, Escherichia coli, and Staphylococcus aureus are important bacterial pathogens commonly implicated in outbreaks of foodborne diseases, while all are known to be able to create biofilms on both abiotic and biotic surfaces. Particularly challenging is the attempt to understand the complexity of inter-bacterial interactions that can be encountered in such unwanted consortia, such as competitive and cooperative ones, together with their impact on the final outcome of these communities (e.g., maturation, physiology, antimicrobial resistance, virulence, dispersal). In this review, up-to-date data on both the intra- and inter-species interactions encountered in biofilms of these pathogens are presented. A better understanding of these interactions, both at molecular and biophysical levels, could lead to novel intervention strategies for controlling pathogenic biofilm formation in food processing environments and thus improve food safety. PMID:26347727

  4. Novel pathway for degradation of protocatechuic acid in Bacillus species.

    PubMed

    Crawford, R L

    1975-02-01

    A species of Bacillus, tentatively identified as B. circulans, degrades protocatechuic acid by a novel reaction involving meta-fission between C2 and C3 of the benzene nucleus. 2-Hydroxymuconic semialdehyde is then degraded to pyruvate and acetaldehyde by enzymatic reactions described in previous work. Protocatechuate 2,3-oxygenase exhibits a rather narrow substrate specificity; the methyl and ethyl esters of protocatechuic acid are oxidized, but other substrates for ring-fission oxygenases, notably catechol, gallic acid, and homoprotocatechuic acid, are not attached.

  5. Species-specific diversity of novel bacterial lineages and differential abundance of predicted pathways for toxic compound degradation in scorpion gut microbiota.

    PubMed

    Bolaños, Luis M; Rosenblueth, Mónica; Castillo-Ramírez, Santiago; Figuier-Huttin, Gilles; Martínez-Romero, Esperanza

    2016-05-01

    Scorpions are considered 'living fossils' that have conserved ancestral anatomical features and have adapted to numerous habitats. However, their gut microbiota diversity has not been studied. Here, we characterized the gut microbiota of two scorpion species, Vaejovis smithi and Centruroides limpidus. Our results indicate that scorpion gut microbiota is species-specific and that food deprivation reduces bacterial diversity. 16S rRNA gene phylogenetic analysis revealed novel bacterial lineages showing a low level of sequence identity to any known bacteria. Furthermore, these novel bacterial lineages were each restricted to a different scorpion species. Additionally, our results of the predicted metagenomic profiles revealed a core set of pathways that were highly abundant in both species, and mostly related to amino acid, carbohydrate, vitamin and cofactor metabolism. Notably, the food-deprived V. smithi shotgun metagenome matched almost completely the metabolic features of the prediction. Finally, comparisons among predicted metagenomic profiles showed that toxic compound degradation pathways were more abundant in recently captured C. limpidus scorpions. This study gives a first insight into the scorpion gut microbiota and provides a reference for future studies on the gut microbiota from other arachnid species. PMID:26058415

  6. Life history correlates of fecal bacterial species richness in a wild population of the blue tit Cyanistes caeruleus.

    PubMed

    Benskin, Clare McW H; Rhodes, Glenn; Pickup, Roger W; Mainwaring, Mark C; Wilson, Kenneth; Hartley, Ian R

    2015-02-01

    Very little is known about the normal gastrointestinal flora of wild birds, or how it might affect or reflect the host's life-history traits. The aim of this study was to survey the species richness of bacteria in the feces of a wild population of blue tits Cyanistes caeruleus and to explore the relationships between bacterial species richness and various life-history traits, such as age, sex, and reproductive success. Using PCR-TGGE, 55 operational taxonomic units (OTUs) were identified in blue tit feces. DNA sequencing revealed that the 16S rRNA gene was amplified from a diverse range of bacteria, including those that shared closest homology with Bacillus licheniformis, Campylobacter lari, Pseudomonas spp., and Salmonella spp. For adults, there was a significant negative relationship between bacterial species richness and the likelihood of being detected alive the following breeding season; bacterial richness was consistent across years but declined through the breeding season; and breeding pairs had significantly more similar bacterial richness than expected by chance alone. Reduced adult survival was correlated with the presence of an OTU most closely resembling C. lari; enhanced adult survival was associated with an OTU most similar to Arthrobacter spp. For nestlings, there was no significant change in bacterial species richness between the first and second week after hatching, and nestlings sharing the same nest had significantly more similar bacterial richness. Collectively, these results provide compelling evidence that bacterial species richness was associated with several aspects of the life history of their hosts.

  7. Amino acid oxidase of leukocytes in relation to H2O2-mediated bacterial killing

    PubMed Central

    Eckstein, Marlene R.; Baehner, Robert L.; Nathan, David G.

    1971-01-01

    D-Amino acid oxidase and L-amino acid oxidase have been measured in sucrose homogenates of polymorphonuclear leukocytes (PMN) obtained from guinea pigs and humans. Subcellular distribution patterns and studies on latency indicate that these oxidases are soluble enzymes. Their hydrogen peroxide-generating capacity was verified. Chronic granulomatous disease PMN, which lack a respiratory burst and fail to generate H2O2 during phagocytosis and do not kill catalase positive bacteria, had peroxide-generating amino acid oxidase activity equal to that found in PMN homogenates from patients with bacterial infections. The precise metabolic and bactericidal role of amino acid oxidases in PMN remains uncertain. PMID:4397948

  8. Host and Environmental Specificity in Bacterial Communities Associated to Two Highly Invasive Marine Species (Genus Asparagopsis).

    PubMed

    Aires, Tânia; Serrão, Ester A; Engelen, Aschwin H

    2016-01-01

    As habitats change due to global and local pressures, population resilience, and adaptive processes depend not only on their gene pools but also on their associated bacteria communities. The hologenome can play a determinant role in adaptive evolution of higher organisms that rely on their bacterial associates for vital processes. In this study, we focus on the associated bacteria of the two most invasive seaweeds in southwest Iberia (coastal mainland) and nearby offshore Atlantic islands, Asparagopsis taxiformis and Asparagopsis armata. Bacterial communities were characterized using 16S rRNA barcoding through 454 next generation sequencing and exploratory shotgun metagenomics to provide functional insights and a backbone for future functional studies. The bacterial community composition was clearly different between the two species A. taxiformis and A. armata and between continental and island habitats. The latter was mainly due to higher abundances of Acidimicrobiales, Sphingomonadales, Xanthomonadales, Myxococcales, and Alteromonadales on the continent. Metabolic assignments for these groups contained a higher number of reads in functions related to oxidative stress and resistance to toxic compounds, more precisely heavy metals. These results are in agreement with their usual association with hydrocarbon degradation and heavy-metals detoxification. In contrast, A. taxiformis from islands contained more bacteria related to oligotrophic environments which might putatively play a role in mineralization of dissolved organic matter. The higher number of functional assignments found in the metagenomes of A. taxiformis collected from Cape Verde Islands suggest a higher contribution of bacteria to compensate nutrient limitation in oligotrophic environments. Our results show that Asparagopsis-associated bacterial communities have host-specificity and are modulated by environmental conditions. Whether this environmental effect reflects the host's selective requirements or

  9. Host and Environmental Specificity in Bacterial Communities Associated to Two Highly Invasive Marine Species (Genus Asparagopsis)

    PubMed Central

    Aires, Tânia; Serrão, Ester A.; Engelen, Aschwin H.

    2016-01-01

    As habitats change due to global and local pressures, population resilience, and adaptive processes depend not only on their gene pools but also on their associated bacteria communities. The hologenome can play a determinant role in adaptive evolution of higher organisms that rely on their bacterial associates for vital processes. In this study, we focus on the associated bacteria of the two most invasive seaweeds in southwest Iberia (coastal mainland) and nearby offshore Atlantic islands, Asparagopsis taxiformis and Asparagopsis armata. Bacterial communities were characterized using 16S rRNA barcoding through 454 next generation sequencing and exploratory shotgun metagenomics to provide functional insights and a backbone for future functional studies. The bacterial community composition was clearly different between the two species A. taxiformis and A. armata and between continental and island habitats. The latter was mainly due to higher abundances of Acidimicrobiales, Sphingomonadales, Xanthomonadales, Myxococcales, and Alteromonadales on the continent. Metabolic assignments for these groups contained a higher number of reads in functions related to oxidative stress and resistance to toxic compounds, more precisely heavy metals. These results are in agreement with their usual association with hydrocarbon degradation and heavy-metals detoxification. In contrast, A. taxiformis from islands contained more bacteria related to oligotrophic environments which might putatively play a role in mineralization of dissolved organic matter. The higher number of functional assignments found in the metagenomes of A. taxiformis collected from Cape Verde Islands suggest a higher contribution of bacteria to compensate nutrient limitation in oligotrophic environments. Our results show that Asparagopsis-associated bacterial communities have host-specificity and are modulated by environmental conditions. Whether this environmental effect reflects the host's selective requirements or

  10. Host and Environmental Specificity in Bacterial Communities Associated to Two Highly Invasive Marine Species (Genus Asparagopsis).

    PubMed

    Aires, Tânia; Serrão, Ester A; Engelen, Aschwin H

    2016-01-01

    As habitats change due to global and local pressures, population resilience, and adaptive processes depend not only on their gene pools but also on their associated bacteria communities. The hologenome can play a determinant role in adaptive evolution of higher organisms that rely on their bacterial associates for vital processes. In this study, we focus on the associated bacteria of the two most invasive seaweeds in southwest Iberia (coastal mainland) and nearby offshore Atlantic islands, Asparagopsis taxiformis and Asparagopsis armata. Bacterial communities were characterized using 16S rRNA barcoding through 454 next generation sequencing and exploratory shotgun metagenomics to provide functional insights and a backbone for future functional studies. The bacterial community composition was clearly different between the two species A. taxiformis and A. armata and between continental and island habitats. The latter was mainly due to higher abundances of Acidimicrobiales, Sphingomonadales, Xanthomonadales, Myxococcales, and Alteromonadales on the continent. Metabolic assignments for these groups contained a higher number of reads in functions related to oxidative stress and resistance to toxic compounds, more precisely heavy metals. These results are in agreement with their usual association with hydrocarbon degradation and heavy-metals detoxification. In contrast, A. taxiformis from islands contained more bacteria related to oligotrophic environments which might putatively play a role in mineralization of dissolved organic matter. The higher number of functional assignments found in the metagenomes of A. taxiformis collected from Cape Verde Islands suggest a higher contribution of bacteria to compensate nutrient limitation in oligotrophic environments. Our results show that Asparagopsis-associated bacterial communities have host-specificity and are modulated by environmental conditions. Whether this environmental effect reflects the host's selective requirements or

  11. Effects of remediation on the bacterial community of an acid mine drainage impacted stream.

    PubMed

    Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G

    2012-11-01

    Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage. PMID:23145829

  12. Effects of remediation on the bacterial community of an acid mine drainage impacted stream.

    PubMed

    Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G

    2012-11-01

    Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage.

  13. Analysis of Known Bacterial Protein Vaccine Antigens Reveals Biased Physical Properties and Amino Acid Composition

    PubMed Central

    Mayers, Carl; Rowe, Sonya; Miller, Julie; Lingard, Bryan; Hayward, Sarah; Titball, Richard W.

    2003-01-01

    Many vaccines have been developed from live attenuated forms of bacterial pathogens or from killed bacterial cells. However, an increased awareness of the potential for transient side-effects following vaccination has prompted an increased emphasis on the use of sub-unit vaccines, rather than those based on whole bacterial cells. The identification of vaccine sub-units is often a lengthy process and bioinformatics approaches have recently been used to identify candidate protein vaccine antigens. Such methods ultimately offer the promise of a more rapid advance towards preclinical studies with vaccines. We have compared the properties of known bacterial vaccine antigens against randomly selected proteins and identified differences in the make-up of these two groups. A computer algorithm that exploits these differences allows the identification of potential vaccine antigen candidates from pathogenic bacteria on the basis of their amino acid composition, a property inherently associated with sub-cellular location. PMID:18629010

  14. Bacterial synthesis of polysialic acid lactosides in recombinant Escherichia coli K-12.

    PubMed

    Richard, Emeline; Buon, Laurine; Drouillard, Sophie; Fort, Sébastien; Priem, Bernard

    2016-07-01

    Bacterial polysialyltransferases (PSTs) are processive enzymes involved in the synthesis of polysialic capsular polysaccharides. They can also synthesize polysialic acid in vitro from disialylated and trisialylated lactoside acceptors, which are the carbohydrate moieties of GD3 and GT3 gangliosides, respectively. Here, we engineered a non-pathogenic Escherichia coli strain that overexpresses recombinant sialyltransferases and sialic acid synthesis genes and can convert an exogenous lactoside into polysialyl lactosides. Several PSTs were assayed for their ability to synthesize polysialyl lactosides in the recombinant strains. Fed-batch cultures produced α-2,8 polysialic acid or alternate α-2,8-2,9 polysialic acid in quantities reaching several grams per liter. Bacterial culture in the presence of propargyl-β-lactoside as the exogenous acceptor led to the production of conjugatable polysaccharides by means of copper-assisted click chemistry. PMID:26927318

  15. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  16. Diagnosis of bacterial vaginosis by a new multiplex peptide nucleic acid fluorescence in situ hybridization method.

    PubMed

    Machado, António; Castro, Joana; Cereija, Tatiana; Almeida, Carina; Cerca, Nuno

    2015-01-01

    Bacterial vaginosis (BV) is one of most common vaginal infections. However, its diagnosis by classical methods reveals low specificity. Our goal was to evaluate the accuracy diagnosis of 150 vaginal samples with research gold standard methods and our Peptide Nucleic Acid (PNA) probes by Fluorescence in situ Hybridization (FISH) methodology. Also, we described the first PNA-FISH methodology for BV diagnosis, which provides results in approximately 3 h. The results showed a sensitivity of 84.6% (95% confidence interval (CI), from 64.3 to 95.0%) and a specificity of 97.6% (95% CI [92.6-99.4%]), demonstrating the higher specificity of the PNA-FISH method and showing false positive results in BV diagnosis commonly obtained by the classical methods. This methodology combines the specificity of PNA probes for Lactobacillus species and G. vaginalis visualization and the calculation of the microscopic field by Nugent score, allowing a trustful evaluation of the bacteria present in vaginal microflora and avoiding the occurrence of misleading diagnostics. Therefore, the PNA-FISH methodology represents a valuable alternative for BV diagnosis. PMID:25737820

  17. Diagnosis of bacterial vaginosis by a new multiplex peptide nucleic acid fluorescence in situ hybridization method

    PubMed Central

    Machado, António; Castro, Joana; Cereija, Tatiana; Almeida, Carina

    2015-01-01

    Bacterial vaginosis (BV) is one of most common vaginal infections. However, its diagnosis by classical methods reveals low specificity. Our goal was to evaluate the accuracy diagnosis of 150 vaginal samples with research gold standard methods and our Peptide Nucleic Acid (PNA) probes by Fluorescence in situ Hybridization (FISH) methodology. Also, we described the first PNA-FISH methodology for BV diagnosis, which provides results in approximately 3 h. The results showed a sensitivity of 84.6% (95% confidence interval (CI), from 64.3 to 95.0%) and a specificity of 97.6% (95% CI [92.6–99.4%]), demonstrating the higher specificity of the PNA-FISH method and showing false positive results in BV diagnosis commonly obtained by the classical methods. This methodology combines the specificity of PNA probes for Lactobacillus species and G. vaginalis visualization and the calculation of the microscopic field by Nugent score, allowing a trustful evaluation of the bacteria present in vaginal microflora and avoiding the occurrence of misleading diagnostics. Therefore, the PNA-FISH methodology represents a valuable alternative for BV diagnosis. PMID:25737820

  18. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  19. Deoxyribonucleic Acid Relatedness Among Species of Erwinia and Between Erwinia Species and Other Enterobacteria

    PubMed Central

    Brenner, Don J.; Fanning, G. R.; Steigerwalt, A. G.

    1972-01-01

    Relatedness in species of Erwinia was assessed by determining the extent of reassociation in heterologous deoxyribonucleic acid preparations. Thermal elution chromatography on hydroxyapatite was used to separate reassociated nucleotide sequences from nonreassociated sequences and to determine the thermal stability of related nucleotide sequences. An apparent 15% core of relatedness is present between fire blight, soft-rot, and “atypical” Erwinia species. All Erwinia species showed low to moderate reaction with representative enteric bacteria. PMID:5018020

  20. Bacterial growth rates are influenced by cellular characteristics of individual species when immersed in electromagnetic fields.

    PubMed

    Tessaro, Lucas W E; Murugan, Nirosha J; Persinger, Michael A

    2015-03-01

    Previous studies have shown that exposure to extremely low-frequency electromagnetic fields (ELF-EMFs) have negative effects on the rate of growth of bacteria. In the present study, two Gram-positive and two Gram-negative species were exposed to six magnetic field conditions in broth cultures. Three variations of the 'Thomas' pulsed frequency-modulated pattern; a strong-static "puck" magnet upwards of 5000G in intensity; a pair of these magnets rotating opposite one another at ∼30rpm; and finally a strong dynamic magnetic field generator termed the 'Resonator' with an average intensity of 250μT were used. Growth rate was discerned by optical density (OD) measurements every hour at 600nm. ELF-EMF conditions significantly affected the rates of growth of the bacterial cultures, while the two static magnetic field conditions were not statistically significant. Most interestingly, the 'Resonator' dynamic magnetic field increased the rates of growth of three species (Staphylococcus epidermidis, Staphylococcus aureus, and Escherichia coli), while slowing the growth of one (Serratia marcescens). We suggest that these effects are due to individual biophysical characteristics of the bacterial species.

  1. Role of lauric acid-potassium hydroxide concentration on bacterial contamination of spray washed broiler carcasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A series of experiments were conducted to examine reductions in bacterial contamination of broiler carcasses washed in a spray cabinet with various concentrations of lauric acid (LA)-potassium hydroxide (KOH) solutions. Fifty eviscerated carcasses and 5 ceca were obtained from the processing line of...

  2. Spray washing carcasses with alkaline solutions of lauric acid to reduce bacterial contamination

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ability of lauric acid (LA)-potassium hydroxide (KOH) solutions to reduce carcass bacterial contamination was examined. Skin of carcasses was inoculated with a cecal paste containing antibiotic resistant strains of Escherichia coli, Salmonella Typhimirum, and Campylobacter coli. In one trial, in...

  3. Surface-Selective Preferential Production of Reactive Oxygen Species on Piezoelectric Ceramics for Bacterial Killing.

    PubMed

    Tan, Guoxin; Wang, Shuangying; Zhu, Ye; Zhou, Lei; Yu, Peng; Wang, Xiaolan; He, Tianrui; Chen, Junqi; Mao, Chuanbin; Ning, Chengyun

    2016-09-21

    Reactive oxygen species (ROS) can be used to kill bacterial cells, and thus the selective generation of ROS from material surfaces is an emerging direction in antibacterial material discovery. We found the polarization of piezoelectric ceramic causes the two sides of the disk to become positively and negatively charged, which translate into cathode and anode surfaces in an aqueous solution. Because of the microelectrolysis of water, ROS are preferentially formed on the cathode surface. Consequently, the bacteria are selectively killed on the cathode surface. However, the cell experiment suggested that the level of ROS is safe for normal mammalian cells. PMID:27599911

  4. Comparative analysis of the intestinal bacterial communities in different species of carp by pyrosequencing.

    PubMed

    Li, Tongtong; Long, Meng; Gatesoupe, François-Joël; Zhang, Qianqian; Li, Aihua; Gong, Xiaoning

    2015-01-01

    Gut microbiota is increasingly regarded as an integral component of the host, due to important roles in the modulation of the immune system, the proliferation of the intestinal epithelium and the regulation of the dietary energy intake. Understanding the factors that influence the composition of these microbial communities is essential to health management, and the application to aquatic animals still requires basic investigation. In this study, we compared the bacterial communities harboured in the intestines and in the rearing water of grass carp (Ctenopharyngodon idellus), crucian carp (Carassius cuvieri), and bighead carp (Hypophthalmichthys nobilis), by using 454-pyrosequencing with barcoded primers targeting the V4 to V5 regions of the bacterial 16S rRNA gene. The specimens of the three species were cohabiting in the same pond. Between 6,218 and 10,220 effective sequences were read from each sample, resulting in a total of 110,398 sequences for 13 samples from gut microbiota and pond water. In general, the microbial communities of the three carps were dominated by Fusobacteria, Firmicutes, Proteobacteria and Bacteroidetes, but the abundance of each phylum was significantly different between species. At the genus level, the overwhelming group was Cetobacterium (97.29 ± 0.46 %) in crucian carp, while its abundance averaged c. 40 and 60 % of the sequences read in the other two species. There was higher microbial diversity in the gut of filter-feeding bighead carp than the gut of the two other species, with grazing feeding habits. The composition of intestine microbiota of grass carp and crucian carp shared higher similarity when compared with bighead carp. The principal coordinates analysis (PCoA) with the weighted UniFrac distance and the heatmap analysis suggested that gut microbiota was not a simple reflection of the microbial community in the local habitat but resulted from species-specific selective pressures, possibly dependent on behavioural, immune

  5. Photoinactivation of Eight Health-Relevant Bacterial Species: Determining the Importance of the Exogenous Indirect Mechanism.

    PubMed

    Maraccini, Peter A; Wenk, Jannis; Boehm, Alexandria B

    2016-05-17

    It is presently unknown to what extent the endogenous direct, endogenous indirect, and exogenous indirect mechanisms contribute to bacterial photoinactivation in natural surface waters. In this study, we investigated the importance of the exogenous indirect mechanism by conducting photoinactivation experiments with eight health-relevant bacterial species (Bacteroides thetaiotaomicron, Campylobacter jejuni, Enterococcus faecalis, Escherichia coli K12, E. coli O157:H7, Salmonella enterica serovar Typhimurium LT2, Staphylococcus aureus, and Streptococcus bovis). We used three synthetic photosensitizers (methylene blue, rose bengal, and nitrite) and two model natural photosensitizers (Suwannee River natural organic matter and dissolved organic matter isolated from a wastewater treatment wetland) that generated singlet oxygen and hydroxyl radical. B. thetaiotaomicron had larger first order rate constants than all other organisms under all conditions tested. The presence of the synthetic photosensitizers generally enhanced photoinactivation of Gram-positive facultative anaerobes (Ent. faecalis, Staph. aureus, and Strep. bovis). Among Gram-negative bacteria, only methylene blue with E. coli K12 and rose bengal with C. jejuni showed an enhancing effect. The presence of model natural photosensitizers either reduced or did not affect photoinactivation rate constants. Our findings highlight the importance of the cellular membrane and photosensitizer properties in modulating the contribution of the exogenous indirect mechanism to the overall bacterial photoinactivation.

  6. Bacterial adherence to titanium, poly-L-lactic acid, and composite hydroxyapatite and poly-L-lactic acid interference screws.

    PubMed

    Masini, Brendan D; Stinner, Daniel J; Waterman, Scott M; Wenke, Joseph C; Gerlinger, Tad L

    2012-01-01

    This study investigates a potential site of bacterial adherence, the implant surface, comparing titanium, poly-L-lactic acid (PLLA), and composite hydroxyapatite and poly-L-lactic acid (PLLA-HA) interference screws using a bioluminescent in vitro model. Interference screws of three materials, titanium (Arthrex, Naples, FL), bioabsorbable poly-L-lactic acid (BIORCI, Smith & Nephew, Andover, MA), and bioabsorbable composite hydroxyapatite and poly-L-lactic acid (BIORCI-HA, Smith & Nephew, Andover, MA) were immersed in a broth of bioluminescent Staphylococcus aureus. The screws were irrigated and then imaged with a photon-capturing camera system yielding a total photon count correlating with residual adherent bacteria. The titanium screws had the lowest mean total bacterial counts followed by the PLLA-HA screws and with the PLLA screws having the highest mean total counts. The difference in means between the titanium group and the PLLA group was statistically significant (p < .001). Titanium interference screws have less bacterial adherence than comparable bioabsorbable PLLA screws.

  7. Analysis of Bacterial Diversity During Acetic Acid Fermentation of Tianjin Duliu Aged Vinegar by 454 Pyrosequencing.

    PubMed

    Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye

    2015-08-01

    The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process.

  8. Muramic Acid Measurements for Bacterial Investigations in Marine Environments by High-Pressure Liquid Chromatography

    PubMed Central

    Mimura, Toru; Romano, Jean-Claude

    1985-01-01

    Muramic acid, a constituent of procaryotic cell walls, was assayed by high-pressure liquid chromatography in samples from several marine environments (water column, surface microlayer, and sediment) and a bacterial culture. It is used as a microbial biomass indicator. The method gave a good separation of muramic acid from interfering compounds with satisfactory reproducibility. A pseudomonad culture had a muramic acid content of 4.7 × 10−10 to 5.3 × 10−10 μg per cell during growth. In natural water samples, highly significant relationships were found between muramic acid concentrations and bacterial numbers for populations of 108 to 1011 cells per liter. The muramic acid content in natural marine water decreased from 5.3 × 10−10 to 1.6 × 10−10 μg per cell with increasing depth. In coastal sediments exposed to sewage pollution, concentrations of muramic acid, ATP, organic carbon, and total amino acids displayed a parallel decrease with increasing distance from the sewage outlet. Advantages of muramic acid measurement by high-pressure liquid chromatography are its high sensitivity and reduction of preparation steps, allowing a short time analysis. PMID:16346848

  9. Bacterial species and their associations with acute and chronic mastitis in suckler ewes.

    PubMed

    Smith, E M; Willis, Z N; Blakeley, M; Lovatt, F; Purdy, K J; Green, L E

    2015-10-01

    Acute mastitis in suckler ewes is often detected because of systemic signs such as anorexia or lameness, whereas chronic mastitis, characterized by intramammary abscesses with no systemic disease, is typically detected when ewes are inspected before mating. The aims of the current study were to identify the species and strains of culturable bacteria associated with acutely diseased, chronically diseased, and unaffected mammary glands to investigate whether species and strains vary by state. To investigate acute mastitis, 28 milk samples were obtained from both glands of 14 ewes with acute mastitis in one gland only. To investigate chronic mastitis, 16 ovine udders were obtained from 2 abattoirs; milk was aspirated from the 32 glands where possible, and the udders were sectioned to expose intramammary abscesses, which were swab sampled. All milk and swab samples were cultured aerobically. In total, 37 bacterial species were identified, 4 from acute mastitis, 26 from chronic mastitis, and 8 from apparently healthy glands. In chronic mastitis, the overall coincidence index of overlap of species detected in intramammary abscesses and milk was 0.60, reducing to 0.36 within individual glands, indicating a high degree of species overlap in milk and abscesses overall, but less overlap within specific glands. Staphylococcus aureus was detected frequently in all sample types; it was isolated from 10/14 glands with acute mastitis. In 5 ewes, closely related strains were present in both affected and unaffected glands. In chronic mastitis, closely related Staphylococcus aureus strains were detected in milk and abscesses from the same gland.

  10. Individual growth detection of bacterial species in an in vitro oral polymicrobial biofilm model.

    PubMed

    Tabenski, L; Maisch, T; Santarelli, F; Hiller, K-A; Schmalz, G

    2014-11-01

    Most in vitro studies on the antibacterial effects of antiseptics have used planktonic bacteria in monocultures. However, this study design does not reflect the in vivo situation in oral cavities harboring different bacterial species that live in symbiotic relationships in biofilms. The aim of this study was to establish a simple in vitro polymicrobial model consisting of only three bacterial strains of different phases of oral biofilm formation to simulate in vivo oral conditions. Therefore, we studied the biofilm formation of Actinomyces naeslundii (An), Fusobacterium nucleatum (Fn), and Enterococcus faecalis (Ef) on 96-well tissue culture plates under static anaerobic conditions using artificial saliva according to the method established by Pratten et al. that was supplemented with 1 g l(-1) sucrose. Growth was separately determined for each bacterial strain after incubation periods of up to 72 h by means of quantitative real-time polymerase chain reaction and live/dead staining. Presence of an extracellular polymeric substance (EPS) was visualized by Concanavalin A staining. Increasing incubation times of up to 72 h showed adhesion and propagation of the bacterial strains with artificial saliva formulation. An and Ef had significantly higher growth rates than Fn. Live/dead staining showed a median of 49.9 % (range 46.0-53.0 %) of living bacteria after 72 h of incubation, and 3D fluorescence microscopy showed a three-dimensional structure containing EPS. An in vitro oral polymicrobial biofilm model was established to better simulate oral conditions and had the advantage of providing the well-controlled experimental conditions of in vitro testing.

  11. Dietary fatty acids and immune response to food-borne bacterial infections.

    PubMed

    Harrison, Lisa M; Balan, Kannan V; Babu, Uma S

    2013-05-01

    Functional innate and acquired immune responses are required to protect the host from pathogenic bacterial infections. Modulation of host immune functions may have beneficial or deleterious effects on disease outcome. Different types of dietary fatty acids have been shown to have variable effects on bacterial clearance and disease outcome through suppression or activation of immune responses. Therefore, we have chosen to review research across experimental models and food sources on the effects of commonly consumed fatty acids on the most common food-borne pathogens, including Salmonella sp., Campylobacter sp., Shiga toxin-producing Escherichia coli, Shigella sp., Listeria monocytogenes, and Staphylococcus aureus. Altogether, the compilation of literature suggests that no single fatty acid is an answer for protection from all food-borne pathogens, and further research is necessary to determine the best approach to improve disease outcomes. PMID:23698167

  12. Isotope composition of sulphate in acid mine drainage as measure of bacterial oxidation

    USGS Publications Warehouse

    Taylor, B.E.; Wheeler, M.C.; Nordstrom, D.K.

    1984-01-01

    The formation of acid waters by oxidation of pyrite-bearing ore deposits, mine tailing piles, and coal measures is a complex biogeochemical process and is a serious environmental problem. We have studied the oxygen and sulphur isotope geochemistry of sulphides, sulphur, sulphate and water in the field and in experiments to identify sources of oxygen and reaction mechanisms of sulphate formation. Here we report that the oxygen isotope composition of sulphate in acid mine drainage shows a large variation due to differing proportions of atmospheric- and water-derived oxygen from both chemical and bacterially-mediated oxidation. 18O-enrichment of sulphate results from pyrite oxidation facilitated by Thiobacillus ferrooxidans in aerated environments. Oxygen isotope analysis may therefore be useful in monitoring the effectiveness of abatement programmes designed to inhibit bacterial oxidation. Sulphur isotopes show no significant fractionation between pyrite and sulphate, indicating the quantitative insignificance of intermediate oxidation states of sulphur under acid conditions. ?? 1984 Nature Publishing Group.

  13. Effects of elaidic acid, a predominant industrial trans fatty acid, on bacterial growth and cell surface hydrophobicity of lactobacilli.

    PubMed

    Wu, Qinglong; Shah, Nagendra P

    2014-12-01

    The consumption of trans fatty acids (TFAs) increases the risk of cardiovascular diseases and coronary heart disease in human, and there are no effective ways to remove TFAs after consumption. The aim of this study was to investigate the effects of elaidic acid on bacterial growth, cell surface hydrophobicity of lactobacilli, and metabolism of elaidic acid by lactobacilli. Lactobacilli were inoculated in MRS broth containing 0, 100, 200, and 500 mg/L of elaidic acid. Viable cell counts of lactobacilli were enumerated, concentrations of elaidic acid were determined, and cell surface hydrophobicity of lactobacilli was measured. The results showed that the growth of lactobacilli was significantly inhibited by 500 mg/L of elaidic acid, however, a cell count of 8.50 log10 CFU/mL was still reached for tested lactobacilli after 24-h incubation. In particular, a reduction of elaidic acid was found for tested lactobacilli after 24-h incubation as compared to its initial concentration of 200 mg/L. However, cell surface hydrophobicity showed no correlations with the metabolism of elaidic acid by lactobacilli. Moreover, elaidic acid was able to influence cell surface hydrophobicity, and the decrease in hydrophobicity was more obvious in Lactobacillus paracasei and Lactobacillus casei compared with that in other tested lactobacilli. This study suggests that elaidic acid could change physiochemical surface properties of lactobacilli and the lactobacilli have the potential to reduce TFAs.

  14. Biochemical parameters and bacterial species richness in soils contaminated by sludge-borne metals and remediated with inorganic soil amendments.

    PubMed

    Mench, Michel; Renella, Giancarlo; Gelsomino, Antonio; Landi, Loretta; Nannipieri, Paolo

    2006-11-01

    The effectiveness of two amendments for the in situ remediation of a Cd- and Ni-contaminated soil in the Louis Fargue long-term field experiment was assessed. In April 1995, one replicate plot (S1) was amended with 5% w/w of beringite (B), a coal fly ash (treatment S1+B), and a second plot with 1% w/w zerovalent-Fe iron grit (SS) (treatment S1+SS), with the aim of increasing metal sorption and attenuating metal impacts. Long-term responses of daily respiration rates, microbial biomass, bacterial species richness and the activities of key soil enzymes (acid and alkaline phosphatase, arylsulfatase, beta-glucosidase, urease and protease activities) were studied in relation to soil metal extractability. Seven years after initial amendments, the labile fractions of Cd and Ni in both the S1+B and S1+SS soils were reduced to various extents depending on the metal and fractions considered. The soil microbial biomass and respiration rate were not affected by metal contamination and amendments in the S1+B and S1+SS soils, whereas the activity of different soil enzymes was restored. The SS treatment was more effective in reducing labile pools of Cd and Ni and led to a greater recovery of soil enzyme activities than the B treatment. Bacterial species richness in the S1 soil did not alter with either treatment. It was concluded that monitoring of the composition and activity of the soil microbial community is important in evaluating the effectiveness of soil remediation practices.

  15. Natural Transformation Facilitates Transfer of Transposons, Integrons and Gene Cassettes between Bacterial Species

    PubMed Central

    Domingues, Sara; Harms, Klaus; Fricke, W. Florian; Johnsen, Pål J.; da Silva, Gabriela J.; Nielsen, Kaare Magne

    2012-01-01

    We have investigated to what extent natural transformation acting on free DNA substrates can facilitate transfer of mobile elements including transposons, integrons and/or gene cassettes between bacterial species. Naturally transformable cells of Acinetobacter baylyi were exposed to DNA from integron-carrying strains of the genera Acinetobacter, Citrobacter, Enterobacter, Escherichia, Pseudomonas, and Salmonella to determine the nature and frequency of transfer. Exposure to the various DNA sources resulted in acquisition of antibiotic resistance traits as well as entire integrons and transposons, over a 24 h exposure period. DNA incorporation was not solely dependent on integrase functions or the genetic relatedness between species. DNA sequence analyses revealed that several mechanisms facilitated stable integration in the recipient genome depending on the nature of the donor DNA; homologous or heterologous recombination and various types of transposition (Tn21-like and IS26-like). Both donor strains and transformed isolates were extensively characterized by antimicrobial susceptibility testing, integron- and cassette-specific PCRs, DNA sequencing, pulsed field gel electrophoreses (PFGE), Southern blot hybridizations, and by re-transformation assays. Two transformant strains were also genome-sequenced. Our data demonstrate that natural transformation facilitates interspecies transfer of genetic elements, suggesting that the transient presence of DNA in the cytoplasm may be sufficient for genomic integration to occur. Our study provides a plausible explanation for why sequence-conserved transposons, IS elements and integrons can be found disseminated among bacterial species. Moreover, natural transformation of integron harboring populations of competent bacteria revealed that interspecies exchange of gene cassettes can be highly efficient, and independent on genetic relatedness between donor and recipient. In conclusion, natural transformation provides a much

  16. Simultaneous Extraction of Viral and Bacterial Nucleic Acids for Molecular Diagnostic Applications

    PubMed Central

    Kajiura, Lauren N.; Stewart, Scott D.; Dresios, John; Uyehara, Catherine F. T.

    2015-01-01

    Molecular detection of microbial pathogens in clinical samples requires the application of efficient sample lysis protocols and subsequent extraction and isolation of their nucleic acids. Here, we describe a simple and time-efficient method for simultaneous extraction of genomic DNA from gram-positive and -negative bacteria, as well as RNA from viral agents present in a sample. This method compared well with existing bacterial- and viral-specialized extraction protocols, worked reliably on clinical samples, and was not pathogen specific. This method may be used to extract DNA and RNA concurrently from viral and bacterial pathogens present in a sample and effectively detect coinfections in routine clinical diagnostics. PMID:26543438

  17. Contribution of reactive oxygen species to (+)-catechin-mediated bacterial lethality.

    PubMed

    Ajiboye, T O; Aliyu, M; Isiaka, I; Haliru, F Z; Ibitoye, O B; Uwazie, J N; Muritala, H F; Bello, S A; Yusuf, I I; Mohammed, A O

    2016-10-25

    The contribution of reactive oxygen species to (+)-catechin-mediated bacterial lethality was investigated. Minimum inhibitory concentrations (MIC) and minimum bactericidal concentration (MBC) of (+)-catechin against E. coli, P. aeruginosa and S. aureus were investigated using 96-well microtitre plate. MIC and MBC of (+)-catechin against E. coli, P. aeruginosa and S. aureus are 600 and 700; 600 and 800; 600 and 800 μg/mL respectively. The optical densities and colony forming units of (+)-catechin-treated bacteria decreased. (+)-Catechin (4× MIC) significantly increased the superoxide anion content of E. coli, P. aeruginosa and S. aureus compared to DMSO. Superoxide dismutase and catalase in (+)-catechin treated E. coli, P. aeruginosa and S. aureus increased significantly. Conversely, level of reduced glutathione in (+)-catechin-treated E. coli, P. aeruginosa and S. aureus decreased significantly while glutathione disulfide increased significantly. Furthermore, malondialdehyde and fragmented DNA increased significantly following exposure to (+)-catechin. From the above findings, (+)-catechin enhanced the generation of reactive oxygen species (superoxide anion radical and hydroxyl radical) in E. coli, P. aeruginosa and S. aureus, possibly by autoxidation, Fenton chemistry and inhibiting electron transport chain resulting into lipid peroxidation and DNA fragmentation and consequentially bacterial cell death. PMID:27634360

  18. Differential bioavailability of soil-sorbed naphthalene to two bacterial species.

    PubMed Central

    Guerin, W F; Boyd, S A

    1992-01-01

    Prediction of the fate of hydrophobic organic contaminants in soils is complicated by the competing processes of sorption and biodegradation. To test the hypothesis that sorbed naphthalene is unavailable to degradative microorganisms, we developed a simple kinetic method to examine the rates and extents of naphthalene degradation in soil-free and soil-containing systems in a comparison of two bacterial species. The method is predicated on the first-order dependence of the initial mineralization rate on the naphthalene concentration when the latter is below the Michaelis-Menten half-saturation constant (Km) for naphthalene for the organism under study. Rates and extents of mineralization were estimated by nonlinear regression analysis of data by using both a simple first-order model and a three-parameter, coupled degradation-desorption model described for the first time here. Bioavailability assays with two bacterial species (Pseudomonas putida ATCC 17484 and a gram-negative soil isolate, designated NP-Alk) gave dramatically different results. For NP-Alk, sorption limited both the rate and extent of naphthalene mineralization, in accordance with values predicted on the basis of the equilibrium aqueous-phase naphthalene concentrations. For strain 17484, both the rates and extents of naphthalene mineralization exceeded the predicted values and resulted in enhanced rates of naphthalene desorption from the soils. We conclude that there are important organism-specific properties which make generalizations regarding the bioavailability of sorbed substrates inappropriate. PMID:1599237

  19. Spatial and Temporal Features of the Growth of a Bacterial Species Colonizing the Zebrafish Gut

    PubMed Central

    Jemielita, Matthew; Taormina, Michael J.; Burns, Adam R.; Hampton, Jennifer S.; Rolig, Annah S.; Guillemin, Karen

    2014-01-01

    ABSTRACT The vertebrate intestine is home to microbial ecosystems that play key roles in host development and health. Little is known about the spatial and temporal dynamics of these microbial communities, limiting our understanding of fundamental properties, such as their mechanisms of growth, propagation, and persistence. To address this, we inoculated initially germ-free zebrafish larvae with fluorescently labeled strains of an Aeromonas species, representing an abundant genus in the zebrafish gut. Using light sheet fluorescence microscopy to obtain three-dimensional images spanning the gut, we quantified the entire bacterial load, as founding populations grew from tens to tens of thousands of cells over several hours. The data yield the first ever measurements of the growth kinetics of a microbial species inside a live vertebrate intestine and show dynamics that robustly fit a logistic growth model. Intriguingly, bacteria were nonuniformly distributed throughout the gut, and bacterial aggregates showed considerably higher growth rates than did discrete individuals. The form of aggregate growth indicates intrinsically higher division rates for clustered bacteria, rather than surface-mediated agglomeration onto clusters. Thus, the spatial organization of gut bacteria both relative to the host and to each other impacts overall growth kinetics, suggesting that spatial characterizations will be an important input to predictive models of host-associated microbial community assembly. PMID:25516613

  20. Comparative genomics of non-pseudomonal bacterial species colonising paediatric cystic fibrosis patients

    PubMed Central

    Ormerod, Kate L.; George, Narelle M.; Fraser, James A.; Wainwright, Claire

    2015-01-01

    The genetic disorder cystic fibrosis is a life-limiting condition affecting ∼70,000 people worldwide. Targeted, early, treatment of the dominant infecting species, Pseudomonas aeruginosa, has improved patient outcomes; however, there is concern that other species are now stepping in to take its place. In addition, the necessarily long-term antibiotic therapy received by these patients may be providing a suitable environment for the emergence of antibiotic resistance. To investigate these issues, we employed whole-genome sequencing of 28 non-Pseudomonas bacterial strains isolated from three paediatric patients. We did not find any trend of increasing antibiotic resistance (either by mutation or lateral gene transfer) in these isolates in comparison with other examples of the same species. In addition, each isolate contained a virulence gene repertoire that was similar to other examples of the relevant species. These results support the impaired clearance of the CF lung not demanding extensive virulence for survival in this habitat. By analysing serial isolates of the same species we uncovered several examples of strain persistence. The same strain of Staphylococcus aureus persisted for nearly a year, despite administration of antibiotics to which it was shown to be sensitive. This is consistent with previous studies showing antibiotic therapy to be inadequate in cystic fibrosis patients, which may also explain the lack of increasing antibiotic resistance over time. Serial isolates of two naturally multi-drug resistant organisms, Achromobacter xylosoxidans and Stenotrophomonas maltophilia, revealed that while all S. maltophilia strains were unique, A. xylosoxidans persisted for nearly five years, making this a species of particular concern. The data generated by this study will assist in developing an understanding of the non-Pseudomonas species associated with cystic fibrosis. PMID:26401445

  1. Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography

    PubMed Central

    Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

    2016-01-01

    The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach

  2. Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography.

    PubMed

    Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

    2016-01-01

    The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach

  3. Evaluation of toxic effects of several carboxylic acids on bacterial growth by toxicodynamic modelling

    PubMed Central

    2011-01-01

    Background Effects of organic acids on microbial fermentation are commonly tested in investigations about metabolic behaviour of bacteria. However, they typically provide only descriptive information without modelling the influence of acid concentrations on bacterial kinetics. Results We developed and applied a mathematical model (secondary model) to capture the toxicological effects of those chemicals on kinetic parameters that define the growth of bacteria in batch cultures. Thus, dose-response kinetics were performed with different bacteria (Leuconostoc mesenteroides, Carnobacterium pisicola, Escherichia coli, Bacillus subtilis and Listonella anguillarum) exposed at increasing concentrations of individual carboxylic acids (formic, acetic, propionic, butyric and lactic). In all bioassays the acids affected the maximum bacterial load (Xm) and the maximum growth rate (vm) but only in specific cases the lag phase (λ) was modified. Significance of the parameters was always high and in all fermentations the toxicodynamic equation was statistically consistent and had good predictability. The differences between D and L-lactic acid effects were significant for the growth of E. coli, L. mesenteroides and C. piscicola. In addition, a global parameter (EC50,τ) was used to compare toxic effects and provided a realistic characterization of antimicrobial agents using a single value. Conclusions The effect of several organic acids on the growth of different bacteria was accurately studied and perfectly characterized by a bivariate equation which combines the basis of dose-response theory with microbial growth kinetics (secondary model). The toxicity of carboxylic acids was lower with the increase of the molecular weight of these chemicals. PMID:22118421

  4. Impacts of hydrophilic colanic acid on bacterial attachment to microfiltration membranes and subsequent membrane biofouling.

    PubMed

    Yoshida, Keitaro; Tashiro, Yosuke; May, Thithiwat; Okabe, Satoshi

    2015-06-01

    In order to examine the interactions between physicochemical properties of specific extracellular polymeric substances (EPS) and membrane biofouling, we investigated the impacts of hydrophilic colanic acid, as a model extracellular polysaccharide component, on initial bacterial attachment to different microfiltration (MF) membranes and membrane biofouling by using Escherichia coli strains producing different amounts of colanic acid. In a newly designed microtiter plate assay, the bacterial attachment by an E. coli strain RcsF(+), which produces massive amounts of colanic acid, decreased only to a hydrophobic membrane because the colanic acid made cell surfaces more hydrophilic, resulting in low cell attachment to hydrophobic membranes. The bench-scale cross-flow filtration tests followed by filtration resistance measurement revealed that RcsF(+) caused severe irreversible membrane fouling (i.e., pore-clogging), whereas less extracellular polysaccharide-producing strains caused moderate but reversible fouling to all membranes used in this study. Further cross-flow filtration tests indicated that colanic acid liberated in the bulk phase could rapidly penetrate pre-accumulated biomass layers (i.e., biofilms) and then directly clogged membrane pores. These results indicate that colanic acid, a hydrophilic extracellular polysaccharide, and possible polysaccharides with similar characteristics with colanic acid are considered as a major cause of severe irreversible membrane fouling (i.e., pore-clogging) regardless of biofilm formation (dynamic membrane).

  5. Waste Workers’ Exposure to Airborne Fungal and Bacterial Species in the Truck Cab and During Waste Collection

    PubMed Central

    Madsen, Anne Mette; Alwan, Taif; Ørberg, Anders; Uhrbrand, Katrine; Jørgensen, Marie Birk

    2016-01-01

    A large number of people work with garbage collection, and exposure to microorganisms is considered an occupational health problem. However, knowledge on microbial exposure at species level is limited. The aim of the study was to achieve knowledge on waste collectors’ exposure to airborne inhalable fungal and bacterial species during waste collection with focus on the transport of airborne microorganisms into the truck cab. Airborne microorganisms were collected with samplers mounted in the truck cab, on the workers’ clothes, and outdoors. Fungal and bacterial species were quantified and identified. The study showed that the workers were exposed to between 112 and 4.8×104 bacteria m−3 air and 326 and 4.6×104 fungi m−3 air. The personal exposures to bacteria and fungi were significantly higher than the concentrations measured in the truck cabs and in the outdoor references. On average, the fungal and bacterial concentrations in truck cabs were 111 and 7.7 times higher than outdoor reference measurements. In total, 23 fungal and 38 bacterial species were found and identified. Most fungal species belonged to the genus Penicillium and in total 11 Penicillium species were found. Identical fungal species were often found both in a personal sample and in the same person’s truck cab, but concentrations were on average 27 times higher in personal samples. Concentrations of fungal and bacterial species found only in the personal samples were lower than concentrations of species also found in truck cabs. Skin-related bacteria constituted a large fraction of bacterial isolates found in personal and truck cab samples. In total, six Staphylococcus species were found. In outdoor samples, no skin-related bacteria were found. On average, concentrations of bacterial species found both in the truck cab and personal samples were 77 times higher in personal samples than in truck cab samples. In conclusion, high concentrations of fungi were found in truck cabs, but the

  6. Use of oleic acid to reduce the population of the bacterial flora of poultry skin.

    PubMed

    Hinton, A; Ingram, K D

    2000-09-01

    The effect of oleic acid on native bacterial flora of poultry skin was examined. Skin from commercial broiler carcasses was washed once or twice in solutions of 0, 2, 4, 6, 8, or 10% (wt/vol) oleic acid and rinsed in peptone water. Aerobic bacteria, Enterobacteriaceae, Campylobacter, and enterococci in the rinsates were enumerated. Significantly fewer aerobic bacteria, Enterobacteriaceae, Campylobacter, and enterococci were recovered from rinsates of skin washed in oleic acid than from control samples. Additionally, fewer bacteria were recovered from rinsates of skin washed in higher concentrations of oleic acid than from skin washed in lower concentrations of the fatty acid. In most cases, there was no significant difference in the number of bacteria recovered from rinsates of skin washed once or twice in solutions of oleic acid. Washing skin samples twice in 10% solutions of oleic acid significantly reduced the number of aerobic bacteria, Enterobacteriaceae, Campylobacter, and enterococci that remained attached to the skin. Campylobacter sp., Enterococcus faecalis, and Listeria monocytogenes isolates possessed the least resistance to the antibacterial activity of oleic acid in vitro, while Escherichia coli and Pseudomonas aeruginosa showed higher resistance. Enterobacter cloacae, Staphylococcus lentus, and Salmonella Typhimurium had the greatest resistance to the antibacterial activity of oleic acid. Findings indicate that oleic acid reduces the number of bacteria on the skin of processed broilers and that the fatty acid is bactericidal to several spoilage and pathogenic bacteria associated with poultry.

  7. Changes in ruminal bacterial community composition following feeding of alfalfa ensiled with a lactic acid bacterial inoculant.

    PubMed

    Mohammed, R; Stevenson, D M; Beauchemin, K A; Muck, R E; Weimer, P J

    2012-01-01

    Some silage inoculants help to improve silage quality and promote an increase in milk production, possibly through altering the rumen microflora. We hypothesized that rumen bacterial community composition (BCC) would be different in cows fed alfalfa ensiled with the inoculant Lactobacillus plantarum MTD/1 (LP) compared with those fed alfalfa ensiled without the inoculant (Ctrl). Eight ruminally cannulated Holstein cows were allotted to 2 diets (Ctrl or LP) in a double crossover design with four 28-d periods. Diets were formulated to contain (% dry matter basis) 28.0% neutral detergent fiber and 16.2% crude protein, and contained alfalfa silage, 50.9; corn silage, 20.6; high-moisture shelled corn, 21.4; soy hulls, 4.7; plus minerals and vitamins, 2.4. Ruminal digesta were collected just before feeding on 3 consecutive days near the end of each period, and were separated into solid and liquid phases. Microbial DNA was extracted from each phase, amplified by PCR using domain-level bacterial primers, and subjected to automated ribosomal intergenic spacer analysis. The pH was 4.56 and 4.86 and the lactate-to-acetate ratio 9.8 and 4.4, respectively, for the treated and untreated alfalfa silages. Dry matter intakes and milk production data were not influenced by diets but showed a cow effect. Total volatile fatty acids (mM) tended to be greater for LP compared with Ctrl. Individual volatile fatty acids were not influenced by diets but showed a significant cow effect. Ruminal acetate (mol/100 mol) and acetate-to-propionate ratio were lower and propionate (mol/100 mol) greater for the 2 milk fat-depressed (MFD; <3.2% fat content) cows compared with the other 6 cows. Correspondence analysis of the 265 peaks in the automated ribosomal intergenic spacer analysis profile across the 188 samples revealed that the first 2 components contributed 7.1 and 3.8% to the total variation in the profile. The ordination points representing the liquid and solid phases clustered separately

  8. Dancing for food in the deep sea: bacterial farming by a new species of Yeti crab.

    PubMed

    Thurber, Andrew R; Jones, William J; Schnabel, Kareen

    2011-01-01

    Vent and seep animals harness chemosynthetic energy to thrive far from the sun's energy. While symbiont-derived energy fuels many taxa, vent crustaceans have remained an enigma; these shrimps, crabs, and barnacles possess a phylogenetically distinct group of chemosynthetic bacterial epibionts, yet the role of these bacteria has remained unclear. We test whether a new species of Yeti crab, which we describe as Kiwa puravida n. sp, farms the epibiotic bacteria that it grows on its chelipeds (claws), chelipeds that the crab waves in fluid escaping from a deep-sea methane seep. Lipid and isotope analyses provide evidence that epibiotic bacteria are the crab's main food source and K. puravida n. sp. has highly-modified setae (hairs) on its 3(rd) maxilliped (a mouth appendage) which it uses to harvest these bacteria. The ε- and γ- proteobacteria that this methane-seep species farms are closely related to hydrothermal-vent decapod epibionts. We hypothesize that this species waves its arm in reducing fluid to increase the productivity of its epibionts by removing boundary layers which may otherwise limit carbon fixation. The discovery of this new species, only the second within a family described in 2005, stresses how much remains undiscovered on our continental margins. PMID:22140426

  9. Dancing for food in the deep sea: bacterial farming by a new species of Yeti crab.

    PubMed

    Thurber, Andrew R; Jones, William J; Schnabel, Kareen

    2011-01-01

    Vent and seep animals harness chemosynthetic energy to thrive far from the sun's energy. While symbiont-derived energy fuels many taxa, vent crustaceans have remained an enigma; these shrimps, crabs, and barnacles possess a phylogenetically distinct group of chemosynthetic bacterial epibionts, yet the role of these bacteria has remained unclear. We test whether a new species of Yeti crab, which we describe as Kiwa puravida n. sp, farms the epibiotic bacteria that it grows on its chelipeds (claws), chelipeds that the crab waves in fluid escaping from a deep-sea methane seep. Lipid and isotope analyses provide evidence that epibiotic bacteria are the crab's main food source and K. puravida n. sp. has highly-modified setae (hairs) on its 3(rd) maxilliped (a mouth appendage) which it uses to harvest these bacteria. The ε- and γ- proteobacteria that this methane-seep species farms are closely related to hydrothermal-vent decapod epibionts. We hypothesize that this species waves its arm in reducing fluid to increase the productivity of its epibionts by removing boundary layers which may otherwise limit carbon fixation. The discovery of this new species, only the second within a family described in 2005, stresses how much remains undiscovered on our continental margins.

  10. Dancing for Food in the Deep Sea: Bacterial Farming by a New Species of Yeti Crab

    PubMed Central

    Thurber, Andrew R.; Jones, William J.; Schnabel, Kareen

    2011-01-01

    Vent and seep animals harness chemosynthetic energy to thrive far from the sun's energy. While symbiont-derived energy fuels many taxa, vent crustaceans have remained an enigma; these shrimps, crabs, and barnacles possess a phylogenetically distinct group of chemosynthetic bacterial epibionts, yet the role of these bacteria has remained unclear. We test whether a new species of Yeti crab, which we describe as Kiwa puravida n. sp, farms the epibiotic bacteria that it grows on its chelipeds (claws), chelipeds that the crab waves in fluid escaping from a deep-sea methane seep. Lipid and isotope analyses provide evidence that epibiotic bacteria are the crab's main food source and K. puravida n. sp. has highly-modified setae (hairs) on its 3rd maxilliped (a mouth appendage) which it uses to harvest these bacteria. The ε- and γ- proteobacteria that this methane-seep species farms are closely related to hydrothermal-vent decapod epibionts. We hypothesize that this species waves its arm in reducing fluid to increase the productivity of its epibionts by removing boundary layers which may otherwise limit carbon fixation. The discovery of this new species, only the second within a family described in 2005, stresses how much remains undiscovered on our continental margins. PMID:22140426

  11. [Hydrocarbons and fatty acid methyl esters in bacterial biomass before and after physicochemical treatment].

    PubMed

    Botvinko, I V; Popova, O V; Stroeva, A R; Shuvalov, S A; Vinokurov, V A

    2014-01-01

    Hydrocarbons and fatty acid methyl esters were identified by chromatography-mass spectrometry in the extracts from the native biomass of bacteria: chemoorganoheterotrophic Arthrobacter sp. and Pseudomonas aeruginosa and chemolithoautotrophic Carboxydothermus sp. Ultrasound treatment of bacterial biomass and mild thermolysis were shown promote formation of a broad spectrum of hydrocarbons from bacterial biomass. The biomarker stigmastane belonging to the sterane group was found in P. aeruginosa biomass after thermolysis at 110 degrees C in an open vial. Alkane composition in P. aeruginosa biomass before and after thermolysis at 300 degrees C in a sealed container remained unchanged, indicating the possibility of preservation of hydrocarbons of bacterial origin in sealed layers under high temperature and elevated pressure.

  12. Similar bacterial community composition in acidic mining lakes with different pH and lake chemistry.

    PubMed

    Kampe, Heike; Dziallas, Claudia; Grossart, Hans-Peter; Kamjunke, Norbert

    2010-10-01

    As extreme environmental conditions strongly affect bacterial community composition (BCC), we examined whether differences in pH-even at low pH-and in iron and sulfate concentrations lead to changes in BCC of acidic mining lakes. Thereby, we tested the following hypotheses: (1) diversity of the bacterial community in acidic lakes decreases with reducing pH, (2) BCC differs between epilimnion and hypolimnion, and (3) BCC in extremely acidic environments does not vary much over time. Therefore, we investigated the BCC of three acidic lakes with different pH values (2.3, 2.7, and 3.2) by denaturing gradient gel electrophoresis (DGGE) and subsequent sequencing of DGGE bands as well as catalyzed reporter deposition-FISH (CARD-FISH). BCC did not significantly vary among the studied lakes nor differ much between water layers. In contrast, BCC significantly changed over time, which is contradictory to our hypotheses. Bacterial communities were dominated by Alpha-, Beta-, and Gammaproteobacteria, whereas Actino- and Acidobacteria rarely occurred. Cell numbers of both free and attached bacteria were positively related to DOC concentration. Overall, low pH and extreme chemical conditions of the studied lakes led to similar assemblages of bacteria with pronounced temporal differences. This notion indicates that temporal changes in environmental conditions including food web structure also affect unique communities of bacteria thriving at low pH.

  13. Epidemiology of urinary tract infections, bacterial species and resistances in primary care in France.

    PubMed

    Malmartel, A; Ghasarossian, C

    2016-03-01

    General practitioners often have to manage urinary tract infections (UTI) with probabilistic treatments, although bacterial resistances are increasing. Therefore, the French Society of Infectious Diseases published new guidelines in 2014. The aim of this study was to investigate the bacterial epidemiology of UTI in the general population in primary care and analyse risk factors for Escherichia coli resistance to antibiotics. A cross-sectional study was conducted in 12 ambulatory laboratories. Patients over 18 years of age coming for urinalysis were included. Risk factors for UTI were collected using a questionnaire and the laboratory records. Bacteria meeting criteria for UTI were analysed. A positive urinalysis was found in 1119 patients, corresponding to 1125 bacterial isolates. The bacterial species were: E. coli (73 %), Enterococcus spp. (7 %), Klebsiella spp. (6 %), Proteus spp. (4 %), Staphylococcus spp. (3 %) and Pseudomonas spp. (2 %). Regardless of the bacteria, the most common resistance was that to co-trimoxazole: 27 % (95 % confidence interval [CI] = [0.24; 0.30]), followed by ofloxacin resistance: 16 % [0.14; 0.18]. Escherichia coli resistances to co-trimoxazole, ofloxacin, cefixime, nitrofurantoin and fosfomycin were, respectively, 25.5 % [0.23; 0.28], 17 % [0.14; 0.20], 5.6 % [0.04; 0.07], 2.2 % [0.01; 0.03] and 1.2 % [0.005; 0.02]. Independent risk factors for E. coli resistance to ofloxacin were age over 85 years (odds ratio [OR] = 3.08; [1.61; 5.87]) and a history of UTI in the last 6 months (OR = 2.34; [1.54; 3.52]). Our findings support the guidelines recommending fluoroquinolone sparing. The scarcity of E. coli resistance to fosfomycin justifies its use as a first-line treatment in acute cystitis. These results should be reassessed in a few years to identify changes in the bacterial epidemiology of UTI. PMID:26740324

  14. In situ identification of bacterial species in marine microfouling films by using an immunofluorescence technique.

    PubMed Central

    Zambon, J J; Huber, P S; Meyer, A E; Slots, J; Fornalik, M S; Baier, R E

    1984-01-01

    An immunofluorescence technique was developed for the in situ identification of specific bacteria in marine microfouling films. Microorganisms adherent to glass plates after 30 days of immersion in a synthetic seawater system were cultured and classified by biochemical tests, flagellar arrangement, and the API 20E system. All isolates were gram-negative aerobic or facultative motile rods, predominantly Pseudomonas spp. Rabbit antisera to the five dominant organisms including Achromobacter spp., Comamonas terrigena, P. putrefaciens, a yellow-pigmented Pseudomonas sp., and Vibrio alginolyticus were prepared. These antisera were shown to be species specific in indirect immunofluorescence assays against a battery of 26 marine isolates from 14 bacterial species, with the exception of antisera to the Pseudomonas spp, which cross-reacted with each other but not with test bacteria of other genera. These immunofluorescent reagents enabled the in situ identification of all five bacterial species in microfouling films. Low-surface-energy test plates had smaller numbers of adherent bacteria in microfouling films than medium-surface-energy test plates, suggesting that the degree of microfouling may be influenced by the surface energy. In addition, the reagents could identify up to 39% of the attached bacteria in microfouling films spontaneously formed on steel plates in flow cells deployed in different areas of the Atlantic Ocean. The microbial composition of the ocean-formed films varied with the geographical area of their formation. The present results indicate that immunofluorescence techniques may provide a rapid and reliable means to identify, in situ, specific bacteria in marine microfouling films. PMID:6393875

  15. Bacterial cellulose produced by a new acid-resistant strain of Gluconacetobacter genus.

    PubMed

    Castro, Cristina; Zuluaga, Robin; Álvarez, Catalina; Putaux, Jean-Luc; Caro, Gloria; Rojas, Orlando J; Mondragon, Iñaki; Gañán, Piedad

    2012-08-01

    A bacterial strain isolated from the fermentation of Colombian homemade vinegar, Gluconacetobacter medellensis, was investigated as a new source of bacterial cellulose (BC). The BC produced from substrate media consisting of various carbon sources at different pH and incubation times was quantified. Hestrin-Schramm (HS) medium modified with glucose led to the highest BC yields followed by sucrose and fructose. Interestingly, the microorganisms are highly tolerant to low pH: an optimum yield of 4.5 g/L was achieved at pH 3.5, which is generally too low for other bacterial species to function. The cellulose microfibrils produced by the new strain were characterized by scanning and transmission electron microscopy, infrared spectroscopy X-ray diffraction and elemental analysis. The morphological, structural and chemical characteristics of the cellulose produced are similar to those expected for BC.

  16. Spatial and Species Variations in Bacterial Communities Associated with Corals from the Red Sea as Revealed by Pyrosequencing

    PubMed Central

    Lee, On On; Yang, Jiangke; Bougouffa, Salim; Wang, Yong; Batang, Zenon; Tian, Renmao; Al-Suwailem, Abdulaziz

    2012-01-01

    Microbial associations with corals are common and are most likely symbiotic, although their diversity and relationships with environmental factors and host species remain unclear. In this study, we adopted a 16S rRNA gene tag-pyrosequencing technique to investigate the bacterial communities associated with three stony Scleractinea and two soft Octocorallia corals from three locations in the Red Sea. Our results revealed highly diverse bacterial communities in the Red Sea corals, with more than 600 ribotypes detected and up to 1,000 species estimated from a single coral species. Altogether, 21 bacterial phyla were recovered from the corals, of which Gammaproteobacteria was the most dominant group, and Chloroflexi, Chlamydiae, and the candidate phylum WS3 were reported in corals for the first time. The associated bacterial communities varied greatly with location, where environmental conditions differed significantly. Corals from disturbed areas appeared to share more similar bacterial communities, but larger variations in community structures were observed between different coral species from pristine waters. Ordination methods identified salinity and depth as the most influential parameters affecting the abundance of Vibrio, Pseudoalteromonas, Serratia, Stenotrophomonas, Pseudomonas, and Achromobacter in the corals. On the other hand, bacteria such as Chloracidobacterium and Endozoicomonas were more sensitive to the coral species, suggesting that the host species type may be influential in the associated bacterial community, as well. The combined influences of the coral host and environmental factors on the associated microbial communities are discussed. This study represents the first comparative study using tag-pyrosequencing technology to investigate the bacterial communities in Red Sea corals. PMID:22865078

  17. Relationship between the Presence of Bartonella Species and Bacterial Loads in Cats and Cat Fleas (Ctenocephalides felis) under Natural Conditions.

    PubMed

    Gutiérrez, Ricardo; Nachum-Biala, Yaarit; Harrus, Shimon

    2015-08-15

    Cats are considered the main reservoir of three zoonotic Bartonella species: Bartonella henselae, Bartonella clarridgeiae, and Bartonella koehlerae. Cat fleas (Ctenocephalides felis) have been experimentally demonstrated to be a competent vector of B. henselae and have been proposed as the potential vector of the two other Bartonella species. Previous studies have reported a lack of association between the Bartonella species infection status (infected or uninfected) and/or bacteremia levels of cats and the infection status of the fleas they host. Nevertheless, to date, no study has compared the quantitative distributions of these bacteria in both cats and their fleas under natural conditions. Thus, the present study explored these relationships by identifying and quantifying the different Bartonella species in both cats and their fleas. Therefore, EDTA-blood samples and fleas collected from stray cats were screened for Bartonella bacteria. Bacterial loads were quantified by high-resolution melt real-time quantitative PCR assays. The results indicated a moderate correlation between the Bartonella bacterial loads in the cats and their fleas when both were infected with the same Bartonella species. Moreover, a positive effect of the host infection status on the Bartonella bacterial loads of the fleas was observed. Conversely, the cat bacterial loads were not affected by the infection status of their fleas. Our results suggest that the Bartonella bacterial loads of fleas are positively affected by the presence of the bacteria in their feline host, probably by multiple acquisitions/accumulation and/or multiplication events.

  18. Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer

    USGS Publications Warehouse

    Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.

    2009-01-01

    Background: Phylogeographic reconstruction of some bacterial populations is hindered by low diversity coupled with high levels of lateral gene transfer. A comparison of recombination levels and diversity at seven housekeeping genes for eleven bacterial species, most of which are commonly cited as having high levels of lateral gene transfer shows that the relative contributions of homologous recombination versus mutation for Burkholderia pseudomallei is over two times higher than for Streptococcus pneumoniae and is thus the highest value yet reported in bacteria. Despite the potential for homologous recombination to increase diversity, B. pseudomallei exhibits a relative lack of diversity at these loci. In these situations, whole genome genotyping of orthologous shared single nucleotide polymorphism loci, discovered using next generation sequencing technologies, can provide very large data sets capable of estimating core phylogenetic relationships. We compared and searched 43 whole genome sequences of B. pseudomallei and its closest relatives for single nucleotide polymorphisms in orthologous shared regions to use in phylogenetic reconstruction. Results: Bayesian phylogenetic analyses of >14,000 single nucleotide polymorphisms yielded completely resolved trees for these 43 strains with high levels of statistical support. These results enable a better understanding of a separate analysis of population differentiation among >1,700 B. pseudomallei isolates as defined by sequence data from seven housekeeping genes. We analyzed this larger data set for population structure and allele sharing that can be attributed to lateral gene transfer. Our results suggest that despite an almost panmictic population, we can detect two distinct populations of B. pseudomallei that conform to biogeographic patterns found in many plant and animal species. That is, separation along Wallace's Line, a biogeographic boundary between Southeast Asia and Australia. Conclusion: We describe an

  19. PLANT MICROBIOME. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa.

    PubMed

    Lebeis, Sarah L; Paredes, Sur Herrera; Lundberg, Derek S; Breakfield, Natalie; Gehring, Jase; McDonald, Meredith; Malfatti, Stephanie; Glavina del Rio, Tijana; Jones, Corbin D; Tringe, Susannah G; Dangl, Jeffery L

    2015-08-21

    Immune systems distinguish "self" from "nonself" to maintain homeostasis and must differentially gate access to allow colonization by potentially beneficial, nonpathogenic microbes. Plant roots grow within extremely diverse soil microbial communities but assemble a taxonomically limited root-associated microbiome. We grew isogenic Arabidopsis thaliana mutants with altered immune systems in a wild soil and also in recolonization experiments with a synthetic bacterial community. We established that biosynthesis of, and signaling dependent on, the foliar defense phytohormone salicylic acid is required to assemble a normal root microbiome. Salicylic acid modulates colonization of the root by specific bacterial families. Thus, plant immune signaling drives selection from the available microbial communities to sculpt the root microbiome.

  20. Life history correlates of fecal bacterial species richness in a wild population of the blue tit Cyanistes caeruleus

    PubMed Central

    Benskin, Clare McW H; Rhodes, Glenn; Pickup, Roger W; Mainwaring, Mark C; Wilson, Kenneth; Hartley, Ian R

    2015-01-01

    Very little is known about the normal gastrointestinal flora of wild birds, or how it might affect or reflect the host's life-history traits. The aim of this study was to survey the species richness of bacteria in the feces of a wild population of blue tits Cyanistes caeruleus and to explore the relationships between bacterial species richness and various life-history traits, such as age, sex, and reproductive success. Using PCR-TGGE, 55 operational taxonomic units (OTUs) were identified in blue tit feces. DNA sequencing revealed that the 16S rRNA gene was amplified from a diverse range of bacteria, including those that shared closest homology with Bacillus licheniformis, Campylobacter lari, Pseudomonas spp., and Salmonella spp. For adults, there was a significant negative relationship between bacterial species richness and the likelihood of being detected alive the following breeding season; bacterial richness was consistent across years but declined through the breeding season; and breeding pairs had significantly more similar bacterial richness than expected by chance alone. Reduced adult survival was correlated with the presence of an OTU most closely resembling C. lari; enhanced adult survival was associated with an OTU most similar to Arthrobacter spp. For nestlings, there was no significant change in bacterial species richness between the first and second week after hatching, and nestlings sharing the same nest had significantly more similar bacterial richness. Collectively, these results provide compelling evidence that bacterial species richness was associated with several aspects of the life history of their hosts. PMID:25750710

  1. Biomarkers for Tuberculosis Based on Secreted, Species-Specific, Bacterial Small Molecules.

    PubMed

    Pan, Shih-Jung; Tapley, Asa; Adamson, John; Little, Tessa; Urbanowski, Michael; Cohen, Keira; Pym, Alexander; Almeida, Deepak; Dorasamy, Afton; Layre, Emilie; Young, David C; Singh, Ravesh; Patel, Vinod B; Wallengren, Kristina; Ndung'u, Thumbi; Wilson, Douglas; Moody, D Branch; Bishai, William

    2015-12-01

    Improved biomarkers are needed for tuberculosis. To develop tests based on products secreted by tubercle bacilli that are strictly associated with viability, we evaluated 3 bacterial-derived, species-specific, small molecules as biomarkers: 2 mycobactin siderophores and tuberculosinyladenosine. Using liquid chromatography-tandem mass spectrometry, we demonstrated the presence of 1 or both mycobactins and/or tuberculosinyladenosine in serum and whole lung tissues from infected mice and sputum, cerebrospinal fluid (CSF), or lymph nodes from infected patients but not uninfected controls. Detection of the target molecules distinguished host infection status in 100% of mice with both serum and lung as the target sample. In human subjects, we evaluated detection of the bacterial small molecules (BSMs) in multiple body compartments in 3 patient cohorts corresponding to different forms of tuberculosis. We detected at least 1 of the 3 molecules in 90%, 71%, and 40% of tuberculosis patients' sputum, CSF, and lymph node samples, respectively. In paucibacillary forms of human tuberculosis, which are difficult to diagnose even with culture, detection of 1 or more BSM was rapid and compared favorably to polymerase chain reaction-based detection. Secreted BSMs, detectable in serum, warrant further investigation as a means for diagnosis and therapeutic monitoring in patients with tuberculosis.

  2. Bacterially synthesized folate and supplemental folic acid are absorbed across the large intestine of piglets.

    PubMed

    Asrar, Farhan M; O'Connor, Deborah L

    2005-10-01

    A large pool of folate exists in the large intestine of humans. Preliminary evidence, primarily in vitro, suggests that this folate may be bioavailable. The purpose of this study was to test the hypothesis that supplemental folic acid and bacterially synthesized folate are absorbed across the large intestine of piglets. The pig was used as an animal model because it resembles the human in terms of folate absorption, at least in the small intestine. A tracer of [3H]-folic acid or [3H]-para-aminobenzoic acid ([3H]-PABA), a precursor of bacterially synthesized folate, was injected into the cecum of 11-day-old piglets. Feces and urine were collected for 3 days. Thereafter, piglets were killed, and livers and kidneys harvested. [3H]-Folate was isolated from biological samples by affinity chromatography using immobilized milk folate binding proteins and counted using a scintillation counter. In piglets injected with [3H]-folic acid, the feces, liver, urine and kidneys accounted for 82.1%, 12.3%, 3.9% and 1.7% of recovered [3H]-folate, respectively. In piglets injected with [3H]-PABA, the amount of recovered bacterially synthesized folate in the feces, liver and urine was 85.1%, 0.4% and 14.6%, respectively. Twenty-three percent and 13% of tritium were recovered in samples examined (liver, kidney, fecal and urine) from piglets injected with [3H]-folic acid and [3H]-PABA, respectively. Using our estimates of [3H]-folic acid absorption and the total and percent monoglutamyl folate content of piglet feces, we predict that at least 18% of the dietary folate requirement for the piglet could be met by folate absorption across the large intestine.

  3. Efficacy of two sperm preparation techniques in reducing non-specific bacterial species from human semen

    PubMed Central

    Abeysundara, Prabath K; Dissanayake, DMAB; Wijesinghe, Prasantha S; Perera, RRDP; Nishad, AAN

    2013-01-01

    CONTEXT: Artificial reproductive techniques using seminal preparations with bacteria may cause pelvic inflammatory disease and its sequalae. AIMS: To assess efficacy of two sperm preparation techniques to clear bacteria and the effect of bacteriospermia on sperm recovery rates. SETTINGS AND DESIGN: A descriptive cross-sectional study was carried out among males of subfertile couples. SUBJECTS AND METHODS: Semen samples were randomly allocated into swim-up method (group S, n = 68) and density gradient method (group D, n = 50) for sperm preparation. Seminal fluid analysis and bacterial cultures were performed in each sample before and after sperm preparation. STATISTICAL ANALYSIS: McNemar's chi-squared test and independent samples t-test in SPSS version 16.0 were used. RESULTS: Organisms were found in 86 (72.88%) out of 118 samples, before sperm preparation; Streptococcus species (n = 40, 46.51% of which 14 were Group D Streptococcus species), Coagulase negative Staphylococcus species (n = 17, 19.76%), Staphylococcus aureus (n = 13, 15.11%), Coliform species (n = 11, 12.79% of which 09 were Escherichia coli) and Corynebacterium species (n = 5, 5.81%). There was a statistically significant reduction of culture positive samples in raw vs. processed samples; in group S, 49 (72.05%) vs. 16 (23.52%) and in group D, 37 (74%) vs. 18 (36%). In group S and D, mean (SD) recovery rates of culture positive vs. culture negative samples were 39.44% (SD-14.02) vs. 44.22% (SD-22.38), P = 0.39 and 52.50% (SD-37.16) vs. 49.58% (SD-40.32), P = 0.82 respectively. CONCLUSIONS: Both sperm preparation methods significantly reduced bacteria in semen, but total clearance was not achieved. Sperm recovery rate was not affected by bacteriospermia. PMID:24082658

  4. Structure-Activity Relationships of Antimicrobial Gallic Acid Derivatives from Pomegranate and Acacia Fruit Extracts against Potato Bacterial Wilt Pathogen.

    PubMed

    Farag, Mohamed A; Al-Mahdy, Dalia A; Salah El Dine, Riham; Fahmy, Sherifa; Yassin, Aymen; Porzel, Andrea; Brandt, Wolfgang

    2015-06-01

    Bacterial wilts of potato, tomato, pepper, and or eggplant caused by Ralstonia solanacearum are among the most serious plant diseases worldwide. In this study, the issue of developing bactericidal agents from natural sources against R. solanacearum derived from plant extracts was addressed. Extracts prepared from 25 plant species with antiseptic relevance in Egyptian folk medicine were screened for their antimicrobial properties against the potato pathogen R. solancearum by using the disc-zone inhibition assay and microtitre plate dilution method. Plants exhibiting notable antimicrobial activities against the tested pathogen include extracts from Acacia arabica and Punica granatum. Bioactivity-guided fractionation of A. arabica and P. granatum resulted in the isolation of bioactive compounds 3,5-dihydroxy-4-methoxybenzoic acid and gallic acid, in addition to epicatechin. All isolates displayed significant antimicrobial activities against R. solanacearum (MIC values 0.5-9 mg/ml), with 3,5-dihydroxy-4-methoxybenzoic acid being the most effective one with a MIC value of 0.47 mg/ml. We further performed a structure-activity relationship (SAR) study for the inhibition of R. solanacearum growth by ten natural, structurally related benzoic acids.

  5. Structure-Activity Relationships of Antimicrobial Gallic Acid Derivatives from Pomegranate and Acacia Fruit Extracts against Potato Bacterial Wilt Pathogen.

    PubMed

    Farag, Mohamed A; Al-Mahdy, Dalia A; Salah El Dine, Riham; Fahmy, Sherifa; Yassin, Aymen; Porzel, Andrea; Brandt, Wolfgang

    2015-06-01

    Bacterial wilts of potato, tomato, pepper, and or eggplant caused by Ralstonia solanacearum are among the most serious plant diseases worldwide. In this study, the issue of developing bactericidal agents from natural sources against R. solanacearum derived from plant extracts was addressed. Extracts prepared from 25 plant species with antiseptic relevance in Egyptian folk medicine were screened for their antimicrobial properties against the potato pathogen R. solancearum by using the disc-zone inhibition assay and microtitre plate dilution method. Plants exhibiting notable antimicrobial activities against the tested pathogen include extracts from Acacia arabica and Punica granatum. Bioactivity-guided fractionation of A. arabica and P. granatum resulted in the isolation of bioactive compounds 3,5-dihydroxy-4-methoxybenzoic acid and gallic acid, in addition to epicatechin. All isolates displayed significant antimicrobial activities against R. solanacearum (MIC values 0.5-9 mg/ml), with 3,5-dihydroxy-4-methoxybenzoic acid being the most effective one with a MIC value of 0.47 mg/ml. We further performed a structure-activity relationship (SAR) study for the inhibition of R. solanacearum growth by ten natural, structurally related benzoic acids. PMID:26080741

  6. Southern leaf blight disease severity is correlated with decreased maize leaf epiphytic bacterial species richness and the phyllosphere bacterial diversity decline is enhanced by nitrogen fertilization

    PubMed Central

    Manching, Heather C.; Balint-Kurti, Peter J.; Stapleton, Ann E.

    2014-01-01

    Plant leaves are inhabited by a diverse group of microorganisms that are important contributors to optimal growth. Biotic and abiotic effects on plant growth are usually studied in controlled settings examining response to variation in single factors and in field settings with large numbers of variables. Multi-factor experiments with combinations of stresses bridge this gap, increasing our understanding of the genotype-environment-phenotype functional map for the host plant and the affiliated epiphytic community. The maize inbred B73 was exposed to single and combination abiotic and the biotic stress treatments: low nitrogen fertilizer and high levels of infection with southern leaf blight (causal agent Cochliobolus heterostrophus). Microbial epiphyte samples were collected at the vegetative early-season phase and species composition was determined using 16S ribosomal intergenic spacer analysis. Plant traits and level of southern leaf blight disease were measured late-season. Bacterial diversity was different among stress treatment groups (P < 0.001). Lower species richness—alpha diversity—was correlated with increased severity of southern leaf blight disease when disease pressure was high. Nitrogen fertilization intensified the decline in bacterial alpha diversity. While no single bacterial ribotype was consistently associated with disease severity, small sets of ribotypes were good predictors of disease levels. Difference in leaf bacterial-epiphyte diversity early in the season were correlated with plant disease severity, supporting further tests of microbial epiphyte-disease correlations for use in predicting disease progression. PMID:25177328

  7. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    PubMed Central

    Lui, Clarissa; Cady, Nathaniel C.; Batt, Carl A.

    2009-01-01

    The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform. PMID:22412335

  8. Surviving chytridiomycosis: differential anti-Batrachochytrium dendrobatidis activity in bacterial isolates from three lowland species of Atelopus.

    PubMed

    Flechas, Sandra V; Sarmiento, Carolina; Cárdenas, Martha E; Medina, Edgar M; Restrepo, Silvia; Amézquita, Adolfo

    2012-01-01

    In the Neotropics, almost every species of the stream-dwelling harlequin toads (genus Atelopus) have experienced catastrophic declines. The persistence of lowland species of Atelopus could be explained by the lower growth rate of Batrachochytrium dendrobatidis (Bd) at temperatures above 25 °C. We tested the complementary hypothesis that the toads' skin bacterial microbiota acts as a protective barrier against the pathogen, perhaps delaying or impeding the symptomatic phase of chytridiomycosis. We isolated 148 cultivable bacterial strains from three lowland Atelopus species and quantified the anti-Bd activity through antagonism assays. Twenty-six percent (38 strains representing 12 species) of the bacteria inhibited Bd growth and just two of them were shared among the toad species sampled in different localities. Interestingly, the strongest anti-Bd activity was measured in bacteria isolated from A. elegans, the only species that tested positive for the pathogen. The cutaneous bacterial microbiota is thus likely a fitness-enhancing trait that may (adaptation) or not (exaptation) have appeared because of natural selection mediated by chytridiomycosis. Our findings reveal bacterial strains for development of local probiotic treatments against chytridiomycosis and also shed light on the mechanisms behind the frog-bacteria-pathogen interaction. PMID:22970314

  9. Surviving Chytridiomycosis: Differential Anti-Batrachochytrium dendrobatidis Activity in Bacterial Isolates from Three Lowland Species of Atelopus

    PubMed Central

    Flechas, Sandra V.; Sarmiento, Carolina; Cárdenas, Martha E.; Medina, Edgar M.; Restrepo, Silvia; Amézquita, Adolfo

    2012-01-01

    In the Neotropics, almost every species of the stream-dwelling harlequin toads (genus Atelopus) have experienced catastrophic declines. The persistence of lowland species of Atelopus could be explained by the lower growth rate of Batrachochytrium dendrobatidis (Bd) at temperatures above 25°C. We tested the complementary hypothesis that the toads' skin bacterial microbiota acts as a protective barrier against the pathogen, perhaps delaying or impeding the symptomatic phase of chytridiomycosis. We isolated 148 cultivable bacterial strains from three lowland Atelopus species and quantified the anti-Bd activity through antagonism assays. Twenty-six percent (38 strains representing 12 species) of the bacteria inhibited Bd growth and just two of them were shared among the toad species sampled in different localities. Interestingly, the strongest anti-Bd activity was measured in bacteria isolated from A. elegans, the only species that tested positive for the pathogen. The cutaneous bacterial microbiota is thus likely a fitness-enhancing trait that may (adaptation) or not (exaptation) have appeared because of natural selection mediated by chytridiomycosis. Our findings reveal bacterial strains for development of local probiotic treatments against chytridiomycosis and also shed light on the mechanisms behind the frog-bacteria-pathogen interaction. PMID:22970314

  10. Coevolution between Stop Codon Usage and Release Factors in Bacterial Species

    PubMed Central

    Wei, Yulong; Wang, Juan; Xia, Xuhua

    2016-01-01

    Three stop codons in bacteria represent different translation termination signals, and their usage is expected to depend on their differences in translation termination efficiency, mutation bias, and relative abundance of release factors (RF1 decoding UAA and UAG, and RF2 decoding UAA and UGA). In 14 bacterial species (covering Proteobacteria, Firmicutes, Cyanobacteria, Actinobacteria and Spirochetes) with cellular RF1 and RF2 quantified, UAA is consistently over-represented in highly expressed genes (HEGs) relative to lowly expressed genes (LEGs), whereas UGA usage is the opposite even in species where RF2 is far more abundant than RF1. UGA usage relative to UAG increases significantly with PRF2 [=RF2/(RF1 + RF2)] as expected from adaptation between stop codons and their decoders. PRF2 is > 0.5 over a wide range of AT content (measured by PAT3 as the proportion of AT at third codon sites), but decreases rapidly toward zero at the high range of PAT3. This explains why bacterial lineages with high PAT3 often have UGA reassigned because of low RF2. There is no indication that UAG is a minor stop codon in bacteria as claimed in a recent publication. The claim is invalid because of the failure to apply the two key criteria in identifying a minor codon: (1) it is least preferred by HEGs (or most preferred by LEGs) and (2) it corresponds to the least abundant decoder. Our results suggest a more plausible explanation for why UAA usage increases, and UGA usage decreases, with PAT3, but UAG usage remains low over the entire PAT3 range. PMID:27297468

  11. Bacterial species associated with traditional starter cultures used for fermented bamboo shoot production in Manipur state of India.

    PubMed

    Jeyaram, K; Romi, W; Singh, Th Anand; Devi, A Ranjita; Devi, S Soni

    2010-09-30

    Soidon is a non-salted acidic fermented food prepared from the succulent bamboo shoot tip of Schizostachyum capitatum Munro by using a traditional liquid starter called "soidon mahi" in Manipur state of India. In this study, 163 bacterial isolates associated with this starter samples were identified and their population distribution was investigated by amplified ribosomal DNA restriction analysis (ARDRA), 16S rDNA sequencing and randomly amplified polymorphic DNA (RAPD) analysis. This acidic starter (pH 4.5+/-0.15) was dominated by a characteristic association of Bacillus and lactic acid bacteria (LAB) together. The population distribution of dominant species were Bacillus subtilis 29.3%, Bacillus cereus 35.7%, Bacillus pumilus 2.6%, Lactobacillus brevis 9.6%, Lactobacillus plantarum 5.1%, Carnobacterium sp. 11.9%, Enterococcus faecium 1.2% and Pseudomonas fluorescens 4.6%. Alarming population load (10(6)-10(7)cfu/ml) of B. cereus in 87% of starter samples studied should raise concern regarding biosafety of soidon consumption. PCR amplification of 16S-23S rDNA intergenic transcribed spacer (ITS) region and ITS-RFLP profiles revealed a high diversity with eight subgroups in B. subtilis, five subgroups in B. cereus and three subgroups in L. brevis isolates. The most abundant B. subtilis subgroup IB.1 distributed in most of the samples showed very less clonal variability during RAPD analysis. The molecular methods used in this study identified the dominant strains of Bacillus and LAB distributed in most of the starter samples. These dominant strains of B. subtilis, L. brevis and L. plantarum would allow for developing a defined starter culture for the production of quality soidon.

  12. Use of bacterial extracts to enhance amino acid breakdown in dry fermented sausages.

    PubMed

    Herranz, B; Fernández, M; de la Hoz, L; Ordóñez, J A

    2006-02-01

    The effect of the intracellular cell-free extracts (ICFEs) of two bacterial strains (Lactobacillus sakei GO and Bacillus pumilus) on the amino acid catabolism and the sensory properties of dry fermented sausages, was investigated. Extracts were added to sausages alone or in combination with a protease, papain. Amino acid breakdown was monitored by the changes in free amino acids, ammonia and amine content during the ripening process. A 15% decrease in the content of free amino acids was observed in sausages added with the ICFE from L. sakei GO. Furthermore, the extract of L. sakei GO significantly reduced (54-68%) the content of the amino acids considered as precursors of the typical ripened flavour, i.e., valine, leucine and isoleucine. Chemical changes were not reflected in a significant improvement of the sensory quality of sausages added with the ICFEs. The potential use of the bacterial ICFEs studied in the present work for the manufacture of dry fermented sausages, and its comparison with the use of fungal extracts, are discussed. PMID:22061560

  13. Isolation and identification of a new tetrodotoxin-producing bacterial species, Raoultella terrigena, from Hong Kong marine puffer fish Takifugu niphobles.

    PubMed

    Yu, Vincent Chung-Him; Yu, Peter Hoi-Fu; Ho, Kin-Chung; Lee, Fred Wang-Fat

    2011-01-01

    Puffer fish, Takifugu niphobles, collected from the Hong Kong coastal waters were screened for tetrodotoxin-producing bacteria. A Gram-negative, non-acid-fast, non-sporing and rod shaped bacterial strain (designated as gutB01) was isolated from the intestine of the puffer fish and was shown to produce tetrodotoxin (TTX). Based on the Microbial Identification (MIDI) and 16S-23S rDNA internal transcribed spacer (ITS) phylogenetic analysis, the strain was identified as Raoultella terrigena. The TTX production ability of the strain was confirmed by mouse bioassay, ELISA and mass spectrometry (MALDI-TOF). Our results reiterate that the TTX found in puffer fish was likely produced by the associated bacteria and TTX are widely produced amongst a diversity of bacterial species.

  14. Isolation and Identification of a New Tetrodotoxin-Producing Bacterial Species, Raoultella terrigena, from Hong Kong Marine Puffer Fish Takifugu niphobles

    PubMed Central

    Yu, Vincent Chung-Him; Yu, Peter Hoi-Fu; Ho, Kin-Chung; Lee, Fred Wang-Fat

    2011-01-01

    Puffer fish, Takifugu niphobles, collected from the Hong Kong coastal waters were screened for tetrodotoxin-producing bacteria. A Gram-negative, non-acid-fast, non-sporing and rod shaped bacterial strain (designated as gutB01) was isolated from the intestine of the puffer fish and was shown to produce tetrodotoxin (TTX). Based on the Microbial Identification (MIDI) and 16S-23S rDNA internal transcribed spacer (ITS) phylogenetic analysis, the strain was identified as Raoultella terrigena. The TTX production ability of the strain was confirmed by mouse bioassay, ELISA and mass spectrometry (MALDI-TOF). Our results reiterate that the TTX found in puffer fish was likely produced by the associated bacteria and TTX are widely produced amongst a diversity of bacterial species. PMID:22163191

  15. Biomass and organic acids in sandstone of a weathering building: Production by bacterial and fungal isolates.

    PubMed

    Palmer, R J; Siebert, J; Hirsch, P

    1991-12-01

    Ten fungal and nine bacterial strains were isolated from a weathering sandstone building. Their growth, organic acid production, and acidification capacity were assessed in culture under nutritional conditions similar to those in situ. Biomass (10-50 nmol phospholipid-PO4g(-1)) within the rock was small compared to soils. The isolated organisms were able to produce high amounts of those acids found in the sandstone, but acid production did not cause a drastic reduction in culture pH. It is suggested that the importance of acidification in microbial degradation of sandstone has been overestimated and that, under in situ pH and nutritional conditions, cation chelation by microbially produced organic acid anions may be more relevant to the weathering process.

  16. Protein, cell and bacterial response to atmospheric pressure plasma grafted hyaluronic acid on poly(methylmethacrylate).

    PubMed

    D'Sa, Raechelle A; Raj, Jog; Dickinson, Peter J; McMahon, M Ann S; McDowell, David A; Meenan, Brian J

    2015-11-01

    Hyaluronic acid (HA) has been immobilised on poly(methyl methacrylate) (PMMA) surfaces using a novel dielectric barrier discharge (DBD) plasma process for the purposes of repelling protein, cellular and bacterial adhesion in the context of improving the performance of ophthalmic devices. Grafting was achieved by the following steps: (1) treatment of the PMMA with a DBD plasma operating at atmospheric pressure, (2) amine functionalisation of the activated polymer surface by exposure to a 3-aminopropyltrimethoxysilane (APTMS) linker molecule and (3) reaction of HA with the surface bound amine. The mechanism and effectiveness of the grafting process was verified by surface analysis. XPS data indicates that the APTMS linker molecule binds to PMMA via the Si-O chemistry and has the required pendant amine moiety. The carboxylic acid moiety on HA then binds with this -NH2 group via standard carbodiimide chemistry. ToF-SIMS confirms the presence of a coherent HA layer the microstructure of which is verified by AFM. The plasma grafted HA coating surfaces showed a pronounced decrease in protein and cellular adhesion when tested with bovine serum albumin and human corneal epithelial cells, respectively. The ability of these coatings to resist bacterial adhesion was established using Staphylococcus aureus NTC8325. Interestingly, the coatings did not repel bacterial adhesion, indicating that the mechanism of adhesion of bacterial cells is different to that for the surface interactions of mammalian cells. It is proposed that this difference is a consequence of the specific HA conformation that occurs under the conditions employed here. Hence, it is apparent that the microstructure/architecture of the HA coatings is an important factor in fabricating surfaces intended to repel proteins, mammalian and bacterial cells.

  17. Protein, cell and bacterial response to atmospheric pressure plasma grafted hyaluronic acid on poly(methylmethacrylate).

    PubMed

    D'Sa, Raechelle A; Raj, Jog; Dickinson, Peter J; McMahon, M Ann S; McDowell, David A; Meenan, Brian J

    2015-11-01

    Hyaluronic acid (HA) has been immobilised on poly(methyl methacrylate) (PMMA) surfaces using a novel dielectric barrier discharge (DBD) plasma process for the purposes of repelling protein, cellular and bacterial adhesion in the context of improving the performance of ophthalmic devices. Grafting was achieved by the following steps: (1) treatment of the PMMA with a DBD plasma operating at atmospheric pressure, (2) amine functionalisation of the activated polymer surface by exposure to a 3-aminopropyltrimethoxysilane (APTMS) linker molecule and (3) reaction of HA with the surface bound amine. The mechanism and effectiveness of the grafting process was verified by surface analysis. XPS data indicates that the APTMS linker molecule binds to PMMA via the Si-O chemistry and has the required pendant amine moiety. The carboxylic acid moiety on HA then binds with this -NH2 group via standard carbodiimide chemistry. ToF-SIMS confirms the presence of a coherent HA layer the microstructure of which is verified by AFM. The plasma grafted HA coating surfaces showed a pronounced decrease in protein and cellular adhesion when tested with bovine serum albumin and human corneal epithelial cells, respectively. The ability of these coatings to resist bacterial adhesion was established using Staphylococcus aureus NTC8325. Interestingly, the coatings did not repel bacterial adhesion, indicating that the mechanism of adhesion of bacterial cells is different to that for the surface interactions of mammalian cells. It is proposed that this difference is a consequence of the specific HA conformation that occurs under the conditions employed here. Hence, it is apparent that the microstructure/architecture of the HA coatings is an important factor in fabricating surfaces intended to repel proteins, mammalian and bacterial cells. PMID:26449450

  18. Mutations in y-aminobutyric acid (GABA) transaminase genes in plants or Pseudomonas syringae reduce bacterial virulence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pseudomonas syringae pv. tomato DC3000 is a bacterial pathogen of Arabidopsis and tomato that grows in the apoplast. The non-protein amino acid '-amino butyric acid (GABA) is produced by Arabidopsis and tomato and is the most abundant amino acid in the apoplastic fluid of tomato. The DC3000 genome h...

  19. Both Leaf Properties and Microbe-Microbe Interactions Influence Within-Species Variation in Bacterial Population Diversity and Structure in the Lettuce (Lactuca Species) Phyllosphere▿

    PubMed Central

    Hunter, Paul J.; Hand, Paul; Pink, David; Whipps, John M.; Bending, Gary D.

    2010-01-01

    Morphological and chemical differences between plant genera influence phyllosphere microbial populations, but the factors driving within-species variation in phyllosphere populations are poorly understood. Twenty-six lettuce accessions were used to investigate factors controlling within-species variation in phyllosphere bacterial populations. Morphological and physiochemical characteristics of the plants were compared, and bacterial community structure and diversity were investigated using terminal restriction fragment length polymorphism (T-RFLP) profiling and 16S rRNA gene clone libraries. Plant morphology and levels of soluble carbohydrates, calcium, and phenolic compounds (which have long been associated with plant responses to biotic stress) were found to significantly influence bacterial community structure. Clone libraries from three representative accessions were found to be significantly different in terms of both sequence differences and the bacterial genera represented. All three libraries were dominated by Pseudomonas species and the Enterobacteriaceae family. Significant differences in the relative proportions of genera in the Enterobacteriaceae were detected between lettuce accessions. Two such genera (Erwinia and Enterobacter) showed significant variation between the accessions and revealed microbe-microbe interactions. We conclude that both leaf surface properties and microbial interactions are important in determining the structure and diversity of the phyllosphere bacterial community. PMID:20952648

  20. Beneficial Effect of Acetic Acid on the Xylose Utilization and Bacterial Cellulose Production by Gluconacetobacter xylinus.

    PubMed

    Yang, Xiao-Yan; Huang, Chao; Guo, Hai-Jun; Xiong, Lian; Luo, Jun; Wang, Bo; Chen, Xue-Fang; Lin, Xiao-Qing; Chen, Xin-De

    2014-09-01

    In this work, acetic acid was found as one promising substrate to improve xylose utilization by Gluconacetobacter xylinus CH001. Also, with the help of adding acetic acid into medium, the bacterial cellulose (BC) production by G. xylinus was increased significantly. In the medium containing 3 g l(-1) acetic acid, the optimal xylose concentration for BC production was 20 g l(-1). In the medium containing 20 g l(-1) xylose, the xylose utilization and BC production by G. xylinus were stimulated by acetic acid within certain concentration. The highest BC yield (1.35 ± 0.06 g l(-1)) was obtained in the medium containing 20 g l(-1) xylose and 3 g l(-1) acetic acid after 14 days. This value was 6.17-fold higher than the yield (0.21 ± 0.01 g l(-1)) in the medium only containing 20 g l(-1) xylose. The results analyzed by FE-SEM, FTIR, and XRD showed that acetic acid affected little on the microscopic morphology and physicochemical characteristics of BC. Base on the phenomenon observed, lignocellulosic acid hydrolysates (xylose and acetic acid are main carbon sources present in it) could be considered as one potential substrate for BC production.

  1. Host species and developmental stage, but not host social structure, affects bacterial community structure in socially polymorphic bees.

    PubMed

    McFrederick, Quinn S; Wcislo, William T; Hout, Michael C; Mueller, Ulrich G

    2014-05-01

    Social transmission and host developmental stage are thought to profoundly affect the structure of bacterial communities associated with honey bees and bumble bees, but these ideas have not been explored in other bee species. The halictid bees Megalopta centralis and M. genalis exhibit intrapopulation social polymorphism, which we exploit to test whether bacterial communities differ by host social structure, developmental stage, or host species. We collected social and solitary Megalopta nests and sampled bees and nest contents from all stages of host development. To survey these bacterial communities, we used 16S rRNA gene 454 pyrosequencing. We found no effect of social structure, but found differences by host species and developmental stage. Wolbachia prevalence differed between the two host species. Bacterial communities associated with different developmental stages appeared to be driven by environmentally acquired bacteria. A Lactobacillus kunkeei clade bacterium that is consistently associated with other bee species was dominant in pollen provisions and larval samples, but less abundant in mature larvae and pupae. Foraging adults appeared to often reacquire L. kunkeei clade bacteria, likely while foraging at flowers. Environmental transmission appears to be more important than social transmission for Megalopta bees at the cusp between social and solitary behavior.

  2. Influences of Plant Species, Season and Location on Leaf Endophytic Bacterial Communities of Non-Cultivated Plants

    PubMed Central

    Ding, Tao; Melcher, Ulrich

    2016-01-01

    Bacteria are known to be associated endophytically with plants. Research on endophytic bacteria has identified their importance in food safety, agricultural production and phytoremediation. However, the diversity of endophytic bacterial communities and the forces that shape their compositions in non-cultivated plants are largely uncharacterized. In this study, we explored the diversity, community structure, and dynamics of endophytic bacteria in different plant species in the Tallgrass Prairie Preserve of northern Oklahoma, USA. High throughput sequencing of amplified segments of bacterial rDNA from 81 samples collected at four sampling times from five plant species at four locations identified 335 distinct OTUs at 97% sequence similarity, representing 16 phyla. Proteobacteria was the dominant phylum in the communities, followed by the phyla Bacteriodetes and Actinobacteria. Bacteria from four classes of Proteobacteria were detected with Alphaproteobacteria as the dominant class. Analysis of molecular variance revealed that host plant species and collecting date had significant influences on the compositions of the leaf endophytic bacterial communities. The proportion of Alphaproteobacteria was much higher in the communities from Asclepias viridis than from other plant species and differed from month to month. The most dominant bacterial groups identified in LDA Effect Size analysis showed host-specific patterns, indicating mutual selection between host plants and endophytic bacteria and that leaf endophytic bacterial compositions were dynamic, varying with the host plant’s growing season in three distinct patterns. In summary, next generation sequencing has revealed variations in the taxonomic compositions of leaf endophytic bacterial communities dependent primarily on the nature of the plant host species. PMID:26974817

  3. Influences of Plant Species, Season and Location on Leaf Endophytic Bacterial Communities of Non-Cultivated Plants.

    PubMed

    Ding, Tao; Melcher, Ulrich

    2016-01-01

    Bacteria are known to be associated endophytically with plants. Research on endophytic bacteria has identified their importance in food safety, agricultural production and phytoremediation. However, the diversity of endophytic bacterial communities and the forces that shape their compositions in non-cultivated plants are largely uncharacterized. In this study, we explored the diversity, community structure, and dynamics of endophytic bacteria in different plant species in the Tallgrass Prairie Preserve of northern Oklahoma, USA. High throughput sequencing of amplified segments of bacterial rDNA from 81 samples collected at four sampling times from five plant species at four locations identified 335 distinct OTUs at 97% sequence similarity, representing 16 phyla. Proteobacteria was the dominant phylum in the communities, followed by the phyla Bacteriodetes and Actinobacteria. Bacteria from four classes of Proteobacteria were detected with Alphaproteobacteria as the dominant class. Analysis of molecular variance revealed that host plant species and collecting date had significant influences on the compositions of the leaf endophytic bacterial communities. The proportion of Alphaproteobacteria was much higher in the communities from Asclepias viridis than from other plant species and differed from month to month. The most dominant bacterial groups identified in LDA Effect Size analysis showed host-specific patterns, indicating mutual selection between host plants and endophytic bacteria and that leaf endophytic bacterial compositions were dynamic, varying with the host plant's growing season in three distinct patterns. In summary, next generation sequencing has revealed variations in the taxonomic compositions of leaf endophytic bacterial communities dependent primarily on the nature of the plant host species.

  4. Superhydrophobic poly(L-lactic acid) surface as potential bacterial colonization substrate

    PubMed Central

    2011-01-01

    Hydrophobicity is a very important surface property and there is a growing interest in the production and characterization of superhydrophobic surfaces. Accordingly, it was recently shown how to obtain a superhydrophobic surface using a simple and cost-effective method on a polymer named poly(L-lactic acid) (PLLA). To evaluate the ability of such material as a substrate for bacterial colonization, this work assessed the capability of different bacteria to colonize a biomimetic rough superhydrophobic (SH) PLLA surface and also a smooth hydrophobic (H) one. The interaction between these surfaces and bacteria with different morphologies and cell walls was studied using one strain of Staphylococcus aureus and one of Pseudomonas aeruginosa. Results showed that both bacterial strains colonized the surfaces tested, although significantly higher numbers of S. aureus cells were found on SH surfaces comparing to H ones. Moreover, scanning electron microscopy images showed an extracellular matrix produced by P. aeruginosa on SH PLLA surfaces, indicating that this bacterium is able to form a biofilm on such substratum. Bacterial removal through lotus leaf effect was also tested, being more efficient on H coupons than on SH PLLA ones. Overall, the results showed that SH PLLA surfaces can be used as a substrate for bacterial colonization and, thus, have an exceptional potential for biotechnology applications. PMID:22018163

  5. Linking regional variation of epibiotic bacterial diversity and trophic ecology in a new species of Kiwaidae (Decapoda, Anomura) from East Scotia Ridge (Antarctica) hydrothermal vents

    PubMed Central

    Zwirglmaier, Katrin; Reid, William D K; Heywood, Jane; Sweeting, Christopher J; Wigham, Benjamin D; Polunin, Nicholas V C; Hawkes, Jeff A; Connelly, Douglas P; Pearce, David; Linse, Katrin

    2015-01-01

    We analyzed the diversity of bacterial epibionts and trophic ecology of a new species of Kiwa yeti crab discovered at two hydrothermal vent fields (E2 and E9) on the East Scotia Ridge (ESR) in the Southern Ocean using a combination of 454 pyrosequencing, Sanger sequencing, and stable isotope analysis. The Kiwa epibiont communities were dominated by Epsilon- and Gammaproteobacteria. About 454 sequencing of the epibionts on 15 individual Kiwa specimen revealed large regional differences between the two hydrothermal vent fields: at E2, the bacterial community on the Kiwa ventral setae was dominated (up to 75%) by Gammaproteobacteria, whereas at E9 Epsilonproteobacteria dominated (up to 98%). Carbon stable isotope analysis of both Kiwa and the bacterial epibionts also showed distinct differences between E2 and E9 in mean and variability. Both stable isotope and sequence data suggest a dominance of different carbon fixation pathways of the epibiont communities at the two vent fields. At E2, epibionts were putatively fixing carbon via the Calvin-Benson-Bassham and reverse tricarboxylic acid cycle, while at E9 the reverse tricarboxylic acid cycle dominated. Co-varying epibiont diversity and isotope values at E2 and E9 also present further support for the hypothesis that epibionts serve as a food source for Kiwa. PMID:25515351

  6. Linking regional variation of epibiotic bacterial diversity and trophic ecology in a new species of Kiwaidae (Decapoda, Anomura) from East Scotia Ridge (Antarctica) hydrothermal vents.

    PubMed

    Zwirglmaier, Katrin; Reid, William D K; Heywood, Jane; Sweeting, Christopher J; Wigham, Benjamin D; Polunin, Nicholas V C; Hawkes, Jeff A; Connelly, Douglas P; Pearce, David; Linse, Katrin

    2015-02-01

    We analyzed the diversity of bacterial epibionts and trophic ecology of a new species of Kiwa yeti crab discovered at two hydrothermal vent fields (E2 and E9) on the East Scotia Ridge (ESR) in the Southern Ocean using a combination of 454 pyrosequencing, Sanger sequencing, and stable isotope analysis. The Kiwa epibiont communities were dominated by Epsilon- and Gammaproteobacteria. About 454 sequencing of the epibionts on 15 individual Kiwa specimen revealed large regional differences between the two hydrothermal vent fields: at E2, the bacterial community on the Kiwa ventral setae was dominated (up to 75%) by Gammaproteobacteria, whereas at E9 Epsilonproteobacteria dominated (up to 98%). Carbon stable isotope analysis of both Kiwa and the bacterial epibionts also showed distinct differences between E2 and E9 in mean and variability. Both stable isotope and sequence data suggest a dominance of different carbon fixation pathways of the epibiont communities at the two vent fields. At E2, epibionts were putatively fixing carbon via the Calvin-Benson-Bassham and reverse tricarboxylic acid cycle, while at E9 the reverse tricarboxylic acid cycle dominated. Co-varying epibiont diversity and isotope values at E2 and E9 also present further support for the hypothesis that epibionts serve as a food source for Kiwa.

  7. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family.

    PubMed

    Broussard, Tyler C; Miller, Darcie J; Jackson, Pamela; Nourse, Amanda; White, Stephen W; Rock, Charles O

    2016-03-18

    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

  8. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family.

    PubMed

    Broussard, Tyler C; Miller, Darcie J; Jackson, Pamela; Nourse, Amanda; White, Stephen W; Rock, Charles O

    2016-03-18

    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins.

  9. Co-operative inhibitory effects of hydrogen peroxide and iodine against bacterial and yeast species

    PubMed Central

    2013-01-01

    Background Hydrogen peroxide and iodine are powerful antimicrobials widely used as antiseptics and disinfectants. Their antimicrobial properties are known to be enhanced by combining them with other compounds. We studied co-operative inhibitory activities (synergism, additive effects and modes of growth inhibition) of hydrogen peroxide and iodine used concurrently against 3 bacterial and 16 yeast species. Results Synergistic or additive inhibitory effects were shown for hydrogen peroxide and iodine mixtures against all 19 species used in the study. Both biocides were mostly cidal individually and in mixtures against Pseudomonas aeruginosa and Staphylococcus aureus. Both compounds manifested static inhibitory effects individually, but their mixtures were synergistically cidal for Saccharomyces cerevisiae and Escherihia coli. Cells of S. cerevisiae treated with hydrogen peroxide and iodine-hydrogen peroxide mixture produced increased numbers of respiratory deficient mutants indicating genotoxic effects. Conclusion Iodine and hydrogen peroxide used concurrently interact synergistically or additively against a range of prokaryotic and eukaryotic microorganisms. The study provides an insight as to how these traditional antimicrobials could be used more effectively for disinfection and antisepsis. In addition, a simple approach is proposed for scoring genotoxicity of different biocides by using the budding yeast system. PMID:23856115

  10. Synthesis of a novel acrylated abietic acid-g-bacterial cellulose hydrogel by gamma irradiation.

    PubMed

    Abeer, Muhammad Mustafa; Amin, Mohd Cairul Iqbal Mohd; Lazim, Azwan Mat; Pandey, Manisha; Martin, Claire

    2014-09-22

    Acrylated abietic acid (acrylated AbA) and acrylated abietic acid-grafted bacterial cellulose pH sensitive hydrogel (acrylated AbA-g-BC) were prepared by a one-pot synthesis. The successful dimerization of acrylic acid (AA) and abietic acid (AbA) and grafting of the dimer onto bacterial cellulose (BC) was confirmed by 13C solid state NMR as well as FT-IR. X-ray diffraction analysis showed characteristic peaks for AbA and BC; further, there was no effect of increasing amorphous AA content on the overall crystallinity of the hydrogel. Differential scanning calorimetry revealed a glass transition temperature of 80°C. Gel fraction and swelling studies gave insight into the features of the hydrogel, suggesting that it was suitable for future applications such as drug delivery. Scanning electron microscopy observations showed an interesting interpenetrating network within the walls of hydrogel samples with the lowest levels of AA and gamma radiation doses. Cell viability test revealed that the synthesized hydrogel is safe for future use in biomedical applications.

  11. [Fatty acids in different edible fish species from Mexico].

    PubMed

    Castro González, María Isabel; Rodríguez, Ana Gabriela Maafs; Galindo Gómez, Carlos

    2013-12-01

    Different biotic and abiotic factors determine the fatty acid (FA) composition of fish tissues and organs. This information is useful for humans due to the fact that fish consumption is associated with health benefits. The aim of the present study was to identify the variation in the concentration of fatty acids, according to different factors, among ten edible marine fish species in Mexico, collected from June to December 2009 in the largest fish market in Mexico City: Euthynnus alletteratus, Sciaenops ocellatus, Bairdiella chrysoura, Sphyraena guachancho, Symphurus elongatus, Istiophorus platypterus, Ophichthus rex, Eugerres plumieri, Eucinostomus entomelas and Oreochromrnis mossambicus. Lipid content was gravimetrically quantified, the fatty acids were determined using a gas chromatograph and the results were statistically analyzed. Total lipid content ranged from 0.93 to 1.95 g/100 g in E. entomelas and O. urolepis hornorum, respectively. E. alletteratus, B. chrysoura, S. elongatus, I. platypterus, O. rex and E. plumieri presented the following order in FA concentration: Polyunsaturated FA (PUFA)>Saturated FA (SFA)>Monounsaturated FA (MUFA). S. ocellatus, S. guachancho and E. entomelas presented SFA>PUFA>MUFA; and only O. mossambicus presented SFA>MUFA>PUFA. O. mossambicus had the highest concentration (mg/100 g) of SFA (559.40) and MUFA (442.60), while B. chrysoura presented the highest content (mg/100 g) of PUFA (663.03), n-3 PUFA (514.03), EPA+DHA (506.10) and n-6 PUFA (145.80). Biotic and abiotic factors of the analyzed fish significantly influenced their FA concentration. Subtropical species presented 42.1% more EPA+DHA than tropical specie. Values presented here will vary according to the changes in the ecosystem and characteristics of each fish species, however the information generated in the present study is useful for improving fish consumption recommendations. PMID:24432548

  12. Pseudomonas granadensis sp. nov., a new bacterial species isolated from the Tejeda, Almijara and Alhama Natural Park, Granada, Spain.

    PubMed

    Pascual, Javier; García-López, Marina; Bills, Gerald F; Genilloud, Olga

    2015-02-01

    During the course of screening bacterial isolates as sources of as-yet unknown bioactive compounds with pharmaceutical applications, a chemo-organotrophic, Gram-negative bacterium was isolated from a soil sample taken from the Tejeda, Almijara and Alhama Natural Park, Granada, Spain. Strain F-278,770(T) was oxidase- and catalase-positive, aerobic, with a respiratory type of metabolism with oxygen as the terminal electron acceptor, non-spore-forming and motile by one polar flagellum, although some cells had two polar flagella. Phylogenetic analysis of the 16S rRNA, gyrB, rpoB and rpoD genes revealed that strain F-278,770(T) belongs to the Pseudomonas koreensis subgroup (Pseudomonas fluorescens lineage), with Pseudomonas moraviensis, P. koreensis, P. baetica and P. helmanticensis as its closest relatives. Chemotaxonomic traits such as polar lipid and fatty acid compositions and G+C content of genomic DNA corroborated the placement of strain F-278,770(T) in the genus Pseudomonas. DNA-DNA hybridization assays and phenotypic traits confirmed that this strain represents a novel species of the genus Pseudomonas, for which the name Pseudomonas granadensis sp. nov. is proposed. The type strain is F-278,770(T) ( = DSM 28040(T) = LMG 27940(T)).

  13. Hyperoxaluria leads to dysbiosis and drives selective enrichment of oxalate metabolizing bacterial species in recurrent kidney stone endures

    PubMed Central

    Suryavanshi, Mangesh V.; Bhute, Shrikant S.; Jadhav, Swapnil D.; Bhatia, Manish S.; Gune, Rahul P.; Shouche, Yogesh S.

    2016-01-01

    Hyperoxaluria due to endogenously synthesized and exogenously ingested oxalates is a leading cause of recurrent oxalate stone formations. Even though, humans largely rely on gut microbiota for oxalate homeostasis, hyperoxaluria associated gut microbiota features remain largely unknown. Based on 16S rRNA gene amplicons, targeted metagenomic sequencing of formyl-CoA transferase (frc) gene and qPCR assay, we demonstrate a selective enrichment of Oxalate Metabolizing Bacterial Species (OMBS) in hyperoxaluria condition. Interestingly, higher than usual concentration of oxalate was found inhibitory to many gut microbes, including Oxalobacter formigenes, a well-characterized OMBS. In addition a concomitant enrichment of acid tolerant pathobionts in recurrent stone sufferers is observed. Further, specific enzymes participating in oxalate metabolism are found augmented in stone endures. Additionally, hyperoxaluria driven dysbiosis was found to be associated with oxalate content, stone episodes and colonization pattern of Oxalobacter formigenes. Thus, we rationalize the first in-depth surveillance of OMBS in the human gut and their association with hyperoxaluria. Our findings can be utilized in the treatment of hyperoxaluria associated recurrent stone episodes. PMID:27708409

  14. Fusarium species from nepalese rice and production of mycotoxins and gibberellic acid by selected species.

    PubMed

    Desjardins, A E; Manandhar, H K; Plattner, R D; Manandhar, G G; Poling, S M; Maragos, C M

    2000-03-01

    Infection of cereal grains with Fusarium species can cause contamination with mycotoxins that affect human and animal health. To determine the potential for mycotoxin contamination, we isolated Fusarium species from samples of rice seeds that were collected in 1997 on farms in the foothills of the Nepal Himalaya. The predominant Fusarium species in surface-disinfested seeds with husks were species of the Gibberella fujikuroi complex, including G. fujikuroi mating population A (anamorph, Fusarium verticillioides), G. fujikuroi mating population C (anamorph, Fusarium fujikuroi), and G. fujikuroi mating population D (anamorph, Fusarium proliferatum). The widespread occurrence of mating population D suggests that its role in the complex symptoms of bakanae disease of rice may be significant. Other common species were Gibberella zeae (anamorph, Fusarium graminearum) and Fusarium semitectum, with Fusarium acuminatum, Fusarium anguioides, Fusarium avenaceum, Fusarium chlamydosporum, Fusarium equiseti, and Fusarium oxysporum occasionally present. Strains of mating population C produced beauvericin, moniliformin, and gibberellic acid, but little or no fumonisin, whereas strains of mating population D produced beauvericin, fumonisin, and, usually, moniliformin, but no gibberellic acid. Some strains of G. zeae produced the 8-ketotrichothecene nivalenol, whereas others produced deoxynivalenol. Despite the occurrence of fumonisin-producing strains of mating population D, and of 8-ketotrichothecene-producing strains of G. zeae, Nepalese rice showed no detectable contamination with these mycotoxins. Effective traditional practices for grain drying and storage may prevent contamination of Nepalese rice with Fusarium mycotoxins.

  15. Lactic Acid Bacterial Starter Culture with Antioxidant and γ-Aminobutyric Acid Biosynthetic Activities Isolated from Flatfish-Sikhae Fermentation.

    PubMed

    Won, Yeong Geol; Yu, Hyun-Hee; Chang, Young-Hyo; Hwang, Han-Joon

    2015-12-01

    The aim of this study is to select a lactic acid bacterial strain as a starter culture for flatfish-Sikhae fermentation and to evaluate its suitability for application in a food system. Four strains of lactic acid bacteria isolated from commercial flatfish-Sikhae were identified and selected as starter culture candidates through investigation of growth rates, salt tolerance, food safety, and functional properties such as antioxidative and antimicrobial activities. The fermentation properties of the starter candidates were also examined in food systems prepared with these strains (candidate batch) in comparison with a spontaneous fermentation process without starter culture (control batch) at 15°C. The results showed that the candidate YG331 batch had better fermentation properties such as viable cell count, pH, and acidity than the other experimental batches, including the control batch. The results are expressed according to selection criteria based on a preliminary sensory evaluation and physiochemical investigation. Also, only a small amount of histamine was detected with the candidate YG331 batch. The radical scavenging activity of the candidate batches was better compared with the control batch, and especially candidate YG331 batch showed the best radical scavenging activity. Also, we isolated another starter candidate (identified as Lactobacillus brevis PM03) with γ-aminobutyric acid (GABA)-producing activity from commercial flatfish-Sikhae products. The sensory scores of the candidate YG331 batch were better than those of the other experimental batches in terms of flavor, color, and overall acceptance. In this study, we established selection criteria for the lactic acid bacterial starter for the flatfish-Sikhae production and finally selected candidate YG331 as the most suitable starter.

  16. The propionic acids. Gastrointestinal toxicity in various species.

    PubMed

    Elliott, G A; Purmalis, A; VanderMeer, D A; Denlinger, R H

    1988-01-01

    The propionic acids represent the largest chemical class of nonsteroidal anti-inflammatory agents (NSAID). Several of them are widely used, both in the United States and internationally. This paper discusses observations made on fenoprofen, flurbiprofen, ibuprofen and naproxen. Of these compounds, three are racemates; the fourth, naproxen, is an enantiomer. As a group, the propionic acids, along with most members of the other classes of NSAID, produce gastrointestinal damage in most species. These lesions vary from erythema, hemorrhage and erosion to ulceration and peritonitis. As might be expected, the degree of gastrointestinal intolerance depends on many factors: the individual compound, the dose-level, the duration of the period of drug administration, and the pharmacokinetics and metabolism in a given species. For example, in our experience the rat is less tolerant of NSAID than is the monkey, and the dog is less tolerant than the rat. Gastrointestinal lesions have been seen following both parenteral and oral administration; these findings suggest that factors other than local irritation play a role in the development of lesions. Most NSAID inhibit prostaglandin cyclo-oxygenase activity, which results in a prostaglandin deficiency at the tissue level. The administration of relevant exogenous prostaglandins, such as 16,16-dimethyl PGE2, has been shown to inhibit the gastrointestinal toxicity accompanying the administration of several NSAID, including some of the propionic acids.

  17. Diversity and Localization of Bacterial Endosymbionts from Whitefly Species Collected in Brazil

    PubMed Central

    Marubayashi, Julio Massaharu; Kliot, Adi; Yuki, Valdir Atsushi; Rezende, Jorge Alberto Marques; Krause-Sakate, Renate; Pavan, Marcelo Agenor; Ghanim, Murad

    2014-01-01

    Whiteflies (Hemiptera: Aleyrodidae) are sap-sucking insect pests, and some cause serious damage in agricultural crops by direct feeding and by transmitting plant viruses. Whiteflies maintain close associations with bacterial endosymbionts that can significantly influence their biology. All whitefly species harbor a primary endosymbiont, and a diverse array of secondary endosymbionts. In this study, we surveyed 34 whitefly populations collected from the states of Sao Paulo, Bahia, Minas Gerais and Parana in Brazil, for species identification and for infection with secondary endosymbionts. Sequencing the mitochondrial Cytochrome Oxidase I gene revealed the existence of five whitefly species: The sweetpotato whitefly Bemisia tabaci B biotype (recently termed Middle East-Asia Minor 1 or MEAM1), the greenhouse whitefly Trialeurodes vaporariorum, B. tabaci A biotype (recently termed New World 2 or NW2) collected only from Euphorbia, the Acacia whitefly Tetraleurodes acaciae and Bemisia tuberculata both were detected only on cassava. Sequencing rRNA genes showed that Hamiltonella and Rickettsia were highly prevalent in all MEAM1 populations, while Cardinium was close to fixation in only three populations. Surprisingly, some MEAM1 individuals and one NW2 population were infected with Fritschea. Arsenopnohus was the only endosymbiont detected in T. vaporariorum. In T. acaciae and B. tuberculata populations collected from cassava, Wolbachia was fixed in B. tuberculata and was highly prevalent in T. acaciae. Interestingly, while B. tuberculata was additionally infected with Arsenophonus, T. acaciae was infected with Cardinium and Fritschea. Fluorescence in situ hybridization analysis on representative individuals showed that Hamiltonella, Arsenopnohus and Fritschea were localized inside the bacteriome, Cardinium and Wolbachia exhibited dual localization patterns inside and outside the bacteriome, and Rickettsia showed strict localization outside the bacteriome. This study is

  18. Diversity and localization of bacterial endosymbionts from whitefly species collected in Brazil.

    PubMed

    Marubayashi, Julio Massaharu; Kliot, Adi; Yuki, Valdir Atsushi; Rezende, Jorge Alberto Marques; Krause-Sakate, Renate; Pavan, Marcelo Agenor; Ghanim, Murad

    2014-01-01

    Whiteflies (Hemiptera: Aleyrodidae) are sap-sucking insect pests, and some cause serious damage in agricultural crops by direct feeding and by transmitting plant viruses. Whiteflies maintain close associations with bacterial endosymbionts that can significantly influence their biology. All whitefly species harbor a primary endosymbiont, and a diverse array of secondary endosymbionts. In this study, we surveyed 34 whitefly populations collected from the states of Sao Paulo, Bahia, Minas Gerais and Parana in Brazil, for species identification and for infection with secondary endosymbionts. Sequencing the mitochondrial Cytochrome Oxidase I gene revealed the existence of five whitefly species: The sweetpotato whitefly Bemisia tabaci B biotype (recently termed Middle East-Asia Minor 1 or MEAM1), the greenhouse whitefly Trialeurodes vaporariorum, B. tabaci A biotype (recently termed New World 2 or NW2) collected only from Euphorbia, the Acacia whitefly Tetraleurodes acaciae and Bemisia tuberculata both were detected only on cassava. Sequencing rRNA genes showed that Hamiltonella and Rickettsia were highly prevalent in all MEAM1 populations, while Cardinium was close to fixation in only three populations. Surprisingly, some MEAM1 individuals and one NW2 population were infected with Fritschea. Arsenopnohus was the only endosymbiont detected in T. vaporariorum. In T. acaciae and B. tuberculata populations collected from cassava, Wolbachia was fixed in B. tuberculata and was highly prevalent in T. acaciae. Interestingly, while B. tuberculata was additionally infected with Arsenophonus, T. acaciae was infected with Cardinium and Fritschea. Fluorescence in situ hybridization analysis on representative individuals showed that Hamiltonella, Arsenopnohus and Fritschea were localized inside the bacteriome, Cardinium and Wolbachia exhibited dual localization patterns inside and outside the bacteriome, and Rickettsia showed strict localization outside the bacteriome. This study is

  19. Trophic complexity in aqueous systems: bacterial species richness and protistan predation regulate dissolved organic carbon and dissolved total nitrogen removal.

    PubMed

    Saleem, Muhammad; Fetzer, Ingo; Harms, Hauke; Chatzinotas, Antonis

    2016-02-24

    Loading of water bodies with dissolved organic carbon (DOC) and dissolved total nitrogen (DTN) affects their integrity and functioning. Microbial interactions mitigate the negative effects of high nutrient loads in these ecosystems. Despite numerous studies on how biodiversity mediates ecosystem functions, whether and how diversity and complexity of microbial food webs (horizontal, vertical) and the underlying ecological mechanisms influence nutrient removal has barely been investigated. Using microbial microcosms accommodating systematic combinations of prey (bacteria) and predator (protists) species, we showed that increasing bacterial richness improved the extent and reliability of DOC and DTN removal. Bacterial diversity drove nutrient removal either due to species foraging physiology or functional redundancy, whereas protistan diversity affected nutrient removal through bacterial prey resource partitioning and changing nutrient balance in the system. Our results demonstrate that prey-predator diversity and trophic interactions interactively determine nutrient contents, thus implying the vital role of microbial trophic complexity as a biological buffer against DOC and DTN.

  20. Trophic complexity in aqueous systems: bacterial species richness and protistan predation regulate dissolved organic carbon and dissolved total nitrogen removal.

    PubMed

    Saleem, Muhammad; Fetzer, Ingo; Harms, Hauke; Chatzinotas, Antonis

    2016-02-24

    Loading of water bodies with dissolved organic carbon (DOC) and dissolved total nitrogen (DTN) affects their integrity and functioning. Microbial interactions mitigate the negative effects of high nutrient loads in these ecosystems. Despite numerous studies on how biodiversity mediates ecosystem functions, whether and how diversity and complexity of microbial food webs (horizontal, vertical) and the underlying ecological mechanisms influence nutrient removal has barely been investigated. Using microbial microcosms accommodating systematic combinations of prey (bacteria) and predator (protists) species, we showed that increasing bacterial richness improved the extent and reliability of DOC and DTN removal. Bacterial diversity drove nutrient removal either due to species foraging physiology or functional redundancy, whereas protistan diversity affected nutrient removal through bacterial prey resource partitioning and changing nutrient balance in the system. Our results demonstrate that prey-predator diversity and trophic interactions interactively determine nutrient contents, thus implying the vital role of microbial trophic complexity as a biological buffer against DOC and DTN. PMID:26888033

  1. Phenotypic and genotypic characterization of lactic acid bacteria isolated from raw goat milk and effect of farming practices on the dominant species of lactic acid bacteria.

    PubMed

    Tormo, Hélène; Ali Haimoud Lekhal, Djamila; Roques, C

    2015-10-01

    Lactic acid bacteria, in particular Lactococcus lactis, play a decisive role in the cheese making process and more particularly in lactic cheeses which are primarily produced on goat dairy farms. The objective of this study was therefore to identify the main lactic acid bacteria found in raw goats' milk from three different regions in France and evaluate if certain farming practices have an effect on the distribution of species of lactic acid bacteria in the various milk samples. Identification at genus or species level was carried out using phenotypic tests and genotypic methods including repetitive element REP-PCR, species-specific PCR and 16S rRNA gene sequencing. The distribution of the main bacterial species in the milk samples varied depending on farms and their characteristics. Out of the 146 strains identified, L. lactis was the dominant species (60% of strains), followed by Enterococcus (38%) of which Enterococcus faecalis and Enterococcus faecium. Within the species L. lactis, L. lactis subsp lactis was detected more frequently than L. lactis subsp cremoris (74% vs. 26%). The predominance of L. lactis subsp cremoris was linked to geographical area studied. It appears that the animals' environment plays a role in the balance between the dominance of L. lactis and enterococci in raw goats' milk. The separation between the milking parlor and the goat shed (vs no separation) and only straw in the bedding (vs straw and hay) seems to promote L. lactis in the milk (vs enterococci).

  2. Biodegradation of PAHs by two bacterial species isolated from coal gasification sites

    SciTech Connect

    Schneider, J.; Grosser, R.J.; Jayasimhulu, K.; Warshawsky, D.

    1994-12-31

    Utilization of microbial processes for bioremediation requires measuring compound degradability as well as characterization of the intermediates formed. A Mycobacterium sp. and Xanthamonas sp. were isolated from coal gasification site soils using standard enrichment techniques. The Mycobacterium sp. was isolated for its ability to mineralize pyrene, but was also found to be capable of degrading other polycyclic aromatic compounds. The Xanthamonas sp. was isolated for its ability to mineralize carbazole and showed very high substrate specificity. The Xanthamonas sp. was incubated with carbazole as the sole added carbon source for approximately two weeks. Analysis of organic extracts show the presence of at least three cleavage products of carbazole. Two of these have been tentatively identified as 2-indole-acetic acid and 2-indole-acrylic acid. A pathway for carbazole degradation by this species is proposed in which the indole moiety is maintained. Analysis of metabolites formed during pyrene degradation were found to include 4,5-pyrene-dihydrodiol, 4-phenanthroic acid, and 4,5-diphenanthroic acid. This Mycobacterium sp. was also found to biodegrade benz(a)anthracene- and benzo(a)pyrene-producing ring cleavage products. For benz(a)anthracene, analysis of organic extracts of the growth medium show at least two dihydrodiol intermediates formed as well as a ring cleavage product. A dihydrodiol intermediate and three ring cleavage products were also found with benzo(a)pyrene. Fluorescence spectra of the benzo(a)pyrene dihydrodiol intermediate was characteristic of that for benz(a)anthracene.

  3. Ruthenium recovery from acetic acid waste water through sorption with bacterial biosorbent fibers.

    PubMed

    Kwak, In Seob; Won, Sung Wook; Chung, Yong Sik; Yun, Yeoung-Sang

    2013-01-01

    A fibrous bacterial biosorbent was developed to bind precious metal-organic complexes in batch and column processes. Polyethylenimine (PEI)-modified bacterial biosorbent fiber (PBBF) was prepared by spinning Corynebacterium glutamicum biomass-chitosan blends, coating them with PEI and cross-linking with glutaraldehyde. When an acetic acid waste solution containing 1822.9mg/L Ru was used as a model waste solution, Ru uptake by the PBBF was 16.5 times higher than that of the commercial ion exchange resin, Lewatit MonoPlus M600. The maximum amounts of Ru uptake were 110.5, 16.0 and 6.7mg/g for PBBF, raw biomass, and Lewatit MonoPlus M600, respectively. In a flow-through packed bed, PBBF exhibited the breakthrough time of 42.32h. Therefore, PBBF can be considered as an alternative sorbent for recovery of anionic metal-organic complexes from waste solutions.

  4. Wild plant species growing closely connected in a subalpine meadow host distinct root-associated bacterial communities

    PubMed Central

    Aleklett, Kristin; Leff, Jonathan W.; Fierer, Noah

    2015-01-01

    Plant roots are known to harbor large and diverse communities of bacteria. It has been suggested that plant identity can structure these root-associated communities, but few studies have specifically assessed how the composition of root microbiota varies within and between plant species growing under natural conditions. We assessed the community composition of endophytic and epiphytic bacteria through high throughput sequencing using 16S rDNA derived from root tissues collected from a population of a wild, clonal plant (Orange hawkweed–Pilosella aurantiaca) as well as two neighboring plant species (Oxeye daisy–Leucanthemum vulgare and Alsike clover–Trifolium hybridum). Our first goal was to determine if plant species growing in close proximity, under similar environmental conditions, still hosted unique root microbiota. Our results showed that plants of different species host distinct bacterial communities in their roots. In terms of community composition, Betaproteobacteria (especially the family Oxalobacteraceae) were found to dominate in the root microbiota of L. vulgare and T. hybridum samples, whereas the root microbiota of P. aurantiaca had a more heterogeneous distribution of bacterial abundances where Gammaproteobacteria and Acidobacteria occupied a larger portion of the community. We also explored the extent of individual variance within each plant species investigated, and found that in the plant species thought to have the least genetic variance among individuals (P. aurantiaca) still hosted just as diverse microbial communities. Whether all plant species host their own distinct root microbiota and plants more closely related to each other share more similar bacterial communities still remains to be fully explored, but among the plants examined in this experiment there was no trend that the two species belonging to the same family shared more similarities in terms of bacterial community composition. PMID:25755932

  5. Accuracy, reproducibility, and interpretation of fatty acid methyl ester profiles of model bacterial communities

    USGS Publications Warehouse

    Kidd, Haack S.; Garchow, H.; Odelson, D.A.; Forney, L.J.; Klug, M.J.

    1994-01-01

    We determined the accuracy and reproducibility of whole-community fatty acid methyl ester (FAME) analysis with two model bacterial communities differing in composition by using the Microbial ID, Inc. (MIDI), system. The biomass, taxonomic structure, and expected MIDI-FAME profiles under a variety of environmental conditions were known for these model communities a priori. Not all members of each community could be detected in the composite profile because of lack of fatty acid 'signatures' in some isolates or because of variations (approximately fivefold) in fatty acid yield across taxa. MIDI- FAME profiles of replicate subsamples of a given community were similar in terms of fatty acid yield per unit of community dry weight and relative proportions of specific fatty acids. Principal-components analysis (PCA) of MIDI-FAME profiles resulted in a clear separation of the two different communities and a clustering of replicates of each community from two separate experiments on the first PCA axis. The first PCA axis accounted for 57.1% of the variance in the data and was correlated with fatty acids that varied significantly between communities and reflected the underlying community taxonomic structure. On the basis of our data, community fatty acid profiles can be used to assess the relative similarities and differences of microbial communities that differ in taxonomic composition. However, detailed interpretation of community fatty acid profiles in terms of biomass or community taxonomic composition must be viewed with caution until our knowledge of the quantitative and qualitative distribution of fatty acids over a wide variety of taxa and the effects of growth conditions on fatty acid profiles is more extensive.

  6. Oceanobacillus endoradicis sp. nov., an endophytic bacterial species isolated from the root of Paris polyphylla Smith var. yunnanensis.

    PubMed

    Yang, Ling-Ling; Tang, Shu-Kun; Chu, Xiao; Jiang, Zhao; Xu, Li-Hua; Zhi, Xiao-Yang

    2016-07-01

    A bacterial strain, py1294(T), isolated from a root of Paris polyphylla Smith var. yunnanensis collected from Yunnan province, southwest China, was characterised by using a polyphasic approach to clarify its taxonomic position. Strain py1294(T) was found to be Gram-positive, aerobic, spore-forming, peritrichous flagella and rod shaped. Growth was found to occur in the presence of 0-8 % (w/v) NaCl (optimum 1-3 %), at pH 6.5-9.5 (optimum 8.0) and at 10-42 °C (optimum 30 °C). The major cellular fatty acids were identified as anteiso-C15:0, anteiso-C17:0, iso-C16:0 and iso-C14:0. The predominant quinone was identified as MK-7 and a minor amount of MK-6 was detected. The diagnostic polar lipids were diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The cell wall peptidoglycan was found to contain meso-diaminopimelic acid. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain py1294(T) forms a well-supported clade with Oceanobacillus damuensis PT-20(T) (97.9 % sequence similarity) within the genus Oceanobacillus, although it also shares a high sequence similarity with Ornithinibacillus contaminans (97.5 %). Crucially, the DNA-DNA relatedness value between strain py1294(T) and O. damuensis PT-20(T) was 29.7 ± 3.2 %. The G+C content was determined to be 42.3 mol%. On the basis of the phylogenetic and phenotypic data, a novel species Oceanobacillus endoradicis sp. nov. is proposed, with py1294(T) (=DSM 100726(T) = KCTC 33731(T)) as the type strain. PMID:27059624

  7. Host Species and Environmental Effects on Bacterial Communities Associated with Drosophila in the Laboratory and in the Natural Environment

    PubMed Central

    Staubach, Fabian; Baines, John F.; Künzel, Sven; Bik, Elisabeth M.; Petrov, Dmitri A.

    2013-01-01

    The fruit fly Drosophila is a classic model organism to study adaptation as well as the relationship between genetic variation and phenotypes. Although associated bacterial communities might be important for many aspects of Drosophila biology, knowledge about their diversity, composition, and factors shaping them is limited. We used 454-based sequencing of a variable region of the bacterial 16S ribosomal RNA gene to characterize the bacterial communities associated with wild and laboratory Drosophila isolates. In order to specifically investigate effects of food source and host species on bacterial communities, we analyzed samples from wild Drosophila melanogaster and D. simulans collected from a variety of natural substrates, as well as from adults and larvae of nine laboratory-reared Drosophila species. We find no evidence for host species effects in lab-reared flies; instead, lab of origin and stochastic effects, which could influence studies of Drosophila phenotypes, are pronounced. In contrast, the natural Drosophila–associated microbiota appears to be predominantly shaped by food substrate with an additional but smaller effect of host species identity. We identify a core member of this natural microbiota that belongs to the genus Gluconobacter and is common to all wild-caught flies in this study, but absent from the laboratory. This makes it a strong candidate for being part of what could be a natural D. melanogaster and D. simulans core microbiome. Furthermore, we were able to identify candidate pathogens in natural fly isolates. PMID:23967097

  8. Diversity and localization of bacterial symbionts in three whitefly species (Hemiptera: Aleyrodidae) from the east coast of the Adriatic Sea.

    PubMed

    Skaljac, M; Zanić, K; Hrnčić, S; Radonjić, S; Perović, T; Ghanim, M

    2013-02-01

    Several whitefly species (Hemiptera: Aleyrodidae) are cosmopolitan phloem-feeders that cause serious damage in numerous agricultural crops. All whitefly species harbor a primary bacterial symbiont and a diverse array of secondary symbionts which may influence several aspects of the insect's biology. We surveyed infections by secondary symbionts in Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood) and Siphoninus phillyreae (Haliday) from areas in the east cost of the Adriatic Sea. Both the Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) B. tabaci genetic groups were detected in Montenegro, whereas only the MED was confirmed in Croatia. Trialeurodes vaporariorum and S. phillyreae were found in all areas surveyed. MEAM1 and MED exhibited similarity to previously reported infections, while populations of T. vaporariorum from Montenegro harbored Rickettsia, Wolbachia and Cardinium in addition to previously reported Hamiltonella and Arsenopnohus. Siphoninus phillyreae harbored Hamiltonella, Wolbachia, Cardinium and Arsenophonus, with the latter appearing in two alleles. Multiple infections of all symbionts were common in the three insect species tested, with some reaching near fixation. Florescent in situ hybridization showed new localization patterns for Hamiltonella in S. phillyreae, and the morphology of the bacteriosome differed from that observed in other whitefly species. Our results show new infections with bacterial symbionts in the whitefly species studied. Infections with the same symbionts in reproductively isolated whitefly species confirm complex relationships between whiteflies and bacterial symbionts, and suggest possible horizontal transfer of some of these bacteria.

  9. Phosphate addition and plant species alters microbial community structure in acidic upland grassland soil.

    PubMed

    Rooney, Deirdre C; Clipson, Nicholas J W

    2009-01-01

    Agricultural improvement (addition of fertilizers, liming) of seminatural acidic grasslands across Ireland and the UK has resulted in significant shifts in floristic composition, soil chemistry, and microbial community structure. Although several factors have been proposed as responsible for driving shifts in microbial communities, the exact causes of such changes are not well defined. Phosphate was added to grassland microcosms to investigate the effect on fungal and bacterial communities. Plant species typical of unimproved grasslands (Agrostis capillaris, Festuca ovina) and agriculturally improved grasslands (Lolium perenne) were grown, and phosphate was added 25 days after seed germination, with harvesting after a further 50 days. Phosphate addition significantly increased root biomass (p < 0.001) and shoot biomass (p < 0.05), soil pH (by 0.1 U), and microbial activity (by 5.33 mg triphenylformazan [TPF] g(-1) soil; p < 0.001). A slight decrease (by 0.257 mg biomass-C g(-1) soil; p < 0.05) in microbial biomass after phosphate addition was found. The presence of plant species significantly decreased soil pH (p < 0.05; by up to 0.2 U) and increased microbial activity (by up to 6.02 mg TPF g(-1) soil) but had no significant effect on microbial biomass. Microbial communities were profiled using automated ribosomal intergenic spacer analysis. Multidimensional scaling plots and canonical correspondence analysis revealed that phosphate addition and its interactions with upland grassland plant species resulted in considerable changes in the fungal and bacterial communities of upland soil. The fungal community structure was significantly affected by both phosphate (R = 0.948) and plant species (R = 0.857), and the bacterial community structure was also significantly affected by phosphate (R = 0.758) and plant species (R = 0.753). Differences in microbial community structure following P addition were also revealed by similarity percentage analysis. These data suggest

  10. Pyrolytic Methylation-Gas Chromatography of Whole Bacterial Cells for Rapid Profiling of Cellular Fatty Acids

    PubMed Central

    Dworzanski, Jacek P.; Berwald, Luc; Meuzelaar, Henk L. C.

    1990-01-01

    A novel, on-line derivatization technique has been developed which enables generation of fatty acid methyl ester (FAME) profiles from microorganisms by gas chromatography-mass spectrometry without the need for laborious and time-consuming sample preparation. Microgram amounts of bacterial cells are directly applied to a thin ferromagnetic filament and covered with a single drop of methanolic solution of tetramethylammonium hydroxide. After air drying, the filament is inserted into a special gas chromatograph inlet equipped with a high-frequency coil, thus enabling rapid inductive heating of the ferromagnetic filament. This so-called Curie-point heating technique is shown to produce patterns of bacterial FAMEs which are qualitatively and quantitatively nearly identical to those obtained from extracts of methylated lipids prepared by conventional sample pretreatment methods. Relatively minor differences involve the loss of hydroxy-substituted fatty acids by the pyrolytic approach as well as strongly enhanced signals of FAMEs derived from mycolic acids. This type of pyrolysis enables on-line derivatization and thermal extraction of volatile derivatives for analysis, whereas the residual components remain on a disposable probe (ferromagnetic wire) of a pyrolytic device. The reduced sample size (micrograms instead of milligrams) and the lack of sample preparation requirements open up the possibility of rapid microbiological identification of single colonies (thus overcoming the need for time-consuming subculturing) as well as analysis of FAME profiles directly from complex environmental samples. PMID:16348214

  11. Isolation of bacterial cellulose nanocrystalline from pineapple peel waste: Optimization of acid concentration in the hydrolysis method

    NASA Astrophysics Data System (ADS)

    Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik

    2016-02-01

    Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.

  12. Tree phyllosphere bacterial communities: exploring the magnitude of intra- and inter-individual variation among host species

    PubMed Central

    Messier, Christian; Kembel, Steven W.

    2016-01-01

    Background The diversity and composition of the microbial community of tree leaves (the phyllosphere) varies among trees and host species and along spatial, temporal, and environmental gradients. Phyllosphere community variation within the canopy of an individual tree exists but the importance of this variation relative to among-tree and among-species variation is poorly understood. Sampling techniques employed for phyllosphere studies include picking leaves from one canopy location to mixing randomly selected leaves from throughout the canopy. In this context, our goal was to characterize the relative importance of intra-individual variation in phyllosphere communities across multiple species, and compare this variation to inter-individual and interspecific variation of phyllosphere epiphytic bacterial communities in a natural temperate forest in Quebec, Canada. Methods We targeted five dominant temperate forest tree species including angiosperms and gymnosperms: Acer saccharum, Acer rubrum, Betula papyrifera, Abies balsamea and Picea glauca. For one randomly selected tree of each species, we sampled microbial communities at six distinct canopy locations: bottom-canopy (1–2 m height), the four cardinal points of mid-canopy (2–4 m height), and the top-canopy (4–6 m height). We also collected bottom-canopy leaves from five additional trees from each species. Results Based on an analysis of bacterial community structure measured via Illumina sequencing of the bacterial 16S gene, we demonstrate that 65% of the intra-individual variation in leaf bacterial community structure could be attributed to the effect of inter-individual and inter-specific differences while the effect of canopy location was not significant. In comparison, host species identity explains 47% of inter-individual and inter-specific variation in leaf bacterial community structure followed by individual identity (32%) and canopy location (6%). Discussion Our results suggest that individual

  13. Tree phyllosphere bacterial communities: exploring the magnitude of intra- and inter-individual variation among host species

    PubMed Central

    Messier, Christian; Kembel, Steven W.

    2016-01-01

    Background The diversity and composition of the microbial community of tree leaves (the phyllosphere) varies among trees and host species and along spatial, temporal, and environmental gradients. Phyllosphere community variation within the canopy of an individual tree exists but the importance of this variation relative to among-tree and among-species variation is poorly understood. Sampling techniques employed for phyllosphere studies include picking leaves from one canopy location to mixing randomly selected leaves from throughout the canopy. In this context, our goal was to characterize the relative importance of intra-individual variation in phyllosphere communities across multiple species, and compare this variation to inter-individual and interspecific variation of phyllosphere epiphytic bacterial communities in a natural temperate forest in Quebec, Canada. Methods We targeted five dominant temperate forest tree species including angiosperms and gymnosperms: Acer saccharum, Acer rubrum, Betula papyrifera, Abies balsamea and Picea glauca. For one randomly selected tree of each species, we sampled microbial communities at six distinct canopy locations: bottom-canopy (1–2 m height), the four cardinal points of mid-canopy (2–4 m height), and the top-canopy (4–6 m height). We also collected bottom-canopy leaves from five additional trees from each species. Results Based on an analysis of bacterial community structure measured via Illumina sequencing of the bacterial 16S gene, we demonstrate that 65% of the intra-individual variation in leaf bacterial community structure could be attributed to the effect of inter-individual and inter-specific differences while the effect of canopy location was not significant. In comparison, host species identity explains 47% of inter-individual and inter-specific variation in leaf bacterial community structure followed by individual identity (32%) and canopy location (6%). Discussion Our results suggest that individual

  14. Analysis of Vaginal Acetic Acid in Patients Undergoing Treatment for Bacterial Vaginosis

    PubMed Central

    Chaudry, Amjad N.; Travers, Paul J.; Yuenger, Jeffrey; Colletta, Lorraine; Evans, Phillip; Zenilman, Jonathan M.; Tummon, Andrew

    2004-01-01

    A “gold standard” method for the diagnosis of bacterial vaginosis (BV) is lacking. The clinical criteria described by the Amsel technique are subjective and difficult to quantify. Alternatively, the reading of Gram-stained vaginal smears by scoring techniques such as those that use the Nugent or Hay-Ison scoring systems is again subjective, requires expert personnel to perform the reading, and is infrequently used clinically. Recently, a new diagnostic device, the Osmetech Microbial Analyzer—Bacterial Vaginosis (OMA-BV), which determines a patient's BV status on the basis of measurement of the amount of acetic acid present in a vaginal swab specimen, was approved by the Food and Drug Administration. The present study uses the conducting polymer gas-sensing technology of OMA-BV to measure the concentration of acetic acid in the headspace above vaginal swab specimens from patients undergoing treatment for BV with metronidazole. In 97.8% of the cases the level of acetic acid detected fell sharply during the treatment period, crossing from above to below the diagnostic threshold of 900 ppm. The diagnosis obtained on the basis of the level of vaginal acetic acid was compared with the diagnoses obtained by use of the Amsel criteria and the Nugent scoring system both at the time of initial entry into the study and at the repeat samplings on days 7 and 14. The results obtained with OMA-BV showed overall agreements compared with the results of the Amsel and Nugent tests of 98 and 94%, respectively, for the 34 patients monitored through the treatment process. This provides further evidence that the measurement of vaginal acetic acid by headspace analysis with conducting polymer sensors is a valid alternative to present tests for the diagnosis of BV. PMID:15528711

  15. Purification and properties of an organophosphorus acid anhydrase from a halophilic bacterial isolate.

    PubMed Central

    DeFrank, J J; Cheng, T C

    1991-01-01

    A moderately halophilic bacterial isolate has been found to possess high levels of enzymatic activity against several highly toxic organophosphorus compounds. The predominant enzyme, designated organophosphorus acid anhydrase 2, has been purified 1,000-fold to homogeneity and characterized. The enzyme is a single polypeptide with a molecular weight of 60,000. With diisopropylfluorophosphate as a substrate, the enzyme has optimum activity at pH 8.5 and 50 degrees C, and it is stimulated by manganese and cobalt. Images PMID:2001997

  16. Red and infrared laser therapy inhibits in vitro growth of major bacterial species that commonly colonize skin ulcers.

    PubMed

    de Sousa, Natanael Teixeira Alves; Gomes, Rosana Caetano; Santos, Marcos Ferracioli; Brandino, Hugo Evangelista; Martinez, Roberto; de Jesus Guirro, Rinaldo Roberto

    2016-04-01

    Low-level laser therapy (LLLT) is used in chronic wounds due to its healing effects. However, bacterial species may colonize these wounds and the optimal parameters for effective bacterial inhibition are not clear. The aim of this study was to analyze the effect of LLLT on bacterial growth in vitro. Bacterial strains including Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa were suspended in saline solution at a concentration of 10(3) cells/ml and exposed to laser irradiation at wavelengths of 660, 830, and 904 nm at fluences of 0 (control), 3, 6, 12, 18, and 24 J/cm(2). An aliquot of the irradiated suspension was spread on the surface of petri plates and incubated at 37 °C for quantification of colony-forming unit after 24, 48, and 72 h. Laser irradiation inhibited the growth of S. aureus at all wavelengths and fluences higher than 12 J/cm(2), showing a strong correlation between increase in fluence and bacterial inhibition. However, for P. aeruginosa, LLLT inhibited growth at all wavelengths only at a fluence of 24 J/cm(2). E. coli had similar growth inhibition at a wavelength of 830 nm at fluences of 3, 6, 12, and 24 J/cm(2). At wavelengths of 660 and 904 nm, growth inhibition was only observed at fluences of 12 and 18 J/cm(2), respectively. LLLT inhibited bacterial growth at all wavelengths, for a maximum of 72 h after irradiation, indicating a correlation between bacterial species, fluence, and wavelength.

  17. Bacterial Profiling Reveals Novel "Ca. Neoehrlichia", Ehrlichia, and Anaplasma Species in Australian Human-Biting Ticks.

    PubMed

    Gofton, Alexander W; Doggett, Stephen; Ratchford, Andrew; Oskam, Charlotte L; Paparini, Andrea; Ryan, Una; Irwin, Peter

    2015-01-01

    In Australia, a conclusive aetiology of Lyme disease-like illness in human patients remains elusive, despite growing numbers of people presenting with symptoms attributed to tick bites. In the present study, we surveyed the microbial communities harboured by human-biting ticks from across Australia to identify bacteria that may contribute to this syndrome. Universal PCR primers were used to amplify the V1-2 hyper-variable region of bacterial 16S rRNA genes in DNA samples from individual Ixodes holocyclus (n = 279), Amblyomma triguttatum (n = 167), Haemaphysalis bancrofti (n = 7), and H. longicornis (n = 7) ticks. The 16S amplicons were sequenced on the Illumina MiSeq platform and analysed in USEARCH, QIIME, and BLAST to assign genus and species-level taxonomies. Nested PCR and Sanger sequencing were used to confirm the NGS data and further analyse novel findings. All 460 ticks were negative for Borrelia spp. by both NGS and nested PCR analysis. Two novel "Candidatus Neoehrlichia" spp. were identified in 12.9% of I. holocyclus ticks. A novel Anaplasma sp. was identified in 1.8% of A. triguttatum ticks, and a novel Ehrlichia sp. was identified in both A. triguttatum (1.2%) ticks and a single I. holocyclus (0.6%) tick. Further phylogenetic analysis of novel "Ca. Neoehrlichia", Anaplasma and Ehrlichia based on 1,265 bp 16S rRNA gene sequences suggests that these are new species. Determining whether these newly discovered organisms cause disease in humans and animals, like closely related bacteria do abroad, is of public health importance and requires further investigation. PMID:26709826

  18. Prevalence of selected bacterial named species and uncultivated phylotypes in endodontic abscesses from two geographic locations.

    PubMed

    Rôças, Isabela N; Baumgartner, J Craig; Xia, Tian; Siqueira, José F

    2006-12-01

    Evidence is mounting that the prevalence of some putative endodontic pathogens can significantly vary according to the geographic location in which samples were taken. This study aimed to provide additional knowledge on this subject by comparing the frequencies of 10 selected candidate endodontic pathogens in samples of acute apical abscesses obtained from two distinct geographic locations; Portland, OR, and Rio de Janeiro, Brazil. DNA was extracted from aspirates and used as template in nested PCR assays using 16S rRNA gene taxon-specific oligonucleotide primers. Of the target species/phylotypes, Treponema denticola (73% of the cases), Porphyromonas endodontalis (70%), and Tannerella forsythia (57%) were the most prevalent taxa found in Brazilian samples. Dialister invisus (70% of the cases), P. endodontalis (63%) and Dialister pneumosintes (55%) were the most frequent taxa in the Portland, OR samples. Data analysis revealed that T. denticola and T. forsythia were significantly more detected in Brazilian samples than in the Portland, OR samples. Although D. invisus, Filifactor alocis, and Synergistes oral clone W090 were detected in many more samples from the Portland, OR patients, differences were not found to be statistically significant. These findings confirmed that some bacterial taxa can markedly differ in the frequencies they occur in samples from different locations. It remains to be clarified whether this observation translates into relevant therapeutic implications.

  19. Influence of fluoride on the bacterial composition of a dual-species biofilm composed of Streptococcus mutans and Streptococcus oralis.

    PubMed

    Jung, Ji-Eun; Cai, Jian-Na; Cho, Sung-Dae; Song, Kwang-Yeob; Jeon, Jae-Gyu

    2016-10-01

    Despite the widespread use of fluoride for the prevention of dental caries, few studies have demonstrated the effects of fluoride on the bacterial composition of dental biofilms. This study investigated whether fluoride affects the proportion of Streptococcus mutans and S. oralis in mono- and dual-species biofilm models, via microbiological, biochemical, and confocal fluorescence microscope studies. Fluoride did not affect the bacterial count and bio-volume of S. mutans and S. oralis in mono-species biofilms, except for the 24-h-old S. mutans biofilms. However, fluoride reduced the proportion and bio-volume of S. mutans but did not decrease those of S. oralis during both S. oralis and S. mutans dual-species biofilm formation, which may be related to the decrease in extracellular polysaccharide formation by fluoride. These results suggest that fluoride may prevent the shift in the microbial proportion to cariogenic bacteria in dental biofilms, subsequently inhibiting the cariogenic bacteria dominant biofilm formation. PMID:27643392

  20. 2-hydroxyisocaproic acid is fungicidal for Candida and Aspergillus species.

    PubMed

    Sakko, M; Moore, C; Novak-Frazer, L; Rautemaa, V; Sorsa, T; Hietala, P; Järvinen, A; Bowyer, P; Tjäderhane, L; Rautemaa, R

    2014-04-01

    The amino acid derivative 2-hydroxyisocaproic acid (HICA) is a nutritional additive used to increase muscle mass. Low levels can be detected in human plasma as a result of leucine metabolism. It has broad antibacterial activity but its efficacy against pathogenic fungi is not known. The aim was to test the efficacy of HICA against Candida and Aspergillus species. Efficacy of HICA against 19 clinical and reference isolates representing five Candida and three Aspergillus species with variable azole antifungal sensitivity profiles was tested using a microdilution method. The concentrations were 18, 36 and 72 mg ml(-1) . Growth was determined spectrophotometrically for Candida isolates and by visual inspection for Aspergillus isolates, viability was tested by culture and impact on morphology by microscopy. HICA of 72 mg ml(-1) was fungicidal against all Candida and Aspergillus fumigatus and Aspergillus terreus isolates. Lower concentrations were fungistatic. Aspergillus flavus was not inhibited by HICA. HICA inhibited hyphal formation in susceptible Candida albicans and A. fumigatus isolates and affected cell wall integrity. In conclusion, HICA has broad antifungal activity against Candida and Aspergillus at concentrations relevant for topical therapy. As a fungicidal agent with broad-spectrum bactericidal activity, it may be useful in the topical treatment of multispecies superficial infections.

  1. Composition of the Cutaneous Bacterial Community in Japanese Amphibians: Effects of Captivity, Host Species, and Body Region.

    PubMed

    Sabino-Pinto, Joana; Bletz, Molly Catherine; Islam, Mohammed Mafizul; Shimizu, Norio; Bhuju, Sabin; Geffers, Robert; Jarek, Michael; Kurabayashi, Atsushi; Vences, Miguel

    2016-08-01

    The cutaneous microbiota plays a significant role in the biology of their vertebrate hosts, and its composition is known to be influenced both by host and environment, with captive conditions often altering alpha diversity. Here, we compare the cutaneous bacterial communities of 61 amphibians (both wild and captive) from Hiroshima, Japan, using high-throughput amplicon sequencing of a segment of the 16S rRNA gene. The majority of these samples came from a captive breeding facility at Hiroshima University where specimens from six species are maintained under highly standardized conditions for several generations. This allowed to identify host effects on the bacterial communities under near identical environmental conditions in captivity. We found the structure of the cutaneous bacterial community significantly differing between wild and captive individuals of newts, Cynops pyrrhogaster, with a higher alpha diversity found in the wild individuals. Community structure also showed distinct patterns when comparing different species of amphibians kept under highly similar conditions, revealing an intrinsic host effect. Bacterial communities of dorsal vs. ventral skin surfaces did not significantly differ in most species, but a trend of higher alpha diversity on the ventral surface was found in Oriental fire-bellied toads, Bombina orientalis. This study confirms the cutaneous microbiota of amphibians as a highly dynamic system influenced by a complex interplay of numerous factors.

  2. Composition of the Cutaneous Bacterial Community in Japanese Amphibians: Effects of Captivity, Host Species, and Body Region.

    PubMed

    Sabino-Pinto, Joana; Bletz, Molly Catherine; Islam, Mohammed Mafizul; Shimizu, Norio; Bhuju, Sabin; Geffers, Robert; Jarek, Michael; Kurabayashi, Atsushi; Vences, Miguel

    2016-08-01

    The cutaneous microbiota plays a significant role in the biology of their vertebrate hosts, and its composition is known to be influenced both by host and environment, with captive conditions often altering alpha diversity. Here, we compare the cutaneous bacterial communities of 61 amphibians (both wild and captive) from Hiroshima, Japan, using high-throughput amplicon sequencing of a segment of the 16S rRNA gene. The majority of these samples came from a captive breeding facility at Hiroshima University where specimens from six species are maintained under highly standardized conditions for several generations. This allowed to identify host effects on the bacterial communities under near identical environmental conditions in captivity. We found the structure of the cutaneous bacterial community significantly differing between wild and captive individuals of newts, Cynops pyrrhogaster, with a higher alpha diversity found in the wild individuals. Community structure also showed distinct patterns when comparing different species of amphibians kept under highly similar conditions, revealing an intrinsic host effect. Bacterial communities of dorsal vs. ventral skin surfaces did not significantly differ in most species, but a trend of higher alpha diversity on the ventral surface was found in Oriental fire-bellied toads, Bombina orientalis. This study confirms the cutaneous microbiota of amphibians as a highly dynamic system influenced by a complex interplay of numerous factors. PMID:27278778

  3. A COMPARATIVE ANALYSIS OF THREE CLASSES OF BACTERIAL NON-SPECIFIC ACID PHOSPHATASES AND ARCHAEAL PHOSPHOESTERASES: EVOLUTIONARY PERSPECTIVE

    PubMed Central

    U. Gandhi, Neha; B. Chandra, Sathees

    2012-01-01

    Introduction: Bacterial nonspecific acid phosphohydrolases (NSAPs) or phosphatases are group of enzymes secreted as soluble periplasmic proteins or retained as membrane bound lipoproteins that are usually able to dephosphorylate a broad array of structurally unrelated organic phosphoesters (nucleotides, sugar phosphates, phytic acid etc.) to acquire inorganic phosphate (Pi) and organic byproducts. They exhibit optimal catalytic activity at acidic to neutral pH values. On the basis of amino acid sequence relatedness, phosphatase are grouped into different molecular families namely Class A, Class B and Class C acid phosphatase respectively. Results and discussion: In this article out of thirty three sequences, twenty six belonging to each of the three classes of bacterial acid phosphatase and seven belonging to archaeal phosphoesterases were analyzed using various tools of bioinformatics. Phylogenetic analysis, dot plot comparisons and motif analysis were done to identify a number of similarities and differences between three classes of bacterial acid phosphatases and archaeal phosphoesterases. In this research we have attempted to decipher evolutionary relationship between three classes of bacterial acid phosphatase and archaeal phosphoesterases using bioinformatics approach. PMID:23322973

  4. Endospore abundance and D:L-amino acid modeling of bacterial turnover in holocene marine sediment (Aarhus Bay)

    NASA Astrophysics Data System (ADS)

    Langerhuus, Alice T.; Røy, Hans; Lever, Mark A.; Morono, Yuki; Inagaki, Fumio; Jørgensen, Bo B.; Lomstein, Bente Aa.

    2012-12-01

    In order to study bacterial activity, and turnover times of bacterial necromass and biomass in marine sediment, two stations from the Aarhus Bay, Denmark were analyzed. Sediment cores were up to 11 m deep and covered a timescale from the present to ˜11,000 years ago. Sediment was analyzed for total hydrolysable amino acids (THAA), total hydrolysable amino sugars, the bacterial endospore marker dipicolinic acid (DPA), and amino acid enantiomers (L- and D-form) of aspartic acid. Turnover times of bacterial necromass and vegetative cells, as well as carbon oxidation rates were estimated by use of the D:L-amino acid racemization model. Diagenetic indicators were applied to evaluate the diagenetic state of the sedimentary organic matter. The contribution of amino acids to total organic carbon, and the ratio between the amino acids aspartic acid and glutamic acid, and their respective non protein degradation products, β-alanine and γ-amino butyric acid, all indicated increasing degradation state of the organic matter with sediment depth and age. Quantification of DPA showed that endospores were abundant, and increased with depth relative to vegetative cells. Most of the amino acids (97%) could be ascribed to microbial necromass, i.e. the remains of dead bacterial cells. Model estimates showed that the turnover times of microbial necromass were in the range of 0.5-1 × 105 years, while turnover times of vegetative cells were in the range of tens to hundreds of years. The turnover time of the TOC pool increased with depth in the sediment, indicating that the TOC pool became progressively more refractory and unavailable to microorganisms with depth and age of the organic matter.

  5. Biodegradable water absorbent synthesized from bacterial poly(amino acid)s.

    PubMed

    Kunioka, Masao

    2004-03-15

    Biodegradable hydrogels prepared by gamma-irradiation from microbial poly(amino acid)s have been studied. pH-Sensitive hydrogels were prepared by the gamma-irradiation of poly(gamma-glutamic acid) (PGA) produced by Bacillus subtilis and poly(epsilon-lysine) (PL) produced by Streptomyces albulus in aqueous solutions. When the gamma-irradiation dose was 19 kGy or more, and the concentration of PGA in water was 2 wt.-% or more, transparent hydrogels could be produced. For the 19 kGy dose, the produced hydrogel was very weak, however, the specific water content (wt. of absorbed water/wt. of dry hydrogel) of this PGA hydrogel was approximately 3,500. The specific water content decreased to 200, increasing when the gamma-irradiation dose was over 100 kGy. Under acid conditions or upon the addition of electrolytes, the PGA hydrogels shrunk. The PGA hydrogel was pH-sensitive and the change in the volume of the hydrogel depended on the pH value outside the hydrogel in the swelling medium. This PGA hydrogel was hydrodegradable and biodegradable. A new novel purifier reagent (coagulant), made from the PGA hydrogels, for contaminated turbid water has been found and developed by Japanese companies. A very small amount of this coagulant (only 2 ppm in turbid water) with poly(aluminum chloride) can be used for the purification of turbid water. A PL aqueous solution also can change into a hydrogel by gamma-irradiation. The specific water content of the PL hydrogel ranged from 20 to 160 depending on the preparation conditions. Under acid conditions, the PL hydrogel swelled because of the ionic repulsion of the protonated amino groups in the PL molecules. The rate of enzymatic degradation of the respective PL hydrogels by a neutral protease was much faster than the rate of simple hydrolytic degradation. PMID:15468223

  6. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities

    PubMed Central

    Huete-Stauffer, Tamara M.; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G.

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  7. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities.

    PubMed

    Huete-Stauffer, Tamara M; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  8. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities.

    PubMed

    Huete-Stauffer, Tamara M; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures.

  9. Formic acid and acetic acid induce a programmed cell death in pathogenic Candida species.

    PubMed

    Lastauskienė, Eglė; Zinkevičienė, Auksė; Girkontaitė, Irutė; Kaunietis, Arnoldas; Kvedarienė, Violeta

    2014-09-01

    Cutaneous fungal infections are common and widespread. Antifungal agents used for the treatment of these infections often have undesirable side effects. Furthermore, increased resistance of the microorganisms to the antifungal drugs becomes the growing problem. Accordingly, the search for natural antifungal compounds continues to receive attention. Apoptosis is highly regulated programmed cell death. During yeast cell apoptosis, amino acids and peptides are released and can stimulate regeneration of human epithelium cells. Thus, detection of chemical compounds inducing apoptosis in yeast and nontoxic for humans is of great medical relevance. The aim of this study was to detect chemical compound inducing apoptosis in pathogenic Candida species with the lowest toxicity to the mammalian cells. Five chemical compounds--acetic acid, sodium bicarbonate, potassium carbonate, lithium acetate, and formic acid--were tested for evaluation of antifungal activity on C. albicans, C. guilliermondii, and C. lusitaniae. The results showed that acetic acid and formic acid at the lowest concentrations induced yeast cells death. Apoptosis analysis revealed that cells death was accompanied by activation of caspase. Minimal inhibitory concentrations of potassium carbonate and sodium bicarbonate induced Candida cells necrosis. Toxicity test with mammalian cell cultures showed that formic acid has the lowest effect on the growth of Jurkat and NIH 3T3 cells. In conclusion, our results show that a low concentration of formic acid induces apoptosis-like programmed cell death in the Candida yeast and has a minimal effect on the survivability of mammalian cells, suggesting potential applications in the treatment of these infections. PMID:24752490

  10. Algal and Bacterial Activities in Acidic (pH 3) Strip Mine Lakes

    PubMed Central

    Gyure, Ruth A.; Konopka, Allan; Brooks, Austin; Doemel, William

    1987-01-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H2S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H2S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by [14C]glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake. PMID:16347430

  11. Archaeal and bacterial diversity in acidic to circumneutral hot springs in the Philippines.

    PubMed

    Huang, Qiuyuan; Jiang, Hongchen; Briggs, Brandon R; Wang, Shang; Hou, Weiguo; Li, Gaoyuan; Wu, Geng; Solis, Ramonito; Arcilla, Carlo A; Abrajano, Teofilo; Dong, Hailiang

    2013-09-01

    The microbial diversity was investigated in sediments of six acidic to circumneutral hot springs (Temperature: 60-92 °C, pH 3.72-6.58) in the Philippines using an integrated approach that included geochemistry and 16S rRNA gene pyrosequencing. Both bacterial and archaeal abundances were lower in high-temperature springs than in moderate-temperature ones. Overall, the archaeal community consisted of sequence reads that exhibited a high similarity (nucleotide identity > 92%) to phyla Crenarchaeota, Euryarchaeota, and unclassified Archaea. The bacterial community was composed of sequence reads moderately related (nucleotide identity > 90%) to 17 phyla, with Aquificae and Firmicutes being dominant. These phylogenetic groups were correlated with environmental conditions such as temperature, dissolved sulfate and calcium concentrations in spring water, and sediment properties including total nitrogen, pyrite, and elemental sulfur. Based on the phylogenetic inference, sulfur metabolisms appear to be key physiological functions in these hot springs. Sulfobacillus (within phylum Firmicutes) along with members within Sulfolobales were abundant in two high-temperature springs (> 76 °C), and they were hypothesized to play an important role in regulating the sulfur cycling under high-temperature conditions. The results of this study improve our understanding of microbial diversity and community composition in acidic to circumneutral terrestrial hot springs and their relationships with geochemical conditions.

  12. Algal and bacterial activities in acidic (pH 3) strip mine lakes

    SciTech Connect

    Gyure, R.A.; Konopka, A.; Brooks, A.; Doemel, W.

    1987-09-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H/sub 2/S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H/sub 2/S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by (/sup 14/C)glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake.

  13. Probing determinants of cyclopiazonic acid sensitivity of bacterial Ca2+-ATPases.

    PubMed

    Kotšubei, Aljona; Gorgel, Manuela; Morth, Jens P; Nissen, Poul; Andersen, Jacob L

    2013-11-01

    Cyclopiazonic acid (CPA) is a specific and potent inhibitor of the sarcoplasmic reticulum Ca(2+)-ATPase 1a (SERCA1a). Despite high sequence similarity to SERCA1a, Listeria monocytogenes Ca(2+)-ATPase 1 (LMCA1) is not inhibited by CPA. To test whether a CPA binding site could be created while maintaining the functionality of the ATPase we targeted four amino acid positions in LMCA1 for mutational studies based on a multiple sequence alignment of SERCA-like Ca(2+)-ATPases and structural analysis of the CPA site. The identification of CPA-sensitive gain-of-function mutants pinpointed key determinants of the CPA binding site. The importance of these determinants was further underscored by the characterization of the CPA sensitivity of two additional bacterial Ca(2+)-ATPases from Lactococcus lactis and Bacillus cereus. The CPA sensitivity was predicted from their sequence compared with the LMCA1 results, and this was experimentally confirmed. Interestingly, a cluster of Lactococcus bacteria applied in the production of fermented cheese display Ca(2+)-ATPases that are predictably CPA insensitive and may originate from their coexistence with CPA-producing Penicillum and Aspergillus fungi in the cheese. The differences between bacterial and mammalian binding pockets encompassing the CPA site suggest that CPA derivatives that are specific for bacteria or other pathogens can be developed. PMID:23621633

  14. Re-engineering nalidixic acid's chemical scaffold: A step towards the development of novel anti-tubercular and anti-bacterial leads for resistant pathogens.

    PubMed

    Peraman, Ramalingam; Varma, Raghu Veer; Reddy, Y Padmanabha

    2015-10-01

    Occurrence of antibacterial and antimycobacterial resistance stimulated a thrust to discover new drugs for infectious diseases. Herein we report the work on re-engineering nalidixic acid's chemical scaffold for newer leads. Stepwise clubbing of quinoxaline, 1,2,4-triazole/1,3,4-oxadiazole with nalidixic acid yielded better compounds. Compounds were screened against ciprofloxacin resistant bacteria and Mycobacterium tuberculosis H37Rv species. Results were obtained as minimum inhibitory concentration, it was evident that molecule with quinoxaline linked azide as side chain served as antitubercular lead (<6.25 μg/ml) whilst molecule with oxadiazole or triazole linked quinoxaline side chain served as anti-bacterial lead. Few compounds were significantly active against Escherichia coli and Proteus vulgaris with MIC less than 0.06 μg/ml and relatively potent than ciprofloxacin. No true compound was potentially active against Salmonella species as compared to amoxicillin.

  15. Unifying mechanism for bacterial cell signalers (4,5-dihydroxy-2,3-pentanedione, lactones and oligopeptides): electron transfer and reactive oxygen species. Practical medical features.

    PubMed

    Kovacic, Peter

    2007-01-01

    Cell signaling has attracted much attention involving higher organisms, and more recently is of considerable interest concerning involvement in the bacterial realm. Many aspects can apply, including quorum sensing. Of the participating molecules, designated autoinducers, 4,5-dihydroxy-2,3-pentanedione (DPD) is one of the most important. It is in equilibrium with a furanone and a furanosyl-borate diester (AI-2). A prior hypothesis for cell signaling in higher organisms invoked a key role for electron transfer (ET) and reactive oxygen species (ROS), as well as conduits, relays and electrical effects. The principal ET functionalities are quinones, metal complexes, ArNO(2), and iminium species. A lesser known type is the alpha-dicarbonyl class. Diacetyl, a member, as well as its imine derivatives, can serve as a model for DPD, since the parent possesses a reduction potential amenable to ET in the biological domain. Hence, it is conceivable that DPD and its imine derivatives may be involved in ET-ROS processes. Presence of hydroxy groups should facilitate ET by DPD vs. diacetyl. Extensive prior literature supports participation of ET functionalities in action of therapeutic drugs, toxins and various illnesses. This biochemical behavior also applies to the alpha-dicarbonyl parent models. A second important bacterial autoinducer is the lactone category. Although ET functionality is lacking, the presence of the 1,3-dicarbonyl structure can provide a site for avid chelation with redox metal, e.g., iron or copper, followed by ET-ROS. Findings with added iron furnish support for the proposal. Oligopeptides comprise the third principal type of bacterial signaling agent. A prior review incorporates these within the theoretical framework based on ET by redox amino acids and redox enzymes. In recent years there has been a rapid increase in resistance to antibiotics by pathogenic bacteria. Infectious diseases are the leading cause of death worldwide and the third leading cause in

  16. Effect of acidic electrolyzed water-induced bacterial inhibition and injury in live clam (Venerupis philippinarum) and mussel (Mytilus edulis).

    PubMed

    Al-Qadiri, Hamzah M; Al-Holy, Murad A; Shiroodi, Setareh Ghorban; Ovissipour, Mahmoudreza; Govindan, Byju N; Al-Alami, Nivin; Sablani, Shyam S; Rasco, Barbara

    2016-08-16

    The effect of acidic electrolyzed water (AEW) on inactivating Escherichia coli O104:H4, Listeria monocytogenes, Aeromonas hydrophila, Vibrio parahaemolyticus and Campylobacter jejuni in laboratory contaminated live clam (Venerupis philippinarum) and mussel (Mytilus edulis) was investigated. The initial levels of bacterial contamination were: in clam 4.9 to 5.7log10CFU/g, and in mussel 5.1 to 5.5log10CFU/g. Two types of AEW were used for treatment time intervals of 1 and 2h: strong (SAEW) with an available chlorine concentration (ACC) of 20mg/L, pH=3.1, and an oxidation-reduction potential (ORP) of 1150mV, and weak (WAEW) at ACC of 10mg/L, pH=3.55 and ORP of 950mV. SAEW and WAEW exhibited significant inhibitory activity against inoculated bacteria in both shellfish species with significant differences compared to saline solutions treatments (1-2% NaCl) and untreated controls (0h). SAEW showed the largest inhibitory activity, the extent of reduction (log10CFU/g) ranged from 1.4-1.7 for E. coli O104:H4; 1.0-1.6 for L. monocytogenes; 1.3-1.6 for A. hydrophila; 1.0-1.5 for V. parahaemolyticus; and 1.5-2.2 for C. jejuni in both types of shellfish. In comparison, significantly (P<0.05) lower inhibitory effect of WAEW was achieved compared to SAEW, where the extent of reduction (log10CFU/g) ranged from 0.7-1.1 for E. coli O104:H4; 0.6-0.9 for L. monocytogenes; 0.6-1.3 for A. hydrophila; 0.7-1.3 for V. parahaemolyticus; and 0.8-1.9 for C. jejuni in both types of shellfish. Among all bacterial strains examined in this study, AEW induced less bacterial injury (~0.1-1.0log10CFU/g) and more inactivation effect. This study revealed that AEW (10-20mg/L ACC) could be used to reduce bacterial contamination in live clam and mussel, which may help control possible unhygienic practices during production and processing of shellfish without apparent changes in the quality of the shellfish. PMID:27208583

  17. Recent advances in inhibitors of bacterial fatty acid synthesis type II (FASII) system enzymes as potential antibacterial agents.

    PubMed

    Wang, Yi; Ma, Shutao

    2013-10-01

    Bacterial infections are a constant and serious threat to human health. With the increase of multidrug resistance of clinically pathogenic bacteria, common antibiotic therapies have been less effective. Fatty acid synthesis type II (FASII) system enzymes are essential for bacterial membrane lipid biosynthesis and represent increasingly promising targets for the discovery of antibacterial agents with new mechanisms of action. This review highlights recent advances in inhibitors of bacterial FASII as potential antibacterial agents, paying special attention to the activities, mechanisms, and structure-activity relationships of those inhibitors that mainly target β-ketoacyl-ACP synthase, β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydratase, and enoyl-ACP reductase. Although inhibitors with low nanomolar and selective activity against various bacterial FASII have entered clinical trials, further research is needed to expand upon both available and yet unknown scaffolds to identify new FASII inhibitors that may have antibacterial potential, particularly against resistant bacterial strains.

  18. Divalent cations enhance fluoride binding to Streptococcus mutans and Streptococcus sanguinis cells and subsequently inhibit bacterial acid production.

    PubMed

    Domon-Tawaraya, H; Nakajo, K; Washio, J; Ashizawa, T; Ichino, T; Sugawara, H; Fukumoto, S; Takahashi, N

    2013-01-01

    One preventive effect of topical fluoride application is derived from the fact that fluoride can inhibit bacterial acid production. Furthermore, divalent cations such as Ca(2+) and Mg(2+) increase the binding of fluoride to bacterial cells. These findings suggest that exposure of oral bacteria to fluoride in the presence of divalent cations increases fluoride binding to bacterial cells and subsequently enhances fluoride-induced inhibition of bacterial acid production. This study investigated the effects of fluoride exposure (0-20,000 ppm F) in the presence of Ca(2+) or Mg(2+) prior to glucose challenge on pH fall ability by bacterial sugar fermentation, as well as fluoride binding to bacterial cells by exposure to fluoride, and fluoride release from bacterial cells during bacterial sugar fermentation, using caries-related bacteria, Streptococcus mutans and Streptococcus sanguinis. The pH fall by both streptococci was inhibited by exposure to over 250 ppm F in the presence of Ca(2+) (p < 0.01), whereas in the presence of Mg(2+), the pH fall by S. mutans and S. sanguinis was inhibited after exposure to over 250 and 950 ppm F, respectively (p < 0.05). The amounts of fluoride binding to and released from streptococcal cells increased with the concentration of fluoride the cells were exposed to in the presence of Mg(2+), but were high enough even after 250 ppm F exposure in the presence of Ca(2+). The enhanced inhibition of acid production in the presence of divalent cations is probably due to the improved efficiency of fluoride binding to bacterial cells being improved via these divalent cations.

  19. Utilization of corncob acid hydrolysate for bacterial cellulose production by Gluconacetobacter xylinus.

    PubMed

    Huang, Chao; Yang, Xiao-Yan; Xiong, Lian; Guo, Hai-Jun; Luo, Jun; Wang, Bo; Zhang, Hai-Rong; Lin, Xiao-Qing; Chen, Xin-De

    2015-02-01

    In this study, corncob acid hydrolysate was used as a substrate for bacterial cellulose (BC) production by Gluconacetobacter xylinus. After 2 weeks' static fermentation, a BC yield of 4 g/L could be obtained. Both effects of medium composition and fermentation condition on the BC production were evaluated. Most extra substrates (carbon and nitrogen sources) except mannitol, butyric acid, and levulinic acid showed no effect on the improvement of BC yield. Fermentation condition including fermentation mode, inoculation concentration, and initial pH showed certain influence on the BC yield and thus should be well controlled. The analysis by field emission scanning electron microscope (FE-SEM), Fourier transform infrared spectroscopy (FTIR), and X-ray diffraction (XRD) showed that the BC sample had obvious nano-network structure, clear functional groups that were found in cellulose, and relatively high crystallinity and crystallinity index value. Moreover, the BC sample had great water-holding capacity. Overall, corncob acid hydrolysate could be one promising substrate for BC production. PMID:25422061

  20. Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.

    PubMed

    Kaul, Tiffany K; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V; Kapahi, Pankaj; Gill, Matthew S

    2014-01-01

    The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit. PMID:24475206

  1. Linkage between the bacterial acid stress and stringent responses: the structure of the inducible lysine decarboxylase.

    PubMed

    Kanjee, Usheer; Gutsche, Irina; Alexopoulos, Eftichia; Zhao, Boyu; El Bakkouri, Majida; Thibault, Guillaume; Liu, Kaiyin; Ramachandran, Shaliny; Snider, Jamie; Pai, Emil F; Houry, Walid A

    2011-03-01

    The Escherichia coli inducible lysine decarboxylase, LdcI/CadA, together with the inner-membrane lysine-cadaverine antiporter, CadB, provide cells with protection against mild acidic conditions (pH∼5). To gain a better understanding of the molecular processes underlying the acid stress response, the X-ray crystal structure of LdcI was determined. The structure revealed that the protein is an oligomer of five dimers that associate to form a decamer. Surprisingly, LdcI was found to co-crystallize with the stringent response effector molecule ppGpp, also known as the alarmone, with 10 ppGpp molecules in the decamer. ppGpp is known to mediate the stringent response, which occurs in response to nutrient deprivation. The alarmone strongly inhibited LdcI enzymatic activity. This inhibition is important for modulating the consumption of lysine in cells during acid stress under nutrient limiting conditions. Hence, our data provide direct evidence for a link between the bacterial acid stress and stringent responses. PMID:21278708

  2. A bacterial strain with a unique quadruplet codon specifying non-native amino acids.

    PubMed

    Chatterjee, Abhishek; Lajoie, Marc J; Xiao, Han; Church, George M; Schultz, Peter G

    2014-08-18

    The addition of noncanonical amino acids to the genetic code requires unique codons not assigned to the 20 canonical amino acids. Among the 64 triplet codons, only the three nonsense "stop" codons have been used to encode non-native amino acids. Use of quadruplet "frame-shift" suppressor codons provides an abundant alternative but suffers from low suppression efficiency as a result of competing recognition of their first three bases by endogenous host tRNAs or release factors. Deletion of release factor 1 in a genomically recoded strain of E. coli (E. coli C321), in which all endogenous amber stop codons (UAG) are replaced with UAA, abolished UAG mediated translation termination. Here we show that a Methanocaldococcus jannaschii-derived frame-shift suppressor tRNA/aminoacyl-tRNA synthetase pair enhanced UAGN suppression efficiency in this recoded bacterial strain. These results demonstrate that efficient quadruplet codons for encoding non-native amino acids can be generated by eliminating competing triplet codon recognition at the ribosome.

  3. Utilization of corncob acid hydrolysate for bacterial cellulose production by Gluconacetobacter xylinus.

    PubMed

    Huang, Chao; Yang, Xiao-Yan; Xiong, Lian; Guo, Hai-Jun; Luo, Jun; Wang, Bo; Zhang, Hai-Rong; Lin, Xiao-Qing; Chen, Xin-De

    2015-02-01

    In this study, corncob acid hydrolysate was used as a substrate for bacterial cellulose (BC) production by Gluconacetobacter xylinus. After 2 weeks' static fermentation, a BC yield of 4 g/L could be obtained. Both effects of medium composition and fermentation condition on the BC production were evaluated. Most extra substrates (carbon and nitrogen sources) except mannitol, butyric acid, and levulinic acid showed no effect on the improvement of BC yield. Fermentation condition including fermentation mode, inoculation concentration, and initial pH showed certain influence on the BC yield and thus should be well controlled. The analysis by field emission scanning electron microscope (FE-SEM), Fourier transform infrared spectroscopy (FTIR), and X-ray diffraction (XRD) showed that the BC sample had obvious nano-network structure, clear functional groups that were found in cellulose, and relatively high crystallinity and crystallinity index value. Moreover, the BC sample had great water-holding capacity. Overall, corncob acid hydrolysate could be one promising substrate for BC production.

  4. Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.

    2012-07-01

    Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.

  5. Bacterial community structure in the rhizosphere of three cactus species from semi-arid highlands in central Mexico.

    PubMed

    Aguirre-Garrido, J Félix; Montiel-Lugo, Daniel; Hernández-Rodríguez, César; Torres-Cortes, Gloria; Millán, Vicenta; Toro, Nicolás; Martínez-Abarca, Francisco; Ramírez-Saad, Hugo C

    2012-05-01

    The nature reserve of Tehuacan-Cuicatlan in central Mexico is known for its diversity and endemism mainly in cactus plants. Although the xerophytic flora is reasonably documented, the bacterial communities associated with these species have been largely neglected. We assessed the diversity and composition of bacterial communities in bulk (non-rhizospheric) soil and the rhizosphere of three cactus plant species: Mammillaria carnea, Opuntia pilifera and Stenocereus stellatus, approached using cultivation and molecular techniques, considering the possible effect of dry and rainy seasons. Cultivation-dependent methods were focused on putative N(2)-fixers and heterotrophic aerobic bacteria, in the two media tested the values obtained for dry season samples grouped together regardless of the sample type (rhizospheric or non-rhizospheric), these groups also included the non-rhizospheric sample for rainy season, on each medium. These CFU values were smaller and significantly different from those obtained on rhizospheric samples from rainy season. Genera composition among isolates of the rhizospheric samples was very similar for each season, the most abundant taxa being α-Proteobacteria, Actinobacteria and Firmicutes. Interestingly, the genus Ochrobactrum was highly represented among rhizospheric samples, when cultured in N-free medium. The structure of the bacterial communities was approached with molecular techniques targeting partial 16S rRNA sequences such as denaturing gradient gel electrophoresis and serial analysis of ribosomal sequence tags. Under these approaches, the most represented bacterial phyla were Actinobacteria, Proteobacteria and Acidobacteria. The first two were also highly represented when using isolation techniques.

  6. Analysis of mycolic acid cleavage products and cellular fatty acids of Mycobacterium species by capillary gas chromatography.

    PubMed

    Lambert, M A; Moss, C W; Silcox, V A; Good, R C

    1986-04-01

    After growth and experimental conditions were established, the mycolic acid cleavage products, constituent fatty acids, and alcohols of representative strains of Mycobacterium tuberculosis, M. smegmatis, M. fortuitum complex, M. kansasii, M. gordonae, and M. avium complex were determined by capillary gas chromatography. Reproducible cleavage of mycolic acid methyl esters to tetracosanoic (24:0) or hexacosanoic (26:0) acid methyl esters was achieved by heating the sample in a high-temperature muffle furnace. The major constituent fatty acids in all species were hexadecanoic (16:0) and octadecenoic (18:1 omega 9-c, oleic) acids. With the exception of M. gordonae, 10-methyloctadecanoic acid was found in all species; moreover, M. gordonae was the only species tested which contained 2-methyltetradecanoic acid. M. kansasii was characterized by the presence of 2,4-dimethyltetradecanoic acid, M. avium complex by 2-eicosanol, and M. tuberculosis by 26:0 mycolic acid cleavage product. The mycolic acid cleavage product in the other five species tested was 24:0. Although a limited number of strains and species were tested, preliminary results indicate that this gas chromatographic method can be used to characterize mycobacterial cultures by their mycolic acid cleavage products and constituent fatty acid and alcohol content. PMID:3084554

  7. Accuracy of species identity of commercial bacterial cultures intended for probiotic or nutritional use.

    PubMed

    Huys, Geert; Vancanneyt, Marc; D'Haene, Klaas; Vankerckhoven, Vanessa; Goossens, Herman; Swings, Jean

    2006-11-01

    Independent studies have indicated that the microbiological composition of several commercial probiotic products does not correspond to the product label information. The present study set out to investigate to what extent these problems may be due to the use of misidentified cultures at the onset of production. For this purpose, 213 cultures of lactic acid bacteria (LAB) and propionibacteria intended for probiotic or nutritional use were collected from 26 manufacturers of probiotic products, three international culture collections and one research institute. The accuracy of the taxonomic identity provided by the strain depositor was assessed through a polyphasic approach based on validated and standardized identification methods including fluorescent amplified fragment length polymorphism (FAFLP) and repetitive DNA element (rep)-PCR fingerprinting, protein profiling and partial 16S rDNA sequencing. The majority of the cultures were received as members of the genera Lactobacillus (57%) and Bifidobacterium (22%); however, propionibacteria, enterococci, Lactococcus lactis (subsp. lactis), Streptococcus thermophilus and pediococci were also obtained. Upon reidentification, 46 cases of misidentification at the genus level (n=19) or species level (n=27) were recorded, including 34 commercial probiotic cultures deposited by 10 different companies. The finding that more than 28% of the commercial cultures intended for human and/or animal probiotic use were misidentified at the genus or species level suggests that many cases of probiotic product mislabeling originate from the incorporation of incorrectly identified strains. A large number of these discrepancies could be related to the use of methods with limited taxonomic resolution (e.g., API strips) or that are unsuitable for reliable identification up to species level (e.g., pulsed-field gel electrophoresis and randomly amplified polymorphic DNA analysis). The current study has again highlighted that reliable

  8. The soil bacterial communities of South African fynbos riparian ecosystems invaded by Australian Acacia species.

    PubMed

    Slabbert, Etienne; Jacobs, Shayne Martin; Jacobs, Karin

    2014-01-01

    Riparian ecosystem along rivers and streams are characterised by lateral and longitudinal ecological gradients and, as a result, harbour unique biodiversity. Riparian ecosystems in the fynbos of the Western Cape, South Africa, are characterised by seasonal dynamics, with summer droughts followed by high flows during winter. The unique hydrology and geomorphology of riparian ecosystems play an important role in shaping these ecosystems. The riparian vegetation in the Western Cape has, however, largely been degraded due to the invasion of non-indigenous plants, in particular Acacia mearnsii, A. saligna and A. dealbata. This study investigated the effect of hydrology and invasion on the bacterial communities associated with fynbos riparian ecosystems. Bacterial communities were characterised with automated ribosomal intergenic spacer analysis (ARISA) and 454 16S rDNA pyrosequencing. Chemical and physical properties of soil within sites were also determined and correlated with community data. Sectioning across the lateral zones revealed significant differences in community composition, and the specific bacterial taxa influenced. Results also showed that the bacterial community structure could be linked to Acacia invasion. The presence of invasive Acacia was correlated with specific bacterial phyla. However, high similarity between cleared and pristine sites suggests that the effect of Acacia on the soil bacterial community structure may not be permanent. This study demonstrates how soil bacterial communities are influenced by hydrological gradients associated with riparian ecosystems and the impact of Acacia invasion on these communities. PMID:24475145

  9. The soil bacterial communities of South African fynbos riparian ecosystems invaded by Australian Acacia species.

    PubMed

    Slabbert, Etienne; Jacobs, Shayne Martin; Jacobs, Karin

    2014-01-01

    Riparian ecosystem along rivers and streams are characterised by lateral and longitudinal ecological gradients and, as a result, harbour unique biodiversity. Riparian ecosystems in the fynbos of the Western Cape, South Africa, are characterised by seasonal dynamics, with summer droughts followed by high flows during winter. The unique hydrology and geomorphology of riparian ecosystems play an important role in shaping these ecosystems. The riparian vegetation in the Western Cape has, however, largely been degraded due to the invasion of non-indigenous plants, in particular Acacia mearnsii, A. saligna and A. dealbata. This study investigated the effect of hydrology and invasion on the bacterial communities associated with fynbos riparian ecosystems. Bacterial communities were characterised with automated ribosomal intergenic spacer analysis (ARISA) and 454 16S rDNA pyrosequencing. Chemical and physical properties of soil within sites were also determined and correlated with community data. Sectioning across the lateral zones revealed significant differences in community composition, and the specific bacterial taxa influenced. Results also showed that the bacterial community structure could be linked to Acacia invasion. The presence of invasive Acacia was correlated with specific bacterial phyla. However, high similarity between cleared and pristine sites suggests that the effect of Acacia on the soil bacterial community structure may not be permanent. This study demonstrates how soil bacterial communities are influenced by hydrological gradients associated with riparian ecosystems and the impact of Acacia invasion on these communities.

  10. The Soil Bacterial Communities of South African Fynbos Riparian Ecosystems Invaded by Australian Acacia Species

    PubMed Central

    Slabbert, Etienne; Jacobs, Shayne Martin; Jacobs, Karin

    2014-01-01

    Riparian ecosystem along rivers and streams are characterised by lateral and longitudinal ecological gradients and, as a result, harbour unique biodiversity. Riparian ecosystems in the fynbos of the Western Cape, South Africa, are characterised by seasonal dynamics, with summer droughts followed by high flows during winter. The unique hydrology and geomorphology of riparian ecosystems play an important role in shaping these ecosystems. The riparian vegetation in the Western Cape has, however, largely been degraded due to the invasion of non-indigenous plants, in particular Acacia mearnsii, A. saligna and A. dealbata. This study investigated the effect of hydrology and invasion on the bacterial communities associated with fynbos riparian ecosystems. Bacterial communities were characterised with automated ribosomal intergenic spacer analysis (ARISA) and 454 16S rDNA pyrosequencing. Chemical and physical properties of soil within sites were also determined and correlated with community data. Sectioning across the lateral zones revealed significant differences in community composition, and the specific bacterial taxa influenced. Results also showed that the bacterial community structure could be linked to Acacia invasion. The presence of invasive Acacia was correlated with specific bacterial phyla. However, high similarity between cleared and pristine sites suggests that the effect of Acacia on the soil bacterial community structure may not be permanent. This study demonstrates how soil bacterial communities are influenced by hydrological gradients associated with riparian ecosystems and the impact of Acacia invasion on these communities. PMID:24475145

  11. Inter-species interconnections in acid mine drainage microbial communities

    PubMed Central

    Comolli, Luis R.; Banfield, Jill F.

    2014-01-01

    Metagenomic studies are revolutionizing our understanding of microbes in the biosphere. They have uncovered numerous proteins of unknown function in tens of essentially unstudied lineages that lack cultivated representatives. Notably, few of these microorganisms have been visualized, and even fewer have been described ultra-structurally in their essentially intact, physiologically relevant states. Here, we present cryogenic transmission electron microscope (cryo-TEM) 2D images and 3D tomographic datasets for archaeal species from natural acid mine drainage (AMD) microbial communities. Ultrastructural findings indicate the importance of microbial interconnectedness via a range of mechanisms, including direct cytoplasmic bridges and pervasive pili. The data also suggest a variety of biological structures associated with cell-cell interfaces that lack explanation. Some may play roles in inter-species interactions. Interdependences amongst the archaea may have confounded prior isolation efforts. Overall, the findings underline knowledge gaps related to archaeal cell components and highlight the likely importance of co-evolution in shaping microbial lineages. PMID:25120533

  12. Molecular and Ecological Evidence for Species Specificity and Coevolution in a Group of Marine Algal-Bacterial Symbioses

    PubMed Central

    Ashen, Jon B.; Goff, Lynda J.

    2000-01-01

    The phylogenetic relationships of bacterial symbionts from three gall-bearing species in the marine red algal genus Prionitis (Rhodophyta) were inferred from 16S rDNA sequence analysis and compared to host phylogeny also inferred from sequence comparisons (nuclear ribosomal internal-transcribed-spacer region). Gall formation has been described previously on two species of Prionitis, P. lanceolata (from central California) and P. decipiens (from Peru). This investigation reports gall formation on a third related host, Prionitis filiformis. Phylogenetic analyses based on sequence comparisons place the bacteria as a single lineage within the Roseobacter grouping of the α subclass of the division Proteobacteria (99.4 to 98.25% sequence identity among phylotypes). Comparison of symbiont and host molecular phylogenies confirms the presence of three gall-bearing algal lineages and is consistent with the hypothesis that these red seaweeds and their bacterial symbionts are coevolving. The species specificity of these associations was investigated in nature by whole-cell hybridization of gall bacteria and in the laboratory by using cross-inoculation trials. Whole-cell in situ hybridization confirmed that a single bacterial symbiont phylotype is present in galls on each host. In laboratory trials, bacterial symbionts were incapable of inducing galls on alternate hosts (including two non-gall-bearing species). Symbiont-host specificity in Prionitis gall formation indicates an effective ecological separation between these closely related symbiont phylotypes and provides an example of a biological context in which to consider the organismic significance of 16S rDNA sequence variation. PMID:10877801

  13. Reductive dechlorination of methoxychlor by bacterial species of environmental origin: evidence for primary biodegradation of methoxychlor in submerged environments.

    PubMed

    Satsuma, Koji; Masuda, Minoru

    2012-02-29

    Methoxychlor [1,1,1-trichloro-2,2-bis(4-methoxyphenyl)ethane] is an organochlorine insecticide that undergoes dechlorination in natural submerged environments. We investigated the ability to dechlorinate this compound in seven environmental bacterial species ( Aeromonas hydrophila , Enterobacter amnigenus , Klebsiella terrigena , Bacillus subtilis , Achromobacter xylosoxidans , Acinetobacter calcoaceticus , and Mycobacterium obuense ) and the enteric bacterium Escherichia coli as a positive control. In R2A broth at 25 °C under aerobic, static culture, all species except Ach. xylosoxidans were observed to convert methoxychlor to dechlorinated methoxychlor [1,1-dichloro-2,2-bis(4-methoxyphenyl)ethane]. The medium was aerobic at first, but bacterial growth resulted in the consumption of oxygen and generated microaerobic and weakly reductive conditions. Replacement of the headspace of the culture tubes with nitrogen gas was found to decrease the dechlorination rate. Our findings suggest that extensive bacterial species ubiquitously inhabiting the subsurface water environment play an important role in the primary dechlorination of methoxychlor.

  14. Limitations to estimating bacterial cross-species transmission using genetic and genomic markers: inferences from simulation modeling

    PubMed Central

    Benavides, Julio A; Cross, Paul C; Luikart, Gordon; Creel, Scott

    2014-01-01

    Cross-species transmission (CST) of bacterial pathogens has major implications for human health, livestock, and wildlife management because it determines whether control actions in one species may have subsequent effects on other potential host species. The study of bacterial transmission has benefitted from methods measuring two types of genetic variation: variable number of tandem repeats (VNTRs) and single nucleotide polymorphisms (SNPs). However, it is unclear whether these data can distinguish between different epidemiological scenarios. We used a simulation model with two host species and known transmission rates (within and between species) to evaluate the utility of these markers for inferring CST. We found that CST estimates are biased for a wide range of parameters when based on VNTRs and a most parsimonious reconstructed phylogeny. However, estimations of CST rates lower than 5% can be achieved with relatively low bias using as low as 250 SNPs. CST estimates are sensitive to several parameters, including the number of mutations accumulated since introduction, stochasticity, the genetic difference of strains introduced, and the sampling effort. Our results suggest that, even with whole-genome sequences, unbiased estimates of CST will be difficult when sampling is limited, mutation rates are low, or for pathogens that were recently introduced. PMID:25469159

  15. The native bacterioplankton community in the central baltic sea is influenced by freshwater bacterial species.

    PubMed

    Riemann, L; Leitet, C; Pommier, T; Simu, K; Holmfeldt, K; Larsson, U; Hagström, A

    2008-01-01

    The Baltic Sea is one of the largest brackish environments on Earth. Despite extensive knowledge about food web interactions and pelagic ecosystem functioning, information about the bacterial community composition in the Baltic Sea is scarce. We hypothesized that due to the eutrophic low-salinity environment and the long water residence time (>5 years), the bacterioplankton community from the Baltic proper shows a native "brackish" composition influenced by both freshwater and marine phylotypes. The bacterial community composition in surface water (3-m depth) was examined at a single station throughout a full year. Denaturing gradient gel electrophoresis (DGGE) showed that the community composition changed over the year. Further, it indicated that at the four extensive samplings (16S rRNA gene clone libraries and bacterial isolates from low- and high-nutrient agar plates and seawater cultures), different bacterial assemblages associated with different environmental conditions were present. Overall, the sequencing of 26 DGGE bands, 160 clones, 209 plate isolates, and 9 dilution culture isolates showed that the bacterial assemblage in surface waters of the central Baltic Sea was dominated by Bacteroidetes but exhibited a pronounced influence of typical freshwater phylogenetic groups within Actinobacteria, Verrucomicrobia, and Betaproteobacteria and a lack of typical marine taxa. This first comprehensive analysis of bacterial community composition in the central Baltic Sea points to the existence of an autochthonous estuarine community uniquely adapted to the environmental conditions prevailing in this brackish environment.

  16. Cryptococcus neoformans can utilize the bacterial melanin precursor homogentisic acid for fungal melanogenesis.

    PubMed

    Frases, Susana; Salazar, Angela; Dadachova, Ekaterina; Casadevall, Arturo

    2007-01-01

    Cryptococcus neoformans melanizes in the environment and in mammalian tissues, but the process of melanization in either venue is mysterious given that this microbe produces melanin only from exogenous substrates. Understanding the process of melanization is important because melanization is believed to protect against various stresses in the environment, including UV radiation, and pigment production is associated with virulence. Melanization in C. neoformans requires the availability of diphenolic precursors. In contrast, many bacteria synthesize melanin from homogentisic acid (HGA). We report that C. neoformans strains representing all four serotypes can produce a brown pigment from HGA. The brown pigment was acid resistant and had the electron paramagnetic resonance spectrum of a stable free radical, qualities that identified it as a melanin. Melanin "ghost"-like particles obtained from pigmented C. neoformans cells were hydrophobic, fluorescent under a variety of irradiation wavelengths, negatively charged, insoluble in organic solvents and alcohols, resistant to degradation by strong acids, and vulnerable to bleaching. HGA melanization was laccase dependent and repressed by high concentrations of glucose. The ability of C. neoformans to utilize a bacterial melanin precursor compound suggests a new substrate source for melanization in the environment.

  17. Cryptococcus neoformans Can Utilize the Bacterial Melanin Precursor Homogentisic Acid for Fungal Melanogenesis▿

    PubMed Central

    Frases, Susana; Salazar, Angela; Dadachova, Ekaterina; Casadevall, Arturo

    2007-01-01

    Cryptococcus neoformans melanizes in the environment and in mammalian tissues, but the process of melanization in either venue is mysterious given that this microbe produces melanin only from exogenous substrates. Understanding the process of melanization is important because melanization is believed to protect against various stresses in the environment, including UV radiation, and pigment production is associated with virulence. Melanization in C. neoformans requires the availability of diphenolic precursors. In contrast, many bacteria synthesize melanin from homogentisic acid (HGA). We report that C. neoformans strains representing all four serotypes can produce a brown pigment from HGA. The brown pigment was acid resistant and had the electron paramagnetic resonance spectrum of a stable free radical, qualities that identified it as a melanin. Melanin “ghost”-like particles obtained from pigmented C. neoformans cells were hydrophobic, fluorescent under a variety of irradiation wavelengths, negatively charged, insoluble in organic solvents and alcohols, resistant to degradation by strong acids, and vulnerable to bleaching. HGA melanization was laccase dependent and repressed by high concentrations of glucose. The ability of C. neoformans to utilize a bacterial melanin precursor compound suggests a new substrate source for melanization in the environment. PMID:17098915

  18. Lactic acid bacterial symbionts in honeybees - an unknown key to honey's antimicrobial and therapeutic activities.

    PubMed

    Olofsson, Tobias C; Butler, Èile; Markowicz, Pawel; Lindholm, Christina; Larsson, Lennart; Vásquez, Alejandra

    2016-10-01

    Could honeybees' most valuable contribution to mankind besides pollination services be alternative tools against infections? Today, due to the emerging antibiotic-resistant pathogens, we are facing a new era of searching for alternative tools against infections. Natural products such as honey have been applied against human's infections for millennia without sufficient scientific evidence. A unique lactic acid bacterial (LAB) microbiota was discovered by us, which is in symbiosis with honeybees and present in large amounts in fresh honey across the world. This work investigates if the LAB symbionts are the source to the unknown factors contributing to honey's properties. Hence, we tested the LAB against severe wound pathogens such as methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa and vancomycin-resistant Enterococcus (VRE) among others. We demonstrate a strong antimicrobial activity from each symbiont and a synergistic effect, which counteracted all the tested pathogens. The mechanisms of action are partly shown by elucidating the production of active compounds such as proteins, fatty acids, anaesthetics, organic acids, volatiles and hydrogen peroxide. We show that the symbionts produce a myriad of active compounds that remain in variable amounts in mature honey. Further studies are now required to investigate if these symbionts have a potential in clinical applications as alternative tools against topical human and animal infections.

  19. Comparative Inter-Species Pharmacokinetics of Phenoxyacetic Acid Herbicides and Related Organic Acids. Evidence that the Dog is Not a Relevant Species for Evaluation of Human Health Risk.

    SciTech Connect

    Timchalk, Chuck

    2004-07-15

    Phenoxyacetic acids including 2,4-dichlorophenoxyacetic acid (2,4-D) and 4-chloro-2-methylphenoxyacetic acid (MCPA) are widely utilized organic acid herbicides that have undergone extensive toxicity and pharmacokinetic analyses. The dog is particularly susceptible to the toxicity of phenoxyacetic acids and related organic acids relative to other species. Active renal clearance mechanisms for organic acids are ubiquitous in mammalian species, and thus a likely mechanism responsible for the increased sensitivity of the dog to these agents is linked to a lower capacity to secrete organic acids from the kidney. Using published data describing the pharmacokinetics of phenoxyacetic and structurally related organic acids in a variety of species including humans, inter-species comparative pharmacokinetics were evaluated using allometic parameter scaling. For both 2,4-D and MCPA the dog plasma half-life (t1/2) and renal clearance (Clr; ml hr-1) rates did not scale as a function of body weight across species; whereas for all other species evaluated, including humans, these pharmacokinetic parameters reasonably scaled. This exceptional response in the dog is clearly illustrated by comparing the plasma t1/2 at comparable doses of 2,4-D and MCPA, across several species. At a dosage of 5 mg/kg, in dogs the plasma t1/2 for 2,4-D and MCPA were {approx}92 - 106 hr and 63 hr, respectively, which is substantially longer than in the rat ({approx}1 and 6 hr, respectively) or in humans (12 and 11 hr, respectively). This longer t1/2, and slower elimination in the dog, results in substantially higher body burdens of these organic acids, at comparable doses, relative to other species. Although these results indicate the important role of renal transport clearance mechanisms as determinants of the clearance and potential toxicity outcomes of phenoxyacetic acid herbicides across several species, other contributing mechanisms such as reabsorption from the renal tubules is highly likely. These

  20. Antagonistic effects of α-tocopherol and ursolic acid on model bacterial membranes.

    PubMed

    Broniatowski, Marcin; Flasiński, Michał; Hąc-Wydro, Katarzyna

    2015-10-01

    α-tocopherol (Toc), the most active component of vitamin E can exert antagonistic effects disabling the therapy of cancers and bacterial infections. Such antagonisms were observed also between Toc and bioactive pentacyclic triterpenes (PT) exhibiting anticancer and antibacterial properties. Both Toc and PT are water-insoluble membrane active substances. Thus, our idea was to emulate their interactions with model Escherichia coli membranes. E. coli inner membranes were selected for the experiments because their lipid composition is quite simple and well characterized and the two main components are phosphatidylethanolamine and phosphatidylglycerol. As a model of E. coli membranes we applied Langmuir monolayers formed by the E. coli total extract of polar lipids (Etotal) as well as by the main lipid components: phosphatidylethanolamine (POPE) and phosphatidylglycerol (ECPG). The antagonistic effects of ursolic acid (Urs) and Toc were investigated with the application of ternary Langmuir monolayers formed by Urs, Toc and one of the phospholipids POPE or ECPG. Our studies indicated that the affinities of Urs and Toc towards the POPE molecule are comparable; whereas there are profound differences in the interactions of Urs and Toc with ECPG. Thus, the model experiments prove that in the case of E. coli membrane, the differences in the interactions between Urs and Toc with the anionic bacterial phosphatidylglycerol can be the key factor responsible for the antagonistic effects observed between PT and Toc in vivo.

  1. Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

    PubMed

    Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

    2015-07-01

    The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells. PMID:25940300

  2. Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

    PubMed

    Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

    2015-07-01

    The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells.

  3. Bacterial GRAS domain proteins throw new light on gibberellic acid response mechanisms

    PubMed Central

    Zhang, Dapeng; Iyer, Lakshminarayan M.; Aravind, L.

    2012-01-01

    Summary: Gibberellic acids (GAs) are key plant hormones, regulating various aspects of growth and development, which have been at the center of the ‘green revolution’. GRAS family proteins, the primary players in GA signaling pathways, remain poorly understood. Using sequence-profile searches, structural comparisons and phylogenetic analysis, we establish that the GRAS family first emerged in bacteria and belongs to the Rossmann fold methyltransferase superfamily. All bacterial and a subset of plant GRAS proteins are likely to function as small-molecule methylases. The remaining plant versions have lost one or more AdoMet (SAM)-binding residues while preserving their substrate-binding residues. We predict that GRAS proteins might either modify or bind small molecules such as GAs or their derivatives. Contact: aravind@ncbi.nlm.nih.gov Supplementary Information: Supplementary Material for this article is available at Bioinformatics online. PMID:22829623

  4. Polymeric Cryogel-Based Boronate Affinity Chromatography for Separation of Ribonucleic Acid from Bacterial Extracts.

    PubMed

    Shakya, Akhilesh Kumar; Srivastava, Akshay; Kumar, Ashok

    2015-01-01

    Three-dimensional monolithic columns are preferred stationary phase in column chromatography. Conventional columns based on silica or particles are efficient in bioseparation though associated with limitations of nonspecific interaction and uneven porosity that causes high mass transfer resistance for the movement of big molecules. Cryogels as a monolith column have shown promising application in bioseparation. Cryogels column can be synthesized in the form of a monolith at sub-zero temperature through gelation of pre-synthesized polymers or polymerization of monomers. Cryogels are macroporous and mechanically stable materials. They have open interconnected micron-sized pores with a wide range of porosity (10-200 μm). Current protocol demonstrated the ability of poly(hydroxymethyl methacrylate)-co-vinylphenyl boronic acid p(HEMA-co-VPBA) cryogel matrix for selective separation of RNA from the bacterial crude extract. PMID:26623972

  5. Evolution of the Lactic Acid Bacterial Community during Malt Whisky Fermentation: a Polyphasic Study

    PubMed Central

    van Beek, Sylvie; Priest, Fergus G.

    2002-01-01

    The development of the lactic acid bacterial community in a commercial malt whisky fermentation occurred in three broad phases. Initially, bacteria were inhibited by strong yeast growth. Fluorescence microscopy and environmental scanning electron microscopy revealed, in this early stage, both cocci and rods that were at least partly derived from the wort and yeast but also stemmed from the distillery plant. Denaturing gradient gel electrophoresis (DGGE) of partial 16S rRNA genes and sequence analysis revealed cocci related to Streptococcus thermophilus or Saccharococcus thermophilus, Lactobacillus brevis, and Lactobacillus fermentum. The middle phase began 35 to 40 h after yeast inoculation and was characterized by exponential growth of lactobacilli and residual yeast metabolism. Lactobacillus casei or Lactobacillus paracasei, L. fermentum, and Lactobacillus ferintoshensis were detected in samples of fermenting wort examined by DGGE during this stage. Bacterial growth was accompanied by the accumulation of acetic and lactic acids and the metabolism of residual maltooligosaccharides. By 70 h, two new PCR bands were detected on DGGE gels, and the associated bacteria were largely responsible for the final phase of the fermentation. The bacteria were phylogenetically related to Lactobacillus acidophilus and Lactobacillus delbrueckii, and strains similar to the former had previously been recovered from malt whisky fermentations in Japan. These were probably obligately homofermentative bacteria, required malt wort for growth, and could not be cultured on normal laboratory media, such as MRS. Their metabolism during the last 20 to 30 h of fermentation was associated with yeast death and autolysis and further accumulation of lactate but no additional acetate. PMID:11772639

  6. Evolution of the lactic acid bacterial community during malt whisky fermentation: a polyphasic study.

    PubMed

    van Beek, Sylvie; Priest, Fergus G

    2002-01-01

    The development of the lactic acid bacterial community in a commercial malt whisky fermentation occurred in three broad phases. Initially, bacteria were inhibited by strong yeast growth. Fluorescence microscopy and environmental scanning electron microscopy revealed, in this early stage, both cocci and rods that were at least partly derived from the wort and yeast but also stemmed from the distillery plant. Denaturing gradient gel electrophoresis (DGGE) of partial 16S rRNA genes and sequence analysis revealed cocci related to Streptococcus thermophilus or Saccharococcus thermophilus, Lactobacillus brevis, and Lactobacillus fermentum. The middle phase began 35 to 40 h after yeast inoculation and was characterized by exponential growth of lactobacilli and residual yeast metabolism. Lactobacillus casei or Lactobacillus paracasei, L. fermentum, and Lactobacillus ferintoshensis were detected in samples of fermenting wort examined by DGGE during this stage. Bacterial growth was accompanied by the accumulation of acetic and lactic acids and the metabolism of residual maltooligosaccharides. By 70 h, two new PCR bands were detected on DGGE gels, and the associated bacteria were largely responsible for the final phase of the fermentation. The bacteria were phylogenetically related to Lactobacillus acidophilus and Lactobacillus delbrueckii, and strains similar to the former had previously been recovered from malt whisky fermentations in Japan. These were probably obligately homofermentative bacteria, required malt wort for growth, and could not be cultured on normal laboratory media, such as MRS. Their metabolism during the last 20 to 30 h of fermentation was associated with yeast death and autolysis and further accumulation of lactate but no additional acetate.

  7. Species diversity and relative abundance of lactic acid bacteria in the milk of rhesus monkeys (Macaca mulatta)

    PubMed Central

    Jin, L.; Hinde, K.; Tao, L.

    2013-01-01

    Background Mother’s milk is a source of bacteria that influences the development of the infant commensal gut microbiota. To date, the species diversity and relative abundance of lactic acid bacteria in the milk of non-human primates have not been described. Methods Milk samples were aseptically obtained from 54 female rhesus monkeys (Macaca mulatta) at peak lactation. Following GM17 and MRS agar plating, single bacterial colonies were isolated based on difference in morphotypes, then grouped based on whole-cell protein profiles on SDS–PAGE. Bacterial DNA was isolated and the sequence the 16S rRNA gene was analyzed. Results A total of 106 strains of 19 distinct bacterial species, belonging to five genera, Bacillus, Enterococcus, Lactobacillus, Pediococcus, and Streptococcus, were identified. Conclusions Maternal gut and oral commensal bacteria may be translocated to the mammary gland during lactation and present in milk. This pathway can be an important source of commensal bacteria to the infant gut and oral cavity. PMID:20946146

  8. The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species

    PubMed Central

    McGraw, Joseph E.; Jensen, Brittany J.; Bishop, Sydney S.; Lokken, James P.; Dorff, Kellen J.; Ripley, Michael P.; Munro, James B.

    2015-01-01

    Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. PMID:26497452

  9. The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species.

    PubMed

    Dailey, Frank E; McGraw, Joseph E; Jensen, Brittany J; Bishop, Sydney S; Lokken, James P; Dorff, Kellen J; Ripley, Michael P; Munro, James B

    2015-10-23

    Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains.

  10. The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species.

    PubMed

    Dailey, Frank E; McGraw, Joseph E; Jensen, Brittany J; Bishop, Sydney S; Lokken, James P; Dorff, Kellen J; Ripley, Michael P; Munro, James B

    2016-01-01

    Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. PMID:26497452

  11. Characterization of Mycolic Acids in Total Fatty Acid Methyl Ester Fractions from Mycobacterium Species by High Resolution MALDI-TOFMS.

    PubMed

    Teramoto, Kanae; Suga, Mitsuo; Sato, Takafumi; Wada, Takayuki; Yamamoto, Atsushi; Fujiwara, Nagatoshi

    2015-01-01

    Mycolic acids (MAs) are characteristic components of bacteria in the suborder Corynebacterineae, such as Mycobacterium. MAs are categorized into subclasses based on their functional bases (cyclopropane ring, methoxy, keto, and epoxy group). Since MAs have heterogeneity among bacterial species, analyzing of MAs are required in the chemotaxonomic field. However, their structural analysis is not easy because of their long carbon-chain lengths and several functional groups. In this study, total fatty acid (FA) methyl ester (ME) fraction of M. tuberculosis H37Rv was analyzed by matrix-assisted laser desorption/ionization (MALDI) time-of-flight mass spectrometry (TOFMS) with a spiral ion trajectory (MALDI spiral-TOFMS). The distributions of carbon-chain length and their relative peak intensities were confirmed with those obtained by analysis of each subclass fraction which was separated from total FA ME fraction using thin-layer chromatography (TLC). The observed major peaks were reliably assigned as MAs owing to the high mass accuracy (error<3 ppm). The types of MA subclasses, their distributions of carbon-chain lengths, their relative peak intensities, and the ratio of even- and odd-numbered carbon-chain MAs for the total FA ME fraction were consistent with those of MA subclass fractions. To visualize whole MAs, contour maps of relative peak intensities for whole MAs were created. The contour maps indicated the MA subclasses and their distributions of carbon-chains with relative peak intensities at a glance. Our proposed method allows simple characterization in a short time and thus enables the analysis of large numbers of samples, and it would contribute to the chemotaxonomy. PMID:26819906

  12. Raman and surface-enhanced Raman spectroscopy of amino acids and nucleotide bases for target bacterial vibrational mode identification

    NASA Astrophysics Data System (ADS)

    Guicheteau, Jason; Argue, Leanne; Hyre, Aaron; Jacobson, Michele; Christesen, Steven D.

    2006-05-01

    Raman and surface-enhanced Raman spectroscopy (SERS) studies of bacteria have reported a wide range of vibrational mode assignments associated with biological material. We present Raman and SER spectra of the amino acids phenylalanine, tyrosine, tryptophan, glutamine, cysteine, alanine, proline, methionine, asparagine, threonine, valine, glycine, serine, leucine, isoleucine, aspartic acid and glutamic acid and the nucleic acid bases adenosine, guanosine, thymidine, and uridine to better characterize biological vibrational mode assignments for bacterial target identification. We also report spectra of the bacteria Bacillus globigii, Pantoea agglomerans, and Yersinia rhodei along with band assignments determined from the reference spectra obtained.

  13. Analysis of bacterial diversity in acidic pond water and compost after treatment of artificial acid mine drainage for metal removal.

    PubMed

    Morales, Teresita A; Dopson, Mark; Athar, Rana; Herbert, Roger B

    2005-06-01

    The microbial population of a sludge amended leaf compost material utilized for treatment of artificial acid mine drainage was studied by culture-independent molecular methods. Iron-rich and sulfurous wastewater (artificial acid mine drainage) was circulated through a column bioreactor for 16 months. After 12 months the column was inoculated with a mixed culture from an acidic pond receiving acid mine drainage from a tailings impoundment at a decommissioned site in Kristineberg, North Sweden. Hydrogen sulfide odor and the formation of black precipitates indicated that sulfate-reduction occurred in the column. 16S rDNA gene analysis by denaturing gradient gel electrophoresis, cloning, and sequencing as well as fluorescent in situ hybridization confirmed the presence of microorganisms closely related to sulfate-reducing bacteria and microorganisms from the genera Pseudoxanthmonas, Dechlorosoma, Desulfovibrio, Agrobacterium, Methylocapsa, Rhodococcus, Sulfobacillus, and some unidentified bacteria. Sulfate-reducing bacteria were found in the column bioreactor 2 weeks after inoculation, but not thereafter. This suggests they were in low abundance, even though sulfate remediation rates were significant. Instead, the population contained species similar to those previously found to utilize humic substances released from the compost material. PMID:15818559

  14. Degradation of 4-chlorophenylacetic acid by a Pseudomonas species.

    PubMed Central

    Klages, U; Markus, A; Lingens, F

    1981-01-01

    Pseudomonas sp. strain CBS3 was able to utilize 4-chlorophenylacetic acid as the sole source of carbon and energy. When this strain was grown with 4-chlorophenylacetic acid, homoprotocatechuic acid was found to be an intermediate which was further metabolized by the meta-cleavage pathway. Furthermore, three isomers of chlorohydroxyphenylacetic acid, two of them identified as 3-chloro-4-hydroxyphenylacetic acid and 4-chloro-3-hydroxyphenylacetic acid, were isolated from the culture medium. 4-Hydroxyphenylacetic acid was catabolized in a different manner by the glutathione-dependent homogentisate pathway. Degradation enzymes of both of these pathways were inducible. PMID:7217006

  15. Topological characterization of a bacterial cellulose-acrylic acid polymeric matrix.

    PubMed

    Halib, N; Mohd Amin, M C I; Ahmad, I; Abrami, M; Fiorentino, S; Farra, R; Grassi, G; Musiani, F; Lapasin, R; Grassi, M

    2014-10-01

    This paper focuses on the micro- and nano-topological organization of a hydrogel, constituted by a mixture of bacterial cellulose and acrylic acid, and intended for biomedical applications. The presence of acrylic acid promotes the formation of two interpenetrated continuous phases: the primary "pores phase" (PP) containing only water and the secondary "polymeric network phase" (PNP) constituted by the polymeric network swollen by the water. Low field Nuclear Magnetic Resonance (LF NMR), rheology, Scanning Electron Microscopy (SEM) and release tests were used to determine the characteristics of the two phases. In particular, we found that this system is a strong hydrogel constituted by 81% (v/v) of PP phase the remaining part being occupied by the PNP phase. Pores diameters span in the range 10-100 μm, the majority of them (85%) falling in the range 30-90 μm. The high PP phase tortuosity indicates that big pores are not directly connected to each other, but their connection is realized by a series of interconnected small pores that rend the drug path tortuous. The PNP is characterized by a polymer volume fraction around 0.73 while mesh size is around 3 nm. The theoretical interpretation of the experimental data coming from the techniques panel adopted, yielded to the micro- and nano-organization of our hydrogel. PMID:24932712

  16. Biocompatible and mucoadhesive bacterial cellulose-g-poly(acrylic acid) hydrogels for oral protein delivery.

    PubMed

    Ahmad, Naveed; Amin, Mohd Cairul Iqbal Mohd; Mahali, Shalela Mohd; Ismail, Ismanizan; Chuang, Victor Tuan Giam

    2014-11-01

    Stimuli-responsive bacterial cellulose-g-poly(acrylic acid) hydrogels were investigated for their potential use as an oral delivery system for proteins. These hydrogels were synthesized using electron beam irradiation without any cross-linking agents, thereby eliminating any potential toxic effects associated with cross-linkers. Bovine serum albumin (BSA), a model protein drug, was loaded into the hydrogels, and the release profile in simulated gastrointestinal fluids was investigated. Cumulative release of less than 10% in simulated gastric fluid (SGF) demonstrated the potential of these hydrogels to protect BSA from the acidic environment of the stomach. Subsequent conformational stability analyses of released BSA by SDS-PAGE, circular dichroism, and an esterase activity assay indicated that the structural integrity and bioactivity of BSA was maintained and preserved by the hydrogels. Furthermore, an increase in BSA penetration across intestinal mucosa tissue was observed in an ex vivo penetration experiment. Our fabricated hydrogels exhibited excellent cytocompatibility and showed no sign of toxicity, indicating the safety of these hydrogels for in vivo applications.

  17. Species diversity of fishes in naturally acidic lakes in New Jersey

    SciTech Connect

    Graham, J.H. )

    1993-11-01

    Fish communities in acidic lakes of New Jersey have fewer species than do those in more alkaline lakes of comparable size. This conclusion is based on a multiple regression analysis of published data on fish communities, area, and pH in 85 lakes. Some interesting patterns emerge, however, when species are partitioned into introduced and native species. As expected, diversity of introduced species declines with increasing acidity. The number of native species in a particular lake, however, is independent of pH (range of 4.1 to 9.1). Although diversity of native species is not influenced by pH, species composition changes. The lack of a significant relationship between species diversity of native species and pH can be attributed to the replacement of acid-intolerant species by tolerant species. The smaller number of introduced species in acidic lakes is attributable to both fewer species stocked and a greater frequency of failure for those that were stocked. Species introduction records for largemouth bass Micropterus salmoides and bluegill Lepomis macrochirus, which are not native to New Jersey, reveal far more failed introduction in acidic waters than in neutral or alkaline waters. 54 refs., 6 figs., 5 tabs.

  18. Bacterial Utilization of L-sugars and D-amino Acids

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-01-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084

  19. Bacterial utilization of L-sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-08-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of

  20. Enterobacter morus sp. nov., a novel Enterobacter species associated with bacterial wilt on mulberry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A mulberry pathogenetic bacterial strain R18-2T isolated from the diseased mulberry root was analyzed by a polyphasic taxonomic study. Comparative 16S rRNA gene sequence analysis combined with rpoB gene sequence analysis allocated the strain R18-2T to the genus Enterobacter. The strain was Gram nega...

  1. Reactive Oxygen Species Mediated Bacterial Biofilm Inhibition via Zinc Oxide Nanoparticles and Their Statistical Determination

    PubMed Central

    Dwivedi, Sourabh; Wahab, Rizwan; Khan, Farheen; Mishra, Yogendra K.; Musarrat, Javed; Al-Khedhairy, Abdulaziz A.

    2014-01-01

    The formation of bacterial biofilm is a major challenge in clinical applications. The main aim of this study is to describe the synthesis, characterization and biocidal potential of zinc oxide nanoparticles (NPs) against bacterial strain Pseudomonas aeruginosa. These nanoparticles were synthesized via soft chemical solution process in a very short time and their structural properties have been investigated in detail by using X-ray diffraction and transmission electron microscopy measurements. In this work, the potential of synthesized ZnO-NPs (∼10–15 nm) has been assessed in-vitro inhibition of bacteria and the formation of their biofilms was observed using the tissue culture plate assays. The crystal violet staining on biofilm formation and its optical density revealed the effect on biofilm inhibition. The NPs at a concentration of 100 µg/mL significantly inhibited the growth of bacteria and biofilm formation. The biofilm inhibition by ZnO-NPs was also confirmed via bio-transmission electron microscopy (Bio-TEM). The Bio-TEM analysis of ZnO-NPs treated bacteria confirmed the deformation and damage of cells. The bacterial growth in presence of NPs concluded the bactericidal ability of NPs in a concentration dependent manner. It has been speculated that the antibacterial activity of NPs as a surface coating material, could be a feasible approach for controlling the pathogens. Additionally, the obtained bacterial solution data is also in agreement with the results from statistical analytical methods. PMID:25402188

  2. 'Lascolabacter vaginalis' strain KHD1, a new bacterial species cultivated from human female genital tract.

    PubMed

    Diop, K; Mediannikov, O; Fournier, P-E; Raoult, D; Bretelle, F; Fenollar, F

    2016-09-01

    We present the major characteristics of 'Lascolabacter vaginalis' strain KHD1 (= CSUR P0109 = DSM 101752), a new member of the family Prevotellaceae that was cultivated from a vaginal sample of a 33-year-old woman with bacterial vaginosis. PMID:27358744

  3. Lactobacillus species isolated from vaginal secretions of healthy and bacterial vaginosis-intermediate Mexican women: a prospective study

    PubMed Central

    2013-01-01

    Background Lactobacillus jensenii, L. iners, L. crispatus and L. gasseri are the most frequently occurring lactobacilli in the vagina. However, the native species vary widely according to the studied population. The present study was performed to genetically determine the identity of Lactobacillus strains present in the vaginal discharge of healthy and bacterial vaginosis (BV) intermediate Mexican women. Methods In a prospective study, 31 strains preliminarily identified as Lactobacillus species were isolated from 21 samples collected from 105 non-pregnant Mexican women. The samples were classified into groups according to the Nugent score criteria proposed for detection of BV: normal (N), intermediate (I) and bacterial vaginosis (BV). We examined the isolates using culture-based methods as well as molecular analysis of the V1–V3 regions of the 16S rRNA gene. Enterobacterial repetitive intergenic consensus (ERIC) sequence analysis was performed to reject clones. Results Clinical isolates (25/31) were classified into four groups based on sequencing and analysis of the 16S rRNA gene: L. acidophilus (14/25), L. reuteri (6/25), L. casei (4/25) and L. buchneri (1/25). The remaining six isolates were presumptively identified as Enterococcus species. Within the L. acidophilus group, L. gasseri was the most frequently isolated species, followed by L. jensenii and L. crispatus. L. fermentum, L. rhamnosus and L. brevis were also isolated, and were placed in the L. reuteri, L. casei and L. buchneri groups, respectively. ERIC profile analysis showed intraspecific variability amongst the L. gasseri and L. fermentum species. Conclusions These findings agree with previous studies showing that L. crispatus, L. gasseri and L. jensenii are consistently present in the healthy vaginal ecosystem. Additional species or phylotypes were detected in the vaginal microbiota of the non-pregnant Mexican (Hispanic-mestizo) population, and thus, these results further our understanding of

  4. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor

    PubMed Central

    Esfandiari, Leyla; Wang, Siqing; Wang, Siqi; Banda, Anisha; Lorenzini, Michael; Kocharyan, Gayane; Monbouquette, Harold G.; Schmidt, Jacob J.

    2016-01-01

    A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli) 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL) depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD) of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids. PMID:27455337

  5. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor.

    PubMed

    Esfandiari, Leyla; Wang, Siqing; Wang, Siqi; Banda, Anisha; Lorenzini, Michael; Kocharyan, Gayane; Monbouquette, Harold G; Schmidt, Jacob J

    2016-07-22

    A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli) 16S rRNA at 10 fM, which corresponds to ~100-1000 colony forming units/mL (CFU/mL) depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD) of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.

  6. Dietary supplementation of usnic acid, an antimicrobial compound in lichens, does not affect rumen bacterial diversity or density in reindeer.

    PubMed

    Glad, Trine; Barboza, Perry; Mackie, Roderick I; Wright, André-Denis G; Brusetti, Lorenzo; Mathiesen, Svein D; Sundset, Monica A

    2014-06-01

    Reindeer (Rangifer tarandus tarandus) may include large proportions of lichens in their winter diet. These dietary lichens are rich in phenolic secondary compounds, the most well-known being the antimicrobial usnic acid. Previous studies have shown that reindeer host rumen bacteria resistant to usnic acid and that usnic acid is quickly detoxified in their rumen. In the present study, reindeer (n = 3) were sampled before, during, and after usnic acid supplementation to determine the effect on their rumen microbial ecology. Ad libitum intake of usnic acid averaged up to 278 mg/kg body mass. Population densities of rumen bacteria and methanogenic archaea determined by real-time PCR, ranged from 1.36 × 10(9) to 11.8 × 10(9) and 9.0 × 10(5) to 1.35 × 10(8) cells/g wet weight, respectively, and the two populations did not change significantly during usnic acid supplementation (repeated measures ANOVA) or vary significantly between the rumen liquid and particle fraction (paired t test). Rumen bacterial community structure determined by denaturing gradient gel electrophoresis did not change in response to intake of usnic acid. Firmicutes (38.7 %) and Bacteriodetes (27.4 %) were prevalent among the 16S rRNA gene sequences (n = 62) from the DGGE gels, but representatives of the phyla Verrucomicrobia (14.5 %) and Proteobacteria (1.6 %) were also detected. Rapid detoxification of the usnic acid or resistance to usnic acid may explain why the diversity of the dominant bacterial populations and the bacterial density in the reindeer rumen does not change during usnic acid supplementation.

  7. Regulation of host weight gain and lipid metabolism by bacterial bile acid modification in the gut.

    PubMed

    Joyce, Susan A; MacSharry, John; Casey, Patrick G; Kinsella, Michael; Murphy, Eileen F; Shanahan, Fergus; Hill, Colin; Gahan, Cormac G M

    2014-05-20

    Alterations in the gastrointestinal microbiota have been implicated in obesity in mice and humans, but the key microbial functions influencing host energy metabolism and adiposity remain to be determined. Despite an increased understanding of the genetic content of the gastrointestinal microbiome, functional analyses of common microbial gene sets are required. We established a controlled expression system for the parallel functional analysis of microbial alleles in the murine gut. Using this approach we show that bacterial bile salt hydrolase (BSH) mediates a microbe-host dialogue that functionally regulates host lipid metabolism and plays a profound role in cholesterol metabolism and weight gain in the host. Expression of cloned BSH enzymes in the gastrointestinal tract of gnotobiotic or conventionally raised mice significantly altered plasma bile acid signatures and regulated transcription of key genes involved in lipid metabolism (Pparγ, Angptl4), cholesterol metabolism (Abcg5/8), gastrointestinal homeostasis (RegIIIγ), and circadian rhythm (Dbp, Per1/2) in the liver or small intestine. High-level expression of BSH in conventionally raised mice resulted in a significant reduction in host weight gain, plasma cholesterol, and liver triglycerides, demonstrating the overall impact of elevated BSH activity on host physiology. In addition, BSH activity in vivo varied according to BSH allele group, indicating that subtle differences in activity can have significant effects on the host. In summary, we demonstrate that bacterial BSH activity significantly impacts the systemic metabolic processes and adiposity in the host and represents a key mechanistic target for the control of obesity and hypercholesterolemia. PMID:24799697

  8. Genome sequencing of environmental Escherichia coli expands understanding of the ecology and speciation of the model bacterial species.

    PubMed

    Luo, Chengwei; Walk, Seth T; Gordon, David M; Feldgarden, Michael; Tiedje, James M; Konstantinidis, Konstantinos T

    2011-04-26

    Defining bacterial species remains a challenging problem even for the model bacterium Escherichia coli and has major practical consequences for reliable diagnosis of infectious disease agents and regulations for transport and possession of organisms of economic importance. E. coli traditionally is thought to live within the gastrointestinal tract of humans and other warm-blooded animals and not to survive for extended periods outside its host; this understanding is the basis for its widespread use as a fecal contamination indicator. Here, we report the genome sequences of nine environmentally adapted strains that are phenotypically and taxonomically indistinguishable from typical E. coli (commensal or pathogenic). We find, however, that the commensal genomes encode for more functions that are important for fitness in the human gut, do not exchange genetic material with their environmental counterparts, and hence do not evolve according to the recently proposed fragmented speciation model. These findings are consistent with a more stringent and ecologic definition for bacterial species than the current definition and provide means to start replacing traditional approaches of defining distinctive phenotypes for new species with omics-based procedures. They also have important implications for reliable diagnosis and regulation of pathogenic E. coli and for the coliform cell-counting test.

  9. Loofah sponges as reservoirs and vehicles in the transmission of potentially pathogenic bacterial species to human skin.

    PubMed

    Bottone, E J; Perez, A A; Oeser, J L

    1994-02-01

    Loofah sponges are natural products used as exfoliative beauty aids. As a consequence of tracing a case of Pseudomonas aeruginosa folliculitis to a contaminated loofah sponge, we assessed the role of loofah sponges in supporting the growth of a wide variety of bacterial species. Our data show growth enhancement of sterile loofah fragments for numerous gram-negative (Pseudomonas, Xanthomonas, and Klebsiella) and gram-positive (Enterococcus and group B Streptococcus) species of human and environmental origin. Furthermore, hydrated new, unused loofah sponges undergo a shift in bacterial flora from sparse colonies of Bacillus spp. and Staphylococcus epidermidis to a predominantly gram-negative flora. The growth-promoting potential of loofah sponges (and other exfoliatives) can be further augmented by desquamated epithelial cells entrapped in the loofah fibrous matrix. Therefore, as loofah sponges (and other exfoliatives) can serve as a reservoir and a vehicle for the transmission of potentially pathogenic species to the human skin, we recommend their decontamination with hypochlorite (10%) bleach at regular intervals. PMID:8150959

  10. A genomic approach to bacterial taxonomy: an examination and proposed reclassification of species within the genus Neisseria.

    PubMed

    Bennett, Julia S; Jolley, Keith A; Earle, Sarah G; Corton, Craig; Bentley, Stephen D; Parkhill, Julian; Maiden, Martin C J

    2012-06-01

    In common with other bacterial taxa, members of the genus Neisseria are classified using a range of phenotypic and biochemical approaches, which are not entirely satisfactory in assigning isolates to species groups. Recently, there has been increasing interest in using nucleotide sequences for bacterial typing and taxonomy, but to date, no broadly accepted alternative to conventional methods is available. Here, the taxonomic relationships of 55 representative members of the genus Neisseria have been analysed using whole-genome sequence data. As genetic material belonging to the accessory genome is widely shared among different taxa but not present in all isolates, this analysis indexed nucleotide sequence variation within sets of genes, specifically protein-coding genes that were present and directly comparable in all isolates. Variation in these genes identified seven species groups, which were robust to the choice of genes and phylogenetic clustering methods used. The groupings were largely, but not completely, congruent with current species designations, with some minor changes in nomenclature and the reassignment of a few isolates necessary. In particular, these data showed that isolates classified as Neisseria polysaccharea are polyphyletic and probably include more than one taxonomically distinct organism. The seven groups could be reliably and rapidly generated with sequence variation within the 53 ribosomal protein subunit (rps) genes, further demonstrating that ribosomal multilocus sequence typing (rMLST) is a practicable and powerful means of characterizing bacteria at all levels, from domain to strain.

  11. Fatty acid composition of seeds of some species of Nepeta L.

    PubMed

    Kiliç, Turgut; Dirmenci, Tuncay; Gören, Ahmet C

    2007-05-01

    The fatty acid compositions of Nepeta viscida, N. cilicica, N. crinita, N. nuda ssp. glandulifera and N. aristata were analyzed by GC/MS. The main free fatty acids were found as linolenic acid (49.8-58.5%), linoleic acid (10.9-23.5%), oleic acid (11.5-19.2%), palmitic acid (5.2-6.8%) and stearic acid (2.0-3.7%) and, total fatty acid compositions of species were analyzed and results were found as 36.2-49.8%, 17.1-25.8%, 15.4-25.8%, 6.4-7.8%, and 2.7-4.1%, respectively.

  12. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    SciTech Connect

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-10-23

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  13. Acute toxicity of peracetic acid to various fish species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Peracetic acid (PAA; also called peroxyacetic acid) is a promising disinfectant in the US aquaculture industry to control parasites and fungus. It is a stabilized mixture of acetic acid and hydrogen peroxide that does not leave dangerous residues in the environment when it breaks down as most compo...

  14. Dietary Omega-3 Fatty Acids Increase Survival and Decrease Bacterial Load in Mice Subjected to Staphylococcus aureus-Induced Sepsis.

    PubMed

    Svahn, Sara L; Ulleryd, Marcus A; Grahnemo, Louise; Ståhlman, Marcus; Borén, Jan; Nilsson, Staffan; Jansson, John-Olov; Johansson, Maria E

    2016-04-01

    Sepsis caused by Staphylococcus aureus is increasing in incidence. With the alarming use of antibiotics,S. aureus is prone to become methicillin resistant. Antibiotics are the only widely used pharmacological treatment for sepsis. Interestingly, mice fed high-fat diet (HFD) rich in polyunsaturated fatty acids have better survival of S. aureus-induced sepsis than mice fed HFD rich in saturated fatty acids (HFD-S). To investigate what component of polyunsaturated fatty acids, i.e., omega-3 or omega-6 fatty acids, exerts beneficial effects on the survival of S. aureus-induced sepsis, mice were fed HFD rich in omega-3 or omega-6 fatty acids for 8 weeks prior to inoculation with S. aureus Further, mice fed HFD-S were treated with omega-3 fatty acid metabolites known as resolvins. Mice fed HFD rich in omega-3 fatty acids had increased survival and decreased bacterial loads compared to those for mice fed HFD-S after S. aureus-induced sepsis. Furthermore, the bacterial load was decreased in resolvin-treated mice fed HFD-S after S. aureus-induced sepsis compared with that in mice treated with vehicle. Dietary omega-3 fatty acids increase the survival of S. aureus-induced sepsis by reversing the deleterious effect of HFD-S on mouse survival.

  15. Dietary Omega-3 Fatty Acids Increase Survival and Decrease Bacterial Load in Mice Subjected to Staphylococcus aureus-Induced Sepsis

    PubMed Central

    Ulleryd, Marcus A.; Grahnemo, Louise; Ståhlman, Marcus; Borén, Jan; Nilsson, Staffan; Jansson, John-Olov

    2016-01-01

    Sepsis caused by Staphylococcus aureus is increasing in incidence. With the alarming use of antibiotics, S. aureus is prone to become methicillin resistant. Antibiotics are the only widely used pharmacological treatment for sepsis. Interestingly, mice fed high-fat diet (HFD) rich in polyunsaturated fatty acids have better survival of S. aureus-induced sepsis than mice fed HFD rich in saturated fatty acids (HFD-S). To investigate what component of polyunsaturated fatty acids, i.e., omega-3 or omega-6 fatty acids, exerts beneficial effects on the survival of S. aureus-induced sepsis, mice were fed HFD rich in omega-3 or omega-6 fatty acids for 8 weeks prior to inoculation with S. aureus. Further, mice fed HFD-S were treated with omega-3 fatty acid metabolites known as resolvins. Mice fed HFD rich in omega-3 fatty acids had increased survival and decreased bacterial loads compared to those for mice fed HFD-S after S. aureus-induced sepsis. Furthermore, the bacterial load was decreased in resolvin-treated mice fed HFD-S after S. aureus-induced sepsis compared with that in mice treated with vehicle. Dietary omega-3 fatty acids increase the survival of S. aureus-induced sepsis by reversing the deleterious effect of HFD-S on mouse survival. PMID:26857576

  16. Hemoglobin toxicity in experimental bacterial peritonitis is due to production of reactive oxygen species.

    PubMed

    Yoo, Y M; Kim, K M; Kim, S S; Han, J A; Lea, H Z; Kim, Y M

    1999-11-01

    Hemoglobin (Hb) is a toxic molecule responsible for the extreme lethality associated with experimental Escherichia coli peritonitis, but the mechanism has yet to be elucidated. Hb, but not globin, showed toxic effects in a live E. coli model but not in a model using killed E. coli. Methemoglobin, hematin, and the well-known Fenton reagents iron and iron-EDTA demonstrated the same lethal effect in E. coli peritonitis as Hb, while the addition of the Fenton inhibitors desferrioxamine (DF) and diethylenetriamine pentaacetate removed most of the cytotoxic activity of iron. Administration of a combined dose of superoxide dismutase and catalase minimized the action of Hb and iron-EDTA, suggesting that both O(2)(.-) and H(2)O(2) are involved in the toxic action of Hb in this rat model. The combination of the antioxidative enzymes and DF further suppressed iron-mediated lethality. An electron spin resonance technique with the spin-trapping reagent 5, 5-dimethyl-1-pyroline-N-oxide (DMPO) showed O(2)(.-) generation in the peritoneal fluid of rats injected with E. coli alone or E. coli plus iron-DF, and (.)OH generation was detected in the peritoneal fluid of the rats injected with iron-EDTA. Hb did not show any spin adduct of oxygen radicals, suggesting that Hb produces non-spin-trapping radical ferryl ion, which decayed the spin adduct of DMPO. In the presence of Hb or iron-EDTA, O(2)(-)-generating activity and viability of phagocytes decreased, whereas lipid peroxidation of peritoneal phagocytes increased. Generation of oxygen radicals and lipid peroxidation did not differ in the live and dead bacterial models. Bacterial numbers in the peritoneal cavity and blood were markedly increased in the live bacterial model with Hb and iron-EDTA. The Fenton inhibitor iron-DF prevented the loss of phagocyte function, lipid peroxidation, and bacterial proliferation. These results led us to conclude that the lethal toxicity of Hb in bacterial peritonitis is associated with a Fenton

  17. Bacterial delta-aminolevulinic acid synthase activity is not essential for leghemoglobin formation in the soybean/Bradyrhizobium japonicum symbiosis

    SciTech Connect

    Guerinot, M.L.; Chelm, B.K.

    1986-03-01

    Previous studies of legume nodules have indicated that formation of the heme moiety of leghemoglobin is a function of the bacterial symbiont. The authors now show that a hemA mutant of Bradyrhizobium japonicum that cannot carry out the first step in heme biosynthesis forms fully effective nodules on soybeans. The bacterial mutant strain was constructed by first isolated the wild-type hemA gene encoding delta-aminolevulinic acid synthase (EC 2.3.1.37) from a cosmid library, using a fragment of the Rhizobium meliloti hemA gene as a hybridization probe. A deletion of the hemA gene region, generated in vitro, then was used to construct the analogous chromosomal mutation by gene-directed mutagenesis. The mutant strain had no delta-aminolevulinic acid synthase activity and was unable to grow in minimal medium unless delta-aminolevulinic acid was added. Despite its auxotrophy, the mutant strain incited nodules that appeared normal, contained heme, and were capable of high levels of acetylene reduction. These results rule out bacterial delta-aminolevulinic acid synthase activity as the exclusive source of delta-aminolevulinic acid for heme formation in soybean nodules.

  18. Quantitative thermodynamic predication of interactions between nucleic acid and non-nucleic acid species using Microsoft excel.

    PubMed

    Zou, Jiaqi; Li, Na

    2013-09-01

    Proper design of nucleic acid sequences is crucial for many applications. We have previously established a thermodynamics-based quantitative model to help design aptamer-based nucleic acid probes by predicting equilibrium concentrations of all interacting species. To facilitate customization of this thermodynamic model for different applications, here we present a generic and easy-to-use platform to implement the algorithm of the model with Microsoft(®) Excel formulas and VBA (Visual Basic for Applications) macros. Two Excel spreadsheets have been developed: one for the applications involving only nucleic acid species, the other for the applications involving both nucleic acid and non-nucleic acid species. The spreadsheets take the nucleic acid sequences and the initial concentrations of all species as input, guide the user to retrieve the necessary thermodynamic constants, and finally calculate equilibrium concentrations for all species in various bound and unbound conformations. The validity of both spreadsheets has been verified by comparing the modeling results with the experimental results on nucleic acid sequences reported in the literature. This Excel-based platform described here will allow biomedical researchers to rationalize the sequence design of nucleic acid probes using the thermodynamics-based modeling even without relevant theoretical and computational skills.

  19. Characteristics of organic acids in the fruit of different pumpkin species.

    PubMed

    Nawirska-Olszańska, Agnieszka; Biesiada, Anita; Sokół-Łętowska, Anna; Kucharska, Alicja Z

    2014-04-01

    The aim of the research was to determine the composition of organic acids in fruit of different cultivars of three pumpkin species. The amount of acids immediately after fruit harvest and after 3 months of storage was compared. The content of organic acids in the examined pumpkin cultivars was assayed using the method of high performance liquid chromatography (HPLC). Three organic acids (citric acid, malic acid, and fumaric acid) were identified in the cultivars, whose content considerably varied depending on a cultivar. Three-month storage resulted in decreased content of the acids in the case of cultivars belonging to Cucurbita maxima and Cucurbita pepo species, while a slight increase was recorded for Cucurbita moschata species.

  20. Use of poly(lactic acid) amendments to promote the bacterial fixation of metals in zinc smelter tailings.

    PubMed

    Edenborn, H M

    2004-04-01

    The ability of poly(lactic acid) (PLA) to serve as a long-term source of lactic acid for bacterial sulfate reduction activity in zinc smelter tailings was investigated. Solid PLA polymers mixed in water hydrolyzed abiotically to release lactic acid into solution over an extended period of time. The addition of both PLA and gypsum was required for indigenous bacteria to lower redox potential, raise pH, and stimulate sulfate reduction activity in highly oxidized smelter tailings after one year of treatment. Bioavailable cadmium, copper, lead and zinc were all lowered significantly in PLA/gypsum treated soil, but PLA amendments alone increased the bioavailability of lead, nickel and zinc. Similar PLA amendments may be useful in constructed wetlands and reactive barrier walls for the passive treatment of mine drainage, where enhanced rates of bacterial sulfate reduction are desirable.

  1. Discovery of Rickettsia species in Dermacentor niveus Neumann ticks by investigating the diversity of bacterial communities.

    PubMed

    Zhuang, Lu; Wang, Cheng-Yan; Tong, Yi-Gang; Tang, Fang; Yang, Hong; Liu, Wei; Cao, Wu-Chun

    2014-09-01

    Ticks (Dermacentor niveus Neumann) were collected from Tacheng, Xinjiang Uygur Autonomous Region, and their bacterial diversity was investigated using the 16S RNA gene library method from one pooled sample. A total of 452 clones was successfully sequenced and assigned to 4 phyla. The dominant phylum was the Proteobacteria, accounting for 62.8% of all the clones of the 16S rRNA gene at the confidence level 80%. The other sequences were assigned to the phyla Bacteroidetes, Firmicutes, Actinobacteria and accounted for 13.5%, 12.4%, and 11.3%, respectively. These results provide an insight into the bacterial diversity associated with D. niveus ticks in the natural environment of Tacheng. They indicate the occurrence of Rickettsia raoultii and Rickettsia slovaca in D. niveus ticks in this area, and as a consequence, cases of TIBOLA/DEBONEL may occur (tick-borne lymphadenopathy/Dermacentor-borne necrosis erythema and lymphadenopathy).

  2. Rhizosphere bacterial carbon turnover is higher in nucleic acids than membrane lipids: implications for understanding soil carbon cycling

    PubMed Central

    Malik, Ashish A.; Dannert, Helena; Griffiths, Robert I.; Thomson, Bruce C.; Gleixner, Gerd

    2015-01-01

    Using a pulse chase 13CO2 plant labeling experiment we compared the flow of plant carbon into macromolecular fractions of rhizosphere soil microorganisms. Time dependent 13C dilution patterns in microbial cellular fractions were used to calculate their turnover time. The turnover times of microbial biomolecules were found to vary: microbial RNA (19 h) and DNA (30 h) turned over fastest followed by chloroform fumigation extraction-derived soluble cell lysis products (14 days), while phospholipid fatty acids (PLFAs) had the slowest turnover (42 days). PLFA/NLFA 13C analyses suggest that both mutualistic arbuscular mycorrhizal and saprophytic fungi are dominant in initial plant carbon uptake. In contrast, high initial 13C enrichment in RNA hints at bacterial importance in initial C uptake due to the dominance of bacterial derived RNA in total extracts of soil RNA. To explain this discrepancy, we observed low renewal rate of bacterial lipids, which may therefore bias lipid fatty acid based interpretations of the role of bacteria in soil microbial food webs. Based on our findings, we question current assumptions regarding plant-microbe carbon flux and suggest that the rhizosphere bacterial contribution to plant assimilate uptake could be higher. This highlights the need for more detailed quantitative investigations with nucleic acid biomarkers to further validate these findings. PMID:25914679

  3. Comparative Genomics of the Bacterial Genus Streptococcus Illuminates Evolutionary Implications of Species Groups

    PubMed Central

    Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; Klenk, Hans-Peter; Li, Wen-Jun

    2014-01-01

    Members of the genus Streptococcus within the phylum Firmicutes are among the most diverse and significant zoonotic pathogens. This genus has gone through considerable taxonomic revision due to increasing improvements of chemotaxonomic approaches, DNA hybridization and 16S rRNA gene sequencing. It is proposed to place the majority of streptococci into “species groups”. However, the evolutionary implications of species groups are not clear presently. We use comparative genomic approaches to yield a better understanding of the evolution of Streptococcus through genome dynamics, population structure, phylogenies and virulence factor distribution of species groups. Genome dynamics analyses indicate that the pan-genome size increases with the addition of newly sequenced strains, while the core genome size decreases with sequential addition at the genus level and species group level. Population structure analysis reveals two distinct lineages, one including Pyogenic, Bovis, Mutans and Salivarius groups, and the other including Mitis, Anginosus and Unknown groups. Phylogenetic dendrograms show that species within the same species group cluster together, and infer two main clades in accordance with population structure analysis. Distribution of streptococcal virulence factors has no obvious patterns among the species groups; however, the evolution of some common virulence factors is congruous with the evolution of species groups, according to phylogenetic inference. We suggest that the proposed streptococcal species groups are reasonable from the viewpoints of comparative genomics; evolution of the genus is congruent with the individual evolutionary trajectories of different species groups. PMID:24977706

  4. Effect of acidic electrolyzed water on the viability of bacterial and fungal plant pathogens and on bacterial spot disease of tomato.

    PubMed

    Abbasi, P A; Lazarovits, G

    2006-10-01

    Acidic electrolyzed water (AEW), known to have germicidal activity, was obtained after electrolysis of 0.045% aqueous solution of sodium chloride. Freshly prepared AEW (pH 2.3-2.6, oxidation-reduction potential 1007-1025 mV, and free active chlorine concentration 27-35 ppm) was tested in vitro and (or) on tomato foliage and seed surfaces for its effects on the viability of plant pathogen propagules that could be potential seed contaminants. Foliar sprays of AEW were tested against bacterial spot disease of tomato under greenhouse and field conditions. The viability of propagules of Xanthomonas campestris pv. vesicatoria (bacterial spot pathogen), Streptomyces scabies (potato scab pathogen), and Fusarium oxysporum f.sp. lycopersici (root rot pathogen) was significantly reduced 4-8 log units within 2 min of exposure to AEW. Immersion of tomato seed from infected fruit in AEW for 1 and 3 min significantly reduced the populations of X. campestris pv. vesicatoria from the surface of the seed without affecting seed germination. Foliar sprays of AEW reduced X. campestris pv. vesicatoria populations and leaf spot severity on tomato foliage in the greenhouse. In the field, multiple sprays of AEW consistently reduced bacterial spot severity on tomato foliage. Disease incidence and severity was also reduced on fruit, but only in 2003. Fruit yield was either enhanced or not affected by the AEW sprays. These results indicate a potential use of AEW as a seed surface disinfectant or contact bactericide. PMID:17110959

  5. Multilocus sequence analysis of xanthomonads causing bacterial spot of tomato and pepper plants reveals strains generated by recombination among species and recent global spread of Xanthomonas gardneri.

    PubMed

    Timilsina, Sujan; Jibrin, Mustafa O; Potnis, Neha; Minsavage, Gerald V; Kebede, Misrak; Schwartz, Allison; Bart, Rebecca; Staskawicz, Brian; Boyer, Claudine; Vallad, Gary E; Pruvost, Olivier; Jones, Jeffrey B; Goss, Erica M

    2015-02-01

    Four Xanthomonas species are known to cause bacterial spot of tomato and pepper, but the global distribution and genetic diversity of these species are not well understood. A collection of bacterial spot-causing strains from the Americas, Africa, Southeast Asia, and New Zealand were characterized for genetic diversity and phylogenetic relationships using multilocus sequence analysis of six housekeeping genes. By examining strains from different continents, we found unexpected phylogeographic patterns, including the global distribution of a single multilocus haplotype of X. gardneri, possible regional differentiation in X. vesicatoria, and high species diversity on tomato in Africa. In addition, we found evidence of multiple recombination events between X. euvesicatoria and X. perforans. Our results indicate that there have been shifts in the species composition of bacterial spot pathogen populations due to the global spread of dominant genotypes and that recombination between species has generated genetic diversity in these populations. PMID:25527544

  6. Magnetic resonance tells microbiology where to go; bacterial teichoic acid protects liquid water at sub-zero temperatures

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Wickham, Jason R.; Eastman, Margaret A.; Harrison, William; Pereira, Mark P.; Brown, Eric D.

    2008-08-01

    Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, although, with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as high salt concentration (brine veins) and adhesion to particulates or ice crystal defects. Teichoic acid is a phosphodiester polymer ubiquitous in Gram positive bacteria, composing 50% of the mass of the bacterial cell wall and excreted into the extracellular space of biofilm communities. We have found that when bound to the peptidoglycan cell wall (wall teichoic acid) or as a free molecule (lipoteichoic acid), teichoic acid is surrounded by liquid water at temperatures significantly below freezing. Using solid-state NMR, we are unable to collect 31P CPMAS spectra for frozen solutions of lipoteichoic acid at temperatures above -60 °C. For wall teichoic acid in D2O, signals are not seen above -30 °C. These results can be explained by the presence of liquid water, which permits rapid molecular motion to remove 1H/31P dipolar coupling. 2H quadrupole echo NMR spectroscopy reveals that both liquid and solid water are present. We suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.

  7. Rosmarinic acid is a homoserine lactone mimic produced by plants that activates a bacterial quorum-sensing regulator.

    PubMed

    Corral-Lugo, Andrés; Daddaoua, Abdelali; Ortega, Alvaro; Espinosa-Urgel, Manuel; Krell, Tino

    2016-01-05

    Quorum sensing is a bacterial communication mechanism that controls genes, enabling bacteria to live as communities, such as biofilms. Homoserine lactone (HSL) molecules function as quorum-sensing signals for Gram-negative bacteria. Plants also produce previously unidentified compounds that affect quorum sensing. We identified rosmarinic acid as a plant-derived compound that functioned as an HSL mimic. In vitro assays showed that rosmarinic acid bound to the quorum-sensing regulator RhlR of Pseudomonas aeruginosa PAO1 and competed with the bacterial ligand N-butanoyl-homoserine lactone (C4-HSL). Furthermore, rosmarinic acid stimulated a greater increase in RhlR-mediated transcription in vitro than that of C4-HSL. In P. aeruginosa, rosmarinic acid induced quorum sensing-dependent gene expression and increased biofilm formation and the production of the virulence factors pyocyanin and elastase. Because P. aeruginosa PAO1 infection induces rosmarinic acid secretion from plant roots, our results indicate that rosmarinic acid secretion is a plant defense mechanism to stimulate a premature quorum-sensing response. P. aeruginosa is a ubiquitous pathogen that infects plants and animals; therefore, identification of rosmarinic acid as an inducer of premature quorum-sensing responses may be useful in agriculture and inform human therapeutic strategies.

  8. Dihydrolipoic but not alpha-lipoic acid affects susceptibility of eukaryotic cells to bacterial invasion.

    PubMed

    Bozhokina, Ekaterina; Khaitlina, Sofia; Gamaley, Irina

    2015-05-01

    Sensitivity of eukaryotic cells to facultative pathogens can depend on physiological state of host cells. Previously we have shown that pretreatment of HeLa cells with N-acetylcysteine (NAC) makes the cells 2-3-fold more sensitive to invasion by the wild-type Serratia grimesii and recombinant Escherichia coli expressing gene of actin-specific metalloprotease grimelysin [1]. To evaluate the impact of chemically different antioxidants, in the present work we studied the effects of α-Lipoic acid (LA) and dihydrolipoic acid (DHLA) on efficiency of S. grimesii and recombinant E. coli expressing grimelysin gene to penetrate into HeLa and CaCo cells. Similarly to the effect of NAC, pretreatment of HeLa and CaCo cells with 0.6 or 1.25 mM DHLA increased the entry of grimelysin producing bacteria by a factor of 2.5 and 3 for the wild-type S. grimesii and recombinant E. coli, respectively. In contrast, pretreatment of the cells with 0.6 or 1.25 mM LA did not affect the bacteria uptake. The increased invasion of HeLa and CaCo cells correlated with the enhanced expression of E-cadherin and β-catenin genes, whereas expression of these genes in the LA-treated cells was not changed. Comparison of these results suggests that it is sulfhydryl group of DHLA that promotes efficient modification of cell properties assisting bacterial uptake. We assume that the NAC- and DHLA-induced stimulation of the E-cadherin-catenin pathway contributes to the increased internalization of the grimelysin producing bacteria within transformed cells.

  9. Malic acid production from thin stillage by Aspergillus species.

    PubMed

    West, Thomas P

    2011-12-01

    The ability of Aspergillus strains to utilize thin stillage to produce malic acid was compared. The highest malic acid was produced by Aspergillus niger ATCC 9142 at 17 g l(-1). Biomass production from thin stillage was similar with all strains but ATCC 10577 was the highest at 19 g l(-1). The highest malic acid yield (0.8 g g(-1)) was with A. niger ATCC 9142 and ATCC 10577 on the stillage. Thus, thin stillage has the potential to act as a substrate for the commercial production of food-grade malic acid by the A. niger strains.

  10. On the nature and origin of acidic species in petroleum. 1. Detailed acid type distribution in a California crude oil.

    SciTech Connect

    Tomczyk, N. A.; Winans, R. E.; Shinn, J. H.; Robinson, R. C.; Chemistry; Chevron Research and Technology Co.

    2001-11-21

    Acidity in crude oils has long been a problem for refining. Knowledge of the detailed chemical composition of the acids responsible for corrosion can facilitate identification of problem crude oils and potentially lead to improved processing options for corrosive oils. A highly aerobically biodegraded crude from the San Joaquin Valley, which has a long history of causing corrosion problems during refining, was the subject of this study. The oil was first extracted with base, then acidified and extracted with petroleum ether. A portion of the resulting acid fraction was methylated. The unmethylated extract was analyzed by FTIR, NMR, and the methylated sample was analyzed by high-resolution mass spectrometry (HRMS). Over 96% of the ions observed in HRMS have been assigned reliable formulas. Considerably greater functionality is seen in this sample than would be presumed from the 'naphthenic acid' title typically assigned to these species. Although over 60% of the compounds contained two or more oxygens, compounds containing only oxygen heteroatoms accounted for less than 10% of the acidic compounds identified. Approximately one-half of the species contained nitrogen and about one-fourth contained sulfur. It is believed that microbial degradation is a major source of these acidic components. It was also observed that acid species with higher degrees of heteroatom substitution generally also had a higher degree of saturation than those species having less heteroatoms, possibly due to impeded migration of highly substituted, less-saturated species.

  11. Acyl Carrier Protein Synthases from Gram-Negative, Gram-Positive, and Atypical Bacterial Species: Biochemical and Structural Properties and Physiological Implications

    PubMed Central

    McAllister, Kelly A.; Peery, Robert B.; Zhao, Genshi

    2006-01-01

    Acyl carrier protein (ACP) synthase (AcpS) catalyzes the transfer of the 4′-phosphopantetheine moiety from coenzyme A (CoA) onto a serine residue of apo-ACP, resulting in the conversion of apo-ACP to the functional holo-ACP. The holo form of bacterial ACP plays an essential role in mediating the transfer of acyl fatty acid intermediates during the biosynthesis of fatty acids and phospholipids. AcpS is therefore an attractive target for therapeutic intervention. In this study, we have purified and characterized the AcpS enzymes from Escherichia coli, Streptococcus pneumoniae, and Mycoplasma pneumoniae, which exemplify gram-negative, gram-positive, and atypical bacteria, respectively. Our gel filtration column chromatography and cross-linking studies demonstrate that the AcpS enzyme from M. pneumoniae, like E. coli enzyme, exhibits a homodimeric structure, but the enzyme from S. pneumoniae exhibits a trimeric structure. Our biochemical studies show that the AcpS enzymes from M. pneumoniae and S. pneumoniae can utilize both short- and long-chain acyl CoA derivatives but prefer long-chain CoA derivatives as substrates. On the other hand, the AcpS enzyme from E. coli can utilize short-chain CoA derivatives but not the long-chain CoA derivatives tested. Finally, our biochemical studies show that M. pneumoniae AcpS is kinetically a very sluggish enzyme compared with those from E. coli and S. pneumoniae. Together, the results of these studies show that the AcpS enzymes from different bacterial species exhibit different native structures and substrate specificities with regard to the utilization of CoA and its derivatives. These findings suggest that AcpS from different microorganisms plays a different role in cellular physiology. PMID:16788183

  12. Maternal Vitamin D, Folate, and Polyunsaturated Fatty Acid Status and Bacterial Vaginosis during Pregnancy

    PubMed Central

    Dunlop, Anne L.; Taylor, Robert N.; Tangpricha, Vin; Fortunato, Stephen; Menon, Ramkumar

    2011-01-01

    Objective. To investigate associations among serum 25-hydroxy-vitamin D (25-OH-D), folate, omega-6/omega-3 fatty acid ratio and bacterial vaginosis (BV) during pregnancy. Methods. Biospecimens and data were derived from a random sample (N = 160) of women from the Nashville Birth Cohort. We compared mean plasma nutrient concentrations for women with and without BV during pregnancy (based on Nugent score ≥7) and assessed the odds of BV for those with 25-OH-D <12 ng/mL, folate <5 ug/L, and omega-6/omega-3 ratio >15. Results. The mean plasma 25-OH-D was significantly lower among women with BV during pregnancy (18.00±8.14 ng/mL versus 24.34±11.97 ng/mL, P = 0.044). The adjusted odds of BV were significantly increased among pregnant women with 25-OH-D <12 ng/mL (aOR 5.11, 95% CI: 1.19–21.97) and folate <5 ug/L (aOR 7.06, 95% CI: 1.07–54.05). Conclusion. Vitamin D and folate deficiencies were strongly associated with BV (Nugent score ≥7) during pregnancy. PMID:22190843

  13. Efficacy of Poly-Lactic-Co-Glycolic Acid Micro- and Nanoparticles of Ciprofloxacin Against Bacterial Biofilms.

    PubMed

    Thomas, Nicky; Thorn, Chelsea; Richter, Katharina; Thierry, Benjamin; Prestidge, Clive

    2016-10-01

    Bacterial biofilms are associated with a number of recurring infectious diseases and are a major cause for antibiotic resistance. Despite the broad use of polymeric microparticles and nanoparticles in biomedical research, it is not clear which particle size is more effective against biofilms. The purpose of this study was to evaluate the efficacy of sustained release poly-lactic-co-glycolic acid (PLGA) micro- and nanoparticles containing ciprofloxacin against biofilms of Staphylococcus aureus and Pseudomonas aeruginosa. The PLGA particles were prepared by the double emulsion solvent evaporation method. The resulting microparticles (12 μm) and nanoparticles (300 nm) contained drug loads of 7.3% and 4.5% (wt/wt) ciprofloxacin, respectively. Drug release was complete within 1 week following comparable release profiles for both particle sizes. Micro- and nanoparticles demonstrated a similar in vitro antibiofilm performance against mature P aeruginosa and S aureus with marked differences between the 2 strains. The sustained release of ciprofloxacin from micro- and nanoparticles over 6 days was equally effective as the continuous treatment with ciprofloxacin solution over the same period resulting in the eradication of culturable S aureus suggesting that reformulation of ciprofloxacin as sustained release PLGA micro- and nanoparticles might be valuable formulation approaches for the treatment of biofilms. PMID:27519649

  14. Bacterial glycosyltransferase toxins.

    PubMed

    Jank, Thomas; Belyi, Yury; Aktories, Klaus

    2015-12-01

    Mono-glycosylation of host proteins is a common mechanism by which bacterial protein toxins manipulate cellular functions of eukaryotic target host cells. Prototypic for this group of glycosyltransferase toxins are Clostridium difficile toxins A and B, which modify guanine nucleotide-binding proteins of the Rho family. However, toxin-induced glycosylation is not restricted to the Clostridia. Various types of bacterial pathogens including Escherichia coli, Yersinia, Photorhabdus and Legionella species produce glycosyltransferase toxins. Recent studies discovered novel unexpected variations in host protein targets and amino acid acceptors of toxin-catalysed glycosylation. These findings open new perspectives in toxin as well as in carbohydrate research.

  15. Honey bees avoid nectar colonized by three bacterial species, but not by a yeast species, isolated from the bee gut.

    PubMed

    Good, Ashley P; Gauthier, Marie-Pierre L; Vannette, Rachel L; Fukami, Tadashi

    2014-01-01

    The gut microflora of the honey bee, Apis mellifera, is receiving increasing attention as a potential determinant of the bees' health and their efficacy as pollinators. Studies have focused primarily on the microbial taxa that appear numerically dominant in the bee gut, with the assumption that the dominant status suggests their potential importance to the bees' health. However, numerically minor taxa might also influence the bees' efficacy as pollinators, particularly if they are not only present in the gut, but also capable of growing in floral nectar and altering its chemical properties. Nonetheless, it is not well understood whether honey bees have any feeding preference for or against nectar colonized by specific microbial species. To test whether bees exhibit a preference, we conducted a series of field experiments at an apiary using synthetic nectar inoculated with specific species of bacteria or yeast that had been isolated from the bee gut, but are considered minor components of the gut microflora. These species had also been found in floral nectar. Our results indicated that honey bees avoided nectar colonized by the bacteria Asaia astilbes, Erwinia tasmaniensis, and Lactobacillus kunkeei, whereas the yeast Metschnikowia reukaufii did not affect the feeding preference of the insects. Our results also indicated that avoidance of bacteria-colonized nectar was caused not by the presence of the bacteria per se, but by the chemical changes to nectar made by the bacteria. These findings suggest that gut microbes may not only affect the bees' health as symbionts, but that some of the microbes may possibly affect the efficacy of A. mellifera as pollinators by altering nectar chemistry and influencing their foraging behavior.

  16. Honey bees avoid nectar colonized by three bacterial species, but not by a yeast species, isolated from the bee gut.

    PubMed

    Good, Ashley P; Gauthier, Marie-Pierre L; Vannette, Rachel L; Fukami, Tadashi

    2014-01-01

    The gut microflora of the honey bee, Apis mellifera, is receiving increasing attention as a potential determinant of the bees' health and their efficacy as pollinators. Studies have focused primarily on the microbial taxa that appear numerically dominant in the bee gut, with the assumption that the dominant status suggests their potential importance to the bees' health. However, numerically minor taxa might also influence the bees' efficacy as pollinators, particularly if they are not only present in the gut, but also capable of growing in floral nectar and altering its chemical properties. Nonetheless, it is not well understood whether honey bees have any feeding preference for or against nectar colonized by specific microbial species. To test whether bees exhibit a preference, we conducted a series of field experiments at an apiary using synthetic nectar inoculated with specific species of bacteria or yeast that had been isolated from the bee gut, but are considered minor components of the gut microflora. These species had also been found in floral nectar. Our results indicated that honey bees avoided nectar colonized by the bacteria Asaia astilbes, Erwinia tasmaniensis, and Lactobacillus kunkeei, whereas the yeast Metschnikowia reukaufii did not affect the feeding preference of the insects. Our results also indicated that avoidance of bacteria-colonized nectar was caused not by the presence of the bacteria per se, but by the chemical changes to nectar made by the bacteria. These findings suggest that gut microbes may not only affect the bees' health as symbionts, but that some of the microbes may possibly affect the efficacy of A. mellifera as pollinators by altering nectar chemistry and influencing their foraging behavior. PMID:24466119

  17. Honey Bees Avoid Nectar Colonized by Three Bacterial Species, But Not by a Yeast Species, Isolated from the Bee Gut

    PubMed Central

    Good, Ashley P.; Gauthier, Marie-Pierre L.; Vannette, Rachel L.; Fukami, Tadashi

    2014-01-01

    The gut microflora of the honey bee, Apis mellifera, is receiving increasing attention as a potential determinant of the bees’ health and their efficacy as pollinators. Studies have focused primarily on the microbial taxa that appear numerically dominant in the bee gut, with the assumption that the dominant status suggests their potential importance to the bees’ health. However, numerically minor taxa might also influence the bees’ efficacy as pollinators, particularly if they are not only present in the gut, but also capable of growing in floral nectar and altering its chemical properties. Nonetheless, it is not well understood whether honey bees have any feeding preference for or against nectar colonized by specific microbial species. To test whether bees exhibit a preference, we conducted a series of field experiments at an apiary using synthetic nectar inoculated with specific species of bacteria or yeast that had been isolated from the bee gut, but are considered minor components of the gut microflora. These species had also been found in floral nectar. Our results indicated that honey bees avoided nectar colonized by the bacteria Asaia astilbes, Erwinia tasmaniensis, and Lactobacillus kunkeei, whereas the yeast Metschnikowia reukaufii did not affect the feeding preference of the insects. Our results also indicated that avoidance of bacteria-colonized nectar was caused not by the presence of the bacteria per se, but by the chemical changes to nectar made by the bacteria. These findings suggest that gut microbes may not only affect the bees’ health as symbionts, but that some of the microbes may possibly affect the efficacy of A. mellifera as pollinators by altering nectar chemistry and influencing their foraging behavior. PMID:24466119

  18. Metatranscriptomic analysis of lactic acid bacterial gene expression during kimchi fermentation.

    PubMed

    Jung, Ji Young; Lee, Se Hee; Jin, Hyun Mi; Hahn, Yoonsoo; Madsen, Eugene L; Jeon, Che Ok

    2013-05-15

    Barcode-based 16S rRNA gene pyrosequencing showed that the kimchi microbiome was dominated by six lactic acid bacteria (LAB), Leuconostoc (Lc.) mesenteroides, Lactobacillus (Lb.) sakei, Weissella (W.) koreensis, Lc. gelidum, Lc. carnosum, and Lc. gasicomitatum. Therefore, we used completed genome sequences of representatives of these bacteria to investigate metatranscriptomic gene-expression profiles during kimchi fermentation. Total mRNA was extracted from kimchi samples taken at five time points during a 29 day-fermentation. Nearly all (97.7%) of the metagenome sequences that were recruited on all LAB genomes of GenBank mapped onto the six LAB strains; this high coverage rate indicated that this approach for assessing processes carried out by the kimchi microbiome was valid. Expressed mRNA sequences (as cDNA) were determined using Illumina GA IIx. Assignment of mRNA sequences to metabolic genes using MG-RAST revealed the prevalence of carbohydrate metabolism and lactic acid fermentation. The mRNA sequencing reads were mapped onto genomes of the six LAB strains, which showed that Lc. mesenteroides was most active during the early-stage fermentation, whereas gene expression by Lb. sakei and W. koreensis was high during later stages. However, gene expression by Lb. sakei decreased rapidly at 25 days of fermentation, which was possibly caused by bacteriophage infection of the Lactobacillus species. Many genes related to carbohydrate transport and hydrolysis and lactate fermentation were actively expressed, which indicated typical heterolactic acid fermentation. Mannitol dehydrogenase-encoding genes (mdh) were identified from all Leuconostoc species and especially Lc. mesenteroides, which harbored three copies (two copies on chromosome and one copy on plasmid) of mdh with different expression patterns. These results contribute to knowledge of the active populations and gene expression in the LAB community responsible for an important fermentation process.

  19. Rapid detection method for fusaric acid-producing species of Fusarium by PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusaric acid is a mycotoxin produced by species of the fungus Fusarium and can act synergistically with other Fusarium toxins. In order to develop a specific detection method for fusaric acid-producing fungus, PCR prim¬ers were designed to amplify FUB10, a transcription factor gene in fusaric acid ...

  20. Bacterial colonization of the phyllosphere of mediterranean perennial species as influenced by leaf structural and chemical features.

    PubMed

    Yadav, R K P; Karamanoli, K; Vokou, D

    2005-08-01

    In this study, we assessed various leaf structural and chemical features as possible predictors of the size of the phyllosphere bacterial population in the Mediterranean environment. We examined eight perennial species, naturally occurring and coexisting in the same area, in Halkidiki (northern Greece). They are Arbutus unedo, Quercus coccifera, Pistacia lentiscus, and Myrtus communis (evergreen sclerophyllous species), Lavandula stoechas and Cistus incanus (drought semi-deciduous species), and Calamintha nepeta and Melissa officinalis (non-woody perennial species). M. communis, L. stoechas, C. nepeta, and M. officinalis produce essential oil in substantial quantities. We sampled summer leaves from these species and (1) estimated the size of the bacterial population of their phyllosphere, (2) estimated the concentration of different leaf constituents, and (3) studied leaf morphological and anatomical features and expressed them in a quantitative way. The aromatic plants are on average more highly colonized than the other species, whereas the non-woody perennials are more highly colonized than the woody species. The population size of epiphytic bacteria is positively correlated with glandular and non-glandular trichome densities, and with water and phosphorus contents; it is negatively correlated with total phenolics content and the thickness of the leaf, of the mesophyll, and of the abaxial epidermis. No correlation was found with the density of stomata, the nitrogen, and the soluble sugar contents. By regression tree analysis, we found that the leaf-microbe system can be effectively described by three leaf attributes with leaf water content being the primary explanatory attribute. Leaves with water content >73% are the most highly colonized. For leaves with water content <73%, the phosphorus content, with a critical value of 1.34 mg g(-1) d.w., is the next explanatory leaf attribute, followed by the thickness of the adaxial epidermis. Leaves higher in phosphorus

  1. The potential of spectral and hyperspectral-imaging techniques for bacterial detection in food: A case study on lactic acid bacteria.

    PubMed

    Foca, Giorgia; Ferrari, Carlotta; Ulrici, Alessandro; Sciutto, Giorgia; Prati, Silvia; Morandi, Stefano; Brasca, Milena; Lavermicocca, Paola; Lanteri, Silvia; Oliveri, Paolo

    2016-06-01

    Official methods for the detection of bacteria are based on culture techniques. These methods have limitations such as time consumption, cost, detection limits and the impossibility to analyse a large number of samples. For these reasons, the development of rapid, low-cost and non-destructive analytical methods is a task of growing interest. In the present study, the capability of spectral and hyperspectral techniques to detect bacterial surface contamination was investigated preliminarily on gel cultures, and subsequently on sliced cooked ham. In more detail, two species of lactic acid bacteria (LAB) were considered, namely Lactobacillus curvatus and Lactobacillus sakei, both of which are responsible for common alterations in sliced cooked ham. Three techniques were investigated, with different equipment, respectively: a macroscopic hyperspectral scanner operating in the NIR (10,470-5880cm(-1)) region, a FT-NIR spectrophotometer equipped with a transmission arm as the sampling tool, working in the 12,500-5800cm(-1) region, and a FT-MIR microscopy operating in the 4000-675cm(-1) region. Multivariate exploratory data analysis, in particular principal component analysis (PCA), was applied in order to extract useful information from original data and from hyperspectrograms. The results obtained demonstrate that the spectroscopic and imaging techniques investigated can represent an effective and sensitive tool to detect surface bacterial contamination in samples and, in particular, to recognise species to which bacteria belong.

  2. The potential of spectral and hyperspectral-imaging techniques for bacterial detection in food: A case study on lactic acid bacteria.

    PubMed

    Foca, Giorgia; Ferrari, Carlotta; Ulrici, Alessandro; Sciutto, Giorgia; Prati, Silvia; Morandi, Stefano; Brasca, Milena; Lavermicocca, Paola; Lanteri, Silvia; Oliveri, Paolo

    2016-06-01

    Official methods for the detection of bacteria are based on culture techniques. These methods have limitations such as time consumption, cost, detection limits and the impossibility to analyse a large number of samples. For these reasons, the development of rapid, low-cost and non-destructive analytical methods is a task of growing interest. In the present study, the capability of spectral and hyperspectral techniques to detect bacterial surface contamination was investigated preliminarily on gel cultures, and subsequently on sliced cooked ham. In more detail, two species of lactic acid bacteria (LAB) were considered, namely Lactobacillus curvatus and Lactobacillus sakei, both of which are responsible for common alterations in sliced cooked ham. Three techniques were investigated, with different equipment, respectively: a macroscopic hyperspectral scanner operating in the NIR (10,470-5880cm(-1)) region, a FT-NIR spectrophotometer equipped with a transmission arm as the sampling tool, working in the 12,500-5800cm(-1) region, and a FT-MIR microscopy operating in the 4000-675cm(-1) region. Multivariate exploratory data analysis, in particular principal component analysis (PCA), was applied in order to extract useful information from original data and from hyperspectrograms. The results obtained demonstrate that the spectroscopic and imaging techniques investigated can represent an effective and sensitive tool to detect surface bacterial contamination in samples and, in particular, to recognise species to which bacteria belong. PMID:27130097

  3. Rapid Identification of Biothreat and Other Clinically Relevant Bacterial Species by Use of Universal PCR Coupled with High-Resolution Melting Analysis▿

    PubMed Central

    Yang, Samuel; Ramachandran, Padmini; Rothman, Richard; Hsieh, Yu-Hsiang; Hardick, Andrew; Won, Helen; Kecojevic, Aleksandar; Jackman, Joany; Gaydos, Charlotte

    2009-01-01

    A rapid assay for eubacterial species identification is described using high-resolution melt analysis to characterize PCR products. Unique melt profiles generated from multiple hypervariable regions of the 16S rRNA gene for 100 clinically relevant bacterial pathogens, including category A and B biothreat agents and their surrogates, allowed highly specific species identification. PMID:19458181

  4. Crystallization and preliminary X-ray analysis of a bacterial l-amino-acid oxidase from Rhodococcus opacus

    SciTech Connect

    Faust, Annette; Geueke, Birgit; Niefind, Karsten; Hummel, Werner; Schomburg, Dietmar

    2006-03-01

    The crystallization and preliminary X-ray analysis of a bacterial l-amino acid oxidase from R. opacus is described. The homodimeric protein contains one molecule of non-covalently bound FAD per monomer. Crystals with good diffraction properties were grown in two different orthorhombic space groups (P2{sub 1}2{sub 1}2{sub 1} and C222{sub 1}). l-Amino-acid oxidases (EC 1.4.3.2) catalyse the stereospecific oxidative deamination of an l-amino-acid substrate to an α-keto acid with the production of ammonia and hydrogen peroxide. In this study, the crystallization and preliminary X-ray analysis of a bacterial l-amino-acid oxidase from Rhodococcus opacus (RoLAAO) is described. RoLAAO is a dimeric protein consisting of two identical subunits of 489 amino acids with a calculated molecular weight of 54.2 kDa and a non-covalently bound FAD molecule. RoLAAO was crystallized by the vapour-diffusion method in two different space groups: P2{sub 1}2{sub 1}2{sub 1} (unit-cell parameters a = 65.7, b = 109.7, c = 134.4 Å) and C222{sub 1} (unit-cell parameters a = 68.3, b = 88.4, c = 186.6 Å). Both crystal forms diffracted X-rays to a resolution of at least 1.6 Å.

  5. A short-term mineral amendment impacts the mineral weathering bacterial communities in an acidic forest soil.

    PubMed

    Lepleux, C; Uroz, S; Collignon, C; Churin, J-L; Turpault, M-P; Frey-Klett, P

    2013-09-01

    Mineral amendment (i.e. calcium, phosphorous, potassium and/or magnesium) is a management practice used in forestry to improve nutrient availability and recover soil fertility, especially in nutrient-poor forest ecosystems. However, whether this amendment can lead to modifications of the soil characteristics and an improvement in tree growth, and its impact on the soil bacterial communities, especially the mineral weathering bacterial communities, remains poorly documented. In this study, we investigated the short-term impact of a mineral amendment on the taxonomic and functional structure of the mineral weathering bacterial communities. To do this, a plantation of four-year old oak (Quercus petraea) trees amended with or without dolomite [CaMg(CO3)2] was established in the experimental forest site of Breuil-Chenue, which is characterized by an acidic soil and a low availability of calcium and magnesium. Three years after amendment, soil samples were used to isolate bacteria as well as to determine the soil characteristics and the metabolic potentials of these soil microbial communities. Based on a bioassay for quantifying the solubilisation of inorganic phosphorous, we demonstrate that the bacterial isolates coming from the non-amended bulk soil were significantly more efficient than those from the amended bulk soil. No difference was observed between the bacterial isolates coming from the amended and non-amended rhizospheres. Notably, the taxonomic analyses revealed a dominance of bacterial isolates belonging to the Burkholderia genus in both samples. Overall, our results suggest that the bioavailability of nutritive cations into soil impacts the distribution and the efficacy of mineral weathering bacterial communities coming from the soil but not those coming from the rhizosphere.

  6. Reactive Carbonyl Species Derived from Omega-3 and Omega-6 Fatty Acids.

    PubMed

    Wang, Yu; Cui, Ping

    2015-07-22

    Inflammation-related reactive oxygen species (ROS) and reactive nitrogen species (RNS) are associated with the development of cancer. ROS and RNS can directly damage biomacromolecules such as proteins, DNA, and lipids. Lipid peroxidation, however, can result in reactive carbonyl species (RCS) that can also modify proteins and DNA. In contrast to an extensive literature on the modification of proteins and DNA from omega-6 fatty acids, there are few studies on RCS generation from other fatty acids, particularly omega-3 fatty acids, which are frequently consumed from the diet and diet supplements. Therefore, a comparison between omega-3 and omega-6 fatty acids has been conducted. LC-MS/MS analysis of carbonyl-dinitrophenylhydrazine (DNPH) standards yielded characteristic fragment ions. Autoxidation products of α-linolenic acid and linoleic acid were then derivatized with DNPH and analyzed by LC-MS/MS. The results showed that α-linolenic acid, an omega-3 fatty acid, generated more acrolein and crotonaldehyde than did linoleic acid, an omega-6 fatty acid. Omega-3 fatty acids might be easily degraded to smaller monoaldehydes or dicarbonyls. Omega-3 fatty acids have been considered as health improvement components for a long time. However, on the basis of the results presented here, use of omega-3 fatty acids should be re-evaluated in vivo for safety purposes.

  7. Shifts in bacterial communities of two caribbean reef-building coral species affected by white plague disease

    PubMed Central

    Cárdenas, Anny; Rodriguez-R, Luis M; Pizarro, Valeria; Cadavid, Luis F; Arévalo-Ferro, Catalina

    2012-01-01

    Coral reefs are deteriorating at an alarming rate mainly as a consequence of the emergence of coral diseases. The white plague disease (WPD) is the most prevalent coral disease in the southwestern Caribbean, affecting dozens of coral species. However, the identification of a single causal agent has proved problematic. This suggests more complex etiological scenarios involving alterations in the dynamic interaction between environmental factors, the coral immune system and the symbiotic microbial communities. Here we compare the microbiome of healthy and WPD-affected corals from the two reef-building species Diploria strigosa and Siderastrea siderea collected at the Tayrona National Park in the Caribbean of Colombia. Microbiomes were analyzed by combining culture-dependent methods and pyrosequencing of 16S ribosomal DNA (rDNA) V5-V6 hypervariable regions. A total of 20 410 classifiable 16S rDNA sequences reads were obtained including all samples. No significant differences in operational taxonomic unit diversity were found between healthy and affected tissues; however, a significant increase of Alphaproteobacteria and a concomitant decrease in the Beta- and Gammaproteobacteria was observed in WPD-affected corals of both species. Significant shifts were also observed in the orders Rhizobiales, Caulobacteriales, Burkholderiales, Rhodobacterales, Aleteromonadales and Xanthomonadales, although they were not consistent between the two coral species. These shifts in the microbiome structure of WPD-affected corals suggest a loss of community-mediated growth control mechanisms on bacterial populations specific for each holobiont system. PMID:21955993

  8. Content of essential polyunsaturated fatty acids in three canned fish species.

    PubMed

    Gladyshev, Michail I; Sushchik, Nadezhda N; Makhutova, Olesia N; Kalachova, Galina S

    2009-05-01

    Three canned fish species--Pacific saury (Cololabis saira), Pacific herring (Clupea harengus) and Baltic sprat (Sprattus sprattus)--most common and popular in Russia, were analyzed for fatty acids. Special attention was paid to long-chain essential polyunsaturated fatty acids: eicosapentaenoic acid (20:5omega3) and docosahexaenoic acid (22:6omega3). Sums of eicosapentaenoic acid and docosahexaenoic acid in saury, herring and sprat were, on average, 2.42, 1.80 and 1.43 g/100 g product, respectively. Contents of these essential acids in all the canned fish species were found to be very high compared with many other fish reported in the available literature. All the canned fish appeared to be highly valuable products for human nutrition concerning the content of eicosapentaenoic and docosahexaenoic acids. PMID:18608541

  9. Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis

    PubMed Central

    Nanson, Jeffrey D.; Forwood, Jade K.

    2015-01-01

    Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections. PMID:26539719

  10. Nutritional stress induces exchange of cell material and energetic coupling between bacterial species.

    PubMed

    Benomar, Saida; Ranava, David; Cárdenas, María Luz; Trably, Eric; Rafrafi, Yan; Ducret, Adrien; Hamelin, Jérôme; Lojou, Elisabeth; Steyer, Jean-Philippe; Giudici-Orticoni, Marie-Thérèse

    2015-02-23

    Knowledge of the behaviour of bacterial communities is crucial for understanding biogeochemical cycles and developing environmental biotechnology. Here we demonstrate the formation of an artificial consortium between two anaerobic bacteria, Clostridium acetobutylicum (Gram-positive) and Desulfovibrio vulgaris Hildenborough (Gram-negative, sulfate-reducing) in which physical interactions between the two partners induce emergent properties. Molecular and cellular approaches show that tight cell-cell interactions are associated with an exchange of molecules, including proteins, which allows the growth of one partner (D. vulgaris) in spite of the shortage of nutrients. This physical interaction induces changes in expression of two genes encoding enzymes at the pyruvate crossroads, with concomitant changes in the distribution of metabolic fluxes, and allows a substantial increase in hydrogen production without requiring genetic engineering. The stress induced by the shortage of nutrients of D. vulgaris appears to trigger the interaction.

  11. Fine-scale cospeciation between Brachycaudus and Buchnera aphidicola: bacterial genome helps define species and evolutionary relationships in aphids.

    PubMed

    Jousselin, Emmanuelle; Desdevises, Yves; Coeur d'acier, Armelle

    2009-01-01

    Aphids harbour an obligatory symbiont, Buchnera aphidicola, providing essential amino acids not supplied by their diet. These bacteria are transmitted vertically and phylogenic analyses suggest that they have 'cospeciated' with their hosts. We investigated this cospeciation phenomenon at a fine taxonomic level, within the aphid genus Brachycaudus. We used DNA-based methods of species delimitation in both organisms, to avoid biases in the definition of aphid and Buchnera species and to infer association patterns without the presumption of a specific interaction. Our results call into question certain 'taxonomic' species of Brachycaudus and suggest that B. aphidicola has diversified into independently evolving entities, each specific to a 'phylogenetic' Brachycaudus species. We also found that Buchnera and their hosts simultaneously diversified, in parallel. These results validate the use of Buchnera DNA data for inferring the evolutionary history of their host. The Buchnera genome evolves rapidly, making it the perfect tool for resolving ambiguities in aphid taxonomy. This study also highlights the usefulness of species delimitation methods in cospeciation studies involving species difficult to conceptualize--as is the case for bacteria--and in cases in which the taxonomy of the interacting organisms has not been determined independently and species definition depends on host association.

  12. Species sorting and seasonal dynamics primarily shape bacterial communities in the Upper Mississippi River.

    PubMed

    Staley, Christopher; Gould, Trevor J; Wang, Ping; Phillips, Jane; Cotner, James B; Sadowsky, Michael J

    2015-02-01

    Bacterial community structure (BCS) in freshwater ecosystems varies seasonally and due to physicochemical gradients, but metacommunity structure of a major river remains understudied. Here we characterize the BCS along the Mississippi River and contributing rivers in Minnesota over three years using Illumina next-generation sequencing, to determine how changes in environmental conditions as well as inputs from surrounding land and confluences impacted community structure. Contributions of sediment to water microbial diversity were also evaluated. Long-term variation in community membership was observed, and significant shifts in relative abundances of major freshwater taxa, including α-Proteobacteria, Burkholderiales, and Actinomycetales, were observed due to temporal and spatial variations. Environmental parameters (e.g. temperature, rainfall, and nutrient concentrations) primarily contributed to differences in phyla abundances (88% of variance), with minimal influence from spatial distance alone (<1% of variance). Furthermore, an annually-recurrent BCS was observed in late summer, further suggesting that seasonal dynamics strongly influence community composition. Sediment communities differed from those in the water, but contributed up to 50% to community composition in the water column. Among water sampling sites, 34% showed significant variability in BCS of replicate samples indicating variability among riverine communities due to heterogeneity in the water column. Results of this study highlight the need for a better understanding of spatial and temporal variations in riverine bacterial diversity associated with physicochemical gradients and reveal how communities in sediments, and potentially other environmental reservoirs, impact waterborne BCS. Techniques used in this study may prove useful to determine sources of microbes from sediments and soils to waterways, which will facilitate best management practices and total maximum daily load determinations.

  13. CAP-D3 Promotes Bacterial Clearance in Human Intestinal Epithelial Cells by Repressing Expression of Amino Acid Transporters

    PubMed Central

    Kemp, Jacqueline R.; Nickerson, Kourtney P.; Deutschman, Emily; Kim, Yeojung; West, Gail; Sadler, Tammy; Stylianou, Eleni; Krokowski, Dawid; Hatzoglou, Maria; de la Motte, Carol; Rubin, Brian P.; Fiocchi, Claudio

    2015-01-01

    BACKGROUND & AIMS Defects in colonic epithelial barrier defenses are associated with ulcerative colitis (UC). The proteins that regulate bacterial clearance in the colonic epithelium have not been completely identified. The chromosome-associated protein D3 (dCAP-D3), regulates responses to bacterial infection. We examined whether CAP-D3 promotes bacterial clearance in human colonic epithelium. METHODS Clearance of Salmonella or adherent-invasive Escherichia coli LF82 was assessed by gentamycin protection assays in HT-29 and Caco-2 cells expressing small hairpin RNAs against CAP-D3. We used immunoblot assays to measure levels of CAP-D3 in colonic epithelial cells from patients with UC and healthy individuals (controls). RNA sequencing identified genes activated by CAP-D3. We analyzed the roles of CAP-D3 target genes in bacterial clearance using gentamycin protection and immunofluorescence assays and studies with pharmacologic inhibitors. RESULTS CAP-D3 expression was reduced in colonic epithelial cells from patients with active UC. Reduced CAP-D3 expression decreased autophagy and impaired intracellular bacterial clearance by HT-29 and Caco-2 colonic epithelial cells. Lower levels of CAP-D3 increased transcription of genes encoding SLC7A5 and SLC3A2, whose products heterodimerize to form an amino acid transporter in HT-29 cells following bacterial infection; levels of SLC7A5–SLC3A2 were increased in tissues from patients with UC, compared with controls. Reduced CAP-D3 in HT-29 cells resulted in earlier recruitment of SLC7A5 to Salmonella-containing vacuoles, increased activity of mTORC1, and increased survival of bacteria. Inhibition of SLC7A5–SLC3A2 or mTORC1 activity rescued the bacterial clearance defects of CAP-D3– deficient cells. CONCLUSIONS CAP-D3 downregulates transcription of genes that encode amino acid transporters (SLC7A5 and SLC3A2) to promote bacterial autophagy by colon epithelial cells. Levels of CAP-D3 protein are reduced in patients with

  14. Amoeba host-Legionella synchronization of amino acid auxotrophy and its role in bacterial adaptation and pathogenic evolution.

    PubMed

    Price, Christopher T D; Richards, Ashley M; Von Dwingelo, Juanita E; Samara, Hala A; Abu Kwaik, Yousef

    2014-02-01

    Legionella pneumophila, the causative agent of Legionnaires' disease, invades and proliferates within a diverse range of free-living amoeba in the environment, but upon transmission to humans, the bacteria hijack alveolar macrophages. Intracellular proliferation of L. pneumophila in two evolutionarily distant hosts is facilitated by bacterial exploitation of conserved host processes that are targeted by bacterial protein effectors injected into the host cell. A key aspect of microbe-host interaction is microbial extraction of nutrients from the host, but understanding of this is still limited. AnkB functions as a nutritional virulence factor and promotes host proteasomal degradation of polyubiquitinated proteins generating gratuitous levels of limiting host cellular amino acids. Legionella pneumophila is auxotrophic for several amino acids including cysteine, which is a metabolically preferred source of carbon and energy during intracellular proliferation, but is limiting in both amoebae and humans. We propose that synchronization of bacterial amino acids auxotrophy with the host is a driving force in pathogenic evolution and nutritional adaptation of L. pneumophila and other intracellular bacteria to life within the host cell. Understanding microbial strategies of nutrient generation and acquisition in the host will provide novel antimicrobial strategies to disrupt pathogen access to essential sources of carbon and energy.

  15. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  16. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, an d analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: (1) to assess the potential terrorist threat to U.S. agricultural crops, (2) to determine whether suitable assays exist to monitor that threat, and (3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  17. A Single Amino Acid Change Is Responsible for Evolution of Acyltransferase Specificity in Bacterial Methionine Biosynthesis

    SciTech Connect

    Zubieta, C.; Arkus, K.A.J.; Cahoon, R.E.; Jez, J.M.

    2009-05-28

    Bacteria and yeast rely on either homoserine transsuccinylase (HTS, metA) or homoserine transacetylase (HTA; met2) for the biosynthesis of methionine. Although HTS and HTA catalyze similar chemical reactions, these proteins are typically unrelated in both sequence and three-dimensional structure. Here we present the 2.0 {angstrom} resolution x-ray crystal structure of the Bacillus cereus metA protein in complex with homoserine, which provides the first view of a ligand bound to either HTA or HTS. Surprisingly, functional analysis of the B. cereus metA protein shows that it does not use succinyl-CoA as a substrate. Instead, the protein catalyzes the transacetylation of homoserine using acetyl-CoA. Therefore, the B. cereus metA protein functions as an HTA despite greater than 50% sequence identity with bona fide HTS proteins. This result emphasizes the need for functional confirmation of annotations of enzyme function based on either sequence or structural comparisons. Kinetic analysis of site-directed mutants reveals that the B. cereus metA protein and the E. coli HTS share a common catalytic mechanism. Structural and functional examination of the B. cereus metA protein reveals that a single amino acid in the active site determines acetyl-CoA (Glu-111) versus succinyl-CoA (Gly-111) specificity in the metA-like of acyltransferases. Switching of this residue provides a mechanism for evolving substrate specificity in bacterial methionine biosynthesis. Within this enzyme family, HTS and HTA activity likely arises from divergent evolution in a common structural scaffold with conserved catalytic machinery and homoserine binding sites.

  18. Antimicrobial and immune modulatory effects of lactic acid and short chain fatty acids produced by vaginal microbiota associated with eubiosis and bacterial vaginosis.

    PubMed

    Aldunate, Muriel; Srbinovski, Daniela; Hearps, Anna C; Latham, Catherine F; Ramsland, Paul A; Gugasyan, Raffi; Cone, Richard A; Tachedjian, Gilda

    2015-01-01

    Lactic acid and short chain fatty acids (SCFAs) produced by vaginal microbiota have reported antimicrobial and immune modulatory activities indicating their potential as biomarkers of disease and/or disease susceptibility. In asymptomatic women of reproductive-age the vaginal microbiota is comprised of lactic acid-producing bacteria that are primarily responsible for the production of lactic acid present at ~110 mM and acidifying the vaginal milieu to pH ~3.5. In contrast, bacterial vaginosis (BV), a dysbiosis of the vaginal microbiota, is characterized by decreased lactic acid-producing microbiota and increased diverse anaerobic bacteria accompanied by an elevated pH>4.5. BV is also characterized by a dramatic loss of lactic acid and greater concentrations of mixed SCFAs including acetate, propionate, butyrate, and succinate. Notably women with lactic acid-producing microbiota have more favorable reproductive and sexual health outcomes compared to women with BV. Regarding the latter, BV is associated with increased susceptibility to sexually transmitted infections (STIs) including HIV. In vitro studies demonstrate that lactic acid produced by vaginal microbiota has microbicidal and virucidal activities that may protect against STIs and endogenous opportunistic bacteria as well as immune modulatory properties that require further characterization with regard to their effects on the vaginal mucosa. In contrast, BV-associated SCFAs have far less antimicrobial activity with the potential to contribute to a pro-inflammatory vaginal environment. Here we review the composition of lactic acid and SCFAs in respective states of eubiosis (non-BV) or dysbiosis (BV), their effects on susceptibility to bacterial/viral STIs and whether they have inherent microbicidal/virucidal and immune modulatory properties. We also explore their potential as biomarkers for the presence and/or increased susceptibility to STIs.

  19. Antimicrobial and immune modulatory effects of lactic acid and short chain fatty acids produced by vaginal microbiota associated with eubiosis and bacterial vaginosis

    PubMed Central

    Aldunate, Muriel; Srbinovski, Daniela; Hearps, Anna C.; Latham, Catherine F.; Ramsland, Paul A.; Gugasyan, Raffi; Cone, Richard A.; Tachedjian, Gilda

    2015-01-01

    Lactic acid and short chain fatty acids (SCFAs) produced by vaginal microbiota have reported antimicrobial and immune modulatory activities indicating their potential as biomarkers of disease and/or disease susceptibility. In asymptomatic women of reproductive-age the vaginal microbiota is comprised of lactic acid-producing bacteria that are primarily responsible for the production of lactic acid present at ~110 mM and acidifying the vaginal milieu to pH ~3.5. In contrast, bacterial vaginosis (BV), a dysbiosis of the vaginal microbiota, is characterized by decreased lactic acid-producing microbiota and increased diverse anaerobic bacteria accompanied by an elevated pH>4.5. BV is also characterized by a dramatic loss of lactic acid and greater concentrations of mixed SCFAs including acetate, propionate, butyrate, and succinate. Notably women with lactic acid-producing microbiota have more favorable reproductive and sexual health outcomes compared to women with BV. Regarding the latter, BV is associated with increased susceptibility to sexually transmitted infections (STIs) including HIV. In vitro studies demonstrate that lactic acid produced by vaginal microbiota has microbicidal and virucidal activities that may protect against STIs and endogenous opportunistic bacteria as well as immune modulatory properties that require further characterization with regard to their effects on the vaginal mucosa. In contrast, BV-associated SCFAs have far less antimicrobial activity with the potential to contribute to a pro-inflammatory vaginal environment. Here we review the composition of lactic acid and SCFAs in respective states of eubiosis (non-BV) or dysbiosis (BV), their effects on susceptibility to bacterial/viral STIs and whether they have inherent microbicidal/virucidal and immune modulatory properties. We also explore their potential as biomarkers for the presence and/or increased susceptibility to STIs. PMID:26082720

  20. Effect of humic acids and sunlight on the cytotoxicity of engineered zinc oxide and titanium dioxide nanoparticles to a river bacterial assemblage.

    PubMed

    Dasari, Thabitha P; Hwang, Huey-Min

    2013-09-01

    The effect of a terrestrial humic acid (HA) and Suwannee River HA on the cytotoxicity of engineered zinc oxide nanoparticles (ZnONPs) and titanium dioxide nanoparticles (TiO2NPs) to natural aquatic bacterial assemblages was measured with spread plate counting. The effect of HA (10 and 40 ppm) on the cytotoxicity of ZnONPs and TiO2NPs was tested factorially in the presence and absence of natural sunlight (light irradiation (LI)). The experiment was of full factorial, completely randomized design and the results were analyzed using the General Linear Model in SAS analytical software. The method of least squares means was used to separate the means or combinations of means. We determined the mechanism of toxicity via measurements of oxidative stress and metal ions. The toxicity of ZnONPs and TiO2NPs to natural aquatic bacterial assemblages appears to be concentration dependent. Moreover, the cytotoxicity of ZnONPs and TiO2NPs appeared to be affected by HA concentration, the presence of sunlight irradiation, and the dynamic multiple interactions among these factors. With respect to light versus darkness in the control group, the data indicate that bacterial viability was inhibited more in the light exposure than in the darkness exposure. The same was true in the HA treatment groups. With respect to terrestrial versus Suwanee River HA for a given nanoparticle, in light versus darkness, bacterial viability was more inhibited in the light treatment groups containing the terrestrial HA than in those containing Suwanee River HA. Differences in the extent of reactive oxygen species formation, adsorption/binding of ZnONPs/TiO2NPs by HA, and the levels of free metal ions were speculated to account for the observed cytotoxicity. TEM images indicate the attachment and binding of the tested nanoparticles to natural bacterial assemblages. Besides the individual parameter, significant effects on bacterial viability count were also observed in the following combined treatments: HA

  1. Colloidal precipitates related to Acid Mine Drainage: bacterial diversity and micro fungi-heavy metal interactions

    NASA Astrophysics Data System (ADS)

    Lucchetti, G.; Carbone, C.; Consani, S.; Zotti, M.; Di Piazza, S.; Pozzolini, M.; Giovine, M.

    2015-12-01

    In Acid Mine Drainage (AMD) settings colloidal precipitates control the mobility of Potential Toxic Elements (PTEs). Mineral-contaminant relationships (i.e. adsorption, ion-exchange, desorption) are rarely pure abiotic processes. Microbes, mainly bacteria and microfungi, can catalyze several reactions modifying the element speciation, as well as the bioavailability of inorganic pollutants. Soil, sediments, and waters heavily polluted with PTEs through AMD processes are a potential reservoir of extremophile bacteria and fungi exploitable for biotechnological purposes. Two different AMD related colloids, an ochraceous precipitate (deposited in weakly acidic conditions, composed by nanocrystalline goethite) and a greenish-blue precipitate (deposited at near-neutral pH, composed by allophane + woodwardite) were sampled. The aims of this work were to a) characterize the mycobiota present in these colloidal minerals by evaluating the presence of alive fungal propagules and extracting bacteria DNA; b) verify the fungal strains tolerance, and bioaccumulation capability on greenish-blue and ZnSO4 enriched media; c) evaluate potential impact of bacteria in the system geochemistry. The preliminary results show an interesting and selected mycobiota able to survive under unfavourable environmental conditions. A significant number of fungal strains were isolated in pure culture. Among them, species belonging to Penicillium and Trichoderma genera were tested on both greenish-blue and ZnSO4 enriched media. The results show a significant tolerance and bioaccumulation capability to some PTEs. The same colloidal precipitates were processed to extract bacteria DNA by using a specific procedure developed for sediments. The results give a good yield of nucleic acids and a positive PCR amplification of 16S rDNA accomplished the first step for future metagenomic analyses.

  2. High performance degradation of azo dye Acid Orange 7 and sulfanilic acid in a laboratory scale reactor after seeding with cultured bacterial strains.

    PubMed

    Coughlin, Michael F; Kinkle, Brian K; Bishop, Paul L

    2003-06-01

    Bacterial strains 1CX and SAD4i--previously isolated from the mixed liquor of a municipal sewage treatment plant--are capable of degrading the azo dye Acid Orange 7 (AO7) and sulfanilic acid, respectively. A rotating drum bioreactor (RDBR), operating under continuous flow and nutrient conditions designed to simulate the effluent from a dye manufacturing plant, was seeded with strains 1CX and SAD4i, forming a biofilm capable of degrading AO7 and sulfanilic acid. In addition, an RDBR containing a pre-existing biofilm capable of degrading AO7, but not sulfanilic acid, was seeded with strain SAD4i alone. Strain SAD4i was incorporated into the existing biofilm and degraded the sulfanilic acid resulting from the degradation of AO7 by indigenous members of the biofilm. The ability to seed a bioreactor with bacterial strains capable of degrading azo dyes, and resulting by-products, in a mixed microbial community suggests that this process could have commercial applications.

  3. Time-kill behavior against eight bacterial species and cytotoxicity of antibacterial monomers

    PubMed Central

    Li, Fang; Weir, Michael D.; Fouad, Ashraf F.; Xu, Hockin H. K.

    2013-01-01

    Objectives The objectives of this study were to investigate: (1) the antibacterial activity of two antibacterial monomers, dimethylaminododecyl methacrylate (DMADDM) and dimethylammoniumethyl dimethacrylate (DMAEDM), against eight different species of oral pathogens for the first time; (2) the cytotoxicity of DMAEDM and DMADDM. Methods DMAEDM and DMADDM were synthesized by reacting a tertiary amine group with an organo-halide. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) against eight species of bacteria were tested. Time-kill determinations were performed to examine the bactericidal kinetics. Cytotoxicity of monomers on human gingival fibroblasts (HGF) was assessed using a methyl thiazolyltetrazolium assay and live/dead viability assay. Results DMADDM showed strong bactericidal activity against all bacteria, with MIC of 1.2 to 9.8μg/mL. DMAEDM had MIC of 20 to 80mg/mL. Time-kill determinations indicated that DMADDM and DMAEDM had rapid killing effects against eight species of bacteria, and eliminated all bacteria in 30min at the concentration of 4-fold MBC. Median lethal concentration for DMADDM and DMAEDM was between 20 to 40μg/mL, which was 20-fold higher than 1 to 2μg/mL for BisGMA control. Conclusions DMAEDM and DMADDM were tested in time-kill assay against eight species of oral bacteria for the first time. Both were effective in bacteria-inhibition, but DMADDM had a higher potency than DMAEDM. Different killing efficacy was found against different bacteria species. DMAEDM and DMADDM had much lower cytotoxicity than BisGMA. Therefore, DMADDM and DMAEDM are promising for use in bonding agents and other restorative/preventive materials to combat a variety of oral pathogens. PMID:23876930

  4. Fatty-Acid Composition of Seeds and Chemotaxonomic Evaluation of Sixteen Sapindaceae Species.

    PubMed

    Coutinho, Diogenes J Gusmão; Barbosa, Mariana O; Silva, Rejane M; da Silva, Suzene I; de Oliveira, Antonio Fernando M

    2015-08-01

    Circumscriptions for the Sapindaceae family and its infrafamilial relationships have been widely discussed. Certain groups are highly morphologically similar; thus, it is difficult to identify certain taxa. DNA Analyses have also indicated complex phylogenetic relationships, and it is difficult to relate such analyses to morphological data. Given the above concerns, this study aimed to investigate the fatty-acid profiles of the seed oils of 16 Sapindaceae species belonging to five tribes and to evaluate their potential chemotaxonomic significance. In total, eleven fatty acids were identified, and eicosenoic acid predominated in nine species. Multivariate analyses (principal component and cluster analyses) of the fatty-acid profiles of the seed oils allowed to separate them in two major clusters. The first cluster, characterized by oils with high eicosenoic acid levels, included all species belonging to the Paullinieae tribe (Cardiospermum, Paullinia, and Serjania species). In the second main cluster, the chemical similarity of the oils was lower, and the species belonged to different tribes. Nevertheless, the tree investigated Allophylus species (Thouinieae tribe) constituted a separate subcluster. Thus, the results showed that the fatty-acid composition of the seed oils of Sapindaceae species provide chemotaxonomic support for the separation of the Paullinieae tribe from the other tribes studied. PMID:26265579

  5. Cytotoxic responses to 405nm light exposure in mammalian and bacterial cells: Involvement of reactive oxygen species.

    PubMed

    Ramakrishnan, Praveen; Maclean, Michelle; MacGregor, Scott J; Anderson, John G; Grant, M Helen

    2016-06-01

    Light at wavelength 405 nm is an effective bactericide. Previous studies showed that exposing mammalian cells to 405 nm light at 36 J/cm(2) (a bactericidal dose) had no significant effect on normal cell function, although at higher doses (54 J/cm(2)), mammalian cell death became evident. This research demonstrates that mammalian and bacterial cell toxicity induced by 405 nm light exposure is accompanied by reactive oxygen species production, as detected by generation of fluorescence from 6-carboxy-2',7'-dichlorodihydrofluorescein diacetate. As indicators of the resulting oxidative stress in mammalian cells, a decrease in intracellular reduced glutathione content and a corresponding increase in the efflux of oxidised glutathione were observed from 405 nm light treated cells. The mammalian cells were significantly protected from dying at 54 J/cm(2) in the presence of catalase, which detoxifies H2O2. Bacterial cells were significantly protected by sodium pyruvate (H2O2 scavenger) and by a combination of free radical scavengers (sodium pyruvate, dimethyl thiourea (OH scavenger) and catalase) at 162 and 324 J/cm(2). Results therefore suggested that the cytotoxic mechanism of 405 nm light in mammalian cells and bacteria could be oxidative stress involving predominantly H2O2 generation, with other ROS contributing to the damage.

  6. Bacterial wilt resistance in tomato, pepper, and eggplant: genetic resources respond to diverse strains in the Ralstonia solanacearum species complex.

    PubMed

    Lebeau, A; Daunay, M-C; Frary, A; Palloix, A; Wang, J-F; Dintinger, J; Chiroleu, F; Wicker, E; Prior, P

    2011-01-01

    Bacterial wilt, caused by strains belonging to the Ralstonia solanacearum species complex, inflicts severe economic losses in many crops worldwide. Host resistance remains the most effective control strategy against this disease. However, wilt resistance is often overcome due to the considerable variation among pathogen strains. To help breeders circumvent this problem, we assembled a worldwide collection of 30 accessions of tomato, eggplant and pepper (Core-TEP), most of which are commonly used as sources of resistance to R. solanacearum or for mapping quantitative trait loci. The Core-TEP lines were challenged with a core collection of 12 pathogen strains (Core-Rs2) representing the phylogenetic diversity of R. solanacearum. We observed six interaction phenotypes, from highly susceptible to highly resistant. Intermediate phenotypes resulted from the plants' ability to tolerate latent infections (i.e., bacterial colonization of vascular elements with limited or no wilting). The Core-Rs2 strains partitioned into three pathotypes on pepper accessions, five on tomato, and six on eggplant. A "pathoprofile" concept was developed to characterize the strain clusters, which displayed six virulence patterns on the whole set of Core-TEP host accessions. Neither pathotypes nor pathoprofiles were phylotype specific. Pathoprofiles with high aggressiveness were mainly found in strains from phylotypes I, IIB, and III. One pathoprofile included a strain that overcame almost all resistance sources. PMID:20795852

  7. Biochemical changes induced by salt stress in halotolerant bacterial isolates are media dependent as well as species specific.

    PubMed

    Joghee, Nidhya Nadarajan; Jayaraman, Gurunathan

    2016-01-01

    Halophilic bacteria respond to salt stress by regulating the cytosolic pools of organic solutes to achieve osmotic equilibrium. In order to understand the metabolic regulation of these organic solutes, for the first time, we have investigated the effect of salt on growth and biochemical changes in four major moderately halophilic bacterial strains isolated from a saltern region of the Kumta coast, India. The strains under study were Halomonas hydrothermalis VITP9, Bacillus aquimaris VITP4, Planococcus maritimus VITP21, and Virgibacillus dokdonensis VITP14, which exhibited similar salt tolerance (0% to 10% w/v NaCl) with optimal growth at 5% w/v NaCl. Biochemical analysis showed that the total intracellular organic solutes increased significantly with increasing NaCl concentration in the growth medium, and the compositions of the solutes were dependent on the type of strain and also on the nutrient richness of the growth medium. Glutamic acid levels increased in all the strains under salt stress, indicating the significance of glutamic acid as the anionic counterpart of K(+)/Na(+) ions and precursor for other synthesized nitrogenous osmolytes. Though initial studies were performed with thin-layer chromatography, mass spectrometry was used to identify the major solutes accumulated by the strains under salt stress, such as proline (VITP4), ectoine (VITP14 and VITP9), and sugars (VITP21) under minimal medium and glycine betaine (by all the strains under study) under complex growth medium conditions. Such comparative study on the stress-dependent metabolic differences of different microbes, under identical experimental condition, helps to identify possible bacterial sources for the production of industrially important solutes. PMID:25286020

  8. Characterization of deoxyribonucleic Acid species from castor bean endosperm: inability to detect a unique deoxyribonucleic Acid species associated with glyoxysomes.

    PubMed

    Douglass, S A; Criddle, R S; Breidenbach, R W

    1973-05-01

    Three DNA buoyant density species (nuclear, 1.692 g cm(-3); mitochondria 1.705 g cm(-3); and proplastid, 1.713 g cm(-3)) can be detected in extracts from castor bean endosperm. No other buoyant density species can be identified. DNA extracts from sucrose density gradient purified glyoxysomes exhibit varying amounts of each of the three identified DNAs but no other distinguishable DNA species. RNA synthesized in vitro by Escherichia coli RNA polymerase using purified castor bean nuclear DNA as a template, hybridizes equally well with its template and with the 1.692 g cm(-3) species from glyoxysome fractions. These results are discussed in terms of their relevance to microbody biogenesis.

  9. The animal food supplement sepiolite promotes a direct horizontal transfer of antibiotic resistance plasmids between bacterial species.

    PubMed

    Rodríguez-Beltrán, Jerónimo; Rodríguez-Rojas, Alexandro; Yubero, Elva; Blázquez, Jesús

    2013-06-01

    Animal fodder is routinely complemented with antibiotics together with other food supplements to improve growth. For instance, sepiolite is currently used as a dietary coadjuvant in animal feed, as it increases animal growth parameters and improves meat and derived final product quality. This type of food additive has so far been considered innocuous for the development and spread of antibiotic resistance. In this study, we demonstrate that sepiolite promotes the direct horizontal transfer of antibiotic resistance plasmids between bacterial species. The conditions needed for plasmid transfer (sepiolite and friction forces) occur in the digestive tracts of farm animals, which routinely receive sepiolite as a food additive. Furthermore, this effect may be aggravated by the use of antibiotics supplied as growth promoters.

  10. Aminomethylphosphonic acid accumulation in plant species treated with glyphosate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aminomethylphosphonic acid (AMPA) is the most frequently detected metabolite of glyphosate in plants. Greenhouse studies were conducted to determine the glyphosate I50 values (rate required to cause a 50% reduction in plant growth) and to quantify AMPA and shikimate concentrations in selected legum...

  11. An Empirical Strategy for Characterizing Bacterial Proteomes across Species in the Absence of Genomic Sequences

    PubMed Central

    Turse, Joshua E.; Marshall, Matthew J.; Fredrickson, James K.; Lipton, Mary S.; Callister, Stephen J.

    2010-01-01

    Global protein identification through current proteomics methods typically depends on the availability of sequenced genomes. In spite of increasingly high throughput sequencing technologies, this information is not available for every microorganism and rarely available for entire microbial communities. Nevertheless, the protein-level homology that exists between related bacteria makes it possible to extract biological information from the proteome of an organism or microbial community by using the genomic sequences of a near neighbor organism. Here, we demonstrate a trans-organism search strategy for determining the extent to which near-neighbor genome sequences can be applied to identify proteins in unsequenced environmental isolates. In proof of concept testing, we found that within a CLUSTAL W distance of 0.089, near-neighbor genomes successfully identified a high percentage of proteins within an organism. Application of this strategy to characterize environmental bacterial isolates lacking sequenced genomes, but having 16S rDNA sequence similarity to Shewanella resulted in the identification of 300–500 proteins in each strain. The majority of identified pathways mapped to core processes, as well as to processes unique to the Shewanellae, in particular to the presence of c-type cytochromes. Examples of core functional categories include energy metabolism, protein and nucleotide synthesis and cofactor biosynthesis, allowing classification of bacteria by observation of conserved processes. Additionally, within these core functionalities, we observed proteins involved in the alternative lactate utilization pathway, recently described in Shewanella. PMID:21103051

  12. [Bactericial activity of chlorhexidine gluconate against recent clinical isolates of various bacterial species in Japan].

    PubMed

    Kanazawa, Katsunori; Ueda, Yutaka

    2004-10-01

    The minimum inhibitory concentration (MIC) and bactericidal activity of chlorhexidine gluconate (CHG) were determined for methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant S. aureus (MRSA), Escherichia coli, Serratia marcescens, Eterobacter cloacae, Pseudomonas aeruginosa and Burkholderia cepacia, isolated from patients in medical institutions all over Japan between 2000 and 2002. The following findings were obtained. 1. The MICs of CHG against MSSA, MRSA, E. coli and B. cepacia were 0.002% or less, and those against S. marcescens, E. cloacae and P. aeruginosa were 0.008% or less. 2. Rapid and strong bactericidal effects of CHG were observed against all clinical isolates of E. coli, E. cloacae and P. aeruginosa tested even at relatively low concentrations (0.02 to 0.05%). 3. Relatively high concentration or prolonged treatment time was required to achieve sufficient bactericidal effect of CHG against some isolates of S. aureus, S. marcescens and B. cepacia. These results suggest that CHG is useful antiseptic agent or disinfectant for recent clinical isolates of various bacterial pathogens. In addition, the selection of treatment concentration and treatment time for each organism and purpose was important to obtain sufficient bactericidal effect.

  13. Biodegradation of free cyanide by bacterial species isolated from cyanide-contaminated artisanal gold mining catchment area in Burkina Faso.

    PubMed

    Razanamahandry, Lovasoa Christine; Andrianisa, Harinaivo Anderson; Karoui, Hela; Kouakou, Koffi Marcelin; Yacouba, Hamma

    2016-08-01

    Soil and water samples were collected from a watershed in Burkina Faso where illegal artisanal gold extraction using cyanidation occurs. The samples were used to evaluate cyanide contamination and the presence of cyanide degrading bacteria (CDB). Free cyanide (F-CN) was detected in all samples, with concentrations varying from 0.023 to 0.9 mg kg(-1), and 0.7-23 μg L(-1) in the soil and water samples, respectively. Potential CDB also were present in the samples. To test the effective F-CN degradation capacity of the isolated CDB species, the species were cultivated in growth media containing 40, 60 or 80 mg F-CN L(-1), with or without nutrients, at pH 9.5 and at room temperature. More than 95% of F-CN was degraded within 25 h, and F-CN degradation was associated with bacterial growth and ammonium production. However, initial concentrations of F-CN higher than 100 mg L(-1) inhibited bacterial growth and cyanide degradation. Abiotic tests showed that less than 3% of F-CN was removed by volatilization. Thus, the degradation of F-CN occurred predominately by biological mechanisms, and such mechanisms are recommended for remediation of contaminated soil and water. The bacteria consortium used in the experiment described above exist in a Sahelian climate, which is characterized by a long hot and dry season. Because the bacteria are already adapted to the local climate conditions and show the potential for cyanide biodegradation, further applicability to other contaminated areas in West Africa, where illegal gold cyanidation is widespread, should be explored. PMID:27209555

  14. Multifactorial Competition and Resistance in a Two-Species Bacterial System

    PubMed Central

    Khare, Anupama; Tavazoie, Saeed

    2015-01-01

    Microorganisms exist almost exclusively in interactive multispecies communities, but genetic determinants of the fitness of interacting bacteria, and accessible adaptive pathways, remain uncharacterized. Here, using a two-species system, we studied the antagonism of Pseudomonas aeruginosa against Escherichia coli. Our unbiased genome-scale approach enabled us to identify multiple factors that explained the entire antagonism observed. We discovered both forms of ecological competition–sequestration of iron led to exploitative competition, while phenazine exposure engendered interference competition. We used laboratory evolution to discover adaptive evolutionary trajectories in our system. In the presence of P. aeruginosa toxins, E. coli populations showed parallel molecular evolution and adaptive convergence at the gene-level. The multiple resistance pathways discovered provide novel insights into mechanisms of toxin entry and activity. Our study reveals the molecular complexity of a simple two-species interaction, an important first-step in the application of systems biology to detailed molecular dissection of interactions within native microbiomes. PMID:26647077

  15. Antioxidant and Antimicrobial Potential, and HPLC Analysis of Stictic and Usnic Acids of Three Usnea Species from Uludag Mountain (Bursa, Turkey).

    PubMed

    Oran, Seyhan; Sahin, Saliha; Sahinturk, Pinar; Ozturk, Sule; Demir, Cevdet

    2016-01-01

    In this study, antioxidant and antimicrobial potentials of Usnea intermedia, U. filipendula, and U. fulvoreagens and their stictic and usnic acid contents were investigated. Antioxidant activity and total phenolic contents were evaluated in acetone, ethanol, and methanol extracts of these three species. Antioxidant activity was measured by ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] method and total phenolic contents were measured by Folin-Ciocalteu method. High-performance liquid chromatography (HPLC) was used for the determination of lichen acids. It can be concluded from stictic and usnic acids contents that the order of solvent efficiency is acetone > ethanol > methanol and acetone > methanol > ethanol, respectively. Broth microdilution method was performed to determine the minimum inhibitory concentration (MIC) of the methanol extracts of three Usnea species. The MIC values of all the extracts ranged from 64 µg/mL to 512 µg/mL for all the bacterial strains that were tested in this study, and all the Fluoro quinolone-resistant Escherichia coli isolates (except for E101) were sensitive to the methanol extracts of the three Usnea species. This paper is the first study to determine the stictic acid content in U. intermedia and U. filipendula. Our findings indicate that these three Usnea species could be used as antioxidant and antimicrobial agents. PMID:27642324

  16. Antioxidant and Antimicrobial Potential, and HPLC Analysis of Stictic and Usnic Acids of Three Usnea Species from Uludag Mountain (Bursa, Turkey)

    PubMed Central

    Oran, Seyhan; Sahin, Saliha; Sahinturk, Pinar; Ozturk, Sule; Demir, Cevdet

    2016-01-01

    In this study, antioxidant and antimicrobial potentials of Usnea intermedia, U. filipendula, and U. fulvoreagens and their stictic and usnic acid contents were investigated. Antioxidant activity and total phenolic contents were evaluated in acetone, ethanol, and methanol extracts of these three species. Antioxidant activity was measured by ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] method and total phenolic contents were measured by Folin-Ciocalteu method. High-performance liquid chromatography (HPLC) was used for the determination of lichen acids. It can be concluded from stictic and usnic acids contents that the order of solvent efficiency is acetone > ethanol > methanol and acetone > methanol > ethanol, respectively. Broth microdilution method was performed to determine the minimum inhibitory concentration (MIC) of the methanol extracts of three Usnea species. The MIC values of all the extracts ranged from 64 µg/mL to 512 µg/mL for all the bacterial strains that were tested in this study, and all the Fluoro quinolone-resistant Escherichia coli isolates (except for E101) were sensitive to the methanol extracts of the three Usnea species. This paper is the first study to determine the stictic acid content in U. intermedia and U. filipendula. Our findings indicate that these three Usnea species could be used as antioxidant and antimicrobial agents.

  17. Antioxidant and Antimicrobial Potential, and HPLC Analysis of Stictic and Usnic Acids of Three Usnea Species from Uludag Mountain (Bursa, Turkey)

    PubMed Central

    Oran, Seyhan; Sahin, Saliha; Sahinturk, Pinar; Ozturk, Sule; Demir, Cevdet

    2016-01-01

    In this study, antioxidant and antimicrobial potentials of Usnea intermedia, U. filipendula, and U. fulvoreagens and their stictic and usnic acid contents were investigated. Antioxidant activity and total phenolic contents were evaluated in acetone, ethanol, and methanol extracts of these three species. Antioxidant activity was measured by ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] method and total phenolic contents were measured by Folin-Ciocalteu method. High-performance liquid chromatography (HPLC) was used for the determination of lichen acids. It can be concluded from stictic and usnic acids contents that the order of solvent efficiency is acetone > ethanol > methanol and acetone > methanol > ethanol, respectively. Broth microdilution method was performed to determine the minimum inhibitory concentration (MIC) of the methanol extracts of three Usnea species. The MIC values of all the extracts ranged from 64 µg/mL to 512 µg/mL for all the bacterial strains that were tested in this study, and all the Fluoro quinolone-resistant Escherichia coli isolates (except for E101) were sensitive to the methanol extracts of the three Usnea species. This paper is the first study to determine the stictic acid content in U. intermedia and U. filipendula. Our findings indicate that these three Usnea species could be used as antioxidant and antimicrobial agents. PMID:27642324

  18. Characterization of a Single Magnetotactic Bacterial Species from Devil's Bathtub, Mendon Ponds Park, Honeoye Falls, NY

    NASA Astrophysics Data System (ADS)

    Wagner, C.; Tarduno, J. A.; Stein, A.; Sia, E.

    2015-12-01

    Magnetotactic bacteria (MTB) belong to a lineage of prokaryotic bacteria that synthesize magnetosomes, single domain magnetic particles (typically magnetite or greigite) with an average size of 50 nanometers. MTB utilize magnetosomes through magnetotaxis, the alignment and movement along magnetic field lines to navigate towards preferred environmental conditions. MTB are sensitive to different environments and are thought to exhibit varying magnetosome morphologies, compositions, sizes, and quantities in regards to the environments which they inhabit. These characteristics allow MTB and magnetofossils (preserved magnetosomes) to be used as modern/paleoenvironmental recorders and biomarkers for environmental change(s). Devil's Bathtub (Mendon Ponds Park, Honeoye Falls, NY) is a meromictic glacial kettle pond surrounded by deciduous tree cover. Here we examine one species of MTB based on prominence of this particular morphology at this locale. Magnetotaxis and morphology of this species have been observed using light microscopy. Micrographs have also been taken using Transmission Electron Microscopy (TEM) to verify cell morphology and to determine magnetosome morphology. TEM and magnetic hysteresis measurements were done to find and test the composition of magnetosomes. In this study we also focus on DNA sequencing and characterization of this MTB, as there are few MTB species which have been DNA sequenced successfully. Data from these experiments are directly applicable to this up-and-coming area of research as it will aid in the understanding and correlation of magnetosome and magnetofossils with environmental characteristics.

  19. Comparison of the formation of nicotinic acid conjugates in leaves of different plant species.

    PubMed

    Ashihara, Hiroshi; Yin, Yuling; Katahira, Riko; Watanabe, Shin; Mimura, Tetsuro; Sasamoto, Hamako

    2012-11-01

    There are three metabolic fates of nicotinic acid in plants: (1) nicotinic acid mononucleotide formation for NAD synthesis by the so-called salvage pathway of pyridine nucleotide biosynthesis; (2) nicotinic acid N-glucoside formation; and (3) trigonelline (N-methylnicotinic acid) formation. In the present study, the metabolism of [carbonyl-(14)C]nicotinamide was investigated in leaves of 23 wild plant species. All species readily converted nicotinamide to nicotinic acid, and only a fraction of nicotinic acid was utilised for NAD and NADP synthesis. The remaining nicotinic acid is converted to the nicotinic acid conjugates. Only one plant species, Cycas revoluta, produced both nicotinic acid N-glucoside and trigonelline; the other 22 species produced one or other of the conjugates. The nicotinic acid N-glucoside-forming plants are Cyathea lepifera, Arenga trewmula var. englri, Barringtonia racemosa, Ilex paraguariensis, Angelica japonica, Scaevola taccada and Farfugium japonicum. In contrast, trigonelline is formed in C. lepifera, Ginkgo biloba, Pinus luchuensis, Casuarina equisetifolia, Alocasia odora, Pandanus odoratissimus, Hylocereus undatus, Kalanchoe pinnata, Kalanchoe tubiflora, Populus alba, Garcinia subelliptica, Oxalis corymbosa, Leucaena leucocephala, Vigna marina, Hibiscus tiliaceus and Melicope triphylla. The diversity of nicotinic acid conjugate formation in plants is discussed using these results and our previous investigation involving a few model plants, various crops and ferns. Nicotinic acid N-glucoside formation was restricted mostly to ferns and selected orders of angiosperms, whereas other plants produce trigonelline. In most cases the formation of both nicotinic acid conjugates is incompatible, but some exceptions have been found. PMID:22983143

  20. Organic acids and selected nitrogen species for ABLE-3

    NASA Technical Reports Server (NTRS)

    Talbot, Robert W.

    1991-01-01

    The NASA Global Tropospheric Experiment (GTE) executed airborne science missions aboard the NASA Wallops Electra (NA429) in the North American high latitude (greater than 45 deg North) atmosphere during Jul. to Aug. 1988 and Jul. to Aug. 1990. These missions were part of GTE's Atmospheric Boundary Layer Experiment (ABLE). The 1988 mission , ABLE-3A, examined the ecosystems of Alaska as a source and/or sink for important tropospheric gases and particles, and gained new information on the chemical composition of the Arctic atmosphere during the summertime. During 1990 the second high latitude mission, ABLE-3B, focused on the Hudson Bay Lowland and Labrador regions of Canada. Both of these missions provided benchmark data sets on atmosphere biosphere exchange and atmospheric chemistry over largely uninhabited regions of North America. In support of the GTE/ABLE-3A and -3B field missions, the University of New Hampshire flew instrumentation aboard the Wallops Electra research aircraft to provide measurements of the trace gases nitric (HNO3), formic (HCOOH), and acetic (CH3COOH) acid. In addition, measurements were conducted to determine the major water soluble ionic composition of the atmospheric aerosol. For ABLE-3B, groundbased measurements of the acidic trace gases were also performed from the NASA micrometerological tower situated at Schefferville, Laborador. These measurements were aimed at assessing dry deposition of acidic gases to the taiga ecosystem in the Laborador region of Canada.

  1. Effect of growth phase on the fatty acid compositions of four species of marine diatoms

    NASA Astrophysics Data System (ADS)

    Liang, Ying; Mai, Kangsen

    2005-04-01

    The fatty acid compositions of four species of marine diatoms ( Chaetoceros gracilis MACC/B13, Cylindrotheca fusiformis MACC/B211, Phaeodactylum tricornutum MACC/B221 and Nitzschia closterium MACC/B222), cultivated at 22°C±1°C with the salinity of 28 in f/2 medium and harvested in the exponential growth phase, the early stationary phase and the late stationary phase, were determined. The results showed that growth phase has significant effect on most fatty acid contents in the four species of marine diatoms. The proportions of 16:0 and 16:1n-7 fatty acids increased while those of 16:3n-4 and eicosapentaenoic acid (EPA) decreased with increasing culture age in all species studied. The subtotal of saturated fatty acids (SFA) increased with the increasing culture age in all species with the exception of B13. The subtotal of monounsaturated fatty acids (MUFA) increased while that of polyunsaturated fatty acids (PUFA) decreased with culture age in the four species of marine diatoms. MUFA reached their lowest value in the exponential growth phase, whereas PUFA reached their highest value in the same phase.

  2. Comparison of tryptophan biosynthetic operon regulation in different Gram-positive bacterial species.

    PubMed

    Gutiérrez-Preciado, Ana; Yanofsky, Charles; Merino, Enrique

    2007-09-01

    The tryptophan biosynthetic operon has been widely used as a model system for studying transcription regulation. In Bacillus subtilis, the trp operon is primarily regulated by a tryptophan-activated RNA-binding protein, TRAP. Here we show that in many other Gram-positive species the trp operon is regulated differently, by tRNA(Trp) sensing by the RNA-based T-box mechanism, with T-boxes arranged in tandem. Our analyses reveal an apparent relationship between trp operon organization and the specific regulatory mechanism(s) used. PMID:17555843

  3. Optimization of the mechanical performance of bacterial cellulose/poly(L-lactic) acid composites.

    PubMed

    Quero, Franck; Nogi, Masaya; Yano, Hiroyuki; Abdulsalami, Kovo; Holmes, Stuart M; Sakakini, Bahij H; Eichhorn, Stephen J

    2010-01-01

    Understanding the nature of the interface between nanofibers and polymer resins in composite materials is challenging because of the complexity of interactions that may occur between fibers and between the matrix and the fibers. The ability to select the most efficient amount of reinforcement for stress transfer, making a saving on both cost and weight, is also a key part of composite design. The use of Raman spectroscopy to investigate micromechanical properties of laminated bacterial cellulose (BC)/poly(l-lactic) acid (PLLA) resin composites is reported for the first time as a means for understanding the fundamental stress-transfer processes in these composites, but also as a tool to select appropriate processing and volume fraction of the reinforcing fibers. Two forms of BC networks are investigated, namely, one cultured for 3 days and another for 6 days. The mechanical properties of the latter were found to be higher than the former in terms of Young's modulus, stress at failure, and work of fracture. However, their specific Young's moduli (divided by density) were found to be similar. Young's modulus and stress at failure of transparent predominantly amorphous PLLA films were found to increase by 100 and 315%, respectively, for an 18% volume fraction of BC fibers. BC networks cultured for 3 days were shown to exhibit enhanced interaction with PLLA because of their higher total surface area compared, as measured by nitrogen adsorption, to the material cultured for 6 days. This enhanced interaction is confirmed by using the Raman spectroscopic approach, whereby larger band shift rates, of a peak initially located at 1095 cm(-1), with respect to both strain and stress, are observed, which is a quantitative measure of enhanced stress transfer. Thermal analysis (differential scanning calorimetry) and electron microscopy imaging (scanning electron microscopy) of the samples also confirms the enhanced coupling between the resin and the BC networks cultured for 3 days

  4. MLPA diagnostics of complex microbial communities: relative quantification of bacterial species in oral biofilms.

    PubMed

    Terefework, Zewdu; Pham, Chi L; Prosperi, Anja C; Entius, Mark M; Errami, Abdellatif; van Spanning, Rob J M; Zaura, Egija; Ten Cate, Jacob M; Crielaard, Wim

    2008-12-01

    A multitude of molecular methods are currently used for identification and characterization of oral biofilms or for community profiling. However, multiplex PCR techniques that are able to routinely identify several species in a single assay are not available. Multiplex Ligation-dependent Probe Amplification (MLPA) identifies up to 45 unique fragments in a single tube PCR. Here we report a novel use of MLPA in the relative quantification of targeted microorganisms in a community of oral microbiota. We designed 9 species specific probes for: Actinomyces gerencseriae, Actinomyces naeslundii, Actinomyces odontolyticus, Candida albicans, Lactobacillus acidophilus, Rothia dentocariosa, Streptococcus mutans, Streptococcus sanguinis and Veillonella parvula; and genus specific probes for selected oral Streptococci and Lactobacilli based on their 16S rDNA sequences. MLPA analysis of DNA pooled from the strains showed the expected specific MLPA products. Relative quantification of a serial dilution of equimolar DNA showed that as little as 10 pg templates can be detected with clearly discernible signals. Moreover, a 2 to 7% divergence in relative signal ratio of amplified probes observed from normalized peak area values suggests MLPA can be a cheaper alternative to using qPCR for quantification. We observed 2 to 6 fold fluctuations in signal intensities of MLPA products in DNAs isolated from multispecies biofilms grown in various media for various culture times. Furthermore, MLPA analyses of DNA isolated from saliva obtained from different donors gave a varying number and intensity of signals. This clearly shows the usefulness of MLPA in a quantitative description of microbial shifts.

  5. Effect of temperature on bacterial species diversity in thermophilic solid-waste composting.

    PubMed

    Strom, P F

    1985-10-01

    Continuously thermophilic composting was examined with a 4.5-liter reactor placed in an incubator maintained at representative temperatures. Feed was a mixture of dried table scraps and shredded newspaper wetted to 55% moisture. One run at 49 degrees C (run A) employed a 1:4 feed-to-compost ratio, while the other runs used a 10:1 ratio and were incubated at 50, 55, 60, or 65 degrees C. Due to self-heating, internal temperatures of the composting mass were 0 to 7 degrees C hotter than the incubator. Two full-scale composting plants (at Altoona, Pa., and Leicester, England) were also examined. Plate counts per gram (dry weight) on Trypticase soy broth (BBL Microbiology Systems) with 2% agar ranged from 0.7 X 10(9) to 5.3 X 10(9) for laboratory composting and 0.02 X 10(9) to 7.4 X 10(9) for field composting. Fifteen taxa were isolated, including 10 of genus Bacillus, which dominated all samples except that from run A. Species diversity decreased markedly in laboratory composting at 60 degrees C and above, but was similar for the three runs incubated at 49, 50, and 55 degrees C. The maximum desirable composting temperature based on species diversity is thus 60 degrees C, the same as that previously recommended based on measures of the rate of decomposition. PMID:4083885

  6. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    PubMed Central

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-01-01

    While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution. PMID:26527268

  7. Acetylation of bacterial cellulose catalyzed by citric acid: Use of reaction conditions for tailoring the esterification extent.

    PubMed

    Ávila Ramírez, Jhon Alejandro; Gómez Hoyos, Catalina; Arroyo, Silvana; Cerrutti, Patricia; Foresti, María Laura

    2016-11-20

    Bacterial cellulose (BC) nanoribbons were partially acetylated by a simple direct solvent-free route catalyzed by citric acid. The assay of reaction conditions within chosen intervals (i.e. esterification time (0.5-7h), catalyst content (0.08-1.01mmol/mmol AGU), and temperature (90-140°C)), illustrated the flexibility of the methodology proposed, with reaction variables which can be conveniently manipulated to acetylate BC to the required degree of substitution (DS) within the 0.20-0.73 interval. Within this DS interval, characterization results indicated a surface-only process in which acetylated bacterial cellulose with tunable DS, preserved fibrous structure and increased hydrophobicity could be easily obtained. The feasibility of reusing the catalyst/excess acylant in view of potential scale-up was also illustrated.

  8. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I.

    PubMed

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-11-01

    While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  9. Acetylation of bacterial cellulose catalyzed by citric acid: Use of reaction conditions for tailoring the esterification extent.

    PubMed

    Ávila Ramírez, Jhon Alejandro; Gómez Hoyos, Catalina; Arroyo, Silvana; Cerrutti, Patricia; Foresti, María Laura

    2016-11-20

    Bacterial cellulose (BC) nanoribbons were partially acetylated by a simple direct solvent-free route catalyzed by citric acid. The assay of reaction conditions within chosen intervals (i.e. esterification time (0.5-7h), catalyst content (0.08-1.01mmol/mmol AGU), and temperature (90-140°C)), illustrated the flexibility of the methodology proposed, with reaction variables which can be conveniently manipulated to acetylate BC to the required degree of substitution (DS) within the 0.20-0.73 interval. Within this DS interval, characterization results indicated a surface-only process in which acetylated bacterial cellulose with tunable DS, preserved fibrous structure and increased hydrophobicity could be easily obtained. The feasibility of reusing the catalyst/excess acylant in view of potential scale-up was also illustrated. PMID:27561540

  10. Impacts of silver nanoparticles on bacterial species B. subtilis and E. coli and the major crop plant Z. mays

    NASA Astrophysics Data System (ADS)

    Doody, Michael A.

    This thesis examines the impacts of citrate-coated silver nanoparticles (c-AgNPs) on two species of bacteria (Bacillus subtilis and Escherichia coli), the major crop plant Zea mays, and the beneficial plant-microbe relationship between Z. mays and B. subtilis. AgNPs are an increasing component of antimicrobial consumer, industrial, and military products. This has led to widespread scientific concern for the ecological safety outside their intended use. An overview of their history, use, and toxicity was used to inform the design of experiments and resulting data. Growth inhibition and sub-lethal toxic effects were used to assess the effects of c-AgNP exposure to bacteria. Similar analytical methods were used to quantify the response of Z. mays to c-AgNP exposure. Results showed that exposure to c-AgNP significantly reduced the growth of bacterial populations and alters their growth kinetics. Z. mays experienced significant sub-lethal effects due to exposure, including reduced root length and biomass, and hyper-accumulated Ag in root tissues. Beneficial interactions between B. subtilis and Z. mays were reduced as both species suffered sub-lethal effects of exposure to c-AgNPs.

  11. Parallel Mutations Result in a Wide Range of Cooperation and Community Consequences in a Two-Species Bacterial Consortium.

    PubMed

    Douglas, Sarah M; Chubiz, Lon M; Harcombe, William R; Ytreberg, F Marty; Marx, Christopher J

    2016-01-01

    Multi-species microbial communities play a critical role in human health, industry, and waste remediation. Recently, the evolution of synthetic consortia in the laboratory has enabled adaptation to be addressed in the context of interacting species. Using an engineered bacterial consortium, we repeatedly evolved cooperative genotypes and examined both the predictability of evolution and the phenotypes that determine community dynamics. Eight Salmonella enterica serovar Typhimurium strains evolved methionine excretion sufficient to support growth of an Escherichia coli methionine auxotroph, from whom they required excreted growth substrates. Non-synonymous mutations in metA, encoding homoserine trans-succinylase (HTS), were detected in each evolved S. enterica methionine cooperator and were shown to be necessary for cooperative consortia growth. Molecular modeling was used to predict that most of the non-synonymous mutations slightly increase the binding affinity for HTS homodimer formation. Despite this genetic parallelism and trend of increasing protein binding stability, these metA alleles gave rise to a wide range of phenotypic diversity in terms of individual versus group benefit. The cooperators with the highest methionine excretion permitted nearly two-fold faster consortia growth and supported the highest fraction of E. coli, yet also had the slowest individual growth rates compared to less cooperative strains. Thus, although the genetic basis of adaptation was quite similar across independent origins of cooperative phenotypes, quantitative measurements of metabolite production were required to predict either the individual-level growth consequences or how these propagate to community-level behavior. PMID:27617746

  12. Parallel Mutations Result in a Wide Range of Cooperation and Community Consequences in a Two-Species Bacterial Consortium

    PubMed Central

    Douglas, Sarah M.; Chubiz, Lon M.; Harcombe, William R.; Ytreberg, F. Marty; Marx, Christopher J.

    2016-01-01

    Multi-species microbial communities play a critical role in human health, industry, and waste remediation. Recently, the evolution of synthetic consortia in the laboratory has enabled adaptation to be addressed in the context of interacting species. Using an engineered bacterial consortium, we repeatedly evolved cooperative genotypes and examined both the predictability of evolution and the phenotypes that determine community dynamics. Eight Salmonella enterica serovar Typhimurium strains evolved methionine excretion sufficient to support growth of an Escherichia coli methionine auxotroph, from whom they required excreted growth substrates. Non-synonymous mutations in metA, encoding homoserine trans-succinylase (HTS), were detected in each evolved S. enterica methionine cooperator and were shown to be necessary for cooperative consortia growth. Molecular modeling was used to predict that most of the non-synonymous mutations slightly increase the binding affinity for HTS homodimer formation. Despite this genetic parallelism and trend of increasing protein binding stability, these metA alleles gave rise to a wide range of phenotypic diversity in terms of individual versus group benefit. The cooperators with the highest methionine excretion permitted nearly two-fold faster consortia growth and supported the highest fraction of E. coli, yet also had the slowest individual growth rates compared to less cooperative strains. Thus, although the genetic basis of adaptation was quite similar across independent origins of cooperative phenotypes, quantitative measurements of metabolite production were required to predict either the individual-level growth consequences or how these propagate to community-level behavior. PMID:27617746

  13. Biotechnological production of caffeic acid derivatives from cell and organ cultures of Echinacea species.

    PubMed

    Murthy, Hosakatte Niranjana; Kim, Yun-Soo; Park, So-Young; Paek, Kee-Yoeup

    2014-09-01

    Caffeic acid derivatives (CADs) are a group of bioactive compounds which are produced in Echinacea species especially Echinacea purpurea, Echinacea angustifolia, and Echinacea pallida. Echinacea is a popular herbal medicine used in the treatment of common cold and it is also a prominent dietary supplement used throughout the world. Caffeic acid, chlorogenic acid (5-O-caffeoylquinic acid), caftaric acid (2-O-caffeoyltartaric acid), cichoric acid (2, 3-O-dicaffeoyltartaric acid), cynarin, and echinacoside are some of the important CADs which have varied pharmacological activities. The concentrations of these bioactive compounds are species specific and also they vary considerably with the cultivated Echinacea species due to geographical location, stage of development, time of harvest, and growth conditions. Due to these reasons, plant cell and organ cultures have become attractive alternative for the production of biomass and caffeic acid derivatives. Adventitious and hairy roots have been induced in E. pupurea and E. angustifolia, and suspension cultures have been established from flask to bioreactor scale for the production of biomass and CADs. Tremendous progress has been made in this area; various bioprocess methods and strategies have been developed for constant high-quality productivity of biomass and secondary products. This review is aimed to discuss biotechnological methods and approaches employed for the sustainable production of CADs.

  14. Exposure of two upland plant species to acidic fogs.

    PubMed

    Ashenden, T W; Rafarel, C R; Bell, S A

    1991-01-01

    A system is described for exposing large numbers of plants to acidic fogs. The system allows low volumes of treatment solutions to be provided at particle sizes chiefly in the 5-30 microm range (equivalent to fog/cloud droplets). Plants of Poa alpina L. and Epilobium brunnescens were propagated from material collected in Snowdonia, North Wales and exposed to fog treatments at pH values of 2.5, 3.5, 4.5 and 5.6. There were 3 x 4 h exposures per week which provided a total of 6 mm deposition. Supplementary watering was with pH 4.5 simulated acid rain (24 mm per week). After 21 weeks, there was increased lowering and a greater dry weight for plants of E. brunnescens exposed to the pH 2.5 fog in comparison with other treatments. Also, the plants used assimilated material to form shoots rather than roots. A similar increase in dry weight accumulation in the pH 2.5 treatment was found in P. alpina after 63 weeks but this was not associated with changes in assimilate partitioning.

  15. Iron Transformations Induced by an Acid-Tolerant Desulfosporosinus Species

    PubMed Central

    Bertel, Doug; Peck, John; Quick, Thomas J.

    2012-01-01

    The mineralogical transformations of Fe phases induced by an acid-tolerant, Fe(III)- and sulfate-reducing bacterium, Desulfosporosinus sp. strain GBSRB4.2 were evaluated under geochemical conditions associated with acid mine drainage-impacted systems (i.e., low pH and high Fe concentrations). X-ray powder diffractometry coupled with magnetic analysis by first-order reversal curve diagrams were used to evaluate mineral phases produced by GBSRB4.2 in media containing different ratios of Fe(II) and Fe(III). In medium containing Fe predominately in the +II oxidation state, ferrimagnetic, single-domain greigite (Fe3S4) was formed, but the addition of Fe(III) inhibited greigite formation. In media that contained abundant Fe(III) [as schwertmannite; Fe8O8(OH)6SO4 · nH2O], the activities of strain GBSRB4.2 enhanced the transformation of schwertmannite to goethite (α-FeOOH), due to the increased pH and Fe(II) concentrations that resulted from the activities of GBSRB4.2. PMID:22038606

  16. Iron transformations induced by an acid-tolerant Desulfosporosinus species.

    PubMed

    Bertel, Doug; Peck, John; Quick, Thomas J; Senko, John M

    2012-01-01

    The mineralogical transformations of Fe phases induced by an acid-tolerant, Fe(III)- and sulfate-reducing bacterium, Desulfosporosinus sp. strain GBSRB4.2 were evaluated under geochemical conditions associated with acid mine drainage-impacted systems (i.e., low pH and high Fe concentrations). X-ray powder diffractometry coupled with magnetic analysis by first-order reversal curve diagrams were used to evaluate mineral phases produced by GBSRB4.2 in media containing different ratios of Fe(II) and Fe(III). In medium containing Fe predominately in the +II oxidation state, ferrimagnetic, single-domain greigite (Fe₃S₄) was formed, but the addition of Fe(III) inhibited greigite formation. In media that contained abundant Fe(III) [as schwertmannite; Fe₈O₈(OH)₆SO₄ · nH₂O], the activities of strain GBSRB4.2 enhanced the transformation of schwertmannite to goethite (α-FeOOH), due to the increased pH and Fe(II) concentrations that resulted from the activities of GBSRB4.2. PMID:22038606

  17. Bacterial Species-Specific Activity of a Fluoroquinolone against Two Closely Related Pasteurellaceae with Similar MICs: Differential In Vitro Inoculum Effects and In Vivo Efficacies

    PubMed Central

    Lhermie, Guillaume; El Garch, Farid; Toutain, Pierre-Louis; Ferran, Aude A.; Bousquet-Mélou, Alain

    2015-01-01

    We investigated the antimicrobial activity of a fluoroquinolone against two genetically close bacterial species belonging to the Pasteurellaceae family. Time-kill experiments were used to measure the in vitro activity of marbofloxacin against two strains of Mannheimia haemolytica and Pasteurella multocida with similar MICs. We observed that marbofloxacin was equally potent against 105 CFU/mL inocula M. haemolytica and P. multocida. However, an inoculum effect was observed with P. multocida, meaning that marbofloxacin activity was decreased against a 108 CFU/mL inoculum, whereas no inoculum effect was observed with M. haemolytica. Marbofloxacin activity was also tested in a lung infection model with immunocompromised mice intratracheally infected with 109 CFU of each bacteria. At the same dose, the clinical and bacteriological outcomes were much better for mice infected with M. haemolytica than for those infected with P. multocida. Moreover, bacteriological eradication was obtained with a lower marbofloxacin dose for mice infected with M. haemolytica. Our results suggest that the differential in vivo marbofloxacin efficacy observed with the two bacterial species of similar MIC could be explained by a differential inoculum effect. Consequently, MICs determined on 105 CFU inocula were not predictive of the differences in antibiotic efficacies against high bacterial inocula of closely related bacterial strains. These results could stimulate further investigations on bacterial species-specific antibiotic doses in a clinical setting. PMID:26506096

  18. Interaction between common organic acids and trace nucleation species in the Earth's atmosphere.

    PubMed

    Xu, Yisheng; Nadykto, Alexey B; Yu, Fangqun; Herb, J; Wang, Wei

    2010-01-14

    Atmospheric aerosols formed via nucleation in the Earth's atmosphere play an important role in the aerosol radiative forcing associated directly with global climate changes and public health. Although it is well-known that atmospheric aerosol particles contain organic species, the chemical nature of and physicochemical processes behind atmospheric nucleation involving organic species remain unclear. In the present work, the interaction of common organic acids with molecular weights of 122, 116, 134, 88, 136, and 150 (benzoic, maleic, malic, pyruvic, phenylacetic, and tartaric acids) with nucleation precursors and charged trace species has been investigated. We found a moderate strong effect of the organic species on the stability of neutral and charged ionic species. In most cases, the free energies of the mixed H(2)SO(4)-organic acid dimer formation are within 1-1.5 kcal mol(-1) of the (H(2)SO(4))(NH(3)) formation energy. The interaction of the organic acids with trace ionic species is quite strong, and the corresponding free energies far exceed those of the (H(3)O(+))(H(2)SO(4)) and (H(3)O(+))(H(2)SO(4))(2) formation. These considerations lead us to conclude that the aforementioned organic acids may possess a substantial capability of stabilizing both neutral and positively charged prenucleation clusters, and thus, they should be studied further with regard to their involvement in the gas-to-particle conversion in the Earth's atmosphere.

  19. Estimates of Soil Bacterial Ribosome Content and Diversity Are Significantly Affected by the Nucleic Acid Extraction Method Employed

    PubMed Central

    Wüst, Pia K.; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf

    2016-01-01

    Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particular Actinobacteria and Proteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137

  20. Structure-Activity Relationship of Amino Acid Tunable Lipidated Norspermidine Conjugates: Disrupting Biofilms with Potent Activity against Bacterial Persisters.

    PubMed

    Konai, Mohini M; Adhikary, Utsarga; Samaddar, Sandip; Ghosh, Chandradhish; Haldar, Jayanta

    2015-12-16

    The emergence of bacterial resistance and biofilm associated infections has created a challenging situation in global health. In this present state of affairs where conventional antibiotics are falling short of being able to provide a solution to these problems, development of novel antibacterial compounds possessing the twin prowess of antibacterial and antibiofilm efficacy is imperative. Herein, we report a library of amino acid tunable lipidated norspermidine conjugates that were prepared by conjugating both amino acids and fatty acids with the amine functionalities of norspermidine through amide bond formation. These lipidated conjugates displayed potent antibacterial activity against various planktonic Gram-positive and Gram-negative bacteria including drug-resistant superbugs such as methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus faecium, and β-lactam-resistant Klebsiella pneumoniae. This class of nontoxic and fast-acting antibacterial molecules (capable of killing bacteria within 15 min) did not allow bacteria to develop resistance against them after several passages. Most importantly, an optimized compound in the series was also capable of killing metabolically inactive persisters and stationary phase bacteria. Additionally, this compound was capable of disrupting the preformed biofilms of S. aureus and E. coli. Therefore, this class of antibacterial conjugates have potential in tackling the challenging situation posed by both bacterial resistance as well as drug tolerance due to biofilm formation. PMID:26452096

  1. An X-ray Absorption Fine Structure study of Au adsorbed onto the non-metabolizing cells of two soil bacterial species

    NASA Astrophysics Data System (ADS)

    Song, Zhen; Kenney, Janice P. L.; Fein, Jeremy B.; Bunker, Bruce A.

    2012-06-01

    Gram-positive and Gram-negative bacterial cells can remove Au from Au(III)-chloride solutions, and the extent of removal is strongly pH dependent. In order to determine the removal mechanisms, X-ray Absorption Fine Structure (XAFS) spectroscopy experiments were conducted on non-metabolizing biomass of Bacillus subtilis and Pseudomonas putida with fixed Au(III) concentrations over a range of bacterial concentrations and pH values. X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) data on both bacterial species indicate that more than 90% of the Au atoms on the bacterial cell walls were reduced to Au(I). In contrast to what has been observed for Au(III) interaction with metabolizing bacterial cells, no Au(0) or Au-Au nearest neighbors were observed in our experimental systems. All of the removed Au was present as adsorbed bacterial surface complexes. For both species, the XAFS data suggest that although Au-chloride-hydroxide aqueous complexes dominate the speciation of Au in solution, Au on the bacterial cell wall is characterized predominantly by binding of Au atoms to sulfhydryl functional groups and amine and/or carboxyl functional groups, and the relative importance of the sulfhydryl groups increases with increasing pH and with decreasing Au loading. The XAFS data for both microorganism species suggest that adsorption is the first step in the formation of Au nanoparticles by bacteria, and the results enhance our ability to account for the behavior of Au in bacteria-bearing geologic systems.

  2. An X-ray Absorption Fine Structure study of Au adsorbed onto the non-metabolizing cells of two soil bacterial species

    SciTech Connect

    Song, Zhen; Kenney, Janice P.L.; Fein, Jeremy B.; Bunker, Bruce A.

    2015-02-09

    Gram-positive and Gram-negative bacterial cells can remove Au from Au(III)-chloride solutions, and the extent of removal is strongly pH dependent. In order to determine the removal mechanisms, X-ray Absorption Fine Structure (XAFS) spectroscopy experiments were conducted on non-metabolizing biomass of Bacillus subtilis and Pseudomonas putida with fixed Au(III) concentrations over a range of bacterial concentrations and pH values. X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) data on both bacterial species indicate that more than 90% of the Au atoms on the bacterial cell walls were reduced to Au(I). In contrast to what has been observed for Au(III) interaction with metabolizing bacterial cells, no Au(0) or Au-Au nearest neighbors were observed in our experimental systems. All of the removed Au was present as adsorbed bacterial surface complexes. For both species, the XAFS data suggest that although Au-chloride-hydroxide aqueous complexes dominate the speciation of Au in solution, Au on the bacterial cell wall is characterized predominantly by binding of Au atoms to sulfhydryl functional groups and amine and/or carboxyl functional groups, and the relative importance of the sulfhydryl groups increases with increasing pH and with decreasing Au loading. The XAFS data for both microorganism species suggest that adsorption is the first step in the formation of Au nanoparticles by bacteria, and the results enhance our ability to account for the behavior of Au in bacteria-bearing geologic systems.

  3. Increasing the dynamic control space of mammalian transcription devices by combinatorial assembly of homologous regulatory elements from different bacterial species.

    PubMed

    Bacchus, William; Weber, Wilfried; Fussenegger, Martin

    2013-01-01

    Prokaryotic transcriptional regulatory elements are widely utilized building blocks for constructing regulatory genetic circuits adapted for mammalian cells and have found their way into a broad range of biotechnological applications. Prokaryotic transcriptional repressors, fused to eukaryotic transactivation or repression domains, compose the transcription factor, which binds and adjusts transcription from chimeric promoters containing the repressor-specific operator sequence. Escherichia coli and Chlamydia trachomatis share common features in the regulatory mechanism of the biosynthesis of l-tryptophan. The repressor protein TrpR of C. trachomatis regulates the trpRBA operon and the TrpR of E. coli regulates the trpEDCBA operon, both requiring l-tryptophan as a co-repressor. Fusion of these bacterial repressors to the VP16 transactivation domain of Herpes simplex virus creates synthetic transactivators that could bind and activate chimeric promoters, assembled by placing repressor-specific operator modules adjacent to a minimal promoter, in an l-tryptophan-adjustable manner. Combinations of different transactivator and promoter variants from the same or different bacterial species resulted in a multitude of regulatory systems where l-tryptophan regulation properties, background noise, and maximal gene expression levels were significantly diverse. Different l-tryptophan analogues showed diverse regulatory capacity depending on the promoter/transactivator combination. We believe the systems approach to rationally choose promoters, transactivators and inducer molecules, to obtain desired and predefined genetic expression dynamics and control profiles, will significantly advance the design of new regulatory circuits as well as improving already existing ones. PMID:23178502

  4. Bacterial catabolism of threonine. Threonine degradation initiated by l-threonine hydrolyase (deaminating) in a species of Corynebacterium

    PubMed Central

    Bell, Stephen C.; Turner, John M.

    1977-01-01

    1. Three bacterial isolates capable of growth on l-threonine medium only when supplemented with branched-chain amino acids, and possessing high l-threonine dehydratase activity, were examined to elucidate the catabolic route for the amino acid. 2. Growth, manometric, radiotracer and enzymic experiments indicated that l-threonine was catabolized by initial deamination to 2-oxobutyrate and thence to propionate. No evidence was obtained for the involvement of l-threonine 3-dehydrogenase or l-threonine aldolase in threonine catabolism. 3. l-Threonine dehydratase of Corynebacterium sp. F5 (N.C.I.B. 11102) was partially purified and its kinetic properties were examined. The enzyme exhibited a sigmoid kinetic response to substrate concentration. The concentration of substrate giving half the maximum velocity, [S0.5], was 40mm and the Hill coefficient (h) was 2.0. l-Isoleucine inhibited enzyme activity markedly, causing 50% inhibition at 60μm, but did not affect the Hill constant. At the fixed l-threonine concentration of 10mm, the effect of l-valine was biphasic, progressive activation occurring at concentrations up to 2mm-l-valine, but was abolished by higher concentrations. Substrate-saturation plots for the l-valine-activated enzyme exhibited normal Michaelis–Menten kinetics with a Hill coefficient (h) of 1.0. The kinetic properties of the enzyme were thus similar to those of the `biosynthetic' isoenzyme from Rhodopseudomonas spheroides rather than those of the enteric bacteria. 4. The synthesis of l-threonine dehydratase was constitutive and was not subject to multivalent repression by l-isoleucine or other branched-chain amino acids either singly or in combination. 5. The catabolism of l-threonine, apparently initiated by a `biosynthetic' l-threonine dehydratase in the isolates studied, depended on the