Science.gov

Sample records for acid bacterial species

  1. Diversity and distribution of culturable lactic acid bacterial species in Indonesian Sayur Asin

    PubMed Central

    Mangunwardoyo, Wibowo; Abinawanto; Salamah, Andi; Sukara, Endang; Sulistiani; Dinoto, Achmad

    2016-01-01

    Background and Objectives: Lactic acid bacteria (LAB) play important roles in processing of Sayur Asin (spontaneously fermented mustard). Unfortunately, information about LAB in Indonesian Sayur Asin, prepared by traditional manufactures which is important as baseline data for maintenance of food quality and safety, is unclear. The aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in Sayur Asin of Indonesia. Materials and Methods: Four Sayur Asin samples (fermentation liquor and fermented mustard) were collected at harvesting times (3–7 days after fermentation) from two traditional manufactures in Tulung Agung (TA) and Kediri (KDR), East Java provinces, Indonesia. LAB strains were isolated by using MRS agar method supplemented with 1% CaCO 3 and characterized morphologically. Identification of the strains was performed basedon 16S rDNA analysis and the phylogenetic tree was drawn to understand the phylogenetic relationship of the collected strains. Results: Different profiles were detected in total count of the plates, salinity and pH of fermenting liquor of Sayur Asin in TA and KDR provinces. A total of 172 LAB isolates were successfully isolated and identified based on their 16S rDNA sequences. Phylogenetic analysis of 27 representative LAB strains from Sayur Asin showed that these strains belonged to 5 distinct species namely Lactobacilus farciminis (N=32), L. fermentum (N=4), L. namurensis (N=15), L. plantarum (N=118) and L. parafarraginis (N=1). Strains D5-S-2013 and B4-S-2013 showed a close phylogenetic relationship with L. composti and L. paralimentarius, respectively where as the sequence had slightly lower similarity of lower than 99%, suggesting that they may be classified into novel species and need further investigation due to exhibition of significant differences in their nucleotide sequences. Lactobacillus plantarum was found being dominant in all sayur asin samples. Conclusion: Lactobacilli were

  2. Peracetic Acid Treatment Generates Potent Inactivated Oral Vaccines from a Broad Range of Culturable Bacterial Species

    PubMed Central

    Moor, Kathrin; Wotzka, Sandra Y.; Toska, Albulena; Diard, Médéric; Hapfelmeier, Siegfried; Slack, Emma

    2016-01-01

    Our mucosal surfaces are the main sites of non-vector-borne pathogen entry, as well as the main interface with our commensal microbiota. We are still only beginning to understand how mucosal adaptive immunity interacts with commensal and pathogenic microbes to influence factors such as infectivity, phenotypic diversity, and within-host evolution. This is in part due to difficulties in generating specific mucosal adaptive immune responses without disrupting the mucosal microbial ecosystem itself. Here, we present a very simple tool to generate inactivated mucosal vaccines from a broad range of culturable bacteria. Oral gavage of 1010 peracetic acid-inactivated bacteria induces high-titer-specific intestinal IgA in the absence of any measurable inflammation or species invasion. As a proof of principle, we demonstrate that this technique is sufficient to provide fully protective immunity in the murine model of invasive non-typhoidal Salmonellosis, even in the face of severe innate immune deficiency. PMID:26904024

  3. Bacterial Responses to Reactive Chlorine Species

    PubMed Central

    Gray, Michael J.; Wholey, Wei-Yun; Jakob, Ursula

    2013-01-01

    Hypochlorous acid (HOCl), the active ingredient of household bleach, is the most common disinfectant in medical, industrial, and domestic use and plays an important role in microbial killing in the innate immune system. Given the critical importance of the antimicrobial properties of chlorine to public health, it is surprising how little is known about the ways in which bacteria sense and respond to reactive chlorine species (RCS). Although the literature on bacterial responses to reactive oxygen species (ROS) is enormous, work addressing bacterial responses to RCS has begun only recently. Transcriptomic and proteomic studies now provide new insights into how bacteria mount defenses against this important class of antimicrobial compounds. In this review, we summarize the current knowledge, emphasizing the overlaps between RCS stress responses and other more well-characterized bacterial defense systems, and identify outstanding questions that represent productive avenues for future research. PMID:23768204

  4. Bacterial responses to reactive chlorine species.

    PubMed

    Gray, Michael J; Wholey, Wei-Yun; Jakob, Ursula

    2013-01-01

    Hypochlorous acid (HOCl), the active ingredient of household bleach, is the most common disinfectant in medical, industrial, and domestic use and plays an important role in microbial killing in the innate immune system. Given the critical importance of the antimicrobial properties of chlorine to public health, it is surprising how little is known about the ways in which bacteria sense and respond to reactive chlorine species (RCS). Although the literature on bacterial responses to reactive oxygen species (ROS) is enormous, work addressing bacterial responses to RCS has begun only recently. Transcriptomic and proteomic studies now provide new insights into how bacteria mount defenses against this important class of antimicrobial compounds. In this review, we summarize the current knowledge, emphasizing the overlaps between RCS stress responses and other more well-characterized bacterial defense systems, and identify outstanding questions that represent productive avenues for future research.

  5. Bacterial Growth on Aminoalkylphosphonic Acids

    PubMed Central

    Harkness, Donald R.

    1966-01-01

    Harkness, Donald R. (University of Miami School of Medicine, Miami, Fla.). Bacterial growth on aminoalkylphosphonic acids. J. Bacteriol. 92:623–627. 1966.—Of 10 bacterial strains tested, 9 were found to be able to utilize the phosphorus of at least one of eight different aminoalkylphosphonic acids for growth, indicating that the ability to catabolize the carbon–phosphorus (C–P) bond is widespread among bacteria. Several organisms gave comparable growth rates as well as cell yields when an equimolar amount of either Pi or 2-aminoethylphosphonic acid (2-AEP) was added to the medium. No compounds containing C–P bonds were detected in Escherichia coli B grown on 2-AEP32-orthophosphate. No degradation of phosphonates by cell-free extracts or suspensions of dried cells was demonstrated. The direct involvement of alkaline phosphatases in cleaving the C–P bond was excluded. PMID:5922537

  6. Eradication of bacterial species via photosensitization

    NASA Astrophysics Data System (ADS)

    Golding, Paul S.; Maddocks, L.; King, Terence A.; Drucker, D. B.

    1999-02-01

    Photosensitization and inactivation efficacy of three bacterial species: Prevotella nigrescens, Staphylococcus aureus and Escherichia coli have been investigated. Samples of Staphylococcus aureus and Escherichia coli were treated with the triphenylmethane dye malachite green isothiocyanate and exposed to light from a variety of continuous and pulsed light sauces at a wavelength of approximately 630 nm. Inactivation of the Gram-positive species Staphylococcus aureus was found to increase with radiation dose, whilst Gram-negative Escherichia coli was resistant to such treatment. Samples of the pigmented species Prevotella nigrescens were found to be inactivated by exposure to light alone. The mechanism of photosensitization and inactivation of Staphylococcus aureus with malachite green isothiocyanate is addressed. The possible roles of the excited triplet state of the photosensitizer, the involvement of molecular oxygen, and the bacterial cell wall are discussed. Photosensitization may provide a way of eliminating naturally pigmented species responsible for a variety of infections, including oral diseases such as gingivitis and periodontitis.

  7. Inhibitory effects on bacterial growth and beta-ketoacyl-ACP reductase by different species of maple leaf extracts and tannic acid.

    PubMed

    Wu, Dan; Wu, Xiao-Dong; You, Xue-Fu; Ma, Xiao-Feng; Tian, Wei-Xi

    2010-01-01

    It is important to develop new antibiotics aimed at novel targets. The investigation found that the leaf extracts from five maples (Acer platanoides, Acer campestre, Acer rubrum, Acer saccharum and Acer truncatum Bunge collected in Denmark, Canada and China) and their component tannic acid displayed antibacterial ability against 24 standard bacteria strains with the minimum inhibitory concentration of 0.3-8.0 mg/mL. Unlike the standard antibiotic levofloxacin (LFX), these samples inhibited Gram-positive bacteria more effectively than they inhibited Gram-negative bacteria. These samples effectively inhibited two antidrug bacterial strains. The results show that these samples inhibit bacteria by a different mechanism from LFX. These samples potently inhibited b-ketoacyl-ACP reductase (FabG), which is an important enzyme in bacterial fatty acid synthesis. Tannic acid showed the strongest inhibition on FabG with a half inhibition concentration of 0.78 microM (0.81 microg/mL). Furthermore, tannic acid and two maple leaf extracts showed time-dependent irreversible inhibition of FabG. These three samples also exhibited better inhibition on bacteria. It is suggested that FabG is the antibacteria target of maple leaf extracts and tannic acid, and both reversible and irreversible inhibitions of FabG are important for the antibacterial effect.

  8. Cross- species communication in bacterial world.

    PubMed

    Majumdar, Sarangam; Pal, Sukla

    2017-02-20

    Biofilms are the compact association of micro organisms and the communication processes in these biofilms are always a wonder. Electrical and chemical signaling mechanism are the key to understand the bacterial communication network. Quorum sensing so far has been able to explain the coordinated motion of bacteria through its chemical signaling mechanism. Bacteria residing within biofilm communities are trivial to communicate. But the recent observation in 2017 by Humphries et al. has revealed that the ion channels enabled electrical signaling mechanism can be as powerful as to attract the distant cells i.e., this signaling mechanism are capable of holding a long range behavior. As a result long range cross species communication in the bacterial world have been possible. This substantial outcome has brought this field into a new paradigm to investigate the complex co-existence of biofilm communities and distant cells with a possible scope of application in synthetic biology. In this present article, we briefly describe this new signaling mechanism and how it gives rise to a long range communication ability in bacterial communities.

  9. Microarray identification of bacterial species in peritonsillar abscesses.

    PubMed

    Wikstén, J E; Laakso, S; Mäki, M; Mäkitie, A A; Pitkäranta, A; Blomgren, K

    2015-05-01

    Peritonsillar abscess (PTA) is the most common otorhinolaryngological infection, requiring management at the special healthcare level. The microbiological findings vary due to geographical, etiological, and methodological factors. This study aimed to identify the bacterial species of PTAs by using a novel polymerase chain reaction (PCR)- and microarray-based assay, and to find causative cofactors among patients with different pathogens. We determined the bacterial findings of aspirates of pus prospectively collected from 180 PTA patients. Samples were pretreated prior to nucleic acid extraction and analyzed with a PCR- and microarray-based assay or DNA sequencing. Both methods were based on the gyrB/parE topoisomerase genes. Patients answered symptom questionnaires at admission, and their medical records were reviewed later. Altogether, 160 (89 %) aspirates of pus tested positive for bacteria, and a bacterial species was identified in 149 (83 %) of the samples. A polybacterial species was detected in 20 (13 %) and anaerobic bacteria in 77 (52 %) of the 149 samples. Fusobacterium necrophorum patients were younger (p < 0 .001) and had more severe symptoms (p = 0.04) than patients with other pathogens. Gender, smoking, or preadmission antibiotics showed no correlation with any of the pathogens. Although requiring some optimization, this microarray assay seems feasible and fast for bacterial identification directly from pus samples, and confirms the diversity of PTA pathogens. Young patients with more severe symptoms may require special attention. Species-specific antibiotic treatment of PTA remains challenging due to bacterial variations; the present assay may aid in specifying PTA antibiotic treatment in the future.

  10. Bacterial Community Diversity Harboured by Interacting Species

    PubMed Central

    Bili, Mikaël; Cortesero, Anne Marie; Mougel, Christophe; Gauthier, Jean Pierre; Ermel, Gwennola; Simon, Jean Christophe; Outreman, Yannick; Terrat, Sébastien; Mahéo, Frédérique; Poinsot, Denis

    2016-01-01

    All animals are infected by microbial partners that can be passengers or residents and influence many biological traits of their hosts. Even if important factors that structure the composition and abundance of microbial communities within and among host individuals have been recently described, such as diet, developmental stage or phylogeny, few studies have conducted cross-taxonomic comparisons, especially on host species related by trophic relationships. Here, we describe and compare the microbial communities associated with the cabbage root fly Delia radicum and its three major parasitoids: the two staphylinid beetles Aleochara bilineata and A. bipustulata and the hymenopteran parasitoid Trybliographa rapae. For each species, two populations from Western France were sampled and microbial communities were described through culture independent methods (454 pyrosequencing). Each sample harbored at least 59 to 261 different bacterial phylotypes but was strongly dominated by one or two. Microbial communities differed markedly in terms of composition and abundance, being mainly influenced by phylogenetic proximity but also geography to a minor extent. Surprisingly, despite their strong trophic interaction, parasitoids shared a very low proportion of microbial partners with their insect host. Three vertically transmitted symbionts from the genus Wolbachia, Rickettsia, and Spiroplasma were found in this study. Among them, Wolbachia and Spiroplasma were found in both the cabbage fly and at least one of its parasitoids, which could result from horizontal transfers through trophic interactions. Phylogenetic analysis showed that this hypothesis may explain some but not all cases. More work is needed to understand the dynamics of symbiotic associations within trophic network and the effect of these bacterial communities on the fitness of their hosts. PMID:27258532

  11. Amylolytic bacterial lactic acid fermentation - a review.

    PubMed

    Reddy, Gopal; Altaf, Md; Naveena, B J; Venkateshwar, M; Kumar, E Vijay

    2008-01-01

    Lactic acid, an enigmatic chemical has wide applications in food, pharmaceutical, leather, textile industries and as chemical feed stock. Novel applications in synthesis of biodegradable plastics have increased the demand for lactic acid. Microbial fermentations are preferred over chemical synthesis of lactic acid due to various factors. Refined sugars, though costly, are the choice substrates for lactic acid production using Lactobacillus sps. Complex natural starchy raw materials used for production of lactic acid involve pretreatment by gelatinization and liquefaction followed by enzymatic saccharification to glucose and subsequent conversion of glucose to lactic acid by Lactobacillus fermentation. Direct conversion of starchy biomass to lactic acid by bacteria possessing both amylolytic and lactic acid producing character will eliminate the two step process to make it economical. Very few amylolytic lactic acid bacteria with high potential to produce lactic acid at high substrate concentrations are reported till date. In this view, a search has been made for various amylolytic LAB involved in production of lactic acid and utilization of cheaply available renewable agricultural starchy biomass. Lactobacillus amylophilus GV6 is an efficient and widely studied amylolytic lactic acid producing bacteria capable of utilizing inexpensive carbon and nitrogen substrates with high lactic acid production efficiency. This is the first review on amylolytic bacterial lactic acid fermentations till date.

  12. Bacterial lipoteichoic acid enhances cryosurvival.

    PubMed

    Rice, Charles V; Middaugh, Amy; Wickham, Jason R; Friedline, Anthony; Thomas, Kieth J; Scull, Erin; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2015-03-01

    Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. We show that lipoteichoic acid (LTA), a biopolymer in the cell wall of Gram-positive bacteria, can be added to B. subtilis cultures and increase freeze tolerance. At 1 % w/v, LTA enables a 50 % survival rate, similar to the results obtained with 1 % w/v glycerol as measured with the resazurin cell viability assay. In the absence of added LTA or glycerol, a very small number of B. subtilis cells survive freezing. This suggests that an innate freeze tolerance mechanism exists. While cryoprotection can be provided by extracellular polymeric substances, our data demonstrate a role for LTA in cryoprotection. Currently, the exact mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. However, low temperature microscopy data show small ice crystals aligned along channels of liquid water. Our observations suggest that teichoic acids could protect liquid water within biofilms and planktonic bacteria, augmenting the role of brine while also raising the possibility for survival without brine present.

  13. Bacterial Lipoteichoic Acid Enhances Cryosurvival

    PubMed Central

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Scull, Erin; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2015-01-01

    Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. We show that lipoteichoic acid (LTA), a biopolymer in the cell wall of Gram-positive bacteria, can be added to B. subtilis cultures and increase freeze tolerance. At 1% w/v, LTA enables a 50% survival rate, similar to the results obtained with 1% w/v glycerol as measured with the resazurin cell viability assay. In the absence of added LTA or glycerol, a very small number of B. subtilis cells survive freezing. This suggests that an innate freeze tolerance mechanism exists. While cryoprotection can be provided by extracellular polymeric substances (EPS), our data demonstrate a role for LTA in cryoprotection. Currently, the exact mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. However, low temperature microscopy data show small ice crystals aligned along channels of liquid water. Our observations suggest that teichoic acids could protect liquid water within biofilms and planktonic bacteria, augmenting the role of brine while also raising the possibility for survival without brine present. PMID:25477208

  14. The bacterial transformation of abietic acid

    PubMed Central

    Cross, B. E.; Myers, P. L.

    1968-01-01

    An Alcaligenes species, which was isolated from soil, can utilize abietic acid as its sole carbon source. During growth, the bacterium transforms abietic acid into 5α-hydroxyabietic acid (I, R=OH), a product considered to be 7β-hydroxy-13-isopropyl-8ξ-podocarp-13-en-15-oic acid (II, R=H) and a compound, C20H28O3, which is believed to be an epoxy-γ-lactone. PMID:5665894

  15. Bacterial Cyanuric Acid Hydrolase for Water Treatment

    PubMed Central

    Yeom, Sujin; Mutlu, Baris R.; Aksan, Alptekin

    2015-01-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  16. Bacterial Acquisition in Juveniles of Several Broadcast Spawning Coral Species

    PubMed Central

    Sharp, Koty H.; Ritchie, Kim B.; Schupp, Peter J.; Ritson-Williams, Raphael; Paul, Valerie J.

    2010-01-01

    Coral animals harbor diverse microorganisms in their tissues, including archaea, bacteria, viruses, and zooxanthellae. The extent to which coral-bacterial associations are specific and the mechanisms for their maintenance across generations in the environment are unknown. The high diversity of bacteria in adult coral colonies has made it challenging to identify species-specific patterns. Localization of bacteria in gametes and larvae of corals presents an opportunity for determining when bacterial-coral associations are initiated and whether they are dynamic throughout early development. This study focuses on the early onset of bacterial associations in the mass spawning corals Montastraea annularis, M. franksi, M. faveolata, Acropora palmata, A. cervicornis, Diploria strigosa, and A. humilis. The presence of bacteria and timing of bacterial colonization was evaluated in gametes, swimming planulae, and newly settled polyps by fluorescence in situ hybridization (FISH) using general eubacterial probes and laser-scanning confocal microscopy. The coral species investigated in this study do not appear to transmit bacteria via their gametes, and bacteria are not detectable in or on the corals until after settlement and metamorphosis. This study suggests that mass-spawning corals do not acquire, or are not colonized by, detectable numbers of bacteria until after larval settlement and development of the juvenile polyp. This timing lays the groundwork for developing and testing new hypotheses regarding general regulatory mechanisms that control bacterial colonization and infection of corals, and how interactions among bacteria and juvenile polyps influence the structure of bacterial assemblages in corals. PMID:20526374

  17. Towards large-scale FAME-based bacterial species identification using machine learning techniques.

    PubMed

    Slabbinck, Bram; De Baets, Bernard; Dawyndt, Peter; De Vos, Paul

    2009-05-01

    In the last decade, bacterial taxonomy witnessed a huge expansion. The swift pace of bacterial species (re-)definitions has a serious impact on the accuracy and completeness of first-line identification methods. Consequently, back-end identification libraries need to be synchronized with the List of Prokaryotic names with Standing in Nomenclature. In this study, we focus on bacterial fatty acid methyl ester (FAME) profiling as a broadly used first-line identification method. From the BAME@LMG database, we have selected FAME profiles of individual strains belonging to the genera Bacillus, Paenibacillus and Pseudomonas. Only those profiles resulting from standard growth conditions have been retained. The corresponding data set covers 74, 44 and 95 validly published bacterial species, respectively, represented by 961, 378 and 1673 standard FAME profiles. Through the application of machine learning techniques in a supervised strategy, different computational models have been built for genus and species identification. Three techniques have been considered: artificial neural networks, random forests and support vector machines. Nearly perfect identification has been achieved at genus level. Notwithstanding the known limited discriminative power of FAME analysis for species identification, the computational models have resulted in good species identification results for the three genera. For Bacillus, Paenibacillus and Pseudomonas, random forests have resulted in sensitivity values, respectively, 0.847, 0.901 and 0.708. The random forests models outperform those of the other machine learning techniques. Moreover, our machine learning approach also outperformed the Sherlock MIS (MIDI Inc., Newark, DE, USA). These results show that machine learning proves very useful for FAME-based bacterial species identification. Besides good bacterial identification at species level, speed and ease of taxonomic synchronization are major advantages of this computational species

  18. Prevalent bacterial species and novel phylotypes in advanced noma lesions.

    PubMed

    Paster, B J; Falkler Jr, W A; Enwonwu, C O; Idigbe, E O; Savage, K O; Levanos, V A; Tamer, M A; Ericson, R L; Lau, C N; Dewhirst, F E

    2002-06-01

    The purpose of this study was to determine the bacterial diversity in advanced noma lesions using culture-independent molecular methods. 16S ribosomal DNA bacterial genes from DNA isolated from advanced noma lesions of four Nigerian children were PCR amplified with universally conserved primers and spirochetal selective primers and cloned into Escherichia coli. Partial 16S rRNA sequences of approximately 500 bases from 212 cloned inserts were used initially to determine species identity or closest relatives by comparison with sequences of known species or phylotypes. Nearly complete sequences of approximately 1,500 bases were obtained for most of the potentially novel species. A total of 67 bacterial species or phylotypes were detected, 25 of which have not yet been grown in vitro. Nineteen of the species or phylotypes, including Propionibacterium acnes, Staphylococcus spp., and the opportunistic pathogens Stenotrophomonas maltophilia and Ochrobactrum anthropi were detected in more than one subject. Other known species that were detected included Achromobacter spp., Afipia spp., Brevundimonas diminuta, Capnocytophaga spp., Cardiobacterium sp., Eikenella corrodens, Fusobacterium spp., Gemella haemoylsans, and Neisseria spp. Phylotypes that were unique to noma infections included those in the genera Eubacterium, Flavobacterium, Kocuria, Microbacterium, and Porphyromonas and the related Streptococcus salivarius and genera Sphingomonas and TREPONEMA: Since advanced noma lesions are infections open to the environment, it was not surprising to detect species not commonly associated with the oral cavity, e.g., from soil. Several species previously implicated as putative pathogens of noma, such as spirochetes and Fusobacterium spp., were detected in at least one subject. However, due to the limited number of available noma subjects, it was not possible at this time to associate specific species with the disease.

  19. Attached bacterial populations shared by four species of aquatic angiosperms.

    PubMed

    Crump, Byron C; Koch, Evamaria W

    2008-10-01

    Symbiotic relationships between microbes and plants are common and well studied in terrestrial ecosystems, but little is known about such relationships in aquatic environments. We compared the phylogenetic diversities of leaf- and root-attached bacteria from four species of aquatic angiosperms using denaturing gradient gel electrophoresis (DGGE) and DNA sequencing of PCR-amplified 16S rRNA genes. Plants were collected from three beds in Chesapeake Bay at sites characterized as freshwater (Vallisneria americana), brackish (Potomogeton perfoliatus and Stuckenia pectinata), and marine (Zostera marina). DGGE analyses showed that bacterial communities were very similar for replicate samples of leaves from canopy-forming plants S. pectinata and P. perfoliatus and less similar for replicate samples of leaves from meadow-forming plants Z. marina and V. americana and of roots of all species. In contrast, bacterial communities differed greatly among plant species and between leaves and roots. DNA sequencing identified 154 bacterial phylotypes, most of which were restricted to single plant species. However, 12 phylotypes were found on more than one plant species, and several of these phylotypes were abundant in clone libraries and represented the darkest bands in DGGE banding patterns. Root-attached phylotypes included relatives of sulfur-oxidizing Gammaproteobacteria and sulfate-reducing Deltaproteobacteria. Leaf-attached phylotypes included relatives of polymer-degrading Bacteroidetes and phototrophic Alphaproteobacteria. Also, leaves and roots of three plant species hosted relatives of methylotrophic Betaproteobacteria belonging to the family Methylophilaceae. These results suggest that aquatic angiosperms host specialized communities of bacteria on their surfaces, including several broadly distributed and potentially mutualistic bacterial populations.

  20. Panamanian frog species host unique skin bacterial communities

    PubMed Central

    Belden, Lisa K.; Hughey, Myra C.; Rebollar, Eria A.; Umile, Thomas P.; Loftus, Stephen C.; Burzynski, Elizabeth A.; Minbiole, Kevin P. C.; House, Leanna L.; Jensen, Roderick V.; Becker, Matthew H.; Walke, Jenifer B.; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N.

    2015-01-01

    Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont

  1. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  2. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  3. The bacterial species definition in the genomic era

    PubMed Central

    Konstantinidis, Konstantinos T; Ramette, Alban; Tiedje, James M

    2006-01-01

    The bacterial species definition, despite its eminent practical significance for identification, diagnosis, quarantine and diversity surveys, remains a very difficult issue to advance. Genomics now offers novel insights into intra-species diversity and the potential for emergence of a more soundly based system. Although we share the excitement, we argue that it is premature for a universal change to the definition because current knowledge is based on too few phylogenetic groups and too few samples of natural populations. Our analysis of five important bacterial groups suggests, however, that more stringent standards for species may be justifiable when a solid understanding of gene content and ecological distinctiveness becomes available. Our analysis also reveals what is actually encompassed in a species according to the current standards, in terms of whole-genome sequence and gene-content diversity, and shows that this does not correspond to coherent clusters for the environmental Burkholderia and Shewanella genera examined. In contrast, the obligatory pathogens, which have a very restricted ecological niche, do exhibit clusters. Therefore, the idea of biologically meaningful clusters of diversity that applies to most eukaryotes may not be universally applicable in the microbial world, or if such clusters exist, they may be found at different levels of distinction. PMID:17062412

  4. Studies on interaction of colloidal silver nanoparticles (SNPs) with five different bacterial species.

    PubMed

    Khan, S Sudheer; Mukherjee, Amitava; Chandrasekaran, N

    2011-10-01

    Silver nanoparticles (SNPs) are being increasingly used in many consumer products like textile fabrics, cosmetics, washing machines, food and drug products owing to its excellent antimicrobial properties. Here we have studied the adsorption and toxicity of SNPs on bacterial species such as Pseudomonas aeruginosa, Micrococcus luteus, Bacillus subtilis, Bacillus barbaricus and Klebsiella pneumoniae. The influence of zeta potential on the adsorption of SNPs on bacterial cell surface was investigated at acidic, neutral and alkaline pH and with varying salt (NaCl) concentrations (0.05, 0.1, 0.5, 1 and 1.5 M). The survival rate of bacterial species decreased with increase in adsorption of SNPs. Maximum adsorption and toxicity was observed at pH 5, and NaCl concentration of <0.5 M. A very less adsorption was observed at pH 9 and NaCl concentration >0.5 M, there by resulting in less toxicity. The zeta potential study suggests that, the adsorption of SNPs on the cell surface was related to electrostatic force of attraction. The equilibrium and kinetics of the adsorption process were also studied. The adsorption equilibrium isotherms fitted well to the Langmuir model. The kinetics of adsorption fitted best to pseudo-first-order. These findings form a basis for interpreting the interaction of nanoparticles with environmental bacterial species.

  5. Impact of lime, nitrogen and plant species on bacterial community structure in grassland microcosms.

    PubMed

    Kennedy, Nabla; Brodie, Eoin; Connolly, John; Clipson, Nicholas

    2004-10-01

    A microcosm-based approach was used to study impacts of plant and chemical factors on the bacterial community structure of an upland acidic grassland soil. Seven perennial plant species typical of both natural, unimproved (Nardus stricta, Agrostis capillaris, Festuca ovina and F. rubra) and fertilized, improved (Holcus lanatus, Lolium perenne and Trifolium repens) grasslands were either left unamended or treated with lime, nitrogen, or lime plus nitrogen in a 75-day glasshouse experiment. Lime and nitrogen amendment were shown to have a greater effect on microbial activity, biomass and bacterial ribotype number than plant species. Liming increased soil pH, microbial activity and biomass, while decreasing ribotype number. Nitrogen addition decreased soil pH, microbial activity and ribotype number. Addition of lime plus nitrogen had intermediate effects, which appeared to be driven more by lime than nitrogen. Terminal restriction fragment length polymorphism (TRFLP) analysis revealed that lime and nitrogen addition altered soil bacterial community structure, while plant species had little effect. These results were further confirmed by multivariate redundancy analysis, and suggest that soil lime and nitrogen status are more important controllers of bacterial community structure than plant rhizosphere effects.

  6. Influence of Root Exudates on the Bacterial Degradation of Chlorobenzoic Acids

    PubMed Central

    Lovecká, Petra; Dražková, Milena; Macková, Martina; Macek, Tomas

    2013-01-01

    Degradation of chlorobenzoic acids (e.g., products of microbial degradation of PCB) by strains of microorganisms isolated from PCB contaminated soils was assessed. From seven bulk-soil isolates two strains unique in ability to degrade a wider range of chlorobenzoic acids than others were selected, individually and even in a complex mixture of 11 different chlorobenzoic acids. Such a feature is lacking in most tested degraders. To investigate the influence of vegetation on chlorobenzoic acids degraders, root exudates of two plant species known for supporting PCB degradation in soil were tested. While with individual chlorobenzoic acids the presence of plant exudates leads to a decrease of degradation yield, in case of a mixture of chlorobenzoic acids either a change in bacterial degradation specificity, associated with 3- and 4-chlorobenzoic acid, or an extension of the spectrum of degraded chlorobenzoic acids was observed. PMID:24222753

  7. Bacterial Diversity at an Acid Mine Drainage Site in Maine

    NASA Astrophysics Data System (ADS)

    Gaynor, J.; Sawyer, T.; Riley, F. E.; Moulton, K. D.; Rothschild, L. J.; Duboise, S. M.

    2010-04-01

    Bacterial diversity in acidic mine drainage at a historic Maine iron mining site was investigated by isolation of environmental DNA, PCR amplification of the V3 region of the 16S rRNA gene, denaturing gradient gel electrophoresis, and DNA sequencing.

  8. Extensive Identification of Bacterial Riboflavin Transporters and Their Distribution across Bacterial Species.

    PubMed

    Gutiérrez-Preciado, Ana; Torres, Alfredo Gabriel; Merino, Enrique; Bonomi, Hernán Ruy; Goldbaum, Fernando Alberto; García-Angulo, Víctor Antonio

    2015-01-01

    Riboflavin, the precursor for the cofactors flavin mononucleotide (FMN) and flavin adenine dinucleotide, is an essential metabolite in all organisms. While the functions for de novo riboflavin biosynthesis and riboflavin import may coexist in bacteria, the extent of this co-occurrence is undetermined. The RibM, RibN, RfuABCD and the energy-coupling factor-RibU bacterial riboflavin transporters have been experimentally characterized. In addition, ImpX, RfnT and RibXY are proposed as riboflavin transporters based on positional clustering with riboflavin biosynthetic pathway (RBP) genes or conservation of the FMN riboswitch regulatory element. Here, we searched for the FMN riboswitch in bacterial genomes to identify genes encoding riboflavin transporters and assessed their distribution among bacteria. Two new putative riboflavin transporters were identified: RibZ in Clostridium and RibV in Mesoplasma florum. Trans-complementation of an Escherichia coli riboflavin auxotroph strain confirmed the riboflavin transport activity of RibZ from Clostridium difficile, RibXY from Chloroflexus aurantiacus, ImpX from Fusobacterium nucleatum and RfnT from Ochrobactrum anthropi. The analysis of the genomic distribution of all known bacterial riboflavin transporters revealed that most occur in species possessing the RBP and that some bacteria may even encode functional riboflavin transporters from two different families. Our results indicate that some species possess ancestral riboflavin transporters, while others possess transporters that appear to have evolved recently. Moreover, our data suggest that unidentified riboflavin transporters also exist. The present study doubles the number of experimentally characterized riboflavin transporters and suggests a specific, non-accessory role for these proteins in riboflavin-prototrophic bacteria.

  9. Validation of hierarchical cluster analysis for identification of bacterial species using 42 bacterial isolates

    NASA Astrophysics Data System (ADS)

    Ghebremedhin, Meron; Yesupriya, Shubha; Luka, Janos; Crane, Nicole J.

    2015-03-01

    Recent studies have demonstrated the potential advantages of the use of Raman spectroscopy in the biomedical field due to its rapidity and noninvasive nature. In this study, Raman spectroscopy is applied as a method for differentiating between bacteria isolates for Gram status and Genus species. We created models for identifying 28 bacterial isolates using spectra collected with a 785 nm laser excitation Raman spectroscopic system. In order to investigate the groupings of these samples, partial least squares discriminant analysis (PLSDA) and hierarchical cluster analysis (HCA) was implemented. In addition, cluster analyses of the isolates were performed using various data types consisting of, biochemical tests, gene sequence alignment, high resolution melt (HRM) analysis and antimicrobial susceptibility tests of minimum inhibitory concentration (MIC) and degree of antimicrobial resistance (SIR). In order to evaluate the ability of these models to correctly classify bacterial isolates using solely Raman spectroscopic data, a set of 14 validation samples were tested using the PLSDA models and consequently the HCA models. External cluster evaluation criteria of purity and Rand index were calculated at different taxonomic levels to compare the performance of clustering using Raman spectra as well as the other datasets. Results showed that Raman spectra performed comparably, and in some cases better than, the other data types with Rand index and purity values up to 0.933 and 0.947, respectively. This study clearly demonstrates that the discrimination of bacterial species using Raman spectroscopic data and hierarchical cluster analysis is possible and has the potential to be a powerful point-of-care tool in clinical settings.

  10. Extensive Identification of Bacterial Riboflavin Transporters and Their Distribution across Bacterial Species

    PubMed Central

    Merino, Enrique; Bonomi, Hernán Ruy; Goldbaum, Fernando Alberto; García-Angulo, Víctor Antonio

    2015-01-01

    Riboflavin, the precursor for the cofactors flavin mononucleotide (FMN) and flavin adenine dinucleotide, is an essential metabolite in all organisms. While the functions for de novo riboflavin biosynthesis and riboflavin import may coexist in bacteria, the extent of this co-occurrence is undetermined. The RibM, RibN, RfuABCD and the energy-coupling factor-RibU bacterial riboflavin transporters have been experimentally characterized. In addition, ImpX, RfnT and RibXY are proposed as riboflavin transporters based on positional clustering with riboflavin biosynthetic pathway (RBP) genes or conservation of the FMN riboswitch regulatory element. Here, we searched for the FMN riboswitch in bacterial genomes to identify genes encoding riboflavin transporters and assessed their distribution among bacteria. Two new putative riboflavin transporters were identified: RibZ in Clostridium and RibV in Mesoplasma florum. Trans-complementation of an Escherichia coli riboflavin auxotroph strain confirmed the riboflavin transport activity of RibZ from Clostridium difficile, RibXY from Chloroflexus aurantiacus, ImpX from Fusobacterium nucleatum and RfnT from Ochrobactrum anthropi. The analysis of the genomic distribution of all known bacterial riboflavin transporters revealed that most occur in species possessing the RBP and that some bacteria may even encode functional riboflavin transporters from two different families. Our results indicate that some species possess ancestral riboflavin transporters, while others possess transporters that appear to have evolved recently. Moreover, our data suggest that unidentified riboflavin transporters also exist. The present study doubles the number of experimentally characterized riboflavin transporters and suggests a specific, non-accessory role for these proteins in riboflavin-prototrophic bacteria. PMID:25938806

  11. Reverse Transcriptase-PCR Analysis of Bacterial rRNA for Detection and Characterization of Bacterial Species in Arthritis Synovial Tissue

    PubMed Central

    Kempsell, Karen E.; Cox, Charles J.; Hurle, Michael; Wong, Anthony; Wilkie, Scott; Zanders, Edward D.; Gaston, J. S. Hill; Crowe, J. Scott

    2000-01-01

    Onset of rheumatoid arthritis (RA) is widely believed to be preceded by exposure to some environmental trigger such as bacterial infectious agents. The influence of bacteria on RA disease onset or pathology has to date been controversial, due to inconsistencies between groups in the report of bacterial species isolated from RA disease tissue. Using a modified technique of reverse transcriptase-PCR amplification, we have detected bacterial rRNA in the synovial tissue of late-stage RA and non-RA arthritis controls. This may be suggestive of the presence of live bacteria. Sequencing of cloned complementary rDNA (crDNA) products revealed a number of bacterial sequences in joint tissue from each patient, and from these analyses a comprehensive profile of the organisms present was compiled. This revealed a number of different organisms in each patient, some of which are common to both RA and non-RA controls and are probably opportunistic colonizers of previously diseased tissue and others which are unique species. These latter organisms may be candidates for a specific role in disease pathology and require further investigation to exclude them as causative agents in the complex bacterial millieu. In addition, many of the detected bacterial species have not been identified previously from synovial tissue or fluid from arthritis patients. These may not be easily cultivable, since they were not revealed in previous studies using conventional in vitro bacterial culture methods. In situ hybridization analyses have revealed the joint-associated bacterial rRNA to be both intra- and extracellular. The role of viable bacteria or their nucleic acids as triggers in disease onset or pathology in either RA or non-RA arthritis controls is unclear and requires further investigation. PMID:10992514

  12. Salivary mucins promote the coexistence of competing oral bacterial species.

    PubMed

    Frenkel, Erica Shapiro; Ribbeck, Katharina

    2017-01-24

    Mucus forms a major ecological niche for microbiota in various locations throughout the human body such as the gastrointestinal tract, respiratory tract and oral cavity. The primary structural components of mucus are mucin glycoproteins, which crosslink to form a complex polymer network that surrounds microbes. Although the mucin matrix could create constraints that impact inhabiting microbes, little is understood about how this key environmental factor affects interspecies interactions. In this study, we develop an experimental model using gel-forming human salivary mucins to understand the influence of mucin on the viability of two competing species of oral bacteria. We use this dual-species model to show that mucins promote the coexistence of the two competing bacteria and that mucins shift cells from the mixed-species biofilm into the planktonic form. Taken together, these findings indicate that the mucus environment could influence bacterial viability by promoting a less competitive mode of growth.The ISME Journal advance online publication, 24 January 2017; doi:10.1038/ismej.2016.200.

  13. Progress in lactic acid bacterial phage research

    PubMed Central

    2014-01-01

    Research on lactic acid bacteria (LAB) has advanced significantly over the past number of decades and these developments have been driven by the parallel advances in technologies such as genomics, bioinformatics, protein expression systems and structural biology, combined with the ever increasing commercial relevance of this group of microorganisms. Some of the more significant and impressive outputs have been in the domain of bacteriophage-host interactions which provides a prime example of the cutting-edge model systems represented by LAB research. Here, we present a retrospective overview of the key advances in LAB phage research including phage-host interactions and co-evolution. We describe how in many instances this knowledge can be pivotal in creating real improvements in the application of LAB cultures in commercial practice. PMID:25185514

  14. Species differences in unlocking B-side electron transfer in bacterial reaction centers

    DOE PAGES

    Dylla, Nicholas P.; Faries, Kaitlyn M.; Wyllie, Ryan M.; ...

    2016-06-21

    The structure of the bacterial photosynthetic reaction center (RC) reveals symmetry-related electron transfer (ET) pathways, but only one path is used in native RCs. Analogous mutations have been made in two Rhodobacter (R.) species. A glutamic acid at position 133 in the M subunit increases transmembrane charge separation via the naturally inactive (B-side) path through impacts on primary ET in mutant R. sphaeroidesRCs. Prior work showed that the analogous substitution in the R. capsulatusRC also increases B-side activity, but mainly affects secondary ET. Finally, the overall yields of transmembrane ET are similar, but enabled in fundamentally different ways.

  15. Bacterial associates of two Caribbean coral species reveal species-specific distribution and geographic variability.

    PubMed

    Morrow, Kathleen M; Moss, Anthony G; Chadwick, Nanette E; Liles, Mark R

    2012-09-01

    Scleractinian corals harbor microorganisms that form dynamic associations with the coral host and exhibit substantial genetic and ecological diversity. Microbial associates may provide defense against pathogens and serve as bioindicators of changing environmental conditions. Here we describe the bacterial assemblages associated with two of the most common and phylogenetically divergent reef-building corals in the Caribbean, Montastraea faveolata and Porites astreoides. Contrasting life history strategies and disease susceptibilities indicate potential differences in their microbiota and immune function that may in part drive changes in the composition of coral reef communities. The ribotype structure and diversity of coral-associated bacteria within the surface mucosal layer (SML) of healthy corals were assessed using denaturing gradient gel electrophoresis (DGGE) fingerprinting and 454 bar-coded pyrosequencing. Corals were sampled at disparate Caribbean locations representing various levels of anthropogenic impact. We demonstrate here that M. faveolata and P. astreoides harbor distinct, host-specific bacteria but that specificity varies by species and site. P. astreoides generally hosts a bacterial assemblage of low diversity that is largely dominated by one bacterial genus, Endozoicomonas, within the order Oceanospirillales. The bacterial assemblages associated with M. faveolata are significantly more diverse and exhibit higher specificity at the family level than P. astreoides assemblages. Both corals have more bacterial diversity and higher abundances of disease-related bacteria at sites closer to the mainland than at those furthest away. The most diverse bacterial taxa and highest relative abundance of disease-associated bacteria were seen for corals near St. Thomas, U.S. Virgin Islands (USVI) (2.5 km from shore), and the least diverse taxa and lowest relative abundance were seen for corals near our most pristine site in Belize (20 km from shore). We conclude

  16. Bacterial community composition associated with freshwater algae: species specificity vs. dependency on environmental conditions and source community.

    PubMed

    Eigemann, Falk; Hilt, Sabine; Salka, Ivette; Grossart, Hans-Peter

    2013-03-01

    We studied bacterial associations with the green alga Desmodesmus armatus and the diatom Stephanodiscus minutulus under changing environmental conditions and bacterial source communities, to evaluate whether bacteria-algae associations are species-specific or more generalized and determined by external factors. Axenic and xenic algae were incubated in situ with and without allelopathically active macrophytes, and in the laboratory with sterile and nonsterile lake water and an allelochemical, tannic acid (TA). Bacterial community composition (BCC) of algae-associated bacteria was analyzed by denaturing gradient gel electrophoresis (DGGE), nonmetric multidimensional scaling, cluster analyses, and sequencing of DGGE bands. BCC of xenic algal cultures of both species were not significantly affected by changes in their environment or bacterial source community, except in the case of TA additions. Species-specific interactions therefore appear to overrule the effects of environmental conditions and source communities. The BCC of xenic and axenic D. armatus cultures subjected to in situ bacterial colonization, however, had lower similarities (ca. 55%), indicating that bacterial precolonization is a strong factor for bacteria-algae associations irrespective of environmental conditions and source community. Our findings emphasize the ecological importance of species-specific bacteria-algae associations with important repercussions for other processes, such as the remineralization of nutrients, and organic matter dynamics.

  17. Bacterial communities and species-specific associations with the mucus of Brazilian coral species

    PubMed Central

    Carlos, Camila; Torres, Tatiana T.; Ottoboni, Laura M. M.

    2013-01-01

    We investigated the existence of species-specific associations between Brazilian coral species and bacteria. Pyrosequencing of the V3 region of the 16S rDNA was used to analyze the taxonomic composition of bacterial communities associated with the mucus of four coral species (Madracis decactis, Mussismilia hispida, Palythoa caribaeorum, and Tubastraea coccinea) in two seasons (winter and summer), which were compared with the surrounding water and sediment. The microbial communities found in samples of mucus, water, and sediment differed according to the composition and relative frequency of OTUs. The coral mucus community seemed to be more stable and resistant to seasonal variations, compared to the water and sediment communities. There was no influence of geographic location on the composition of the communities. The sediment community was extremely diverse and might act as a "seed bank" for the entire environment. Species-specific OTUs were found in P. caribaeorum, T. coccinea, and M. hispida. PMID:23567936

  18. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors

    PubMed Central

    Getino, María; Fernández-López, Raúl; Palencia-Gándara, Carolina; Campos-Gómez, Javier; Sánchez-López, Jose M.; Martínez, Marta; Fernández, Antonio; de la Cruz, Fernando

    2016-01-01

    Bacterial conjugation is the main mechanism for the dissemination of multiple antibiotic resistance in human pathogens. This dissemination could be controlled by molecules that interfere with the conjugation process. A search for conjugation inhibitors among a collection of 1,632 natural compounds, identified tanzawaic acids A and B as best hits. They specially inhibited IncW and IncFII conjugative systems, including plasmids mobilized by them. Plasmids belonging to IncFI, IncI, IncL/M, IncX and IncH incompatibility groups were targeted to a lesser extent, whereas IncN and IncP plasmids were unaffected. Tanzawaic acids showed reduced toxicity in bacterial, fungal or human cells, when compared to synthetic conjugation inhibitors, opening the possibility of their deployment in complex environments, including natural settings relevant for antibiotic resistance dissemination. PMID:26812051

  19. Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species

    PubMed Central

    Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao

    2016-01-01

    Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species. PMID:27630804

  20. Rosacea, Reactive Oxygen Species, and Azelaic Acid

    PubMed Central

    2009-01-01

    Rosacea is a common skin condition thought to be primarily an inflammatory disorder. Neutrophils, in particular, have been implicated in the inflammation associated with rosacea and mediate many of their effects through the release of reactive oxygen species. Recently, the role of reactive oxygen species in the pathophysiology of rosacea has been recognized. Many effective agents for rosacea, including topical azelaic acid and topical metronidazole, have anti-inflammatory properties. in-vitro models have demonstrated the potent antioxidant effects of azelaic acid, providing a potential mechanistic explanation for its efficacy in the treatment of rosacea. PMID:20967185

  1. Biomimetic/Optical Sensors for Detecting Bacterial Species

    NASA Technical Reports Server (NTRS)

    Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth

    2006-01-01

    Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites

  2. What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira

    PubMed Central

    Fouts, Derrick E.; Matthias, Michael A.; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E.; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L.; Haake, David A.; Haft, Daniel H.; Hartskeerl, Rudy; Ko, Albert I.; Levett, Paul N.; Matsunaga, James; Mechaly, Ariel E.; Monk, Jonathan M.; Nascimento, Ana L. T.; Nelson, Karen E.; Palsson, Bernhard; Peacock, Sharon J.; Picardeau, Mathieu; Ricaldi, Jessica N.; Thaipandungpanit, Janjira; Wunder, Elsio A.; Yang, X. Frank; Zhang, Jun-Jie; Vinetz, Joseph M.

    2016-01-01

    Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade’s refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic

  3. Identification of bacterial species by untargeted NMR spectroscopy of the exo-metabolome.

    PubMed

    Palama, T L; Canard, I; Rautureau, G J P; Mirande, C; Chatellier, S; Elena-Herrmann, B

    2016-08-07

    Identification of bacterial species is a crucial bottleneck for clinical diagnosis of infectious diseases. Quick and reliable identification is a key factor to provide suitable antibiotherapies and avoid the development of multiple-drug resistance. We propose a novel nuclear magnetic resonance (NMR)-based metabolomics strategy for rapid discrimination and identification of several bacterial species that relies on untargeted metabolic profiling of supernatants from bacterial culture media. We show that six bacterial species (Gram negative: Escherichia coli, Pseudomonas aeruginosa, Proteus mirabilis; Gram positive: Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus saprophyticus) can be well discriminated from multivariate statistical analysis, opening new prospects for NMR applications to microbial clinical diagnosis.

  4. Bacterial Responses to Glyoxal and Methylglyoxal: Reactive Electrophilic Species

    PubMed Central

    Lee, Changhan; Park, Chankyu

    2017-01-01

    Glyoxal (GO) and methylglyoxal (MG), belonging to α-oxoaldehydes, are produced by organisms from bacteria to humans by glucose oxidation, lipid peroxidation, and DNA oxidation. Since glyoxals contain two adjacent reactive carbonyl groups, they are referred to as reactive electrophilic species (RES), and are damaging to proteins and nucleotides. Therefore, glyoxals cause various diseases in humans, such as diabetes and neurodegenerative diseases, from which all living organisms need to be protected. Although the glyoxalase system has been known for some time, details on how glyoxals are sensed and detoxified in the cell have not been fully elucidated, and are only beginning to be uncovered. In this review, we will summarize the current knowledge on bacterial responses to glyoxal, and specifically focus on the glyoxal-associated regulators YqhC and NemR, as well as their detoxification mediated by glutathione (GSH)-dependent/independent glyoxalases and NAD(P)H-dependent reductases. Furthermore, we will address questions and future directions. PMID:28106725

  5. Broad spectrum microarray for fingerprint-based bacterial species identification

    PubMed Central

    2010-01-01

    Background Microarrays are powerful tools for DNA-based molecular diagnostics and identification of pathogens. Most target a limited range of organisms and are based on only one or a very few genes for specific identification. Such microarrays are limited to organisms for which specific probes are available, and often have difficulty discriminating closely related taxa. We have developed an alternative broad-spectrum microarray that employs hybridisation fingerprints generated by high-density anonymous markers distributed over the entire genome for identification based on comparison to a reference database. Results A high-density microarray carrying 95,000 unique 13-mer probes was designed. Optimized methods were developed to deliver reproducible hybridisation patterns that enabled confident discrimination of bacteria at the species, subspecies, and strain levels. High correlation coefficients were achieved between replicates. A sub-selection of 12,071 probes, determined by ANOVA and class prediction analysis, enabled the discrimination of all samples in our panel. Mismatch probe hybridisation was observed but was found to have no effect on the discriminatory capacity of our system. Conclusions These results indicate the potential of our genome chip for reliable identification of a wide range of bacterial taxa at the subspecies level without laborious prior sequencing and probe design. With its high resolution capacity, our proof-of-principle chip demonstrates great potential as a tool for molecular diagnostics of broad taxonomic groups. PMID:20163710

  6. Method for construction of bacterial strains with increased succinic acid production

    DOEpatents

    Donnelly, Mark I.; Sanville-Millard, Cynthia; Chatterjee, Ranjini

    2000-01-01

    A fermentation process for producing succinic acid is provided comprising selecting a bacterial strain that does not produce succinic acid in high yield, disrupting the normal regulation of sugar metabolism of said bacterial strain, and combining the mutant bacterial strain and selected sugar in anaerobic conditions to facilitate production of succinic acid. Also provided is a method for changing low yield succinic acid producing bacteria to high yield succinic acid producing bacteria comprising selecting a bacterial strain having a phosphotransferase system and altering the phosphotransferase system so as to allow the bacterial strain to simultaneously metabolize different sugars.

  7. Lines of evidence for horizontal gene transfer of a phenazine producing operon into multiple bacterial species.

    PubMed

    Fitzpatrick, David A

    2009-02-01

    Phenazines are secondary metabolites with broad-spectrum antibiotic activity against bacteria, fungi, and eukaryotes. In pseudomonad species, a conserved seven-gene phenazine operon (phzABCDEFG) is required for the conversion of chorismic acid to the broad-spectrum antibiotic phenazine-1-carboxylate. Previous analyses of genes involved in phenazine production from nonpseudomonad species uncovered a high degree of sequence similarity to pseudomonad homologues. The analyses undertaken in this study wished to eluciadate the evolutionary history of genes involved in the production of phenazines. Furthermore, I wanted to determine if the phenazine operon has been transferred through horizontal gene transfer. Analyses of GC content, codon usage patterns, frequency of 3:1 dinucleotides, sequence similarities, and phylogenetic reconstructions were undertaken to map the evolutionary history of phenazine genes from multiple bacterial species. Patchy phyletic distribution, high sequence similarities, and phylogenetic evidence infer that pseudomonad, Streptomyces cinnamonensis, Pantoea agglomerans, Burkholderia cepacia, Pectobacterium atrosepticum, Brevibacterium linens, and Mycobacterium abscessus species all contain a phenazine operon which has most likely been transferred among these species through horizontal gene transfer. The acquisition of an antibiotic-associated operon is significant, as it may increase the relative fitness of the recipient species.

  8. Comparative biocidal activity of peracetic acid, benzalkonium chloride and ortho-phthalaldehyde on 77 bacterial strains.

    PubMed

    Bridier, A; Briandet, R; Thomas, V; Dubois-Brissonnet, F

    2011-07-01

    Despite numerous reports on biocide activities, it is often difficult to have a reliable and relevant overview of bacterial resistance to disinfectants because each work challenges a limited number of strains and tested methods are often different. The aim of this study was to evaluate the bactericidal activity of three different disinfectants commonly used in industrial or medical environments (peracetic acid, benzalkonium chloride and ortho-phthalaldehyde) against 77 bacterial strains from different origins using one standard test method (NF EN 1040). Results highlight the existence of high interspecific variability of resistance to disinfectants and, contrary to widespread belief, Gram-positive strains generally appeared more resistant than Gram-negative strains. Resistance was also variable among strains of the same species such as Bacillus subtilis to peracetic acid, Pseudomonas aeruginosa to benzalkonium chloride and Staphylococcus aureus to ortho-phthalaldehyde.

  9. Production of fusaric acid by Fusarium species.

    PubMed Central

    Bacon, C W; Porter, J K; Norred, W P; Leslie, J F

    1996-01-01

    Fusaric acid is a mycotoxin with low to moderate toxicity, which is of concern since it might be synergistic with other cooccurring mycotoxins. Fusaric acid is widespread on corn and corn-based food and feeds and is frequently found in grain, where Fusarium spp. are also isolated. We surveyed 78 strains of Fusarium moniliforme, F. crookwellense, F. subglutinans, F. sambucinum, F. napiforme, F. heterosporum, F. oxysporum, F. solani, and F. proliferatum for their ability to produce fusaric acid. Strains in Fusarium section Liseola also were assigned to mating population of the Gibberella fujikuroi species complex. The fungi could be divided into three classes, low (< 100 micrograms/g), moderate (100 to 500 micrograms/g), and high (> 500 micrograms/g), based on the amounts of this mycotoxin produced in culture on autoclaved corn. Strains of mating populations C from rice consistently produced moderate to high concentrations of fusaric acid. Two isolates, one each from mating populations C and D, produced fusaric acid in excess of 1,000 micrograms/g of corn. No isolates of any of the Fusarium species examined were negative for the production of fusaric acid on autoclaved corn. PMID:8899996

  10. A genomic perspective on a new bacterial genus and species from the Alcaligenaceae family, Basilea psittacipulmonis

    PubMed Central

    2014-01-01

    Background A novel Gram-negative, non-haemolytic, non-motile, rod-shaped bacterium was discovered in the lungs of a dead parakeet (Melopsittacus undulatus) that was kept in captivity in a petshop in Basel, Switzerland. The organism is described with a chemotaxonomic profile and the nearly complete genome sequence obtained through the assembly of short sequence reads. Results Genome sequence analysis and characterization of respiratory quinones, fatty acids, polar lipids, and biochemical phenotype is presented here. Comparison of gene sequences revealed that the most similar species is Pelistega europaea, with BLAST identities of only 93% to the 16S rDNA gene, 76% identity to the rpoB gene, and a similar GC content (~43%) as the organism isolated from the parakeet, DSM 24701 (40%). The closest full genome sequences are those of Bordetella spp. and Taylorella spp. High-throughput sequencing reads from the Illumina-Solexa platform were assembled with the Edena de novo assembler to form 195 contigs comprising the ~2 Mb genome. Genome annotation with RAST, construction of phylogenetic trees with the 16S rDNA (rrs) gene sequence and the rpoB gene, and phylogenetic placement using other highly conserved marker genes with ML Tree all suggest that the bacterial species belongs to the Alcaligenaceae family. Analysis of samples from cages with healthy parakeets suggested that the newly discovered bacterial species is not widespread in parakeet living quarters. Conclusions Classification of this organism in the current taxonomy system requires the formation of a new genus and species. We designate the new genus Basilea and the new species psittacipulmonis. The type strain of Basilea psittacipulmonis is DSM 24701 (= CIP 110308 T, 16S rDNA gene sequence Genbank accession number JX412111 and GI 406042063). PMID:24581117

  11. Conversion of cysteine to 3-mercaptopyruvic acid by bacterial aminotransferases.

    PubMed

    Andreeßen, Christina; Gerlt, Vanessa; Steinbüchel, Alexander

    2017-04-01

    3-Mercaptopyruvate (3MPy), a structural analog of 3-mercaptopropionic acid, is a precursor compound for biosynthesis of polythioesters in bacteria. The cost-effectiveness and sustainability of the whole process could be greatly improved by using the cysteine degradation pathway for an intracellular supply of 3MPy. Transamination of cysteine to its corresponding α-keto acid 3MPy is catalyzed by cysteine aminotransferases (CAT). However, CAT activity has so far not been described for bacterial aminotransferases (AT), and it was unknown whether they can be applied for the conversion of cysteine to 3MPy. In this study, we selected eight bacterial aminotransferases based on sequence homology to CAT of Rattus norvegicus (Got1). The aminotransferases included four aspartate aminotransferases (AATs) and four aromatic amino acid aminotransferases (ArATs) from Advenella mimigardefordensis DPN7, Escherichia coli MG1655, Shimwellia blattae ATCC 33430, Ralstonia eutropha H16 and Paracoccus denitrificans PD1222. For a more detailed characterization, all selected AAT or ArAT encoding genes were heterologously expressed in E. coli and purified. CAT activity was detected for all aminotransferases when a novel continuous coupled enzyme assay was applied. Kinetic studies revealed the highest catalytic efficiency of 5.1mM/s for AAT from A. mimigardefordensis. Formation of 3MPy from cysteine could additionally be verified by an optimized approach using derivatization of 3MPy with the Girard T reagent and liquid chromatography-mass spectrometry analyses.

  12. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

    PubMed Central

    Alonzo, Francis

    2016-01-01

    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

  13. Catecholamines and in vitro growth of pathogenic bacteria: enhancement of growth varies greatly among bacterial species

    NASA Technical Reports Server (NTRS)

    Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald

    2003-01-01

    The purpose of this study was to examine the effects of catecholamines on in vitro growth of a range of bacterial species, including anaerobes. Bacteria tested included: Porphyromonas gingivalis, Bacteriodes fragilis, Shigella boydii, Shigella sonnie, Enterobacter Sp, and Salmonella choleraesuis. The results of the current study indicated that supplementation of bacterial cultures in minimal medium with norepinephrine or epinephrine did not result in increased growth of bacteria. Positive controls involving treatment of Escherichia coli with catecholamines did result in increased growth of that bacterial species. The results of the present study extend previous observations that showed differential capability of catecholamines to enhance bacterial growth in vitro.

  14. Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco.

    PubMed

    Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Juergen

    2013-11-01

    Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance.

  15. Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar.

    PubMed

    Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng

    2016-05-01

    Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites.

  16. Lactic acid bacterial extract as a biogenic mineral growth modifier

    NASA Astrophysics Data System (ADS)

    Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal

    2009-04-01

    The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.

  17. Species Specific Bacterial Spore Detection Using Lateral-Flow Immunoassay with DPA-Triggered Tb Luminescence

    NASA Technical Reports Server (NTRS)

    Ponce, Adrian

    2003-01-01

    A method of detecting bacterial spores incorporates (1) A method of lateral-flow immunoassay in combination with (2) A method based on the luminescence of Tb3+ ions to which molecules of dipicolinic acid (DPA) released from the spores have become bound. The present combination of lateral-flow immunoassay and DPA-triggered Tb luminescence was developed as a superior alternative to a prior lateral-flow immunoassay method in which detection involves the visual observation and/or measurement of red light scattered from colloidal gold nanoparticles. The advantage of the present combination method is that it affords both (1) High selectivity for spores of the species of bacteria that one seeks to detect (a characteristic of lateral-flow immunoassay in general) and (2) Detection sensitivity much greater (by virtue of the use of DPA-triggered Tb luminescence instead of gold nanoparticles) than that of the prior lateral-flow immunoassay method

  18. Resource-dependent attenuation of species interactions during bacterial succession.

    PubMed

    Rivett, Damian W; Scheuerl, Thomas; Culbert, Christopher T; Mombrikotb, Shorok B; Johnstone, Emma; Barraclough, Timothy G; Bell, Thomas

    2016-09-01

    Bacterial communities are vital for many economically and ecologically important processes. The role of bacterial community composition in determining ecosystem functioning depends critically on interactions among bacterial taxa. Several studies have shown that, despite a predominance of negative interactions in communities, bacteria are able to display positive interactions given the appropriate evolutionary or ecological conditions. We were interested in how interspecific interactions develop over time in a naturalistic setting of low resource supply rates. We assembled aquatic bacterial communities in microcosms and assayed the productivity (respiration and growth) and substrate degradation while tracking community composition. The results demonstrated that while bacterial communities displayed strongly negative interactions during the early phase of colonisation and acclimatisation to novel biotic and abiotic factors, this antagonism declined over time towards a more neutral state. This was associated with a shift from use of labile substrates in early succession to use of recalcitrant substrates later in succession, confirming a crucial role of resource dynamics in linking interspecific interactions with ecosystem functioning.

  19. Exploring the bacterial microbiota associated with native South American species of Aphis (Hemiptera: Aphididae).

    PubMed

    Arneodo, J D; Ortego, J

    2014-06-01

    Aphids harbor a variety of bacterial endosymbionts, including the obligate symbiont Buchnera aphidicola and diverse facultative symbionts. The former supplies its host with essential amino acids. The latter are not indispensable for insect survival, but often improve their host's fitness. To date, the study of such associations was restricted to aphids of Holarctic origin. The bacterial microbiota of seven Aphis species from Argentina was investigated. The presence of B. aphidicola was assessed by specific PCR. Additional symbionts were identified through PCR with eubacterial universal primers, cloning, and sequencing of nearly complete 16S rRNA gene, intergenic spacer region, and partial 23S rRNA gene and subjected to phylogenetic analysis. Infection with B. aphidicola was confirmed in every species analyzed. The facultative symbiont Serratia symbiotica was detected in Aphis malalhuina Mier Durante, Nieto Nafría & Ortego, 2003, Aphis senecionicoides Blanchard, 1944, and Aphis schinifoliae Blanchard, 1939, while Hamiltonella defensa was identified in Aphis mendocina Mier Durante, Ortego & Nieto Nafría, 2006. Arsenophonus sp. was found infecting Aphis melosae Mier Durante & Ortego, 1999, and a new, undescribed Aphis sp. In Aphis danielae Remaudière, 1994, no facultative symbionts could be recorded. When analyzing the highly conserved 16S rRNA gene, the phylogenetic tree grouped the S. symbiotica, H. defensa, and Arsenophonus isolates into three well-defined clusters showing little variability among clones corresponding to the same aphid host species. This article reports for the first time the endosymbionts associated with aphids native to South America. Despite their geographic origin, the qualitative composition of their microbiota revealed no evident differences from that described for aphids in the Northern Hemisphere.

  20. Ultralong C100 mycolic acids support the assignment of Segniliparus as a new bacterial genus.

    PubMed

    Hong, Sunhee; Cheng, Tan-Yun; Layre, Emilie; Sweet, Lindsay; Young, David C; Posey, James E; Butler, W Ray; Moody, D Branch

    2012-01-01

    Mycolic acid-producing bacteria isolated from the respiratory tract of human and non-human mammals were recently assigned as a distinct genus, Segniliparus, because they diverge from rhodococci and mycobacteria in genetic and chemical features. Using high accuracy mass spectrometry, we determined the chemical composition of 65 homologous mycolic acids in two Segniliparus species and separately analyzed the three subclasses to measure relative chain length, number and stereochemistry of unsaturations and cyclopropyl groups within each class. Whereas mycobacterial mycolate subclasses are distinguished from one another by R groups on the meromycolate chain, Segniliparus species synthesize solely non-oxygenated α-mycolates with high levels of cis unsaturation. Unexpectedly Segniliparus α-mycolates diverge into three subclasses based on large differences in carbon chain length with one bacterial culture producing mycolates that range from C58 to C100. Both the overall chain length (C100) and the chain length diversity (C42) are larger than previously seen for mycolic acid-producing organisms and provide direct chemical evidence for assignment of Segniliparus as a distinct genus. Yet, electron microscopy shows that the long and diverse mycolates pack into a typical appearing membrane. Therefore, these new and unexpected extremes of mycolic acid chemical structure raise questions about the modes of mycolic acid packing and folding into a membrane.

  1. Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing

    NASA Astrophysics Data System (ADS)

    Chen, K.

    2017-01-01

    With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).

  2. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily

    PubMed Central

    Matsunaga, James; Barocchi, Michele A.; Croda, Julio; Young, Tracy A.; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A.; Reis, Mitermayer G.; Riley, Lee W.; Haake, David A.; Ko, Albert I.

    2005-01-01

    Summary Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudo-gene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019

  3. Bacterial Communities of Diverse Drosophila Species: Ecological Context of a Host–Microbe Model System

    PubMed Central

    Bhatnagar, Srijak; Eisen, Jonathan A.; Kopp, Artyom

    2011-01-01

    Drosophila melanogaster is emerging as an important model of non-pathogenic host–microbe interactions. The genetic and experimental tractability of Drosophila has led to significant gains in our understanding of animal–microbial symbiosis. However, the full implications of these results cannot be appreciated without the knowledge of the microbial communities associated with natural Drosophila populations. In particular, it is not clear whether laboratory cultures can serve as an accurate model of host–microbe interactions that occur in the wild, or those that have occurred over evolutionary time. To fill this gap, we characterized natural bacterial communities associated with 14 species of Drosophila and related genera collected from distant geographic locations. To represent the ecological diversity of Drosophilids, examined species included fruit-, flower-, mushroom-, and cactus-feeders. In parallel, wild host populations were compared to laboratory strains, and controlled experiments were performed to assess the importance of host species and diet in shaping bacterial microbiome composition. We find that Drosophilid flies have taxonomically restricted bacterial communities, with 85% of the natural bacterial microbiome composed of only four bacterial families. The dominant bacterial taxa are widespread and found in many different host species despite the taxonomic, ecological, and geographic diversity of their hosts. Both natural surveys and laboratory experiments indicate that host diet plays a major role in shaping the Drosophila bacterial microbiome. Despite this, the internal bacterial microbiome represents only a highly reduced subset of the external bacterial communities, suggesting that the host exercises some level of control over the bacteria that inhabit its digestive tract. Finally, we show that laboratory strains provide only a limited model of natural host–microbe interactions. Bacterial taxa used in experimental studies are rare or absent in

  4. Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar.

    PubMed

    Štornik, Aleksandra; Skok, Barbara; Trček, Janja

    2016-03-01

    Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S-23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S-23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1-5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial production of

  5. Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar

    PubMed Central

    Štornik, Aleksandra; Skok, Barbara

    2016-01-01

    Summary Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S−23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S−23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1−5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial

  6. Bacterial species associated with sound and Botrytis-infected grapes from a Greek vineyard.

    PubMed

    Nisiotou, Aspasia A; Rantsiou, Kalliopi; Iliopoulos, Vassilios; Cocolin, Luca; Nychas, George-John E

    2011-02-28

    Grape bacterial microbiota plays central roles in the quality of grapes and wine, yet its diversity remains poorly described. In the present study, bacterial species associated with sound and Botrytis-infected grapes of two cultivars originating from the same vineyard were assessed. Isolates were identified by PCR-Denaturing Gradient Gel Electrophoresis (PCR-DGGE) and sequence analysis of partial 16S rRNA gene. Comparable counts were recorded between Botrytis-infected and sound grape samples. In all cases, the majority of isolates belonged to different species of Enterobacteriaceae. The dominant species in the vineyard was Klebsiella oxytoca that was found in different combinations with Citrobacter freundii, Enterobacter spp., Erwinia sp., Pantoea dispersa, Tatumella ptyseos or other species. In fermenting musts, those populations declined while other species evolved, like Lactobacillus plantarum and Enterobacter ludwigii. Populations in botrytised samples persisted longer during spontaneous fermentations. Present study suggests that bacterial diversity on grapes may be wider than previously described.

  7. Bacterial profiling of White Plague Disease in a comparative coral species framework.

    PubMed

    Roder, Cornelia; Arif, Chatchanit; Bayer, Till; Aranda, Manuel; Daniels, Camille; Shibl, Ahmed; Chavanich, Suchana; Voolstra, Christian R

    2014-01-01

    Coral reefs are threatened throughout the world. A major factor contributing to their decline is outbreaks and propagation of coral diseases. Due to the complexity of coral-associated microbe communities, little is understood in terms of disease agents, hosts and vectors. It is known that compromised health in corals is correlated with shifts in bacterial assemblages colonizing coral mucus and tissue. However, general disease patterns remain, to a large extent, ambiguous as comparative studies over species, regions, or diseases are scarce. Here, we compare bacterial assemblages of samples from healthy (HH) colonies and such displaying signs of White Plague Disease (WPD) of two different coral species (Pavona duerdeni and Porites lutea) from the same reef in Koh Tao, Thailand, using 16S rRNA gene microarrays. In line with other studies, we found an increase of bacterial diversity in diseased (DD) corals, and a higher abundance of taxa from the families that include known coral pathogens (Alteromonadaceae, Rhodobacteraceae, Vibrionaceae). In our comparative framework analysis, we found differences in microbial assemblages between coral species and coral health states. Notably, patterns of bacterial community structures from HH and DD corals were maintained over species boundaries. Moreover, microbes that differentiated the two coral species did not overlap with microbes that were indicative of HH and DD corals. This suggests that while corals harbor distinct species-specific microbial assemblages, disease-specific bacterial abundance patterns exist that are maintained over coral species boundaries.

  8. Bacterial endophyte communities of three agricultural important grass species differ in their response towards management regimes.

    PubMed

    Wemheuer, Franziska; Kaiser, Kristin; Karlovsky, Petr; Daniel, Rolf; Vidal, Stefan; Wemheuer, Bernd

    2017-01-19

    Endophytic bacteria are critical for plant growth and health. However, compositional and functional responses of bacterial endophyte communities towards agricultural practices are still poorly understood. Hence, we analyzed the influence of fertilizer application and mowing frequency on bacterial endophytes in three agriculturally important grass species. For this purpose, we examined bacterial endophytic communities in aerial plant parts of Dactylis glomerata L., Festuca rubra L., and Lolium perenne L. by pyrotag sequencing of bacterial 16S rRNA genes over two consecutive years. Although management regimes influenced endophyte communities, observed responses were grass species-specific. This might be attributed to several bacteria specifically associated with a single grass species. We further predicted functional profiles from obtained 16S rRNA data. These profiles revealed that predicted abundances of genes involved in plant growth promotion or nitrogen metabolism differed between grass species and between management regimes. Moreover, structural and functional community patterns showed no correlation to each other indicating that plant species-specific selection of endophytes is driven by functional rather than phylogenetic traits. The unique combination of 16S rRNA data and functional profiles provided a holistic picture of compositional and functional responses of bacterial endophytes in agricultural relevant grass species towards management practices.

  9. Bacterial endophyte communities of three agricultural important grass species differ in their response towards management regimes

    NASA Astrophysics Data System (ADS)

    Wemheuer, Franziska; Kaiser, Kristin; Karlovsky, Petr; Daniel, Rolf; Vidal, Stefan; Wemheuer, Bernd

    2017-01-01

    Endophytic bacteria are critical for plant growth and health. However, compositional and functional responses of bacterial endophyte communities towards agricultural practices are still poorly understood. Hence, we analyzed the influence of fertilizer application and mowing frequency on bacterial endophytes in three agriculturally important grass species. For this purpose, we examined bacterial endophytic communities in aerial plant parts of Dactylis glomerata L., Festuca rubra L., and Lolium perenne L. by pyrotag sequencing of bacterial 16S rRNA genes over two consecutive years. Although management regimes influenced endophyte communities, observed responses were grass species-specific. This might be attributed to several bacteria specifically associated with a single grass species. We further predicted functional profiles from obtained 16S rRNA data. These profiles revealed that predicted abundances of genes involved in plant growth promotion or nitrogen metabolism differed between grass species and between management regimes. Moreover, structural and functional community patterns showed no correlation to each other indicating that plant species-specific selection of endophytes is driven by functional rather than phylogenetic traits. The unique combination of 16S rRNA data and functional profiles provided a holistic picture of compositional and functional responses of bacterial endophytes in agricultural relevant grass species towards management practices.

  10. Bacterial endophyte communities of three agricultural important grass species differ in their response towards management regimes

    PubMed Central

    Wemheuer, Franziska; Kaiser, Kristin; Karlovsky, Petr; Daniel, Rolf; Vidal, Stefan; Wemheuer, Bernd

    2017-01-01

    Endophytic bacteria are critical for plant growth and health. However, compositional and functional responses of bacterial endophyte communities towards agricultural practices are still poorly understood. Hence, we analyzed the influence of fertilizer application and mowing frequency on bacterial endophytes in three agriculturally important grass species. For this purpose, we examined bacterial endophytic communities in aerial plant parts of Dactylis glomerata L., Festuca rubra L., and Lolium perenne L. by pyrotag sequencing of bacterial 16S rRNA genes over two consecutive years. Although management regimes influenced endophyte communities, observed responses were grass species-specific. This might be attributed to several bacteria specifically associated with a single grass species. We further predicted functional profiles from obtained 16S rRNA data. These profiles revealed that predicted abundances of genes involved in plant growth promotion or nitrogen metabolism differed between grass species and between management regimes. Moreover, structural and functional community patterns showed no correlation to each other indicating that plant species-specific selection of endophytes is driven by functional rather than phylogenetic traits. The unique combination of 16S rRNA data and functional profiles provided a holistic picture of compositional and functional responses of bacterial endophytes in agricultural relevant grass species towards management practices. PMID:28102323

  11. Bis(aminomethyl)phosphinic Acid, a Highly Promising Scaffold for the Development of Bacterial Urease Inhibitors

    PubMed Central

    2014-01-01

    Inhibitors of bacterial ureases are considered to be promising compounds in the treatment of infections caused by Helicobacter pylori in the gastric tract and/or by urealytic bacteria (e.g., Proteus species) in the urinary tract. A new, extended transition state scaffold, bis(aminomethyl)phosphinic acid, was successfully explored for the construction of effective enzyme inhibitors. A reliable methodology for the synthesis of phosphinate analogues in a three-component Mannich-type reaction was elaborated. The obtained molecules were assayed against ureases purified from Sporosarcina pasteurii and Proteus mirabilis, and aminomethyl(N-n-hexylaminomethyl)phosphinic acid was found to be the most potent inhibitor, with a Ki = 108 nM against the S. pasteurii enzyme. PMID:25699141

  12. A new mathematical model of bacterial interactions in two-species oral biofilms.

    PubMed

    Martin, Bénédicte; Tamanai-Shacoori, Zohreh; Bronsard, Julie; Ginguené, Franck; Meuric, Vincent; Mahé, Fabrice; Bonnaure-Mallet, Martine

    2017-01-01

    Periodontitis are bacterial inflammatory diseases, where the bacterial biofilms present on the tooth-supporting tissues switch from a healthy state towards a pathogenic state. Among bacterial species involved in the disease, Porphyromonas gingivalis has been shown to induce dysbiosis, and to induce virulence of otherwise healthy bacteria like Streptococcus gordonii. During biofilm development, primary colonizers such as S. gordonii first attach to the surface and allow the subsequent adhesion of periodontal pathogens such as P. gingivalis. Interactions between those two bacteria have been extensively studied during the adhesion step of the biofilm. The aim of the study was to understand interactions of both species during the growing phase of the biofilm, for which little knowledge is available, using a mathematical model. This two-species biofilm model was based on a substrate-dependent growth, implemented with damage parameters, and validated thanks to data obtained on experimental biofilms. Three different hypothesis of interactions were proposed and assayed using this model: independence, competition between both bacteria species, or induction of toxicity by one species for the other species. Adequacy between experimental and simulated biofilms were found with the last hypothetic mathematical model. This new mathematical model of two species bacteria biofilms, dependent on different substrates for growing, can be applied to any bacteria species, environmental conditions, or steps of biofilm development. It will be of great interest for exploring bacterial interactions in biofilm conditions.

  13. Arthrobacter Species as a Prey Cell Reservoir for Nonobligate Bacterial Predators in Soil

    DTIC Science & Technology

    1989-01-01

    species as a prey cell reservoir for nonobligate bacterial predators in soil. Can. J. Microbiol. 35 : 559--564, tine investigation at etc entreprise sur...8217 .Stieprom tice ~s species and Bad//uhs instead of’ A. glohifrbrmis. to provide 1 .0 mng/g soil did not nivoie from the soil did not interfecre because

  14. A new mathematical model of bacterial interactions in two-species oral biofilms

    PubMed Central

    Martin, Bénédicte; Tamanai-Shacoori, Zohreh; Bronsard, Julie; Ginguené, Franck; Meuric, Vincent

    2017-01-01

    Periodontitis are bacterial inflammatory diseases, where the bacterial biofilms present on the tooth-supporting tissues switch from a healthy state towards a pathogenic state. Among bacterial species involved in the disease, Porphyromonas gingivalis has been shown to induce dysbiosis, and to induce virulence of otherwise healthy bacteria like Streptococcus gordonii. During biofilm development, primary colonizers such as S. gordonii first attach to the surface and allow the subsequent adhesion of periodontal pathogens such as P. gingivalis. Interactions between those two bacteria have been extensively studied during the adhesion step of the biofilm. The aim of the study was to understand interactions of both species during the growing phase of the biofilm, for which little knowledge is available, using a mathematical model. This two-species biofilm model was based on a substrate-dependent growth, implemented with damage parameters, and validated thanks to data obtained on experimental biofilms. Three different hypothesis of interactions were proposed and assayed using this model: independence, competition between both bacteria species, or induction of toxicity by one species for the other species. Adequacy between experimental and simulated biofilms were found with the last hypothetic mathematical model. This new mathematical model of two species bacteria biofilms, dependent on different substrates for growing, can be applied to any bacteria species, environmental conditions, or steps of biofilm development. It will be of great interest for exploring bacterial interactions in biofilm conditions. PMID:28253369

  15. Comparative molecular analysis of bacterial species associated with periodontal disease.

    PubMed

    De Iuliis, V; Ursi, S; Di Tommaso, L M; Caruso, M; Marino, A; D Ercole, S; Caputi, S; Sinjari, B; Festa, F; Macri, M; Martinotti, S; Vitullo, G; Toniato, E

    2016-01-01

    Periodontal disease is an inflammatory disorder affecting the supporting teeth structures, including gingiva, periodontal ligament and alveolar bone, causing loss of connective tissue, reabsorption of alveolar bone and formation of periodontal pockets. The aim of this study is to find a correlation between bacterial growth and periodontal disease. Fifty-seven patients aged between 21 and 65 years, median age 46 years, were enrolled. According to gingival pocket depth, ranging from 3 to 7 mm, patients were divided into two groups: the first (30 patients, 53%) with deep pockets ³ 5 mm and the second (27 patients, 47%) less than 5 mm. The samples taken were processed for microbiological analysis by absolute quantitative real-time Taq-Man technique. Patients affected by periodontal disease were 32 (56%) and patients with gingival bleeding were 35 (61%). This data showed that the presence, the type and the bacterial load in gingival pockets were strongly correlated with gingival depth, periodontal disease and gingival bleeding. Quantitative microbiological analysis is a key point to improve patient compliance, allowing to choose the specific antibiotic treatment. avoiding antibiotic resistance and ensuring the successful outcome of therapy for periodontal disease.

  16. Bacterial carbon processing by generalist species in the coastal ocean.

    PubMed

    Mou, Xiaozhen; Sun, Shulei; Edwards, Robert A; Hodson, Robert E; Moran, Mary Ann

    2008-02-07

    The assimilation and mineralization of dissolved organic carbon (DOC) by marine bacterioplankton is a major process in the ocean carbon cycle. However, little information exists on the specific metabolic functions of participating bacteria and on whether individual taxa specialize on particular components of the marine DOC pool. Here we use experimental metagenomics to show that coastal communities are populated by taxa capable of metabolizing a wide variety of organic carbon compounds. Genomic DNA captured from bacterial community subsets metabolizing a single model component of the DOC pool (either dimethylsulphoniopropionate or vanillate) showed substantial overlap in gene composition as well as a diversity of carbon-processing capabilities beyond the selected phenotypes. Our direct measure of niche breadth for bacterial functional assemblages indicates that, in accordance with ecological theory, heterogeneity in the composition and supply of organic carbon to coastal oceans may favour generalist bacteria. In the important interplay between microbial community structure and biogeochemical cycling, coastal heterotrophic communities may be controlled less by transient changes in the carbon reservoir that they process and more by factors such as trophic interactions and physical conditions.

  17. Acetic Acid Bacterial Biota of the Pink Sugar Cane Mealybug, Saccharococcus sacchari, and Its Environs

    PubMed Central

    Ashbolt, Nicholas J.; Inkerman, Peter A.

    1990-01-01

    Saccharococcus sacchari is the primary colonizer of the developing “sterile” tissue between the leaf sheath and stem of sugar cane. The honeydew secreted by the mealybugs is acidic (about pH 3) and supports an atypical epiphytic microbiota dominated by acetobacter-like bacteria and acidophilic yeast species. However, Erwinia and Leuconostoc species predominate within the leaf sheath pocket region when the mealybugs die out. The unidentified acetobacters were readily isolated from S. sacchari throughout its life cycle and from other genera of mealybugs on sugar cane and various other plants, both above and below ground. No other insect present on sugar cane was a significant vector of acetic acid bacteria. The major factors restricting microbial diversity within the environs of mealybugs were considered to be yeast activity along with bacterial production of acetic acid, ketogluconic acids, and gamma-pyrones, in association with their lowering of pH. The microbial products may aid in suppressing the attack by the parasitic mold Aspergillus parasiticus on mealybugs but could act as attractants for the predatory fruit fly Cacoxenus perspicax. PMID:16348144

  18. Transcriptional Responses of Treponema denticola to Other Oral Bacterial Species

    PubMed Central

    Simanian, Emil J.; Shi, Wenyuan; Lux, Renate

    2014-01-01

    The classic organization by Socransky and coworkers categorized the oral bacteria of the subgingival plaque into different complexes. Treponema denticola, Porphyromonas gingivalis and Tannerella forsythia are grouped into the red complex that is highly correlated with periodontal disease. Socransky's work closely associates red with orange complex species such as Fusobacterium nucleatum and Prevotella intermedia but not with members of the other complexes. While the relationship between species contained by these complexes is in part supported by their ability to physically attach to each other, the physiological consequences of these interactions and associations are less clear. In this study, we employed T. denticola as a model organism to analyze contact-dependent responses to interactions with species belonging to the same complex (P. gingivalis and T. forsythia), the closely associated orange complex (using F. nucleatum and P. intermedia as representatives) and the unconnected yellow complex (using Streptococcus sanguinis and S. gordonii as representatives). RNA was extracted from T. denticola alone as well as after pairwise co-incubation for 5 hrs with representatives of the different complexes, and the respective gene expression profiles were determined using microarrays. Numerous genes related to motility, metabolism, transport, outer membrane and hypothetical proteins were differentially regulated in T. denticola in the presence of the tested partner species. Further analysis revealed a significant overlap in the affected genes and we identified a general response to the presence of other species, those specific to two of the three complexes as well as individual complexes. Most interestingly, many predicted major antigens (e.g. flagella, Msp, CTLP) were suppressed in responses that included red complex species indicating that the presence of the most closely associated species induces immune-evasive strategies. In summary, the data presented here provide

  19. Diversity of Vaginal Lactic Acid Bacterial Microbiota in 15 Algerian Pregnant Women with and without Bacterial Vaginosis by using Culture Independent Method

    PubMed Central

    Abdi, Akila; Fhoula, Imène; Bringel, Françoise; Boudabous, Abdelatif; Ouzari, Imene Hadda

    2016-01-01

    Introduction Bacterial Vaginosis (BV) is the most common lower genital tract disorder among women of reproductive age (pregnant and non-pregnant) and a better knowledge of Lactobacillus species richness in healthy and infected vaginal microbiota is needed to efficiently design better probiotic products to promote the maintenance of normal flora which will help prevent bacterial vaginosis. Aim To evaluate and compare the diversity of lactic acid bacterial species in pregnant women with and without BV. Materials and Methods A pilot study was carried out during November-2014 to March-2015 in University Badji Mokhtar, Annaba, Algeria. Vaginal swabs were collected from 15 pregnant women aged between 19 and 35 years (mean 27.6 years; n=15) living in the East of Algeria visiting Gynecology service, hospital Abdallah Nouaouria- El bouni, Annaba. Vaginal samples were gram-stained, and scored by the Nugent method. The cohort included cases of women with healthy “normal” vaginal flora, infected flora with bacterial vaginosis and women with “intermediate” flora. The vaginal LAB community from pregnant women was identified by culture independent method based on Denaturing Gradient Gel Electrophoresis (DGGE), with the 16S rRNA gene sequencing. Results A majority of LAB affiliated to the genus Lactobacillus was found in “normal” and “intermediate” flora (87.5% and 43.75% respectively), while a majority of LAB affiliated to the genus Enterococcus was identified in women with bacterial vaginosis and intermediate flora (60% and 46.75% respectively). Our results showed that the presence of Lactobacillus iners and Lactobacillus delbruekii promotes stability of the vaginal microbiota. Conclusion This result confirms the findings of previous studies suggesting that the occurrence of predominant Lactobacillus negatively correlates with bacterial vaginosis incidence and their current use as probiotics. Lactobacillus iners and Lactobacillus delbruekii can be defined as

  20. Species Composition of Bacterial Communities Influences Attraction of Mosquitoes to Experimental Plant Infusions

    PubMed Central

    Ponnusamy, Loganathan; Wesson, Dawn M.; Arellano, Consuelo; Schal, Coby

    2013-01-01

    In the container habitats of immature mosquitoes, catabolism of plant matter and other organic detritus by microbial organisms produces metabolites that mediate the oviposition behavior of Aedes aegypti and Aedes albopictus. Public health agencies commonly use oviposition traps containing plant infusions for monitoring populations of these mosquito species, which are global vectors of dengue viruses. In laboratory experiments, gravid females exhibited significantly diminished responses to experimental infusions made with sterilized white oak leaves, showing that attractive odorants were produced through microbial metabolic activity. We evaluated effects of infusion concentration and fermentation time on attraction of gravid females to infusions made from senescent bamboo or white oak leaves. We used plate counts of heterotrophic bacteria, total counts of 4′,6-diamidino-2-phenylindole-stained bacterial cells, and 16S ribosomal DNA (rDNA) polymerase chain reaction–denaturing gradient gel electrophoresis (DGGE) to show that changes in the relative abundance of bacteria and the species composition of bacterial communities influenced attraction of gravid A. aegypti and A. albopictus mosquitoes to infusions. DGGE profiles showed that bacterial species composition in infusions changed over time. Principal components analysis indicated that oviposition responses to plant infusions were in general most affected by bacterial diversity and abundance. Analysis of bacterial 16S rDNA sequences derived from DGGE bands revealed that Proteo-bacteria (Alpha-, Beta-, Delta-, and Gamma-) were the predominant bacteria detected in both types of plant infusions. Gravid A. aegypti were significantly attracted to a mix of 14 bacterial species cultured from bamboo leaf infusion. The oviposition response of gravid mosquitoes to plant infusions is strongly influenced by abundance and diversity of bacterial species, which in turn is affected by plant species, leaf biomass, and fermentation

  1. Fatty Acid Compositions of Six Wild Edible Mushroom Species

    PubMed Central

    Günç Ergönül, Pelin; Akata, Ilgaz; Kalyoncu, Fatih; Ergönül, Bülent

    2013-01-01

    The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina) collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2). Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids. PMID:23844377

  2. Bacterial genomic epidemiology, from local outbreak characterization to species-history reconstruction

    PubMed Central

    Gaiarsa, Stefano; De Marco, Leone; Comandatore, Francesco; Marone, Piero; Bandi, Claudio; Sassera, Davide

    2015-01-01

    Bacteriology has embraced the next-generation sequencing revolution, swiftly moving from the time of single genome sequencing to the age of genomic epidemiology. Hundreds and now even thousands of genomes are being sequenced for single bacterial species, allowing unprecedented levels of resolution and insight in the evolution and epidemic diffusion of the main bacterial pathogens. Here, we present a review of some of the most recent and groundbreaking studies in this field. PMID:26878934

  3. Fluorescence in-situ hybridization for the identification of bacterial species in archival heart valve sections of canine bacterial endocarditis.

    PubMed

    Kornreich, B G; Craven, M; McDonough, S P; Nydam, D V; Scorza, V; Assarasakorn, S; Lappin, M; Simpson, K W

    2012-05-01

    Bacterial endocarditis (BE) is defined as inflammation of cardiac valve structures and/or the endocardium secondary to bacterial infection. Canine valvular BE is associated with significant morbidity and mortality and ante-mortem diagnosis and post-mortem identification of causative organisms is problematic. Identification of bacteria in canine BE has traditionally relied on visualization of organisms on histological sections stained with haematoxylin and eosin (HE), Gram and modified Steiner's stains. Each of these staining techniques has limitations with respect to identification of bacterial species in cases of BE. Fluorescence in-situ hybridization (FISH) has been introduced recently as a technique to identify bacteria in biological specimens. To our knowledge, FISH has not been used previously to identify bacteria in archival samples of heart valves from dogs with naturally occurring BE. We sought to determine whether FISH could detect the presence and species of bacteria in archival heart valve sections from dogs with BE, and to compare FISH to histochemical stains in the identification of bacteria. FISH detected bacteria in seven of 17 cases of canine BE and showed near perfect agreement with modified Steiner's stain for the detection of bacteria. FISH identified Streptococcus spp. and/or Staphylococcus spp. in all of these cases, but Bartonella spp. were not identified.

  4. Clostridium algifaecis sp. nov., an anaerobic bacterial species from decomposing algal scum.

    PubMed

    Wu, Yu-Fan; Zheng, Hui; Wu, Qing-Long; Yang, Hong; Liu, Shuang-Jiang

    2014-11-01

    Two anaerobic bacterial strains, MB9-7(T) and MB9-9, were isolated from decomposing algal scum and were characterized using a polyphasic approach. Phylogenetic analysis of 16S rRNA gene sequences showed that strains MB9-7(T) and MB9-9 are closely related to each other (99.7% similarity) and they are also closely related to Clostridium tyrobutyricum (96.5%). The two strains were Gram-stain positive and rod-shaped. Growth occurred at 20-45 °C, at pH 4.0-8.0 and at NaCl concentrations of up to 2% (w/v). Acid was produced from glucose, xylose and mannose. Products of fermentation in PYG medium were mainly butyrate, acetate, carbon dioxide and hydrogen. The predominant cellular fatty acids were C(14:0) and C(16:0). The cellular polar lipids comprised phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine, two glycolipids, one phospholipid, one aminophospholipid and two aminolipids. The DNA G+C contents of strain MB9-7(T) and MB9-9 were 27.9 and 28.7 mol%, respectively. These results support the assignment of the new isolates to the genus Clostridium and also distinguish them from other species of the genus Clostridium. Hence, it is proposed that strains MB9-7(T) and MB9-9 represent a novel species of the genus Clostridium, with the suggested name Clostridium algifaecis sp. nov. The type strain is MB9-7(T) ( =CGMCC 1.5188(T) =DSM 28783(T)).

  5. Gene Loss Dominates As a Source of Genetic Variation within Clonal Pathogenic Bacterial Species.

    PubMed

    Bolotin, Evgeni; Hershberg, Ruth

    2015-07-10

    Some of the most dangerous pathogens such as Mycobacterium tuberculosis and Yersinia pestis evolve clonally. This means that little or no recombination occurs between strains belonging to these species. Paradoxically, although different members of these species show extreme sequence similarity of orthologous genes, some show considerable intraspecies phenotypic variation, the source of which remains elusive. To examine the possible sources of phenotypic variation within clonal pathogenic bacterial species, we carried out an extensive genomic and pan-genomic analysis of the sources of genetic variation available to a large collection of clonal and nonclonal pathogenic bacterial species. We show that while nonclonal species diversify through a combination of changes to gene sequences, gene loss and gene gain, gene loss completely dominates as a source of genetic variation within clonal species. Indeed, gene loss is so prevalent within clonal species as to lead to levels of gene content variation comparable to those found in some nonclonal species that are much more diverged in their gene sequences and that acquire a substantial number of genes horizontally. Gene loss therefore needs to be taken into account as a potential dominant source of phenotypic variation within clonal bacterial species.

  6. Effect of Organic Matter Decomposition Level on Bacterial Species Diversity and Composition in Relationship to Pythium Damping-Off Severity

    PubMed Central

    Boehm, M. J.; Madden, L. V.; Hoitink, H. A. J.

    1993-01-01

    Rhizosphere bacteria were isolated from root tip segments of cucumber seedlings grown in a suppressive, slightly decomposed light-colored peat mix, a conducive, more decomposed dark-colored peat mix, and a suppressive dark peat mix amended with composted hardwood bark. The bacteria were identified by a gas chromatographic fatty acid methyl ester analysis. The total number of taxa recovered from a single root tip segment ranged from 9 to 18. No single taxon predominated on all root tip segments harvested from any of the mixes. The highest relative population density reached by a given taxon on any root tip segment was 45%. Hill's first and second diversity numbers, the modified Hill's ratio, and Hurlbert's rarefaction method, which were used as measures of species diversity, indicated that the organic matter decomposition level of the potting mixes did not affect bacterial species diversity. Bray-Curtis polar ordination and Dice resemblance functions, however, indicated that the organic matter decomposition level of a mix significantly influenced the composition of bacterial species in the rhizosphere. Pseudomonas spp. and other taxa capable of inducing suppression of pythium damping-off predominated in the suppressive mixes. These organisms were absent from the conducive mix, in which Arthrobacter and Bacillus spp. predominated. Although effective bacterial biocontrol agents were isolated from both the suppressive mixes and the conducive mix, the majority were isolated from the less decomposed suppressive mixes. Finally, the efficacy of strains was significantly greater in the slightly decomposed light peat mix than in the decomposed dark peat mix. Natural disease suppression within these mixes was associated with the organic matter decomposition level and the bacterial species compositions of the mixes. PMID:16349117

  7. [Advances in the progress of anti-bacterial biofilms properties of acetic acid].

    PubMed

    Gao, Xinxin; Jin, Zhenghua; Chen, Xinxin; Yu, Jia'ao

    2016-06-01

    Bacterial biofilms are considered to be the hindrance in the treatment of chronic wound, because of their tolerance toward antibiotics and other antimicrobial agents. They also have strong ability to escape from the host immune attack. Acetic acid, as a kind of organic weak acid, can disturb the biofilms by freely diffusing through the bacterial biofilms and bacterial cell membrane structure. Then the acid dissociates to release the hydrogen ions, leading to the disorder of the acid-base imbalance, change of protein conformation, and the degradation of the DNA within the membranes. This paper reviews the literature on the characteristics and treatment strategies of the bacterial biofilms and the acetic acid intervention on them, so as to demonstrate the roles acetic acid may play in the treatment of chronic wound, and thus provide a convincing treatment strategy for this kind of disease.

  8. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03

    PubMed Central

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-01-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l-1. The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters. PMID:25253925

  9. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03.

    PubMed

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-05-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l(-1). The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters.

  10. [Purification and characterization of thermostable amylases from two bacterial species].

    PubMed

    Dong, Yongcun; Liu, Yang; Chen, Yuanyuan; Niu, Dandan; Zhang, Liang; Shi, Guiyang; Wang, Zhengxiang

    2008-02-01

    Two thermophilic bacterial isolates, strain 173 and strain 174, with raw starch-digesting activities were selected from thermophilic bacteria growing in hot spring of Tengchong County, Yunnan Province, China. By amplification, sequencing and alignment analysis of 16S ribosomal DNAs, they were identified as members of genus Geobacillus. In shaker flask culture Geobacillus sp. 173 produced 14.5 U/mL amylase and for Geobacillus sp. 174 with 12.9 U/mL. Both amylases were purified by starch absorption-desorption and chromatograph. The amylases from strain 173 and strain 174 purified to about 50 and 29 folds were respectively achieved with an overall yield of 34% and 41%. The maximum gelatinized-starch-digesting activity of the purified amylases were at 70 degrees C and pH 5.0 - 5.5. The high raw-starch-digesting activity of these enzymes were observed at 50 degrees C - 60 degrees C (from strain 173) and 40 degrees C - 60 degrees C (from strain 174). Both enzymes were not sensitive to ions including mental ions (Na+, K+, Mg2+, Ca2+, Mn2+, Zn2+) and others (EDTA, Citrate), but were slightly inhibited by ions such as Co2+, Cu2+ for amylase from strain 173 and Cu2+ for amylase from strain 174. Both enzyme had specificity of starch substrates.

  11. Prevalence of hydrogen peroxide-producing Lactobacillus species in normal women and women with bacterial vaginosis.

    PubMed Central

    Eschenbach, D A; Davick, P R; Williams, B L; Klebanoff, S J; Young-Smith, K; Critchlow, C M; Holmes, K K

    1989-01-01

    A predominance of Lactobacillus species in the vaginal flora is considered normal. In women with bacterial vaginosis, the prevalence and concentrations of intravaginal Gardnerella vaginalis and anaerobes are increased, whereas the prevalence of intravaginal Lactobacillus species is decreased. Because some lactobacilli are known to produce hydrogen peroxide (H2O2), which can be toxic to organisms that produce little or no H2O2-scavenging enzymes (e.g., catalase), we postulated that an absence of H2O2-producing Lactobacillus species could allow an overgrowth of catalase-negative organisms, such as those found among women with bacterial vaginosis. In this study, H2O2-producing facultative Lactobacillus species were found in the vaginas of 27 (96%) of 28 normal women and 4 (6%) of 67 women with bacterial vaginosis (P less than 0.001). Anaerobic Lactobacillus species (which do not produce hydrogen peroxide) were isolated from 24 (36%) of 67 women with bacterial vaginosis and 1 (4%) of 28 normal women (P less than 0.001). The production of H2O2 by Lactobacillus species may represent a nonspecific antimicrobial defense mechanism of the normal vaginal ecosystem. PMID:2915019

  12. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species

    PubMed Central

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-01-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species. PMID:26884157

  13. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species.

    PubMed

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-03-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species.

  14. Effect of species, breed, and age on bacterial load in bovine and bubaline semen

    PubMed Central

    Sannat, Chandrahas; Nair, Ajit; Sahu, S. B.; Sahasrabudhe, S. A.; Kumar, Ashish; Gupta, Amit Kumar; Shende, R. K.

    2015-01-01

    Aim: The present study was conducted to investigate the effect of species, breed and age on bacterial load in fresh and frozen semen of Cattle and Buffalo bull. Materials and Methods: Present study covered 56 cow and 10 buffalo bulls stationed at Central Semen Station Anjora, Durg (Chhattisgarh). Impact of breeds on bacterial load in semen was assessed using six breeds of cattle viz. Sahiwal, Gir, Red Sindhi, Tharparkar, Jersey and Holstein Friesian (HF) cross. Cow bulls were categorized into four different groups based on their age (<4 years, 4-5 years, 5-6 years and > 6 years) to study variation among age groups. Bacterial load was measured in fresh and frozen semen samples from these bulls using the standard plate count (SPC) method and count was expressed as colony forming unit (CFU) per ml of semen. Results: Higher bacterial load was reported in fresh (2.36 × 104 ± 1943 CFU/ml) and frozen (1.00 × 10 ± 90 CFU/ml) semen of cow bulls as compared to buffalo bulls (1.95 × 104 ± 2882 and 7.75 × 102 ± 160 CFU/ml in fresh and frozen semen, respectively). Jersey bull showed significantly higher bacterial count (p < 0.05) both in fresh (4.07 × 104 ± 13927 CFU/ml) and frozen (1.92 × 103 ± 178 CFU/ml) semen followed by HF cross, Sahiwal, Gir, Red Sindhi and Tharparkar bull. Bulls aged < 4 years and more than 6 years yielded increased bacterial load in their semen. Although a minor variation was reported between species and among age groups, no significant differences were measured. Conclusion: Bacterial load in semen did not differ significantly between species and age groups; however significant variation was reported among different breeds. Bulls of Jersey breed showed significantly higher bacterial load in semen as compared to the crossbred and indigenous bull. PMID:27047115

  15. Bacterial community in sclerotia of Cenococcum species and soil in sub-alpine forest, central Japan

    NASA Astrophysics Data System (ADS)

    Nonoyama, Y.; Narisawa, K.; Ohta, H.; Watanabe, M.

    2009-04-01

    Species of Cenococcum, ectomycorrhizal fungi, may be particularly abundant in cold- or nutrient-stressed habitats. The fungus is easily recognized by its jet-black hyphae, and distinct compact masses of fungal mycelium called sclerotia. They are hard, black, comparatively smooth and mostly spherical. Sclerotia are formed in rhizosphere and can provide sufficient inoculums for several years. The purpose of this study is to investigate bacterial community inside sclerotia, with an interest on contribution of sclerotia to microbial diversity in rhizosphere. To investigate bacterial community inside of the fungal sclerotia by 16S rDNA gene clone library, several hundred of sclerotia (ca. 1g) were collected from sub-alpine forest soil in central Japan. Furthermore, three sclerotium grains were applied to investigate internal bacteria community by culture method. The isolated bacterial strains were then proceeded to determine their 16S rDNA partial sequences. The predominant group determined by clone library analysis of 16S ribosomal RNA genes with DNA from the sclerotia was Acidobacteria in both sclerotia and soil. Bacterial community of sclerotia showed higher diversity compared to soil. On the contrary, bacterial flora isolated from single sclerotium differed each other. Additionally, the bacterial community was composed by limited species of related genus.

  16. Identification of different bacterial species in biofilms using confocal Raman microscopy

    NASA Astrophysics Data System (ADS)

    Beier, Brooke D.; Quivey, Robert G.; Berger, Andrew J.

    2010-11-01

    Confocal Raman microspectroscopy is used to discriminate between different species of bacteria grown in biofilms. Tests are performed using two bacterial species, Streptococcus sanguinis and Streptococcus mutans, which are major components of oral plaque and of particular interest due to their association with healthy and cariogenic plaque, respectively. Dehydrated biofilms of these species are studied as a simplified model of dental plaque. A prediction model based on principal component analysis and logistic regression is calibrated using pure biofilms of each species and validated on pure biofilms grown months later, achieving 96% accuracy in prospective classification. When biofilms of the two species are partially mixed together, Raman-based identifications are achieved within ~2 μm of the boundaries between species with 97% accuracy. This combination of spatial resolution and predication accuracy should be suitable for forming images of species distributions within intact two-species biofilms.

  17. Bacterial persistence induced by salicylate via reactive oxygen species

    PubMed Central

    Wang, Tiebin; El Meouche, Imane; Dunlop, Mary J.

    2017-01-01

    Persisters are phenotypic variants of regular cells that exist in a dormant state with low metabolic activity, allowing them to exhibit high tolerance to antibiotics. Despite increasing recognition of their role in chronic and recalcitrant infections, the mechanisms that induce persister formation are not fully understood. In this study, we find that salicylate can induce persister formation in Escherichia coli via generation of reactive oxygen species (ROS). Salicylate-induced ROS cause a decrease in the membrane potential, reduce metabolism and lead to an increase in persistence. These effects can be recovered by culturing cells in the presence of a ROS quencher or in an anaerobic environment. Our findings reveal that salicylate-induced oxidative stress can lead to persistence, suggesting that ROS, and their subsequent impact on membrane potential and metabolism, may play a broad role in persister formation. PMID:28281556

  18. The Use of Laser-Induced Breakdown Spectroscopy for Distinguishing Between Bacterial Pathogen Species and Strains

    PubMed Central

    Multari, Rosalie A.; Cremers, David A.; Dupre, Joanne M.; Gustafson, John E.

    2013-01-01

    Laser-induced breakdown spectroscopy (LIBS) was used in a blind study to successfully differentiate bacterial pathogens, both species and strain. The pathogens used for the study were chosen and prepared by one set of researchers. The LIBS data were collected and analyzed by another set of researchers. The latter researchers had no knowledge of the sample identities other than that (1) the first five of fifteen samples were unique (not replicates) and (2) the remaining ten samples consisted of two replicates of each of the first five samples. Using only chemometric analysis of the LIBS data, the ten replicate bacterial samples were successfully matched to each of the first five samples. The results of this blind study show it is possible to differentiate the bacterial pathogens Escherichia coli, three clonal methicillin-resistant Staphylococcus aureus (MRSA) strains, and one unrelated MRSA strain using LIBS. This is an important finding because it demonstrates that LIBS can be used to determine bacterial pathogen species within a defined sample set and can be used to differentiate between clonal relationships among strains of a single multiple-antibiotic-resistant bacterial species. Such a capability is important for the development of LIBS instruments for use in medical, water, and food safety applications. PMID:20615288

  19. Antibiofilm Activity, Compound Characterization, and Acute Toxicity of Extract from a Novel Bacterial Species of Paenibacillus

    PubMed Central

    Alasil, Saad Musbah; Omar, Rahmat; Yusof, Mohd Yasim

    2014-01-01

    The effectiveness of many antimicrobial agents is currently decreasing; therefore, it is important to search for alternative therapeutics. Our study was carried out to assess the in vitro antibiofilm activity using microtiter plate assay, to characterize the bioactive compounds using Ultra Performance Liquid Chromatography-Diode Array Detection and Liquid Chromatography-Mass Spectrometry and to test the oral acute toxicity on Sprague Dawley rats of extract derived from a novel bacterial species of Paenibacillus strain 139SI. Our results indicate that the crude extract and its three identified compounds exhibit strong antibiofilm activity against a broad range of clinically important pathogens. Three potential compounds were identified including an amino acid antibiotic C8H20N3O4P (MW 253.237), phospholipase A2 inhibitor C21H36O5 (MW 368.512), and an antibacterial agent C14H11N3O2 (MW 253.260). The acute toxicity test indicates that the mortality rate among all rats was low and that the biochemical parameters, hematological profile, and histopathology examination of liver and kidneys showed no significant differences between experimental groups (P > 0.05). Overall, our findings suggest that the extract and its purified compounds derived from novel Paenibacillus sp. are nontoxic exhibiting strong antibiofilm activity against Gram-positive and Gram-negative pathogens that can be useful towards new therapeutic management of biofilm-associated infections. PMID:24790603

  20. Risk of spontaneous bacterial peritonitis associated with gastric Acid suppression.

    PubMed

    Chang, Shy-Shin; Lai, Chih-Cheng; Lee, Meng-tse Gabriel; Lee, Yu-Chien; Tsai, Yi-Wen; Hsu, Wan-Ting; Lee, Chien-Chang

    2015-06-01

    The primary objective of this study was to determine the association between the use of gastric acid suppressants (GAS) and the risk of developing spontaneous bacterial peritonitis (SBP) in patients with advanced liver cirrhosis (LC). A case-control study nested within a cohort of 480,000 representatives of Taiwan National Health Insurance beneficiaries was carried out. A case was matched with 100 controls on age, gender, and index date of SBP diagnosis. GAS use was identified from the 1-year period before the index date. Conditional logistic regression analysis was used to adjust for various unbalanced covariates between users and nonusers of GAS. A total of 947 cases of SBP were identified among the 86,418 patients with advanced LC. A significant increased risk of developing SBP was found to be associated with current (within 30 days), and recent (within 30-90 day) use of 2 different classes of GAS: proton pump inhibitors (PPIs) and histamine 2 receptor antagonists (H2RAs). The confounder adjusted rate ratio (aRR) for the current use of PPIs was 2.77 (95% CI: 1.90-4.04) and H2RAs was 2.62 (95% CI: 2.00-3.42). The risk of SBP attenuated for the recent use of PPIs (aRR: 2.20, 95%CI: 1.60-3.02) or H2RAs (aRR: 1.72, 95% CI: 1.25-2.37). In addition, sensitivity analysis using hospitalized SBP as the primary outcome showed a similar risk for the current use of PPIs (aRR, 3.24; 95% CI: 2.08-5.05) and H2RAs (aRR 2.43; 95% CI 1.71-3.46). Furthermore, higher cumulative days of gastric acid suppression were associated with a higher risk of SBP (trend P < 0.0001). To conclude, exposure to GAS was associated with an increased risk of SBP in patients with advanced LC. The association was more pronounced in current PPI users compared with nonusers.

  1. Coordinated Regulation of Species-Specific Hydroxycinnamic Acid Degradation and Siderophore Biosynthesis Pathways in Agrobacterium fabrum

    PubMed Central

    Baude, Jessica; Vial, Ludovic; Villard, Camille; Campillo, Tony; Lavire, Céline; Nesme, Xavier

    2016-01-01

    ABSTRACT The rhizosphere-inhabiting species Agrobacterium fabrum (genomospecies G8 of the Agrobacterium tumefaciens species complex) is known to degrade hydroxycinnamic acids (HCAs), especially ferulic acid and p-coumaric acid, via the novel A. fabrum HCA degradation pathway. Gene expression profiles of A. fabrum strain C58 were investigated in the presence of HCAs, using a C58 whole-genome oligoarray. Both ferulic acid and p-coumaric acid caused variations in the expression of more than 10% of the C58 genes. Genes of the A. fabrum HCA degradation pathway, together with the genes involved in iron acquisition, were among the most highly induced in the presence of HCAs. Two operons coding for the biosynthesis of a particular siderophore, as well as genes of the A. fabrum HCA degradation pathway, have been described as being specific to the species. We demonstrate here their coordinated expression, emphasizing the interdependence between the iron concentration in the growth medium and the rate at which ferulic acid is degraded by cells. The coordinated expression of these functions may be advantageous in HCA-rich but iron-starved environments in which microorganisms have to compete for both iron and carbon sources, such as in plant roots. The present results confirm that there is cooperation between the A. fabrum-specific genes, defining a particular ecological niche. IMPORTANCE We previously identified seven genomic regions in Agrobacterium fabrum that were specifically present in all of the members of this species only. Here we demonstrated that two of these regions, encoding the hydroxycinnamic acid degradation pathway and the iron acquisition pathway, were regulated in a coordinated manner. The coexpression of these functions may be advantageous in hydroxycinnamic acid-rich but iron-starved environments in which microorganisms have to compete for both iron and carbon sources, such as in plant roots. These data support the view that bacterial genomic species

  2. Improved Discrimination of Bacterial Spore Species With Ft-Ir Spectroscopy by Pretreatment With Autoclaving

    DTIC Science & Technology

    2005-10-01

    species of bacterial endospores: Bacillus cereus, Bacillus globigii, Bacillus megaterium , Bacillus subtilis, and Clostridium perfringens. Discrimination...subtilis strain PS832, a prototropic laboratory strain derived from strain 168 and Bacillus megaterium QM B1551 were prepared in liqiud SNB (B... Bacillus cereus is known to cause food poisoning. Some potentially pathogenic microorganisms, specifically from the genera Bacillus and Clostridium

  3. Bacterial Diversity and Community Structure in Two Bornean Nepenthes Species with Differences in Nitrogen Acquisition Strategies.

    PubMed

    Sickel, Wiebke; Grafe, T Ulmar; Meuche, Ivonne; Steffan-Dewenter, Ingolf; Keller, Alexander

    2016-05-01

    Carnivorous plants of the genus Nepenthes have been studied for over a century, but surprisingly little is known about associations with microorganisms. The two species Nepenthes rafflesiana and Nepenthes hemsleyana differ in their pitcher-mediated nutrient sources, sequestering nitrogen from arthropod prey and arthropods as well as bat faeces, respectively. We expected bacterial communities living in the pitchers to resemble this diet difference. Samples were taken from different parts of the pitchers (leaf, peristome, inside, outside, digestive fluid) of both species. Bacterial communities were determined using culture-independent high-throughput amplicon sequencing. Bacterial richness and community structure were similar in leaves, peristomes, inside and outside walls of both plant species. Regarding digestive fluids, bacterial richness was higher in N. hemsleyana than in N. rafflesiana. Additionally, digestive fluid communities were highly variable in structure, with strain-specific differences in community composition between replicates. Acidophilic taxa were mostly of low abundance, except the genus Acidocella, which strikingly reached extremely high levels in two N. rafflesiana fluids. In N. hemsleyana fluid, some taxa classified as vertebrate gut symbionts as well as saprophytes were enriched compared to N. rafflesiana, with saprophytes constituting potential competitors for nutrients. The high variation in community structure might be caused by a number of biotic and abiotic factors. Nitrogen-fixing bacteria were present in both study species, which might provide essential nutrients to the plant at times of low prey capture and/or rare encounters with bats.

  4. Bacterial Communities in the Rhizospheres of Three Mangrove Tree Species from Beilun Estuary, China

    PubMed Central

    Wu, Peng; Xiong, Xiaofei; Xu, Zhanzhou; Lu, Chuqian; Cheng, Hao; Lyu, Xiangli; Zhang, Jinghuai; He, Wei; Deng, Wei; Lyu, Yihua; Lou, Quansheng; Hong, Yiguo; Fang, Hongda

    2016-01-01

    The bacterial communities played important roles in the high productivity mangrove ecosystem. In this study, we investigated the vertical distributions of rhizosphere bacteria from three mangrove species (Bruguiera gymnorrhiza, Kandelia candel and Aegiceras corniculatum) in Beilun Estuary, China using high throughput DNA pyrosequencing of the 16S rRNA gene. Phylogenetic analysis showed that bacterial communities from mangrove rhizosphere sediments were dominated by Proteobacteria (mostly Deltaproteobacteria and Gammaproteobacteria), followed by Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. However, the ANOVA analysis on Shannon and Chao1 indices indicated that bacterial communities among sediments of the three mangrove species varied more strongly than the sampling depths. In addition, the PCA result demonstrated that the bacterial communities could be separated into three groups according to the mangrove species. Moreover, the dominated orders Rhodospirillales, GCA004 and envOPS12 were significantly different among sediments of the three mangrove species. The results of this study provided valuable information about the distribution feature of rhizosphere bacteria from Chinese mangrove plants and shed insights into biogeochemical transformations driven by bacteria in rhizosphere sediments. PMID:27695084

  5. Bacterial Communities in the Rhizospheres of Three Mangrove Tree Species from Beilun Estuary, China.

    PubMed

    Wu, Peng; Xiong, Xiaofei; Xu, Zhanzhou; Lu, Chuqian; Cheng, Hao; Lyu, Xiangli; Zhang, Jinghuai; He, Wei; Deng, Wei; Lyu, Yihua; Lou, Quansheng; Hong, Yiguo; Fang, Hongda

    2016-01-01

    The bacterial communities played important roles in the high productivity mangrove ecosystem. In this study, we investigated the vertical distributions of rhizosphere bacteria from three mangrove species (Bruguiera gymnorrhiza, Kandelia candel and Aegiceras corniculatum) in Beilun Estuary, China using high throughput DNA pyrosequencing of the 16S rRNA gene. Phylogenetic analysis showed that bacterial communities from mangrove rhizosphere sediments were dominated by Proteobacteria (mostly Deltaproteobacteria and Gammaproteobacteria), followed by Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. However, the ANOVA analysis on Shannon and Chao1 indices indicated that bacterial communities among sediments of the three mangrove species varied more strongly than the sampling depths. In addition, the PCA result demonstrated that the bacterial communities could be separated into three groups according to the mangrove species. Moreover, the dominated orders Rhodospirillales, GCA004 and envOPS12 were significantly different among sediments of the three mangrove species. The results of this study provided valuable information about the distribution feature of rhizosphere bacteria from Chinese mangrove plants and shed insights into biogeochemical transformations driven by bacteria in rhizosphere sediments.

  6. Influence of the acid type in the production of chitosan films reinforced with bacterial nanocellulose.

    PubMed

    Velásquez-Cock, J; Ramírez, E; Betancourt, S; Putaux, J-L; Osorio, M; Castro, C; Gañán, P; Zuluaga, R

    2014-08-01

    Chitosan films reinforced with bacterial cellulose (BC) nanoribbons were studied to understand the influence of acid (acetic and lactic acids) on the reinforcing effect. For both acids, the maximum concentration of the reinforcing constituent was 5wt% with respect to the dry weight of chitosan. The infrared spectra, mechanical properties, morphology and antimicrobial activity of the films were analyzed. The results showed a difference between the acids in their behavior and effect on the reinforcement, with a tensile strength of 12.3MPa for the acetic acid films and 3.3MPa for the lactic acid films. Additionally, the bacterial inhibition tests were shown to be positive for the lactic acid films and negative for the acetic acid films. Therefore, exchanging the acid used in these films may be desirable for certain applications.

  7. Speedy speciation in a bacterial microcosm: new species can arise as frequently as adaptations within a species

    PubMed Central

    Koeppel, Alexander F; Wertheim, Joel O; Barone, Laura; Gentile, Nicole; Krizanc, Danny; Cohan, Frederick M

    2013-01-01

    Microbiologists are challenged to explain the origins of enormous numbers of bacterial species worldwide. Contributing to this extreme diversity may be a simpler process of speciation in bacteria than in animals and plants, requiring neither sexual nor geographical isolation between nascent species. Here, we propose and test a novel hypothesis for the extreme diversity of bacterial species—that splitting of one population into multiple ecologically distinct populations (cladogenesis) may be as frequent as adaptive improvements within a single population's lineage (anagenesis). We employed a set of experimental microcosms to address the relative rates of adaptive cladogenesis and anagenesis among the descendants of a Bacillus subtilis clone, in the absence of competing species. Analysis of the evolutionary trajectories of genetic markers indicated that in at least 7 of 10 replicate microcosm communities, the original population founded one or more new, ecologically distinct populations (ecotypes) before a single anagenetic event occurred within the original population. We were able to support this inference by identifying putative ecotypes formed in these communities through differences in genetic marker association, colony morphology and microhabitat association; we then confirmed the ecological distinctness of these putative ecotypes in competition experiments. Adaptive mutations leading to new ecotypes appeared to be about as common as those improving fitness within an existing ecotype. These results suggest near parity of anagenesis and cladogenesis rates in natural populations that are depauperate of bacterial diversity. PMID:23364353

  8. Bacterial production of free fatty acids from freshwater macroalgal cellulose.

    PubMed

    Hoover, Spencer W; Marner, Wesley D; Brownson, Amy K; Lennen, Rebecca M; Wittkopp, Tyler M; Yoshitani, Jun; Zulkifly, Shahrizim; Graham, Linda E; Chaston, Sheena D; McMahon, Katherine D; Pfleger, Brian F

    2011-07-01

    The predominant strategy for using algae to produce biofuels relies on the overproduction of lipids in microalgae with subsequent conversion to biodiesel (methyl-esters) or green diesel (alkanes). Conditions that both optimize algal growth and lipid accumulation rarely overlap, and differences in growth rates can lead to wild species outcompeting the desired lipid-rich strains. Here, we demonstrate an alternative strategy in which cellulose contained in the cell walls of multicellular algae is used as a feedstock for cultivating biofuel-producing microorganisms. Cellulose was extracted from an environmental sample of Cladophora glomerata-dominated periphyton that was collected from Lake Mendota, WI, USA. The resulting cellulose cake was hydrolyzed by commercial enzymes to release fermentable glucose. The hydrolysis mixture was used to formulate an undefined medium that was able to support the growth, without supplementation, of a free fatty acid (FFA)-overproducing strain of Escherichia coli (Lennen et. al 2010). To maximize free fatty acid production from glucose, an isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible vector was constructed to express the Umbellularia californica acyl-acyl carrier protein (ACP) thioesterase. Thioesterase expression was optimized by inducing cultures with 50 μM IPTG. Cell density and FFA titers from cultures grown on algae-based media reached 50% of those (∼90 μg/mL FFA) cultures grown on rich Luria-Bertani broth supplemented with 0.2% glucose. In comparison, cultures grown in two media based on AFEX-pretreated corn stover generated tenfold less FFA than cultures grown in algae-based media. This study demonstrates that macroalgal cellulose is a potential carbon source for the production of biofuels or other microbially synthesized compounds.

  9. Bacterial production of free fatty acids from freshwater macroalgal cellulose

    PubMed Central

    Hoovers, Spencer W.; Marner, Wesley D.; Brownson, Amy K.; Lennen, Rebecca M.; Wittkopp, Tyler M.; Yoshitani, Jun; Zulkifly, Shahrizim; Graham, Linda E.; Chaston, Sheena D.; McMahon, Katherine D.

    2013-01-01

    The predominant strategy for using algae to produce biofuels relies on the overproduction of lipids in microalgae with subsequent conversion to biodiesel (methyl-esters) or green diesel (alkanes). Conditions that both optimize algal growth and lipid accumulation rarely overlap, and differences in growth rates can lead to wild species outcompeting the desired lipid-rich strains. Here, we demonstrate an alternative strategy in which cellulose contained in the cell walls of multicellular algae is used as a feedstock for cultivating biofuel-producing micro-organisms. Cellulose was extracted from an environmental sample of Cladophora glomerata-dominated periphyton that was collected from Lake Mendota, WI, USA. The resulting cellulose cake was hydrolyzed by commercial enzymes to release fermentable glucose. The hydrolysis mixture was used to formulate an undefined medium that was able to support the growth, without supplementation, of a free fatty acid (FFA)-overproducing strain of Escherichia coli (Lennen et. al 2010). To maximize free fatty acid production from glucose, an isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible vector was constructed to express the Umbellularia californica acyl–acyl carrier protein (ACP) thioesterase. Thioesterase expression was optimized by inducing cultures with 50 μM IPTG. Cell density and FFA titers from cultures grown on algae-based media reached 50% of those (~90 μg/mL FFA) cultures grown on rich Luria–Bertani broth supplemented with 0.2% glucose. In comparison, cultures grown in two media based on AFEX-pretreated corn stover generated tenfold less FFA than cultures grown in algae-based media. This study demonstrates that macroalgal cellulose is a potential carbon source for the production of biofuels or other microbially synthesized compounds. PMID:21643704

  10. Plants of the fynbos biome harbour host species-specific bacterial communities.

    PubMed

    Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel

    2016-08-01

    The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth.

  11. Histone Deacetylase Inhibitors Promote Mitochondrial Reactive Oxygen Species Production and Bacterial Clearance by Human Macrophages.

    PubMed

    Ariffin, Juliana K; das Gupta, Kaustav; Kapetanovic, Ronan; Iyer, Abishek; Reid, Robert C; Fairlie, David P; Sweet, Matthew J

    2015-12-28

    Broad-spectrum histone deacetylase inhibitors (HDACi) are used clinically as anticancer agents, and more isoform-selective HDACi have been sought to modulate other conditions, including chronic inflammatory diseases. Mouse studies suggest that HDACi downregulate immune responses and may compromise host defense. However, their effects on human macrophage antimicrobial responses are largely unknown. Here, we show that overnight pretreatment of human macrophages with HDACi prior to challenge with Salmonella enterica serovar Typhimurium or Escherichia coli results in significantly reduced intramacrophage bacterial loads, which likely reflect the fact that this treatment regime impairs phagocytosis. In contrast, cotreatment of human macrophages with HDACi at the time of bacterial challenge did not impair phagocytosis; instead, HDACi cotreatment actually promoted clearance of intracellular S. Typhimurium and E. coli. Mechanistically, treatment of human macrophages with HDACi at the time of bacterial infection enhanced mitochondrial reactive oxygen species generation by these cells. The capacity of HDACi to promote the clearance of intracellular bacteria from human macrophages was abrogated when cells were pretreated with MitoTracker Red CMXRos, which perturbs mitochondrial function. The HDAC6-selective inhibitor tubastatin A promoted bacterial clearance from human macrophages, whereas the class I HDAC inhibitor MS-275, which inhibits HDAC1 to -3, had no effect on intracellular bacterial loads. These data are consistent with HDAC6 and/or related HDACs constraining mitochondrial reactive oxygen species production from human macrophages during bacterial challenge. Our findings suggest that, whereas long-term HDACi treatment regimes may potentially compromise host defense, selective HDAC inhibitors may have applications in treating acute bacterial infections.

  12. Histone Deacetylase Inhibitors Promote Mitochondrial Reactive Oxygen Species Production and Bacterial Clearance by Human Macrophages

    PubMed Central

    Ariffin, Juliana K.; das Gupta, Kaustav; Kapetanovic, Ronan; Iyer, Abishek; Reid, Robert C.; Fairlie, David P.

    2015-01-01

    Broad-spectrum histone deacetylase inhibitors (HDACi) are used clinically as anticancer agents, and more isoform-selective HDACi have been sought to modulate other conditions, including chronic inflammatory diseases. Mouse studies suggest that HDACi downregulate immune responses and may compromise host defense. However, their effects on human macrophage antimicrobial responses are largely unknown. Here, we show that overnight pretreatment of human macrophages with HDACi prior to challenge with Salmonella enterica serovar Typhimurium or Escherichia coli results in significantly reduced intramacrophage bacterial loads, which likely reflect the fact that this treatment regime impairs phagocytosis. In contrast, cotreatment of human macrophages with HDACi at the time of bacterial challenge did not impair phagocytosis; instead, HDACi cotreatment actually promoted clearance of intracellular S. Typhimurium and E. coli. Mechanistically, treatment of human macrophages with HDACi at the time of bacterial infection enhanced mitochondrial reactive oxygen species generation by these cells. The capacity of HDACi to promote the clearance of intracellular bacteria from human macrophages was abrogated when cells were pretreated with MitoTracker Red CMXRos, which perturbs mitochondrial function. The HDAC6-selective inhibitor tubastatin A promoted bacterial clearance from human macrophages, whereas the class I HDAC inhibitor MS-275, which inhibits HDAC1 to -3, had no effect on intracellular bacterial loads. These data are consistent with HDAC6 and/or related HDACs constraining mitochondrial reactive oxygen species production from human macrophages during bacterial challenge. Our findings suggest that, whereas long-term HDACi treatment regimes may potentially compromise host defense, selective HDAC inhibitors may have applications in treating acute bacterial infections. PMID:26711769

  13. Extremophiles in Mineral Sulphide Heaps: Some Bacterial Responses to Variable Temperature, Acidity and Solution Composition

    PubMed Central

    Watling, Helen R.; Shiers, Denis W.; Collinson, David M.

    2015-01-01

    In heap bioleaching, acidophilic extremophiles contribute to enhanced metal extraction from mineral sulphides through the oxidation of Fe(II) and/or reduced inorganic sulphur compounds (RISC), such as elemental sulphur or mineral sulphides, or the degradation of organic compounds derived from the ore, biota or reagents used during mineral processing. The impacts of variable solution acidity and composition, as well as temperature on the three microbiological functions have been examined for up to four bacterial species found in mineral sulphide heaps. The results indicate that bacteria adapt to sufficiently high metal concentrations (Cu, Ni, Co, Zn, As) to allow them to function in mineral sulphide heaps and, by engaging alternative metabolic pathways, to extend the solution pH range over which growth is sustained. Fluctuating temperatures during start up in sulphide heaps pose the greatest threat to efficient bacterial colonisation. The large masses of ores in bioleaching heaps mean that high temperatures arising from sulphide oxidation are hard to control initially, when the sulphide content of the ore is greatest. During that period, mesophilic and moderately thermophilic bacteria are markedly reduced in both numbers and activity. PMID:27682094

  14. Identification of household bacterial community and analysis of species shared with human microbiome.

    PubMed

    Jeon, Yoon-Seong; Chun, Jongsik; Kim, Bong-Soo

    2013-11-01

    Microbial populations in indoor environments, where we live and eat, are important for public health. Various bacterial species reside in the kitchen, and refrigerators, the major means of food storage within kitchens, can be a direct source of food borne illness. Therefore, the monitoring of microbiota in the refrigerator is important for food safety. We investigated and compared bacterial communities that reside in the vegetable compartment of the refrigerator and on the seat of the toilet, which is recognized as highly colonized by microorganisms, in ten houses using high-throughput sequencing. Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes were predominant in refrigerator and toilet samples. However, Proteobacteria was more abundant in the refrigerator, and Firmicutes was more abundant in the toilet. These household bacterial communities were compared with those of human skin and gut to identify potential sources of household bacteria. Bacterial communities from refrigerators and toilets shared more species in common with human skin than gut. Opportunistic pathogens, including Propionibacterium acnes, Bacteroides vulgatus, and Staphylococcus epidermidis, were identified as species shared with human skin and gut microbiota. This approach can provide a general background of the household microbiota and a potential method of source-tracking for public health purposes.

  15. Diazotrophic potential among bacterial communities associated with wild and cultivated Agave species.

    PubMed

    Desgarennes, Damaris; Garrido, Etzel; Torres-Gomez, Miryam J; Peña-Cabriales, Juan J; Partida-Martinez, Laila P

    2014-12-01

    Agaves are major biotic resources in arid and semi-arid ecosystems. Despite their ecological, economical and cultural relevance, many aspects of the microbial communities associated with agaves are still unknown. Here, we investigated the bacterial communities associated with two Agave species by 16S rRNA- Denaturing gradient gel electrophoresis fingerprinting and sequencing. We also evaluated the effects of biotic and abiotic factors in the structure of the bacterial communities. In parallel, we isolated and characterized diazotrophic bacteria associated with agaves, as Agave soils are characterized by their low nitrogen content. Our results demonstrate that in Agave, the structure of prokaryotic assemblages was mostly influenced by the community group, where the soil, episphere, and endosphere were clearly distinct. Proteobacteria (γ and α), Actinobacteria, and Acidobacteria were the dominant phyla. Bacterial communities in the episphere of agaves were mainly influenced by the host species, whereas in the endosphere were affected by the season. Fifteen bacterial taxa were common and abundant in the endosphere of both Agave species during the dry season. Notably, some of the confirmed diazotrophic strains belonged to this group, suggesting a possible beneficial role in planta.

  16. Heavy metals species affect fungal-bacterial synergism during the bioremediation of fluoranthene.

    PubMed

    Ma, Xiao-Kui; Ding, Ning; Peterson, Eric Charles; Daugulis, Andrew J

    2016-09-01

    The co-occurrence of polycyclic aromatic hydrocarbons (PAHs) with heavy metals (HMs) is very common in contaminated soils, but the influence of HMs on fungal-bacterial synergism during PAH bioremediation has not been investigated. The bioremediation of fluoranthene-contaminated sand using co-cultures of Acremonium sp. P0997 and Bacillus subtilis showed increases of 109.4 and 9.8 % in degradation compared to pure bacterial and fungal cultures, respectively, removing 64.1 ± 1.4 % fluoanthene in total. The presence of Cu(2+) reduced fluoranthene removal to 53.7 ± 1.7 %, while inhibiting bacterial growth, and reducing translocation of bacteria on fungal hyphae by 49.5 %, in terms of the bacterial translocation ratio. Cu(2+) reduced bacterial diffusion by 46.8 and 31.9 %, as reflected by D (a bulk random motility diffusional coefficient) and D eff (the effective one-dimensional diffusion coefficient) compared to the control without HM supplementation, respectively. However, Mn(2+) resulted in a 78.2 ± 1.9 % fluoranthene degradation, representing an increase of 21.9 %, while enhancing bacterial growth and bacterial translocation on fungal hyphae, showing a 12.0 % increase in translocation ratio, with no observable impact on D and D eff. Hence, the presence of HMs has been shown to affect fungal-bacterial synergism in PAH degradation, and this effect differs with HM species.

  17. Differing Daphnia magna assimilation efficiencies for terrestrial, bacterial, and algal carbon and fatty acids.

    PubMed

    Taipale, Sami J; Brett, Michael T; Hahn, Martin W; Martin-Creuzburg, Dominik; Yeung, Sean; Hiltunen, Minna; Strandberg, Ursula; Kankaala, Paula

    2014-02-01

    There is considerable interest in the pathways by which carbon and growth-limiting elemental and biochemical nutrients are supplied to upper trophic levels. Fatty acids and sterols are among the most important molecules transferred across the plant-animal interface of food webs. In lake ecosystems, in addition to phytoplankton, bacteria and terrestrial organic matter are potential trophic resources for zooplankton, especially in those receiving high terrestrial organic matter inputs. We therefore tested carbon, nitrogen, and fatty acid assimilation by the crustacean Daphnia magna when consuming these resources. We fed Daphnia with monospecific diets of high-quality (Cryptomonas marssonii) and intermediate-quality (Chlamydomonas sp. and Scenedesmus gracilis) phytoplankton species, two heterotrophic bacterial strains, and particles from the globally dispersed riparian grass, Phragmites australis, representing terrestrial particulate organic carbon (t-POC). We also fed Daphnia with various mixed diets, and compared Daphnia fatty acid, carbon, and nitrogen assimilation across treatments. Our results suggest that bacteria were nutritionally inadequate diets because they lacked sterols and polyunsaturated omega-3 and omega-6 (omega-3 and omega-6) fatty acids (PUFAs). However, Daphnia were able to effectively use carbon and nitrogen from Actinobacteria, if their basal needs for essential fatty acids and sterols were met by phytoplankton. In contrast to bacteria, t-POC contained sterols and omega-6 and omega-3 fatty acids, but only at 22%, 1.4%, and 0.2% of phytoplankton levels, respectively, which indicated that t-POC food quality was especially restricted with regard to omega-3 PUFAs. Our results also showed higher assimilation of carbon than fatty acids from t-POC and bacteria into Daphnia, based on stable-isotope and fatty acids analysis, respectively. A relatively high (>20%) assimilation of carbon and fatty acids from t-POC was observed only when the proportion of t

  18. Intestinal microbiota in metabolic diseases: from bacterial community structure and functions to species of pathophysiological relevance.

    PubMed

    Clavel, Thomas; Desmarchelier, Charles; Haller, Dirk; Gérard, Philippe; Rohn, Sascha; Lepage, Patricia; Daniel, Hannelore

    2014-07-01

    The trillions of bacterial cells that colonize the mammalian digestive tract influence both host physiology and the fate of dietary compounds. Gnotobionts and fecal transplantation have been instrumental in revealing the causal role of intestinal bacteria in energy homeostasis and metabolic dysfunctions such as type-2 diabetes. However, the exact contribution of gut bacterial metabolism to host energy balance is still unclear and knowledge about underlying molecular mechanisms is scant. We have previously characterized cecal bacterial community functions and host responses in diet-induced obese mice using omics approaches. Based on these studies, we here discuss issues on the relevance of mouse models, give evidence that the metabolism of cholesterol-derived compounds by gut bacteria is of particular importance in the context of metabolic disorders and that dominant species of the family Coriobacteriaceae are good models to study these functions.

  19. Coral-Associated Bacterial Diversity Is Conserved across Two Deep-Sea Anthothela Species

    PubMed Central

    Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C.; Clostio, Rachel W.; Brooke, Sandra D.; Ross, Steve W.

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4–V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont. PMID:27092120

  20. Coral-associated bacterial diversity is conserved across two deep-sea Anthothela species

    USGS Publications Warehouse

    Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C; Clostio, Rachel W; Brooke, Sandra D.; Ross, Steve W.

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4-V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont.

  1. Coral-Associated Bacterial Diversity Is Conserved across Two Deep-Sea Anthothela Species.

    PubMed

    Lawler, Stephanie N; Kellogg, Christina A; France, Scott C; Clostio, Rachel W; Brooke, Sandra D; Ross, Steve W

    2016-01-01

    Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4-V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont.

  2. Disentangling the interactions between photochemical and bacterial degradation of dissolved organic matter: amino acids play a central role.

    PubMed

    Amado, André M; Cotner, James B; Cory, Rose M; Edhlund, Betsy L; McNeill, Kristopher

    2015-04-01

    Photochemical and bacterial degradation are important pathways to carbon mineralization and can be coupled in dissolved organic matter (DOM) decomposition. However, details of several mechanisms of the coupled photochemical and biological processing of DOM remain too poorly understood to achieve accurate predictions of the impact of these processes on DOM fate and reactivity. The aim of this study was to evaluate how photochemical degradation of amino acids affects bacterial metabolism and whether or not photochemical degradation of DOM competes for amino acids with biological processes. We examined the interactions between photochemical and bacterial degradation dynamics using a mixture of 18 amino acids and examined their dynamics and turnover rates within a larger pool of allochthonous or autochthonous DOM. We observed that photochemical exposure of DOM containing amino acids led to delayed biomass production (even though the final biomass did not differ), most likely due to a need for upregulation of biosynthetic pathways for amino acids that were damaged by photochemically produced reactive oxygen species (ROS). This response was most pronounced in bacterial communities where the abundance of photosensitive amino acids was highest (amended treatments and autochthonous DOM) and least pronounced when the abundance of these amino acids was low (unamended and allochthonous DOM), likely because these bacteria already had these biosynthetic pathways functioning. We observed both a cost and benefit associated with photochemical exposure of DOM. We observed a cost associated with photochemically produced ROS that partially degrade key amino acids and a benefit associated with an increase in the availability of other compounds in the DOM. Bacteria growing on DOM sources that are low in labile amino acids, such as those in terrestrially influenced environments, experience more of the benefits associated with photochemical exposure, whereas bacteria growing in more amino

  3. Bacterial communities associated with the pitcher fluids of three Nepenthes (Nepenthaceae) pitcher plant species growing in the wild.

    PubMed

    Chou, Lee Yiung; Clarke, Charles M; Dykes, Gary A

    2014-10-01

    Nepenthes pitcher plants produce modified jug-shaped leaves to attract, trap and digest insect prey. We used 16S rDNA cloning and sequencing to compare bacterial communities in pitcher fluids of each of three species, namely Nepenthes ampullaria, Nepenthes gracilis and Nepenthes mirabilis, growing in the wild. In contrast to previous greenhouse-based studies, we found that both opened and unopened pitchers harbored bacterial DNA. Pitchers of N. mirabilis had higher bacterial diversity as compared to other Nepenthes species. The composition of the bacterial communities could be different between pitcher types for N. mirabilis (ANOSIM: R = 0.340, p < 0.05). Other Nepenthes species had similar bacterial composition between pitcher types. SIMPER showed that more than 50 % of the bacterial taxa identified from the open pitchers of N. mirabilis were not found in other groups. Our study suggests that bacteria in N. mirabilis are divided into native and nonnative groups.

  4. Bacterial-biota dynamics of eight bryophyte species from different ecosystems

    PubMed Central

    Koua, Faisal Hammad Mekky; Kimbara, Kazuhide; Tani, Akio

    2014-01-01

    Despite the importance of bryophyte-associated microorganisms in various ecological aspects including their crucial roles in the soil-enrichment of organic mass and N2 fixation, nonetheless, little is known about the microbial diversity of the bryophyte phyllospheres (epi-/endophytes). To get insights into bacterial community structures and their dynamics on the bryophyte habitats in different ecosystems and their potential biological roles, we utilized the 16S rRNA gene PCR-DGGE and subsequent phylogenetic analyses to investigate the bacterial community of eight bryophyte species collected from three distinct ecosystems from western Japan. Forty-two bacterial species belonging to γ-proteobacteria and Firmicutes with 71.4% and 28.6%, respectively, were identified among 90 DGGE gel band population. These DGGE-bands were assigned to 13 different genera with obvious predomination the genus Clostridium with 21.4% from the total bacterial community. These analyses provide new insights into bryophyte-associated bacteria and their relations to the ecosystems. PMID:25737654

  5. Genome-wide survey of codons under diversifying selection in a highly recombining bacterial species, Helicobacter pylori

    PubMed Central

    Yahara, Koji; Furuta, Yoshikazu; Morimoto, Shinpei; Kikutake, Chie; Komukai, Sho; Matelska, Dorota; Dunin-Horkawicz, Stanisław; Bujnicki, Janusz M.; Uchiyama, Ikuo; Kobayashi, Ichizo

    2016-01-01

    Selection has been a central issue in biology in eukaryotes as well as prokaryotes. Inference of selection in recombining bacterial species, compared with clonal ones, has been a challenge. It is not known how codons under diversifying selection are distributed along the chromosome or among functional categories or how frequently such codons are subject to mutual homologous recombination. Here, we explored these questions by analysing genes present in >90% among 29 genomes of Helicobacter pylori, one of the bacterial species with the highest mutation and recombination rates. By a method for recombining sequences, we identified codons under diversifying selection (dN/dS > 1), which were widely distributed and accounted for ∼0.2% of all the codons of the genome. The codons were enriched in genes of host interaction/cell surface and genome maintenance (DNA replication, recombination, repair, and restriction modification system). The encoded amino acid residues were sometimes found adjacent to critical catalytic/binding residues in protein structures. Furthermore, by estimating the intensity of homologous recombination at a single nucleotide level, we found that these codons appear to be more frequently subject to recombination. We expect that the present study provides a new approach to population genomics of selection in recombining prokaryotes. PMID:26961370

  6. Assessing the viability of bacterial species in drinking water by combined cellular and molecular analyses.

    PubMed

    Kahlisch, Leila; Henne, Karsten; Gröbe, Lothar; Brettar, Ingrid; Höfle, Manfred G

    2012-02-01

    The question which bacterial species are present in water and if they are viable is essential for drinking water safety but also of general relevance in aquatic ecology. To approach this question we combined propidium iodide/SYTO9 staining ("live/dead staining" indicating membrane integrity), fluorescence-activated cell sorting (FACS) and community fingerprinting for the analysis of a set of tap water samples. Live/dead staining revealed that about half of the bacteria in the tap water had intact membranes. Molecular analysis using 16S rRNA and 16S rRNA gene-based single-strand conformation polymorphism (SSCP) fingerprints and sequencing of drinking water bacteria before and after FACS sorting revealed: (1) the DNA- and RNA-based overall community structure differed substantially, (2) the community retrieved from RNA and DNA reflected different bacterial species, classified as 53 phylotypes (with only two common phylotypes), (3) the percentage of phylotypes with intact membranes or damaged cells were comparable for RNA- and DNA-based analyses, and (4) the retrieved species were primarily of aquatic origin. The pronounced difference between phylotypes obtained from DNA extracts (dominated by Betaproteobacteria, Bacteroidetes, and Actinobacteria) and from RNA extracts (dominated by Alpha-, Beta-, Gammaproteobacteria, Bacteroidetes, and Cyanobacteria) demonstrate the relevance of concomitant RNA and DNA analyses for drinking water studies. Unexpected was that a comparable fraction (about 21%) of phylotypes with membrane-injured cells was observed for DNA- and RNA-based analyses, contradicting the current understanding that RNA-based analyses represent the actively growing fraction of the bacterial community. Overall, we think that this combined approach provides an interesting tool for a concomitant phylogenetic and viability analysis of bacterial species of drinking water.

  7. Colonization of the upper genital tract by vaginal bacterial species in non-pregnant women

    PubMed Central

    MITCHELL, Caroline M.; HAICK, Anoria; NKWOPARA, Evangelyn; GARCIA, Rochelle; RENDI, Mara; AGNEW, Kathy; FREDRICKS, David N.; ESCHENBACH, David

    2016-01-01

    Objective Evaluate upper genital tract (UGT) presence of vaginal bacterial species using sensitive molecular methods capable of detecting fastidious bacterial vaginosis (BV)-associated bacteria. Study Design Vaginal swabs were collected prior to hysterectomy. The excised uterus was sterilely opened and swabs collected from endometrium and upper endocervix. DNA was tested in 11 quantitative PCR (qPCR) assays for 12 bacterial species: Lactobacillus iners, L. crispatus, L. jensenii, Gardnerella vaginalis, Atopobium vaginae, Megasphaera spp., Prevotella spp., Leptotrichia/Sneathia, BVAB1, BVAB2, BVAB3 and a broad-range16S rRNA gene assay. Endometrial fluid was tested with Luminex and ELISA for cytokines and defensins, and tissue for gene expression of defensins and cathelicidin. Results We enrolled 58 women: mean age 43 + 7 years, mostly white (n = 46; 79%) and BV-negative (n = 43; 74%). By species-specific qPCR, 55 (95%) had UGT colonization with at least one species (n = 52), or were positive by 16S PCR (n = 3). The most common species were L. iners (45% UGT, 61% vagina), Prevotella spp. (33% UGT, 76% vagina) and L. crispatus (33% UGT, 56% vagina). Median quantities of bacteria in the UGT were lower than vaginal levels by 2–4 log10 rRNA gene copies/swab. There were no differences in endometrial inflammatory markers between women with no bacteria, Lactobacillus only or any BV-associated species in the UGT. Conclusion Our data suggest that the endometrial cavity is not sterile in most women undergoing hysterectomy, and that the presence of low levels of bacteria in the uterus is not associated with significant inflammation. PMID:25524398

  8. Bacterial production and transformation of dissolved neutral sugars and amino acids in seawater

    NASA Astrophysics Data System (ADS)

    Jørgensen, L.; Lechtenfeld, O.; Benner, R.; Middelboe, M.; Stedmon, C. A.

    2014-04-01

    Dissolved organic matter (DOM) in the ocean consists of a heterogeneous mixture of molecules, most of which are of unknown origin. Neutral sugars and amino acids are among the few recognizable biomolecules in DOM, and the molecular composition of these biomolecules is shaped primarily by biological production and degradation processes. This study provides insight into the bioavailability of biomolecules as well as the chemical composition of DOM produced by bacteria. The molecular compositions of neutral sugars and amino acids were investigated in DOM produced by bacteria and in DOM remaining after long-term bacterial degradation. Results from bioassay incubations (32 days) with natural and artificial seawater, indicate that the molecular compositions following bacterial degradation are not strongly influenced by the initial substrate or bacterial community. The molecular composition of neutral sugars released by bacteria was characterized by a high glucose content (47 mol%) and heterogeneous contributions from other neutral sugars (3-14 mol%). DOM remaining after bacterial degradation was characterized by a high galactose content (33 mol%), followed by glucose (22 mol%) and the remaining neutral sugars (7-11 mol%). The ratio of D-amino acids to L-amino acids increased during the experiments as a response to bacterial degradation, and after 32 days the D/L ratios of aspartic acid, glutamic acid, serine and alanine reached around 0.79, 0.32, 0.30 and 0.51 in all treatments, respectively. The striking similarity in neutral sugar and amino acid compositions between natural and artificial seawater samples, suggests that the microbial carbon pump also applies for neutral sugars and amino acids and that bacterially-produced biomolecules persist for long periods in the ocean.

  9. Loline alkaloid production by fungal endophytes of Fescue species select for particular epiphytic bacterial microflora

    PubMed Central

    Roberts, Elizabeth; Lindow, Steven

    2014-01-01

    The leaves of fescue grasses are protected from herbivores by the production of loline alkaloids by the mutualist fungal endophytes Neotyphodium sp. or Epichloë sp. Most bacteria that reside on the leaf surface of such grasses can consume these defensive chemicals. Loline-consuming bacteria are rare on the leaves of other plant species. Several bacterial species including Burkholderia ambifaria recovered from tall fescue could use N-formyl loline as a sole carbon and nitrogen source in culture and achieved population sizes that were about eightfold higher when inoculated onto plants harboring loline-producing fungal endophytes than on plants lacking such endophytes or which were colonized by fungal variants incapable of loline production. In contrast, mutants of B. ambifaria and other bacterial species incapable of loline catabolism achieved similarly low population sizes on tall fescue colonized by loline-producing Neotyphodium sp. and on plants lacking this endophytic fungus. Lolines that are released onto the surface of plants benefiting from a fungal mutualism thus appear to be a major resource that can be exploited by epiphytic bacteria, thereby driving the establishment of a characteristic bacterial community on such plants. PMID:24108329

  10. The importance of species sorting differs between habitat generalists and specialists in bacterial communities.

    PubMed

    Székely, Anna J; Langenheder, Silke

    2014-01-01

    Recent studies have shown that the spatial turnover of bacterial communities, that is, beta-diversity, is determined by a combination of different assembly mechanisms, such as species sorting, that is, environmental filtering, and dispersal-related mechanisms. However, it is currently unclear to what extent the importance of the different mechanisms depends on community traits. Here, we implemented a study using a rock pool metacommunity to test whether habitat specialization of bacterial taxa and groups or their phylogenetic identity influenced by which mechanisms communities were assembled. In general, our results show that species sorting was the most important assembly mechanism. However, we found that a larger fraction of the variation in bacterial community composition between pools could be explained by environmental factors in case of habitat generalists, that is, taxa that were widespread and abundant in the metacommunity, compared with habitat specialists, that is, taxa that had a more restricted distribution range and tended to be rare. Differences in assembly mechanisms were observed between different major phyla and classes. However, also here, a larger fraction of the variation in community composition among pools could be explained for taxonomic groups that contained on average more habitat generalists. In summary, our results show that species sorting is stronger for the most common taxa, indicating that beta-diversity along environmental gradients can be adequately described without considering rare taxa.

  11. [Finding of the bacterial species Edwardsiella tarda in the aquarium fish Betta splendens].

    PubMed

    Vladík, P; Prouza, A; Vítovec, J

    1983-01-01

    A case of the mass occurrence of a disease in the aquarium fish species Betta splendens is described; morphologically the disease was characterized by the finding of large dermal changes located mainly in the dorsal part and by miliary granulomata in liver, spleen and kidneys. The granulomata consisted of epitheloid light cells with centrally located necrosis. Gram-negative bacteria with morphological and biochemical characteristics corresponding to the bacterial species Edwardsiella tarda were isolated from the kidneys, liver and from the dermal lesion. The characteristics of the strains isolated by us were compared with the reference Edwardsiella strain (Bth 1/64) obtained from the Czechoslovak collection of type cultures, Prague.

  12. Effects of viruses on bacterial functions under contrasting nutritional conditions for four species of bacteria isolated from Hong Kong waters

    PubMed Central

    Liu, Hao; Yuan, Xiangcheng; Xu, Jie; Harrison, Paul J.; He, Lei; Yin, Kedong

    2015-01-01

    Free living viruses are ubiquitous in marine waters and concentrations are usually several times higher than the bacterial abundance. These viruses are capable of lysing host bacteria and therefore, play an important role in the microbial loop in oligotrophic waters. However, few studies have been conducted to compare the role of viruses in regulating bacterial abundance and heterotrophic activities between natural oligotrophic waters and anthropogenic influenced eutrophic waters. In this study, we examined viral effects on bacterial functions of four single bacterial species incubated with natural viral assemblages in seawater samples from eutrophic and oligotrophic waters. The viral-lysis of bacteria was significantly higher in eutrophic than oligotrophic waters. This suggests that viruses were capable of controlling bacterial abundance, respiration and production in the eutrophic waters. Cellular bacterial respiration and production was higher with viruses than without viruses, which was more evident in the oligotrophic waters. These results indicate that viruses can slow down bacterial consumption of oxygen and reduce bacteria-induced eutrophication effects in anthropogenic eutrophic waters, but switch to the role of sustaining the bacterial population when nutrients are limiting. There were bacterial species differences in resisting viral attack, which can influence the dominance and biodiversity of bacterial species in coastal waters. PMID:26404394

  13. Effects of viruses on bacterial functions under contrasting nutritional conditions for four species of bacteria isolated from Hong Kong waters

    NASA Astrophysics Data System (ADS)

    Liu, Hao; Yuan, Xiangcheng; Xu, Jie; Harrison, Paul J.; He, Lei; Yin, Kedong

    2015-09-01

    Free living viruses are ubiquitous in marine waters and concentrations are usually several times higher than the bacterial abundance. These viruses are capable of lysing host bacteria and therefore, play an important role in the microbial loop in oligotrophic waters. However, few studies have been conducted to compare the role of viruses in regulating bacterial abundance and heterotrophic activities between natural oligotrophic waters and anthropogenic influenced eutrophic waters. In this study, we examined viral effects on bacterial functions of four single bacterial species incubated with natural viral assemblages in seawater samples from eutrophic and oligotrophic waters. The viral-lysis of bacteria was significantly higher in eutrophic than oligotrophic waters. This suggests that viruses were capable of controlling bacterial abundance, respiration and production in the eutrophic waters. Cellular bacterial respiration and production was higher with viruses than without viruses, which was more evident in the oligotrophic waters. These results indicate that viruses can slow down bacterial consumption of oxygen and reduce bacteria-induced eutrophication effects in anthropogenic eutrophic waters, but switch to the role of sustaining the bacterial population when nutrients are limiting. There were bacterial species differences in resisting viral attack, which can influence the dominance and biodiversity of bacterial species in coastal waters.

  14. Effects of viruses on bacterial functions under contrasting nutritional conditions for four species of bacteria isolated from Hong Kong waters.

    PubMed

    Liu, Hao; Yuan, Xiangcheng; Xu, Jie; Harrison, Paul J; He, Lei; Yin, Kedong

    2015-09-25

    Free living viruses are ubiquitous in marine waters and concentrations are usually several times higher than the bacterial abundance. These viruses are capable of lysing host bacteria and therefore, play an important role in the microbial loop in oligotrophic waters. However, few studies have been conducted to compare the role of viruses in regulating bacterial abundance and heterotrophic activities between natural oligotrophic waters and anthropogenic influenced eutrophic waters. In this study, we examined viral effects on bacterial functions of four single bacterial species incubated with natural viral assemblages in seawater samples from eutrophic and oligotrophic waters. The viral-lysis of bacteria was significantly higher in eutrophic than oligotrophic waters. This suggests that viruses were capable of controlling bacterial abundance, respiration and production in the eutrophic waters. Cellular bacterial respiration and production was higher with viruses than without viruses, which was more evident in the oligotrophic waters. These results indicate that viruses can slow down bacterial consumption of oxygen and reduce bacteria-induced eutrophication effects in anthropogenic eutrophic waters, but switch to the role of sustaining the bacterial population when nutrients are limiting. There were bacterial species differences in resisting viral attack, which can influence the dominance and biodiversity of bacterial species in coastal waters.

  15. RT-PCR–DGGE Analysis to Elucidate the Dominant Bacterial Species of Industrial Spanish-Style Green Table Olive Fermentations

    PubMed Central

    Benítez-Cabello, Antonio; Bautista-Gallego, Joaquín; Garrido-Fernández, Antonio; Rantsiou, Kalliopi; Cocolin, Luca; Jiménez-Díaz, Rufino; Arroyo-López, Francisco N.

    2016-01-01

    This paper describes the dominant bacterial species metabolically active through the industrial production of Spanish-style Manzanilla and Gordal olives. For this purpose, samples (brines and fruits) obtained at 0, 15, and 90 fermentation days were analyzed by a culture-independent approach to determine viable cells by reverse transcription of RNA and further PCR-DGGE analysis, detecting at least 7 different species. Vibrio vulnificus, Lactobacillus plantarum group, and Lactobacillus parafarraginis were present in samples from both cultivars; Lactobacillus sanfranciscensis and Halolactobacillus halophilus were detected only in Gordal samples, while Staphylococcus sp. was exclusively found at the onset of Manzanilla fermentations. Physicochemical data showed a typical fermentation profile while scanning electron microscopy confirmed the in situ biofilm formation on the olive epidermis. Different Bacillus, Staphylococcus, and Enterococcus species, not detected during the fermentation process, were also found in the solid marine salt used by the industry for preparation of brines. Elucidation of these non-lactic acid bacteria species role during fermentation is then an appealingly challenge, particularly regarding safety issues. PMID:27582739

  16. Yeast and bacterial diversity along a transect in an acidic, As-Fe rich environment revealed by cultural approaches.

    PubMed

    Delavat, François; Lett, Marie-Claire; Lièvremont, Didier

    2013-10-01

    Acid mine drainages (AMDs) are often thought to harbour low biodiversity, yet little is known about the diversity distribution along the drainages. Using culture-dependent approaches, the microbial diversity from the Carnoulès AMD sediment was investigated for the first time along a transect showing progressive environmental stringency decrease. In total, 20 bacterial genera were detected, highlighting a higher bacterial diversity than previously thought. Moreover, this approach led to the discovery of 16 yeast species, demonstrating for the first time the presence of this important phylogenetic group in this AMD. All in all, the location of the microbes along the transect helps to better understand their distribution in a pollution gradient.

  17. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  18. N-Acetyl-L-cysteine Effects on Multi-species Oral Biofilm Formation and Bacterial Ecology

    PubMed Central

    Rasmussen, Karin; Nikrad, Julia; Reilly, Cavan; Li, Yuping; Jones, Robert S.

    2015-01-01

    Future therapies for the treatment of dental decay have to consider the importance of preserving bacterial ecology while reducing biofilm adherence to teeth. A multi-species plaque derived (MSPD) biofilm model was used to assess how concentrations of N-acetyl-L-cysteine (0, 0.1%, 1%, 10%) affected the growth of complex oral biofilms. Biofilms were grown (n=96) for 24 hours on hydroxyapatite disks in BMM media with 0.5% sucrose. Bacterial viability and biomass formation was examined on each disk using a microtiter plate reader. In addition, fluorescence microscopy and Scanning Electron Microscopy was used to qualitatively examine the effect of NAC on bacterial biofilm aggregation, extracellular components, and bacterial morphology. The total biomass was significantly decreased after exposure of both 1% (from 0.48, with a 95% confidence interval of (0.44, 0.57) to 0.35, with confidence interval (0.31, 0.38)) and 10% NAC (0.14 with confidence interval (0.11, 0.17)). 16S rRNA amplicon sequencing analysis indicated that 1% NAC reduced biofilm adherence while preserving biofilm ecology. PMID:26518358

  19. Bacterial community structure in freshwater springs infested with the invasive plant species Hydrilla verticillata

    PubMed Central

    Gordon-Bradley, N.; Li, N.

    2015-01-01

    The phylogenetic composition and physiological profiles of bacterial communities in freshwater springs were evaluated during the blooming and non-blooming stages of the invasive plant species, Hydrilla verticillata. Community-level physiological profiles (CLPPs) and pyrosequencing of 16S rRNA gene amplicons were used to study potential Hydrilla mediated shifts in the physiological potential and phylogenetic composition of the bacterial community in infested systems. The results of CLPP revealed that the microbes in the Hydrilla invaded sites utilized less substrates during blooming periods than during nonblooming periods of the plant. Spearman’s rank correlation analysis showed some relationships between the relative abundances of bacterial taxa and the Biolog substrate utilization pattern. The relative abundance of the identified taxa showed some striking differences based on the blooming status of Hydrilla and to a lesser extent on site variation. The relative abundance of Actinobacteria, Bacteriodetes, and Verrucomicrobia was generally higher during Hydrilla blooms, while Deltaproteobacteria was generally higher during non-blooming stages of Hydrilla. The detected genera also varied based on the blooming stages of the plant. Based on the findings, it appears that Hydrilla alters the phylogenetic composition and structure of the bacterial community during the blooming stage. PMID:26207069

  20. Isolation and characterization of novel phorate-degrading bacterial species from agricultural soil.

    PubMed

    Jariyal, Monu; Gupta, V K; Mandal, Kousik; Jindal, Vikas; Banta, Geetika; Singh, Balwinder

    2014-02-01

    Based upon 16S rDNA sequence homology, 15 phorate-degrading bacteria isolated from sugarcane field soils by selective enrichment were identified to be different species of Bacillus, Pseudomonas, Brevibacterium, and Staphylococcus. Relative phorate degradation in a mineral salt medium containing phorate (50 μg ml(-1)) as sole carbon source established that all the bacterial species could actively degrade more than 97 % phorate during 21 days. Three of these species viz. Bacillus aerophilus strain IMBL 4.1, Brevibacterium frigoritolerans strain IMBL 2.1, and Pseudomonas fulva strain IMBL 5.1 were found to be most active phorate metabolizers, degrading more than 96 % phorate during 2 days and 100 % phorate during 13 days. Qualitative analysis of phorate residues by gas liquid chromatography revealed complete metabolization of phorate without detectable accumulation of any known phorate metabolites. Phorate degradation by these bacterial species did not follow the first-order kinetics except the P. fulva strain IMBL 5.1 with half-life period (t1/2) ranging between 0.40 and 5.47 days.

  1. Cold temperature decreases bacterial species richness in nitrogen-removing bioreactors treating inorganic mine waters.

    PubMed

    Karkman, A; Mattila, K; Tamminen, M; Virta, M

    2011-12-01

    Explosives used in mining, such as ammonium nitrate fuel oil (ANFO), can cause eutrophication of the surrounding environment by leakage of ammonium and nitrate from undetonated material that is not properly treated. Cold temperatures in mines affect nitrogen removal from water when such nutrients are treated with bioreactors in situ. In this study we identified bacteria in the bioreactors and studied the effect of temperature on the bacterial community. The bioreactors consisted of sequential nitrification and denitrification units running at either 5 or 10°C. One nitrification bioreactor running at 5°C was fed with salt spiked water. From the nitrification bioreactors, sequences from both ammonia- and nitrite-oxidizing bacteria were identified, but the species were distinct at different temperatures. The main nitrifiers in the lower temperature were closely related to the genera Nitrosospira and Candidatus Nitrotoga. 16S rRNA gene sequences closely related to halotolerant Nitrosomonas eutropha were found only from the salt spiked nitrification bioreactor. At 10°C the genera Nitrosomonas and Nitrospira were the abundant nitrifiers. The results showed that bacterial species richness estimates were low, <150 operational taxonomic units (OTUs), in all bioreactor clone libraries, when sequences were assigned to operational taxonomic units at an evolutionary distance of 0.03. The only exception was the nitrification bioreactor running at 10°C where species richness was higher, >300 OTUs. Species richness was lower in bioreactors running at 5°C compared to those operating at 10°C.

  2. A New Species of Pristionchus (Rhabditida: Diplogastridae) and Its Bacterial Symbiont from Yixing, China

    PubMed Central

    Li, Pengpeng; Dai, Chensheng; Bao, Haoran; Chen, Long; Gao, Di; Wang, Guoxiang; Wang, Jin; Wang, Hui; Yedid, Gabriel; Zhang, Keyun

    2015-01-01

    A new nematode species, Pristionchus entomophilus n. sp., was collected during a soil sample survey in Yixing of Jiangsu province, eastern China. P. entomophilus n. sp. is distinguished by its unique characteristics. This new species is mainly hermaphroditic, with males seldom found. The new nematode has a similar body length but has much narrower body width compared with P. pacificus. Its body is covered with longitudinal ridges: 12 ridges on head, 13 or 14 ridges in the middle, 11 and 7 ridges in front and rear of the anus, respectively. The eurystomatous form mouth includes a triangular dorsal tooth, a large claw-like right subventral tooth, and a row of five ventral denticles placed opposite the dorsal tooth. Only eight pairs of genital papillae and a pair of phasmids are present in the tail of the male as the sixth pair of papillae having seemingly been degenerated and lost. Molecular phylogenetic trees based on 18S rDNA confirmed that the new species belongs to the genus Pristionchus and is most closely related to P. pacificus. Moreover, the new species was found to be occasionally associated with the entomopathogenic bacterial strain 09FLYB1 of Serratia nematodophila and be able to stably transfer the bacterial strain for several generations. PMID:26527840

  3. RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids

    PubMed Central

    Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A

    2012-01-01

    Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150

  4. Intra- and inter-species interactions within biofilms of important foodborne bacterial pathogens

    PubMed Central

    Giaouris, Efstathios; Heir, Even; Desvaux, Mickaël; Hébraud, Michel; Møretrø, Trond; Langsrud, Solveig; Doulgeraki, Agapi; Nychas, George-John; Kačániová, Miroslava; Czaczyk, Katarzyna; Ölmez, Hülya; Simões, Manuel

    2015-01-01

    A community-based sessile life style is the normal mode of growth and survival for many bacterial species. Under such conditions, cell-to-cell interactions are inevitable and ultimately lead to the establishment of dense, complex and highly structured biofilm populations encapsulated in a self-produced extracellular matrix and capable of coordinated and collective behavior. Remarkably, in food processing environments, a variety of different bacteria may attach to surfaces, survive, grow, and form biofilms. Salmonella enterica, Listeria monocytogenes, Escherichia coli, and Staphylococcus aureus are important bacterial pathogens commonly implicated in outbreaks of foodborne diseases, while all are known to be able to create biofilms on both abiotic and biotic surfaces. Particularly challenging is the attempt to understand the complexity of inter-bacterial interactions that can be encountered in such unwanted consortia, such as competitive and cooperative ones, together with their impact on the final outcome of these communities (e.g., maturation, physiology, antimicrobial resistance, virulence, dispersal). In this review, up-to-date data on both the intra- and inter-species interactions encountered in biofilms of these pathogens are presented. A better understanding of these interactions, both at molecular and biophysical levels, could lead to novel intervention strategies for controlling pathogenic biofilm formation in food processing environments and thus improve food safety. PMID:26347727

  5. Bacterial colonization and extinction on marine aggregates: stochastic model of species presence and abundance

    PubMed Central

    Kramer, Andrew M; Lyons, M Maille; Dobbs, Fred C; Drake, John M

    2013-01-01

    Organic aggregates provide a favorable habitat for aquatic microbes, are efficiently filtered by shellfish, and may play a major role in the dynamics of aquatic pathogens. Quantifying this role requires understanding how pathogen abundance in the water and aggregate size interact to determine the presence and abundance of pathogen cells on individual aggregates. We build upon current understanding of the dynamics of bacteria and bacterial grazers on aggregates to develop a model for the dynamics of a bacterial pathogen species. The model accounts for the importance of stochasticity and the balance between colonization and extinction. Simulation results suggest that while colonization increases linearly with background density and aggregate size, extinction rates are expected to be nonlinear on small aggregates in a low background density of the pathogen. Under these conditions, we predict lower probabilities of pathogen presence and reduced abundance on aggregates compared with predictions based solely on colonization. These results suggest that the importance of aggregates to the dynamics of aquatic bacterial pathogens may be dependent on the interaction between aggregate size and background pathogen density, and that these interactions are strongly influenced by ecological interactions and pathogen traits. The model provides testable predictions and can be a useful tool for exploring how species-specific differences in pathogen traits may alter the effect of aggregates on disease transmission. PMID:24340173

  6. Korean indigenous bacterial species with valid names belonging to the phylum Actinobacteria.

    PubMed

    Bae, Kyung Sook; Kim, Mi Sun; Lee, Ji Hee; Kang, Joo Won; Kim, Dae In; Lee, Ji Hee; Seong, Chi Nam

    2016-12-01

    , Gyeonggi, Jeonnam, Daejeon, and Chungnam. A large number of novel actinobacterial species continue to be discovered since the Korean government is encouraging the search for new bacterial species and researchers are endeavoring to find out novel strains from extreme or untapped environments.

  7. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  8. Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo

    PubMed Central

    McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda

    2016-01-01

    ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099

  9. Evolution of the bacterial species Lactobacillus delbrueckii: a partial genomic study with reflections on prokaryotic species concept.

    PubMed

    Germond, Jacques-Edouard; Lapierre, Luciane; Delley, Michèle; Mollet, Beat; Felis, Giovanna E; Dellaglio, Franco

    2003-01-01

    The species Lactobacillus delbrueckii consists at present of three subspecies, delbrueckii, lactis and bulgaricus, showing a high level of DNA-DNA hybridization similarity but presenting markedly different traits related to distinct ecological adaptation. The internal genetic heterogeneity of the bacterial species L. delbrueckii was analyzed. Phenotypic and several genetic traits were investigated for 61 strains belonging to this species. These included 16S rDNA sequence mutations, expression of beta-galactosidase and of the cell wall-anchored protease, the characterization of the lactose operon locus and of the sequence of lacR gene, galactose metabolism, and the distribution of insertion sequences. The high genetic heterogeneity of taxa was confirmed by every trait investigated: the lac operon was completely deleted in the subsp. delbrueckii, different mutation events in the repressor gene of the operon led to a constitutive expression of lacZ in the subsp. bulgaricus. Structural differences in the same genetic locus were probably due to the presence of different IS elements in the flanking regions. The different expression of the cell wall-anchored protease, constitutive in the subsp. bulgaricus, inducible in the subsp. lactis, and absent in the subsp. delbrueckii was also a consequence of mutations at the gene level. The galT gene for galactose metabolism was found only in the subsp. lactis, while no specific amplification product was detected in the other two subspecies. All these data, together with the absence of a specific IS element, ISL6, from the major number of strains belonging to the subsp. bulgaricus, confirmed a deep internal heterogeneity among the three subspecies. Moreover, this evidence and the directional mutations found in the 16S rDNA sequences suggested that, of the three subspecies, L. delbrueckii subsp. lactis is the taxon closer to the ancestor. Limitations of the current prokaryotic species definition were also discussed, based on

  10. Life history correlates of fecal bacterial species richness in a wild population of the blue tit Cyanistes caeruleus.

    PubMed

    Benskin, Clare McW H; Rhodes, Glenn; Pickup, Roger W; Mainwaring, Mark C; Wilson, Kenneth; Hartley, Ian R

    2015-02-01

    Very little is known about the normal gastrointestinal flora of wild birds, or how it might affect or reflect the host's life-history traits. The aim of this study was to survey the species richness of bacteria in the feces of a wild population of blue tits Cyanistes caeruleus and to explore the relationships between bacterial species richness and various life-history traits, such as age, sex, and reproductive success. Using PCR-TGGE, 55 operational taxonomic units (OTUs) were identified in blue tit feces. DNA sequencing revealed that the 16S rRNA gene was amplified from a diverse range of bacteria, including those that shared closest homology with Bacillus licheniformis, Campylobacter lari, Pseudomonas spp., and Salmonella spp. For adults, there was a significant negative relationship between bacterial species richness and the likelihood of being detected alive the following breeding season; bacterial richness was consistent across years but declined through the breeding season; and breeding pairs had significantly more similar bacterial richness than expected by chance alone. Reduced adult survival was correlated with the presence of an OTU most closely resembling C. lari; enhanced adult survival was associated with an OTU most similar to Arthrobacter spp. For nestlings, there was no significant change in bacterial species richness between the first and second week after hatching, and nestlings sharing the same nest had significantly more similar bacterial richness. Collectively, these results provide compelling evidence that bacterial species richness was associated with several aspects of the life history of their hosts.

  11. Host and Environmental Specificity in Bacterial Communities Associated to Two Highly Invasive Marine Species (Genus Asparagopsis)

    PubMed Central

    Aires, Tânia; Serrão, Ester A.; Engelen, Aschwin H.

    2016-01-01

    As habitats change due to global and local pressures, population resilience, and adaptive processes depend not only on their gene pools but also on their associated bacteria communities. The hologenome can play a determinant role in adaptive evolution of higher organisms that rely on their bacterial associates for vital processes. In this study, we focus on the associated bacteria of the two most invasive seaweeds in southwest Iberia (coastal mainland) and nearby offshore Atlantic islands, Asparagopsis taxiformis and Asparagopsis armata. Bacterial communities were characterized using 16S rRNA barcoding through 454 next generation sequencing and exploratory shotgun metagenomics to provide functional insights and a backbone for future functional studies. The bacterial community composition was clearly different between the two species A. taxiformis and A. armata and between continental and island habitats. The latter was mainly due to higher abundances of Acidimicrobiales, Sphingomonadales, Xanthomonadales, Myxococcales, and Alteromonadales on the continent. Metabolic assignments for these groups contained a higher number of reads in functions related to oxidative stress and resistance to toxic compounds, more precisely heavy metals. These results are in agreement with their usual association with hydrocarbon degradation and heavy-metals detoxification. In contrast, A. taxiformis from islands contained more bacteria related to oligotrophic environments which might putatively play a role in mineralization of dissolved organic matter. The higher number of functional assignments found in the metagenomes of A. taxiformis collected from Cape Verde Islands suggest a higher contribution of bacteria to compensate nutrient limitation in oligotrophic environments. Our results show that Asparagopsis-associated bacterial communities have host-specificity and are modulated by environmental conditions. Whether this environmental effect reflects the host's selective requirements or

  12. Isolation of a lead tolerant novel bacterial species, Achromobacter sp. TL-3: assessment of bioflocculant activity.

    PubMed

    Batta, Neha; Subudhi, Sanjukta; Lal, Banwari; Devi, Arundhuti

    2013-11-01

    Lead is one of the four heavy metals that has a profound damaging effects on human health. In the recent past there has been an increasing global concern for development of sustainable bioremediation technologies for detoxification of lead contaminant. Present investigation highlights for lead biosorption by a newly isolated novel bacterial species; Achromobacter sp. TL-3 strain, isolated from activated sludge samples contaminated with heavy metals (collected from oil refinery, Assam, North-East India). For isolation of lead tolerant bacteria, sludge samples were enriched into Luria Broth medium supplemented separately with a range of lead nitrate; 250, 500, 750, 1000, 1250 and 1500 ppm respectively. The bacterial consortium that could tolerate 1500 ppm of lead nitrate was selected further for purification of lead tolerant bacterial isolates. Purified lead tolerant bacterial isolates were then eventually inoculated into production medium supplemented with ethanol and glycerol as carbon and energy source to investigate for bioflocculant production. Bioflocculant production was estimated by monitoring the potential of lead tolerant bacterial isolate to flocculate Kaolin clay in presence of 1% CaCl2. Compared to other isolates, TL-3 isolate demonstrated for maximum bioflocculant activity of 95% and thus was identified based on 16S rRNA gene sequence analysis. TL3 isolate revealed maximum homology (98%) with Achromobacter sp. and thus designated as Achromobacter sp. TL-3. Bioflocculant activity of TL-3 isolate was correlated with the change in pH and growth. Achromobacter sp. TL-3 has significant potential for lead biosorption and can be effectively employed for detoxification of lead contaminated waste effluents/waste waters.

  13. Bacterial conversion of phenylalanine and aromatic carboxylic acids into dihydrodiols.

    PubMed Central

    Wegst, W; Tittmann, U; Eberspächer, J; Lingens, F

    1981-01-01

    Strain E of chloridazon-degrading bacteria, when grown on L-phenylalanine accumulates cis-2,3-dihydro-2,3-dihydroxyphenylalanine. In experiments with resting cells and during growth the bacterium converts the aromatic carboxylic acids phenylacetate, phenylpropionate, phenylbutyrate and phenyl-lactate into the corresponding cis-2,3-dihydrodiol compounds. The amino acids L-phenylalanine, N-acetyl-L-phenylalanine and t-butyloxycarbonyl-L-phenylalanine were also transformed into dihydrodiols. All seven dihydrodiols, thus obtained, were characterized both by conventional analytical techniques and by the ability to serve as substrates for a cis-dihydrodiol dehydrogenase. PMID:7306016

  14. Bacterial conversion of phenylalanine and aromatic carboxylic acids into dihydrodiols.

    PubMed

    Wegst, W; Tittmann, U; Eberspächer, J; Lingens, F

    1981-03-15

    Strain E of chloridazon-degrading bacteria, when grown on L-phenylalanine accumulates cis-2,3-dihydro-2,3-dihydroxyphenylalanine. In experiments with resting cells and during growth the bacterium converts the aromatic carboxylic acids phenylacetate, phenylpropionate, phenylbutyrate and phenyl-lactate into the corresponding cis-2,3-dihydrodiol compounds. The amino acids L-phenylalanine, N-acetyl-L-phenylalanine and t-butyloxycarbonyl-L-phenylalanine were also transformed into dihydrodiols. All seven dihydrodiols, thus obtained, were characterized both by conventional analytical techniques and by the ability to serve as substrates for a cis-dihydrodiol dehydrogenase.

  15. Mineral Types and Tree Species Determine the Functional and Taxonomic Structures of Forest Soil Bacterial Communities.

    PubMed

    Colin, Y; Nicolitch, O; Turpault, M-P; Uroz, S

    2017-03-01

    mineralogy influences the diversity, structure, and function of soil bacterial communities in relation to the soil conditions is crucial to better understanding the relative role of the soil bacterial communities in nutrient cycling and plant nutrition in nutrient-poor environments. The present study determined in detail the diversity and structure of bacterial communities associated with different mineral types incubated for 2.5 years in the soil under different tree species using cultivation-dependent and -independent analyses. Our data showed an enrichment of specific bacterial taxa on the minerals, specifically on the most weathered minerals, suggesting that they play key roles in mineral weathering and nutrient cycling in nutrient-poor forest ecosystems.

  16. Bacterial growth rates are influenced by cellular characteristics of individual species when immersed in electromagnetic fields.

    PubMed

    Tessaro, Lucas W E; Murugan, Nirosha J; Persinger, Michael A

    2015-03-01

    Previous studies have shown that exposure to extremely low-frequency electromagnetic fields (ELF-EMFs) have negative effects on the rate of growth of bacteria. In the present study, two Gram-positive and two Gram-negative species were exposed to six magnetic field conditions in broth cultures. Three variations of the 'Thomas' pulsed frequency-modulated pattern; a strong-static "puck" magnet upwards of 5000G in intensity; a pair of these magnets rotating opposite one another at ∼30rpm; and finally a strong dynamic magnetic field generator termed the 'Resonator' with an average intensity of 250μT were used. Growth rate was discerned by optical density (OD) measurements every hour at 600nm. ELF-EMF conditions significantly affected the rates of growth of the bacterial cultures, while the two static magnetic field conditions were not statistically significant. Most interestingly, the 'Resonator' dynamic magnetic field increased the rates of growth of three species (Staphylococcus epidermidis, Staphylococcus aureus, and Escherichia coli), while slowing the growth of one (Serratia marcescens). We suggest that these effects are due to individual biophysical characteristics of the bacterial species.

  17. A general method for rapid determination of antibiotic susceptibility and species in bacterial infections.

    PubMed

    Mezger, Anja; Gullberg, Erik; Göransson, Jenny; Zorzet, Anna; Herthnek, David; Tano, Eva; Nilsson, Mats; Andersson, Dan I

    2015-02-01

    To ensure correct antibiotic treatment and reduce the unnecessary use of antibiotics, there is an urgent need for new rapid methods for species identification and determination of antibiotic susceptibility in infectious pathogenic bacteria. We have developed a general method for the rapid identification of the bacterial species causing an infection and the determination of their antibiotic susceptibility profiles. An initial short cultivation step in the absence and presence of different antibiotics was combined with sensitive species-specific padlock probe detection of the bacterial target DNA to allow a determination of growth (i.e., resistance) and no growth (i.e., susceptibility). A proof-of-concept was established for urinary tract infections in which we applied the method to determine the antibiotic susceptibility profiles of Escherichia coli for two drugs with 100% accuracy in 3.5 h. The short assay time from sample to readout enables fast appropriate treatment with effective drugs and minimizes the need to prescribe broad-spectrum antibiotics due to unknown resistance profiles of the treated infection.

  18. Isolation and identification of bacterial endophytes from pharmaceutical agarwood-producing Aquilaria species

    PubMed Central

    Bhore, Subhash J.; Preveena, Jagadesan; Kandasamy, Kodi I.

    2013-01-01

    Background: Resins and gums are used in traditional medicine and do have potential applications in pharmacy and medicine. Agarwood is the fragrant resinous wood, which is an important commodity from Aquilaria species and has been used as a sedative, analgesic, and digestive in traditional medicine. Endophytic bacteria are potentially important in producing pharmaceutical compounds found in the plants. Hence, it was important to understand which types of endophytic bacteria are associated with pharmaceutical agarwood-producing Aquilaria species. Objective: This study was undertaken to isolate and identify endophytic bacteria associated with agarwood-producing seven (7) Aquilaria species from Malaysia. Materials and Methods: Botanical samples of seven Aquilaria species were collected, and endophytic bacteria were isolated from surface-sterilized-tissue samples. The 16S rRNA gene fragments were amplified using PCR method, and endophytic bacterial isolates (EBIs) were identified based on 16S rRNA gene sequence similarity based method. Results: Culturable, 77 EBIs were analyzed, and results of 16S rRNA gene sequences analysis suggest that 18 different types of endophytic bacteria are associated with (seven) Aquilaria species. From 77 EBIs, majority (36.4%) of the isolates were of Bacillus pumilus. Conclusion: These findings indicate that agarwood-producing Aquilaria species are harboring 18 different types of culturable endophytic bacteria. PMID:23798890

  19. Effects of remediation on the bacterial community of an acid mine drainage impacted stream.

    PubMed

    Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G

    2012-11-01

    Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage.

  20. Analysis of Known Bacterial Protein Vaccine Antigens Reveals Biased Physical Properties and Amino Acid Composition

    PubMed Central

    Mayers, Carl; Rowe, Sonya; Miller, Julie; Lingard, Bryan; Hayward, Sarah; Titball, Richard W.

    2003-01-01

    Many vaccines have been developed from live attenuated forms of bacterial pathogens or from killed bacterial cells. However, an increased awareness of the potential for transient side-effects following vaccination has prompted an increased emphasis on the use of sub-unit vaccines, rather than those based on whole bacterial cells. The identification of vaccine sub-units is often a lengthy process and bioinformatics approaches have recently been used to identify candidate protein vaccine antigens. Such methods ultimately offer the promise of a more rapid advance towards preclinical studies with vaccines. We have compared the properties of known bacterial vaccine antigens against randomly selected proteins and identified differences in the make-up of these two groups. A computer algorithm that exploits these differences allows the identification of potential vaccine antigen candidates from pathogenic bacteria on the basis of their amino acid composition, a property inherently associated with sub-cellular location. PMID:18629010

  1. Diagnosis of bacterial vaginosis by a new multiplex peptide nucleic acid fluorescence in situ hybridization method

    PubMed Central

    Machado, António; Castro, Joana; Cereija, Tatiana; Almeida, Carina

    2015-01-01

    Bacterial vaginosis (BV) is one of most common vaginal infections. However, its diagnosis by classical methods reveals low specificity. Our goal was to evaluate the accuracy diagnosis of 150 vaginal samples with research gold standard methods and our Peptide Nucleic Acid (PNA) probes by Fluorescence in situ Hybridization (FISH) methodology. Also, we described the first PNA-FISH methodology for BV diagnosis, which provides results in approximately 3 h. The results showed a sensitivity of 84.6% (95% confidence interval (CI), from 64.3 to 95.0%) and a specificity of 97.6% (95% CI [92.6–99.4%]), demonstrating the higher specificity of the PNA-FISH method and showing false positive results in BV diagnosis commonly obtained by the classical methods. This methodology combines the specificity of PNA probes for Lactobacillus species and G. vaginalis visualization and the calculation of the microscopic field by Nugent score, allowing a trustful evaluation of the bacteria present in vaginal microflora and avoiding the occurrence of misleading diagnostics. Therefore, the PNA-FISH methodology represents a valuable alternative for BV diagnosis. PMID:25737820

  2. Role of lauric acid-potassium hydroxide concentration on bacterial contamination of spray washed broiler carcasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A series of experiments were conducted to examine reductions in bacterial contamination of broiler carcasses washed in a spray cabinet with various concentrations of lauric acid (LA)-potassium hydroxide (KOH) solutions. Fifty eviscerated carcasses and 5 ceca were obtained from the processing line of...

  3. Aryl hydrocarbon receptor protects against bacterial infection by promoting macrophage survival and reactive oxygen species production.

    PubMed

    Kimura, Akihiro; Abe, Hiromi; Tsuruta, Sanae; Chiba, Sayuri; Fujii-Kuriyama, Yoshiaki; Sekiya, Takashi; Morita, Rimpei; Yoshimura, Akihiko

    2014-04-01

    Aryl hydrocarbon receptor (AhR) is crucial for various immune responses. The relationship between AhR and infection with the intracellular bacteria Listeria monocytogenes (LM) is poorly understood. Here, we show that in response to LM infection, AhR is required for bacterial clearance by promoting macrophage survival and reactive oxygen species (ROS) production. AhR-deficient mice were more susceptible to listeriosis, and AhR deficiency enhances bacterial growth in vivo and in vitro. On the other hand, pro-inflammatory cytokines were increased in AhR-deficient macrophages infected with LM despite enhanced susceptibility to LM infection in AhR-deficient mice. Subsequent studies demonstrate that AhR protects against macrophage cell death induced by LM infection through the induction of the antiapoptotic factor, the apoptosis inhibitor of macrophages, which promotes macrophage survival in the setting of LM infection. Furthermore, AhR promotes ROS production for bacterial clearance. Our results demonstrate that AhR is essential to the resistance against LM infection as it promotes macrophage survival and ROS production. This suggests that the activation of AhR by its ligands may be an effective strategy against listeriosis.

  4. Photoinactivation of Eight Health-Relevant Bacterial Species: Determining the Importance of the Exogenous Indirect Mechanism.

    PubMed

    Maraccini, Peter A; Wenk, Jannis; Boehm, Alexandria B

    2016-05-17

    It is presently unknown to what extent the endogenous direct, endogenous indirect, and exogenous indirect mechanisms contribute to bacterial photoinactivation in natural surface waters. In this study, we investigated the importance of the exogenous indirect mechanism by conducting photoinactivation experiments with eight health-relevant bacterial species (Bacteroides thetaiotaomicron, Campylobacter jejuni, Enterococcus faecalis, Escherichia coli K12, E. coli O157:H7, Salmonella enterica serovar Typhimurium LT2, Staphylococcus aureus, and Streptococcus bovis). We used three synthetic photosensitizers (methylene blue, rose bengal, and nitrite) and two model natural photosensitizers (Suwannee River natural organic matter and dissolved organic matter isolated from a wastewater treatment wetland) that generated singlet oxygen and hydroxyl radical. B. thetaiotaomicron had larger first order rate constants than all other organisms under all conditions tested. The presence of the synthetic photosensitizers generally enhanced photoinactivation of Gram-positive facultative anaerobes (Ent. faecalis, Staph. aureus, and Strep. bovis). Among Gram-negative bacteria, only methylene blue with E. coli K12 and rose bengal with C. jejuni showed an enhancing effect. The presence of model natural photosensitizers either reduced or did not affect photoinactivation rate constants. Our findings highlight the importance of the cellular membrane and photosensitizer properties in modulating the contribution of the exogenous indirect mechanism to the overall bacterial photoinactivation.

  5. Hydroxytyrosol from tyrosol using hydroxyphenylacetic acid-induced bacterial cultures and evidence of the role of 4-HPA 3-hydroxylase.

    PubMed

    Liebgott, Pierre-Pol; Amouric, Agnès; Comte, Alexia; Tholozan, Jean-Luc; Lorquin, Jean

    2009-12-01

    Hydroxytyrosol (HTyr) is a potent natural antioxidant found in olive mill wastewaters. Bacterial conversion of 4-tyrosol (2-(4-hydroxyphenyl)-ethanol) to HTyr was reported in a limited number of bacterial species including Pseudomonas aeruginosa. In this work, we studied this conversion, taking as a model the newly isolated Halomonas sp. strain HTB24. It was first hypothesized that the enzyme responsible for 4-tyrosol hydroxylation in HTyr was a 4-hydroxyphenylacetic acid 3-hydroxylase (HPAH, EC 1.14.13.3), previously known to convert 4-hydroxyphenylacetic acid (4-HPA) into 3,4-dihydroxyphenylacetic acid (3,4-DHPA) in P. aeruginosa. Cloning and expression of hpaB (oxygenase component) and hpaC (reductase component) genes from P. aeruginosa confirmed this hypothesis. Furthermore, using cultures of HTB24 containing 4-tyrosol, it was shown that 4-HPA accumulation preceded 4-tyrosol hydroxylation. We further demonstrated that the synthesis of HPAH activity was induced by 4-HPA, with the latter compound being formed from 4-tyrosol oxidation by aryl-dehydrogenases. Interestingly, similar results were obtained with other 4-HPA-induced bacteria, including P. aeruginosa, Serratia marcescens, Escherichia coli, Micrococcus luteus and other Halomonas, thus demonstrating general hydroxylating activity of 4-tyrosol by the HPAH enzyme. E. coli W did not have aryl-dehydrogenase activity and hence were unable to oxidize 4-tyrosol to 4-HPA and HTyr to 3,4-DHPA, making this bacterium a good candidate for achieving better HTyr production.

  6. Structural variation and inhibitor binding in polypeptide deformylase from four different bacterial species.

    PubMed

    Smith, Kathrine J; Petit, Chantal M; Aubart, Kelly; Smyth, Martin; McManus, Edward; Jones, Jo; Fosberry, Andrew; Lewis, Ceri; Lonetto, Michael; Christensen, Siegfried B

    2003-02-01

    Polypeptide deformylase (PDF) catalyzes the deformylation of polypeptide chains in bacteria. It is essential for bacterial cell viability and is a potential antibacterial drug target. Here, we report the crystal structures of polypeptide deformylase from four different species of bacteria: Streptococcus pneumoniae, Staphylococcus aureus, Haemophilus influenzae, and Escherichia coli. Comparison of these four structures reveals significant overall differences between the two Gram-negative species (E. coli and H. influenzae) and the two Gram-positive species (S. pneumoniae and S. aureus). Despite these differences and low overall sequence identity, the S1' pocket of PDF is well conserved among the four enzymes studied. We also describe the binding of nonpeptidic inhibitor molecules SB-485345, SB-543668, and SB-505684 to both S. pneumoniae and E. coli PDF. Comparison of these structures shows similar binding interactions with both Gram-negative and Gram-positive species. Understanding the similarities and subtle differences in active site structure between species will help to design broad-spectrum polypeptide deformylase inhibitor molecules.

  7. Bacterial species and their associations with acute and chronic mastitis in suckler ewes.

    PubMed

    Smith, E M; Willis, Z N; Blakeley, M; Lovatt, F; Purdy, K J; Green, L E

    2015-10-01

    Acute mastitis in suckler ewes is often detected because of systemic signs such as anorexia or lameness, whereas chronic mastitis, characterized by intramammary abscesses with no systemic disease, is typically detected when ewes are inspected before mating. The aims of the current study were to identify the species and strains of culturable bacteria associated with acutely diseased, chronically diseased, and unaffected mammary glands to investigate whether species and strains vary by state. To investigate acute mastitis, 28 milk samples were obtained from both glands of 14 ewes with acute mastitis in one gland only. To investigate chronic mastitis, 16 ovine udders were obtained from 2 abattoirs; milk was aspirated from the 32 glands where possible, and the udders were sectioned to expose intramammary abscesses, which were swab sampled. All milk and swab samples were cultured aerobically. In total, 37 bacterial species were identified, 4 from acute mastitis, 26 from chronic mastitis, and 8 from apparently healthy glands. In chronic mastitis, the overall coincidence index of overlap of species detected in intramammary abscesses and milk was 0.60, reducing to 0.36 within individual glands, indicating a high degree of species overlap in milk and abscesses overall, but less overlap within specific glands. Staphylococcus aureus was detected frequently in all sample types; it was isolated from 10/14 glands with acute mastitis. In 5 ewes, closely related strains were present in both affected and unaffected glands. In chronic mastitis, closely related Staphylococcus aureus strains were detected in milk and abscesses from the same gland.

  8. Bacterial species involved in the conversion of dietary flavonoids in the human gut

    PubMed Central

    Braune, Annett; Blaut, Michael

    2016-01-01

    ABSTRACT The gut microbiota plays a crucial role in the conversion of dietary flavonoids and thereby affects their health-promoting effects in the human host. The identification of the bacteria involved in intestinal flavonoid conversion has gained increasing interest. This review summarizes available information on the so far identified human intestinal flavonoid-converting bacterial species and strains as well as their enzymes catalyzing the underlying reactions. The majority of described species involved in flavonoid transformation are capable of carrying out the O-deglycosylation of flavonoids. Other bacteria cleave the less common flavonoid-C-glucosides and/or further degrade the aglycones of flavonols, flavanonols, flavones, flavanones, dihydrochalcones, isoflavones and monomeric flavan-3-ols. To increase the currently limited knowledge in this field, identification of flavonoid-converting bacteria should be continued using culture-dependent screening or isolation procedures and molecular approaches based on sequence information of the involved enzymes. PMID:26963713

  9. Novel rumen bacterial diversity in two geographically separated sub-species of reindeer.

    PubMed

    Sundset, Monica A; Praesteng, Kirsti E; Cann, Isaac K O; Mathiesen, Svein D; Mackie, Roderick I

    2007-10-01

    Svalbard reindeer (Rangifer tarandus platyrhynchus) live under austere nutritional conditions on the high-arctic archipelago of Svalbard, while semi-domesticated Norwegian reindeer (R. tarandus tarandus) migrate between lush coastal summer pastures and inland winter pastures with lichens on mainland Norway. Svalbard reindeer are known to have high rumen concentrations of cellulolytic bacteria, ranging from 15% of the viable population in summer to 35% in winter, compared to only 2.5% in Norwegian reindeer. Their rumen bacterial diversity was investigated through comparative analyses of 16S rRNA gene sequences ( approximately 1.5 kb in length) generated from clone libraries (n = 121) and bacterial isolates (n = 51). LIBSHUFF comparisons of the composition of the two 16S rRNA libraries from Norwegian reindeer showed a significant effect of artificial feeding compared to natural pasture, but failed to yield significant differences between libraries from Norwegian reindeer and Svalbard reindeer. The combined sequences from reindeer were not significantly different from those reported in wild Thompson's gazelle in Kenya but did differ from those reported in domestic cattle in Japan. A total of 90 distinct operational taxonomic units (OTUs) were identified by employing a criterion of 97% similarity, while the Chao1 index estimated the reindeer bacterial rumen population richness at 698 OTUs. The majority of the clone library sequences (92.5%) represented novel strains with <97% identity to any known sequence in the public database, most of them affiliated with the bacterial phylum Firmicutes (low G+C Gram-positives) related to the order Clostridiales (76.7%), while Gram-negative bacteria in the Bacteriodales (Prevotella-Bacteroides group) contributed to 22.5%. Also, six of the isolates were putatively novel strains, possibly representing new species in the Clostridium subphylum (cluster XIVa), Actinomyces and Butyrivibrio.

  10. Engineering Escherichia coli for biodiesel production utilizing a bacterial fatty acid methyltransferase.

    PubMed

    Nawabi, Parwez; Bauer, Stefan; Kyrpides, Nikos; Lykidis, Athanasios

    2011-11-01

    The production of low-cost biofuels in engineered microorganisms is of great interest due to the continual increase in the world's energy demands. Biodiesel is a renewable fuel that can potentially be produced in microbes cost-effectively. Fatty acid methyl esters (FAMEs) are a common component of biodiesel and can be synthesized from either triacylglycerol or free fatty acids (FFAs). Here we report the identification of a novel bacterial fatty acid methyltransferase (FAMT) that catalyzes the formation of FAMEs and 3-hydroxyl fatty acid methyl esters (3-OH-FAMEs) from the respective free acids and S-adenosylmethionine (AdoMet). FAMT exhibits a higher specificity toward 3-hydroxy free fatty acids (3-OH-FFAs) than FFAs, synthesizing 3-hydroxy fatty acid methyl esters (3-OH-FAMEs) in vivo. We have also identified bacterial members of the fatty acyl-acyl carrier protein (ACP) thioesterase (FAT) enzyme family with distinct acyl chain specificities. These bacterial FATs exhibit increased specificity toward 3-hydroxyacyl-ACP, generating 3-OH-FFAs, which can subsequently be utilized by FAMTs to produce 3-OH-FAMEs. PhaG (3-hydroxyacyl ACP:coenzyme A [CoA] transacylase) constitutes an alternative route to 3-OH-FFA synthesis; the coexpression of PhaG with FAMT led to the highest level of accumulation of 3-OH-FAMEs and FAMEs. The availability of AdoMet, the second substrate for FAMT, is an important factor regulating the amount of methyl esters produced by bacterial cells. Our results indicate that the deletion of the global methionine regulator metJ and the overexpression of methionine adenosyltransferase result in increased methyl ester synthesis.

  11. Bacterial Species- and Strain-Dependent Induction of Tissue Factor in Human Vascular Endothelial Cells

    PubMed Central

    Veltrop, M. H. A. M.; Beekhuizen, H.; Thompson, J.

    1999-01-01

    A cardinal process in bacterial endocarditis (BE) is the activation of the clotting system and the formation of a fibrin clot on the inner surface of the heart, the so-called endocardial vegetation. The processes that lead to the activation of the clotting system on endothelial surfaces upon exposure to bacteria are largely unknown. In the present study, we investigated in an in vitro model whether infection of human endothelial cells (EC) with bacteria that are relevant to BE, such as Staphylococcus aureus, Streptococcus sanguis, and Staphylococcus epidermidis, leads to induction of tissue factor (TF)-dependent procoagulant activity (TFA) and whether this process is influenced by host factors, such as interleukin-1 (IL-1), that are produced in response to the bacteremia in vivo. The results show that S. aureus binds to and is internalized by EC, resulting in expression of TF mRNA and TF surface protein as well as generation of TFA within 4 to 8 h after infection. No TFA was found when EC were exposed to UV-irradiated S. aureus or bacterial cell wall fragments. S. sanguis and S. epidermidis, although also binding to EC, did not induce endothelial TFA. This indicates a species and strain dependency. EC also expressed TFA after exposure to IL-1. The enhanced TFA of EC after exposure to S. aureus was not prevented by IL-1 receptor antagonist, arguing against an auto- or paracrine contribution of endogenous IL-1. When IL-1 was applied together with bacteria, this had a synergistic effect on the induction of EC TFA. This was found in particular with S. aureus but also, although to a lesser degree, with S. sanguis and S. epidermidis. This influence of IL-1 on the species- and strain-dependent induction of EC TFA suggests that bacterial factors as well as host factors orchestrate the induction of coagulation in an early stage in the pathogenesis of endovascular disease, such as BE. PMID:10531276

  12. Screening of species-specific lactic acid bacteria for veal calves multi-strain probiotic adjuncts.

    PubMed

    Ripamonti, Barbara; Agazzi, Alessandro; Bersani, Carla; De Dea, Paola; Pecorini, Chiara; Pirani, Silvia; Rebucci, Raffaella; Savoini, Giovanni; Stella, Simone; Stenico, Alberta; Tirloni, Erica; Domeneghini, Cinzia

    2011-06-01

    The selection of promising specific species of lactic acid bacteria with potential probiotic characteristics is of particular interest in producing multi species-specific probiotic adjuncts in veal calves rearing. The aim of the present work was to select and evaluate in vitro the functional activity of lactic acid bacteria, Bifidobacterium longum and Bacillus coagulans strains isolated from veal calves in order to assess their potential use as multi species-specific probiotics for veal calves. For this purpose, bacterial strains isolated from faeces collected from 40 healthy 50-day-calves, were identified by RiboPrinter and 16s rRNA gene sequence. The most frequent strains belonged to the species B. longum, Streptococcus bovis, Lactobacillus animalis and Streptococcus macedonicus. Among these, 7 strains were chosen for testing their probiotic characteristics in vitro. Three strains, namely L. animalis SB310, Lactobacillus paracasei subsp. paracasei SB137 and B. coagulans SB117 showed varying individual but promising capabilities to survive in the gastrointestinal tract, to adhere, to produce antimicrobial compounds. These three selected species-specific bacteria demonstrated in vitro, both singularly and mixed, the functional properties needed for their use as potential probiotics in veal calves.

  13. Contribution of reactive oxygen species to (+)-catechin-mediated bacterial lethality.

    PubMed

    Ajiboye, T O; Aliyu, M; Isiaka, I; Haliru, F Z; Ibitoye, O B; Uwazie, J N; Muritala, H F; Bello, S A; Yusuf, I I; Mohammed, A O

    2016-10-25

    The contribution of reactive oxygen species to (+)-catechin-mediated bacterial lethality was investigated. Minimum inhibitory concentrations (MIC) and minimum bactericidal concentration (MBC) of (+)-catechin against E. coli, P. aeruginosa and S. aureus were investigated using 96-well microtitre plate. MIC and MBC of (+)-catechin against E. coli, P. aeruginosa and S. aureus are 600 and 700; 600 and 800; 600 and 800 μg/mL respectively. The optical densities and colony forming units of (+)-catechin-treated bacteria decreased. (+)-Catechin (4× MIC) significantly increased the superoxide anion content of E. coli, P. aeruginosa and S. aureus compared to DMSO. Superoxide dismutase and catalase in (+)-catechin treated E. coli, P. aeruginosa and S. aureus increased significantly. Conversely, level of reduced glutathione in (+)-catechin-treated E. coli, P. aeruginosa and S. aureus decreased significantly while glutathione disulfide increased significantly. Furthermore, malondialdehyde and fragmented DNA increased significantly following exposure to (+)-catechin. From the above findings, (+)-catechin enhanced the generation of reactive oxygen species (superoxide anion radical and hydroxyl radical) in E. coli, P. aeruginosa and S. aureus, possibly by autoxidation, Fenton chemistry and inhibiting electron transport chain resulting into lipid peroxidation and DNA fragmentation and consequentially bacterial cell death.

  14. Recombination produces coherent bacterial species clusters in both core and accessory genomes

    PubMed Central

    Croucher, Nicholas J.; Gutmann, Michael U.; Corander, Jukka; Hanage, William P.

    2015-01-01

    Background: Population samples show bacterial genomes can be divided into a core of ubiquitous genes and accessory genes that are present in a fraction of isolates. The ecological significance of this variation in gene content remains unclear. However, microbiologists agree that a bacterial species should be ‘genomically coherent’, even though there is no consensus on how this should be determined. Results: We use a parsimonious model combining diversification in both the core and accessory genome, including mutation, homologous recombination (HR) and horizontal gene transfer (HGT) introducing new loci, to produce a population of interacting clusters of strains with varying genome content. New loci introduced by HGT may then be transferred on by HR. The model fits well to a systematic population sample of 616 pneumococcal genomes, capturing the major features of the population structure with parameter values that agree well with empirical estimates. Conclusions: The model does not include explicit selection on individual genes, suggesting that crude comparisons of gene content may be a poor predictor of ecological function. We identify a clearly divergent subpopulation of pneumococci that are inconsistent with the model and may be considered genomically incoherent with the rest of the population. These strains have a distinct disease tropism and may be rationally defined as a separate species. We also find deviations from the model that may be explained by recent population bottlenecks or spatial structure.

  15. Analysis of Bacterial Diversity During Acetic Acid Fermentation of Tianjin Duliu Aged Vinegar by 454 Pyrosequencing.

    PubMed

    Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye

    2015-08-01

    The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process.

  16. Muramic Acid Measurements for Bacterial Investigations in Marine Environments by High-Pressure Liquid Chromatography

    PubMed Central

    Mimura, Toru; Romano, Jean-Claude

    1985-01-01

    Muramic acid, a constituent of procaryotic cell walls, was assayed by high-pressure liquid chromatography in samples from several marine environments (water column, surface microlayer, and sediment) and a bacterial culture. It is used as a microbial biomass indicator. The method gave a good separation of muramic acid from interfering compounds with satisfactory reproducibility. A pseudomonad culture had a muramic acid content of 4.7 × 10−10 to 5.3 × 10−10 μg per cell during growth. In natural water samples, highly significant relationships were found between muramic acid concentrations and bacterial numbers for populations of 108 to 1011 cells per liter. The muramic acid content in natural marine water decreased from 5.3 × 10−10 to 1.6 × 10−10 μg per cell with increasing depth. In coastal sediments exposed to sewage pollution, concentrations of muramic acid, ATP, organic carbon, and total amino acids displayed a parallel decrease with increasing distance from the sewage outlet. Advantages of muramic acid measurement by high-pressure liquid chromatography are its high sensitivity and reduction of preparation steps, allowing a short time analysis. PMID:16346848

  17. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  18. The Biofilm Lifestyle Involves an Increase in Bacterial Membrane Saturated Fatty Acids

    PubMed Central

    Dubois-Brissonnet, Florence; Trotier, Elsa; Briandet, Romain

    2016-01-01

    Biofilm formation on contact surfaces contributes to persistence of foodborne pathogens all along the food and feed chain. The specific physiological features of bacterial cells embedded in biofilms contribute to their high tolerance to environmental stresses, including the action of antimicrobial compounds. As membrane lipid adaptation is a vital facet of bacterial response when cells are submitted to harsh or unstable conditions, we focused here on membrane fatty acid composition of biofilm cells as compared to their free-growing counterparts. Pathogenic bacteria (Staphylococcus aureus, Listeria monocytogenes, Pseudomonas aeruginosa, Salmonella Typhimurium) were cultivated in planktonic or biofilm states and membrane fatty acid analyses were performed on whole cells in both conditions. The percentage of saturated fatty acids increases in biofilm cells in all cases, with a concomitant decrease of branched-chain fatty acids for Gram-positive bacteria, or with a decrease in the sum of other fatty acids for Gram-negative bacteria. We propose that increased membrane saturation in biofilm cells is an adaptive stress response that allows bacteria to limit exchanges, save energy, and survive. Reprogramming of membrane fluidity in biofilm cells might explain specific biofilm behavior including bacterial recalcitrance to biocide action. PMID:27840623

  19. d-Amino Acid Probes for Penicillin Binding Protein-based Bacterial Surface Labeling*

    PubMed Central

    Fura, Jonathan M.; Kearns, Daniel; Pires, Marcos M.

    2015-01-01

    Peptidoglycan is an essential and highly conserved mesh structure that surrounds bacterial cells. It plays a critical role in retaining a defined cell shape, and, in the case of pathogenic Gram-positive bacteria, it lies at the interface between bacterial cells and the host organism. Intriguingly, bacteria can metabolically incorporate unnatural d-amino acids into the peptidoglycan stem peptide directly from the surrounding medium, a process mediated by penicillin binding proteins (PBPs). Metabolic peptidoglycan remodeling via unnatural d-amino acids has provided unique insights into peptidoglycan biosynthesis of live bacteria and has also served as the basis of a synthetic immunology strategy with potential therapeutic implications. A striking feature of this process is the vast promiscuity displayed by PBPs in tolerating entirely unnatural side chains. However, the chemical space and physical features of this side chain promiscuity have not been determined systematically. In this report, we designed and synthesized a library of variants displaying diverse side chains to comprehensively establish the tolerability of unnatural d-amino acids by PBPs in both Gram-positive and Gram-negative organisms. In addition, nine Bacillus subtilis PBP-null mutants were evaluated with the goal of identifying a potential primary PBP responsible for unnatural d-amino acid incorporation and gaining insights into the temporal control of PBP activity. We empirically established the scope of physical parameters that govern the metabolic incorporation of unnatural d-amino acids into bacterial peptidoglycan. PMID:26499795

  20. The Biofilm Lifestyle Involves an Increase in Bacterial Membrane Saturated Fatty Acids.

    PubMed

    Dubois-Brissonnet, Florence; Trotier, Elsa; Briandet, Romain

    2016-01-01

    Biofilm formation on contact surfaces contributes to persistence of foodborne pathogens all along the food and feed chain. The specific physiological features of bacterial cells embedded in biofilms contribute to their high tolerance to environmental stresses, including the action of antimicrobial compounds. As membrane lipid adaptation is a vital facet of bacterial response when cells are submitted to harsh or unstable conditions, we focused here on membrane fatty acid composition of biofilm cells as compared to their free-growing counterparts. Pathogenic bacteria (Staphylococcus aureus, Listeria monocytogenes, Pseudomonas aeruginosa, Salmonella Typhimurium) were cultivated in planktonic or biofilm states and membrane fatty acid analyses were performed on whole cells in both conditions. The percentage of saturated fatty acids increases in biofilm cells in all cases, with a concomitant decrease of branched-chain fatty acids for Gram-positive bacteria, or with a decrease in the sum of other fatty acids for Gram-negative bacteria. We propose that increased membrane saturation in biofilm cells is an adaptive stress response that allows bacteria to limit exchanges, save energy, and survive. Reprogramming of membrane fluidity in biofilm cells might explain specific biofilm behavior including bacterial recalcitrance to biocide action.

  1. Biofilm bacterial community structure in streams affected by acid mine drainage.

    PubMed

    Lear, Gavin; Niyogi, Dev; Harding, Jon; Dong, Yimin; Lewis, Gillian

    2009-06-01

    We examined the bacterial communities of epilithic biofilms in 17 streams which represented a gradient ranging from relatively pristine streams to streams highly impacted by acid mine drainage (AMD). A combination of automated ribosomal intergenic spacer analysis with multivariate analysis and ordination provided a sensitive, high-throughput method to monitor the impact of AMD on stream bacterial communities. Significant differences in community structure were detected among neutral to alkaline (pH 6.7 to 8.3), acidic (pH 3.9 to 5.7), and very acidic (pH 2.8 to 3.5) streams. DNA sequence analysis revealed that the acidic streams were generally dominated by bacteria related to the iron-oxidizing genus Gallionella, while the organisms in very acidic streams were less diverse and included a high proportion of acidophilic eukaryotes, including taxa related to the algal genera Navicula and Klebsormidium. Despite the presence of high concentrations of dissolved metals (e.g., Al and Zn) and deposits of iron hydroxide in some of the streams studied, pH was the most important determinant of the observed differences in bacterial community variability. These findings confirm that any restoration activities in such systems must focus on dealing with pH as the first priority.

  2. Innovative use of a bacterial enzyme involved in sialic acid degradation to initiate sialic acid biosynthesis in glycoengineered insect cells

    PubMed Central

    Geisler, Christoph; Jarvis, Donald L.

    2012-01-01

    The baculovirus/insect cell system is widely used for recombinant protein production, but it is suboptimal for recombinant glycoprotein production because it does not provide sialylation, which is an essential feature of many glycoprotein biologics. This problem has been addressed by metabolic engineering, which has extended endogenous insect cell N-glycosylation pathways and enabled glycoprotein sialylation by baculovirus/insect cell systems. However, further improvement is needed because even the most extensively engineered baculovirus/insect cell systems require media supplementation with N-acetylmannosamine, an expensive sialic acid precursor, for efficient recombinant glycoprotein sialylation. Our solution to this problem focused on E. coli N-acetylglucosamine-6-phosphate 2′-epimerase (GNPE), which normally functions in bacterial sialic acid degradation. Considering that insect cells have the product, but not the substrate for this enzyme, we hypothesized that GNPE might drive the reverse reaction in these cells, thereby initiating sialic acid biosynthesis in the absence of media supplementation. We tested this hypothesis by isolating transgenic insect cells expressing E. coli GNPE together with a suite of mammalian genes needed for N-glycoprotein sialylation. Various assays showed that these cells efficiently produced sialic acid, CMP-sialic acid, and sialylated recombinant N-glycoproteins even in growth media without N-acetylmannosamine. Thus, this study demonstrated that a eukaryotic recombinant protein production platform can be glycoengineered with a bacterial gene, that a bacterial enzyme which normally functions in sialic acid degradation can be used to initiate sialic acid biosynthesis, and that insect cells expressing this enzyme can produce sialylated N-glycoproteins without N-acetylmannosamine supplementation, which will reduce production costs in glycoengineered baculovirus/insect cell systems. PMID:23022569

  3. Dietary Fatty Acids and Immune Response to Food-Borne Bacterial Infections

    PubMed Central

    Harrison, Lisa M.; Balan, Kannan V.; Babu, Uma S.

    2013-01-01

    Functional innate and acquired immune responses are required to protect the host from pathogenic bacterial infections. Modulation of host immune functions may have beneficial or deleterious effects on disease outcome. Different types of dietary fatty acids have been shown to have variable effects on bacterial clearance and disease outcome through suppression or activation of immune responses. Therefore, we have chosen to review research across experimental models and food sources on the effects of commonly consumed fatty acids on the most common food-borne pathogens, including Salmonella sp., Campylobacter sp., Shiga toxin-producing Escherichia coli, Shigella sp., Listeria monocytogenes, and Staphylococcus aureus. Altogether, the compilation of literature suggests that no single fatty acid is an answer for protection from all food-borne pathogens, and further research is necessary to determine the best approach to improve disease outcomes. PMID:23698167

  4. Isotope composition of sulphate in acid mine drainage as measure of bacterial oxidation

    USGS Publications Warehouse

    Taylor, B.E.; Wheeler, M.C.; Nordstrom, D.K.

    1984-01-01

    The formation of acid waters by oxidation of pyrite-bearing ore deposits, mine tailing piles, and coal measures is a complex biogeochemical process and is a serious environmental problem. We have studied the oxygen and sulphur isotope geochemistry of sulphides, sulphur, sulphate and water in the field and in experiments to identify sources of oxygen and reaction mechanisms of sulphate formation. Here we report that the oxygen isotope composition of sulphate in acid mine drainage shows a large variation due to differing proportions of atmospheric- and water-derived oxygen from both chemical and bacterially-mediated oxidation. 18O-enrichment of sulphate results from pyrite oxidation facilitated by Thiobacillus ferrooxidans in aerated environments. Oxygen isotope analysis may therefore be useful in monitoring the effectiveness of abatement programmes designed to inhibit bacterial oxidation. Sulphur isotopes show no significant fractionation between pyrite and sulphate, indicating the quantitative insignificance of intermediate oxidation states of sulphur under acid conditions. ?? 1984 Nature Publishing Group.

  5. Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography

    PubMed Central

    Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

    2016-01-01

    The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach

  6. Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography.

    PubMed

    Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

    2016-01-01

    The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach

  7. Waste Workers’ Exposure to Airborne Fungal and Bacterial Species in the Truck Cab and During Waste Collection

    PubMed Central

    Madsen, Anne Mette; Alwan, Taif; Ørberg, Anders; Uhrbrand, Katrine; Jørgensen, Marie Birk

    2016-01-01

    A large number of people work with garbage collection, and exposure to microorganisms is considered an occupational health problem. However, knowledge on microbial exposure at species level is limited. The aim of the study was to achieve knowledge on waste collectors’ exposure to airborne inhalable fungal and bacterial species during waste collection with focus on the transport of airborne microorganisms into the truck cab. Airborne microorganisms were collected with samplers mounted in the truck cab, on the workers’ clothes, and outdoors. Fungal and bacterial species were quantified and identified. The study showed that the workers were exposed to between 112 and 4.8×104 bacteria m−3 air and 326 and 4.6×104 fungi m−3 air. The personal exposures to bacteria and fungi were significantly higher than the concentrations measured in the truck cabs and in the outdoor references. On average, the fungal and bacterial concentrations in truck cabs were 111 and 7.7 times higher than outdoor reference measurements. In total, 23 fungal and 38 bacterial species were found and identified. Most fungal species belonged to the genus Penicillium and in total 11 Penicillium species were found. Identical fungal species were often found both in a personal sample and in the same person’s truck cab, but concentrations were on average 27 times higher in personal samples. Concentrations of fungal and bacterial species found only in the personal samples were lower than concentrations of species also found in truck cabs. Skin-related bacteria constituted a large fraction of bacterial isolates found in personal and truck cab samples. In total, six Staphylococcus species were found. In outdoor samples, no skin-related bacteria were found. On average, concentrations of bacterial species found both in the truck cab and personal samples were 77 times higher in personal samples than in truck cab samples. In conclusion, high concentrations of fungi were found in truck cabs, but the

  8. Fatty acid and tocochromanol patterns of some Salvia L. species.

    PubMed

    Bagci, Eyup; Vural, Mecit; Dirmenci, Tuncay; Bruehl, Ludger; Aitzetmüller, Kurt

    2004-01-01

    In the course of our investigations of new sources of higher plant lipids, seed fatty acid compositions and the tocochromanol contents of Salvia bracteata, S. euphratica var. euphratica, S. aucherii var. canascens, S. cryptantha, S. staminea, S. limbata, S. virgata, S. hypargeia, S. halophylla, S. syriaca and S. cilicica were investigated using GLC and HPLC systems. Some of the species are endemic to Turkey. All the Salvia sp. showed the same pattern of fatty acids. Linoleic, linolenic and oleic acid were found as the abundant components. Tocochromanol derivatives of the seed oil showed differences between Salvia species. gamma-Tocopherol was the abundant component in most of the seed oils except of S. cilicica. The total tocopherol contents of the seed oils were determined to be more than the total of tocotrienols.

  9. Dancing for Food in the Deep Sea: Bacterial Farming by a New Species of Yeti Crab

    PubMed Central

    Thurber, Andrew R.; Jones, William J.; Schnabel, Kareen

    2011-01-01

    Vent and seep animals harness chemosynthetic energy to thrive far from the sun's energy. While symbiont-derived energy fuels many taxa, vent crustaceans have remained an enigma; these shrimps, crabs, and barnacles possess a phylogenetically distinct group of chemosynthetic bacterial epibionts, yet the role of these bacteria has remained unclear. We test whether a new species of Yeti crab, which we describe as Kiwa puravida n. sp, farms the epibiotic bacteria that it grows on its chelipeds (claws), chelipeds that the crab waves in fluid escaping from a deep-sea methane seep. Lipid and isotope analyses provide evidence that epibiotic bacteria are the crab's main food source and K. puravida n. sp. has highly-modified setae (hairs) on its 3rd maxilliped (a mouth appendage) which it uses to harvest these bacteria. The ε- and γ- proteobacteria that this methane-seep species farms are closely related to hydrothermal-vent decapod epibionts. We hypothesize that this species waves its arm in reducing fluid to increase the productivity of its epibionts by removing boundary layers which may otherwise limit carbon fixation. The discovery of this new species, only the second within a family described in 2005, stresses how much remains undiscovered on our continental margins. PMID:22140426

  10. Cheating fosters species co-existence in well-mixed bacterial communities.

    PubMed

    Leinweber, Anne; Fredrik Inglis, R; Kümmerli, Rolf

    2017-01-06

    Explaining the enormous biodiversity observed in bacterial communities is challenging because ecological theory predicts that competition between species occupying the same niche should lead to the exclusion of less competitive community members. Competitive exclusion should be particularly strong when species compete for a single limiting resource or live in unstructured habitats that offer no refuge for weaker competitors. Here, we describe the 'cheating effect', a form of intra-specific competition that can counterbalance between-species competition, thereby fostering biodiversity in unstructured habitats. Using experimental communities consisting of the strong competitor Pseudomonas aeruginosa (PA) and its weaker counterpart Burkholderia cenocepacia (BC), we show that co-existence is impossible when the two species compete for a single limiting resource, iron. However, when introducing a PA cheating mutant, which specifically exploits the iron-scavenging siderophores produced by the PA wild type, we found that biodiversity was preserved under well-mixed conditions where PA cheats could outcompete the PA wild type. Cheating fosters biodiversity in our system because it creates strong intra-specific competition, which equalizes fitness differences between PA and BC. Our study identifies cheating - typically considered a destructive element - as a constructive force in shaping biodiversity.The ISME Journal advance online publication, 6 January 2017; doi:10.1038/ismej.2016.195.

  11. The effect of humic acids on the cytotoxicity of silver nanoparticles to a natural aquatic bacterial assemblage.

    PubMed

    Dasari, Thabitha P; Hwang, Huey-Min

    2010-11-01

    The effect of a terrestrial humic acid (HA) and a river HA on the cytotoxicity of silver nanoparticles (AgNPs) to natural aquatic bacterial assemblages (0 μM, 2.5 μM and 5 μM) was measured with spread plate counting. The effect of HA (20 and 40 ppm) on the cytotoxicity of AgNPs ranging in size between 15 and 25 nm was tested in the presence and in the absence of natural sunlight. The experiment was a full factorial, completely randomized design and the results were analyzed using the General Linear Model in SAS. LSMEANS was used to separate the means or combinations of means. Significant main effects of all independent variables, plus interaction effects in all cases except HA/LI and HA/AgNPs/LI were observed. The toxicity of AgNPs to natural aquatic bacterial assemblages appears to be concentration dependent for concentrations between 0 μM and 5 μM. The data indicate that the light exposure inhibited viability more than the darkness exposure. The HA treatment groups in the presence of light showed greater reduced viability count compared to darkness exposure groups. The inhibition of bacterial viability counts by AgNPs exposure was less in the light treatment groups containing a terrestrial HA compared to that with a river HA. Difference in the extent of reactive oxygen species formation and adsorption/binding of AgNPs was speculated to account for the observed phenomenon.

  12. Bacterial dehalogenation of halogenated alkanes and fatty acids.

    PubMed Central

    Omori, T; Alexander, M

    1978-01-01

    Sewage samples dehalogenated 1,9-dichloronane, 1-chloroheptane, and 6-bromohexanoate, but an organism able to use 1,9-dichlorononane as the sole carbon source could not be isolated from these samples. Resting cells of Pseudomonas sp. grown on n-undecane, but not cells grown on glycerol, dehalogenated 1,9-dichlorononane in the presence of chloramphenicol. Resting cells of five other n-undecane-utilizing bacteria cleaved the halogen from dichlorononane and 6-bromohexanoate, and four dehalogenated 1-chloroheptane; however, none of these organisms used 1,9-dichlorononane for growth. By contrast, four benzoate-utilizing bacteria removed bromine from 6-bromohexanoate but had little or no activity on the chlorinated hydrocarbons. Incubation of sewage with 1,9-dichlorononane increased its subsequent capacity to dehalogenate 1,9-dichlorononane and 6-bromohexanoate but not 1-chloroheptane. A soil isolate could dehalogenate several dichloralkanes, three halogenated heptanes, and halogen-containing fatty acids. An enzyme preparation from this bacterium released chloride from 1,9-dichlorononane. PMID:655703

  13. Epidemiology of urinary tract infections, bacterial species and resistances in primary care in France.

    PubMed

    Malmartel, A; Ghasarossian, C

    2016-03-01

    General practitioners often have to manage urinary tract infections (UTI) with probabilistic treatments, although bacterial resistances are increasing. Therefore, the French Society of Infectious Diseases published new guidelines in 2014. The aim of this study was to investigate the bacterial epidemiology of UTI in the general population in primary care and analyse risk factors for Escherichia coli resistance to antibiotics. A cross-sectional study was conducted in 12 ambulatory laboratories. Patients over 18 years of age coming for urinalysis were included. Risk factors for UTI were collected using a questionnaire and the laboratory records. Bacteria meeting criteria for UTI were analysed. A positive urinalysis was found in 1119 patients, corresponding to 1125 bacterial isolates. The bacterial species were: E. coli (73 %), Enterococcus spp. (7 %), Klebsiella spp. (6 %), Proteus spp. (4 %), Staphylococcus spp. (3 %) and Pseudomonas spp. (2 %). Regardless of the bacteria, the most common resistance was that to co-trimoxazole: 27 % (95 % confidence interval [CI] = [0.24; 0.30]), followed by ofloxacin resistance: 16 % [0.14; 0.18]. Escherichia coli resistances to co-trimoxazole, ofloxacin, cefixime, nitrofurantoin and fosfomycin were, respectively, 25.5 % [0.23; 0.28], 17 % [0.14; 0.20], 5.6 % [0.04; 0.07], 2.2 % [0.01; 0.03] and 1.2 % [0.005; 0.02]. Independent risk factors for E. coli resistance to ofloxacin were age over 85 years (odds ratio [OR] = 3.08; [1.61; 5.87]) and a history of UTI in the last 6 months (OR = 2.34; [1.54; 3.52]). Our findings support the guidelines recommending fluoroquinolone sparing. The scarcity of E. coli resistance to fosfomycin justifies its use as a first-line treatment in acute cystitis. These results should be reassessed in a few years to identify changes in the bacterial epidemiology of UTI.

  14. Spatial organization of dual-species bacterial aggregates on leaf surfaces.

    PubMed

    Monier, J-M; Lindow, S E

    2005-09-01

    The spatial organization of cells within bacterial aggregates on leaf surfaces was determined for pair-wise mixtures of three different bacterial species commonly found on leaves, Pseudomonas syringae, Pantoea agglomerans, and Pseudomonas fluorescens. Cells were coinoculated onto bean plants and allowed to grow under moist conditions, and the resulting aggregates were examined in situ by epifluorescence microscopy. Each bacterial strain could be localized because it expressed either the green or the cyan fluorescent protein constitutively, and the viability of individual cells was assessed by propidium iodide staining. Each pair of bacterial strains that was coinoculated onto leaves formed mixed aggregates. The degree of segregation of cells in mixed aggregates differed between the different coinoculated pairs of strains and was higher in mixtures of P. fluorescens A506 and P. agglomerans 299R and mixtures of P. syringae B728a and P. agglomerans 299R than in mixtures of two isogenic strains of P. agglomerans 299R. The fractions of the total cell population that were dead in mixed and monospecific aggregates of a gfp-marked strain of P. agglomerans 299R and a cfp-marked strain of P. agglomerans 299R, or of P. fluorescens A506 and P. agglomerans 299R, were similar. However, the proportion of dead cells in mixed aggregates of P. syringae B728a and P. agglomerans 299R was significantly higher (13.2% +/- 8.2%) than that in monospecific aggregates of these two strains (1.6% +/- 0.7%), and it increased over time. While dead cells in such mixed aggregates were preferentially found at the interface between clusters of cells of these strains, cells of these two strains located at the interface did not exhibit equal probabilities of mortality. After 9 days of incubation, about 77% of the P. agglomerans 299R cells located at the interface were dead, while only about 24% of the P. syringae B728a cells were dead. The relevance of our results to understanding bacterial

  15. Efficient degradation of tannic acid by black Aspergillus species.

    PubMed

    Van Diepeningen, Anne D; Debets, Alfons J M; Varga, Janos; van der Gaag, Marijn; Swart, Klaas; Hoekstra, Rolf F

    2004-08-01

    A set of aspergillus strains from culture collections and wild-type black aspergilli isolated on non-selective media were used to validate the use of media with 20% tannic acid for exclusive and complete selection of the black aspergilli. The 20% tannic acid medium proved useful for both quantitative and qualitative selection of all different black aspergilli, including all recognized species: A. carbonarius, A. japonicus, A. aculeatus, A foetidus, A. heteromorphus, A. niger, A. tubingensis and A. brasiliensis haplotypes. Even higher concentrations of tannic acid can be utilized by the black aspergilli suggesting a very efficient tannic acid-degrading system. Colour mutants show that the characteristic ability to grow on high tannic acid concentrations is not causally linked to the other typical feature of these aspergilli, i.e. the formation of brown-black pigments. Sequence analysis of the A. niger genome using the A. oryzae tannase gene yielded eleven tannase-like genes, far more than in related species. Therefore, a unique ecological niche in the degradation of tannic acid and connected nitrogen release seems to be reserved for these black-spored cosmopolitans.

  16. In situ identification of bacterial species in marine microfouling films by using an immunofluorescence technique.

    PubMed Central

    Zambon, J J; Huber, P S; Meyer, A E; Slots, J; Fornalik, M S; Baier, R E

    1984-01-01

    An immunofluorescence technique was developed for the in situ identification of specific bacteria in marine microfouling films. Microorganisms adherent to glass plates after 30 days of immersion in a synthetic seawater system were cultured and classified by biochemical tests, flagellar arrangement, and the API 20E system. All isolates were gram-negative aerobic or facultative motile rods, predominantly Pseudomonas spp. Rabbit antisera to the five dominant organisms including Achromobacter spp., Comamonas terrigena, P. putrefaciens, a yellow-pigmented Pseudomonas sp., and Vibrio alginolyticus were prepared. These antisera were shown to be species specific in indirect immunofluorescence assays against a battery of 26 marine isolates from 14 bacterial species, with the exception of antisera to the Pseudomonas spp, which cross-reacted with each other but not with test bacteria of other genera. These immunofluorescent reagents enabled the in situ identification of all five bacterial species in microfouling films. Low-surface-energy test plates had smaller numbers of adherent bacteria in microfouling films than medium-surface-energy test plates, suggesting that the degree of microfouling may be influenced by the surface energy. In addition, the reagents could identify up to 39% of the attached bacteria in microfouling films spontaneously formed on steel plates in flow cells deployed in different areas of the Atlantic Ocean. The microbial composition of the ocean-formed films varied with the geographical area of their formation. The present results indicate that immunofluorescence techniques may provide a rapid and reliable means to identify, in situ, specific bacteria in marine microfouling films. PMID:6393875

  17. Production and characterization of bacterial cellulose membranes with hyaluronic acid from chicken comb.

    PubMed

    de Oliveira, Sabrina Alves; da Silva, Bruno Campos; Riegel-Vidotti, Izabel Cristina; Urbano, Alexandre; de Sousa Faria-Tischer, Paula Cristina; Tischer, Cesar Augusto

    2017-04-01

    The bacterial cellulose (BC), from Gluconacetobacter hansenii, is a biofilm with a high degree of crystallinity that can be used for therapeutic purposes and as a candidate for healing wounds. Hyaluronic acid (HA) is a constitutive polysaccharide found in the extracellular matrix and is a material used in tissue engineering and scaffolding for tissue regeneration. In this study, polymeric composites were produced in presence of hyaluronic acid isolated from chicken comb on different days of fermentation, specifically on the first (BCHA-SABT0) and third day (BCHA-SABT3) of fermentation. The structural characteristics, thermal stability and molar mass of hyaluronic acid from chicken comb were evaluated. Native membrane and polymeric composites were characterized with respect to their morphology and crystallinity. The optimized process of extraction and purification of hyaluronic acid resulted in low molar mass hyaluronic acid with structural characteristics similar to the standard commercial hyaluronic acid. The results demonstrate that the polymeric composites (BC/HA-SAB) can be produced in situ. The membranes produced on the third day presented better incorporation of HA-SAB between cellulose microfiber, resulting in membranes with higher thermal stability, higher roughness and lower crystallinity. The biocompatiblily of bacterial cellulose and the importance of hyaluronic acid as a component of extracellular matrix qualify the polymeric composites as promising biomaterials for tissue engineering.

  18. Evaluation of toxic effects of several carboxylic acids on bacterial growth by toxicodynamic modelling

    PubMed Central

    2011-01-01

    Background Effects of organic acids on microbial fermentation are commonly tested in investigations about metabolic behaviour of bacteria. However, they typically provide only descriptive information without modelling the influence of acid concentrations on bacterial kinetics. Results We developed and applied a mathematical model (secondary model) to capture the toxicological effects of those chemicals on kinetic parameters that define the growth of bacteria in batch cultures. Thus, dose-response kinetics were performed with different bacteria (Leuconostoc mesenteroides, Carnobacterium pisicola, Escherichia coli, Bacillus subtilis and Listonella anguillarum) exposed at increasing concentrations of individual carboxylic acids (formic, acetic, propionic, butyric and lactic). In all bioassays the acids affected the maximum bacterial load (Xm) and the maximum growth rate (vm) but only in specific cases the lag phase (λ) was modified. Significance of the parameters was always high and in all fermentations the toxicodynamic equation was statistically consistent and had good predictability. The differences between D and L-lactic acid effects were significant for the growth of E. coli, L. mesenteroides and C. piscicola. In addition, a global parameter (EC50,τ) was used to compare toxic effects and provided a realistic characterization of antimicrobial agents using a single value. Conclusions The effect of several organic acids on the growth of different bacteria was accurately studied and perfectly characterized by a bivariate equation which combines the basis of dose-response theory with microbial growth kinetics (secondary model). The toxicity of carboxylic acids was lower with the increase of the molecular weight of these chemicals. PMID:22118421

  19. Impacts of hydrophilic colanic acid on bacterial attachment to microfiltration membranes and subsequent membrane biofouling.

    PubMed

    Yoshida, Keitaro; Tashiro, Yosuke; May, Thithiwat; Okabe, Satoshi

    2015-06-01

    In order to examine the interactions between physicochemical properties of specific extracellular polymeric substances (EPS) and membrane biofouling, we investigated the impacts of hydrophilic colanic acid, as a model extracellular polysaccharide component, on initial bacterial attachment to different microfiltration (MF) membranes and membrane biofouling by using Escherichia coli strains producing different amounts of colanic acid. In a newly designed microtiter plate assay, the bacterial attachment by an E. coli strain RcsF(+), which produces massive amounts of colanic acid, decreased only to a hydrophobic membrane because the colanic acid made cell surfaces more hydrophilic, resulting in low cell attachment to hydrophobic membranes. The bench-scale cross-flow filtration tests followed by filtration resistance measurement revealed that RcsF(+) caused severe irreversible membrane fouling (i.e., pore-clogging), whereas less extracellular polysaccharide-producing strains caused moderate but reversible fouling to all membranes used in this study. Further cross-flow filtration tests indicated that colanic acid liberated in the bulk phase could rapidly penetrate pre-accumulated biomass layers (i.e., biofilms) and then directly clogged membrane pores. These results indicate that colanic acid, a hydrophilic extracellular polysaccharide, and possible polysaccharides with similar characteristics with colanic acid are considered as a major cause of severe irreversible membrane fouling (i.e., pore-clogging) regardless of biofilm formation (dynamic membrane).

  20. Spatial and Species Variations in Bacterial Communities Associated with Corals from the Red Sea as Revealed by Pyrosequencing

    PubMed Central

    Lee, On On; Yang, Jiangke; Bougouffa, Salim; Wang, Yong; Batang, Zenon; Tian, Renmao; Al-Suwailem, Abdulaziz

    2012-01-01

    Microbial associations with corals are common and are most likely symbiotic, although their diversity and relationships with environmental factors and host species remain unclear. In this study, we adopted a 16S rRNA gene tag-pyrosequencing technique to investigate the bacterial communities associated with three stony Scleractinea and two soft Octocorallia corals from three locations in the Red Sea. Our results revealed highly diverse bacterial communities in the Red Sea corals, with more than 600 ribotypes detected and up to 1,000 species estimated from a single coral species. Altogether, 21 bacterial phyla were recovered from the corals, of which Gammaproteobacteria was the most dominant group, and Chloroflexi, Chlamydiae, and the candidate phylum WS3 were reported in corals for the first time. The associated bacterial communities varied greatly with location, where environmental conditions differed significantly. Corals from disturbed areas appeared to share more similar bacterial communities, but larger variations in community structures were observed between different coral species from pristine waters. Ordination methods identified salinity and depth as the most influential parameters affecting the abundance of Vibrio, Pseudoalteromonas, Serratia, Stenotrophomonas, Pseudomonas, and Achromobacter in the corals. On the other hand, bacteria such as Chloracidobacterium and Endozoicomonas were more sensitive to the coral species, suggesting that the host species type may be influential in the associated bacterial community, as well. The combined influences of the coral host and environmental factors on the associated microbial communities are discussed. This study represents the first comparative study using tag-pyrosequencing technology to investigate the bacterial communities in Red Sea corals. PMID:22865078

  1. Relationship between the Presence of Bartonella Species and Bacterial Loads in Cats and Cat Fleas (Ctenocephalides felis) under Natural Conditions

    PubMed Central

    Gutiérrez, Ricardo; Nachum-Biala, Yaarit

    2015-01-01

    Cats are considered the main reservoir of three zoonotic Bartonella species: Bartonella henselae, Bartonella clarridgeiae, and Bartonella koehlerae. Cat fleas (Ctenocephalides felis) have been experimentally demonstrated to be a competent vector of B. henselae and have been proposed as the potential vector of the two other Bartonella species. Previous studies have reported a lack of association between the Bartonella species infection status (infected or uninfected) and/or bacteremia levels of cats and the infection status of the fleas they host. Nevertheless, to date, no study has compared the quantitative distributions of these bacteria in both cats and their fleas under natural conditions. Thus, the present study explored these relationships by identifying and quantifying the different Bartonella species in both cats and their fleas. Therefore, EDTA-blood samples and fleas collected from stray cats were screened for Bartonella bacteria. Bacterial loads were quantified by high-resolution melt real-time quantitative PCR assays. The results indicated a moderate correlation between the Bartonella bacterial loads in the cats and their fleas when both were infected with the same Bartonella species. Moreover, a positive effect of the host infection status on the Bartonella bacterial loads of the fleas was observed. Conversely, the cat bacterial loads were not affected by the infection status of their fleas. Our results suggest that the Bartonella bacterial loads of fleas are positively affected by the presence of the bacteria in their feline host, probably by multiple acquisitions/accumulation and/or multiplication events. PMID:26070666

  2. In vaginal fluid, bacteria associated with bacterial vaginosis can be suppressed with lactic acid but not hydrogen peroxide

    PubMed Central

    2011-01-01

    Background Hydrogen peroxide (H2O2) produced by vaginal lactobacilli is generally believed to protect against bacteria associated with bacterial vaginosis (BV), and strains of lactobacilli that can produce H2O2 are being developed as vaginal probiotics. However, evidence that led to this belief was based in part on non-physiological conditions, antioxidant-free aerobic conditions selected to maximize both production and microbicidal activity of H2O2. Here we used conditions more like those in vivo to compare the effects of physiologically plausible concentrations of H2O2 and lactic acid on a broad range of BV-associated bacteria and vaginal lactobacilli. Methods Anaerobic cultures of seventeen species of BV-associated bacteria and four species of vaginal lactobacilli were exposed to H2O2, lactic acid, or acetic acid at pH 7.0 and pH 4.5. After two hours, the remaining viable bacteria were enumerated by growth on agar media plates. The effect of vaginal fluid (VF) on the microbicidal activities of H2O2 and lactic acid was also measured. Results Physiological concentrations of H2O2 (< 100 μM) failed to inactivate any of the BV-associated bacteria tested, even in the presence of human myeloperoxidase (MPO) that increases the microbicidal activity of H2O2. At 10 mM, H2O2 inactivated all four species of vaginal lactobacilli but only one of seventeen species of BV-associated bacteria. Moreover, the addition of just 1% vaginal fluid (VF) blocked the microbicidal activity of 1 M H2O2. In contrast, lactic acid at physiological concentrations (55-111 mM) and pH (4.5) inactivated all the BV-associated bacteria tested, and had no detectable effect on the vaginal lactobacilli. Also, the addition of 10% VF did not block the microbicidal activity of lactic acid. Conclusions Under optimal, anaerobic growth conditions, physiological concentrations of lactic acid inactivated BV-associated bacteria without affecting vaginal lactobacilli, whereas physiological concentrations of H2O2

  3. Similar bacterial community composition in acidic mining lakes with different pH and lake chemistry.

    PubMed

    Kampe, Heike; Dziallas, Claudia; Grossart, Hans-Peter; Kamjunke, Norbert

    2010-10-01

    As extreme environmental conditions strongly affect bacterial community composition (BCC), we examined whether differences in pH-even at low pH-and in iron and sulfate concentrations lead to changes in BCC of acidic mining lakes. Thereby, we tested the following hypotheses: (1) diversity of the bacterial community in acidic lakes decreases with reducing pH, (2) BCC differs between epilimnion and hypolimnion, and (3) BCC in extremely acidic environments does not vary much over time. Therefore, we investigated the BCC of three acidic lakes with different pH values (2.3, 2.7, and 3.2) by denaturing gradient gel electrophoresis (DGGE) and subsequent sequencing of DGGE bands as well as catalyzed reporter deposition-FISH (CARD-FISH). BCC did not significantly vary among the studied lakes nor differ much between water layers. In contrast, BCC significantly changed over time, which is contradictory to our hypotheses. Bacterial communities were dominated by Alpha-, Beta-, and Gammaproteobacteria, whereas Actino- and Acidobacteria rarely occurred. Cell numbers of both free and attached bacteria were positively related to DOC concentration. Overall, low pH and extreme chemical conditions of the studied lakes led to similar assemblages of bacteria with pronounced temporal differences. This notion indicates that temporal changes in environmental conditions including food web structure also affect unique communities of bacteria thriving at low pH.

  4. Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer

    USGS Publications Warehouse

    Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.

    2009-01-01

    Background: Phylogeographic reconstruction of some bacterial populations is hindered by low diversity coupled with high levels of lateral gene transfer. A comparison of recombination levels and diversity at seven housekeeping genes for eleven bacterial species, most of which are commonly cited as having high levels of lateral gene transfer shows that the relative contributions of homologous recombination versus mutation for Burkholderia pseudomallei is over two times higher than for Streptococcus pneumoniae and is thus the highest value yet reported in bacteria. Despite the potential for homologous recombination to increase diversity, B. pseudomallei exhibits a relative lack of diversity at these loci. In these situations, whole genome genotyping of orthologous shared single nucleotide polymorphism loci, discovered using next generation sequencing technologies, can provide very large data sets capable of estimating core phylogenetic relationships. We compared and searched 43 whole genome sequences of B. pseudomallei and its closest relatives for single nucleotide polymorphisms in orthologous shared regions to use in phylogenetic reconstruction. Results: Bayesian phylogenetic analyses of >14,000 single nucleotide polymorphisms yielded completely resolved trees for these 43 strains with high levels of statistical support. These results enable a better understanding of a separate analysis of population differentiation among >1,700 B. pseudomallei isolates as defined by sequence data from seven housekeeping genes. We analyzed this larger data set for population structure and allele sharing that can be attributed to lateral gene transfer. Our results suggest that despite an almost panmictic population, we can detect two distinct populations of B. pseudomallei that conform to biogeographic patterns found in many plant and animal species. That is, separation along Wallace's Line, a biogeographic boundary between Southeast Asia and Australia. Conclusion: We describe an

  5. Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer

    PubMed Central

    2009-01-01

    Background Phylogeographic reconstruction of some bacterial populations is hindered by low diversity coupled with high levels of lateral gene transfer. A comparison of recombination levels and diversity at seven housekeeping genes for eleven bacterial species, most of which are commonly cited as having high levels of lateral gene transfer shows that the relative contributions of homologous recombination versus mutation for Burkholderia pseudomallei is over two times higher than for Streptococcus pneumoniae and is thus the highest value yet reported in bacteria. Despite the potential for homologous recombination to increase diversity, B. pseudomallei exhibits a relative lack of diversity at these loci. In these situations, whole genome genotyping of orthologous shared single nucleotide polymorphism loci, discovered using next generation sequencing technologies, can provide very large data sets capable of estimating core phylogenetic relationships. We compared and searched 43 whole genome sequences of B. pseudomallei and its closest relatives for single nucleotide polymorphisms in orthologous shared regions to use in phylogenetic reconstruction. Results Bayesian phylogenetic analyses of >14,000 single nucleotide polymorphisms yielded completely resolved trees for these 43 strains with high levels of statistical support. These results enable a better understanding of a separate analysis of population differentiation among >1,700 B. pseudomallei isolates as defined by sequence data from seven housekeeping genes. We analyzed this larger data set for population structure and allele sharing that can be attributed to lateral gene transfer. Our results suggest that despite an almost panmictic population, we can detect two distinct populations of B. pseudomallei that conform to biogeographic patterns found in many plant and animal species. That is, separation along Wallace's Line, a biogeographic boundary between Southeast Asia and Australia. Conclusion We describe an

  6. Chromosome painting in silico in a bacterial species reveals fine population structure.

    PubMed

    Yahara, Koji; Furuta, Yoshikazu; Oshima, Kenshiro; Yoshida, Masaru; Azuma, Takeshi; Hattori, Masahira; Uchiyama, Ikuo; Kobayashi, Ichizo

    2013-06-01

    Identifying population structure forms an important basis for genetic and evolutionary studies. Most current methods to identify population structure have limitations in analyzing haplotypes and recombination across the genome. Recently, a method of chromosome painting in silico has been developed to overcome these shortcomings and has been applied to multiple human genome sequences. This method detects the genome-wide transfer of DNA sequence chunks through homologous recombination. Here, we apply it to the frequently recombining bacterial species Helicobacter pylori that has infected Homo sapiens since their birth in Africa and shows wide phylogeographic divergence. Multiple complete genome sequences were analyzed including sequences from Okinawa, Japan, that we recently sequenced. The newer method revealed a finer population structure than revealed by a previous method that examines only MLST housekeeping genes or a phylogenetic network analysis of the core genome. Novel subgroups were found in Europe, Amerind, and East Asia groups. Examination of genetic flux showed some singleton strains to be hybrids of subgroups and revealed evident signs of population admixture in Africa, Europe, and parts of Asia. We expect this approach to further our understanding of intraspecific bacterial evolution by revealing population structure at a finer scale.

  7. PATRIC: the Comprehensive Bacterial Bioinformatics Resource with a Focus on Human Pathogenic Species ▿ ‡ #

    PubMed Central

    Gillespie, Joseph J.; Wattam, Alice R.; Cammer, Stephen A.; Gabbard, Joseph L.; Shukla, Maulik P.; Dalay, Oral; Driscoll, Timothy; Hix, Deborah; Mane, Shrinivasrao P.; Mao, Chunhong; Nordberg, Eric K.; Scott, Mark; Schulman, Julie R.; Snyder, Eric E.; Sullivan, Daniel E.; Wang, Chunxia; Warren, Andrew; Williams, Kelly P.; Xue, Tian; Seung Yoo, Hyun; Zhang, Chengdong; Zhang, Yan; Will, Rebecca; Kenyon, Ronald W.; Sobral, Bruno W.

    2011-01-01

    Funded by the National Institute of Allergy and Infectious Diseases, the Pathosystems Resource Integration Center (PATRIC) is a genomics-centric relational database and bioinformatics resource designed to assist scientists in infectious-disease research. Specifically, PATRIC provides scientists with (i) a comprehensive bacterial genomics database, (ii) a plethora of associated data relevant to genomic analysis, and (iii) an extensive suite of computational tools and platforms for bioinformatics analysis. While the primary aim of PATRIC is to advance the knowledge underlying the biology of human pathogens, all publicly available genome-scale data for bacteria are compiled and continually updated, thereby enabling comparative analyses to reveal the basis for differences between infectious free-living and commensal species. Herein we summarize the major features available at PATRIC, dividing the resources into two major categories: (i) organisms, genomes, and comparative genomics and (ii) recurrent integration of community-derived associated data. Additionally, we present two experimental designs typical of bacterial genomics research and report on the execution of both projects using only PATRIC data and tools. These applications encompass a broad range of the data and analysis tools available, illustrating practical uses of PATRIC for the biologist. Finally, a summary of PATRIC's outreach activities, collaborative endeavors, and future research directions is provided. PMID:21896772

  8. Biomarkers for Tuberculosis Based on Secreted, Species-Specific, Bacterial Small Molecules.

    PubMed

    Pan, Shih-Jung; Tapley, Asa; Adamson, John; Little, Tessa; Urbanowski, Michael; Cohen, Keira; Pym, Alexander; Almeida, Deepak; Dorasamy, Afton; Layre, Emilie; Young, David C; Singh, Ravesh; Patel, Vinod B; Wallengren, Kristina; Ndung'u, Thumbi; Wilson, Douglas; Moody, D Branch; Bishai, William

    2015-12-01

    Improved biomarkers are needed for tuberculosis. To develop tests based on products secreted by tubercle bacilli that are strictly associated with viability, we evaluated 3 bacterial-derived, species-specific, small molecules as biomarkers: 2 mycobactin siderophores and tuberculosinyladenosine. Using liquid chromatography-tandem mass spectrometry, we demonstrated the presence of 1 or both mycobactins and/or tuberculosinyladenosine in serum and whole lung tissues from infected mice and sputum, cerebrospinal fluid (CSF), or lymph nodes from infected patients but not uninfected controls. Detection of the target molecules distinguished host infection status in 100% of mice with both serum and lung as the target sample. In human subjects, we evaluated detection of the bacterial small molecules (BSMs) in multiple body compartments in 3 patient cohorts corresponding to different forms of tuberculosis. We detected at least 1 of the 3 molecules in 90%, 71%, and 40% of tuberculosis patients' sputum, CSF, and lymph node samples, respectively. In paucibacillary forms of human tuberculosis, which are difficult to diagnose even with culture, detection of 1 or more BSM was rapid and compared favorably to polymerase chain reaction-based detection. Secreted BSMs, detectable in serum, warrant further investigation as a means for diagnosis and therapeutic monitoring in patients with tuberculosis.

  9. Biomarkers for Tuberculosis Based on Secreted, Species-Specific, Bacterial Small Molecules

    PubMed Central

    Pan, Shih-Jung; Tapley, Asa; Adamson, John; Little, Tessa; Urbanowski, Michael; Cohen, Keira; Pym, Alexander; Almeida, Deepak; Dorasamy, Afton; Layre, Emilie; Young, David C.; Singh, Ravesh; Patel, Vinod B.; Wallengren, Kristina; Ndung'u, Thumbi; Wilson, Douglas; Moody, D. Branch; Bishai, William

    2015-01-01

    Improved biomarkers are needed for tuberculosis. To develop tests based on products secreted by tubercle bacilli that are strictly associated with viability, we evaluated 3 bacterial-derived, species-specific, small molecules as biomarkers: 2 mycobactin siderophores and tuberculosinyladenosine. Using liquid chromatography–tandem mass spectrometry, we demonstrated the presence of 1 or both mycobactins and/or tuberculosinyladenosine in serum and whole lung tissues from infected mice and sputum, cerebrospinal fluid (CSF), or lymph nodes from infected patients but not uninfected controls. Detection of the target molecules distinguished host infection status in 100% of mice with both serum and lung as the target sample. In human subjects, we evaluated detection of the bacterial small molecules (BSMs) in multiple body compartments in 3 patient cohorts corresponding to different forms of tuberculosis. We detected at least 1 of the 3 molecules in 90%, 71%, and 40% of tuberculosis patients' sputum, CSF, and lymph node samples, respectively. In paucibacillary forms of human tuberculosis, which are difficult to diagnose even with culture, detection of 1 or more BSM was rapid and compared favorably to polymerase chain reaction–based detection. Secreted BSMs, detectable in serum, warrant further investigation as a means for diagnosis and therapeutic monitoring in patients with tuberculosis. PMID:26014799

  10. Goniothalamus Species: A Source of Drugs for the Treatment of Cancers and Bacterial Infections?

    PubMed Central

    2007-01-01

    Irrespective of the presence of cytotoxic acetogenins and styryl-lactones in the genus Goniothalamus, only 22 species in the genus Goniothalamus, out of 160 species (13.7%) have so far been investigated. In an effort to promote further research on the genus Goniothalamus which could represent a source of drugs for the treatment of cancers and bacterial infections, this work offers a broad analysis of current knowledge on Goniothalamus species. Therefore, it includes (i) taxonomy (ii) botanical description (iii) traditional medicinal uses and (iv) phytochemical and pharmacological studies. We discuss the molecular mechanisms of actions of acetogenins and styryl-lactones, with some emphasis on the possible involvement of protein kinase, Bax and TRAIL receptors in the cytotoxic effects of styryl-lactones. We also report (v) the growth inhibition of several nosocomial bacteria by Goniothalamus. scortechinii. The crude methanol extract of G. scortechinii showed a good and broad spectrum of antibacterial activity against both Gram-negative and Gram-positive bacteria. PMID:17965760

  11. Life history correlates of fecal bacterial species richness in a wild population of the blue tit Cyanistes caeruleus

    PubMed Central

    Benskin, Clare McW H; Rhodes, Glenn; Pickup, Roger W; Mainwaring, Mark C; Wilson, Kenneth; Hartley, Ian R

    2015-01-01

    Very little is known about the normal gastrointestinal flora of wild birds, or how it might affect or reflect the host's life-history traits. The aim of this study was to survey the species richness of bacteria in the feces of a wild population of blue tits Cyanistes caeruleus and to explore the relationships between bacterial species richness and various life-history traits, such as age, sex, and reproductive success. Using PCR-TGGE, 55 operational taxonomic units (OTUs) were identified in blue tit feces. DNA sequencing revealed that the 16S rRNA gene was amplified from a diverse range of bacteria, including those that shared closest homology with Bacillus licheniformis, Campylobacter lari, Pseudomonas spp., and Salmonella spp. For adults, there was a significant negative relationship between bacterial species richness and the likelihood of being detected alive the following breeding season; bacterial richness was consistent across years but declined through the breeding season; and breeding pairs had significantly more similar bacterial richness than expected by chance alone. Reduced adult survival was correlated with the presence of an OTU most closely resembling C. lari; enhanced adult survival was associated with an OTU most similar to Arthrobacter spp. For nestlings, there was no significant change in bacterial species richness between the first and second week after hatching, and nestlings sharing the same nest had significantly more similar bacterial richness. Collectively, these results provide compelling evidence that bacterial species richness was associated with several aspects of the life history of their hosts. PMID:25750710

  12. Bacterial sphingophospholipids containing non-hydroxy fatty acid activate murine macrophages via Toll-like receptor 4 and stimulate bacterial clearance.

    PubMed

    Fujiwara, Nagatoshi; Porcelli, Steven A; Naka, Takashi; Yano, Ikuya; Maeda, Shinji; Kuwata, Hirotaka; Akira, Shizuo; Uematsu, Satoshi; Takii, Takemasa; Ogura, Hisashi; Kobayashi, Kazuo

    2013-06-01

    Sphingobacterium spiritivorum has five unusual sphingophospholipids (SPLs). Our previous study determined the complete chemical structures of these SPLs. The compositions of the long-chain bases/fatty acids in the ceramide portion, isoheptadecasphingosine/isopentadecanoate or isoheptadecasphingosine/2-hydroxy isopentadecanoate, are characteristic. The immune response against bacterial lipid components is considered to play important roles in microbial infections. It is reported that several bacterial sphingolipids composed of ceramide are recognized by CD1-restricted T and NKT cells and that a non-peptide antigen is recognized by γδ T cells. In this study, we demonstrated that these bacterial SPLs activated murine bone marrow macrophages (BMMs) via Toll-like receptor (TLR) 4 but not TLR2, although they slightly activated CD1d-restricted NKT and γδT cells. Interestingly, this TLR 4-recognition pathway of bacterial SPLs involves the fatty acid composition of ceramide in addition to the sugar moiety. A non-hydroxy fatty acid composed of ceramide was necessary to activate murine BMMs. The bacterial survival was significantly higher in TLR4-KO mice than in TLR2-KO and wild-type mice. The results indicate that activation of the TLR4-dependent pathway of BMMs by SPLs induced an innate immune response and contributed to bacterial clearance.

  13. Southern leaf blight disease severity is correlated with decreased maize leaf epiphytic bacterial species richness and the phyllosphere bacterial diversity decline is enhanced by nitrogen fertilization.

    PubMed

    Manching, Heather C; Balint-Kurti, Peter J; Stapleton, Ann E

    2014-01-01

    Plant leaves are inhabited by a diverse group of microorganisms that are important contributors to optimal growth. Biotic and abiotic effects on plant growth are usually studied in controlled settings examining response to variation in single factors and in field settings with large numbers of variables. Multi-factor experiments with combinations of stresses bridge this gap, increasing our understanding of the genotype-environment-phenotype functional map for the host plant and the affiliated epiphytic community. The maize inbred B73 was exposed to single and combination abiotic and the biotic stress treatments: low nitrogen fertilizer and high levels of infection with southern leaf blight (causal agent Cochliobolus heterostrophus). Microbial epiphyte samples were collected at the vegetative early-season phase and species composition was determined using 16S ribosomal intergenic spacer analysis. Plant traits and level of southern leaf blight disease were measured late-season. Bacterial diversity was different among stress treatment groups (P < 0.001). Lower species richness-alpha diversity-was correlated with increased severity of southern leaf blight disease when disease pressure was high. Nitrogen fertilization intensified the decline in bacterial alpha diversity. While no single bacterial ribotype was consistently associated with disease severity, small sets of ribotypes were good predictors of disease levels. Difference in leaf bacterial-epiphyte diversity early in the season were correlated with plant disease severity, supporting further tests of microbial epiphyte-disease correlations for use in predicting disease progression.

  14. Southern leaf blight disease severity is correlated with decreased maize leaf epiphytic bacterial species richness and the phyllosphere bacterial diversity decline is enhanced by nitrogen fertilization

    PubMed Central

    Manching, Heather C.; Balint-Kurti, Peter J.; Stapleton, Ann E.

    2014-01-01

    Plant leaves are inhabited by a diverse group of microorganisms that are important contributors to optimal growth. Biotic and abiotic effects on plant growth are usually studied in controlled settings examining response to variation in single factors and in field settings with large numbers of variables. Multi-factor experiments with combinations of stresses bridge this gap, increasing our understanding of the genotype-environment-phenotype functional map for the host plant and the affiliated epiphytic community. The maize inbred B73 was exposed to single and combination abiotic and the biotic stress treatments: low nitrogen fertilizer and high levels of infection with southern leaf blight (causal agent Cochliobolus heterostrophus). Microbial epiphyte samples were collected at the vegetative early-season phase and species composition was determined using 16S ribosomal intergenic spacer analysis. Plant traits and level of southern leaf blight disease were measured late-season. Bacterial diversity was different among stress treatment groups (P < 0.001). Lower species richness—alpha diversity—was correlated with increased severity of southern leaf blight disease when disease pressure was high. Nitrogen fertilization intensified the decline in bacterial alpha diversity. While no single bacterial ribotype was consistently associated with disease severity, small sets of ribotypes were good predictors of disease levels. Difference in leaf bacterial-epiphyte diversity early in the season were correlated with plant disease severity, supporting further tests of microbial epiphyte-disease correlations for use in predicting disease progression. PMID:25177328

  15. Pathogenic bacterial species associated with endodontic infection evade innate immune control by disabling neutrophils.

    PubMed

    Matsui, Aritsune; Jin, Jun-O; Johnston, Christopher D; Yamazaki, Hajime; Houri-Haddad, Yael; Rittling, Susan R

    2014-10-01

    Endodontic infections, in which oral bacteria access the tooth pulp chamber, are common and do not resolve once established. To investigate the effects of these infections on the innate immune response, we established a mouse subcutaneous chamber model, where a mixture of four oral pathogens commonly associated with these infections (endodontic pathogens [EP]), i.e., Fusobacterium nucleatum, Streptococcus intermedius, Parvimonas micra, and Prevotella intermedia, was inoculated into subcutaneously implanted titanium chambers. Cells that infiltrated the chamber after these infections were primarily neutrophils; however, these neutrophils were unable to control the infection. Infection with a nonpathogenic oral bacterial species, Streptococcus mitis, resulted in well-controlled infection, with bacterial numbers reduced by 4 to 5 log units after 7 days. Propidium iodide (PI) staining of the chamber neutrophils identified three distinct populations: neutrophils from EP-infected chambers were intermediate in PI staining, while cells in chambers from mice infected with S. mitis were PI positive (apoptotic) or negative (live). Strikingly, neutrophils from EP-infected chambers were severely impaired in their ability to phagocytose and to generate reactive oxygen species in vitro after removal from the chamber compared to cells from S. mitis-infected chambers. The mechanism of neutrophil impairment was necrotic cell death as determined by morphological analyses. P. intermedia alone could induce a similar neutrophil phenotype. We conclude that the endodontic pathogens, particularly P. intermedia, can efficiently disable and kill infiltrating neutrophils, allowing these infections to become established. These results can help explain the persistence of endodontic infections and demonstrate a new virulence mechanism associated with P. intermedia.

  16. Pathogenic Bacterial Species Associated with Endodontic Infection Evade Innate Immune Control by Disabling Neutrophils

    PubMed Central

    Matsui, Aritsune; Jin, Jun-O; Johnston, Christopher D.; Yamazaki, Hajime; Houri-Haddad, Yael

    2014-01-01

    Endodontic infections, in which oral bacteria access the tooth pulp chamber, are common and do not resolve once established. To investigate the effects of these infections on the innate immune response, we established a mouse subcutaneous chamber model, where a mixture of four oral pathogens commonly associated with these infections (endodontic pathogens [EP]), i.e., Fusobacterium nucleatum, Streptococcus intermedius, Parvimonas micra, and Prevotella intermedia, was inoculated into subcutaneously implanted titanium chambers. Cells that infiltrated the chamber after these infections were primarily neutrophils; however, these neutrophils were unable to control the infection. Infection with a nonpathogenic oral bacterial species, Streptococcus mitis, resulted in well-controlled infection, with bacterial numbers reduced by 4 to 5 log units after 7 days. Propidium iodide (PI) staining of the chamber neutrophils identified three distinct populations: neutrophils from EP-infected chambers were intermediate in PI staining, while cells in chambers from mice infected with S. mitis were PI positive (apoptotic) or negative (live). Strikingly, neutrophils from EP-infected chambers were severely impaired in their ability to phagocytose and to generate reactive oxygen species in vitro after removal from the chamber compared to cells from S. mitis-infected chambers. The mechanism of neutrophil impairment was necrotic cell death as determined by morphological analyses. P. intermedia alone could induce a similar neutrophil phenotype. We conclude that the endodontic pathogens, particularly P. intermedia, can efficiently disable and kill infiltrating neutrophils, allowing these infections to become established. These results can help explain the persistence of endodontic infections and demonstrate a new virulence mechanism associated with P. intermedia. PMID:25024367

  17. Bacterial species associated with traditional starter cultures used for fermented bamboo shoot production in Manipur state of India.

    PubMed

    Jeyaram, K; Romi, W; Singh, Th Anand; Devi, A Ranjita; Devi, S Soni

    2010-09-30

    Soidon is a non-salted acidic fermented food prepared from the succulent bamboo shoot tip of Schizostachyum capitatum Munro by using a traditional liquid starter called "soidon mahi" in Manipur state of India. In this study, 163 bacterial isolates associated with this starter samples were identified and their population distribution was investigated by amplified ribosomal DNA restriction analysis (ARDRA), 16S rDNA sequencing and randomly amplified polymorphic DNA (RAPD) analysis. This acidic starter (pH 4.5+/-0.15) was dominated by a characteristic association of Bacillus and lactic acid bacteria (LAB) together. The population distribution of dominant species were Bacillus subtilis 29.3%, Bacillus cereus 35.7%, Bacillus pumilus 2.6%, Lactobacillus brevis 9.6%, Lactobacillus plantarum 5.1%, Carnobacterium sp. 11.9%, Enterococcus faecium 1.2% and Pseudomonas fluorescens 4.6%. Alarming population load (10(6)-10(7)cfu/ml) of B. cereus in 87% of starter samples studied should raise concern regarding biosafety of soidon consumption. PCR amplification of 16S-23S rDNA intergenic transcribed spacer (ITS) region and ITS-RFLP profiles revealed a high diversity with eight subgroups in B. subtilis, five subgroups in B. cereus and three subgroups in L. brevis isolates. The most abundant B. subtilis subgroup IB.1 distributed in most of the samples showed very less clonal variability during RAPD analysis. The molecular methods used in this study identified the dominant strains of Bacillus and LAB distributed in most of the starter samples. These dominant strains of B. subtilis, L. brevis and L. plantarum would allow for developing a defined starter culture for the production of quality soidon.

  18. Comparing the tolerance limits of selected bacterial and protozoan species to nickel in wastewater systems.

    PubMed

    Kamika, I; Momba, M N B

    2011-12-01

    Heavy-metal resistant microorganisms play a significant role in the treatment of industrial wastewater. The detoxifying ability of these resistant microorganisms can be manipulated for bioremediation of heavy metals in wastewater systems. This study aimed at comparing the tolerance limit of selected wastewater protozoan species (Aspidisca sp., Trachelophyllum sp. and Peranema sp.) against Ni(2+) with that of selected bacterial species (Bacillus licheniformis-ATCC12759, Brevibacillus laterosporus-ATCC64 and Pseudomonas putida-ATCC31483) commonly found in wastewater systems. The isolates were exposed to various concentrations of Ni(2+) in mixed liquor and their tolerance to Ni(2+) assessed at different temperatures (25°C, 30°C, 35°C and 40°C) and pHs (4, 6, 7, 8 and 10). The physicochemical parameters such as chemical oxygen demand (COD) and dissolved oxygen (DO) of the media and the growth rates of the isolates were measured using standard methods. In terms of their minimum inhibitory concentrations (MIC), the results revealed that the isolates could tolerate Ni(2+) at concentrations ranging between 32 and 52ppm for protozoa and between 52 and 84ppm for bacteria. B. licheniformis-ATCC12759 was the most tolerant bacterial species (MIC: 84ppm-Ni(2+)) while Peranema sp. was the most tolerant protozoan species (MIC: 52ppm-Ni(2+)). At 10 and/or 20ppm-Ni(2+) the growth of B. licheniformis-ATCC12759 (6.30 days(-1) for 10 and 5.73 days(-1) for 20ppm-Ni(2+)), P. putida-ATCC31483 (6.02 days(-1) for 10 and 5.31 days(-1) for 20ppm-Ni(2+)) and Peranema sp. (2.15 days(-1) for 10ppm-Ni(2+)) was stimulated after one day of incubation. Statistical evidence showed significant differences (p=0.0065) between the MIC of the six isolates and positive correlations between COD and the growth rates of isolates (r=0.8999/0.8810 for bacteria/protozoa). The tolerance limit of all isolates was significantly dependent on the pH and the temperature. The study suggests that these isolates can

  19. Isolation and identification of a new tetrodotoxin-producing bacterial species, Raoultella terrigena, from Hong Kong marine puffer fish Takifugu niphobles.

    PubMed

    Yu, Vincent Chung-Him; Yu, Peter Hoi-Fu; Ho, Kin-Chung; Lee, Fred Wang-Fat

    2011-01-01

    Puffer fish, Takifugu niphobles, collected from the Hong Kong coastal waters were screened for tetrodotoxin-producing bacteria. A Gram-negative, non-acid-fast, non-sporing and rod shaped bacterial strain (designated as gutB01) was isolated from the intestine of the puffer fish and was shown to produce tetrodotoxin (TTX). Based on the Microbial Identification (MIDI) and 16S-23S rDNA internal transcribed spacer (ITS) phylogenetic analysis, the strain was identified as Raoultella terrigena. The TTX production ability of the strain was confirmed by mouse bioassay, ELISA and mass spectrometry (MALDI-TOF). Our results reiterate that the TTX found in puffer fish was likely produced by the associated bacteria and TTX are widely produced amongst a diversity of bacterial species.

  20. Structure-Activity Relationships of Antimicrobial Gallic Acid Derivatives from Pomegranate and Acacia Fruit Extracts against Potato Bacterial Wilt Pathogen.

    PubMed

    Farag, Mohamed A; Al-Mahdy, Dalia A; Salah El Dine, Riham; Fahmy, Sherifa; Yassin, Aymen; Porzel, Andrea; Brandt, Wolfgang

    2015-06-01

    Bacterial wilts of potato, tomato, pepper, and or eggplant caused by Ralstonia solanacearum are among the most serious plant diseases worldwide. In this study, the issue of developing bactericidal agents from natural sources against R. solanacearum derived from plant extracts was addressed. Extracts prepared from 25 plant species with antiseptic relevance in Egyptian folk medicine were screened for their antimicrobial properties against the potato pathogen R. solancearum by using the disc-zone inhibition assay and microtitre plate dilution method. Plants exhibiting notable antimicrobial activities against the tested pathogen include extracts from Acacia arabica and Punica granatum. Bioactivity-guided fractionation of A. arabica and P. granatum resulted in the isolation of bioactive compounds 3,5-dihydroxy-4-methoxybenzoic acid and gallic acid, in addition to epicatechin. All isolates displayed significant antimicrobial activities against R. solanacearum (MIC values 0.5-9 mg/ml), with 3,5-dihydroxy-4-methoxybenzoic acid being the most effective one with a MIC value of 0.47 mg/ml. We further performed a structure-activity relationship (SAR) study for the inhibition of R. solanacearum growth by ten natural, structurally related benzoic acids.

  1. The Influence of Time and Plant Species on the Composition of the Decomposing Bacterial Community in a Stream Ecosystem.

    PubMed

    Wymore, Adam S; Liu, Cindy M; Hungate, Bruce A; Schwartz, Egbert; Price, Lance B; Whitham, Thomas G; Marks, Jane C

    2016-05-01

    Foliar chemistry influences leaf decomposition, but little is known about how litter chemistry affects the assemblage of bacterial communities during decomposition. Here we examined relationships between initial litter chemistry and the composition of the bacterial community in a stream ecosystem. We incubated replicated genotypes of Populus fremontii and P. angustifolia leaf litter that differ in percent tannin and lignin, then followed changes in bacterial community composition during 28 days of decomposition using 16S rRNA gene-based pyrosequencing. Using a nested experimental design, the majority of variation in bacterial community composition was explained by time (i.e., harvest day) (R(2) = 0.50). Plant species, nested within harvest date, explained a significant but smaller proportion of the variation (R(2) = 0.03). Significant differences in community composition between leaf species were apparent at day 14, but no significant differences existed among genotypes. Foliar chemistry correlated significantly with community composition at day 14 (r = 0.46) indicating that leaf litter with more similar phytochemistry harbor bacterial communities that are alike. Bacteroidetes and β-proteobacteria dominated the bacterial assemblage on decomposing leaves, and Verrucomicrobia and α- and δ-proteobacteria became more abundant over time. After 14 days, bacterial diversity diverged significantly between leaf litter types with fast-decomposing P. fremontii hosting greater richness than slowly decomposing P. angustifolia; however, differences were no longer present after 28 days in the stream. Leaf litter tannin, lignin, and lignin: N ratios all correlated negatively with diversity. This work shows that the bacterial community on decomposing leaves in streams changes rapidly over time, influenced by leaf species via differences in genotype-level foliar chemistry.

  2. Bacterial viability and antibiotic susceptibility testing with SYTOX green nucleic acid stain.

    PubMed Central

    Roth, B L; Poot, M; Yue, S T; Millard, P J

    1997-01-01

    A fluorescent nucleic acid stain that does not penetrate living cells was used to assess the integrity of the plasma membranes of bacteria. SYTOX Green nucleic acid stain is an unsymmetrical cyanine dye with three positive charges that is completely excluded from live eukaryotic and prokaryotic cells. Binding of SYTOX Green stain to nucleic acids resulted in a > 500-fold enhancement in fluorescence emission (absorption and emission maxima at 502 and 523 nm, respectively), rendering bacteria with compromised plasma membranes brightly green fluorescent. SYTOX Green stain is readily excited by the 488-nm line of the argon ion laser. The fluorescence signal from membrane-compromised bacteria labeled with SYTOX Green stain was typically > 10-fold brighter than that from intact organisms. Bacterial suspensions labeled with SYTOX Green stain emitted green fluorescence in proportion to the fraction of permeabilized cells in the population, which was quantified by microscopy, fluorometry, or flow cytometry. Flow cytometric and fluorometric approaches were used to quantify the effect of beta-lactam antibiotics on the cell membrane integrity of Escherichia coli. Detection and discrimination of live and permeabilized cells labeled with SYTOX Green stain by flow cytometry were markedly improved over those by propidium iodide-based tests. These studies showed that bacterial labeling with SYTOX Green stain is an effective alternative to conventional methods for measuring bacterial viability and antibiotic susceptibility. PMID:9172364

  3. Both leaf properties and microbe-microbe interactions influence within-species variation in bacterial population diversity and structure in the lettuce (Lactuca Species) phyllosphere.

    PubMed

    Hunter, Paul J; Hand, Paul; Pink, David; Whipps, John M; Bending, Gary D

    2010-12-01

    Morphological and chemical differences between plant genera influence phyllosphere microbial populations, but the factors driving within-species variation in phyllosphere populations are poorly understood. Twenty-six lettuce accessions were used to investigate factors controlling within-species variation in phyllosphere bacterial populations. Morphological and physiochemical characteristics of the plants were compared, and bacterial community structure and diversity were investigated using terminal restriction fragment length polymorphism (T-RFLP) profiling and 16S rRNA gene clone libraries. Plant morphology and levels of soluble carbohydrates, calcium, and phenolic compounds (which have long been associated with plant responses to biotic stress) were found to significantly influence bacterial community structure. Clone libraries from three representative accessions were found to be significantly different in terms of both sequence differences and the bacterial genera represented. All three libraries were dominated by Pseudomonas species and the Enterobacteriaceae family. Significant differences in the relative proportions of genera in the Enterobacteriaceae were detected between lettuce accessions. Two such genera (Erwinia and Enterobacter) showed significant variation between the accessions and revealed microbe-microbe interactions. We conclude that both leaf surface properties and microbial interactions are important in determining the structure and diversity of the phyllosphere bacterial community.

  4. Both Leaf Properties and Microbe-Microbe Interactions Influence Within-Species Variation in Bacterial Population Diversity and Structure in the Lettuce (Lactuca Species) Phyllosphere▿

    PubMed Central

    Hunter, Paul J.; Hand, Paul; Pink, David; Whipps, John M.; Bending, Gary D.

    2010-01-01

    Morphological and chemical differences between plant genera influence phyllosphere microbial populations, but the factors driving within-species variation in phyllosphere populations are poorly understood. Twenty-six lettuce accessions were used to investigate factors controlling within-species variation in phyllosphere bacterial populations. Morphological and physiochemical characteristics of the plants were compared, and bacterial community structure and diversity were investigated using terminal restriction fragment length polymorphism (T-RFLP) profiling and 16S rRNA gene clone libraries. Plant morphology and levels of soluble carbohydrates, calcium, and phenolic compounds (which have long been associated with plant responses to biotic stress) were found to significantly influence bacterial community structure. Clone libraries from three representative accessions were found to be significantly different in terms of both sequence differences and the bacterial genera represented. All three libraries were dominated by Pseudomonas species and the Enterobacteriaceae family. Significant differences in the relative proportions of genera in the Enterobacteriaceae were detected between lettuce accessions. Two such genera (Erwinia and Enterobacter) showed significant variation between the accessions and revealed microbe-microbe interactions. We conclude that both leaf surface properties and microbial interactions are important in determining the structure and diversity of the phyllosphere bacterial community. PMID:20952648

  5. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    PubMed Central

    Lui, Clarissa; Cady, Nathaniel C.; Batt, Carl A.

    2009-01-01

    The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform. PMID:22412335

  6. [Inhibitory effect of essential oils, food additives, peracetic acid and detergents on bacterial histidine decarboxylase].

    PubMed

    Kamii, Eri; Terada, Gaku; Akiyama, Jyunki; Isshiki, Kenji

    2011-01-01

    The aim of this study is to examine whether various essential oils, food additives, peracetic acid and detergents inhibit bacterial histidine decarboxylase. Crude extract of Morganella morganii NBRC3848 was prepared and incubated with various agents. Histidine decarboxylase activity was significantly inhibited (p<0.05) by 26 of 45 compounds tested. Among the 26 agents, sodium hypochlorite completely decomposed both histidine and histamine, while peracetic acid caused slight decomposition. Histidine and histamine were stable in the presence of the other 24 agents. These results indicated that 25 of the agents examined were inhibitors of histidine decarboxylase.

  7. Host species and developmental stage, but not host social structure, affects bacterial community structure in socially polymorphic bees.

    PubMed

    McFrederick, Quinn S; Wcislo, William T; Hout, Michael C; Mueller, Ulrich G

    2014-05-01

    Social transmission and host developmental stage are thought to profoundly affect the structure of bacterial communities associated with honey bees and bumble bees, but these ideas have not been explored in other bee species. The halictid bees Megalopta centralis and M. genalis exhibit intrapopulation social polymorphism, which we exploit to test whether bacterial communities differ by host social structure, developmental stage, or host species. We collected social and solitary Megalopta nests and sampled bees and nest contents from all stages of host development. To survey these bacterial communities, we used 16S rRNA gene 454 pyrosequencing. We found no effect of social structure, but found differences by host species and developmental stage. Wolbachia prevalence differed between the two host species. Bacterial communities associated with different developmental stages appeared to be driven by environmentally acquired bacteria. A Lactobacillus kunkeei clade bacterium that is consistently associated with other bee species was dominant in pollen provisions and larval samples, but less abundant in mature larvae and pupae. Foraging adults appeared to often reacquire L. kunkeei clade bacteria, likely while foraging at flowers. Environmental transmission appears to be more important than social transmission for Megalopta bees at the cusp between social and solitary behavior.

  8. Effects of diet type, developmental stage, and gut compartment in the gut bacterial communities of two Cerambycidae species (Coleoptera).

    PubMed

    Kim, Jeong Myeong; Choi, Min-Young; Kim, Jae-Woo; Lee, Shin Ae; Ahn, Jae-Hyung; Song, Jaekyeong; Kim, Seong-Hyun; Weon, Hang-Yeon

    2017-01-01

    The gut bacterial community of wood-feeding beetles has been examined for its role on plant digestion and biocontrol method development. Monochamus alternatus and Psacothea hilaris, both belonging to the subfamily Lamiinae, are woodfeeding beetles found in eastern Asia and Europe and generally considered as destructive pests for pine and mulberry trees, respectively. However, limited reports exist on the gut bacterial communities in these species. Here, we characterized gut bacterial community compositions in larva and imago of each insect species reared with host tree logs and artificial diets as food sources. High-throughput 454 pyrosequencing of bacterial 16S rRNA gene revealed 225 operational taxonomic units (OTUs) based on a 97% sequences similarity cutoff from 138,279 sequence reads, the majority of which were derived from Proteobacteria (48.2%), Firmicutes (45.5%), and Actinobacteria (5.2%). The OTU network analysis revealed 7 modules with densely connected OTUs in specific gut samples, in which the distributions of Lactococcus-, Kluyvera-, Serratia-, and Enterococcus-related OTUs were distinct between diet types or developmental stages of the host insects. The gut bacterial communities were separated on a detrended correspondence analysis (DCA) plot and by c-means fuzzy clustering analysis, according to diet type. The results from this study suggest that diet was the main determinant for gut bacterial community composition in the two beetles.

  9. Comparison of archaeal and bacterial communities in two sponge species and seawater from an Indonesian coral reef environment.

    PubMed

    Polónia, Ana Rita Moura; Cleary, Daniel Francis Richard; Freitas, Rossana; Coelho, Francisco José Riso da Costa; de Voogd, Nicole Joy; Gomes, Newton Carlos Marcial

    2016-10-01

    Most existing coral reef studies have focused on a single biotope and a single domain (Archaea or Bacteria). Few coral reef studies have explored the archaeal and bacterial community simultaneously. In this study, we compare the diversity and composition of archaeal and bacterial communities in seawater and two closely related sponge species (Stylissa carteri and Stylissa massa) in the Berau reef system, Indonesia. A 16S rRNA gene barcoded pyrosequencing approach was used to test to what extent seawater, S. carteri and S. massa host compositionally distinct communities of Archaea and Bacteria. Proteobacteria dominated the bacterial communities of all three studied biotopes whereas Euryarchaeota was the most abundant archaeal phylum in seawater and Crenarchaeota the most abundant archaeal phylum in both Stylissa species. Biotopes explained 56% and 53% of the variation in archaeal and bacterial composition respectively and there was significant congruence between the composition of archaeal and bacterial communities. These results suggest that the processes that drive bacterial composition within the studied biotopes may be fundamentally similar to those that drive archaeal composition.

  10. Influences of Plant Species, Season and Location on Leaf Endophytic Bacterial Communities of Non-Cultivated Plants.

    PubMed

    Ding, Tao; Melcher, Ulrich

    2016-01-01

    Bacteria are known to be associated endophytically with plants. Research on endophytic bacteria has identified their importance in food safety, agricultural production and phytoremediation. However, the diversity of endophytic bacterial communities and the forces that shape their compositions in non-cultivated plants are largely uncharacterized. In this study, we explored the diversity, community structure, and dynamics of endophytic bacteria in different plant species in the Tallgrass Prairie Preserve of northern Oklahoma, USA. High throughput sequencing of amplified segments of bacterial rDNA from 81 samples collected at four sampling times from five plant species at four locations identified 335 distinct OTUs at 97% sequence similarity, representing 16 phyla. Proteobacteria was the dominant phylum in the communities, followed by the phyla Bacteriodetes and Actinobacteria. Bacteria from four classes of Proteobacteria were detected with Alphaproteobacteria as the dominant class. Analysis of molecular variance revealed that host plant species and collecting date had significant influences on the compositions of the leaf endophytic bacterial communities. The proportion of Alphaproteobacteria was much higher in the communities from Asclepias viridis than from other plant species and differed from month to month. The most dominant bacterial groups identified in LDA Effect Size analysis showed host-specific patterns, indicating mutual selection between host plants and endophytic bacteria and that leaf endophytic bacterial compositions were dynamic, varying with the host plant's growing season in three distinct patterns. In summary, next generation sequencing has revealed variations in the taxonomic compositions of leaf endophytic bacterial communities dependent primarily on the nature of the plant host species.

  11. Susceptibility of different bacterial species isolated from food animals to copper sulphate, zinc chloride and antimicrobial substances used for disinfection.

    PubMed

    Aarestrup, Frank M; Hasman, Henrik

    2004-05-20

    A total of 569 different bacterial isolates (156 Salmonella, 202 E. coli, 43 S. aureus, 38 S. hyicus, 52 E. faecalis, 78 E. faecium) were tested for susceptibility to copper sulphate, benzalkonium chloride, hydrogen peroxide and chlorhexidine using MIC determinations. A total of 442 isolates were also tested for susceptibility to formaldehyde and 177 isolates for susceptibility to zinc chloride. Enterococcal isolates formed a bimodal distribution of MICs to copper sulphate, whereas the other bacterial species formed one large population. Otherwise the isolates formed one large population of susceptibilities to the different antimicrobial agents. Large variations were observed in the susceptibility of the different bacterial species to the different compounds. Staphylococci were in general very susceptible to all antimicrobial compounds tested. The Salmonella isolates were in general less susceptible to copper sulphate, benzalkonium chloride and chlorhexidine followed by E. coli and the Gram-positive species. The opposite was the case for zinc chloride. All isolates were very susceptible to H(2)O(2) with MICs ranging from 0.002 to 0.016%, and to formaldehyde with MICs at 0.003 and 0.006%. This study showed that Danish bacterial isolates from livestock so far have not or have only to a limited degree developed resistance to antimicrobial compounds commonly used for disinfection. Acquired copper resistance was only found in enterococci. There were large differences in the intrinsic susceptibility of the different bacterial species to these compounds, and Salmonella especially seems intrinsically less susceptible than the other bacterial species, which might have human health implications.

  12. Beneficial Effect of Acetic Acid on the Xylose Utilization and Bacterial Cellulose Production by Gluconacetobacter xylinus.

    PubMed

    Yang, Xiao-Yan; Huang, Chao; Guo, Hai-Jun; Xiong, Lian; Luo, Jun; Wang, Bo; Chen, Xue-Fang; Lin, Xiao-Qing; Chen, Xin-De

    2014-09-01

    In this work, acetic acid was found as one promising substrate to improve xylose utilization by Gluconacetobacter xylinus CH001. Also, with the help of adding acetic acid into medium, the bacterial cellulose (BC) production by G. xylinus was increased significantly. In the medium containing 3 g l(-1) acetic acid, the optimal xylose concentration for BC production was 20 g l(-1). In the medium containing 20 g l(-1) xylose, the xylose utilization and BC production by G. xylinus were stimulated by acetic acid within certain concentration. The highest BC yield (1.35 ± 0.06 g l(-1)) was obtained in the medium containing 20 g l(-1) xylose and 3 g l(-1) acetic acid after 14 days. This value was 6.17-fold higher than the yield (0.21 ± 0.01 g l(-1)) in the medium only containing 20 g l(-1) xylose. The results analyzed by FE-SEM, FTIR, and XRD showed that acetic acid affected little on the microscopic morphology and physicochemical characteristics of BC. Base on the phenomenon observed, lignocellulosic acid hydrolysates (xylose and acetic acid are main carbon sources present in it) could be considered as one potential substrate for BC production.

  13. The effect of the bacterial product, succinic acid, on neutrophil bactericidal activity.

    PubMed

    Abdul-Majid, K B; Kenny, P A; Finlay-Jones, J J

    1997-02-01

    We investigated the effect of succinic acid on neutrophil bactericidal activity in a model of intra-abdominal abscess induced in mice by the peritoneal inoculation of 5 x 10(6) cfu ml-1 E. coli and 5 x 10(8) cfu ml-1 B. fragilis plus 1 mg of bran as faecal fibre analogue. The mean pH of the induced abscesses at week 1 was 6.7, higher than the pH associated with succinic acid inhibitory activity. We therefore determined the effect of succinic acid (0-100 mM) at pH 6.7 on the bactericidal activity of mouse bone marrow-derived neutrophils. Phagocytic killing of Proteus mirabilis by neutrophils was significantly inhibited by 30-100 mM succinic acid at pH 6.7 but there was no significant effect of succinic acid on engulfment of bacteria at this pH. However, significant inhibition of intracellular killing (assayed by adding succinic acid to suspensions of neutrophils which had engulfed bacteria in low serum concentrations but in the absence of succinic acid) was noted at 70 and 100 mM. These results indicate that succinic acid inhibits neutrophil bactericidal activity at a physiological pH, principally through inhibition of intracellular killing mechanisms and therefore contributing to bacterial persistence in this model of abscess formation.

  14. Linking regional variation of epibiotic bacterial diversity and trophic ecology in a new species of Kiwaidae (Decapoda, Anomura) from East Scotia Ridge (Antarctica) hydrothermal vents.

    PubMed

    Zwirglmaier, Katrin; Reid, William D K; Heywood, Jane; Sweeting, Christopher J; Wigham, Benjamin D; Polunin, Nicholas V C; Hawkes, Jeff A; Connelly, Douglas P; Pearce, David; Linse, Katrin

    2015-02-01

    We analyzed the diversity of bacterial epibionts and trophic ecology of a new species of Kiwa yeti crab discovered at two hydrothermal vent fields (E2 and E9) on the East Scotia Ridge (ESR) in the Southern Ocean using a combination of 454 pyrosequencing, Sanger sequencing, and stable isotope analysis. The Kiwa epibiont communities were dominated by Epsilon- and Gammaproteobacteria. About 454 sequencing of the epibionts on 15 individual Kiwa specimen revealed large regional differences between the two hydrothermal vent fields: at E2, the bacterial community on the Kiwa ventral setae was dominated (up to 75%) by Gammaproteobacteria, whereas at E9 Epsilonproteobacteria dominated (up to 98%). Carbon stable isotope analysis of both Kiwa and the bacterial epibionts also showed distinct differences between E2 and E9 in mean and variability. Both stable isotope and sequence data suggest a dominance of different carbon fixation pathways of the epibiont communities at the two vent fields. At E2, epibionts were putatively fixing carbon via the Calvin-Benson-Bassham and reverse tricarboxylic acid cycle, while at E9 the reverse tricarboxylic acid cycle dominated. Co-varying epibiont diversity and isotope values at E2 and E9 also present further support for the hypothesis that epibionts serve as a food source for Kiwa.

  15. Linking regional variation of epibiotic bacterial diversity and trophic ecology in a new species of Kiwaidae (Decapoda, Anomura) from East Scotia Ridge (Antarctica) hydrothermal vents

    PubMed Central

    Zwirglmaier, Katrin; Reid, William D K; Heywood, Jane; Sweeting, Christopher J; Wigham, Benjamin D; Polunin, Nicholas V C; Hawkes, Jeff A; Connelly, Douglas P; Pearce, David; Linse, Katrin

    2015-01-01

    We analyzed the diversity of bacterial epibionts and trophic ecology of a new species of Kiwa yeti crab discovered at two hydrothermal vent fields (E2 and E9) on the East Scotia Ridge (ESR) in the Southern Ocean using a combination of 454 pyrosequencing, Sanger sequencing, and stable isotope analysis. The Kiwa epibiont communities were dominated by Epsilon- and Gammaproteobacteria. About 454 sequencing of the epibionts on 15 individual Kiwa specimen revealed large regional differences between the two hydrothermal vent fields: at E2, the bacterial community on the Kiwa ventral setae was dominated (up to 75%) by Gammaproteobacteria, whereas at E9 Epsilonproteobacteria dominated (up to 98%). Carbon stable isotope analysis of both Kiwa and the bacterial epibionts also showed distinct differences between E2 and E9 in mean and variability. Both stable isotope and sequence data suggest a dominance of different carbon fixation pathways of the epibiont communities at the two vent fields. At E2, epibionts were putatively fixing carbon via the Calvin-Benson-Bassham and reverse tricarboxylic acid cycle, while at E9 the reverse tricarboxylic acid cycle dominated. Co-varying epibiont diversity and isotope values at E2 and E9 also present further support for the hypothesis that epibionts serve as a food source for Kiwa. PMID:25515351

  16. Hyperoxaluria leads to dysbiosis and drives selective enrichment of oxalate metabolizing bacterial species in recurrent kidney stone endures

    PubMed Central

    Suryavanshi, Mangesh V.; Bhute, Shrikant S.; Jadhav, Swapnil D.; Bhatia, Manish S.; Gune, Rahul P.; Shouche, Yogesh S.

    2016-01-01

    Hyperoxaluria due to endogenously synthesized and exogenously ingested oxalates is a leading cause of recurrent oxalate stone formations. Even though, humans largely rely on gut microbiota for oxalate homeostasis, hyperoxaluria associated gut microbiota features remain largely unknown. Based on 16S rRNA gene amplicons, targeted metagenomic sequencing of formyl-CoA transferase (frc) gene and qPCR assay, we demonstrate a selective enrichment of Oxalate Metabolizing Bacterial Species (OMBS) in hyperoxaluria condition. Interestingly, higher than usual concentration of oxalate was found inhibitory to many gut microbes, including Oxalobacter formigenes, a well-characterized OMBS. In addition a concomitant enrichment of acid tolerant pathobionts in recurrent stone sufferers is observed. Further, specific enzymes participating in oxalate metabolism are found augmented in stone endures. Additionally, hyperoxaluria driven dysbiosis was found to be associated with oxalate content, stone episodes and colonization pattern of Oxalobacter formigenes. Thus, we rationalize the first in-depth surveillance of OMBS in the human gut and their association with hyperoxaluria. Our findings can be utilized in the treatment of hyperoxaluria associated recurrent stone episodes. PMID:27708409

  17. Pseudomonas granadensis sp. nov., a new bacterial species isolated from the Tejeda, Almijara and Alhama Natural Park, Granada, Spain.

    PubMed

    Pascual, Javier; García-López, Marina; Bills, Gerald F; Genilloud, Olga

    2015-02-01

    During the course of screening bacterial isolates as sources of as-yet unknown bioactive compounds with pharmaceutical applications, a chemo-organotrophic, Gram-negative bacterium was isolated from a soil sample taken from the Tejeda, Almijara and Alhama Natural Park, Granada, Spain. Strain F-278,770(T) was oxidase- and catalase-positive, aerobic, with a respiratory type of metabolism with oxygen as the terminal electron acceptor, non-spore-forming and motile by one polar flagellum, although some cells had two polar flagella. Phylogenetic analysis of the 16S rRNA, gyrB, rpoB and rpoD genes revealed that strain F-278,770(T) belongs to the Pseudomonas koreensis subgroup (Pseudomonas fluorescens lineage), with Pseudomonas moraviensis, P. koreensis, P. baetica and P. helmanticensis as its closest relatives. Chemotaxonomic traits such as polar lipid and fatty acid compositions and G+C content of genomic DNA corroborated the placement of strain F-278,770(T) in the genus Pseudomonas. DNA-DNA hybridization assays and phenotypic traits confirmed that this strain represents a novel species of the genus Pseudomonas, for which the name Pseudomonas granadensis sp. nov. is proposed. The type strain is F-278,770(T) ( = DSM 28040(T) = LMG 27940(T)).

  18. [Fatty acids in different edible fish species from Mexico].

    PubMed

    Castro González, María Isabel; Rodríguez, Ana Gabriela Maafs; Galindo Gómez, Carlos

    2013-12-01

    Different biotic and abiotic factors determine the fatty acid (FA) composition of fish tissues and organs. This information is useful for humans due to the fact that fish consumption is associated with health benefits. The aim of the present study was to identify the variation in the concentration of fatty acids, according to different factors, among ten edible marine fish species in Mexico, collected from June to December 2009 in the largest fish market in Mexico City: Euthynnus alletteratus, Sciaenops ocellatus, Bairdiella chrysoura, Sphyraena guachancho, Symphurus elongatus, Istiophorus platypterus, Ophichthus rex, Eugerres plumieri, Eucinostomus entomelas and Oreochromrnis mossambicus. Lipid content was gravimetrically quantified, the fatty acids were determined using a gas chromatograph and the results were statistically analyzed. Total lipid content ranged from 0.93 to 1.95 g/100 g in E. entomelas and O. urolepis hornorum, respectively. E. alletteratus, B. chrysoura, S. elongatus, I. platypterus, O. rex and E. plumieri presented the following order in FA concentration: Polyunsaturated FA (PUFA)>Saturated FA (SFA)>Monounsaturated FA (MUFA). S. ocellatus, S. guachancho and E. entomelas presented SFA>PUFA>MUFA; and only O. mossambicus presented SFA>MUFA>PUFA. O. mossambicus had the highest concentration (mg/100 g) of SFA (559.40) and MUFA (442.60), while B. chrysoura presented the highest content (mg/100 g) of PUFA (663.03), n-3 PUFA (514.03), EPA+DHA (506.10) and n-6 PUFA (145.80). Biotic and abiotic factors of the analyzed fish significantly influenced their FA concentration. Subtropical species presented 42.1% more EPA+DHA than tropical specie. Values presented here will vary according to the changes in the ecosystem and characteristics of each fish species, however the information generated in the present study is useful for improving fish consumption recommendations.

  19. Diversity and localization of bacterial endosymbionts from whitefly species collected in Brazil.

    PubMed

    Marubayashi, Julio Massaharu; Kliot, Adi; Yuki, Valdir Atsushi; Rezende, Jorge Alberto Marques; Krause-Sakate, Renate; Pavan, Marcelo Agenor; Ghanim, Murad

    2014-01-01

    Whiteflies (Hemiptera: Aleyrodidae) are sap-sucking insect pests, and some cause serious damage in agricultural crops by direct feeding and by transmitting plant viruses. Whiteflies maintain close associations with bacterial endosymbionts that can significantly influence their biology. All whitefly species harbor a primary endosymbiont, and a diverse array of secondary endosymbionts. In this study, we surveyed 34 whitefly populations collected from the states of Sao Paulo, Bahia, Minas Gerais and Parana in Brazil, for species identification and for infection with secondary endosymbionts. Sequencing the mitochondrial Cytochrome Oxidase I gene revealed the existence of five whitefly species: The sweetpotato whitefly Bemisia tabaci B biotype (recently termed Middle East-Asia Minor 1 or MEAM1), the greenhouse whitefly Trialeurodes vaporariorum, B. tabaci A biotype (recently termed New World 2 or NW2) collected only from Euphorbia, the Acacia whitefly Tetraleurodes acaciae and Bemisia tuberculata both were detected only on cassava. Sequencing rRNA genes showed that Hamiltonella and Rickettsia were highly prevalent in all MEAM1 populations, while Cardinium was close to fixation in only three populations. Surprisingly, some MEAM1 individuals and one NW2 population were infected with Fritschea. Arsenopnohus was the only endosymbiont detected in T. vaporariorum. In T. acaciae and B. tuberculata populations collected from cassava, Wolbachia was fixed in B. tuberculata and was highly prevalent in T. acaciae. Interestingly, while B. tuberculata was additionally infected with Arsenophonus, T. acaciae was infected with Cardinium and Fritschea. Fluorescence in situ hybridization analysis on representative individuals showed that Hamiltonella, Arsenopnohus and Fritschea were localized inside the bacteriome, Cardinium and Wolbachia exhibited dual localization patterns inside and outside the bacteriome, and Rickettsia showed strict localization outside the bacteriome. This study is

  20. Superhydrophobic poly(L-lactic acid) surface as potential bacterial colonization substrate

    PubMed Central

    2011-01-01

    Hydrophobicity is a very important surface property and there is a growing interest in the production and characterization of superhydrophobic surfaces. Accordingly, it was recently shown how to obtain a superhydrophobic surface using a simple and cost-effective method on a polymer named poly(L-lactic acid) (PLLA). To evaluate the ability of such material as a substrate for bacterial colonization, this work assessed the capability of different bacteria to colonize a biomimetic rough superhydrophobic (SH) PLLA surface and also a smooth hydrophobic (H) one. The interaction between these surfaces and bacteria with different morphologies and cell walls was studied using one strain of Staphylococcus aureus and one of Pseudomonas aeruginosa. Results showed that both bacterial strains colonized the surfaces tested, although significantly higher numbers of S. aureus cells were found on SH surfaces comparing to H ones. Moreover, scanning electron microscopy images showed an extracellular matrix produced by P. aeruginosa on SH PLLA surfaces, indicating that this bacterium is able to form a biofilm on such substratum. Bacterial removal through lotus leaf effect was also tested, being more efficient on H coupons than on SH PLLA ones. Overall, the results showed that SH PLLA surfaces can be used as a substrate for bacterial colonization and, thus, have an exceptional potential for biotechnology applications. PMID:22018163

  1. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family*

    PubMed Central

    Broussard, Tyler C.; Miller, Darcie J.; Jackson, Pamela; Nourse, Amanda; White, Stephen W.; Rock, Charles O.

    2016-01-01

    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

  2. Serum sialic acid in malignant tumors, bacterial infections, and chronic liver diseases.

    PubMed

    Stefenelli, N; Klotz, H; Engel, A; Bauer, P

    1985-01-01

    The total serum sialic acid concentration was determined in 2,264 persons with various malignant tumors, bacterial infections, rheumatic diseases, and chronic liver diseases, and in a control group. The thiobarbiturate method according to Warren was used. The upper limit (95% percentile) in the control group was 2.23 mumol/ml. Higher values were found in the groups with neoplasms (mean: 3.04 mumol/ml), inflammatory diseases (e.g., pneumonia: 3.02 mumol/ml), and active rheumatoid arthritis (3.05 mumol/ml). In the group with malignant diseases, the sialic acid concentration at the time of diagnosis was highest for bronchial carcinoma (3.29 mumol/ml) and lowest for breast cancer (2.58 mumol/ml). In chronic liver diseases the mean sialic acid level was lower than in a heterogeneous group of noninflammatory and nonneoplastic diseases. The estimation of the serum sialic acid concentration could be useful in the detection of tumor burden and metastases, and in the evaluation of the later course and prognosis of malignant neoplasms if bacterial/inflammatory and active rheumatoid processes can be excluded.

  3. Synthesis of a novel acrylated abietic acid-g-bacterial cellulose hydrogel by gamma irradiation.

    PubMed

    Abeer, Muhammad Mustafa; Amin, Mohd Cairul Iqbal Mohd; Lazim, Azwan Mat; Pandey, Manisha; Martin, Claire

    2014-09-22

    Acrylated abietic acid (acrylated AbA) and acrylated abietic acid-grafted bacterial cellulose pH sensitive hydrogel (acrylated AbA-g-BC) were prepared by a one-pot synthesis. The successful dimerization of acrylic acid (AA) and abietic acid (AbA) and grafting of the dimer onto bacterial cellulose (BC) was confirmed by 13C solid state NMR as well as FT-IR. X-ray diffraction analysis showed characteristic peaks for AbA and BC; further, there was no effect of increasing amorphous AA content on the overall crystallinity of the hydrogel. Differential scanning calorimetry revealed a glass transition temperature of 80°C. Gel fraction and swelling studies gave insight into the features of the hydrogel, suggesting that it was suitable for future applications such as drug delivery. Scanning electron microscopy observations showed an interesting interpenetrating network within the walls of hydrogel samples with the lowest levels of AA and gamma radiation doses. Cell viability test revealed that the synthesized hydrogel is safe for future use in biomedical applications.

  4. Biodegradation of PAHs by two bacterial species isolated from coal gasification sites

    SciTech Connect

    Schneider, J.; Grosser, R.J.; Jayasimhulu, K.; Warshawsky, D.

    1994-12-31

    Utilization of microbial processes for bioremediation requires measuring compound degradability as well as characterization of the intermediates formed. A Mycobacterium sp. and Xanthamonas sp. were isolated from coal gasification site soils using standard enrichment techniques. The Mycobacterium sp. was isolated for its ability to mineralize pyrene, but was also found to be capable of degrading other polycyclic aromatic compounds. The Xanthamonas sp. was isolated for its ability to mineralize carbazole and showed very high substrate specificity. The Xanthamonas sp. was incubated with carbazole as the sole added carbon source for approximately two weeks. Analysis of organic extracts show the presence of at least three cleavage products of carbazole. Two of these have been tentatively identified as 2-indole-acetic acid and 2-indole-acrylic acid. A pathway for carbazole degradation by this species is proposed in which the indole moiety is maintained. Analysis of metabolites formed during pyrene degradation were found to include 4,5-pyrene-dihydrodiol, 4-phenanthroic acid, and 4,5-diphenanthroic acid. This Mycobacterium sp. was also found to biodegrade benz(a)anthracene- and benzo(a)pyrene-producing ring cleavage products. For benz(a)anthracene, analysis of organic extracts of the growth medium show at least two dihydrodiol intermediates formed as well as a ring cleavage product. A dihydrodiol intermediate and three ring cleavage products were also found with benzo(a)pyrene. Fluorescence spectra of the benzo(a)pyrene dihydrodiol intermediate was characteristic of that for benz(a)anthracene.

  5. Aminomethylphosphonic acid accumulation in plant species treated with glyphosate.

    PubMed

    Reddy, Krishna N; Rimando, Agnes M; Duke, Stephen O; Nandula, Vijay K

    2008-03-26

    Aminomethylphosphonic acid (AMPA) is the most frequently detected metabolite of glyphosate in plants. The objective of this study was to determine if there is any correlation of metabolism of glyphosate to AMPA in different plant species and their natural level of resistance to glyphosate. Greenhouse studies were conducted to determine the glyphosate I 50 values (rate required to cause a 50% reduction in plant growth) and to quantify AMPA and shikimate concentrations in selected leguminous and nonleguminous species treated with glyphosate at respective I 50 rates. Coffee senna [ Cassia occidentalis (L.) Link] was the most sensitive ( I 50 = 75 g/ha) and hemp sesbania [ Sesbania herbacea (P.Mill.) McVaugh] was the most resistant ( I 50 = 456 g/ha) to glyphosate. Hemp sesbania was 6-fold and Illinois bundleflower [ Desmanthus illinoensis (Michx.) MacM. ex B.L.Robins. & Fern.] was 4-fold more resistant to glyphosate than coffee senna. Glyphosate was present in all plant species, and its concentration ranged from 0.308 to 38.7 microg/g of tissue. AMPA was present in all leguminous species studied except hemp sesbania. AMPA concentration ranged from 0.119 to 4.77 microg/g of tissue. Shikimate was present in all plant species treated with glyphosate, and levels ranged from 0.053 to 16.5 mg/g of tissue. Non-glyphosate-resistant (non-GR) soybean accumulated much higher shikimate than glyphosate-resistant (GR) soybean. Although some leguminous species were found to be more resistant to glyphosate than others, and there was considerable variation between species in the glyphosate to AMPA levels found, metabolism of glyphosate to AMPA did not appear to be a common factor in explaining natural resistance levels.

  6. Host species and environmental effects on bacterial communities associated with Drosophila in the laboratory and in the natural environment.

    PubMed

    Staubach, Fabian; Baines, John F; Künzel, Sven; Bik, Elisabeth M; Petrov, Dmitri A

    2013-01-01

    The fruit fly Drosophila is a classic model organism to study adaptation as well as the relationship between genetic variation and phenotypes. Although associated bacterial communities might be important for many aspects of Drosophila biology, knowledge about their diversity, composition, and factors shaping them is limited. We used 454-based sequencing of a variable region of the bacterial 16S ribosomal RNA gene to characterize the bacterial communities associated with wild and laboratory Drosophila isolates. In order to specifically investigate effects of food source and host species on bacterial communities, we analyzed samples from wild Drosophila melanogaster and D. simulans collected from a variety of natural substrates, as well as from adults and larvae of nine laboratory-reared Drosophila species. We find no evidence for host species effects in lab-reared flies; instead, lab of origin and stochastic effects, which could influence studies of Drosophila phenotypes, are pronounced. In contrast, the natural Drosophila-associated microbiota appears to be predominantly shaped by food substrate with an additional but smaller effect of host species identity. We identify a core member of this natural microbiota that belongs to the genus Gluconobacter and is common to all wild-caught flies in this study, but absent from the laboratory. This makes it a strong candidate for being part of what could be a natural D. melanogaster and D. simulans core microbiome. Furthermore, we were able to identify candidate pathogens in natural fly isolates.

  7. Lactic Acid Bacterial Starter Culture with Antioxidant and γ-Aminobutyric Acid Biosynthetic Activities Isolated from Flatfish-Sikhae Fermentation.

    PubMed

    Won, Yeong Geol; Yu, Hyun-Hee; Chang, Young-Hyo; Hwang, Han-Joon

    2015-12-01

    The aim of this study is to select a lactic acid bacterial strain as a starter culture for flatfish-Sikhae fermentation and to evaluate its suitability for application in a food system. Four strains of lactic acid bacteria isolated from commercial flatfish-Sikhae were identified and selected as starter culture candidates through investigation of growth rates, salt tolerance, food safety, and functional properties such as antioxidative and antimicrobial activities. The fermentation properties of the starter candidates were also examined in food systems prepared with these strains (candidate batch) in comparison with a spontaneous fermentation process without starter culture (control batch) at 15°C. The results showed that the candidate YG331 batch had better fermentation properties such as viable cell count, pH, and acidity than the other experimental batches, including the control batch. The results are expressed according to selection criteria based on a preliminary sensory evaluation and physiochemical investigation. Also, only a small amount of histamine was detected with the candidate YG331 batch. The radical scavenging activity of the candidate batches was better compared with the control batch, and especially candidate YG331 batch showed the best radical scavenging activity. Also, we isolated another starter candidate (identified as Lactobacillus brevis PM03) with γ-aminobutyric acid (GABA)-producing activity from commercial flatfish-Sikhae products. The sensory scores of the candidate YG331 batch were better than those of the other experimental batches in terms of flavor, color, and overall acceptance. In this study, we established selection criteria for the lactic acid bacterial starter for the flatfish-Sikhae production and finally selected candidate YG331 as the most suitable starter.

  8. Oceanobacillus endoradicis sp. nov., an endophytic bacterial species isolated from the root of Paris polyphylla Smith var. yunnanensis.

    PubMed

    Yang, Ling-Ling; Tang, Shu-Kun; Chu, Xiao; Jiang, Zhao; Xu, Li-Hua; Zhi, Xiao-Yang

    2016-07-01

    A bacterial strain, py1294(T), isolated from a root of Paris polyphylla Smith var. yunnanensis collected from Yunnan province, southwest China, was characterised by using a polyphasic approach to clarify its taxonomic position. Strain py1294(T) was found to be Gram-positive, aerobic, spore-forming, peritrichous flagella and rod shaped. Growth was found to occur in the presence of 0-8 % (w/v) NaCl (optimum 1-3 %), at pH 6.5-9.5 (optimum 8.0) and at 10-42 °C (optimum 30 °C). The major cellular fatty acids were identified as anteiso-C15:0, anteiso-C17:0, iso-C16:0 and iso-C14:0. The predominant quinone was identified as MK-7 and a minor amount of MK-6 was detected. The diagnostic polar lipids were diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The cell wall peptidoglycan was found to contain meso-diaminopimelic acid. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain py1294(T) forms a well-supported clade with Oceanobacillus damuensis PT-20(T) (97.9 % sequence similarity) within the genus Oceanobacillus, although it also shares a high sequence similarity with Ornithinibacillus contaminans (97.5 %). Crucially, the DNA-DNA relatedness value between strain py1294(T) and O. damuensis PT-20(T) was 29.7 ± 3.2 %. The G+C content was determined to be 42.3 mol%. On the basis of the phylogenetic and phenotypic data, a novel species Oceanobacillus endoradicis sp. nov. is proposed, with py1294(T) (=DSM 100726(T) = KCTC 33731(T)) as the type strain.

  9. Diversity and localization of bacterial symbionts in three whitefly species (Hemiptera: Aleyrodidae) from the east coast of the Adriatic Sea.

    PubMed

    Skaljac, M; Zanić, K; Hrnčić, S; Radonjić, S; Perović, T; Ghanim, M

    2013-02-01

    Several whitefly species (Hemiptera: Aleyrodidae) are cosmopolitan phloem-feeders that cause serious damage in numerous agricultural crops. All whitefly species harbor a primary bacterial symbiont and a diverse array of secondary symbionts which may influence several aspects of the insect's biology. We surveyed infections by secondary symbionts in Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood) and Siphoninus phillyreae (Haliday) from areas in the east cost of the Adriatic Sea. Both the Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) B. tabaci genetic groups were detected in Montenegro, whereas only the MED was confirmed in Croatia. Trialeurodes vaporariorum and S. phillyreae were found in all areas surveyed. MEAM1 and MED exhibited similarity to previously reported infections, while populations of T. vaporariorum from Montenegro harbored Rickettsia, Wolbachia and Cardinium in addition to previously reported Hamiltonella and Arsenopnohus. Siphoninus phillyreae harbored Hamiltonella, Wolbachia, Cardinium and Arsenophonus, with the latter appearing in two alleles. Multiple infections of all symbionts were common in the three insect species tested, with some reaching near fixation. Florescent in situ hybridization showed new localization patterns for Hamiltonella in S. phillyreae, and the morphology of the bacteriosome differed from that observed in other whitefly species. Our results show new infections with bacterial symbionts in the whitefly species studied. Infections with the same symbionts in reproductively isolated whitefly species confirm complex relationships between whiteflies and bacterial symbionts, and suggest possible horizontal transfer of some of these bacteria.

  10. Phenotypic and genotypic characterization of lactic acid bacteria isolated from raw goat milk and effect of farming practices on the dominant species of lactic acid bacteria.

    PubMed

    Tormo, Hélène; Ali Haimoud Lekhal, Djamila; Roques, C

    2015-10-01

    Lactic acid bacteria, in particular Lactococcus lactis, play a decisive role in the cheese making process and more particularly in lactic cheeses which are primarily produced on goat dairy farms. The objective of this study was therefore to identify the main lactic acid bacteria found in raw goats' milk from three different regions in France and evaluate if certain farming practices have an effect on the distribution of species of lactic acid bacteria in the various milk samples. Identification at genus or species level was carried out using phenotypic tests and genotypic methods including repetitive element REP-PCR, species-specific PCR and 16S rRNA gene sequencing. The distribution of the main bacterial species in the milk samples varied depending on farms and their characteristics. Out of the 146 strains identified, L. lactis was the dominant species (60% of strains), followed by Enterococcus (38%) of which Enterococcus faecalis and Enterococcus faecium. Within the species L. lactis, L. lactis subsp lactis was detected more frequently than L. lactis subsp cremoris (74% vs. 26%). The predominance of L. lactis subsp cremoris was linked to geographical area studied. It appears that the animals' environment plays a role in the balance between the dominance of L. lactis and enterococci in raw goats' milk. The separation between the milking parlor and the goat shed (vs no separation) and only straw in the bedding (vs straw and hay) seems to promote L. lactis in the milk (vs enterococci).

  11. Identification of the Atlantic cod L-amino acid oxidase and its alterations following bacterial exposure.

    PubMed

    Kitani, Yoichiro; Fernandes, Jorge M O; Kiron, Viswanath

    2015-06-01

    Antibacterial factors that are present in epidermal mucus of fish have a potential role in the first line of host defence to bacterial pathogens. This study reports the identification of L-amino acid oxidase (LAO) in Atlantic cod (GmLao) and the changes in the molecule following bacterial exposure. The gmlao transcripts and LAO activity were present on both the body surface and in the internal organs of the fish. Relative mRNA level of gmlao increased significantly in the gills, the spleen and the head kidney (up to 8-fold) of fish that were challenged with the pathogen Vibrio anguillarum. The gmlao expression in skin was 4-fold higher in challenged fish. Our data indicate that LAO may be an important effector of antibacterial defence in Atlantic cod.

  12. Ohr plays a central role in bacterial responses against fatty acid hydroperoxides and peroxynitrite.

    PubMed

    Alegria, Thiago G P; Meireles, Diogo A; Cussiol, José R R; Hugo, Martín; Trujillo, Madia; de Oliveira, Marcos Antonio; Miyamoto, Sayuri; Queiroz, Raphael F; Valadares, Napoleão Fonseca; Garratt, Richard C; Radi, Rafael; Di Mascio, Paolo; Augusto, Ohara; Netto, Luis E S

    2017-01-10

    Organic hydroperoxide resistance (Ohr) enzymes are unique Cys-based, lipoyl-dependent peroxidases. Here, we investigated the involvement of Ohr in bacterial responses toward distinct hydroperoxides. In silico results indicated that fatty acid (but not cholesterol) hydroperoxides docked well into the active site of Ohr from Xylella fastidiosa and were efficiently reduced by the recombinant enzyme as assessed by a lipoamide-lipoamide dehydrogenase-coupled assay. Indeed, the rate constants between Ohr and several fatty acid hydroperoxides were in the 10(7)-10(8) M(-1)⋅s(-1) range as determined by a competition assay developed here. Reduction of peroxynitrite by Ohr was also determined to be in the order of 10(7) M(-1)⋅s(-1) at pH 7.4 through two independent competition assays. A similar trend was observed when studying the sensitivities of a ∆ohr mutant of Pseudomonas aeruginosa toward different hydroperoxides. Fatty acid hydroperoxides, which are readily solubilized by bacterial surfactants, killed the ∆ohr strain most efficiently. In contrast, both wild-type and mutant strains deficient for peroxiredoxins and glutathione peroxidases were equally sensitive to fatty acid hydroperoxides. Ohr also appeared to play a central role in the peroxynitrite response, because the ∆ohr mutant was more sensitive than wild type to 3-morpholinosydnonimine hydrochloride (SIN-1 , a peroxynitrite generator). In the case of H2O2 insult, cells treated with 3-amino-1,2,4-triazole (a catalase inhibitor) were the most sensitive. Furthermore, fatty acid hydroperoxide and SIN-1 both induced Ohr expression in the wild-type strain. In conclusion, Ohr plays a central role in modulating the levels of fatty acid hydroperoxides and peroxynitrite, both of which are involved in host-pathogen interactions.

  13. Accuracy, reproducibility, and interpretation of fatty acid methyl ester profiles of model bacterial communities

    USGS Publications Warehouse

    Kidd, Haack S.; Garchow, H.; Odelson, D.A.; Forney, L.J.; Klug, M.J.

    1994-01-01

    We determined the accuracy and reproducibility of whole-community fatty acid methyl ester (FAME) analysis with two model bacterial communities differing in composition by using the Microbial ID, Inc. (MIDI), system. The biomass, taxonomic structure, and expected MIDI-FAME profiles under a variety of environmental conditions were known for these model communities a priori. Not all members of each community could be detected in the composite profile because of lack of fatty acid 'signatures' in some isolates or because of variations (approximately fivefold) in fatty acid yield across taxa. MIDI- FAME profiles of replicate subsamples of a given community were similar in terms of fatty acid yield per unit of community dry weight and relative proportions of specific fatty acids. Principal-components analysis (PCA) of MIDI-FAME profiles resulted in a clear separation of the two different communities and a clustering of replicates of each community from two separate experiments on the first PCA axis. The first PCA axis accounted for 57.1% of the variance in the data and was correlated with fatty acids that varied significantly between communities and reflected the underlying community taxonomic structure. On the basis of our data, community fatty acid profiles can be used to assess the relative similarities and differences of microbial communities that differ in taxonomic composition. However, detailed interpretation of community fatty acid profiles in terms of biomass or community taxonomic composition must be viewed with caution until our knowledge of the quantitative and qualitative distribution of fatty acids over a wide variety of taxa and the effects of growth conditions on fatty acid profiles is more extensive.

  14. Airborne bacterial reduction by spraying slightly acidic electrolyzed water in a laying-hen house.

    PubMed

    Zheng, Weichao; Kang, Runmin; Wang, Hongning; Li, Baoming; Xu, Changwen; Wang, Shuang

    2013-10-01

    Spraying slightly acidic electrolyzed water (SAEW) has been considered as a potential approach to reduce airborne bacteria in laying-hen houses. In this study, the effects of spraying SAEW on airborne bacterial reduction were investigated in a laying-hen house as compared with using diluted didecyl dimethyl ammonium bromide (DDAB). Averaged air temperature reduced by approximate 1 degrees C and average relative humidity increased by 3% at a stable ventilation rate (about 2.5 m3 hr(-1) per bird) in the laying-hen house 30 min after spraying (120 mL m(-2)). Compared with the control without spraying, the airborne bacterial concentration was reduced by about 0.70 and 0.37 log10 colony-forming units (CFU) m(-3) in the 4 hr after spraying 120 mL m(-2) SAEW (available chlorine concentration [ACC] of 156 mg L(-1)) and diluted DDAB (active compound concentration of 167 mg L(-1)), respectively. Compared with spraying diluted DDAB, spraying SAEW was determined to be more effective for reducing airborne bacterial in laying-hen houses. The effects of spraying SAEW and diluted DDAB on airborne bacterial reduction in the laying-hen house increased with the increasing available chlorine concentrations for SAEW (156, 206, 262 mg L(-1)) and increasing active compound concentrations for diluted DDAB (167, 333, 500 mg L(-1)), respectively. Spraying SAEW and diluted DDAB with two levels of spraying volumes (120 and 90 mL m(-2)) both showed significant differences on airborne bacterial reduction in the laying-hen house (P < 0.05).

  15. Tree phyllosphere bacterial communities: exploring the magnitude of intra- and inter-individual variation among host species

    PubMed Central

    Messier, Christian; Kembel, Steven W.

    2016-01-01

    Background The diversity and composition of the microbial community of tree leaves (the phyllosphere) varies among trees and host species and along spatial, temporal, and environmental gradients. Phyllosphere community variation within the canopy of an individual tree exists but the importance of this variation relative to among-tree and among-species variation is poorly understood. Sampling techniques employed for phyllosphere studies include picking leaves from one canopy location to mixing randomly selected leaves from throughout the canopy. In this context, our goal was to characterize the relative importance of intra-individual variation in phyllosphere communities across multiple species, and compare this variation to inter-individual and interspecific variation of phyllosphere epiphytic bacterial communities in a natural temperate forest in Quebec, Canada. Methods We targeted five dominant temperate forest tree species including angiosperms and gymnosperms: Acer saccharum, Acer rubrum, Betula papyrifera, Abies balsamea and Picea glauca. For one randomly selected tree of each species, we sampled microbial communities at six distinct canopy locations: bottom-canopy (1–2 m height), the four cardinal points of mid-canopy (2–4 m height), and the top-canopy (4–6 m height). We also collected bottom-canopy leaves from five additional trees from each species. Results Based on an analysis of bacterial community structure measured via Illumina sequencing of the bacterial 16S gene, we demonstrate that 65% of the intra-individual variation in leaf bacterial community structure could be attributed to the effect of inter-individual and inter-specific differences while the effect of canopy location was not significant. In comparison, host species identity explains 47% of inter-individual and inter-specific variation in leaf bacterial community structure followed by individual identity (32%) and canopy location (6%). Discussion Our results suggest that individual

  16. Bacterial Profiling Reveals Novel "Ca. Neoehrlichia", Ehrlichia, and Anaplasma Species in Australian Human-Biting Ticks.

    PubMed

    Gofton, Alexander W; Doggett, Stephen; Ratchford, Andrew; Oskam, Charlotte L; Paparini, Andrea; Ryan, Una; Irwin, Peter

    2015-01-01

    In Australia, a conclusive aetiology of Lyme disease-like illness in human patients remains elusive, despite growing numbers of people presenting with symptoms attributed to tick bites. In the present study, we surveyed the microbial communities harboured by human-biting ticks from across Australia to identify bacteria that may contribute to this syndrome. Universal PCR primers were used to amplify the V1-2 hyper-variable region of bacterial 16S rRNA genes in DNA samples from individual Ixodes holocyclus (n = 279), Amblyomma triguttatum (n = 167), Haemaphysalis bancrofti (n = 7), and H. longicornis (n = 7) ticks. The 16S amplicons were sequenced on the Illumina MiSeq platform and analysed in USEARCH, QIIME, and BLAST to assign genus and species-level taxonomies. Nested PCR and Sanger sequencing were used to confirm the NGS data and further analyse novel findings. All 460 ticks were negative for Borrelia spp. by both NGS and nested PCR analysis. Two novel "Candidatus Neoehrlichia" spp. were identified in 12.9% of I. holocyclus ticks. A novel Anaplasma sp. was identified in 1.8% of A. triguttatum ticks, and a novel Ehrlichia sp. was identified in both A. triguttatum (1.2%) ticks and a single I. holocyclus (0.6%) tick. Further phylogenetic analysis of novel "Ca. Neoehrlichia", Anaplasma and Ehrlichia based on 1,265 bp 16S rRNA gene sequences suggests that these are new species. Determining whether these newly discovered organisms cause disease in humans and animals, like closely related bacteria do abroad, is of public health importance and requires further investigation.

  17. Cooperative role for tetraspanins in adhesin-mediated attachment of bacterial species to human epithelial cells.

    PubMed

    Green, Luke R; Monk, Peter N; Partridge, Lynda J; Morris, Paul; Gorringe, Andrew R; Read, Robert C

    2011-06-01

    The tetraspanins are a superfamily of transmembrane proteins with diverse functions and can form extended microdomains within the plasma membrane in conjunction with partner proteins, which probably includes receptors for bacterial adhesins. Neisseria meningitidis, the causative agent of meningococcal disease, attaches to host nasopharyngeal epithelial cells via type IV pili and opacity (Opa) proteins. We examined the role of tetraspanin function in Neisseria meningitidis adherence to epithelial cells. Tetraspanins CD9, CD63, and CD151 were expressed by HEC-1-B and DETROIT 562 cells. Coincubation of cells with antibodies against all three tetraspanin molecules used individually or in combination, with recombinant tetraspanin extracellular domains (EC2), or with small interfering RNAs (siRNAs) significantly reduced adherence of Neisseria meningitidis. In contrast, recombinant CD81, a different tetraspanin, had no effect on meningococcal adherence. Antitetraspanin antibodies reduced the adherence to epithelial cells of Neisseria meningitidis strain derivatives expressing Opa and pili significantly more than isogenic strains lacking these determinants. Adherence to epithelial cells of strains of Staphylococcus aureus, Neisseria lactamica, Escherichia coli, and Streptococcus pneumoniae was also reduced by pretreatment of cells with tetraspanin antibodies and recombinant proteins. These data suggest that tetraspanins are required for optimal function of epithelial adhesion platforms containing specific receptors for Neisseria meningitidis and potentially for multiple species of bacteria.

  18. Phospholipid-Derived Fatty Acids and Quinones as Markers for Bacterial Biomass and Community Structure in Marine Sediments

    PubMed Central

    Kunihiro, Tadao; Veuger, Bart; Vasquez-Cardenas, Diana; Pozzato, Lara; Le Guitton, Marie; Moriya, Kazuyoshi; Kuwae, Michinobu; Omori, Koji; Boschker, Henricus T. S.; van Oevelen, Dick

    2014-01-01

    Phospholipid-derived fatty acids (PLFA) and respiratory quinones (RQ) are microbial compounds that have been utilized as biomarkers to quantify bacterial biomass and to characterize microbial community structure in sediments, waters, and soils. While PLFAs have been widely used as quantitative bacterial biomarkers in marine sediments, applications of quinone analysis in marine sediments are very limited. In this study, we investigated the relation between both groups of bacterial biomarkers in a broad range of marine sediments from the intertidal zone to the deep sea. We found a good log-log correlation between concentrations of bacterial PLFA and RQ over several orders of magnitude. This relationship is probably due to metabolic variation in quinone concentrations in bacterial cells in different environments, whereas PLFA concentrations are relatively stable under different conditions. We also found a good agreement in the community structure classifications based on the bacterial PLFAs and RQs. These results strengthen the application of both compounds as quantitative bacterial biomarkers. Moreover, the bacterial PLFA- and RQ profiles revealed a comparable dissimilarity pattern of the sampled sediments, but with a higher level of dissimilarity for the RQs. This means that the quinone method has a higher resolution for resolving differences in bacterial community composition. Combining PLFA and quinone analysis as a complementary method is a good strategy to yield higher resolving power in bacterial community structure. PMID:24769853

  19. Isolation of bacterial cellulose nanocrystalline from pineapple peel waste: Optimization of acid concentration in the hydrolysis method

    NASA Astrophysics Data System (ADS)

    Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik

    2016-02-01

    Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.

  20. Ecological drift and local exposures drive enteric bacterial community differences within species of Galápagos iguanas.

    PubMed

    Lankau, Emily W; Hong, Pei-Ying; Mackie, Roderick I

    2012-04-01

    Diet strongly influences the intestinal microbial communities through species sorting. Alternatively, these communicates may differ because of chance variation in local microbial exposures or species losses among allopatric host populations (i.e. ecological drift). We investigated how these forces shape enteric communities of Galápagos marine and land iguanas. Geographically proximate populations shared more similar communities within a host ecotype, suggesting a role for ecological drift during host colonization of the islands. Additionally, evidence of taxa sharing between proximate heterospecific host populations suggests that contemporary local exposures also influence the gut community assembly. While selective forces such as host-bacterial interactions or dietary differences are dominant drivers of intestinal community differences among hosts, historical and contemporary processes of ecological drift may lead to differences in bacterial composition within a host species. Whether such differences in community structure translate into geographic variation in benefits derived from these intimate microbial communities remains to be explored.

  1. Composition of the Cutaneous Bacterial Community in Japanese Amphibians: Effects of Captivity, Host Species, and Body Region.

    PubMed

    Sabino-Pinto, Joana; Bletz, Molly Catherine; Islam, Mohammed Mafizul; Shimizu, Norio; Bhuju, Sabin; Geffers, Robert; Jarek, Michael; Kurabayashi, Atsushi; Vences, Miguel

    2016-08-01

    The cutaneous microbiota plays a significant role in the biology of their vertebrate hosts, and its composition is known to be influenced both by host and environment, with captive conditions often altering alpha diversity. Here, we compare the cutaneous bacterial communities of 61 amphibians (both wild and captive) from Hiroshima, Japan, using high-throughput amplicon sequencing of a segment of the 16S rRNA gene. The majority of these samples came from a captive breeding facility at Hiroshima University where specimens from six species are maintained under highly standardized conditions for several generations. This allowed to identify host effects on the bacterial communities under near identical environmental conditions in captivity. We found the structure of the cutaneous bacterial community significantly differing between wild and captive individuals of newts, Cynops pyrrhogaster, with a higher alpha diversity found in the wild individuals. Community structure also showed distinct patterns when comparing different species of amphibians kept under highly similar conditions, revealing an intrinsic host effect. Bacterial communities of dorsal vs. ventral skin surfaces did not significantly differ in most species, but a trend of higher alpha diversity on the ventral surface was found in Oriental fire-bellied toads, Bombina orientalis. This study confirms the cutaneous microbiota of amphibians as a highly dynamic system influenced by a complex interplay of numerous factors.

  2. Analysis of Vaginal Acetic Acid in Patients Undergoing Treatment for Bacterial Vaginosis

    PubMed Central

    Chaudry, Amjad N.; Travers, Paul J.; Yuenger, Jeffrey; Colletta, Lorraine; Evans, Phillip; Zenilman, Jonathan M.; Tummon, Andrew

    2004-01-01

    A “gold standard” method for the diagnosis of bacterial vaginosis (BV) is lacking. The clinical criteria described by the Amsel technique are subjective and difficult to quantify. Alternatively, the reading of Gram-stained vaginal smears by scoring techniques such as those that use the Nugent or Hay-Ison scoring systems is again subjective, requires expert personnel to perform the reading, and is infrequently used clinically. Recently, a new diagnostic device, the Osmetech Microbial Analyzer—Bacterial Vaginosis (OMA-BV), which determines a patient's BV status on the basis of measurement of the amount of acetic acid present in a vaginal swab specimen, was approved by the Food and Drug Administration. The present study uses the conducting polymer gas-sensing technology of OMA-BV to measure the concentration of acetic acid in the headspace above vaginal swab specimens from patients undergoing treatment for BV with metronidazole. In 97.8% of the cases the level of acetic acid detected fell sharply during the treatment period, crossing from above to below the diagnostic threshold of 900 ppm. The diagnosis obtained on the basis of the level of vaginal acetic acid was compared with the diagnoses obtained by use of the Amsel criteria and the Nugent scoring system both at the time of initial entry into the study and at the repeat samplings on days 7 and 14. The results obtained with OMA-BV showed overall agreements compared with the results of the Amsel and Nugent tests of 98 and 94%, respectively, for the 34 patients monitored through the treatment process. This provides further evidence that the measurement of vaginal acetic acid by headspace analysis with conducting polymer sensors is a valid alternative to present tests for the diagnosis of BV. PMID:15528711

  3. Detection of Bacillus and Stenotrophomonas species growing in an organic acid and endocrine-disrupting chemical-rich environment of distillery spent wash and its phytotoxicity.

    PubMed

    Chandra, Ram; Kumar, Vineet

    2017-01-01

    Sugarcane molasses-based distillery spent wash (DSW) is well known for its toxicity and complex mixture of various recalcitrant organic pollutants with acidic pH, but the chemical nature of these pollutants is unknown. This study revealed the presence of toxic organic acids (butanedioic acid bis(TMS)ester; 2-hydroxysocaproic acid; benzenepropanoic acid, α-[(TMS)oxy], TMS ester; vanillylpropionic acid, bis(TMS)), and other recalcitrant organic pollutants (2-furancarboxylic acid, 5-[[(TMS)oxy] methyl], TMS ester; benzoic acid 3-methoxy-4-[(TMS)oxy], TMS ester; and tricarballylic acid 3TMS), which are listed as endocrine-disrupting chemicals. In addition, several major heavy metals were detected, including Fe (163.947), Mn (4.556), Zn (2.487), and Ni (1.175 mg l(-1)). Bacterial community analysis by restriction fragment length polymorphism revealed that Bacillus and Stenotrophomonas were dominant autochthonous bacterial communities belonging to the phylum Firmicutes and γ-Proteobacteria, respectively. The presence of Bacillus and Stenotrophomonas species in highly acidic environments indicated its broad range adaptation. These findings indicated that these autochthonous bacterial communities were pioneer taxa for in situ remediation of this hazardous waste during ecological succession. Further, phytotoxicity assay of DSW with Phaseolus mungo L. and Triticum aestivum revealed that T. aestivum was more sensitive than P. mungo L. in the seed germination test. The results of this study may be useful for monitoring and toxicity assessment of sugarcane molasses-based distillery waste at disposal sites.

  4. A role for coenzyme M (2-mercaptoethanesulfonic acid) in a bacterial pathway of aliphatic epoxide carboxylation

    PubMed Central

    Allen, Jeffrey R.; Clark, Daniel D.; Krum, Jonathan G.; Ensign, Scott A.

    1999-01-01

    The bacterial metabolism of short-chain aliphatic alkenes occurs via oxidation to epoxyalkanes followed by carboxylation to β-ketoacids. Epoxyalkane carboxylation requires four enzymes (components I–IV), NADPH, NAD+, and a previously unidentified nucleophilic thiol. In the present work, coenzyme M (2-mercaptoethanesulfonic acid), a compound previously found only in the methanogenic Archaea where it serves as a methyl group carrier and activator, has been identified as the thiol and central cofactor of aliphatic epoxide carboxylation in the Gram-negative bacterium Xanthobacter strain Py2. Component I catalyzed the addition of coenzyme M to epoxypropane to form a β-hydroxythioether, 2-(2-hydroxypropylthio)ethanesulfonate. Components III and IV catalyzed the NAD+-dependent stereoselective dehydrogenation of R- and S-enantiomers of 2-(2-hydroxypropylthio)ethanesulfonate to form 2-(2-ketopropylthio)ethanesulfonate. Component II catalyzed the NADPH-dependent cleavage and carboxylation of the β-ketothioether to form acetoacetate and coenzyme M. These findings evince a newfound versatility for coenzyme M as a carrier and activator of alkyl groups longer in chain-length than methane, a function for coenzyme M in a catabolic pathway of hydrocarbon oxidation, and the presence of coenzyme M in the bacterial domain of the phylogenetic tree. These results serve to unify bacterial and Archaeal metabolism further and showcase diverse biological functions for an elegantly simple organic molecule. PMID:10411892

  5. Bioleaching of copper from waste printed circuit boards by bacterial consortium enriched from acid mine drainage.

    PubMed

    Xiang, Yun; Wu, Pingxiao; Zhu, Nengwu; Zhang, Ting; Liu, Wen; Wu, Jinhua; Li, Ping

    2010-12-15

    The objectives of this study were to evaluate the solubility of copper in waste printed circuit boards (PCBs) by bacterial consortium enriched from natural acid mine drainage, and to determine optimum conditions of bioleaching copper from PCBs. The results indicated that the extraction of copper was mainly accomplished indirectly through oxidation by ferric ions generated from ferrous ion oxidation bacteria. The initial pH and Fe(2+) concentration played an important role in copper extraction and precipitate formation. The leaching rate of copper was generally higher at lower PCB powder dosage. Moreover, a two-step process was extremely necessary for bacterial growth and obtaining an appropriate Fe(2+) oxidation rate; a suitable time when 6.25 g/L of Fe(2+) remained in the solution was suggested for adding PCB powder. The maximum leaching rate of copper was achieved 95% after 5 days under the conditions of initial pH 1.5, 9 g/L of initial Fe(2+), and 20 g/L of PCB powder. All findings demonstrated that copper could be efficiently solubilized from waste PCBs by using bacterial consortium, and the leaching period was shortened remarkably from about 12 days to 5 days.

  6. Endospore abundance and D:L-amino acid modeling of bacterial turnover in holocene marine sediment (Aarhus Bay)

    NASA Astrophysics Data System (ADS)

    Langerhuus, Alice T.; Røy, Hans; Lever, Mark A.; Morono, Yuki; Inagaki, Fumio; Jørgensen, Bo B.; Lomstein, Bente Aa.

    2012-12-01

    In order to study bacterial activity, and turnover times of bacterial necromass and biomass in marine sediment, two stations from the Aarhus Bay, Denmark were analyzed. Sediment cores were up to 11 m deep and covered a timescale from the present to ˜11,000 years ago. Sediment was analyzed for total hydrolysable amino acids (THAA), total hydrolysable amino sugars, the bacterial endospore marker dipicolinic acid (DPA), and amino acid enantiomers (L- and D-form) of aspartic acid. Turnover times of bacterial necromass and vegetative cells, as well as carbon oxidation rates were estimated by use of the D:L-amino acid racemization model. Diagenetic indicators were applied to evaluate the diagenetic state of the sedimentary organic matter. The contribution of amino acids to total organic carbon, and the ratio between the amino acids aspartic acid and glutamic acid, and their respective non protein degradation products, β-alanine and γ-amino butyric acid, all indicated increasing degradation state of the organic matter with sediment depth and age. Quantification of DPA showed that endospores were abundant, and increased with depth relative to vegetative cells. Most of the amino acids (97%) could be ascribed to microbial necromass, i.e. the remains of dead bacterial cells. Model estimates showed that the turnover times of microbial necromass were in the range of 0.5-1 × 105 years, while turnover times of vegetative cells were in the range of tens to hundreds of years. The turnover time of the TOC pool increased with depth in the sediment, indicating that the TOC pool became progressively more refractory and unavailable to microorganisms with depth and age of the organic matter.

  7. Bacterial production of conjugated linoleic and linolenic Acid in foods: a technological challenge.

    PubMed

    Gorissen, Lara; Leroy, Frédéric; De Vuyst, Luc; De Smet, Stefaan; Raes, Katleen

    2015-01-01

    Conjugated linoleic acid (CLA) and conjugated linolenic acid (CLNA) isomers are present in foods derived from ruminants as a result of the respective linoleic acid (LA) and α-linolenic acid (LNA) metabolism by ruminal microorganisms and in animals' tissues. CLA and CLNA have isomer-specific, health-promoting properties, including anticarcinogenic, antiatherogenic, anti-inflammatory, and antidiabetic activity, as well as the ability to reduce body fat. Besides ruminal microorganisms, such as Butyrivibrio fibrisolvens, many food-grade bacteria, such as bifidobacteria, lactic acid bacteria (LAB), and propionibacteria, are able to convert LA and LNA to CLA and CLNA, respectively. Linoleate isomerase activity, responsible for this conversion, is strain-dependent and probably related to the ability of the producer strain to tolerate the toxic effects of LA and LNA. Since natural concentrations of CLA and CLNA in ruminal food products are relatively low to exert their health benefits, food-grade bacteria with linoleate isomerase activity could be used as starter or adjunct cultures to develop functional fermented dairy and meat products with increased levels of CLA and CLNA or included in fermented products as probiotic cultures. However, results obtained so far are below expectations due to technological bottlenecks. More research is needed to assess if bacterial production kinetics can be increased and can match food processing requirements.

  8. Bacterial carbon-phosphorus lyase: products, rates, and regulation of phosphonic and phosphinic acid metabolism.

    PubMed Central

    Wackett, L P; Shames, S L; Venditti, C P; Walsh, C T

    1987-01-01

    Carbon-phosphorus bond cleavage activity, found in bacteria that utilize alkyl- and phenylphosphonic acids, has not yet been obtained in a cell-free system. Given this constraint, a systematic examination of in vivo C-P lyase activity has been conducted to develop insight into the C-P cleavage reaction. Six bacterial strains were obtained by enrichment culture, identified, and characterized with respect to their phosphonic acid substrate specificity. One isolate, Agrobacterium radiobacter, was shown to cleave the carbon-phosphorus bond of a wide range of substrates, including fosfomycin, glyphosate, and dialkyl phosphinic acids. Furthermore, this organism processed vinyl-, propenyl-, and propynylphosphonic acids, a previously uninvestigated group, to ethylene, propene, and propyne, respectively. A determination of product stoichiometries revealed that both C-P bonds of dimethylphosphinic acid are cleaved quantitatively to methane and, furthermore, that the extent of C-P bond cleavage correlated linearly with the specific growth rate for a range of substrates. The broad substrate specificity of Agrobacterium C-P lyase and the comprehensive characterization of the in vivo activity make this an attractive system for further biochemical and mechanistic experiments. In addition, the failure to observe the activity in a group of gram-positive bacteria holds open the possibility that a periplasmic component may be required for in vivo expression of C-P lyase activity. PMID:3804975

  9. [Advancement in the research of early detection of bacterial nucleic acid in molecular diagnosis of sepsis].

    PubMed

    Liu, Xiao; Ren, Hui; Peng, Dai-zhi

    2013-04-01

    Early diagnosis of sepsis helps make effective clinical decisions and improve the survival rate of patients with severe infection. However, the timely and accurate diagnosis of sepsis is still a great challenge in clinic. In order to settle the very problem, the scientists in the world have made a lot of exploration and research in the field of rapid molecular identification of pathogens. Nowadays, the nucleic acid detection of sepsis is mainly composed of 3 types of methodological strategies, either based on positive blood culture, single colonies, or directly on blood specimens. This paper presents a comprehensive overview of advances in the research of early detection of bacterial nucleic acid as molecular diagnosis of sepsis.

  10. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities.

    PubMed

    Huete-Stauffer, Tamara M; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures.

  11. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities

    PubMed Central

    Huete-Stauffer, Tamara M.; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G.

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  12. Algal and bacterial activities in acidic (pH 3) strip mine lakes

    SciTech Connect

    Gyure, R.A.; Konopka, A.; Brooks, A.; Doemel, W.

    1987-09-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H/sub 2/S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H/sub 2/S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by (/sup 14/C)glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake.

  13. Algal and Bacterial Activities in Acidic (pH 3) Strip Mine Lakes

    PubMed Central

    Gyure, Ruth A.; Konopka, Allan; Brooks, Austin; Doemel, William

    1987-01-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H2S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H2S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by [14C]glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake. PMID:16347430

  14. Evaluation of Three Bacterial Identification Systems for Species Identification of Bacteria Isolated from Bovine Mastitis and Bulk Tank Milk Samples.

    PubMed

    Savage, Emily; Chothe, Shubhada; Lintner, Valerie; Pierre, Traci; Matthews, Tammy; Kariyawasam, Subhashinie; Miller, Dawn; Tewari, Deepanker; Jayarao, Bhushan

    2017-03-01

    A study was conducted to evaluate Sensititre(®) Automated Reading and Incubation System 2x System (ARIS), API(®) (API), and Bruker MALDI-TOF MS (MALDI) bacterial species identification systems using 132 diverse bacterial isolates from bovine milk samples and bulk tank milk received at the Penn State Animal Diagnostic Laboratory. The results were compared with 16S rRNA gene sequence analysis, which served as the reference method for species identification. The ARIS, API, and MALDI identified 0%, 40%, and 33.4% of species classified as Gram-positive rod isolates belonging to genera Arthrobacter, Bacillus, Brachybacterium, Brevibacterium, and Corynebacterium, respectively. It was observed that 76.5%, 93.9%, and 96.9% of catalase-negative, Gram-positive cocci (n = 33; Aerococcus, Enterococcus, Lactococcus, Streptococcus) were correctly identified to the species level by ARIS, API, and MALDI, respectively, while 33.4%, 84.5%, and 97.7% of catalase-positive, Gram-positive cocci (n = 45; Kocuria, Staphylococcus) were correctly identified to their species by ARIS, API, and MALDI, respectively. A total of 48 isolates (Acinetobacter, Citrobacter, Enterobacter, Escherichia, Klebsiella, Pantoea, Pasteurella, Providencia, Pseduomonas, Serratia) of Gram-negative bacteria were examined, of which 85.4%, 93.7%, and 95.8% of the isolates were correctly identified to the species level by ARIS, API, and MALDI, respectively. In our laboratory, the MALDI had the least costs associated with consumables and reagents compared to ARIS, API, and 16S rRNA identification methods. Identification of bacterial species was accomplished in <2 h using MALDI and 24 h for ARIS, API, and 16S rRNA identification systems.

  15. Re-engineering nalidixic acid's chemical scaffold: A step towards the development of novel anti-tubercular and anti-bacterial leads for resistant pathogens.

    PubMed

    Peraman, Ramalingam; Varma, Raghu Veer; Reddy, Y Padmanabha

    2015-10-01

    Occurrence of antibacterial and antimycobacterial resistance stimulated a thrust to discover new drugs for infectious diseases. Herein we report the work on re-engineering nalidixic acid's chemical scaffold for newer leads. Stepwise clubbing of quinoxaline, 1,2,4-triazole/1,3,4-oxadiazole with nalidixic acid yielded better compounds. Compounds were screened against ciprofloxacin resistant bacteria and Mycobacterium tuberculosis H37Rv species. Results were obtained as minimum inhibitory concentration, it was evident that molecule with quinoxaline linked azide as side chain served as antitubercular lead (<6.25 μg/ml) whilst molecule with oxadiazole or triazole linked quinoxaline side chain served as anti-bacterial lead. Few compounds were significantly active against Escherichia coli and Proteus vulgaris with MIC less than 0.06 μg/ml and relatively potent than ciprofloxacin. No true compound was potentially active against Salmonella species as compared to amoxicillin.

  16. Growth promotion of Lactuca sativa in response to volatile organic compounds emitted from diverse bacterial species.

    PubMed

    Fincheira, Paola; Venthur, Herbert; Mutis, Ana; Parada, Maribel; Quiroz, Andrés

    2016-12-01

    Agrochemicals are currently used in horticulture to increase crop production. Nevertheless, their indiscriminate use is a relevant issue for environmental and legal aspects. Alternative tools for reducing fertilizers and synthetic phytohormones are being investigated, such as the use of volatile organic compounds (VOCs) as growth inducers. Some soil bacteria, such as Pseudomonas and Bacillus, stimulate Arabidopsis and tobacco growth by releasing VOCs, but their effects on vegetables have not been investigated. Lactuca sativa was used as model vegetable to investigate bacterial VOCs as growth inducers. We selected 10 bacteria strains, belonging to Bacillus, Staphylococcus and Serratia genera that are able to produce 3-hydroxy-2-butanone (acetoin), a compound with proven growth promoting activity. Two-day old-seedlings of L. sativa were exposed to VOCs emitted by the selected bacteria grown in different media cultures for 7 days. The results showed that the VOCs released from the bacteria elicited an increase in the number of lateral roots, dry weight, root growth and shoot length, depending on the media used. Three Bacillus strains, BCT53, BCT9 and BCT4, were selected according to its their growth inducing capacity. The BCT9 strain elicited the greatest increases in dry weight and primary root length when L. sativa seedlings were subjected to a 10-day experiment. Finally, because acetoin only stimulated root growth, we suggest that other volatiles could be responsible for the growth promotion of L. sativa. In conclusion, our results strongly suggest that bacteria volatiles can be used as growth-inducers as alternative or complementary strategies for application in horticulture species.

  17. Bacterial community structure in the rhizosphere of three cactus species from semi-arid highlands in central Mexico.

    PubMed

    Aguirre-Garrido, J Félix; Montiel-Lugo, Daniel; Hernández-Rodríguez, César; Torres-Cortes, Gloria; Millán, Vicenta; Toro, Nicolás; Martínez-Abarca, Francisco; Ramírez-Saad, Hugo C

    2012-05-01

    The nature reserve of Tehuacan-Cuicatlan in central Mexico is known for its diversity and endemism mainly in cactus plants. Although the xerophytic flora is reasonably documented, the bacterial communities associated with these species have been largely neglected. We assessed the diversity and composition of bacterial communities in bulk (non-rhizospheric) soil and the rhizosphere of three cactus plant species: Mammillaria carnea, Opuntia pilifera and Stenocereus stellatus, approached using cultivation and molecular techniques, considering the possible effect of dry and rainy seasons. Cultivation-dependent methods were focused on putative N(2)-fixers and heterotrophic aerobic bacteria, in the two media tested the values obtained for dry season samples grouped together regardless of the sample type (rhizospheric or non-rhizospheric), these groups also included the non-rhizospheric sample for rainy season, on each medium. These CFU values were smaller and significantly different from those obtained on rhizospheric samples from rainy season. Genera composition among isolates of the rhizospheric samples was very similar for each season, the most abundant taxa being α-Proteobacteria, Actinobacteria and Firmicutes. Interestingly, the genus Ochrobactrum was highly represented among rhizospheric samples, when cultured in N-free medium. The structure of the bacterial communities was approached with molecular techniques targeting partial 16S rRNA sequences such as denaturing gradient gel electrophoresis and serial analysis of ribosomal sequence tags. Under these approaches, the most represented bacterial phyla were Actinobacteria, Proteobacteria and Acidobacteria. The first two were also highly represented when using isolation techniques.

  18. Effect of acidic electrolyzed water-induced bacterial inhibition and injury in live clam (Venerupis philippinarum) and mussel (Mytilus edulis).

    PubMed

    Al-Qadiri, Hamzah M; Al-Holy, Murad A; Shiroodi, Setareh Ghorban; Ovissipour, Mahmoudreza; Govindan, Byju N; Al-Alami, Nivin; Sablani, Shyam S; Rasco, Barbara

    2016-08-16

    The effect of acidic electrolyzed water (AEW) on inactivating Escherichia coli O104:H4, Listeria monocytogenes, Aeromonas hydrophila, Vibrio parahaemolyticus and Campylobacter jejuni in laboratory contaminated live clam (Venerupis philippinarum) and mussel (Mytilus edulis) was investigated. The initial levels of bacterial contamination were: in clam 4.9 to 5.7log10CFU/g, and in mussel 5.1 to 5.5log10CFU/g. Two types of AEW were used for treatment time intervals of 1 and 2h: strong (SAEW) with an available chlorine concentration (ACC) of 20mg/L, pH=3.1, and an oxidation-reduction potential (ORP) of 1150mV, and weak (WAEW) at ACC of 10mg/L, pH=3.55 and ORP of 950mV. SAEW and WAEW exhibited significant inhibitory activity against inoculated bacteria in both shellfish species with significant differences compared to saline solutions treatments (1-2% NaCl) and untreated controls (0h). SAEW showed the largest inhibitory activity, the extent of reduction (log10CFU/g) ranged from 1.4-1.7 for E. coli O104:H4; 1.0-1.6 for L. monocytogenes; 1.3-1.6 for A. hydrophila; 1.0-1.5 for V. parahaemolyticus; and 1.5-2.2 for C. jejuni in both types of shellfish. In comparison, significantly (P<0.05) lower inhibitory effect of WAEW was achieved compared to SAEW, where the extent of reduction (log10CFU/g) ranged from 0.7-1.1 for E. coli O104:H4; 0.6-0.9 for L. monocytogenes; 0.6-1.3 for A. hydrophila; 0.7-1.3 for V. parahaemolyticus; and 0.8-1.9 for C. jejuni in both types of shellfish. Among all bacterial strains examined in this study, AEW induced less bacterial injury (~0.1-1.0log10CFU/g) and more inactivation effect. This study revealed that AEW (10-20mg/L ACC) could be used to reduce bacterial contamination in live clam and mussel, which may help control possible unhygienic practices during production and processing of shellfish without apparent changes in the quality of the shellfish.

  19. Recent advances in inhibitors of bacterial fatty acid synthesis type II (FASII) system enzymes as potential antibacterial agents.

    PubMed

    Wang, Yi; Ma, Shutao

    2013-10-01

    Bacterial infections are a constant and serious threat to human health. With the increase of multidrug resistance of clinically pathogenic bacteria, common antibiotic therapies have been less effective. Fatty acid synthesis type II (FASII) system enzymes are essential for bacterial membrane lipid biosynthesis and represent increasingly promising targets for the discovery of antibacterial agents with new mechanisms of action. This review highlights recent advances in inhibitors of bacterial FASII as potential antibacterial agents, paying special attention to the activities, mechanisms, and structure-activity relationships of those inhibitors that mainly target β-ketoacyl-ACP synthase, β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydratase, and enoyl-ACP reductase. Although inhibitors with low nanomolar and selective activity against various bacterial FASII have entered clinical trials, further research is needed to expand upon both available and yet unknown scaffolds to identify new FASII inhibitors that may have antibacterial potential, particularly against resistant bacterial strains.

  20. The soil bacterial communities of South African fynbos riparian ecosystems invaded by Australian Acacia species.

    PubMed

    Slabbert, Etienne; Jacobs, Shayne Martin; Jacobs, Karin

    2014-01-01

    Riparian ecosystem along rivers and streams are characterised by lateral and longitudinal ecological gradients and, as a result, harbour unique biodiversity. Riparian ecosystems in the fynbos of the Western Cape, South Africa, are characterised by seasonal dynamics, with summer droughts followed by high flows during winter. The unique hydrology and geomorphology of riparian ecosystems play an important role in shaping these ecosystems. The riparian vegetation in the Western Cape has, however, largely been degraded due to the invasion of non-indigenous plants, in particular Acacia mearnsii, A. saligna and A. dealbata. This study investigated the effect of hydrology and invasion on the bacterial communities associated with fynbos riparian ecosystems. Bacterial communities were characterised with automated ribosomal intergenic spacer analysis (ARISA) and 454 16S rDNA pyrosequencing. Chemical and physical properties of soil within sites were also determined and correlated with community data. Sectioning across the lateral zones revealed significant differences in community composition, and the specific bacterial taxa influenced. Results also showed that the bacterial community structure could be linked to Acacia invasion. The presence of invasive Acacia was correlated with specific bacterial phyla. However, high similarity between cleared and pristine sites suggests that the effect of Acacia on the soil bacterial community structure may not be permanent. This study demonstrates how soil bacterial communities are influenced by hydrological gradients associated with riparian ecosystems and the impact of Acacia invasion on these communities.

  1. The Soil Bacterial Communities of South African Fynbos Riparian Ecosystems Invaded by Australian Acacia Species

    PubMed Central

    Slabbert, Etienne; Jacobs, Shayne Martin; Jacobs, Karin

    2014-01-01

    Riparian ecosystem along rivers and streams are characterised by lateral and longitudinal ecological gradients and, as a result, harbour unique biodiversity. Riparian ecosystems in the fynbos of the Western Cape, South Africa, are characterised by seasonal dynamics, with summer droughts followed by high flows during winter. The unique hydrology and geomorphology of riparian ecosystems play an important role in shaping these ecosystems. The riparian vegetation in the Western Cape has, however, largely been degraded due to the invasion of non-indigenous plants, in particular Acacia mearnsii, A. saligna and A. dealbata. This study investigated the effect of hydrology and invasion on the bacterial communities associated with fynbos riparian ecosystems. Bacterial communities were characterised with automated ribosomal intergenic spacer analysis (ARISA) and 454 16S rDNA pyrosequencing. Chemical and physical properties of soil within sites were also determined and correlated with community data. Sectioning across the lateral zones revealed significant differences in community composition, and the specific bacterial taxa influenced. Results also showed that the bacterial community structure could be linked to Acacia invasion. The presence of invasive Acacia was correlated with specific bacterial phyla. However, high similarity between cleared and pristine sites suggests that the effect of Acacia on the soil bacterial community structure may not be permanent. This study demonstrates how soil bacterial communities are influenced by hydrological gradients associated with riparian ecosystems and the impact of Acacia invasion on these communities. PMID:24475145

  2. Phylogenetic Sequence Variations in Bacterial rRNA Affect Species-Specific Susceptibility to Drugs Targeting Protein Synthesis▿‡

    PubMed Central

    Akshay, Subramanian; Bertea, Mihai; Hobbie, Sven N.; Oettinghaus, Björn; Shcherbakov, Dimitri; Böttger, Erik C.; Akbergenov, Rashid

    2011-01-01

    Antibiotics targeting the bacterial ribosome typically bind to highly conserved rRNA regions with only minor phylogenetic sequence variations. It is unclear whether these sequence variations affect antibiotic susceptibility or resistance development. To address this question, we have investigated the drug binding pockets of aminoglycosides and macrolides/ketolides. The binding site of aminoglycosides is located within helix 44 of the 16S rRNA (A site); macrolides/ketolides bind to domain V of the 23S rRNA (peptidyltransferase center). We have used mutagenesis of rRNA sequences in Mycobacterium smegmatis ribosomes to reconstruct the different bacterial drug binding sites and to study the effects of rRNA sequence variations on drug activity. Our results provide a rationale for differences in species-specific drug susceptibility patterns and species-specific resistance phenotypes associated with mutational alterations in the drug binding pocket. PMID:21730122

  3. Divalent cations enhance fluoride binding to Streptococcus mutans and Streptococcus sanguinis cells and subsequently inhibit bacterial acid production.

    PubMed

    Domon-Tawaraya, H; Nakajo, K; Washio, J; Ashizawa, T; Ichino, T; Sugawara, H; Fukumoto, S; Takahashi, N

    2013-01-01

    One preventive effect of topical fluoride application is derived from the fact that fluoride can inhibit bacterial acid production. Furthermore, divalent cations such as Ca(2+) and Mg(2+) increase the binding of fluoride to bacterial cells. These findings suggest that exposure of oral bacteria to fluoride in the presence of divalent cations increases fluoride binding to bacterial cells and subsequently enhances fluoride-induced inhibition of bacterial acid production. This study investigated the effects of fluoride exposure (0-20,000 ppm F) in the presence of Ca(2+) or Mg(2+) prior to glucose challenge on pH fall ability by bacterial sugar fermentation, as well as fluoride binding to bacterial cells by exposure to fluoride, and fluoride release from bacterial cells during bacterial sugar fermentation, using caries-related bacteria, Streptococcus mutans and Streptococcus sanguinis. The pH fall by both streptococci was inhibited by exposure to over 250 ppm F in the presence of Ca(2+) (p < 0.01), whereas in the presence of Mg(2+), the pH fall by S. mutans and S. sanguinis was inhibited after exposure to over 250 and 950 ppm F, respectively (p < 0.05). The amounts of fluoride binding to and released from streptococcal cells increased with the concentration of fluoride the cells were exposed to in the presence of Mg(2+), but were high enough even after 250 ppm F exposure in the presence of Ca(2+). The enhanced inhibition of acid production in the presence of divalent cations is probably due to the improved efficiency of fluoride binding to bacterial cells being improved via these divalent cations.

  4. Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.

    PubMed

    Kaul, Tiffany K; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V; Kapahi, Pankaj; Gill, Matthew S

    2014-01-01

    The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit.

  5. Development of a bacterial bioassay for atrazine and cyanuric acid detection

    PubMed Central

    Hua, Anna; Gueuné, Hervé; Cregut, Mickaël; Thouand, Gérald; Durand, Marie-José

    2015-01-01

    The s-triazine herbicides are compounds which can disseminate into soils and water. Due to their toxic effects on living organisms, their concentrations in drinking water are legislated by WHO recommendations. Here we have developed for the first time, to the best of our knowledge, an alternative method for physicochemical quantification using two bioluminescent bacterial biosensors: E. coli SM003 for cyanuric acid detection and E. coli SM004 for both atrazine and cyanuric acid detection. The concentration of cyanuric acid detection for E. coli SM003 ranges from 7.83 μM to 2.89 mM, and for E. coli SM004 ranges from 0.22 to 15 μM. Moreover, atrazine detection by E. coli SM004 ranges from 1.08 to 15 μM. According to WHO recommendations, the cyanuric acid detection range is sensitive enough to discriminate between polluted and drinking water. Nevertheless, the detection of atrazine by E. coli SM004 is only applicable for high concentrations of contaminants. PMID:25852669

  6. Bacterial Fatty Acids Enhance Recovery from the Dauer Larva in Caenorhabditis elegans

    PubMed Central

    Kaul, Tiffany K.; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V.; Kapahi, Pankaj; Gill, Matthew S.

    2014-01-01

    The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit. PMID:24475206

  7. Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.

    2012-07-01

    Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.

  8. Combined chemical and physical transformation method with RbCl and sepiolite for the transformation of various bacterial species.

    PubMed

    Ren, Jun; Lee, Haram; Yoo, Seung Min; Yu, Myeong-Sang; Park, Hansoo; Na, Dokyun

    2017-04-01

    DNA transformation that delivers plasmid DNAs into bacterial cells is fundamental in genetic manipulation to engineer and study bacteria. Developed transformation methods to date are optimized to specific bacterial species for high efficiency. Thus, there is always a demand for simple and species-independent transformation methods. We herein describe the development of a chemico-physical transformation method that combines a rubidium chloride (RbCl)-based chemical method and sepiolite-based physical method, and report its use for the simple and efficient delivery of DNA into various bacterial species. Using this method, the best transformation efficiency for Escherichia coli DH5α was 4.3×10(6)CFU/μg of pUC19 plasmid, which is higher than or comparable to the reported transformation efficiencies to date. This method also allowed the introduction of plasmid DNAs into Bacillus subtilis (5.7×10(3)CFU/μg of pSEVA3b67Rb), Bacillus megaterium (2.5×10(3)CFU/μg of pSPAsp-hp), Lactococcus lactis subsp. lactis (1.0×10(2)CFU/μg of pTRKH3-ermGFP), and Lactococcus lactis subsp. cremoris (2.2×10(2)CFU/μg of pMSP3535VA). Remarkably, even when the conventional chemical and physical methods failed to generate transformed cells in Bacillus sp. and Enterococcus faecalis, E. malodoratus and E. mundtii, our combined method showed a significant transformation efficiency (2.4×10(4), 4.5×10(2), 2×10(1), and 0.5×10(1)CFU/μg of plasmid DNA). Based on our results, we anticipate that our simple and efficient transformation method should prove usefulness for introducing DNA into various bacterial species without complicated optimization of parameters affecting DNA entry into the cell.

  9. Ursodeoxycholic Acid and Its Taurine- or Glycine-Conjugated Species Reduce Colitogenic Dysbiosis and Equally Suppress Experimental Colitis in Mice.

    PubMed

    Van den Bossche, Lien; Hindryckx, Pieter; Devisscher, Lindsey; Devriese, Sarah; Van Welden, Sophie; Holvoet, Tom; Vilchez-Vargas, Ramiro; Vital, Marius; Pieper, Dietmar H; Vanden Bussche, Julie; Vanhaecke, Lynn; Van de Wiele, Tom; De Vos, Martine; Laukens, Debby

    2017-04-01

    The promising results seen in studies of secondary bile acids in experimental colitis suggest that they may represent an attractive and safe class of drugs for the treatment of inflammatory bowel diseases (IBD). However, the exact mechanism by which bile acid therapy confers protection from colitogenesis is currently unknown. Since the gut microbiota plays a crucial role in the pathogenesis of IBD, and exogenous bile acid administration may affect the community structure of the microbiota, we examined the impact of the secondary bile acid ursodeoxycholic acid (UDCA) and its taurine or glycine conjugates on the fecal microbial community structure during experimental colitis. Daily oral administration of UDCA, tauroursodeoxycholic acid (TUDCA), or glycoursodeoxycholic acid (GUDCA) equally lowered the severity of dextran sodium sulfate-induced colitis in mice, as evidenced by reduced body weight loss, colonic shortening, and expression of inflammatory cytokines. Illumina sequencing demonstrated that bile acid therapy during colitis did not restore fecal bacterial richness and diversity. However, bile acid therapy normalized the colitis-associated increased ratio of Firmicutes to Bacteroidetes Interestingly, administration of bile acids prevented the loss of Clostridium cluster XIVa and increased the abundance of Akkermansia muciniphila, bacterial species known to be particularly decreased in IBD patients. We conclude that UDCA, which is an FDA-approved drug for cholestatic liver disorders, could be an attractive treatment option to reduce dysbiosis and ameliorate inflammation in human IBD.IMPORTANCE Secondary bile acids are emerging as attractive candidates for the treatment of inflammatory bowel disease. Although bile acids may affect the intestinal microbial community structure, which significantly contributes to the course of these inflammatory disorders, the impact of bile acid therapy on the fecal microbiota during colitis has not yet been considered. Here, we

  10. Salicylic acid signaling inhibits apoplastic reactive oxygen species signaling

    PubMed Central

    2014-01-01

    Background Reactive oxygen species (ROS) are used by plants as signaling molecules during stress and development. Given the amount of possible challenges a plant face from their environment, plants need to activate and prioritize between potentially conflicting defense signaling pathways. Until recently, most studies on signal interactions have focused on phytohormone interaction, such as the antagonistic relationship between salicylic acid (SA)-jasmonic acid and cytokinin-auxin. Results In this study, we report an antagonistic interaction between SA signaling and apoplastic ROS signaling. Treatment with ozone (O3) leads to a ROS burst in the apoplast and induces extensive changes in gene expression and elevation of defense hormones. However, Arabidopsis thaliana dnd1 (defense no death1) exhibited an attenuated response to O3. In addition, the dnd1 mutant displayed constitutive expression of defense genes and spontaneous cell death. To determine the exact process which blocks the apoplastic ROS signaling, double and triple mutants involved in various signaling pathway were generated in dnd1 background. Simultaneous elimination of SA-dependent and SA-independent signaling components from dnd1 restored its responsiveness to O3. Conversely, pre-treatment of plants with SA or using mutants that constitutively activate SA signaling led to an attenuation of changes in gene expression elicited by O3. Conclusions Based upon these findings, we conclude that plants are able to prioritize the response between ROS and SA via an antagonistic action of SA and SA signaling on apoplastic ROS signaling. PMID:24898702

  11. Inter-species interconnections in acid mine drainage microbial communities

    PubMed Central

    Comolli, Luis R.; Banfield, Jill F.

    2014-01-01

    Metagenomic studies are revolutionizing our understanding of microbes in the biosphere. They have uncovered numerous proteins of unknown function in tens of essentially unstudied lineages that lack cultivated representatives. Notably, few of these microorganisms have been visualized, and even fewer have been described ultra-structurally in their essentially intact, physiologically relevant states. Here, we present cryogenic transmission electron microscope (cryo-TEM) 2D images and 3D tomographic datasets for archaeal species from natural acid mine drainage (AMD) microbial communities. Ultrastructural findings indicate the importance of microbial interconnectedness via a range of mechanisms, including direct cytoplasmic bridges and pervasive pili. The data also suggest a variety of biological structures associated with cell-cell interfaces that lack explanation. Some may play roles in inter-species interactions. Interdependences amongst the archaea may have confounded prior isolation efforts. Overall, the findings underline knowledge gaps related to archaeal cell components and highlight the likely importance of co-evolution in shaping microbial lineages. PMID:25120533

  12. Occurrence of homologs of the Escherichia coli lytB gene in gram-negative bacterial species.

    PubMed

    Potter, S; Yang, X; Boulanger, M J; Ishiguro, E E

    1998-04-01

    The Escherichia coli LytB protein regulates the activity of guanosine 3',5'-bispyrophosphate synthetase I (RelA). A Southern blot analysis of chromosomal DNA with the E. coli lytB gene as a probe revealed the presence of lytB homologs in all of the gram-negative bacterial species examined but not in gram-positive species. The lytB homologs from Enterobacter aerogenes and Pseudomonas fluorescens complemented the E. coli lytB44 mutant allele.

  13. Effect of temperature and hydraulic retention time on volatile fatty acid production based on bacterial community structure in anaerobic acidogenesis using swine wastewater.

    PubMed

    Kim, Woong; Shin, Seung Gu; Lim, Juntaek; Hwang, Seokhwan

    2013-06-01

    To investigate the effect of hydraulic retention time (HRT) and temperature (T) on bacterial community structure and volatile fatty acids (VFAs) production of an acidogenic process, and VFA production and changes in the bacterial community in three identical automated anaerobic continuously-stirred tank reactors were analyzed using response surface analysis (RSA) and nonmetric multidimensional scaling (NMDS). For RSA, 11 trials were conducted to find the combination of T and HRT under which VFA production was greatest; VFA production was affected more by HRT than by T. To identify the bacterial community structure in each trial, DNA from each experimental point of the RSA was analyzed using denaturating gradient gel electrophoresis (DGGE), and eight bacteria species were detected. NMDS was conducted on band intensities obtained using DGGE, and bacterial community structure was affected more by T than by HRT. Taken together, these results suggest that VFA production during acidogenesis was more dependent on the physicochemical properties of acidogens, such as their specific growth rate or contact time with of substrates, than on changes in the microbial community.

  14. Comparative Inter-Species Pharmacokinetics of Phenoxyacetic Acid Herbicides and Related Organic Acids. Evidence that the Dog is Not a Relevant Species for Evaluation of Human Health Risk.

    SciTech Connect

    Timchalk, Chuck

    2004-07-15

    Phenoxyacetic acids including 2,4-dichlorophenoxyacetic acid (2,4-D) and 4-chloro-2-methylphenoxyacetic acid (MCPA) are widely utilized organic acid herbicides that have undergone extensive toxicity and pharmacokinetic analyses. The dog is particularly susceptible to the toxicity of phenoxyacetic acids and related organic acids relative to other species. Active renal clearance mechanisms for organic acids are ubiquitous in mammalian species, and thus a likely mechanism responsible for the increased sensitivity of the dog to these agents is linked to a lower capacity to secrete organic acids from the kidney. Using published data describing the pharmacokinetics of phenoxyacetic and structurally related organic acids in a variety of species including humans, inter-species comparative pharmacokinetics were evaluated using allometic parameter scaling. For both 2,4-D and MCPA the dog plasma half-life (t1/2) and renal clearance (Clr; ml hr-1) rates did not scale as a function of body weight across species; whereas for all other species evaluated, including humans, these pharmacokinetic parameters reasonably scaled. This exceptional response in the dog is clearly illustrated by comparing the plasma t1/2 at comparable doses of 2,4-D and MCPA, across several species. At a dosage of 5 mg/kg, in dogs the plasma t1/2 for 2,4-D and MCPA were {approx}92 - 106 hr and 63 hr, respectively, which is substantially longer than in the rat ({approx}1 and 6 hr, respectively) or in humans (12 and 11 hr, respectively). This longer t1/2, and slower elimination in the dog, results in substantially higher body burdens of these organic acids, at comparable doses, relative to other species. Although these results indicate the important role of renal transport clearance mechanisms as determinants of the clearance and potential toxicity outcomes of phenoxyacetic acid herbicides across several species, other contributing mechanisms such as reabsorption from the renal tubules is highly likely. These

  15. Insecticidal potency of bacterial species Bacillus thuringiensis SV2 and Serratia nematodiphila SV6 against larvae of mosquito species Aedes aegypti, Anopheles stephensi, and Culex quinquefasciatus.

    PubMed

    Patil, Chandrashekhar D; Patil, Satish V; Salunke, Bipinchandra K; Salunkhe, Rahul B

    2012-05-01

    The tremendous worldwide efforts to isolate novel mosquito larvicidal bacteria with improved efficacy present significant promise to control vector-borne diseases of public health importance. In the present study, two native bacterial isolates, Bacillus thuringiensis (Bt SV2) and Serratia species (SV6) were evaluated for mosquito larvicidal potential against the early fourth instar larvae of Aedes aegypti, Anopheles stephensi, and Culex quinquefasciatus with reference to B. thuringiensis subsp. israelensis (Bti) H 14. The native Gram-positive, spore-forming Bt SV2 isolate showed 100% mortality against early fourth instars of Aedes aegypti, Anopheles stephensi, and Culex quinquefasciatus, in parallel to Bti H14 strain. After 24 h, Bt SV2 showed 98%, 89%, and 80.67%, and Bti H14 showed 92%, 98.33%, and 60% mortality against Aedes aegypti, Anopheles stephensi, and Culex quinquefasciatus, respectively. Serratia SV6 showed highest activity against Culex quinquefasciatus (100%) followed by Anopheles stephensi (95%) and Aedes aegypti (91%) after 48 h of exposure. The Gram-negative Serratia SV6 showed delayed toxicity compared to Bti H14 and Bt SV2 against early fourth instars of Aedes aegypti, Anopheles stephensi, and Culex quinquefasciatus. The relative mortality of all treatments after 12-h exposures showed the varied toxicity with respect to exposure time, bacterial treatment, and mosquito species. Genetic relatedness of the strains was confirmed on the basis of phylogenetic reconstructions based on alignment of 16S rRNA gene sequences which indicated a strong clustering of the strain SV2 with B. thuringiensis and the strain SV6 with Serratia nematodiphila. In conclusion, the native isolate B. thuringiensis SV2 showed significant toxicity while Serratia SV6 showed less and delayed toxicity against several mosquito species compared with BtiH14. They may be used as novel bacterial insecticidal agents in mosquito vector-borne disease control. To our knowledge, this is the

  16. Peroxidase activity of bacterial cytochrome P450 enzymes: modulation by fatty acids and organic solvents.

    PubMed

    Rabe, Kersten S; Erkelenz, Michael; Kiko, Kathrin; Niemeyer, Christof M

    2010-08-01

    The modulation of peroxidase activity by fatty acid additives and organic cosolvents was determined and compared for four bacterial cytochrome P450 enzymes, thermostable P450 CYP119A1, the P450 domain of CYP102A1 (BMP), CYP152A1 (P450(bsbeta)), and CYP101A1 (P450(cam)). Utilizing a high-throughput microplate assay, we were able to readily screen more than 100 combinations of enzymes, additives and cosolvents in a convenient and highly reproducible assay format. We found that, in general, CYP119A1 and BMP showed an increase in peroxidative activity in the presence of fatty acids, whereas CYP152A1 revealed a decrease in activity and CYP101A1 was only slightly affected. In particular, we observed that the conversion of the fluorogenic peroxidase substrate Amplex Red by CYP119A1 and BMP was increased by a factor of 38 or 11, respectively, when isopropanol and lauric acid were present in the reaction mixture. The activity of CYP119A1 could thus be modulated to reach more than 90% of the activity of CYP152A1 without effectors, which is the system with the highest peroxidative activity. For all P450s investigated we found distinctive reactivity patterns, which suggest similarities in the binding site of CYP119A1 and BMP in contrast with the other two proteins studied. Therefore, this study points towards a role of fatty acids as activators for CYP enzymes in addition to being mere substrates. In general, our detailed description of fatty acid- and organic solvent-effects is of practical interest because it illustrates that optimization of modulators and cosolvents can lead to significantly increased yields in biocatalysis.

  17. Biological control of bacterial wilt in Arabidopsis thaliana involves abscissic acid signalling.

    PubMed

    Feng, Dong Xin; Tasset, Céline; Hanemian, Mathieu; Barlet, Xavier; Hu, Jian; Trémousaygue, Dominique; Deslandes, Laurent; Marco, Yves

    2012-06-01

    Means to control bacterial wilt caused by the phytopathogenic root bacteria Ralstonia solanacearum are limited. Mutants in a large cluster of genes (hrp) involved in the pathogenicity of R. solanacearum were successfully used in a previous study as endophytic biocontrol agents in challenge inoculation experiments on tomato. However, the molecular mechanisms controlling this resistance remained unknown. We developed a protection assay using Arabidopsis thaliana as a model plant and analyzed the events underlying the biological control by genetic, transcriptomic and molecular approaches. High protection rates associated with a significant decrease in the multiplication of R. solanacearum were observed in plants pre-inoculated with a ΔhrpB mutant strain. Neither salicylic acid, nor jasmonic acid/ethylene played a role in the establishment of this resistance. Microarray analysis showed that 26% of the up-regulated genes in protected plants are involved in the biosynthesis and signalling of abscissic acid (ABA). In addition 21% of these genes are constitutively expressed in the irregular xylem cellulose synthase mutants (irx), which present a high level of resistance to R. solanacearum. We propose that inoculation with the ΔhrpB mutant strain generates a hostile environment for subsequent plant colonization by a virulent strain of R. solanacearum.

  18. Lactic acid bacterial symbionts in honeybees - an unknown key to honey's antimicrobial and therapeutic activities.

    PubMed

    Olofsson, Tobias C; Butler, Èile; Markowicz, Pawel; Lindholm, Christina; Larsson, Lennart; Vásquez, Alejandra

    2016-10-01

    Could honeybees' most valuable contribution to mankind besides pollination services be alternative tools against infections? Today, due to the emerging antibiotic-resistant pathogens, we are facing a new era of searching for alternative tools against infections. Natural products such as honey have been applied against human's infections for millennia without sufficient scientific evidence. A unique lactic acid bacterial (LAB) microbiota was discovered by us, which is in symbiosis with honeybees and present in large amounts in fresh honey across the world. This work investigates if the LAB symbionts are the source to the unknown factors contributing to honey's properties. Hence, we tested the LAB against severe wound pathogens such as methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa and vancomycin-resistant Enterococcus (VRE) among others. We demonstrate a strong antimicrobial activity from each symbiont and a synergistic effect, which counteracted all the tested pathogens. The mechanisms of action are partly shown by elucidating the production of active compounds such as proteins, fatty acids, anaesthetics, organic acids, volatiles and hydrogen peroxide. We show that the symbionts produce a myriad of active compounds that remain in variable amounts in mature honey. Further studies are now required to investigate if these symbionts have a potential in clinical applications as alternative tools against topical human and animal infections.

  19. Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

    PubMed

    Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

    2015-07-01

    The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells.

  20. Cautionary tale of using 16S rRNA gene sequence similarity values in identification of human-associated bacterial species.

    PubMed

    Rossi-Tamisier, Morgane; Benamar, Samia; Raoult, Didier; Fournier, Pierre-Edouard

    2015-06-01

    Modern bacterial taxonomy is based on a polyphasic approach that combines phenotypic and genotypic characteristics, including 16S rRNA sequence similarity. However, the 95 % (for genus) and 98.7 % (for species) sequence similarity thresholds that are currently recommended to classify bacterial isolates were defined by comparison of a limited number of bacterial species, and may not apply to many genera that contain human-associated species. For each of 158 bacterial genera containing human-associated species, we computed pairwise sequence similarities between all species that have names with standing in nomenclature and then analysed the results, considering as abnormal any similarity value lower than 95 % or greater than 98.7 %. Many of the current bacterial species with validly published names do not respect the 95 and 98.7 % thresholds, with 57.1 % of species exhibiting 16S rRNA gene sequence similarity rates ≥98.7 %, and 60.1 % of genera containing species exhibiting a 16S rRNA gene sequence similarity rate <95 %. In only 17 of the 158 genera studied (10.8 %), all species respected the 95 and 98.7 % thresholds. As we need powerful and reliable taxonomical tools, and as potential new tools such as pan-genomics have not yet been fully evaluated for taxonomic purposes, we propose to use as thresholds, genus by genus, the minimum and maximum similarity values observed among species.

  1. Activation of the Jasmonic Acid Plant Defence Pathway Alters the Composition of Rhizosphere Bacterial Communities

    PubMed Central

    Carvalhais, Lilia C.; Dennis, Paul G.; Badri, Dayakar V.; Tyson, Gene W.; Vivanco, Jorge M.; Schenk, Peer M.

    2013-01-01

    Jasmonic acid (JA) signalling plays a central role in plant defences against necrotrophic pathogens and herbivorous insects, which afflict both roots and shoots. This pathway is also activated following the interaction with beneficial microbes that may lead to induced systemic resistance. Activation of the JA signalling pathway via application of methyl jasmonate (MeJA) alters the composition of carbon containing compounds released by roots, which are implicated as key determinants of rhizosphere microbial community structure. In this study, we investigated the influence of the JA defence signalling pathway activation in Arabidopsis thaliana on the structure of associated rhizosphere bacterial communities using 16S rRNA gene amplicon pyrosequencing. Application of MeJA did not directly influence bulk soil microbial communities but significant changes in rhizosphere community composition were observed upon activation of the jasmonate signalling pathway. Our results suggest that JA signalling may mediate plant-bacteria interactions in the soil upon necrotrophic pathogen and herbivorous insect attacks. PMID:23424661

  2. Bacterial GRAS domain proteins throw new light on gibberellic acid response mechanisms

    PubMed Central

    Zhang, Dapeng; Iyer, Lakshminarayan M.; Aravind, L.

    2012-01-01

    Summary: Gibberellic acids (GAs) are key plant hormones, regulating various aspects of growth and development, which have been at the center of the ‘green revolution’. GRAS family proteins, the primary players in GA signaling pathways, remain poorly understood. Using sequence-profile searches, structural comparisons and phylogenetic analysis, we establish that the GRAS family first emerged in bacteria and belongs to the Rossmann fold methyltransferase superfamily. All bacterial and a subset of plant GRAS proteins are likely to function as small-molecule methylases. The remaining plant versions have lost one or more AdoMet (SAM)-binding residues while preserving their substrate-binding residues. We predict that GRAS proteins might either modify or bind small molecules such as GAs or their derivatives. Contact: aravind@ncbi.nlm.nih.gov Supplementary Information: Supplementary Material for this article is available at Bioinformatics online. PMID:22829623

  3. Host plant species determines symbiotic bacterial community mediating suppression of plant defenses.

    PubMed

    Chung, Seung Ho; Scully, Erin D; Peiffer, Michelle; Geib, Scott M; Rosa, Cristina; Hoover, Kelli; Felton, Gary W

    2017-01-03

    Herbivore associated bacteria are vital mediators of plant and insect interactions. Host plants play an important role in shaping the gut bacterial community of insects. Colorado potato beetles (CPB; Leptinotarsa decemlineata) use several Solanum plants as hosts in their natural environment. We previously showed that symbiotic gut bacteria from CPB larvae suppressed jasmonate (JA)-induced defenses in tomato. However, little is known about how changes in the bacterial community may be involved in the manipulation of induced defenses in wild and cultivated Solanum plants of CPB. Here, we examined suppression of JA-mediated defense in wild and cultivated hosts of CPB by chemical elicitors and their symbiotic bacteria. Furthermore, we investigated associations between the gut bacterial community and suppression of plant defenses using 16 S rRNA amplicon sequencing. Symbiotic bacteria decreased plant defenses in all Solanum hosts and there were different gut bacterial communities in CPB fed on different host plants. When larvae were reared on different hosts, defense suppression differed among host plants. These results demonstrate that host plants influence herbivore gut bacterial communities and consequently affect the herbivore's ability to manipulate JA-mediated plant defenses. Thus, the presence of symbiotic bacteria that suppress plant defenses might help CPB adapt to host plants.

  4. Host plant species determines symbiotic bacterial community mediating suppression of plant defenses

    PubMed Central

    Chung, Seung Ho; Scully, Erin D.; Peiffer, Michelle; Geib, Scott M.; Rosa, Cristina; Hoover, Kelli; Felton, Gary W.

    2017-01-01

    Herbivore associated bacteria are vital mediators of plant and insect interactions. Host plants play an important role in shaping the gut bacterial community of insects. Colorado potato beetles (CPB; Leptinotarsa decemlineata) use several Solanum plants as hosts in their natural environment. We previously showed that symbiotic gut bacteria from CPB larvae suppressed jasmonate (JA)-induced defenses in tomato. However, little is known about how changes in the bacterial community may be involved in the manipulation of induced defenses in wild and cultivated Solanum plants of CPB. Here, we examined suppression of JA-mediated defense in wild and cultivated hosts of CPB by chemical elicitors and their symbiotic bacteria. Furthermore, we investigated associations between the gut bacterial community and suppression of plant defenses using 16 S rRNA amplicon sequencing. Symbiotic bacteria decreased plant defenses in all Solanum hosts and there were different gut bacterial communities in CPB fed on different host plants. When larvae were reared on different hosts, defense suppression differed among host plants. These results demonstrate that host plants influence herbivore gut bacterial communities and consequently affect the herbivore’s ability to manipulate JA-mediated plant defenses. Thus, the presence of symbiotic bacteria that suppress plant defenses might help CPB adapt to host plants. PMID:28045052

  5. The effect of ionizing radiation on amino acids and bacterial spores in different geo- and cosmochemical environments

    NASA Astrophysics Data System (ADS)

    Kminek, Gerhard

    In this thesis I have investigated the impact of ionizing radiation from the environment on the stability of bacterial spores and amino acids. I measured the radiolysis constant of amino acids and the inactivation constant of bacterial spores. To put these results in the context of a natural setting, I have selected four different cases and calculated the radiation environment for meteorites, the Martian subsurface, terrestrial halite fluid inclusions, and fossil bones. Bacterial spores exhibit a remarkable resistance to adverse environments and are the best example for the long-term survival of life forms. On a molecular level, amino acids are of particular interest because of their importance in biochemistry and their stability in the environment. The significance of amino acids, however, goes back to a time before life existed. The exogenous delivery of amino acids by meteorites might have been essential to provide the required supply of organic molecules for the origin of life on the Earth. There is one common threat, however, to the preservation of amino acids and bacterial spores in all known terrestrial and extraterrestrial environments: ionizing radiation. Amino acids in meteorites are exposed to radiation from internal radioactivity and space radiation. I show that this radiation decomposes substantial amounts of amino acids over time, indicating a higher exogenous delivery of amino acids to the early Earth. The total radiodecomposition since the synthesis of amino acids is between 23 and 68%. Radiodecomposition induces a certain fractionation in favor of smaller amino acids. Fossil bones show a post-mortem uranium uptake. My results suggest a substantial radiodecomposition of amino acids on a 10 million year time scale. Age determination based on racemization of amino acids will be affected in fossil bones that are older than 1--30 million years. My results on the stability of bacterial spores in halite fluid inclusions and on Mars suggest that radiation

  6. Evolution of the Lactic Acid Bacterial Community during Malt Whisky Fermentation: a Polyphasic Study

    PubMed Central

    van Beek, Sylvie; Priest, Fergus G.

    2002-01-01

    The development of the lactic acid bacterial community in a commercial malt whisky fermentation occurred in three broad phases. Initially, bacteria were inhibited by strong yeast growth. Fluorescence microscopy and environmental scanning electron microscopy revealed, in this early stage, both cocci and rods that were at least partly derived from the wort and yeast but also stemmed from the distillery plant. Denaturing gradient gel electrophoresis (DGGE) of partial 16S rRNA genes and sequence analysis revealed cocci related to Streptococcus thermophilus or Saccharococcus thermophilus, Lactobacillus brevis, and Lactobacillus fermentum. The middle phase began 35 to 40 h after yeast inoculation and was characterized by exponential growth of lactobacilli and residual yeast metabolism. Lactobacillus casei or Lactobacillus paracasei, L. fermentum, and Lactobacillus ferintoshensis were detected in samples of fermenting wort examined by DGGE during this stage. Bacterial growth was accompanied by the accumulation of acetic and lactic acids and the metabolism of residual maltooligosaccharides. By 70 h, two new PCR bands were detected on DGGE gels, and the associated bacteria were largely responsible for the final phase of the fermentation. The bacteria were phylogenetically related to Lactobacillus acidophilus and Lactobacillus delbrueckii, and strains similar to the former had previously been recovered from malt whisky fermentations in Japan. These were probably obligately homofermentative bacteria, required malt wort for growth, and could not be cultured on normal laboratory media, such as MRS. Their metabolism during the last 20 to 30 h of fermentation was associated with yeast death and autolysis and further accumulation of lactate but no additional acetate. PMID:11772639

  7. The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species

    PubMed Central

    McGraw, Joseph E.; Jensen, Brittany J.; Bishop, Sydney S.; Lokken, James P.; Dorff, Kellen J.; Ripley, Michael P.; Munro, James B.

    2015-01-01

    Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. PMID:26497452

  8. The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species.

    PubMed

    Dailey, Frank E; McGraw, Joseph E; Jensen, Brittany J; Bishop, Sydney S; Lokken, James P; Dorff, Kellen J; Ripley, Michael P; Munro, James B

    2015-10-23

    Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains.

  9. In vitro activities of a novel nanoemulsion against Burkholderia and other multidrug-resistant cystic fibrosis-associated bacterial species.

    PubMed

    LiPuma, John J; Rathinavelu, Sivaprakash; Foster, Bridget K; Keoleian, Jordan C; Makidon, Paul E; Kalikin, Linda M; Baker, James R

    2009-01-01

    Respiratory tract infection, most often involving opportunistic bacterial species with broad-spectrum antibiotic resistance, is the primary cause of death in persons with cystic fibrosis (CF). Species within the Burkholderia cepacia complex are especially problematic in this patient population. We investigated a novel surfactant-stabilized oil-in-water nanoemulsion (NB-401) for activity against 150 bacterial isolates recovered primarily from CF respiratory tract specimens. These specimens included 75 Burkholderia isolates and 75 isolates belonging to other CF-relevant species including Pseudomonas, Achromobacter, Pandoraea, Ralstonia, Stenotrophomonas, and Acinetobacter. Nearly one-third of the isolates were multidrug resistant, and 20 (13%) were panresistant based on standard antibiotic testing. All isolates belonging to the same species were genotyped to ensure that each isolate was a distinct strain. The MIC(90) of NB-401 was 125 microg/ml. We found no decrease in activity against multidrug-resistant or panresistant strains. MBC testing showed no evidence of tolerance to NB-401. We investigated the activity of NB-401 against a subset of strains grown as a biofilm and against planktonic strains in the presence of CF sputum. Although the activity of NB-401 was decreased under both conditions, the nanoemulsion remained bactericidal for all strains tested. These results support NB-401's potential role as a novel antimicrobial agent for the treatment of infection due to CF-related opportunistic pathogens.

  10. Molecular screening for Midichloria in hard and soft ticks reveals variable prevalence levels and bacterial loads in different tick species.

    PubMed

    Cafiso, Alessandra; Bazzocchi, Chiara; De Marco, Leone; Opara, Maxwell N; Sassera, Davide; Plantard, Olivier

    2016-10-01

    Candidatus Midichloria mitochondrii, symbiont of the sheep tick Ixodes ricinus, was the first described member of the family Candidatus Midichloriaceae, order Rickettsiales. Recent reports are expanding our view of this family, now including numerous bacteria of great biological and medical interest, indicating a widespread distribution with an increasing range of hosts, with ticks being strongly represented. Here we present a molecular screening of 17 tick species, detecting and quantifying bacteria of the family Midichloriaceae in seven of them, including the first report of a representative of this family in a soft tick species (Argasidae), Ornithodoros maritimus. Based on sequence identity and phylogenetic analysis we propose that all these bacterial symbionts of ticks could be members of the genus Midichloria. The performed screening highlights different prevalence levels and variable bacterial loads in different tick species including one, Ixodes aulacodi, where the bacterium is present in all examined individuals, like in I. ricinus. This result prompts us to hypothesize different roles of Midichloria bacteria in different tick species.

  11. Exposure of Bacterial Biofilms to Electrical Current Leads to Cell Death Mediated in Part by Reactive Oxygen Species

    PubMed Central

    Brinkman, Cassandra L.; Schmidt-Malan, Suzannah M.; Karau, Melissa J.; Greenwood-Quaintance, Kerryl; Hassett, Daniel J.; Mandrekar, Jayawant N.

    2016-01-01

    Bacterial biofilms may form on indwelling medical devices such as prosthetic joints, heart valves and catheters, causing challenging-to-treat infections. We have previously described the ‘electricidal effect’, in which bacterial biofilms are decreased following exposure to direct electrical current. Herein, we sought to determine if the decreased bacterial quantities are due to detachment of biofilms or cell death and to investigate the role that reactive oxygen species (ROS) play in the observed effect. Using confocal and electron microscopy and flow cytometry, we found that direct current (DC) leads to cell death and changes in the architecture of biofilms formed by Gram-positive and Gram-negative bacteria. Reactive oxygen species (ROS) appear to play a role in DC-associated cell death, as there was an increase in ROS-production by Staphylococcus aureus and Staphylococcus epidermidis biofilms following exposure to DC. An increase in the production of ROS response enzymes catalase and superoxide dismutase (SOD) was observed for S. aureus, S. epidermidis and Pseudomonas aeruginosa biofilms following exposure to DC. Additionally, biofilms were protected from cell death when supplemented with antioxidants and oxidant scavengers, including catalase, mannitol and Tempol. Knocking out SOD (sodAB) in P. aeruginosa led to an enhanced DC effect. Microarray analysis of P. aeruginosa PAO1 showed transcriptional changes in genes related to the stress response and cell death. In conclusion, the electricidal effect results in death of bacteria in biofilms, mediated, at least in part, by production of ROS. PMID:27992529

  12. Impact of oxalic acid on rumen function and bacterial community in sheep.

    PubMed

    Belenguer, A; Ben Bati, M; Hervás, G; Toral, P G; Yáñez-Ruiz, D R; Frutos, P

    2013-06-01

    Oxalic acid (OA) is a secondary compound occurring in a wide range of plants consumed by ruminants, especially in saline lands or in arid and semi-arid regions. However, its impact on the rumen microbial community and its changes over time, as well as the potential consequences on ruminal function, remain unknown. To examine this impact, five ewes fitted with a ruminal cannula and fed low-quality grass hay were dosed daily with 0.6 mmol of OA/kg body weight through the cannula for 14 days. On days 0 (before the start), 4, 7 and 14 of the administration period, samples of ruminal digesta were collected throughout the day (0, 3, 6 and 9 h after the morning feeding) for analysis of the bacterial community and fermentation parameters (pH, ammonia and volatile fatty acid (VFA) concentrations). In addition, two feedstuffs were incubated in situ using the nylon bag technique to estimate ruminal degradation. Terminal restriction fragment length polymorphism was employed to monitor the dynamics of total bacteria, and quantitative real-time PCR was used to investigate the abundance of the oxalate-degrading Oxalobacter formigenes. Neither pH nor total VFA concentrations were affected. Nevertheless, OA dosing altered molar proportions of most individual VFA and ammonia concentrations (P < 0.001). The dry matter disappearance of alfalfa hay was reduced on days 7 and 14 and that of barley straw only on day 7 (P < 0.01). These slight changes were related to others observed in the relative frequency of a number of terminal restriction fragments. Variations in the ruminal microbiota occurred rapidly with OA administration, which did not modify the bacterial diversity significantly but altered the structure of the community. However, many of these changes were reversed by the end of the experiment, with no significant differences between days 0 and 14 of dosing. These results suggest a rapid adaptation of the rumen bacterial community linked to the estimated increase in the

  13. Stabilization of polynuclear plutonium(IV) species by humic acid

    NASA Astrophysics Data System (ADS)

    Marsac, Rémi; Banik, Nidhu Lal; Marquardt, Christian Michael; Kratz, Jens Volker

    2014-04-01

    Although the formation of tetravalent plutonium (Pu(IV)) polymers with natural organic matter was previously observed by spectroscopy, there is no quantitative evidence of such reaction in batch experiments. In the present study, Pu(IV) interaction with humic acid (HA) was investigated at pH 1.8, 2.5 and 3, as a function of HA concentration and for Pu total concentration equal to 6 × 10-8 M. The finally measured Pu(IV) concentrations ([Pu(IV)]eq) are below Pu(IV) solubility limit. Pu(IV)-HA interaction can be explained by the complexation of Pu(IV) monomers by HA up to [Pu(IV)]eq ∼ 10-8 M. However, the slope of the log-log Pu(IV)-HA binding isotherm changes from ∼0.7 to ∼3.5 for higher [Pu(IV)]eq than ∼10-8 M and at any pH. This result suggests the stabilization of hydrolyzed polymeric Pu(IV) species by HA, with a 4:1 Pu:HA stoichiometry. This confirms, for the first time, previous observations made by spectroscopy in concentrated systems. The humic-ion binding model, Model VII, was introduced into the geochemical speciation program PHREEQC and was used to simulate Pu(IV) monomers binding to HA. The simulations are consistent with other tetravalent actinides-HA binding data from literature. The stabilization of a Pu tetramer (Pu4(OH)88+) by HA was proposed to illustrate the present experimental results for [Pu(IV)]eq > 10-8 M. Predictive simulations of Pu(IV) apparent solubility due to HA show that the chosen Pu(IV)-polymer has no impact for pH > 4. However, the comparison between these predictions and recent spectroscopic results suggest that more hydrolyzed polymeric Pu(IV) species can be stabilized by HA at pH > 4. Polymeric Pu(IV)-HA species might significantly enhance Pu(IV) apparent solubility due to humics, which support a colloid-facilitated transport of this low solubility element.

  14. Selection of key sequence-based features for prediction of essential genes in 31 diverse bacterial species

    PubMed Central

    Liu, Xiao; Wang, Bao-Jin; Xu, Luo; Tang, Hong-Ling; Xu, Guo-Qing

    2017-01-01

    Genes that are indispensable for survival are essential genes. Many features have been proposed for computational prediction of essential genes. In this paper, the least absolute shrinkage and selection operator method was used to screen key sequence-based features related to gene essentiality. To assess the effects, the selected features were used to predict the essential genes from 31 bacterial species based on a support vector machine classifier. For all 31 bacterial objects (21 Gram-negative objects and ten Gram-positive objects), the features in the three datasets were reduced from 57, 59, and 58, to 40, 37, and 38, respectively, without loss of prediction accuracy. Results showed that some features were redundant for gene essentiality, so could be eliminated from future analyses. The selected features contained more complex (or key) biological information for gene essentiality, and could be of use in related research projects, such as gene prediction, synthetic biology, and drug design. PMID:28358836

  15. Plants Assemble Species Specific Bacterial Communities from Common Core Taxa in Three Arcto-Alpine Climate Zones

    PubMed Central

    Kumar, Manoj; Brader, Günter; Sessitsch, Angela; Mäki, Anita; van Elsas, Jan D.; Nissinen, Riitta

    2017-01-01

    Evidence for the pivotal role of plant-associated bacteria to plant health and productivity has accumulated rapidly in the last years. However, key questions related to what drives plant bacteriomes remain unanswered, among which is the impact of climate zones on plant-associated microbiota. This is particularly true for wild plants in arcto-alpine biomes. Here, we hypothesized that the bacterial communities associated with pioneer plants in these regions have major roles in plant health support, and this is reflected in the formation of climate and host plant specific endophytic communities. We thus compared the bacteriomes associated with the native perennial plants Oxyria digyna and Saxifraga oppositifolia in three arcto-alpine regions (alpine, low Arctic and high Arctic) with those in the corresponding bulk soils. As expected, the bulk soil bacterial communities in the three regions were significantly different. The relative abundances of Proteobacteria decreased progressively from the alpine to the high-arctic soils, whereas those of Actinobacteria increased. The candidate division AD3 and Acidobacteria abounded in the low Arctic soils. Furthermore, plant species and geographic region were the major determinants of the structures of the endophere communities. The plants in the alpine region had higher relative abundances of Proteobacteria, while plants from the low- and high-arctic regions were dominated by Firmicutes. A highly-conserved shared set of ubiquitous bacterial taxa (core bacteriome) was found to occur in the two plant species. Burkholderiales, Actinomycetales and Rhizobiales were the main taxa in this core, and they were also the main contributors to the differences in the endosphere bacterial community structures across compartments as well as regions. We postulate that the composition of this core is driven by selection by the two plants. PMID:28174556

  16. Bacterial Species and Antibiotic Sensitivity in Korean Patients Diagnosed with Acute Otitis Media and Otitis Media with Effusion

    PubMed Central

    2017-01-01

    Changes over time in pathogens and their antibiotic sensitivity resulting from the recent overuse and misuse of antibiotics in otitis media (OM) have complicated treatment. This study evaluated changes over 5 years in principal pathogens and their antibiotic sensitivity in patients in Korea diagnosed with acute OM (AOM) and OM with effusion (OME). The study population consisted of 683 patients who visited the outpatient department of otorhinolaryngology in 7 tertiary hospitals in Korea between January 2010 and May 2015 and were diagnosed with acute AOM or OME. Aural discharge or middle ear fluid were collected from patients in the operating room or outpatient department and subjected to tests of bacterial identification and antibiotic sensitivity. The overall bacteria detection rate of AOM was 62.3% and OME was 40.9%. The most frequently isolated Gram-positive bacterial species was coagulase negative Staphylococcus aureus (CNS) followed by methicillin-susceptible S. aureus (MSSA), methicillin-resistant S. aureus (MRSA), and Streptococcus pneumonia (SP), whereas the most frequently isolated Gram-negative bacterium was Pseudomonas aeruginosa (PA). Regardless of OM subtype, ≥ 80% of CNS and MRSA strains were resistant to penicillin (PC) and tetracycline (TC); isolated MRSA strains showed low sensitivity to other antibiotics, with 100% resistant to PC, TC, cefoxitin (CFT), and erythromycin (EM); and isolated PA showed low sensitivity to quinolone antibiotics, including ciprofloxacin (CIP) and levofloxacin (LFX), and to aminoglycosides. Bacterial species and antibiotic sensitivity did not change significantly over 5 years. The rate of detection of MRSA was higher in OME than in previous studies. As bacterial predominance and antibiotic sensitivity could change over time, continuous and periodic surveillance is necessary in guiding appropriate antibacterial therapy. PMID:28244296

  17. Host plant species determines symbiotic bacterial community mediating suppression of plant defenses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Herbivore associated bacteria are vital mediators of plant and insect interactions. Host plants play an important role in shaping the gut bacterial community of insects. Colorado potato beetles (CPB; Leptinotarsa decemlineata) use several Solanum plants as hosts in their natural environment. We prev...

  18. Reactive Oxygen Species Mediated Bacterial Biofilm Inhibition via Zinc Oxide Nanoparticles and Their Statistical Determination

    PubMed Central

    Dwivedi, Sourabh; Wahab, Rizwan; Khan, Farheen; Mishra, Yogendra K.; Musarrat, Javed; Al-Khedhairy, Abdulaziz A.

    2014-01-01

    The formation of bacterial biofilm is a major challenge in clinical applications. The main aim of this study is to describe the synthesis, characterization and biocidal potential of zinc oxide nanoparticles (NPs) against bacterial strain Pseudomonas aeruginosa. These nanoparticles were synthesized via soft chemical solution process in a very short time and their structural properties have been investigated in detail by using X-ray diffraction and transmission electron microscopy measurements. In this work, the potential of synthesized ZnO-NPs (∼10–15 nm) has been assessed in-vitro inhibition of bacteria and the formation of their biofilms was observed using the tissue culture plate assays. The crystal violet staining on biofilm formation and its optical density revealed the effect on biofilm inhibition. The NPs at a concentration of 100 µg/mL significantly inhibited the growth of bacteria and biofilm formation. The biofilm inhibition by ZnO-NPs was also confirmed via bio-transmission electron microscopy (Bio-TEM). The Bio-TEM analysis of ZnO-NPs treated bacteria confirmed the deformation and damage of cells. The bacterial growth in presence of NPs concluded the bactericidal ability of NPs in a concentration dependent manner. It has been speculated that the antibacterial activity of NPs as a surface coating material, could be a feasible approach for controlling the pathogens. Additionally, the obtained bacterial solution data is also in agreement with the results from statistical analytical methods. PMID:25402188

  19. Enterobacter morus sp. nov., a novel Enterobacter species associated with bacterial wilt on mulberry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A mulberry pathogenetic bacterial strain R18-2T isolated from the diseased mulberry root was analyzed by a polyphasic taxonomic study. Comparative 16S rRNA gene sequence analysis combined with rpoB gene sequence analysis allocated the strain R18-2T to the genus Enterobacter. The strain was Gram nega...

  20. Reactive oxygen species mediated bacterial biofilm inhibition via zinc oxide nanoparticles and their statistical determination.

    PubMed

    Dwivedi, Sourabh; Wahab, Rizwan; Khan, Farheen; Mishra, Yogendra K; Musarrat, Javed; Al-Khedhairy, Abdulaziz A

    2014-01-01

    The formation of bacterial biofilm is a major challenge in clinical applications. The main aim of this study is to describe the synthesis, characterization and biocidal potential of zinc oxide nanoparticles (NPs) against bacterial strain Pseudomonas aeruginosa. These nanoparticles were synthesized via soft chemical solution process in a very short time and their structural properties have been investigated in detail by using X-ray diffraction and transmission electron microscopy measurements. In this work, the potential of synthesized ZnO-NPs (∼ 10-15 nm) has been assessed in-vitro inhibition of bacteria and the formation of their biofilms was observed using the tissue culture plate assays. The crystal violet staining on biofilm formation and its optical density revealed the effect on biofilm inhibition. The NPs at a concentration of 100 µg/mL significantly inhibited the growth of bacteria and biofilm formation. The biofilm inhibition by ZnO-NPs was also confirmed via bio-transmission electron microscopy (Bio-TEM). The Bio-TEM analysis of ZnO-NPs treated bacteria confirmed the deformation and damage of cells. The bacterial growth in presence of NPs concluded the bactericidal ability of NPs in a concentration dependent manner. It has been speculated that the antibacterial activity of NPs as a surface coating material, could be a feasible approach for controlling the pathogens. Additionally, the obtained bacterial solution data is also in agreement with the results from statistical analytical methods.

  1. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor

    PubMed Central

    Esfandiari, Leyla; Wang, Siqing; Wang, Siqi; Banda, Anisha; Lorenzini, Michael; Kocharyan, Gayane; Monbouquette, Harold G.; Schmidt, Jacob J.

    2016-01-01

    A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli) 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL) depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD) of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids. PMID:27455337

  2. Amino acid sequence of bacterial microbe-associated molecular pattern flg22 is required for virulence.

    PubMed

    Naito, Kana; Taguchi, Fumiko; Suzuki, Tomoko; Inagaki, Yoshishige; Toyoda, Kazuhiro; Shiraishi, Tomonori; Ichinose, Yuki

    2008-09-01

    Flagellin proteins derived from Pseudomonas syringae pv. tabaci 6605 and flg22Pa (QRLSTGSRINSAKDDAAGLQIA), one of the microbe-associated molecular patterns (MAMP) in bacterial flagellin, induce cell death and growth inhibition in Arabidopsis thaliana. To examine the importance of aspartic acid (D) at position 43 from the N-terminus of a flagellin in its elicitor activity, D43 was replaced with valine (V) and alanine (A) in P. syringae pv. tabaci flagellin and flg22Pta. The abilities of flagellins from P. syringae pv. tabaci D43V and D43A to induce cell death and growth inhibition were reduced, whereas the abilities of flg22PtaD43V and flg22PtaD43A were abolished. These results indicate that D43 is important for elicitor activity in P. syringae pv. tabaci. When tobacco plants were inoculated with each bacterium by the spray method, both P. syringae pv. tabaci D43V and D43A mutants had remarkably reduced ability to cause disease symptoms. Both mutants had reduced or no swimming and swarming motilities and adhesion ability. In P. syringae pv. tabaci D43V, little flagellin protein was detected and few flagella were observed by electron microscopy. These results indicate that mutant flagella are unstable and that flagellar motility is impaired. Thus, the amino acid residue required for MAMP activity is important for the intrinsic flagellar function.

  3. Effects of Abiotic Factors on the Phylogenetic Diversity of Bacterial Communities in Acidic Thermal Springs▿

    PubMed Central

    Mathur, Jayanti; Bizzoco, Richard W.; Ellis, Dean G.; Lipson, David A.; Poole, Alexander W.; Levine, Richard; Kelley, Scott T.

    2007-01-01

    Acidic thermal springs offer ideal environments for studying processes underlying extremophile microbial diversity. We used a carefully designed comparative analysis of acidic thermal springs in Yellowstone National Park to determine how abiotic factors (chemistry and temperature) shape acidophile microbial communities. Small-subunit rRNA gene sequences were PCR amplified, cloned, and sequenced, by using evolutionarily conserved bacterium-specific primers, directly from environmental DNA extracted from Amphitheater Springs and Roaring Mountain sediment samples. Energy-dispersive X-ray spectroscopy, X-ray diffraction, and colorimetric assays were used to analyze sediment chemistry, while an optical emission spectrometer was used to evaluate water chemistry and electronic probes were used to measure the pH, temperature, and Eh of the spring waters. Phylogenetic-statistical analyses found exceptionally strong correlations between bacterial community composition and sediment mineral chemistry, followed by weaker but significant correlations with temperature gradients. For example, sulfur-rich sediment samples contained a high diversity of uncultured organisms related to Hydrogenobaculum spp., while iron-rich sediments were dominated by uncultured organisms related to a diverse array of gram-positive iron oxidizers. A detailed analysis of redox chemistry indicated that the available energy sources and electron acceptors were sufficient to support the metabolic potential of Hydrogenobaculum spp. and iron oxidizers, respectively. Principal-component analysis found that two factors explained 95% of the genetic diversity, with most of the variance attributable to mineral chemistry and a smaller fraction attributable to temperature. PMID:17220248

  4. Discovery and Characterization of Diazenylaryl Sulfonic Acids as Inhibitors of Viral and Bacterial Neuraminidases.

    PubMed

    Hoffmann, Anja; Richter, Martina; von Grafenstein, Susanne; Walther, Elisabeth; Xu, Zhongli; Schumann, Lilia; Grienke, Ulrike; Mair, Christina E; Kramer, Christian; Rollinger, Judith M; Liedl, Klaus R; Schmidtke, Michaela; Kirchmair, Johannes

    2017-01-01

    Viral neuraminidases are an established drug target to combat influenza. Severe complications observed in influenza patients are primarily caused by secondary infections with e.g., Streptococcus pneumoniae. These bacteria engage in a lethal synergism with influenza A viruses (IAVs) and also express neuraminidases. Therefore, inhibitors with dual activity on viral and bacterial neuraminidases are expected to be advantageous for the treatment of influenza infections. Here we report on the discovery and characterization of diazenylaryl sulfonic acids as dual inhibitors of viral and Streptococcus pneumoniae neuraminidase. The initial hit came from a virtual screening campaign for inhibitors of viral neuraminidases. For the most active compound, 7-[2-[4-[2-[4-[2-(2-hydroxy-3,6-disulfo-1-naphthalenyl)diazenyl]-2-methylphenyl]diazenyl]-2-methylphenyl]diazenyl]-1,3-naphthalenedisulfonic acid (NSC65847; 1), the Ki-values measured in a fluorescence-based assay were lower than 1.5 μM for both viral and pneumococcal neuraminidases. The compound also inhibited N1 virus variants containing neuraminidase inhibitor resistance-conferring substitutions. Via enzyme kinetics and nonlinear regression modeling, 1 was suggested to impair the viral neuraminidases and pneumococcal neuraminidase with a mixed-type inhibition mode. Given its antiviral and antipneumococcal activity, 1 was identified as a starting point for the development of novel, dual-acting anti-infectives.

  5. Discovery and Characterization of Diazenylaryl Sulfonic Acids as Inhibitors of Viral and Bacterial Neuraminidases

    PubMed Central

    Hoffmann, Anja; Richter, Martina; von Grafenstein, Susanne; Walther, Elisabeth; Xu, Zhongli; Schumann, Lilia; Grienke, Ulrike; Mair, Christina E.; Kramer, Christian; Rollinger, Judith M.; Liedl, Klaus R.; Schmidtke, Michaela; Kirchmair, Johannes

    2017-01-01

    Viral neuraminidases are an established drug target to combat influenza. Severe complications observed in influenza patients are primarily caused by secondary infections with e.g., Streptococcus pneumoniae. These bacteria engage in a lethal synergism with influenza A viruses (IAVs) and also express neuraminidases. Therefore, inhibitors with dual activity on viral and bacterial neuraminidases are expected to be advantageous for the treatment of influenza infections. Here we report on the discovery and characterization of diazenylaryl sulfonic acids as dual inhibitors of viral and Streptococcus pneumoniae neuraminidase. The initial hit came from a virtual screening campaign for inhibitors of viral neuraminidases. For the most active compound, 7-[2-[4-[2-[4-[2-(2-hydroxy-3,6-disulfo-1-naphthalenyl)diazenyl]-2-methylphenyl]diazenyl]-2-methylphenyl]diazenyl]-1,3-naphthalenedisulfonic acid (NSC65847; 1), the Ki-values measured in a fluorescence-based assay were lower than 1.5 μM for both viral and pneumococcal neuraminidases. The compound also inhibited N1 virus variants containing neuraminidase inhibitor resistance-conferring substitutions. Via enzyme kinetics and nonlinear regression modeling, 1 was suggested to impair the viral neuraminidases and pneumococcal neuraminidase with a mixed-type inhibition mode. Given its antiviral and antipneumococcal activity, 1 was identified as a starting point for the development of novel, dual-acting anti-infectives. PMID:28261167

  6. Effect of multiple washing in salicylic acid on the bacterial flora of the skin of processed broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Experiments were conducted to determine changes in the bacterial flora of the skin of processed broilers after each of five consecutive washings in solutions of the keratolytic agent, salicylic acid. Skin samples from commercially processed broiler carcasses were divided into 3 groups and washed in ...

  7. Orchardgrass forage effects on bacterial communities and long-chain fatty acid profiles in the rumen of Holstein heifers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The aim of this study was to determine if ruminal bacterial community composition (BCC) and long-chain fatty acid (FA) profiles differed in heifers grazing in orchardgrass pasture (OP) versus those fed hay (OH) harvested from the same field at the same stage of maturity. Five ruminally cannulated Ho...

  8. Bacterial Utilization of L-sugars and D-amino Acids

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-01-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084

  9. Bacterial utilization of L-sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-08-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of

  10. A genomic approach to bacterial taxonomy: an examination and proposed reclassification of species within the genus Neisseria

    PubMed Central

    Jolley, Keith A.; Earle, Sarah G.; Corton, Craig; Bentley, Stephen D.; Parkhill, Julian; Maiden, Martin C. J.

    2012-01-01

    In common with other bacterial taxa, members of the genus Neisseria are classified using a range of phenotypic and biochemical approaches, which are not entirely satisfactory in assigning isolates to species groups. Recently, there has been increasing interest in using nucleotide sequences for bacterial typing and taxonomy, but to date, no broadly accepted alternative to conventional methods is available. Here, the taxonomic relationships of 55 representative members of the genus Neisseria have been analysed using whole-genome sequence data. As genetic material belonging to the accessory genome is widely shared among different taxa but not present in all isolates, this analysis indexed nucleotide sequence variation within sets of genes, specifically protein-coding genes that were present and directly comparable in all isolates. Variation in these genes identified seven species groups, which were robust to the choice of genes and phylogenetic clustering methods used. The groupings were largely, but not completely, congruent with current species designations, with some minor changes in nomenclature and the reassignment of a few isolates necessary. In particular, these data showed that isolates classified as Neisseria polysaccharea are polyphyletic and probably include more than one taxonomically distinct organism. The seven groups could be reliably and rapidly generated with sequence variation within the 53 ribosomal protein subunit (rps) genes, further demonstrating that ribosomal multilocus sequence typing (rMLST) is a practicable and powerful means of characterizing bacteria at all levels, from domain to strain. PMID:22422752

  11. Cloning and characterization of the NapA acid phosphatase/phosphotransferase of Morganella morganii: identification of a new family of bacterial acid-phosphatase-encoding genes.

    PubMed

    Thaller, M C; Lombardi, G; Berlutti, F; Schippa, S; Rossolini, G M

    1995-01-01

    The gene encoding a minor phosphate-irrepressible acid phosphatase (named NapA) of Morganella morganii was cloned and sequenced, and its product characterized. NapA is a secreted acid phosphatase composed of four 27 kDa polypeptide subunits. The enzyme is active on several organic phosphate monoesters but not on diesters, and is also endowed with transphosphorylating activity from organic phosphoric acid esters to nucleosides and other compounds with free hydroxyl groups. Its activity is inhibited by EDTA, inorganic phosphate, nucleosides and Ca2+, but not by fluoride or tartrate, and is enhanced by Mg2+, Co2+ and Zn2+. At the sequence level, the NapA enzyme did not show similarities to any other sequenced bacterial phosphatases. However, a search for homologous genes in sequence databases allowed identification of two open reading frames located within sequenced regions of the Escherichia coli and Proteus mirabilis genomes respectively, encoding proteins of unknown function which are highly homologous to the Morganella enzyme. Moreover, the properties of the NapA enzyme are very similar to those reported for the periplasmic nonspecific acid phosphatase II of Salmonella typhimurium (for which no sequence data are available). These data point to the existence of a new family of bacterial acid phosphatases, which we propose designating class B bacterial acid phosphatases.

  12. Bacterial populations and environmental factors controlling cellulose degradation in an acidic Sphagnum peat.

    PubMed

    Pankratov, Timofey A; Ivanova, Anastasia O; Dedysh, Svetlana N; Liesack, Werner

    2011-07-01

    Northern peatlands represent a major global carbon store harbouring approximately one-third of the global reserves of soil organic carbon. A large proportion of these peatlands consists of acidic Sphagnum-dominated ombrotrophic bogs, which are characterized by extremely low rates of plant debris decomposition. The degradation of cellulose, the major component of Sphagnum-derived litter, was monitored in long-term incubation experiments with acidic (pH 4.0) peat extracts. This process was almost undetectable at 10°C and occurred at low rates at 20°C, while it was significantly accelerated at both temperature regimes by the addition of available nitrogen. Cellulose breakdown was only partially inhibited in the presence of cycloheximide, suggesting that bacteria participated in this process. We aimed to identify these bacteria by a combination of molecular and cultivation approaches and to determine the factors that limit their activity in situ. The indigenous bacterial community in peat was dominated by Alphaproteobacteria and Acidobacteria. The addition of cellulose induced a clear shift in the community structure towards an increase in the relative abundance of the Bacteroidetes. Increasing temperature and nitrogen availability resulted in a selective development of bacteria phylogenetically related to Cytophaga hutchinsonii (94-95% 16S rRNA gene sequence similarity), which densely colonized microfibrils of cellulose. Among isolates obtained from this community only some subdivision 1 Acidobacteria were capable of degrading cellulose, albeit at a very slow rate. These Acidobacteria represent indigenous cellulolytic members of the microbial community in acidic peat and are easily out-competed by Cytophaga-like bacteria under conditions of increased nitrogen availability. Members of the phylum Firmicutes, known to be key players in cellulose degradation in neutral habitats, were not detected in the cellulolytic community enriched at low pH.

  13. Bacteroides uniformis is a putative bacterial species associated with the degradation of the isoflavone genistein in human feces.

    PubMed

    Renouf, Mathieu; Hendrich, Suzanne

    2011-06-01

    Inter-individual variation in isoflavone absorption depends on gut microbial degradation and affects the efficacy of these compounds. We hypothesized that inter-individual variation in fecal isoflavone disappearance coincided with variation in bacterial species. In vitro anaerobic fecal disappearance of isoflavones was measured from 33 participants by HPLC. Fecal microbial 16S rRNA variable region PCR products were obtained from 4 participants with the greatest and least genistein or glycitein degradation and were subjected to denaturing gradient gel electrophoresis. DNA bands with a homology of 90-95% to Bacteroides uniformis and Faecalibacterium prausnitzii were present in greater intensities in fecal samples showing a genistein disappearance rate constant of 1.47 ± 0.14 h(-1) compared with those with a genistein disappearance rate constant of 0.15 ± 0.03 h(-1) (P < 0.05). Human fecal bacterial species with DNA sequences 90-100% homologous to Tannerella forsythensis and 4 other species were present in greater intensities in fecal samples showing a glycitein disappearance rate constant of 0.57 ± 0.30 h(-1) compared with fecal samples with a glycitein disappearance rate constant of 0.08 ± 0.03 h(-1) (P < 0.05). In high degraders, B. uniformis may be a candidate for genistein degradation and T. forsythensis for glycitein degradation, based on fecal isoflavone degradation in the presence of these species. Bacteroides acidifaciens increased isoflavone disappearance in anaerobic human fecal incubations under nutrient-rich and -depleted conditions, suggesting this species as one responsible for the generally high degradation of isoflavones by humans. These fecal microbes are candidate biomarkers for interindividual variation in isoflavone uptake and efficacy.

  14. Bacterial lipopolysaccharide suppresses the production of catalytically active lysosomal acid hydrolases in human macrophages

    PubMed Central

    1986-01-01

    Sub-microgram quantities of bacterial lipopolysaccharide (LPS) have been found to substantially reduce the intracellular catalytic activities of three representative lysosomal enzymes (namely, acid phosphatase, hexosaminidase, and beta-glucuronidase) in human monocyte- derived macrophages. This response was not associated with a concurrent increase in enzyme catalytic activity in the culture supernatant, and hence, could not be explained by mobilization of preformed material. By conducting experiments in the presence and absence of indomethacin, a cyclooxygenase inhibitor, the reduction in lysosomal enzyme catalytic activities was shown not to be dependent on the ability of LPS to induce prostaglandin E2 production. The response was not found to be the result of a more generalized LPS-dependent reduction in the ability of the cells to synthesize protein, since the presence of LPS in macrophage cultures did not appreciably affect the amount of [35S]methionine incorporated into total cellular proteins. A kinetic analysis of the effect of LPS on the down-regulation of enzyme catalytic activities indicated that this was an early response of the cells to LPS exposure. An investigation of the effects of blockade of enzyme catabolism (using the lysosomotropic weak-base, methylamine) indicated that the reduction of catalytic enzyme activities in response to LPS was probably due to a decreased rate of production of active product, rather than an enhanced rate of enzyme catabolism. This suggestion was confirmed by experiments in which the synthesis of pro- hexosaminidase (measured by biosynthetic labeling with [35S]methionine and specific immunoprecipitation of labeled pro-hexosaminidase) was found to be reduced by 42% after a 24-h exposure to LPS (although the synthesis of complement component C3 was stimulated by a factor of 4.5). It is suggested that the ability of LPS to regulate the functional expression of protein products contributes to changes in the overall

  15. Characterization and purification of a bacterial chlorogenic acid esterase detected during the extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots.

    PubMed

    Negrel, Jonathan; Javelle, Francine; Morandi, Dominique; Lucchi, Géraldine

    2016-12-01

    A Gram-negative bacterium able to grow using chlorogenic acid (5-caffeoylquinic acid) as sole carbon source has been isolated from the roots of tomato plants inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis. An intracellular esterase exhibiting very high affinity (Km = 2 μM) for chlorogenic acid has been extracted and purified by FPLC from the chlorogenate-grown cultures of this bacterium. The molecular mass of the purified esterase determined by SDS-PAGE was 61 kDa and its isoelectric point determined by chromatofocusing was 7.75. The esterase hydrolysed chlorogenic acid analogues (caffeoylshikimate, and the 4- and 3-caffeoylquinic acid isomers), feruloyl esterases substrates (methyl caffeate and methyl ferulate), and even caffeoyl-CoA in vitro but all of them were less active than chlorogenic acid, demonstrating that the esterase is a genuine chlorogenic acid esterase. It was also induced when the bacterial strain was cultured in the presence of hydroxycinnamic acids (caffeic, p-coumaric or ferulic acid) as sole carbon source, but not in the presence of simple phenolics such as catechol or protocatechuic acid, nor in the presence of organic acids such as succinic or quinic acids. The purified esterase was remarkably stable in the presence of methanol, rapid formation of methyl caffeate occurring when its activity was measured in aqueous solutions containing 10-60% methanol. Our results therefore show that this bacterial chlorogenase can catalyse the transesterification reaction previously detected during the methanolic extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots. Data are presented suggesting that colonisation by Rhizophagus irregularis could increase chlorogenic acid exudation from tomato roots, especially in nutrient-deprived plants, and thus favour the growth of chlorogenate-metabolizing bacteria on the root surface or in the mycorhizosphere.

  16. Fatty acid composition of seeds of some species of Nepeta L.

    PubMed

    Kiliç, Turgut; Dirmenci, Tuncay; Gören, Ahmet C

    2007-05-01

    The fatty acid compositions of Nepeta viscida, N. cilicica, N. crinita, N. nuda ssp. glandulifera and N. aristata were analyzed by GC/MS. The main free fatty acids were found as linolenic acid (49.8-58.5%), linoleic acid (10.9-23.5%), oleic acid (11.5-19.2%), palmitic acid (5.2-6.8%) and stearic acid (2.0-3.7%) and, total fatty acid compositions of species were analyzed and results were found as 36.2-49.8%, 17.1-25.8%, 15.4-25.8%, 6.4-7.8%, and 2.7-4.1%, respectively.

  17. Acute toxicity of peracetic acid to various fish species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Peracetic acid (PAA; also called peroxyacetic acid) is a promising disinfectant in the US aquaculture industry to control parasites and fungus. It is a stabilized mixture of acetic acid and hydrogen peroxide that does not leave dangerous residues in the environment when it breaks down as most compo...

  18. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    SciTech Connect

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-10-23

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  19. Dietary Omega-3 Fatty Acids Increase Survival and Decrease Bacterial Load in Mice Subjected to Staphylococcus aureus-Induced Sepsis.

    PubMed

    Svahn, Sara L; Ulleryd, Marcus A; Grahnemo, Louise; Ståhlman, Marcus; Borén, Jan; Nilsson, Staffan; Jansson, John-Olov; Johansson, Maria E

    2016-04-01

    Sepsis caused by Staphylococcus aureus is increasing in incidence. With the alarming use of antibiotics,S. aureus is prone to become methicillin resistant. Antibiotics are the only widely used pharmacological treatment for sepsis. Interestingly, mice fed high-fat diet (HFD) rich in polyunsaturated fatty acids have better survival of S. aureus-induced sepsis than mice fed HFD rich in saturated fatty acids (HFD-S). To investigate what component of polyunsaturated fatty acids, i.e., omega-3 or omega-6 fatty acids, exerts beneficial effects on the survival of S. aureus-induced sepsis, mice were fed HFD rich in omega-3 or omega-6 fatty acids for 8 weeks prior to inoculation with S. aureus Further, mice fed HFD-S were treated with omega-3 fatty acid metabolites known as resolvins. Mice fed HFD rich in omega-3 fatty acids had increased survival and decreased bacterial loads compared to those for mice fed HFD-S after S. aureus-induced sepsis. Furthermore, the bacterial load was decreased in resolvin-treated mice fed HFD-S after S. aureus-induced sepsis compared with that in mice treated with vehicle. Dietary omega-3 fatty acids increase the survival of S. aureus-induced sepsis by reversing the deleterious effect of HFD-S on mouse survival.

  20. Dietary Omega-3 Fatty Acids Increase Survival and Decrease Bacterial Load in Mice Subjected to Staphylococcus aureus-Induced Sepsis

    PubMed Central

    Ulleryd, Marcus A.; Grahnemo, Louise; Ståhlman, Marcus; Borén, Jan; Nilsson, Staffan; Jansson, John-Olov

    2016-01-01

    Sepsis caused by Staphylococcus aureus is increasing in incidence. With the alarming use of antibiotics, S. aureus is prone to become methicillin resistant. Antibiotics are the only widely used pharmacological treatment for sepsis. Interestingly, mice fed high-fat diet (HFD) rich in polyunsaturated fatty acids have better survival of S. aureus-induced sepsis than mice fed HFD rich in saturated fatty acids (HFD-S). To investigate what component of polyunsaturated fatty acids, i.e., omega-3 or omega-6 fatty acids, exerts beneficial effects on the survival of S. aureus-induced sepsis, mice were fed HFD rich in omega-3 or omega-6 fatty acids for 8 weeks prior to inoculation with S. aureus. Further, mice fed HFD-S were treated with omega-3 fatty acid metabolites known as resolvins. Mice fed HFD rich in omega-3 fatty acids had increased survival and decreased bacterial loads compared to those for mice fed HFD-S after S. aureus-induced sepsis. Furthermore, the bacterial load was decreased in resolvin-treated mice fed HFD-S after S. aureus-induced sepsis compared with that in mice treated with vehicle. Dietary omega-3 fatty acids increase the survival of S. aureus-induced sepsis by reversing the deleterious effect of HFD-S on mouse survival. PMID:26857576

  1. Characteristics of organic acids in the fruit of different pumpkin species.

    PubMed

    Nawirska-Olszańska, Agnieszka; Biesiada, Anita; Sokół-Łętowska, Anna; Kucharska, Alicja Z

    2014-04-01

    The aim of the research was to determine the composition of organic acids in fruit of different cultivars of three pumpkin species. The amount of acids immediately after fruit harvest and after 3 months of storage was compared. The content of organic acids in the examined pumpkin cultivars was assayed using the method of high performance liquid chromatography (HPLC). Three organic acids (citric acid, malic acid, and fumaric acid) were identified in the cultivars, whose content considerably varied depending on a cultivar. Three-month storage resulted in decreased content of the acids in the case of cultivars belonging to Cucurbita maxima and Cucurbita pepo species, while a slight increase was recorded for Cucurbita moschata species.

  2. Quantitative thermodynamic predication of interactions between nucleic acid and non-nucleic acid species using Microsoft excel.

    PubMed

    Zou, Jiaqi; Li, Na

    2013-09-01

    Proper design of nucleic acid sequences is crucial for many applications. We have previously established a thermodynamics-based quantitative model to help design aptamer-based nucleic acid probes by predicting equilibrium concentrations of all interacting species. To facilitate customization of this thermodynamic model for different applications, here we present a generic and easy-to-use platform to implement the algorithm of the model with Microsoft(®) Excel formulas and VBA (Visual Basic for Applications) macros. Two Excel spreadsheets have been developed: one for the applications involving only nucleic acid species, the other for the applications involving both nucleic acid and non-nucleic acid species. The spreadsheets take the nucleic acid sequences and the initial concentrations of all species as input, guide the user to retrieve the necessary thermodynamic constants, and finally calculate equilibrium concentrations for all species in various bound and unbound conformations. The validity of both spreadsheets has been verified by comparing the modeling results with the experimental results on nucleic acid sequences reported in the literature. This Excel-based platform described here will allow biomedical researchers to rationalize the sequence design of nucleic acid probes using the thermodynamics-based modeling even without relevant theoretical and computational skills.

  3. Rhizosphere bacterial carbon turnover is higher in nucleic acids than membrane lipids: implications for understanding soil carbon cycling

    PubMed Central

    Malik, Ashish A.; Dannert, Helena; Griffiths, Robert I.; Thomson, Bruce C.; Gleixner, Gerd

    2015-01-01

    Using a pulse chase 13CO2 plant labeling experiment we compared the flow of plant carbon into macromolecular fractions of rhizosphere soil microorganisms. Time dependent 13C dilution patterns in microbial cellular fractions were used to calculate their turnover time. The turnover times of microbial biomolecules were found to vary: microbial RNA (19 h) and DNA (30 h) turned over fastest followed by chloroform fumigation extraction-derived soluble cell lysis products (14 days), while phospholipid fatty acids (PLFAs) had the slowest turnover (42 days). PLFA/NLFA 13C analyses suggest that both mutualistic arbuscular mycorrhizal and saprophytic fungi are dominant in initial plant carbon uptake. In contrast, high initial 13C enrichment in RNA hints at bacterial importance in initial C uptake due to the dominance of bacterial derived RNA in total extracts of soil RNA. To explain this discrepancy, we observed low renewal rate of bacterial lipids, which may therefore bias lipid fatty acid based interpretations of the role of bacteria in soil microbial food webs. Based on our findings, we question current assumptions regarding plant-microbe carbon flux and suggest that the rhizosphere bacterial contribution to plant assimilate uptake could be higher. This highlights the need for more detailed quantitative investigations with nucleic acid biomarkers to further validate these findings. PMID:25914679

  4. Comparison of the formation of nicotinic acid conjugates in leaves of different plant species.

    PubMed

    Ashihara, Hiroshi; Yin, Yuling; Katahira, Riko; Watanabe, Shin; Mimura, Tetsuro; Sasamoto, Hamako

    2012-11-01

    There are three metabolic fates of nicotinic acid in plants: (1) nicotinic acid mononucleotide formation for NAD synthesis by the so-called salvage pathway of pyridine nucleotide biosynthesis; (2) nicotinic acid N-glucoside formation; and (3) trigonelline (N-methylnicotinic acid) formation. In the present study, the metabolism of [carbonyl-(14)C]nicotinamide was investigated in leaves of 23 wild plant species. All species readily converted nicotinamide to nicotinic acid, and only a fraction of nicotinic acid was utilised for NAD and NADP synthesis. The remaining nicotinic acid is converted to the nicotinic acid conjugates. Only one plant species, Cycas revoluta, produced both nicotinic acid N-glucoside and trigonelline; the other 22 species produced one or other of the conjugates. The nicotinic acid N-glucoside-forming plants are Cyathea lepifera, Arenga trewmula var. englri, Barringtonia racemosa, Ilex paraguariensis, Angelica japonica, Scaevola taccada and Farfugium japonicum. In contrast, trigonelline is formed in C. lepifera, Ginkgo biloba, Pinus luchuensis, Casuarina equisetifolia, Alocasia odora, Pandanus odoratissimus, Hylocereus undatus, Kalanchoe pinnata, Kalanchoe tubiflora, Populus alba, Garcinia subelliptica, Oxalis corymbosa, Leucaena leucocephala, Vigna marina, Hibiscus tiliaceus and Melicope triphylla. The diversity of nicotinic acid conjugate formation in plants is discussed using these results and our previous investigation involving a few model plants, various crops and ferns. Nicotinic acid N-glucoside formation was restricted mostly to ferns and selected orders of angiosperms, whereas other plants produce trigonelline. In most cases the formation of both nicotinic acid conjugates is incompatible, but some exceptions have been found.

  5. Honey bees avoid nectar colonized by three bacterial species, but not by a yeast species, isolated from the bee gut.

    PubMed

    Good, Ashley P; Gauthier, Marie-Pierre L; Vannette, Rachel L; Fukami, Tadashi

    2014-01-01

    The gut microflora of the honey bee, Apis mellifera, is receiving increasing attention as a potential determinant of the bees' health and their efficacy as pollinators. Studies have focused primarily on the microbial taxa that appear numerically dominant in the bee gut, with the assumption that the dominant status suggests their potential importance to the bees' health. However, numerically minor taxa might also influence the bees' efficacy as pollinators, particularly if they are not only present in the gut, but also capable of growing in floral nectar and altering its chemical properties. Nonetheless, it is not well understood whether honey bees have any feeding preference for or against nectar colonized by specific microbial species. To test whether bees exhibit a preference, we conducted a series of field experiments at an apiary using synthetic nectar inoculated with specific species of bacteria or yeast that had been isolated from the bee gut, but are considered minor components of the gut microflora. These species had also been found in floral nectar. Our results indicated that honey bees avoided nectar colonized by the bacteria Asaia astilbes, Erwinia tasmaniensis, and Lactobacillus kunkeei, whereas the yeast Metschnikowia reukaufii did not affect the feeding preference of the insects. Our results also indicated that avoidance of bacteria-colonized nectar was caused not by the presence of the bacteria per se, but by the chemical changes to nectar made by the bacteria. These findings suggest that gut microbes may not only affect the bees' health as symbionts, but that some of the microbes may possibly affect the efficacy of A. mellifera as pollinators by altering nectar chemistry and influencing their foraging behavior.

  6. Honey Bees Avoid Nectar Colonized by Three Bacterial Species, But Not by a Yeast Species, Isolated from the Bee Gut

    PubMed Central

    Good, Ashley P.; Gauthier, Marie-Pierre L.; Vannette, Rachel L.; Fukami, Tadashi

    2014-01-01

    The gut microflora of the honey bee, Apis mellifera, is receiving increasing attention as a potential determinant of the bees’ health and their efficacy as pollinators. Studies have focused primarily on the microbial taxa that appear numerically dominant in the bee gut, with the assumption that the dominant status suggests their potential importance to the bees’ health. However, numerically minor taxa might also influence the bees’ efficacy as pollinators, particularly if they are not only present in the gut, but also capable of growing in floral nectar and altering its chemical properties. Nonetheless, it is not well understood whether honey bees have any feeding preference for or against nectar colonized by specific microbial species. To test whether bees exhibit a preference, we conducted a series of field experiments at an apiary using synthetic nectar inoculated with specific species of bacteria or yeast that had been isolated from the bee gut, but are considered minor components of the gut microflora. These species had also been found in floral nectar. Our results indicated that honey bees avoided nectar colonized by the bacteria Asaia astilbes, Erwinia tasmaniensis, and Lactobacillus kunkeei, whereas the yeast Metschnikowia reukaufii did not affect the feeding preference of the insects. Our results also indicated that avoidance of bacteria-colonized nectar was caused not by the presence of the bacteria per se, but by the chemical changes to nectar made by the bacteria. These findings suggest that gut microbes may not only affect the bees’ health as symbionts, but that some of the microbes may possibly affect the efficacy of A. mellifera as pollinators by altering nectar chemistry and influencing their foraging behavior. PMID:24466119

  7. Bacterial community dynamics in a biodenitrification reactor packed with polylactic acid/poly (3-hydroxybutyrate-co-3-hydroxyvalerate) blend as the carbon source and biofilm carrier.

    PubMed

    Qiu, Tianlei; Xu, Ying; Gao, Min; Han, Meilin; Wang, Xuming

    2017-05-01

    While heterotrophic denitrification has been widely used for treating such nitrogen-rich wastewater, it requires the use of additional carbon sources. With fluctuations in the nitrate concentration in the influent, controlling the C/N ratio to avoid carbon breakthrough becomes difficult. To overcome this obstacle, solid-phase denitrification (SPD) using biodegradable polymers has been used, where denitrification and carbon source biodegradation depend on microorganisms growing within the reactor. However, the microbial community dynamics in continuous-flow SPD reactors have not been fully elucidated yet. Here, we aimed to study bacterial community dynamics in a biodenitrification reactor packed with a polylactic acid/poly (3-hydroxybutyrate-co-3-hydroxyvalerate) (PLA/PHBV) blend as the carbon source and biofilm carrier. A lab-scale denitrifying reactor filled with a PLA/PHBV blend was used. With 85 mg/L of influent NO3-N concentration and a hydraulic retention time (HRT) of 2.5 h, more than 92% of the nitrate was removed. The bacterial community of inoculated activated sludge had the highest species richness in all samples. Bacterial species diversity in the reactor first decreased and then increased to a stable level. Diaphorobacter species were predominant in the reactor after day 24. In total, 178 clones were retrieved from the 16S rRNA gene clone library constructed from the biofilm samples in the reactor at 62 days of operation, and 80.9% of the clones were affiliated with Betaproteobacteria. Of these, 97.2% were classified into phylotypes corresponding to Diaphorobacter nitroreducens strain NA10B with 99% sequence similarity. Diaphorobacter, Rhizobium, Acidovorax, Rubrivivax, Azospira, Thermomonas, and Acidaminobacter constituted the biofilm microflora in the stably running reactor.

  8. Magnetic resonance tells microbiology where to go; bacterial teichoic acid protects liquid water at sub-zero temperatures

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Wickham, Jason R.; Eastman, Margaret A.; Harrison, William; Pereira, Mark P.; Brown, Eric D.

    2008-08-01

    Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, although, with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as high salt concentration (brine veins) and adhesion to particulates or ice crystal defects. Teichoic acid is a phosphodiester polymer ubiquitous in Gram positive bacteria, composing 50% of the mass of the bacterial cell wall and excreted into the extracellular space of biofilm communities. We have found that when bound to the peptidoglycan cell wall (wall teichoic acid) or as a free molecule (lipoteichoic acid), teichoic acid is surrounded by liquid water at temperatures significantly below freezing. Using solid-state NMR, we are unable to collect 31P CPMAS spectra for frozen solutions of lipoteichoic acid at temperatures above -60 °C. For wall teichoic acid in D2O, signals are not seen above -30 °C. These results can be explained by the presence of liquid water, which permits rapid molecular motion to remove 1H/31P dipolar coupling. 2H quadrupole echo NMR spectroscopy reveals that both liquid and solid water are present. We suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.

  9. Rosmarinic acid is a homoserine lactone mimic produced by plants that activates a bacterial quorum-sensing regulator.

    PubMed

    Corral-Lugo, Andrés; Daddaoua, Abdelali; Ortega, Alvaro; Espinosa-Urgel, Manuel; Krell, Tino

    2016-01-05

    Quorum sensing is a bacterial communication mechanism that controls genes, enabling bacteria to live as communities, such as biofilms. Homoserine lactone (HSL) molecules function as quorum-sensing signals for Gram-negative bacteria. Plants also produce previously unidentified compounds that affect quorum sensing. We identified rosmarinic acid as a plant-derived compound that functioned as an HSL mimic. In vitro assays showed that rosmarinic acid bound to the quorum-sensing regulator RhlR of Pseudomonas aeruginosa PAO1 and competed with the bacterial ligand N-butanoyl-homoserine lactone (C4-HSL). Furthermore, rosmarinic acid stimulated a greater increase in RhlR-mediated transcription in vitro than that of C4-HSL. In P. aeruginosa, rosmarinic acid induced quorum sensing-dependent gene expression and increased biofilm formation and the production of the virulence factors pyocyanin and elastase. Because P. aeruginosa PAO1 infection induces rosmarinic acid secretion from plant roots, our results indicate that rosmarinic acid secretion is a plant defense mechanism to stimulate a premature quorum-sensing response. P. aeruginosa is a ubiquitous pathogen that infects plants and animals; therefore, identification of rosmarinic acid as an inducer of premature quorum-sensing responses may be useful in agriculture and inform human therapeutic strategies.

  10. Ozone killing action against bacterial and fungal species; microbiological testing of a domestic ozone generator.

    PubMed

    Dyas, A; Boughton, B J; Das, B C

    1983-10-01

    The action of ozone generated from a small domestic device was examined with a view to using it in clinical isolation units accommodating immunosuppressed patients. Over a six-hour period in an average size room the device did not generate sufficient ozone to suppress bacterial and fungal growth. A useful bactericidal action, against a variety of human pathogens was achieved with ozone concentrations between 0.3 to 0.9 ppm. Bactericidal ozone concentrations are close to the limit permitted for human exposure however and further experiments are indicated.

  11. Malic acid production from thin stillage by Aspergillus species.

    PubMed

    West, Thomas P

    2011-12-01

    The ability of Aspergillus strains to utilize thin stillage to produce malic acid was compared. The highest malic acid was produced by Aspergillus niger ATCC 9142 at 17 g l(-1). Biomass production from thin stillage was similar with all strains but ATCC 10577 was the highest at 19 g l(-1). The highest malic acid yield (0.8 g g(-1)) was with A. niger ATCC 9142 and ATCC 10577 on the stillage. Thus, thin stillage has the potential to act as a substrate for the commercial production of food-grade malic acid by the A. niger strains.

  12. A survey on species and prevalence rate of bacterial agents isolated from cockroaches in three hospitals.

    PubMed

    Zarchi, Ali Akbar Karimi; Vatani, Hadi

    2009-04-01

    The presence of cockroaches has health implications, such as nosocomial infection, as the insects move freely from areas within and around hospitals that may harbor pathogenic organisms. The goals of the present study were to determine species of bacteria isolated from cockroaches found in three Tehran hospitals, and to determine distribution of potential vectors by species and sex. The study is descriptive laboratory research. A total of 305 cockroaches from three species were trapped and identified: Periplaneta americana (65.6%), Blatella germanica (12.1%), and Blatta orientalis (22.3%). From these potential vectors, 19 species of bacteria were isolated and identified. After transportation of cockroaches to the laboratory, separation of the whole-homogenized suspension of each species was carried out. Identification of the isolated bacteria was performed according to Burgey's Manual of Determinative Bacteriology, 9th Edition. The most common species of bacteria isolated from cockroaches were Escherichia coli, Streptococcus Group D, Bacillus spp., Klebsiella pneumoniae, and Proteus vulgaris. No statistical significance was found between sex and species of cockroach carrying bacteria (p > 0.05), but significance was found for sex in Citrobacter freundii, Staphylococcus aureus, and Streptococcus non-group A&B (p < 0.05).

  13. On the nature and origin of acidic species in petroleum. 1. Detailed acid type distribution in a California crude oil.

    SciTech Connect

    Tomczyk, N. A.; Winans, R. E.; Shinn, J. H.; Robinson, R. C.; Chemistry; Chevron Research and Technology Co.

    2001-11-21

    Acidity in crude oils has long been a problem for refining. Knowledge of the detailed chemical composition of the acids responsible for corrosion can facilitate identification of problem crude oils and potentially lead to improved processing options for corrosive oils. A highly aerobically biodegraded crude from the San Joaquin Valley, which has a long history of causing corrosion problems during refining, was the subject of this study. The oil was first extracted with base, then acidified and extracted with petroleum ether. A portion of the resulting acid fraction was methylated. The unmethylated extract was analyzed by FTIR, NMR, and the methylated sample was analyzed by high-resolution mass spectrometry (HRMS). Over 96% of the ions observed in HRMS have been assigned reliable formulas. Considerably greater functionality is seen in this sample than would be presumed from the 'naphthenic acid' title typically assigned to these species. Although over 60% of the compounds contained two or more oxygens, compounds containing only oxygen heteroatoms accounted for less than 10% of the acidic compounds identified. Approximately one-half of the species contained nitrogen and about one-fourth contained sulfur. It is believed that microbial degradation is a major source of these acidic components. It was also observed that acid species with higher degrees of heteroatom substitution generally also had a higher degree of saturation than those species having less heteroatoms, possibly due to impeded migration of highly substituted, less-saturated species.

  14. Bacterial colonization of the phyllosphere of mediterranean perennial species as influenced by leaf structural and chemical features.

    PubMed

    Yadav, R K P; Karamanoli, K; Vokou, D

    2005-08-01

    In this study, we assessed various leaf structural and chemical features as possible predictors of the size of the phyllosphere bacterial population in the Mediterranean environment. We examined eight perennial species, naturally occurring and coexisting in the same area, in Halkidiki (northern Greece). They are Arbutus unedo, Quercus coccifera, Pistacia lentiscus, and Myrtus communis (evergreen sclerophyllous species), Lavandula stoechas and Cistus incanus (drought semi-deciduous species), and Calamintha nepeta and Melissa officinalis (non-woody perennial species). M. communis, L. stoechas, C. nepeta, and M. officinalis produce essential oil in substantial quantities. We sampled summer leaves from these species and (1) estimated the size of the bacterial population of their phyllosphere, (2) estimated the concentration of different leaf constituents, and (3) studied leaf morphological and anatomical features and expressed them in a quantitative way. The aromatic plants are on average more highly colonized than the other species, whereas the non-woody perennials are more highly colonized than the woody species. The population size of epiphytic bacteria is positively correlated with glandular and non-glandular trichome densities, and with water and phosphorus contents; it is negatively correlated with total phenolics content and the thickness of the leaf, of the mesophyll, and of the abaxial epidermis. No correlation was found with the density of stomata, the nitrogen, and the soluble sugar contents. By regression tree analysis, we found that the leaf-microbe system can be effectively described by three leaf attributes with leaf water content being the primary explanatory attribute. Leaves with water content >73% are the most highly colonized. For leaves with water content <73%, the phosphorus content, with a critical value of 1.34 mg g(-1) d.w., is the next explanatory leaf attribute, followed by the thickness of the adaxial epidermis. Leaves higher in phosphorus

  15. Monitoring the lactic acid bacterial diversity during shochu fermentation by PCR-denaturing gradient gel electrophoresis.

    PubMed

    Endo, Akihito; Okada, Sanae

    2005-03-01

    The presence of lactic acid bacteria (LAB) during shochu fermentation was monitored by PCR-denaturing gradient gel electrophoresis (DGGE) and by bacteriological culturing. No LAB were detected from fermented mashes by PCR-DGGE using a universal bacterial PCR primer set. However, PCR-DGGE using a new primer specific for the 16S rDNA of Lactococcus, Streptococcus, Tetragenococcus, Enterococcus, and Vagococcus and two primers specific for the 16S rDNA of Lactobacillus, Pediococcus, Leuconostoc, and Weissella revealed that Enterococcus faecium, Lactobacillus casei, Lactobacillus fermentum, Lactobacillus nagelii, Lactobacillus plantarum, Lactococcus lactis, Leuconostoc citreum, Leuconostoc mesenteroides, and Weissella cibaria inhabited in shochu mashes. It was also found that the LAB community composition during shochu fermentation changed after the main ingredient and water were added during the fermentation process. Therefore, we confirmed that PCR-DGGE using all three primers specific for groups of LAB together was well suited to the study of the LAB diversity in shochu mashes. The results of DGGE profiles were similar to the results of bacteriological culturing. In conclusion, LAB are present during shochu fermentation but not dominant.

  16. Acute oral toxicity and bacterial translocation studies on potentially probiotic strains of lactic acid bacteria.

    PubMed

    Zhou, J S; Shu, Q; Rutherfurd, K J; Prasad, J; Gopal, P K; Gill, H S

    2000-01-01

    Three potentially probiotic lactic acid bacteria (LAB) strains, Lactobacillus rhamnosus HN001 (DR20(TM)), Lb. acidophilus HN017 and Bifidobacterium lactis HN019 (DR10()), have recently been identified and characterized. The present study was designed to evaluate the acute oral toxicity of these strains to mice, and also to investigate bacterial translocation and gut mucosal pathology in BALB/c mice fed HN019, HN001 or HN017 for 8 consecutive days at a high dose of 10(11)cfu/mouse/day. Results showed that these probiotic strains had no adverse effect on general health status, feed intake, body weight gain and intestinal mucosal morphology (villus height, crypt depth, epithelial cell height and mucosal thickness). No viable bacteria were recovered from blood and tissue samples (mesenteric lymph nodes, liver and spleen) of mice, and no treatment-associated illness or death was observed. According to these results, the oral LD(50) of HN019, HN001 and HN017 is more than 50g/kg/day for mice, and their acceptable daily intake (ADI) value is 35g dry bacteria per day for a 70-kg person. This suggests that the probiotic strains HN019, HN001 and HN017 are non-pathogenic and likely to be safe for human consumption.

  17. Identification of Bacillus species occurring in Kantong, an acid fermented seed condiment produced in Ghana.

    PubMed

    Kpikpi, Elmer Nayra; Thorsen, Line; Glover, Richard; Dzogbefia, Victoria Pearl; Jespersen, Lene

    2014-06-16

    Kantong is a condiment produced in Ghana by the spontaneous fermentation of kapok tree (Ceiba pentandra) seeds with cassava flour as an additive. Fermentation is over a 48h period followed by a drying and a kneading process. Although lactic acid bacteria (LAB) have previously been identified other micro-organisms may also be involved in the fermentation process. In this study we examined the occurrence of aerobic endospore-forming bacteria (AEB) in raw materials, during fermentation and in the final product at 2 production sites in Northern Ghana. Total aerobic mesophilic bacterial counts increased from 5.4±0.1log10CFU/g in the raw materials to 8.9±0.1log10CFU/g in the final products, with the AEB accounting for between 23% and 80% of the total aerobic mesophilic (TAM) counts. A total of 196 AEB were identified at a species/subspecies level by the use of phenotypic tests and genotypic methods including M13-PCR typing, 16S rRNA and gyrA gene sequencing. Bacillus subtilis subsp. subtilis (63% of the AEB), Bacillus safensis (26% of the AEB) and Bacillus amyloliquefaciens subsp. plantarum/Bacillus methylotrophicus (9% of the AEB) were the predominant Bacillus species during fermentation and in the final products. B. amyloliquefaciens/B. methylotrophicus originated from cassava flour, B. safensis from seeds and cassava flour, while the origin of B. subtilis was less clear. Brevibacillus agri and Peanibacillus spp. occurred sporadically. Further investigations are required to elucidate the role of AEB occurring in high numbers, in the fermentation of Kantong.

  18. Rapid identification of biothreat and other clinically relevant bacterial species by use of universal PCR coupled with high-resolution melting analysis.

    PubMed

    Yang, Samuel; Ramachandran, Padmini; Rothman, Richard; Hsieh, Yu-Hsiang; Hardick, Andrew; Won, Helen; Kecojevic, Aleksandar; Jackman, Joany; Gaydos, Charlotte

    2009-07-01

    A rapid assay for eubacterial species identification is described using high-resolution melt analysis to characterize PCR products. Unique melt profiles generated from multiple hypervariable regions of the 16S rRNA gene for 100 clinically relevant bacterial pathogens, including category A and B biothreat agents and their surrogates, allowed highly specific species identification.

  19. Culturable bacterial communities associated to Brazilian Oscarella species (Porifera: Homoscleromorpha) and their antagonistic interactions.

    PubMed

    Laport, Marinella Silva; Bauwens, Mathieu; de Oliveira Nunes, Suzanne; Willenz, Philippe; George, Isabelle; Muricy, Guilherme

    2017-04-01

    Sponges offer an excellent model to investigate invertebrate-microorganism interactions. Furthermore, bacteria associated with marine sponges represent a rich source of bioactive metabolites. The aim of this study was to characterize the bacteria inhabiting a genus of sponges, Oscarella, and their potentiality for antimicrobial production. Bacterial isolates were recovered from different Oscarella specimens, among which 337 were phylogenetically identified. The culturable community was dominated by Proteobacteria and Firmicutes, and Vibrio was the most frequently isolated genus, followed by Shewanella. When tested for antimicrobial production, bacteria of the 12 genera isolated were capable of producing antimicrobial substances. The majority of strains were involved in antagonistic interactions and inhibitory activities were also observed against bacteria of medical importance. It was more pronounced in some isolated genera (Acinetobacter, Bacillus, Photobacterium, Shewanella and Vibrio). These findings suggest that chemical antagonism could play a significant role in shaping bacterial communities within Oscarella, a genus classified as low-microbial abundance sponge. Moreover, the identified strains may contribute to the search for new sources of antimicrobial substances, an important strategy for developing therapies to treat infections caused by multidrug-resistant bacteria. This study was the first to investigate the diversity and antagonistic activity of bacteria isolated from Oscarella spp. It highlights the biotechnological potential of sponge-associated bacteria.

  20. Survival of Bacterial Indicator Species and Bacteriophages after Thermal Treatment of Sludge and Sewage

    PubMed Central

    Mocé-Llivina, Laura; Muniesa, Maite; Pimenta-Vale, Hugo; Lucena, Francisco; Jofre, Juan

    2003-01-01

    The inactivation of naturally occurring bacterial indicators and bacteriophages by thermal treatment of a dewatered sludge and raw sewage was studied. The sludge was heated at 80°C, and the sewage was heated at 60°C. In both cases phages were significantly more resistant to thermal inactivation than bacterial indicators, with the exception of spores of sulfite-reducing clostridia. Somatic coliphages and phages infecting Bacteroides fragilis were significantly more resistant than F-specific RNA phages. Similar trends were observed in sludge and sewage. The effects of thermal treatment on various phages belonging to the three groups mentioned above and on various enteroviruses added to sewage were also studied. The results revealed that the variability in the resistance of phages agreed with the data obtained with the naturally occurring populations and that the phages that were studied were more resistant to heat treatment than the enteroviruses that were studied. The phages survived significantly better than Salmonella choleraesuis, and the extents of inactivation indicated that naturally occurring bacteriophages can be used to monitor the inactivation of Escherichia coli and Salmonella. PMID:12620828

  1. 'Halomonas saudii' sp. nov., a new bacterial species isolated from marine plant Halocnemum strobilaceum.

    PubMed

    Bibi, F; Yasir, M; Alvi, S A; Azhar, E I; Al-Ghamdi, A A K; Abuzenadah, A M; Raoult, D; Angelakis, E

    2017-01-01

    We report here the main characteristics of 'Halomonas saudii' strain Saudii DR2 (CSUR P2512), a new species of the Halomonas genus that was isolated from a rhizosphere of Halocnemum strobilaceum in April 2015.

  2. Assessment of oil content and fatty acid composition variability in two economically important Hibiscus species.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Hibiscus genus encompasses more than 300 species, but kenaf (H. cannabinus L.) and roselle (H. sabdariffa L.) are the two most economically important species within the genus. Seeds from these two Hibiscus species contain a relatively high amount of oil with two unusual fatty acids: dihydrosterc...

  3. GC/MS determination of fatty acid picolinyl esters by direct curie-point pyrolysis of whole bacterial cells.

    PubMed

    Kurkiewicz, Slawomir; Dzierzewicz, Zofia; Wilczok, Tadeusz; Dworzanski, Jacek P

    2003-01-01

    A single-step method suitable for cellular fatty acid derivatization to picolinyl esters with the use of a pyrolyzer as a thermochemical micro-reactor was developed for whole bacterial cells. This reduced the preparation time from several hours to less than two minutes. In addition, the minimal bacterial mass required for analysis was reduced from several milligrams to micrograms. The profiling of cellular fatty acids of gram-positive and gram-negative bacteria was achieved using three derivatization methods: preparation of methyl esters, beta-picolinyl esters by Harvey's method and a new method based on pyrolytic derivatization to beta-picolinyl esters. It was shown that there are great similarities between profiles of bacterial fatty acids determined by the pyrolytic derivatization method and traditional preparation methods of picolinyl and methyl esters prior to GC analysis. Results obtained by application of the new technique have immense diagnostic value due to vast similarities between profiles of fatty acids derivatized to either picolinyl and methyl esters. Although the latter are referred to in the literature most often, mass spectra of picolinyl esters contain fragment ions that provide structural information about the chain branching, position of unsaturation, and other substituents.

  4. Caulobacter species as a cause of postneurosurgical bacterial meningitis in a pediatric patient

    PubMed Central

    Bridger, Natalie; Walkty, Andrew; Crockett, Maryanne; Fanella, Sergio; Nichol, Kim; Karlowsky, James A

    2012-01-01

    Caulobacter species have been rarely found to be a cause of human infection. A case of probable Caulobacter species meningitis occurring postneurosurgery in a pediatric patient is reported in the present article. Gram stain and colony morphology of the isolate were not consistent with the identification provided by commercial phenotypic identification systems. The present case illustrates the need to reconcile conflicting phenotypic test results using 16S ribosomal DNA sequencing. PMID:23449318

  5. Shifts in bacterial communities of two caribbean reef-building coral species affected by white plague disease

    PubMed Central

    Cárdenas, Anny; Rodriguez-R, Luis M; Pizarro, Valeria; Cadavid, Luis F; Arévalo-Ferro, Catalina

    2012-01-01

    Coral reefs are deteriorating at an alarming rate mainly as a consequence of the emergence of coral diseases. The white plague disease (WPD) is the most prevalent coral disease in the southwestern Caribbean, affecting dozens of coral species. However, the identification of a single causal agent has proved problematic. This suggests more complex etiological scenarios involving alterations in the dynamic interaction between environmental factors, the coral immune system and the symbiotic microbial communities. Here we compare the microbiome of healthy and WPD-affected corals from the two reef-building species Diploria strigosa and Siderastrea siderea collected at the Tayrona National Park in the Caribbean of Colombia. Microbiomes were analyzed by combining culture-dependent methods and pyrosequencing of 16S ribosomal DNA (rDNA) V5-V6 hypervariable regions. A total of 20 410 classifiable 16S rDNA sequences reads were obtained including all samples. No significant differences in operational taxonomic unit diversity were found between healthy and affected tissues; however, a significant increase of Alphaproteobacteria and a concomitant decrease in the Beta- and Gammaproteobacteria was observed in WPD-affected corals of both species. Significant shifts were also observed in the orders Rhizobiales, Caulobacteriales, Burkholderiales, Rhodobacterales, Aleteromonadales and Xanthomonadales, although they were not consistent between the two coral species. These shifts in the microbiome structure of WPD-affected corals suggest a loss of community-mediated growth control mechanisms on bacterial populations specific for each holobiont system. PMID:21955993

  6. Reactive Carbonyl Species Derived from Omega-3 and Omega-6 Fatty Acids.

    PubMed

    Wang, Yu; Cui, Ping

    2015-07-22

    Inflammation-related reactive oxygen species (ROS) and reactive nitrogen species (RNS) are associated with the development of cancer. ROS and RNS can directly damage biomacromolecules such as proteins, DNA, and lipids. Lipid peroxidation, however, can result in reactive carbonyl species (RCS) that can also modify proteins and DNA. In contrast to an extensive literature on the modification of proteins and DNA from omega-6 fatty acids, there are few studies on RCS generation from other fatty acids, particularly omega-3 fatty acids, which are frequently consumed from the diet and diet supplements. Therefore, a comparison between omega-3 and omega-6 fatty acids has been conducted. LC-MS/MS analysis of carbonyl-dinitrophenylhydrazine (DNPH) standards yielded characteristic fragment ions. Autoxidation products of α-linolenic acid and linoleic acid were then derivatized with DNPH and analyzed by LC-MS/MS. The results showed that α-linolenic acid, an omega-3 fatty acid, generated more acrolein and crotonaldehyde than did linoleic acid, an omega-6 fatty acid. Omega-3 fatty acids might be easily degraded to smaller monoaldehydes or dicarbonyls. Omega-3 fatty acids have been considered as health improvement components for a long time. However, on the basis of the results presented here, use of omega-3 fatty acids should be re-evaluated in vivo for safety purposes.

  7. Production rates of bacterial tetraether lipids and fatty acids in peatland under varying oxygen concentrations

    NASA Astrophysics Data System (ADS)

    Huguet, Arnaud; Meador, Travis B.; Laggoun-Défarge, Fatima; Könneke, Martin; Wu, Weichao; Derenne, Sylvie; Hinrichs, Kai-Uwe

    2017-04-01

    Interpretations of the abundance and distribution of branched glycerol dialkyl glycerol tetraether (brGDGT) lipids have been increasingly applied to infer changes in paleoenvironment and to estimate terrigenous organic matter inputs into estuarine and marine sediments. However, only preliminary information is known regarding the ecology and physiology of the source organisms of these biomarkers. We assessed the production rates of brGDGTs under different redox conditions in peat, where these lipids are found in high concentrations, particularly at greater depths below the fluctuating water table. The incorporation of hydrogen relative to carbon into lipids observed in our dual stable isotope probing assay indicates that brGDGTs were produced by heterotrophic bacteria. Unexpectedly, incubations with stable isotope tracers of the surface horizon (5-20 cm) initiated under oxic conditions before turning suboxic and eventually anoxic exhibited up to one order of magnitude higher rates of brGDGT production (16-87 ng cm-3 y-1) relative to the deeper, anoxic zone (20-35 cm; ca. 7 ng cm-3 y-1), and anoxic incubations of the surface horizon (<3 ng cm-3 y-1). Turnover times of brGDGTs in the surface horizon ranged between 8 and 41 years in the incubations initiated under oxic conditions, in contrast to 123-742 years in anoxic incubations. As brGDGTs were actively produced during both anoxic incubations and those exposed to oxygen, we conclude that their source organisms are likely facultative aerobic heterotrophs that are particularly active in the peat acrotelm. Production rates of bacterial fatty acids (ca. 2 μg cm-3 y-1) were roughly two orders of magnitude higher than those of brGDGTs, suggesting that brGDGT producers are a minor constituent of the microbial community or that brGDGTs are a small component of the microbial cell membrane in comparison to fatty acids, despite the typically high brGDGT concentrations observed in peat. Multivariate analysis identified two

  8. A short-term mineral amendment impacts the mineral weathering bacterial communities in an acidic forest soil.

    PubMed

    Lepleux, C; Uroz, S; Collignon, C; Churin, J-L; Turpault, M-P; Frey-Klett, P

    2013-09-01

    Mineral amendment (i.e. calcium, phosphorous, potassium and/or magnesium) is a management practice used in forestry to improve nutrient availability and recover soil fertility, especially in nutrient-poor forest ecosystems. However, whether this amendment can lead to modifications of the soil characteristics and an improvement in tree growth, and its impact on the soil bacterial communities, especially the mineral weathering bacterial communities, remains poorly documented. In this study, we investigated the short-term impact of a mineral amendment on the taxonomic and functional structure of the mineral weathering bacterial communities. To do this, a plantation of four-year old oak (Quercus petraea) trees amended with or without dolomite [CaMg(CO3)2] was established in the experimental forest site of Breuil-Chenue, which is characterized by an acidic soil and a low availability of calcium and magnesium. Three years after amendment, soil samples were used to isolate bacteria as well as to determine the soil characteristics and the metabolic potentials of these soil microbial communities. Based on a bioassay for quantifying the solubilisation of inorganic phosphorous, we demonstrate that the bacterial isolates coming from the non-amended bulk soil were significantly more efficient than those from the amended bulk soil. No difference was observed between the bacterial isolates coming from the amended and non-amended rhizospheres. Notably, the taxonomic analyses revealed a dominance of bacterial isolates belonging to the Burkholderia genus in both samples. Overall, our results suggest that the bioavailability of nutritive cations into soil impacts the distribution and the efficacy of mineral weathering bacterial communities coming from the soil but not those coming from the rhizosphere.

  9. Content of essential polyunsaturated fatty acids in three canned fish species.

    PubMed

    Gladyshev, Michail I; Sushchik, Nadezhda N; Makhutova, Olesia N; Kalachova, Galina S

    2009-05-01

    Three canned fish species--Pacific saury (Cololabis saira), Pacific herring (Clupea harengus) and Baltic sprat (Sprattus sprattus)--most common and popular in Russia, were analyzed for fatty acids. Special attention was paid to long-chain essential polyunsaturated fatty acids: eicosapentaenoic acid (20:5omega3) and docosahexaenoic acid (22:6omega3). Sums of eicosapentaenoic acid and docosahexaenoic acid in saury, herring and sprat were, on average, 2.42, 1.80 and 1.43 g/100 g product, respectively. Contents of these essential acids in all the canned fish species were found to be very high compared with many other fish reported in the available literature. All the canned fish appeared to be highly valuable products for human nutrition concerning the content of eicosapentaenoic and docosahexaenoic acids.

  10. Interspecific transfer of bacterial endosymbionts between tsetse fly species: infection establishment and effect on host fitness.

    PubMed

    Weiss, Brian L; Mouchotte, Rosa; Rio, Rita V M; Wu, Yi-Neng; Wu, Zheyang; Heddi, Abdelaziz; Aksoy, Serap

    2006-11-01

    Tsetse flies (Glossina spp.) can harbor up to three distinct species of endosymbiotic bacteria that exhibit unique modes of transmission and evolutionary histories with their host. Two mutualist enterics, Wigglesworthia and Sodalis, are transmitted maternally to tsetse flies' intrauterine larvae. The third symbiont, from the genus Wolbachia, parasitizes developing oocytes. In this study, we determined that Sodalis isolates from several tsetse fly species are virtually identical based on a phylogenetic analysis of their ftsZ gene sequences. Furthermore, restriction fragment-length polymorphism analysis revealed little variation in the genomes of Sodalis isolates from tsetse fly species within different subgenera (Glossina fuscipes fuscipes and Glossina morsitans morsitans). We also examined the impact on host fitness of transinfecting G. fuscipes fuscipes and G. morsitans morsitans flies with reciprocal Sodalis strains. Tsetse flies cleared of their native Sodalis symbionts were successfully repopulated with the Sodalis species isolated from a different tsetse fly species. These transinfected flies effectively transmitted the novel symbionts to their offspring and experienced no detrimental fitness effects compared to their wild-type counterparts, as measured by longevity and fecundity. Quantitative PCR analysis revealed that transinfected flies maintained their Sodalis populations at densities comparable to those in flies harboring native symbionts. Our ability to transinfect tsetse flies is indicative of Sodalis ' recent evolutionary history with its tsetse fly host and demonstrates that this procedure may be used as a means of streamlining future paratransgenesis experiments.

  11. Species sorting and seasonal dynamics primarily shape bacterial communities in the Upper Mississippi River.

    PubMed

    Staley, Christopher; Gould, Trevor J; Wang, Ping; Phillips, Jane; Cotner, James B; Sadowsky, Michael J

    2015-02-01

    Bacterial community structure (BCS) in freshwater ecosystems varies seasonally and due to physicochemical gradients, but metacommunity structure of a major river remains understudied. Here we characterize the BCS along the Mississippi River and contributing rivers in Minnesota over three years using Illumina next-generation sequencing, to determine how changes in environmental conditions as well as inputs from surrounding land and confluences impacted community structure. Contributions of sediment to water microbial diversity were also evaluated. Long-term variation in community membership was observed, and significant shifts in relative abundances of major freshwater taxa, including α-Proteobacteria, Burkholderiales, and Actinomycetales, were observed due to temporal and spatial variations. Environmental parameters (e.g. temperature, rainfall, and nutrient concentrations) primarily contributed to differences in phyla abundances (88% of variance), with minimal influence from spatial distance alone (<1% of variance). Furthermore, an annually-recurrent BCS was observed in late summer, further suggesting that seasonal dynamics strongly influence community composition. Sediment communities differed from those in the water, but contributed up to 50% to community composition in the water column. Among water sampling sites, 34% showed significant variability in BCS of replicate samples indicating variability among riverine communities due to heterogeneity in the water column. Results of this study highlight the need for a better understanding of spatial and temporal variations in riverine bacterial diversity associated with physicochemical gradients and reveal how communities in sediments, and potentially other environmental reservoirs, impact waterborne BCS. Techniques used in this study may prove useful to determine sources of microbes from sediments and soils to waterways, which will facilitate best management practices and total maximum daily load determinations.

  12. High diversity of skin-associated bacterial communities of marine fishes is promoted by their high variability among body parts, individuals and species.

    PubMed

    Chiarello, Marlène; Villéger, Sébastien; Bouvier, Corinne; Bettarel, Yvan; Bouvier, Thierry

    2015-07-01

    Animal-associated microbiotas form complex communities, which are suspected to play crucial functions for their host fitness. However, the biodiversity of these communities, including their differences between host species and individuals, has been scarcely studied, especially in case of skin-associated communities. In addition, the intraindividual variability (i.e. between body parts) has never been assessed to date. The objective of this study was to characterize skin bacterial communities of two teleostean fish species, namely the European seabass (Dicentrarchus labrax) and gilthead seabream (Sparus aurata), using a high-throughput DNA sequencing method. In order to focus on intrinsic factors of host-associated bacterial community variability, individuals of the two species were raised in controlled conditions. Bacterial diversity was assessed using a set of four complementary indices, describing the taxonomic and phylogenetic facets of biodiversity and their respective composition (based on presence/absence data) and structure (based on species relative abundances) components. Variability of bacterial diversity was quantified at the interspecific, interindividual and intraindividual scales. We demonstrated that fish surfaces host highly diverse bacterial communities, whose composition was very different from that of surrounding bacterioplankton. This high total biodiversity of skin-associated communities was supported by the important variability, between host species, individuals and the different body parts (dorsal, anal, pectoral and caudal fins).

  13. Fatty acid composition of seed oils from sixAdansonia species with particular reference to cyclopropane and cyclopropene acids.

    PubMed

    Ralaimanarivo, A; Gaydou, E M; Bianchini, J P

    1982-01-01

    The oil content of sixAdansonia species (Bombacaceae family) of Madagascar (Adansonia grandidieri, A. za, A. digitata, A. fony, A. madagascariensis andA. suarenzensis) and Africa (A. digitata) ranges from 8 to 46%. All the oils give a positive response to the Halphen test. Malvalic, sterculic and dihydrosterculic acids were detected using gas liquid chromatography-mass spectrometry (GLC-MS). Epoxy or hydroxy fatty acids were not found in these oils. Fatty acid composition was determined by GLC using glass capillary columns coated with BDS and Carbowax 20 M. Results obtained for cyclopropenic fatty acids (CPEFA) were compared to those given by glass capillary GLC after derivatization with silver nitrate in methanol, by hydrogen bromide titration and by proton magnetic resonance (PMR). Good agreement was observed for the results given by the various methods. Malvalic acid content ranges from 3 to 28%, sterculic acid from 1 to 8% and dihydrosterculic acid from 1.5 to 5.1%. Odd-numbered fatty acids (Pentadecanoic and hepatadecanoic) were also observed in minute amounts (0.1-1.1%). Among the normal fatty acids, we observed mainly palmitic (21-46%), oleic (15-40%) and linoleic (12-32%). The relationship between fatty acid composition andAdansonia species is discussed.

  14. The effects of temperature and growth rate on the proportion of unsaturated fatty acids in bacterial lipids.

    PubMed

    Gill, C O; Suisted, J R

    1978-01-01

    The effects of temperature and growth rate on the fatty acid composition of the extractable lipids of four mesophilic and three psychotrophic bacteria were examined. Two of the mesophiles (Escherichia coli and Pseudomonas aeruginosa) increased the proportion of unsaturated fatty acids in their lipids with decreasing temperature over their whole growth temperature range. The other mesophiles (Enterobacter aerogenes and Lactobacillus casei) increased the proportion of unsaturated fatty acids with decreasing temperature only over the lower half of their growth temperature ranges. The psychrotrophs Pseudomonas fluorescens and Enterobacter sp. had a constant proportion of unsaturated acids over the lower half of their growth temperature range, while the psychotrophic Lactobacillus sp. showed no consistent change in its unsaturated fatty acid composition with temperature. All species showed some variation of unsaturated fatty acid composition with growth rate at the highest and lowest growth temperatures, although such variations were small in some species (Ent. aerogenes and Lactobacillus sp.).

  15. Assessment of oil content and fatty acid composition variability in two economically important Hibiscus species.

    PubMed

    Wang, Ming Li; Morris, Brad; Tonnis, Brandon; Davis, Jerry; Pederson, Gary A

    2012-07-04

    The Hibiscus genus encompasses more than 300 species, but kenaf (Hibiscus cannabinus L.) and roselle (Hibiscus sabdariffa L.) are the two most economically important species within the genus. Seeds from these two Hibiscus species contain a relatively high amount of oil with two unusual fatty acids: dihydrosterculic and vernolic acids. The fatty acid composition in the oil can directly affect oil quality and its utilization. However, the variability in oil content and fatty acid composition for these two species is unclear. For these two species, 329 available accessions were acquired from the USDA germplasm collection. Their oil content and fatty acid composition were determined by nuclear magnetic resonance (NMR) and gas chromatography (GC), respectively. Using NMR and GC analyses, we found that Hibiscus seeds on average contained 18% oil and seed oil was composed of six major fatty acids (each >1%) and seven minor fatty acids (each <1%). Hibiscus cannabinus seeds contained significantly higher amounts of oil (18.14%), palmitic (20.75%), oleic (28.91%), vernolic acids (VA, 4.16%), and significantly lower amounts of stearic (3.96%), linoleic (39.49%), and dihydrosterculic acids (DHSA, 1.08%) than H. sabdariffa seeds (17.35%, 18.52%, 25.16%, 3.52%, 4.31%, 44.72%, and 1.57%, respectively). For edible oils, a higher oleic/linoleic (O/L) ratio and lower level of DHSA are preferred, and for industrial oils a high level of VA is preferred. Our results indicate that seeds from H. cannabinus may be of higher quality than H. sabdariffa seeds for these reasons. Significant variability in oil content and major fatty acids was also detected within both species. The variability in oil content and fatty acid composition revealed from this study will be useful for exploring seed utilization and developing new cultivars in these Hibiscus species.

  16. Design, synthesis and biological evaluation of α-substituted isonipecotic acid benzothiazole analogues as potent bacterial type II topoisomerase inhibitors.

    PubMed

    Axford, Lorraine C; Agarwal, Piyush K; Anderson, Kelly H; Andrau, Laura N; Atherall, John; Barker, Stephanie; Bennett, James M; Blair, Michael; Collins, Ian; Czaplewski, Lloyd G; Davies, David T; Gannon, Carlie T; Kumar, Dushyant; Lancett, Paul; Logan, Alastair; Lunniss, Christopher J; Mitchell, Dale R; Offermann, Daniel A; Palmer, James T; Palmer, Nicholas; Pitt, Gary R W; Pommier, Stéphanie; Price, Daniel; Narasinga Rao, B; Saxena, Rashmi; Shukla, Tarun; Singh, Amit K; Singh, Mahipal; Srivastava, Anil; Steele, Christopher; Stokes, Neil R; Thomaides-Brears, Helena B; Tyndall, Edward M; Watson, David; Haydon, David J

    2013-12-15

    The discovery and optimisation of a new class of benzothiazole small molecules that inhibit bacterial DNA gyrase and topoisomerase IV are described. Antibacterial properties have been demonstrated by activity against DNA gyrase ATPase and potent activity against Staphylococcus aureus, Enterococcus faecalis, Streptococcus pyogenes and Haemophilus influenzae. Further refinements to the scaffold designed to enhance drug-likeness included analogues bearing an α-substituent to the carboxylic acid group, resulting in excellent solubility and favourable pharmacokinetic properties.

  17. Time-kill behavior against eight bacterial species and cytotoxicity of antibacterial monomers

    PubMed Central

    Li, Fang; Weir, Michael D.; Fouad, Ashraf F.; Xu, Hockin H. K.

    2013-01-01

    Objectives The objectives of this study were to investigate: (1) the antibacterial activity of two antibacterial monomers, dimethylaminododecyl methacrylate (DMADDM) and dimethylammoniumethyl dimethacrylate (DMAEDM), against eight different species of oral pathogens for the first time; (2) the cytotoxicity of DMAEDM and DMADDM. Methods DMAEDM and DMADDM were synthesized by reacting a tertiary amine group with an organo-halide. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) against eight species of bacteria were tested. Time-kill determinations were performed to examine the bactericidal kinetics. Cytotoxicity of monomers on human gingival fibroblasts (HGF) was assessed using a methyl thiazolyltetrazolium assay and live/dead viability assay. Results DMADDM showed strong bactericidal activity against all bacteria, with MIC of 1.2 to 9.8μg/mL. DMAEDM had MIC of 20 to 80mg/mL. Time-kill determinations indicated that DMADDM and DMAEDM had rapid killing effects against eight species of bacteria, and eliminated all bacteria in 30min at the concentration of 4-fold MBC. Median lethal concentration for DMADDM and DMAEDM was between 20 to 40μg/mL, which was 20-fold higher than 1 to 2μg/mL for BisGMA control. Conclusions DMAEDM and DMADDM were tested in time-kill assay against eight species of oral bacteria for the first time. Both were effective in bacteria-inhibition, but DMADDM had a higher potency than DMAEDM. Different killing efficacy was found against different bacteria species. DMAEDM and DMADDM had much lower cytotoxicity than BisGMA. Therefore, DMADDM and DMAEDM are promising for use in bonding agents and other restorative/preventive materials to combat a variety of oral pathogens. PMID:23876930

  18. CAP-D3 Promotes Bacterial Clearance in Human Intestinal Epithelial Cells by Repressing Expression of Amino Acid Transporters

    PubMed Central

    Kemp, Jacqueline R.; Nickerson, Kourtney P.; Deutschman, Emily; Kim, Yeojung; West, Gail; Sadler, Tammy; Stylianou, Eleni; Krokowski, Dawid; Hatzoglou, Maria; de la Motte, Carol; Rubin, Brian P.; Fiocchi, Claudio

    2015-01-01

    BACKGROUND & AIMS Defects in colonic epithelial barrier defenses are associated with ulcerative colitis (UC). The proteins that regulate bacterial clearance in the colonic epithelium have not been completely identified. The chromosome-associated protein D3 (dCAP-D3), regulates responses to bacterial infection. We examined whether CAP-D3 promotes bacterial clearance in human colonic epithelium. METHODS Clearance of Salmonella or adherent-invasive Escherichia coli LF82 was assessed by gentamycin protection assays in HT-29 and Caco-2 cells expressing small hairpin RNAs against CAP-D3. We used immunoblot assays to measure levels of CAP-D3 in colonic epithelial cells from patients with UC and healthy individuals (controls). RNA sequencing identified genes activated by CAP-D3. We analyzed the roles of CAP-D3 target genes in bacterial clearance using gentamycin protection and immunofluorescence assays and studies with pharmacologic inhibitors. RESULTS CAP-D3 expression was reduced in colonic epithelial cells from patients with active UC. Reduced CAP-D3 expression decreased autophagy and impaired intracellular bacterial clearance by HT-29 and Caco-2 colonic epithelial cells. Lower levels of CAP-D3 increased transcription of genes encoding SLC7A5 and SLC3A2, whose products heterodimerize to form an amino acid transporter in HT-29 cells following bacterial infection; levels of SLC7A5–SLC3A2 were increased in tissues from patients with UC, compared with controls. Reduced CAP-D3 in HT-29 cells resulted in earlier recruitment of SLC7A5 to Salmonella-containing vacuoles, increased activity of mTORC1, and increased survival of bacteria. Inhibition of SLC7A5–SLC3A2 or mTORC1 activity rescued the bacterial clearance defects of CAP-D3– deficient cells. CONCLUSIONS CAP-D3 downregulates transcription of genes that encode amino acid transporters (SLC7A5 and SLC3A2) to promote bacterial autophagy by colon epithelial cells. Levels of CAP-D3 protein are reduced in patients with

  19. Two UDP-glucuronic acid decarboxylases involved in the biosynthesis of a bacterial exopolysaccharide in Paenibacillus elgii.

    PubMed

    Li, Ou; Qian, Chao-Dong; Zheng, Dao-Qiong; Wang, Pin-Mei; Liu, Yu; Jiang, Xin-Hang; Wu, Xue-Chang

    2015-04-01

    Xylose is described as a component of bacterial exopolysaccharides in only a limited number of bacterial strains. A bacterial strain, Paenibacillus elgii, B69 was shown to be efficient in producing a xylose-containing exopolysaccharide. Sequence analysis was performed to identify the genes encoding the uridine diphosphate (UDP)-glucuronic acid decarboxylase required for the synthesis of UDP-xylose, the precursor of the exopolysaccharide. Two sequences, designated as Peuxs1 and Peuxs2, were found as the candidate genes for such enzymes. The activities of the UDP-glucuronic acid decarboxylases were proven by heterologous expression and real-time nuclear magnetic resonance analysis. The intracellular activity and effect of these genes on the synthesis of exopolysaccharide were further investigated by developing a thymidylate synthase based knockout system. This system was used to substitute the conventional antibiotic resistance gene system in P. elgii, a natural multi-antibiotic resistant strain. Results of intracellular nucleotide sugar analysis showed that the intracellular UDP-xylose and UDP-glucuronic acid levels were affected in Peuxs1 or Peuxs2 knockout strains. The knockout of either Peuxs1 or Peuxs2 reduced the polysaccharide production and changed the monosaccharide ratio. No polysaccharide was found in the Peuxs1/Peuxs2 double knockout strain. Our results show that P. elgii can be efficient in forming UDP-xylose, which is then used for the synthesis of xylose-containing exopolysaccharide.

  20. Amoeba host-Legionella synchronization of amino acid auxotrophy and its role in bacterial adaptation and pathogenic evolution.

    PubMed

    Price, Christopher T D; Richards, Ashley M; Von Dwingelo, Juanita E; Samara, Hala A; Abu Kwaik, Yousef

    2014-02-01

    Legionella pneumophila, the causative agent of Legionnaires' disease, invades and proliferates within a diverse range of free-living amoeba in the environment, but upon transmission to humans, the bacteria hijack alveolar macrophages. Intracellular proliferation of L. pneumophila in two evolutionarily distant hosts is facilitated by bacterial exploitation of conserved host processes that are targeted by bacterial protein effectors injected into the host cell. A key aspect of microbe-host interaction is microbial extraction of nutrients from the host, but understanding of this is still limited. AnkB functions as a nutritional virulence factor and promotes host proteasomal degradation of polyubiquitinated proteins generating gratuitous levels of limiting host cellular amino acids. Legionella pneumophila is auxotrophic for several amino acids including cysteine, which is a metabolically preferred source of carbon and energy during intracellular proliferation, but is limiting in both amoebae and humans. We propose that synchronization of bacterial amino acids auxotrophy with the host is a driving force in pathogenic evolution and nutritional adaptation of L. pneumophila and other intracellular bacteria to life within the host cell. Understanding microbial strategies of nutrient generation and acquisition in the host will provide novel antimicrobial strategies to disrupt pathogen access to essential sources of carbon and energy.

  1. Cytotoxic responses to 405nm light exposure in mammalian and bacterial cells: Involvement of reactive oxygen species.

    PubMed

    Ramakrishnan, Praveen; Maclean, Michelle; MacGregor, Scott J; Anderson, John G; Grant, M Helen

    2016-06-01

    Light at wavelength 405 nm is an effective bactericide. Previous studies showed that exposing mammalian cells to 405 nm light at 36 J/cm(2) (a bactericidal dose) had no significant effect on normal cell function, although at higher doses (54 J/cm(2)), mammalian cell death became evident. This research demonstrates that mammalian and bacterial cell toxicity induced by 405 nm light exposure is accompanied by reactive oxygen species production, as detected by generation of fluorescence from 6-carboxy-2',7'-dichlorodihydrofluorescein diacetate. As indicators of the resulting oxidative stress in mammalian cells, a decrease in intracellular reduced glutathione content and a corresponding increase in the efflux of oxidised glutathione were observed from 405 nm light treated cells. The mammalian cells were significantly protected from dying at 54 J/cm(2) in the presence of catalase, which detoxifies H2O2. Bacterial cells were significantly protected by sodium pyruvate (H2O2 scavenger) and by a combination of free radical scavengers (sodium pyruvate, dimethyl thiourea (OH scavenger) and catalase) at 162 and 324 J/cm(2). Results therefore suggested that the cytotoxic mechanism of 405 nm light in mammalian cells and bacteria could be oxidative stress involving predominantly H2O2 generation, with other ROS contributing to the damage.

  2. Reactive Oxygen Species Produced by the NOX2 Complex in Monocytes Protect Mice from Bacterial Infections1, 2, 3

    PubMed Central

    Pizzolla, Angela; Hultqvist, Malin; Nilson, Bo; Grimm, Melissa J.; Eneljung, Tove; Jonsson, Ing-Marie; Verdrengh, Margareta; Kelkka, Tiina; Gjertsson, Inger; Segal, Brahm H.; Holmdahl, Rikard

    2012-01-01

    Chronic granulomatous disease (CGD) is an inherited disorder characterized by recurrent life-threatening bacterial and fungal infections. CGD results from defective production of reactive oxygen species (ROS) by phagocytes caused by mutations in genes encoding the NADPH oxidase 2 (NOX2) complex subunits. Mice with a spontaneous mutation in Ncf1, which encodes the NCF1 (p47phox) subunit of NOX2, have defective phagocyte NOX2 activity. These mice occasionally develop local spontaneous infections by Staphylococcus xylosus or by the common CGD pathogen S. aureus. Ncf1 mutant mice were more susceptible to systemic challenge with these bacteria than wild type mice. Transgenic Ncf1 mutant mice harboring wild type Ncf1 gene under the human CD68 promoter (MN+ mice) gained the expression of NCF1 and functional NOX2 activity specifically in monocyte/macrophages, although minimal NOX2 activity was detected also in some CD11b+Ly6G+ cells defined as neutrophils. MN+ mice did not develop spontaneous infection and were more resistant to administered staphylococcal infections compared to MN− mice. Most strikingly, MN+ mice survived after administered Burkholderia cepacia, an opportunistic pathogen in CGD patients, whereas MN− mice died. Thus, monocyte/macrophage expression of functional NCF1 protected against spontaneous and administered bacterial infections. PMID:22491245

  3. Association of Actinobacillus actinomycetemcomitans leukotoxin with nucleic acids on the bacterial cell surface.

    PubMed Central

    Ohta, H; Hara, H; Fukui, K; Kurihara, H; Murayama, Y; Kato, K

    1993-01-01

    Actinobacillus actinomycetemcomitans, a periodontopathic gram-negative bacterium, produces a leukotoxin that is a member of the RTX cytotoxin family. Although genes may function in toxin secretion, the leukotoxin is not secreted extracellularly but remains associated with the bacterial cell surface. We report here that this toxin-cell surface association is mediated by nucleic acids and directly demonstrate that the extracellular secretion of toxin occurs in growing cultures with increased ionic strength of medium. All examinations were performed with freshly harvested A. actinomycetemcomitans 301-b from anaerobic fructose-limited chemostat cultures. The occurrence of cell surface-localized DNA was shown by directly digesting whole cells with the restriction endonuclease EcoRI or HindIII, which yielded many DNA fragments. The cell surface DNA constituted about 20% of the total cellular DNA. The leukotoxin was released from the whole cells by digestion with DNase I as well as restriction endonucleases. Because the leukotoxin binds ionically to DNA, it is dependent on the ionic strength of buffers or media. Accordingly, the toxin was released from cells suspended in saline at pH 7.5 in the presence of increasing amounts of MgCl2 (0 to 10 mM) or NaCl (0 to 50 mM). Moreover, a considerable quantity of leukotoxin was detected in the culture supernatant of fructose-limited chemostat cultures when sodium succinate solution was pumped into the steady state as an additional salt (30 and then 50 mM). This toxin-DNA association was also found in well-characterized strains including not only the leukotoxin-producing ATCC 29522 but also the toxin production-variable ATCC 29523 and the non-leukotoxin-producing ATCC 33384 when these strains were grown in the chemostat culture. Images PMID:8406888

  4. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, an d analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: (1) to assess the potential terrorist threat to U.S. agricultural crops, (2) to determine whether suitable assays exist to monitor that threat, and (3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  5. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  6. A Single Amino Acid Change Is Responsible for Evolution of Acyltransferase Specificity in Bacterial Methionine Biosynthesis

    SciTech Connect

    Zubieta, C.; Arkus, K.A.J.; Cahoon, R.E.; Jez, J.M.

    2009-05-28

    Bacteria and yeast rely on either homoserine transsuccinylase (HTS, metA) or homoserine transacetylase (HTA; met2) for the biosynthesis of methionine. Although HTS and HTA catalyze similar chemical reactions, these proteins are typically unrelated in both sequence and three-dimensional structure. Here we present the 2.0 {angstrom} resolution x-ray crystal structure of the Bacillus cereus metA protein in complex with homoserine, which provides the first view of a ligand bound to either HTA or HTS. Surprisingly, functional analysis of the B. cereus metA protein shows that it does not use succinyl-CoA as a substrate. Instead, the protein catalyzes the transacetylation of homoserine using acetyl-CoA. Therefore, the B. cereus metA protein functions as an HTA despite greater than 50% sequence identity with bona fide HTS proteins. This result emphasizes the need for functional confirmation of annotations of enzyme function based on either sequence or structural comparisons. Kinetic analysis of site-directed mutants reveals that the B. cereus metA protein and the E. coli HTS share a common catalytic mechanism. Structural and functional examination of the B. cereus metA protein reveals that a single amino acid in the active site determines acetyl-CoA (Glu-111) versus succinyl-CoA (Gly-111) specificity in the metA-like of acyltransferases. Switching of this residue provides a mechanism for evolving substrate specificity in bacterial methionine biosynthesis. Within this enzyme family, HTS and HTA activity likely arises from divergent evolution in a common structural scaffold with conserved catalytic machinery and homoserine binding sites.

  7. Colloidal precipitates related to Acid Mine Drainage: bacterial diversity and micro fungi-heavy metal interactions

    NASA Astrophysics Data System (ADS)

    Lucchetti, G.; Carbone, C.; Consani, S.; Zotti, M.; Di Piazza, S.; Pozzolini, M.; Giovine, M.

    2015-12-01

    In Acid Mine Drainage (AMD) settings colloidal precipitates control the mobility of Potential Toxic Elements (PTEs). Mineral-contaminant relationships (i.e. adsorption, ion-exchange, desorption) are rarely pure abiotic processes. Microbes, mainly bacteria and microfungi, can catalyze several reactions modifying the element speciation, as well as the bioavailability of inorganic pollutants. Soil, sediments, and waters heavily polluted with PTEs through AMD processes are a potential reservoir of extremophile bacteria and fungi exploitable for biotechnological purposes. Two different AMD related colloids, an ochraceous precipitate (deposited in weakly acidic conditions, composed by nanocrystalline goethite) and a greenish-blue precipitate (deposited at near-neutral pH, composed by allophane + woodwardite) were sampled. The aims of this work were to a) characterize the mycobiota present in these colloidal minerals by evaluating the presence of alive fungal propagules and extracting bacteria DNA; b) verify the fungal strains tolerance, and bioaccumulation capability on greenish-blue and ZnSO4 enriched media; c) evaluate potential impact of bacteria in the system geochemistry. The preliminary results show an interesting and selected mycobiota able to survive under unfavourable environmental conditions. A significant number of fungal strains were isolated in pure culture. Among them, species belonging to Penicillium and Trichoderma genera were tested on both greenish-blue and ZnSO4 enriched media. The results show a significant tolerance and bioaccumulation capability to some PTEs. The same colloidal precipitates were processed to extract bacteria DNA by using a specific procedure developed for sediments. The results give a good yield of nucleic acids and a positive PCR amplification of 16S rDNA accomplished the first step for future metagenomic analyses.

  8. Antimicrobial and immune modulatory effects of lactic acid and short chain fatty acids produced by vaginal microbiota associated with eubiosis and bacterial vaginosis.

    PubMed

    Aldunate, Muriel; Srbinovski, Daniela; Hearps, Anna C; Latham, Catherine F; Ramsland, Paul A; Gugasyan, Raffi; Cone, Richard A; Tachedjian, Gilda

    2015-01-01

    Lactic acid and short chain fatty acids (SCFAs) produced by vaginal microbiota have reported antimicrobial and immune modulatory activities indicating their potential as biomarkers of disease and/or disease susceptibility. In asymptomatic women of reproductive-age the vaginal microbiota is comprised of lactic acid-producing bacteria that are primarily responsible for the production of lactic acid present at ~110 mM and acidifying the vaginal milieu to pH ~3.5. In contrast, bacterial vaginosis (BV), a dysbiosis of the vaginal microbiota, is characterized by decreased lactic acid-producing microbiota and increased diverse anaerobic bacteria accompanied by an elevated pH>4.5. BV is also characterized by a dramatic loss of lactic acid and greater concentrations of mixed SCFAs including acetate, propionate, butyrate, and succinate. Notably women with lactic acid-producing microbiota have more favorable reproductive and sexual health outcomes compared to women with BV. Regarding the latter, BV is associated with increased susceptibility to sexually transmitted infections (STIs) including HIV. In vitro studies demonstrate that lactic acid produced by vaginal microbiota has microbicidal and virucidal activities that may protect against STIs and endogenous opportunistic bacteria as well as immune modulatory properties that require further characterization with regard to their effects on the vaginal mucosa. In contrast, BV-associated SCFAs have far less antimicrobial activity with the potential to contribute to a pro-inflammatory vaginal environment. Here we review the composition of lactic acid and SCFAs in respective states of eubiosis (non-BV) or dysbiosis (BV), their effects on susceptibility to bacterial/viral STIs and whether they have inherent microbicidal/virucidal and immune modulatory properties. We also explore their potential as biomarkers for the presence and/or increased susceptibility to STIs.

  9. Antimicrobial and immune modulatory effects of lactic acid and short chain fatty acids produced by vaginal microbiota associated with eubiosis and bacterial vaginosis

    PubMed Central

    Aldunate, Muriel; Srbinovski, Daniela; Hearps, Anna C.; Latham, Catherine F.; Ramsland, Paul A.; Gugasyan, Raffi; Cone, Richard A.; Tachedjian, Gilda

    2015-01-01

    Lactic acid and short chain fatty acids (SCFAs) produced by vaginal microbiota have reported antimicrobial and immune modulatory activities indicating their potential as biomarkers of disease and/or disease susceptibility. In asymptomatic women of reproductive-age the vaginal microbiota is comprised of lactic acid-producing bacteria that are primarily responsible for the production of lactic acid present at ~110 mM and acidifying the vaginal milieu to pH ~3.5. In contrast, bacterial vaginosis (BV), a dysbiosis of the vaginal microbiota, is characterized by decreased lactic acid-producing microbiota and increased diverse anaerobic bacteria accompanied by an elevated pH>4.5. BV is also characterized by a dramatic loss of lactic acid and greater concentrations of mixed SCFAs including acetate, propionate, butyrate, and succinate. Notably women with lactic acid-producing microbiota have more favorable reproductive and sexual health outcomes compared to women with BV. Regarding the latter, BV is associated with increased susceptibility to sexually transmitted infections (STIs) including HIV. In vitro studies demonstrate that lactic acid produced by vaginal microbiota has microbicidal and virucidal activities that may protect against STIs and endogenous opportunistic bacteria as well as immune modulatory properties that require further characterization with regard to their effects on the vaginal mucosa. In contrast, BV-associated SCFAs have far less antimicrobial activity with the potential to contribute to a pro-inflammatory vaginal environment. Here we review the composition of lactic acid and SCFAs in respective states of eubiosis (non-BV) or dysbiosis (BV), their effects on susceptibility to bacterial/viral STIs and whether they have inherent microbicidal/virucidal and immune modulatory properties. We also explore their potential as biomarkers for the presence and/or increased susceptibility to STIs. PMID:26082720

  10. Time series community genomics analysis reveals rapid shifts in bacterial species, strains, and phage during infant gut colonization

    PubMed Central

    Sharon, Itai; Morowitz, Michael J.; Thomas, Brian C.; Costello, Elizabeth K.; Relman, David A.; Banfield, Jillian F.

    2013-01-01

    The gastrointestinal microbiome undergoes shifts in species and strain abundances, yet dynamics involving closely related microorganisms remain largely unknown because most methods cannot resolve them. We developed new metagenomic methods and utilized them to track species and strain level variations in microbial communities in 11 fecal samples collected from a premature infant during the first month of life. Ninety six percent of the sequencing reads were assembled into scaffolds of >500 bp in length that could be assigned to organisms at the strain level. Six essentially complete (∼99%) and two near-complete genomes were assembled for bacteria that comprised as little as 1% of the community, as well as nine partial genomes of bacteria representing as little as 0.05%. In addition, three viral genomes were assembled and assigned to their hosts. The relative abundance of three Staphylococcus epidermidis strains, as well as three phages that infect them, changed dramatically over time. Genes possibly related to these shifts include those for resistance to antibiotics, heavy metals, and phage. At the species level, we observed the decline of an early-colonizing Propionibacterium acnes strain similar to SK137 and the proliferation of novel Propionibacterium and Peptoniphilus species late in colonization. The Propionibacterium species differed in their ability to metabolize carbon compounds such as inositol and sialic acid, indicating that shifts in species composition likely impact the metabolic potential of the community. These results highlight the benefit of reconstructing complete genomes from metagenomic data and demonstrate methods for achieving this goal. PMID:22936250

  11. The animal food supplement sepiolite promotes a direct horizontal transfer of antibiotic resistance plasmids between bacterial species.

    PubMed

    Rodríguez-Beltrán, Jerónimo; Rodríguez-Rojas, Alexandro; Yubero, Elva; Blázquez, Jesús

    2013-06-01

    Animal fodder is routinely complemented with antibiotics together with other food supplements to improve growth. For instance, sepiolite is currently used as a dietary coadjuvant in animal feed, as it increases animal growth parameters and improves meat and derived final product quality. This type of food additive has so far been considered innocuous for the development and spread of antibiotic resistance. In this study, we demonstrate that sepiolite promotes the direct horizontal transfer of antibiotic resistance plasmids between bacterial species. The conditions needed for plasmid transfer (sepiolite and friction forces) occur in the digestive tracts of farm animals, which routinely receive sepiolite as a food additive. Furthermore, this effect may be aggravated by the use of antibiotics supplied as growth promoters.

  12. New derivatives of salicylamides: Preparation and antimicrobial activity against various bacterial species.

    PubMed

    Pauk, Karel; Zadražilová, Iveta; Imramovský, Aleš; Vinšová, Jarmila; Pokorná, Michaela; Masaříková, Martina; Cížek, Alois; Jampílek, Josef

    2013-11-01

    Three series of salicylanilides, esters of N-phenylsalicylamides and 2-hydroxy-N-[1-(2-hydroxyphenylamino)-1-oxoalkan-2-yl]benzamides, in total thirty target compounds were synthesized and characterized. The compounds were evaluated against seven bacterial and three mycobacterial strains. The antimicrobial activities of some compounds were comparable or higher than the standards ampicillin, ciprofloxacin or isoniazid. Derivatives 3f demonstrated high biological activity against Staphylococcus aureus (⩽0.03μmol/L), Mycobacterium marinum (⩽0.40μmol/L) and Mycobacterium kansasii (1.58μmol/L), 3g shows activity against Clostridium perfringens (⩽0.03μmol/L) and Bacillus cereus (0.09μmol/L), 3h against Pasteurella multocida (⩽0.03μmol/L) and M. kansasii (⩽0.43μmol/L), 3i against methicillin-resistant S. aureus and B. cereus (⩽0.03μmol/L). The structure-activity relationships are discussed for all the compounds.

  13. An empirical strategy for characterizing bacterial proteomes across species in the absence of genomic sequences.

    PubMed

    Turse, Joshua E; Marshall, Matthew J; Fredrickson, James K; Lipton, Mary S; Callister, Stephen J

    2010-11-12

    Global protein identification through current proteomics methods typically depends on the availability of sequenced genomes. In spite of increasingly high throughput sequencing technologies, this information is not available for every microorganism and rarely available for entire microbial communities. Nevertheless, the protein-level homology that exists between related bacteria makes it possible to extract biological information from the proteome of an organism or microbial community by using the genomic sequences of a near neighbor organism. Here, we demonstrate a trans-organism search strategy for determining the extent to which near-neighbor genome sequences can be applied to identify proteins in unsequenced environmental isolates. In proof of concept testing, we found that within a CLUSTAL W distance of 0.089, near-neighbor genomes successfully identified a high percentage of proteins within an organism. Application of this strategy to characterize environmental bacterial isolates lacking sequenced genomes, but having 16S rDNA sequence similarity to Shewanella resulted in the identification of 300-500 proteins in each strain. The majority of identified pathways mapped to core processes, as well as to processes unique to the Shewanellae, in particular to the presence of c-type cytochromes. Examples of core functional categories include energy metabolism, protein and nucleotide synthesis and cofactor biosynthesis, allowing classification of bacteria by observation of conserved processes. Additionally, within these core functionalities, we observed proteins involved in the alternative lactate utilization pathway, recently described in Shewanella.

  14. Multifactorial Competition and Resistance in a Two-Species Bacterial System

    PubMed Central

    Khare, Anupama; Tavazoie, Saeed

    2015-01-01

    Microorganisms exist almost exclusively in interactive multispecies communities, but genetic determinants of the fitness of interacting bacteria, and accessible adaptive pathways, remain uncharacterized. Here, using a two-species system, we studied the antagonism of Pseudomonas aeruginosa against Escherichia coli. Our unbiased genome-scale approach enabled us to identify multiple factors that explained the entire antagonism observed. We discovered both forms of ecological competition–sequestration of iron led to exploitative competition, while phenazine exposure engendered interference competition. We used laboratory evolution to discover adaptive evolutionary trajectories in our system. In the presence of P. aeruginosa toxins, E. coli populations showed parallel molecular evolution and adaptive convergence at the gene-level. The multiple resistance pathways discovered provide novel insights into mechanisms of toxin entry and activity. Our study reveals the molecular complexity of a simple two-species interaction, an important first-step in the application of systems biology to detailed molecular dissection of interactions within native microbiomes. PMID:26647077

  15. Biodegradation of free cyanide by bacterial species isolated from cyanide-contaminated artisanal gold mining catchment area in Burkina Faso.

    PubMed

    Razanamahandry, Lovasoa Christine; Andrianisa, Harinaivo Anderson; Karoui, Hela; Kouakou, Koffi Marcelin; Yacouba, Hamma

    2016-08-01

    Soil and water samples were collected from a watershed in Burkina Faso where illegal artisanal gold extraction using cyanidation occurs. The samples were used to evaluate cyanide contamination and the presence of cyanide degrading bacteria (CDB). Free cyanide (F-CN) was detected in all samples, with concentrations varying from 0.023 to 0.9 mg kg(-1), and 0.7-23 μg L(-1) in the soil and water samples, respectively. Potential CDB also were present in the samples. To test the effective F-CN degradation capacity of the isolated CDB species, the species were cultivated in growth media containing 40, 60 or 80 mg F-CN L(-1), with or without nutrients, at pH 9.5 and at room temperature. More than 95% of F-CN was degraded within 25 h, and F-CN degradation was associated with bacterial growth and ammonium production. However, initial concentrations of F-CN higher than 100 mg L(-1) inhibited bacterial growth and cyanide degradation. Abiotic tests showed that less than 3% of F-CN was removed by volatilization. Thus, the degradation of F-CN occurred predominately by biological mechanisms, and such mechanisms are recommended for remediation of contaminated soil and water. The bacteria consortium used in the experiment described above exist in a Sahelian climate, which is characterized by a long hot and dry season. Because the bacteria are already adapted to the local climate conditions and show the potential for cyanide biodegradation, further applicability to other contaminated areas in West Africa, where illegal gold cyanidation is widespread, should be explored.

  16. Comparison of mammalian mitochondrial ribosomal ribonucleic acid from different species.

    PubMed

    Mitra, R S; Bartoov, B; Monahan, J; Freeman, K B

    1972-08-01

    Mitochondrial ribosomal RNA species from mouse L cells, rat liver, rat hepatoma, hamster BHK-21 cells and human KB cells were examined by electrophoresis on polyacrylamide-agarose gels and sedimentation in sucrose density gradients. The S(E) (electrophoretic mobility) and S values of mitochondrial rRNA of all species were highly dependent on temperature and ionic strength of the medium; the S(E) values increased and the S values decreased with an increase in temperature at a low ionic strength. At an ionic strength of 0.3 at 23-25 degrees C or an ionic strength of 0.01 at 3-4 degrees C the S and S(E) values were almost the same being about 16.2-18.0 and 12.3-13.6 for human and mouse mitochondrial rRNA. The molecular weights under these conditions were calculated to be 3.8x10(5)-4.3x10(5) and 5.9x10(5)-6.8x10(5), depending on the technique used. At 25 degrees C in buffers of low ionic strength mouse mitochondrial rRNA species had a lower electrophoretic mobility than those of human and hamster. Under these conditions the smaller mitochondrial rRNA species of hamster had a lower electrophoretic mobility than that of human but the larger component had an identical mobility. Mouse and rat mitochondrial rRNA species had identical electrophoretic mobilities. Complex differences between human and mouse mitochondrial rRNA species were observed on sedimentation in sucrose density gradients under various conditions of temperature and ionic strength. Mouse L-cell mitochondrial rRNA was eluted after cytoplasmic rRNA on a column of methylated albumin-kieselguhr.

  17. Characterization of a Single Magnetotactic Bacterial Species from Devil's Bathtub, Mendon Ponds Park, Honeoye Falls, NY

    NASA Astrophysics Data System (ADS)

    Wagner, C.; Tarduno, J. A.; Stein, A.; Sia, E.

    2015-12-01

    Magnetotactic bacteria (MTB) belong to a lineage of prokaryotic bacteria that synthesize magnetosomes, single domain magnetic particles (typically magnetite or greigite) with an average size of 50 nanometers. MTB utilize magnetosomes through magnetotaxis, the alignment and movement along magnetic field lines to navigate towards preferred environmental conditions. MTB are sensitive to different environments and are thought to exhibit varying magnetosome morphologies, compositions, sizes, and quantities in regards to the environments which they inhabit. These characteristics allow MTB and magnetofossils (preserved magnetosomes) to be used as modern/paleoenvironmental recorders and biomarkers for environmental change(s). Devil's Bathtub (Mendon Ponds Park, Honeoye Falls, NY) is a meromictic glacial kettle pond surrounded by deciduous tree cover. Here we examine one species of MTB based on prominence of this particular morphology at this locale. Magnetotaxis and morphology of this species have been observed using light microscopy. Micrographs have also been taken using Transmission Electron Microscopy (TEM) to verify cell morphology and to determine magnetosome morphology. TEM and magnetic hysteresis measurements were done to find and test the composition of magnetosomes. In this study we also focus on DNA sequencing and characterization of this MTB, as there are few MTB species which have been DNA sequenced successfully. Data from these experiments are directly applicable to this up-and-coming area of research as it will aid in the understanding and correlation of magnetosome and magnetofossils with environmental characteristics.

  18. Diversity of bacterial species in the nasal cavity of sheep in the highlands of Ethiopia and first report of Histophilus somni in the country.

    PubMed

    Tesfaye, Biruk; Sisay Tessema, Tesfaye; Tefera, Genene

    2013-06-01

    A study was conducted to isolate bacterial species/pathogens from the nasal cavity of apparently healthy and pneumonic sheep. Nasal swabs were collected aseptically, transported in tryptose soya broth and incubated for 24 h. Then, each swab was streaked onto chocolate and blood agar for culture. Bacterial species were identified following standard bacteriological procedures. Accordingly, a total of 1,556 bacteria were isolated from 960 nasal swabs collected from three different highland areas of Ethiopia, namely Debre Berhan, Asella, and Gimba. In Debre Berhan, 140 Mannheimia haemolytica, 81 Histophilus somni, 57 Staphylococcus species, and 52 Bibersteinia trehalosi were isolated. While from Gimba M. haemolytica, Staphylococcus, Streptococcus, and H. somni were isolated at rates of 25.2, 15.9, 11.4, and 5.9 %, respectively, of the total 647 bacterial species. In Asella from 352 bacterial species isolated, 93 (26.4 %) were M. haemolytica, 48 (13.6 %) were Staphylococcus species, 26 (7.4 %) were B. trehalosi, and 17 (4.8 %) H. somni were recognized. Further identification and characterization using BIOLOG identification system Enterococcus avium and Sphingomonas sanguinis were identified at 100 % probability, while, H. somni and Actinobacillus lignerisii were suggested by the system. The study showed that a variety of bacterial species colonize the nasal cavity of the Ethiopian highland sheep with variable proportion between healthy and pneumonic ones. To our knowledge, this is the first report on isolation of H. somni, an important pathogen in cattle, from the respiratory tract of a ruminant species in the country.

  19. [Effect of polymer complexons based on vinylpyrrolidone copolymers with vinyliminodiacetic acid and methacrtloylacetone on the antibiotic sensitivity of antibiotic-resistant bacterial strains].

    PubMed

    Afinogenov, G E; Panarin, E F; Kopeĭkin, V V

    1978-05-01

    Polymer complexons, such as copolymers of vinylpyrrolidone with vinyliminodiacetic acid and metacryloilacetone changed the permeability of the bacterial cell wall due to chelating of the metalic ions contained in the cell wall. An increase in the bacterial sensitivity to chloretracycline, methicillin, ampicillin and methicillin was observed in the presence of the above complexons.

  20. Antioxidant and Antimicrobial Potential, and HPLC Analysis of Stictic and Usnic Acids of Three Usnea Species from Uludag Mountain (Bursa, Turkey)

    PubMed Central

    Oran, Seyhan; Sahin, Saliha; Sahinturk, Pinar; Ozturk, Sule; Demir, Cevdet

    2016-01-01

    In this study, antioxidant and antimicrobial potentials of Usnea intermedia, U. filipendula, and U. fulvoreagens and their stictic and usnic acid contents were investigated. Antioxidant activity and total phenolic contents were evaluated in acetone, ethanol, and methanol extracts of these three species. Antioxidant activity was measured by ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] method and total phenolic contents were measured by Folin-Ciocalteu method. High-performance liquid chromatography (HPLC) was used for the determination of lichen acids. It can be concluded from stictic and usnic acids contents that the order of solvent efficiency is acetone > ethanol > methanol and acetone > methanol > ethanol, respectively. Broth microdilution method was performed to determine the minimum inhibitory concentration (MIC) of the methanol extracts of three Usnea species. The MIC values of all the extracts ranged from 64 µg/mL to 512 µg/mL for all the bacterial strains that were tested in this study, and all the Fluoro quinolone-resistant Escherichia coli isolates (except for E101) were sensitive to the methanol extracts of the three Usnea species. This paper is the first study to determine the stictic acid content in U. intermedia and U. filipendula. Our findings indicate that these three Usnea species could be used as antioxidant and antimicrobial agents. PMID:27642324

  1. Effect of temperature on bacterial species diversity in thermophilic solid-waste composting.

    PubMed Central

    Strom, P F

    1985-01-01

    Continuously thermophilic composting was examined with a 4.5-liter reactor placed in an incubator maintained at representative temperatures. Feed was a mixture of dried table scraps and shredded newspaper wetted to 55% moisture. One run at 49 degrees C (run A) employed a 1:4 feed-to-compost ratio, while the other runs used a 10:1 ratio and were incubated at 50, 55, 60, or 65 degrees C. Due to self-heating, internal temperatures of the composting mass were 0 to 7 degrees C hotter than the incubator. Two full-scale composting plants (at Altoona, Pa., and Leicester, England) were also examined. Plate counts per gram (dry weight) on Trypticase soy broth (BBL Microbiology Systems) with 2% agar ranged from 0.7 X 10(9) to 5.3 X 10(9) for laboratory composting and 0.02 X 10(9) to 7.4 X 10(9) for field composting. Fifteen taxa were isolated, including 10 of genus Bacillus, which dominated all samples except that from run A. Species diversity decreased markedly in laboratory composting at 60 degrees C and above, but was similar for the three runs incubated at 49, 50, and 55 degrees C. The maximum desirable composting temperature based on species diversity is thus 60 degrees C, the same as that previously recommended based on measures of the rate of decomposition. PMID:4083885

  2. Cellular fatty acid compositions and isoprenoid quinone contents of 23 Legionella species.

    PubMed Central

    Lambert, M A; Moss, C W

    1989-01-01

    The cellular fatty acid compositions and ubiquinone contents of 182 Legionella strains representing 23 species were determined by capillary gas-liquid chromatography and reverse-phase high-performance liquid chromatography, respectively. Except for the type strain of Legionella erythra (ATCC 35303T), all Legionella species contained large (40 to 90%) amounts of branched-chain fatty acids and only trace to small (less than 0.5 to 5%) amounts of ester-linked hydroxy acids. The 23 species were placed in three major fatty acid groups on the basis of differences in the relative amounts of 14-methylpentadecanoic (Ci16:0), hexadecanoic (C16:1), and 12-methyltetradecanoic (Ca15:0) acids. All Legionella species contained ubiquinones with 9 to 14 isoprene units in the side chains and were divided into five different ubiquinone groups. The species were further differentiated into 16 groups on the basis of qualitative and quantitative differences in their fatty acid compositions and ubiquinone contents. Both of these chemical characteristics can be used to distinguish Legionella species from other gram-negative bacteria and rapidly and accurately identify suspected isolates before serologic and other tests are done. PMID:2715320

  3. An ultrathin poly(L-lactic acid) nanosheet as a burn wound dressing for protection against bacterial infection.

    PubMed

    Miyazaki, Hiromi; Kinoshita, Manabu; Saito, Akihiro; Fujie, Toshinori; Kabata, Koki; Hara, Etsuko; Ono, Satoshi; Takeoka, Shinji; Saitoh, Daizoh

    2012-01-01

    Burn wounds are highly susceptible to bacterial infection due to impairment of the skin's integrity. Therefore, prevention of bacterial colonization/infection in the wound is crucial for the management of burns, including partial-thickness burn injuries. Although partial-thickness burn injuries still retain the potential for reepithelialization, the complication of wound infection severely impairs the reepithelialization even in such superficial burn injuries. We recently developed a biocompatible nanosheet consisting of poly(L-lactic acid) (PLLA). The PLLA nanosheets have many useful and advantageous biological properties for their application as a wound dressing, such as sufficient flexibility, transparency, and adhesiveness. We herein investigated the suitability of the PLLA nanosheets as a wound dressing for partial-thickness burn wounds in mice. The PLLA nanosheets tightly adhered to the wound without any adhesive agents. Although wound infection with Pseudomonas aeruginosa in the controls significantly impaired reepithelialization of burn wounds, dressing with the PLLA nanosheet markedly protected against bacterial wound infection, thereby improving wound healing in the mice receiving partial-thickness burn injuries. The PLLA nanosheet also showed a potent barrier ability for protecting against bacterial penetration in vitro. The ultrathin PLLA nanosheet may be applied as a protective dressing to reduce environmental contamination of bacteria in a partial-thickness burn wound.

  4. Determination of flavonoids, tannins and ellagic acid in leaves from Rubus L. species.

    PubMed

    Gudej, Jan; Tomczyk, Michal

    2004-11-01

    This paper describes the quantitative determination of flavonoids, tannins and ellagic acid in the leaves from wild and cultivated variations of Rubus L. species (Rosaceae): raspberry (2 wild and 13 cultivars) and blackberry (3 wild and 3 cultivars). The content of flavonoids was analyzed using spectrophotometric (the Christ-Mullers method) and HPLC analysis after acid hydrolysis. The content of tannins was determined by the weight method, with hide powder, described by German Pharmacopoeia 10 (DAB 10). Ellagic acid content was examined using the HPLC method after acid hydrolysis. Flavonoid content, determined using the Christ-Muller's method was higher for the blackberry leaves than for the raspberry leaves and varied between 0.46% and 1.05%. Quercetin and kaempferol were predominant in all samples analyzed using the HPLC method. The highest flavonoid content was found in the leaves of R. nessensis (1.06%); with results in all of the examined samples varying between 0.27% and 1.06%. The concentration of ellagic acid in all species was determined after acid hydrolysis and ranged from 2.06% to 6.89%. The leaves of raspberries are characterized by greater amounts of tannins (varying between 2.62% and 6.87%) than the leaves of other species. The results from this study indicate that the analyzed species are a rich source of flavonoids, ellagic acid and tannins, which may be used for the quality assessment of Rubus L. species leaves.

  5. Effect of growth phase on the fatty acid compositions of four species of marine diatoms

    NASA Astrophysics Data System (ADS)

    Liang, Ying; Mai, Kangsen

    2005-04-01

    The fatty acid compositions of four species of marine diatoms ( Chaetoceros gracilis MACC/B13, Cylindrotheca fusiformis MACC/B211, Phaeodactylum tricornutum MACC/B221 and Nitzschia closterium MACC/B222), cultivated at 22°C±1°C with the salinity of 28 in f/2 medium and harvested in the exponential growth phase, the early stationary phase and the late stationary phase, were determined. The results showed that growth phase has significant effect on most fatty acid contents in the four species of marine diatoms. The proportions of 16:0 and 16:1n-7 fatty acids increased while those of 16:3n-4 and eicosapentaenoic acid (EPA) decreased with increasing culture age in all species studied. The subtotal of saturated fatty acids (SFA) increased with the increasing culture age in all species with the exception of B13. The subtotal of monounsaturated fatty acids (MUFA) increased while that of polyunsaturated fatty acids (PUFA) decreased with culture age in the four species of marine diatoms. MUFA reached their lowest value in the exponential growth phase, whereas PUFA reached their highest value in the same phase.

  6. Organic acids and selected nitrogen species for ABLE-3

    NASA Technical Reports Server (NTRS)

    Talbot, Robert W.

    1991-01-01

    The NASA Global Tropospheric Experiment (GTE) executed airborne science missions aboard the NASA Wallops Electra (NA429) in the North American high latitude (greater than 45 deg North) atmosphere during Jul. to Aug. 1988 and Jul. to Aug. 1990. These missions were part of GTE's Atmospheric Boundary Layer Experiment (ABLE). The 1988 mission , ABLE-3A, examined the ecosystems of Alaska as a source and/or sink for important tropospheric gases and particles, and gained new information on the chemical composition of the Arctic atmosphere during the summertime. During 1990 the second high latitude mission, ABLE-3B, focused on the Hudson Bay Lowland and Labrador regions of Canada. Both of these missions provided benchmark data sets on atmosphere biosphere exchange and atmospheric chemistry over largely uninhabited regions of North America. In support of the GTE/ABLE-3A and -3B field missions, the University of New Hampshire flew instrumentation aboard the Wallops Electra research aircraft to provide measurements of the trace gases nitric (HNO3), formic (HCOOH), and acetic (CH3COOH) acid. In addition, measurements were conducted to determine the major water soluble ionic composition of the atmospheric aerosol. For ABLE-3B, groundbased measurements of the acidic trace gases were also performed from the NASA micrometerological tower situated at Schefferville, Laborador. These measurements were aimed at assessing dry deposition of acidic gases to the taiga ecosystem in the Laborador region of Canada.

  7. PCR-dipstick DNA chromatography for profiling of a subgroup of caries-associated bacterial species in plaque from healthy coronal surfaces and periodontal pockets.

    PubMed

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Mayanagi, Gen; Washio, Jumpei; Takahashi, Nobuhiro

    2016-01-01

    The onset of plaque-mediated disease, including dental caries and periodontal diseases, is highly associated with compositional change of the resident microflora from the ecological perspective. As specific bacterial profiles have been linked to different disease stages, microbial compositional measurements might therefore have great value for clinical diagnosis. Previously we have reported a dry-reagent strip biosensor-PCR-dipstick DNA chromatography, which utilized molecular recognition of oligonucleotides and biotin-streptavidin, and the optical property of colored microspheres, for semiquantifying a five-membered subgroup of caries-associated bacterial species in supragingival plaque from healthy coronal surfaces of teeth. The present study aimed to evaluate this technique's ability to differentiate microflora by comparing the subset profiles. Sixteen subgingival plaque specimens were pooled from periodontal pockets and analyzed for the composition of Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces sp. and Veillonella parvula. Detection frequencies, relative abundance of each bacterial species, and the five-membered bacterial profiles were compared between supra- and subgingival groups. The supragingival plaque harbored significantly more of the tested species and higher amount of Actinomyces sp. and V. parvula. In subgingival plaque, the predominance was obscured, since several highly overlapped profiles were found at comparable frequencies. Thus, PCR-dipstick DNA chromatography using the same plaque sample enabled simultaneous profiling of multiple species at species level and facilitated discrimination between anticipated different microflora, making this technique a promising chair-side microbiota profiling method.

  8. Parallel Mutations Result in a Wide Range of Cooperation and Community Consequences in a Two-Species Bacterial Consortium.

    PubMed

    Douglas, Sarah M; Chubiz, Lon M; Harcombe, William R; Ytreberg, F Marty; Marx, Christopher J

    2016-01-01

    Multi-species microbial communities play a critical role in human health, industry, and waste remediation. Recently, the evolution of synthetic consortia in the laboratory has enabled adaptation to be addressed in the context of interacting species. Using an engineered bacterial consortium, we repeatedly evolved cooperative genotypes and examined both the predictability of evolution and the phenotypes that determine community dynamics. Eight Salmonella enterica serovar Typhimurium strains evolved methionine excretion sufficient to support growth of an Escherichia coli methionine auxotroph, from whom they required excreted growth substrates. Non-synonymous mutations in metA, encoding homoserine trans-succinylase (HTS), were detected in each evolved S. enterica methionine cooperator and were shown to be necessary for cooperative consortia growth. Molecular modeling was used to predict that most of the non-synonymous mutations slightly increase the binding affinity for HTS homodimer formation. Despite this genetic parallelism and trend of increasing protein binding stability, these metA alleles gave rise to a wide range of phenotypic diversity in terms of individual versus group benefit. The cooperators with the highest methionine excretion permitted nearly two-fold faster consortia growth and supported the highest fraction of E. coli, yet also had the slowest individual growth rates compared to less cooperative strains. Thus, although the genetic basis of adaptation was quite similar across independent origins of cooperative phenotypes, quantitative measurements of metabolite production were required to predict either the individual-level growth consequences or how these propagate to community-level behavior.

  9. Parallel Mutations Result in a Wide Range of Cooperation and Community Consequences in a Two-Species Bacterial Consortium

    PubMed Central

    Douglas, Sarah M.; Chubiz, Lon M.; Harcombe, William R.; Ytreberg, F. Marty; Marx, Christopher J.

    2016-01-01

    Multi-species microbial communities play a critical role in human health, industry, and waste remediation. Recently, the evolution of synthetic consortia in the laboratory has enabled adaptation to be addressed in the context of interacting species. Using an engineered bacterial consortium, we repeatedly evolved cooperative genotypes and examined both the predictability of evolution and the phenotypes that determine community dynamics. Eight Salmonella enterica serovar Typhimurium strains evolved methionine excretion sufficient to support growth of an Escherichia coli methionine auxotroph, from whom they required excreted growth substrates. Non-synonymous mutations in metA, encoding homoserine trans-succinylase (HTS), were detected in each evolved S. enterica methionine cooperator and were shown to be necessary for cooperative consortia growth. Molecular modeling was used to predict that most of the non-synonymous mutations slightly increase the binding affinity for HTS homodimer formation. Despite this genetic parallelism and trend of increasing protein binding stability, these metA alleles gave rise to a wide range of phenotypic diversity in terms of individual versus group benefit. The cooperators with the highest methionine excretion permitted nearly two-fold faster consortia growth and supported the highest fraction of E. coli, yet also had the slowest individual growth rates compared to less cooperative strains. Thus, although the genetic basis of adaptation was quite similar across independent origins of cooperative phenotypes, quantitative measurements of metabolite production were required to predict either the individual-level growth consequences or how these propagate to community-level behavior. PMID:27617746

  10. Antarctic bacterial haemoglobin and its role in the protection against nitrogen reactive species.

    PubMed

    Coppola, Daniela; Giordano, Daniela; Tinajero-Trejo, Mariana; di Prisco, Guido; Ascenzi, Paolo; Poole, Robert K; Verde, Cinzia

    2013-09-01

    In a cold and oxygen-rich environment such as Antarctica, mechanisms for the defence against reactive oxygen and nitrogen species are needed and represent important components in the evolutionary adaptations. In the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125, the presence of multiple genes encoding 2/2 haemoglobins and a flavohaemoglobin strongly suggests that these proteins fulfil important physiological roles, perhaps associated to the peculiar features of the Antarctic habitat. In this work, the putative role of Ph-2/2HbO, encoded by the PSHAa0030 gene, was investigated by in vivo and in vitro experiments in order to highlight its involvement in NO detoxification mechanisms. The PSHAa0030 gene was cloned and then over-expressed in a flavohaemoglobin-deficient mutant of Escherichia coli, unable to metabolise NO, and the resulting strain was studied analysing its growth properties and oxygen uptake in the presence of NO. We here demonstrate that Ph-2/2HbO protects growth and cellular respiration of the heterologous host from the toxic effect of NO-donors. Unlike in Mycobacterium tuberculosis 2/2 HbN, the deletion of the N-terminal extension of Ph-2/2HbO does not seem to reduce the NO scavenging activity, showing that the N-terminal extension is not a requirement for efficient NO detoxification. Moreover, the ferric form of Ph-2/2HbO was shown to catalyse peroxynitrite isomerisation in vitro, confirming its potential role in the scavenging of reactive nitrogen species. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins.

  11. Disinfection efficiency of peracetic acid (PAA): inactivation of coliphages and bacterial indicators in a municipal wastewater plant.

    PubMed

    Zanetti, F; De Luca, G; Sacchetti, R; Stampi, S

    2007-11-01

    The aim of the study was to assess the efficiency of low doses of peracetic acid against viral and bacterial indicators in wastewater and to evaluate if the treatment allows regulatory requirements to be satisfied. A total of 31 samplings were carried out, each involving the collection of secondary effluent and of effluent disinfected with 1.2 or 1.5 mg l(-1) of peracetic acid (contact time 20 minutes). In each sample were measured: somatic coliphages, F-specific RNA bacteriophages, Escherichia coli, total and faecal coliforms, enterococci. Peracetic acid disinfection showed significant differences between the reductions of the microorganisms tested: E. coli showed the highest reduction (1.78 and 2.43 Log respectively with 1.2 and 1.5 mg l(-1) of peracetic acid) and phages the lowest (ranging between 0.52 and 0.60 Log). Only a concentration of 1.5 mg l(-1) of peracetic acid would enable the effluent to be discharged into surface waters in compliance with Italian regulations. The variability of microbial resistance against the peracetic acid disinfection treatment, underlines the importance of assessing disinfection efficiency by using more than one indicator microorganism. The detection of E. coli could be usefully accompanied by tests for more resistant microorganisms such as enterococci or coliphages. In conclusion, peracetic acid can be used for the disinfection of effluents even at low doses, with the advantage of reducing costs and preventing the formation of significant amounts of genotoxic by-products.

  12. Bacterial Formation of As(V) and As(III) Ferric Oxyhydroxides in Acid Mine Drainage.

    NASA Astrophysics Data System (ADS)

    Morin, G.; Juillot, F.; Lebrun, S.; Casiot, C.; Elbaz-Poulichet, F.; Bruneel, O.; Personne, J.; Leblanc, M.; Ildefonse, P.; Calas, G.

    2002-12-01

    The oxidation of dissolved Fe(II) which is often promoted by acidophilic bacteria in acid mine drainage (AMD) and some hot springs, leads to the precipitation of Fe(III) oxy-hydroxides which incorporate toxic elements within their structure or adsorb them at their surface, thus limiting their mobility. In such complex natural systems, synchrotron-based techniques as X-ray absorption spectroscopy offer the opportunity to monitor surface/solution interactions as well as redox changes affecting the mobility and toxicity of trace elements as arsenic. Spatial and seasonal variations of the (bio-) oxidation of Fe(II) and As(III), and the subsequent precipitation of As-Fe gels, were followed by XANES, XRD, and SEM along the CarnoulŠs AMD (Gard, France). Chemical and mineralogical data collected on sediments, stromatolite, and bioassay samples showed that some indigenous bacteria living in the As-rich CarnoulŠs water ([As] = up to 350 mg.l-1) play an important role in the nature and composition of the solid phases that sequester arsenic at the site. The formation of nano-crystalline and amorphous As(III) ferric oxy-hydroxides has been related to the presence of bacteria able to oxidize Fe(II) but not As(III), which are only present in winter in the upstream area. A rare ferric arsenite sulfate oxy-hydroxide mineral was discovered in this context. Other types of bacteria, occurring in the downstream area whatever the season, are able to catalyze As(III) to As(V) oxidation and, provided that enough Fe(II) oxidizes, promote the formation of amorphous As(V) rich ferric oxy-hydroxides. These bacterially mediated reactions significantly reduce the concentration of dissolved As(III), which is more toxic and mobile than As(V), and might thus be helpful for designing As-removal processes. This work was supported by the French PEVS and ACI Ecologie Quantitative Programs and the PIRAMID EC program. ?Deceased, 26 October 1999 Juillot F., Ildefonse Ph., Morin G., Calas G., De

  13. Native Bacterial Endophytes Promote Host Growth in a Species-Specific Manner; Phytohormone Manipulations Do Not Result in Common Growth Responses

    PubMed Central

    Long, Hoang Hoa; Schmidt, Dominik D.; Baldwin, Ian T.

    2008-01-01

    Background All plants in nature harbor a diverse community of endophytic bacteria which can positively affect host plant growth. Changes in plant growth frequently reflect alterations in phytohormone homoeostasis by plant-growth-promoting (PGP) rhizobacteria which can decrease ethylene (ET) levels enzymatically by 1-aminocyclopropane-1-carboxylate (ACC) deaminase or produce indole acetic acid (IAA). Whether these common PGP mechanisms work similarly for different plant species has not been rigorously tested. Methodology/ Principal Findings We isolated bacterial endophytes from field-grown Solanum nigrum; characterized PGP traits (ACC deaminase activity, IAA production, phosphate solubilization and seedling colonization); and determined their effects on their host, S. nigrum, as well as on another Solanaceous native plant, Nicotiana attenuata. In S. nigrum, a majority of isolates that promoted root growth were associated with ACC deaminase activity and IAA production. However, in N. attenuata, IAA but not ACC deaminase activity was associated with root growth. Inoculating N. attenuata and S. nigrum with known PGP bacteria from a culture collection (DSMZ) reinforced the conclusion that the PGP effects are not highly conserved. Conclusions/ Significance We conclude that natural endophytic bacteria with PGP traits do not have general and predictable effects on the growth and fitness of all host plants, although the underlying mechanisms are conserved. PMID:18628963

  14. Impact of arachidonic acid enrichment of live rotifer prey on bacterial communities in rotifer and larval fish cultures.

    PubMed

    Seychelles, Laurent H; Doiron, Kim; Audet, Céline; Tremblay, Réjean; Pernet, Fabrice; Lemarchand, Karine

    2013-03-01

    Rotifers (Brachionus plicatilis), commonly used at first feeding in commercial fish hatcheries, carry a large bacteria load. Because they are relatively poor in essential fatty acids, it is common practice to enrich them with fatty acids, including arachidonic acid (AA). This study aims to determine whether prey enrichment with AA may act as a prebiotic and modify the microbial community composition either in AA-enriched rotifer cultures or in larval-rearing water using winter flounder (Pseudopleuronectes americanus) as a larval fish model. AA enrichment modified the bacterial community composition in both the rotifer culture tanks and the larval-rearing tanks. We observed an increase in the number of cultivable bacteria on TCBS (thiosulfate-citrate-bile salts-sucrose) agar, used as a proxy for the abundance of Vibrio sp. The results suggest that AA may also play an indirect role in larval health.

  15. Biotechnological production of caffeic acid derivatives from cell and organ cultures of Echinacea species.

    PubMed

    Murthy, Hosakatte Niranjana; Kim, Yun-Soo; Park, So-Young; Paek, Kee-Yoeup

    2014-09-01

    Caffeic acid derivatives (CADs) are a group of bioactive compounds which are produced in Echinacea species especially Echinacea purpurea, Echinacea angustifolia, and Echinacea pallida. Echinacea is a popular herbal medicine used in the treatment of common cold and it is also a prominent dietary supplement used throughout the world. Caffeic acid, chlorogenic acid (5-O-caffeoylquinic acid), caftaric acid (2-O-caffeoyltartaric acid), cichoric acid (2, 3-O-dicaffeoyltartaric acid), cynarin, and echinacoside are some of the important CADs which have varied pharmacological activities. The concentrations of these bioactive compounds are species specific and also they vary considerably with the cultivated Echinacea species due to geographical location, stage of development, time of harvest, and growth conditions. Due to these reasons, plant cell and organ cultures have become attractive alternative for the production of biomass and caffeic acid derivatives. Adventitious and hairy roots have been induced in E. pupurea and E. angustifolia, and suspension cultures have been established from flask to bioreactor scale for the production of biomass and CADs. Tremendous progress has been made in this area; various bioprocess methods and strategies have been developed for constant high-quality productivity of biomass and secondary products. This review is aimed to discuss biotechnological methods and approaches employed for the sustainable production of CADs.

  16. Acetylation of bacterial cellulose catalyzed by citric acid: Use of reaction conditions for tailoring the esterification extent.

    PubMed

    Ávila Ramírez, Jhon Alejandro; Gómez Hoyos, Catalina; Arroyo, Silvana; Cerrutti, Patricia; Foresti, María Laura

    2016-11-20

    Bacterial cellulose (BC) nanoribbons were partially acetylated by a simple direct solvent-free route catalyzed by citric acid. The assay of reaction conditions within chosen intervals (i.e. esterification time (0.5-7h), catalyst content (0.08-1.01mmol/mmol AGU), and temperature (90-140°C)), illustrated the flexibility of the methodology proposed, with reaction variables which can be conveniently manipulated to acetylate BC to the required degree of substitution (DS) within the 0.20-0.73 interval. Within this DS interval, characterization results indicated a surface-only process in which acetylated bacterial cellulose with tunable DS, preserved fibrous structure and increased hydrophobicity could be easily obtained. The feasibility of reusing the catalyst/excess acylant in view of potential scale-up was also illustrated.

  17. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    PubMed Central

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-01-01

    While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution. PMID:26527268

  18. Iron transformations induced by an acid-tolerant Desulfosporosinus species.

    PubMed

    Bertel, Doug; Peck, John; Quick, Thomas J; Senko, John M

    2012-01-01

    The mineralogical transformations of Fe phases induced by an acid-tolerant, Fe(III)- and sulfate-reducing bacterium, Desulfosporosinus sp. strain GBSRB4.2 were evaluated under geochemical conditions associated with acid mine drainage-impacted systems (i.e., low pH and high Fe concentrations). X-ray powder diffractometry coupled with magnetic analysis by first-order reversal curve diagrams were used to evaluate mineral phases produced by GBSRB4.2 in media containing different ratios of Fe(II) and Fe(III). In medium containing Fe predominately in the +II oxidation state, ferrimagnetic, single-domain greigite (Fe₃S₄) was formed, but the addition of Fe(III) inhibited greigite formation. In media that contained abundant Fe(III) [as schwertmannite; Fe₈O₈(OH)₆SO₄ · nH₂O], the activities of strain GBSRB4.2 enhanced the transformation of schwertmannite to goethite (α-FeOOH), due to the increased pH and Fe(II) concentrations that resulted from the activities of GBSRB4.2.

  19. Iron Transformations Induced by an Acid-Tolerant Desulfosporosinus Species

    PubMed Central

    Bertel, Doug; Peck, John; Quick, Thomas J.

    2012-01-01

    The mineralogical transformations of Fe phases induced by an acid-tolerant, Fe(III)- and sulfate-reducing bacterium, Desulfosporosinus sp. strain GBSRB4.2 were evaluated under geochemical conditions associated with acid mine drainage-impacted systems (i.e., low pH and high Fe concentrations). X-ray powder diffractometry coupled with magnetic analysis by first-order reversal curve diagrams were used to evaluate mineral phases produced by GBSRB4.2 in media containing different ratios of Fe(II) and Fe(III). In medium containing Fe predominately in the +II oxidation state, ferrimagnetic, single-domain greigite (Fe3S4) was formed, but the addition of Fe(III) inhibited greigite formation. In media that contained abundant Fe(III) [as schwertmannite; Fe8O8(OH)6SO4 · nH2O], the activities of strain GBSRB4.2 enhanced the transformation of schwertmannite to goethite (α-FeOOH), due to the increased pH and Fe(II) concentrations that resulted from the activities of GBSRB4.2. PMID:22038606

  20. Identification of Circular RNAs in Kiwifruit and Their Species-Specific Response to Bacterial Canker Pathogen Invasion

    PubMed Central

    Wang, Zupeng; Liu, Yifei; Li, Dawei; Li, Li; Zhang, Qiong; Wang, Shuaibin; Huang, Hongwen

    2017-01-01

    Research studies have recently focused on circle RNAs (circRNAs) in relation to their regulatory functions in animals. However, the systematic identification of circRNAs in plants, especially non-model plants, is limited. In addition, raw report on the prediction of the potential role of circRNAs in plant response to pathogen invasion is currently available. We conducted the systematic identification of circRNAs from four materials originating from three species belonging to genus Actinidia under different situations using ribosomal RNA (rRNA) depleted RNA-Seq data. A total of 3,582 circRNAs were identified in Actinidia, of which 64.01, 21.44, and 14.55% were intergenic circRNAs, exonic circRNAs, and intronic circRNAs, respectively. Tissue-specific expression of circRNAs was observed in kiwifruit, and a species-specific response was detected when infected with Pseudomonas syringae pv. actinidiae (Psa), which is the causative agent of kiwifruit bacterial canker disease. Furthermore, we found that both exonic and intronic circRNAs were significantly positively correlated to parent protein-coding genes, and intronic circRNAs are a class of highly remarkable regulators the parent genes comparing to that of exonic circRNAs. Expression and weighted gene co-expression network analysis (WGCNA) identified a set of circRNAs that were closely associated with plant defense response. The findings of the presents study suggest that circRNAs exhibit tissue- and species-specific expression, as well as play an important role in plant immune response.

  1. Bacterial metabolites from intra- and inter-species influencing thermotolerance: the case of Bacillus cereus and Geobacillus stearothermophilus.

    PubMed

    Gómez-Govea, Mayra Alejandra; García, Santos; Heredia, Norma

    2016-11-28

    Bacterial metabolites with communicative functions could provide protection against stress conditions to members of the same species. Yet, information remains limited about protection provided by metabolites in Bacillus cereus and inter-species. This study investigated the effect of extracellular compounds derived from heat shocked (HS) and non-HS cultures of B. cereus and Geobacillus stearothermophilus on the thermotolerance of non-HS vegetative and sporulating B. cereus. Cultures of B. cereus and G. stearothermophilus were subjected to HS (42 or 65 °C respectively for 30 min) or non-HS treatments. Cells and supernatants were separated, mixed in a combined array, and then exposed to 50 °C for 60 min and viable cells determined. For spores, D values (85 and 95 °C) were evaluated after 120 h. In most cases, supernatants from HS B. cereus cultures added to non-HS B. cereus cells caused their thermotolerance to increase (D 50 12.2-51.9) when compared to supernatants from non-HS cultures (D 50 7.4-21.7). While the addition of supernatants from HS and non-HS G. stearothermophilus cultures caused the thermotolerance of non-HS cells from B. cereus to decrease initially (D 50 3.7-7.1), a subsequent increase was detected in most cases (D 50 18-97.7). In most cases, supernatants from sporulating G. stearothermophilus added to sporulating cells of B. cereus caused the thermotolerance of B. cereus 4810 spores to decline, whereas that of B. cereus 14579 increased. This study clearly shows that metabolites in supernatants from either the same or different species (such as G. stearothermophilus) influence the thermotolerance of B. cereus.

  2. An X-ray Absorption Fine Structure study of Au adsorbed onto the non-metabolizing cells of two soil bacterial species

    SciTech Connect

    Song, Zhen; Kenney, Janice P.L.; Fein, Jeremy B.; Bunker, Bruce A.

    2015-02-09

    Gram-positive and Gram-negative bacterial cells can remove Au from Au(III)-chloride solutions, and the extent of removal is strongly pH dependent. In order to determine the removal mechanisms, X-ray Absorption Fine Structure (XAFS) spectroscopy experiments were conducted on non-metabolizing biomass of Bacillus subtilis and Pseudomonas putida with fixed Au(III) concentrations over a range of bacterial concentrations and pH values. X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) data on both bacterial species indicate that more than 90% of the Au atoms on the bacterial cell walls were reduced to Au(I). In contrast to what has been observed for Au(III) interaction with metabolizing bacterial cells, no Au(0) or Au-Au nearest neighbors were observed in our experimental systems. All of the removed Au was present as adsorbed bacterial surface complexes. For both species, the XAFS data suggest that although Au-chloride-hydroxide aqueous complexes dominate the speciation of Au in solution, Au on the bacterial cell wall is characterized predominantly by binding of Au atoms to sulfhydryl functional groups and amine and/or carboxyl functional groups, and the relative importance of the sulfhydryl groups increases with increasing pH and with decreasing Au loading. The XAFS data for both microorganism species suggest that adsorption is the first step in the formation of Au nanoparticles by bacteria, and the results enhance our ability to account for the behavior of Au in bacteria-bearing geologic systems.

  3. Use of protoplasts from paired heterogenic bacterial species to detect tin contaminants: prospects for biosensor development.

    PubMed

    Mountfort, Douglas; Laczka, Olivier; Debarnot, Claire; Bonnin, Audrey; Pasco, Neil; Lloyd-Jones, Gareth

    2007-02-15

    Two different bacteria gave different respiratory responses to the test analytes, tributyl tin (TBT) and cadmium as expressed by positive sigmoid responses by Halomonas sp. (slope, +1.71 [TBT]; +1.76 [Cd]) and negative sigmoid responses by Bacillus pumilis (slope, -1.06 [TBT]; -0.59 [Cd]). The EC50 values determined from Hill plots for the response of Halomonas sp. to the TBT and Cd were 1 and 8.5 mM, respectively, which were lower by a factor of 10 than the corresponding values for B. pumilis. With protoplasts of B. pumilis there was a major shift in the signal from sigmoid negative to positive with TBT (+1.35) but not Cd (-0.5), while the signals with the remaining protoplast-analyte combinations remained unchanged. For all four protoplast-analyte combinations the EC50 values were in the order of 10-100-fold lower than those for their whole cell counterparts. When other analytes were tested the protoplasts gave a similar response to tin as for TBT, but detected copper and 2,4-dichlorophenol with similar signal profiles to Cd and with lower sensitivity. The difference in signal and higher sensitivity of the two species protoplast system towards TBT/tin compared to the other analytes tested, suggests that it may feasible to develop this approach for the detection of tin residues.

  4. Attenuated Virulence and Genomic Reductive Evolution in the Entomopathogenic Bacterial Symbiont Species, Xenorhabdus poinarii

    PubMed Central

    Ogier, Jean-Claude; Pagès, Sylvie; Bisch, Gaëlle; Chiapello, Hélène; Médigue, Claudine; Rouy, Zoé; Teyssier, Corinne; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2014-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Unlike other Xenorhabdus species, Xenorhabdus poinarii is avirulent when injected into insects in the absence of its nematode host. We sequenced the genome of the X. poinarii strain G6 and the closely related but virulent X. doucetiae strain FRM16. G6 had a smaller genome (500–700 kb smaller) than virulent Xenorhabdus strains and lacked genes encoding potential virulence factors (hemolysins, type 5 secretion systems, enzymes involved in the synthesis of secondary metabolites, and toxin–antitoxin systems). The genomes of all the X. poinarii strains analyzed here had a similar small size. We did not observe the accumulation of pseudogenes, insertion sequences or decrease in coding density usually seen as a sign of genomic erosion driven by genetic drift in host-adapted bacteria. Instead, genome reduction of X. poinarii seems to have been mediated by the excision of genomic blocks from the flexible genome, as reported for the genomes of attenuated free pathogenic bacteria and some facultative mutualistic bacteria growing exclusively within hosts. This evolutionary pathway probably reflects the adaptation of X. poinarii to specific host. PMID:24904010

  5. Survival of added bacterial species and metabolism of toxic compounds in natural environments

    SciTech Connect

    King, V.M.

    1987-01-01

    Bacteria able to degrade either 2,4-dichlorophenol (DCP) or phenanthrene (PHEN) were isolated from polluted freshwater environments. Two isolates able to degrade each compound were tested for mineralization with a sensitive /sup 14/C assay and for survival in lake water and sewage using a selective medium. One DCP isolate was identified as Alcaligenes paradoxus and the other as Alcaligenes sp. One PHEN isolate was identified as Pseudomonas fluorescens and the other as Pseudomonas sp. All four isolates survived and grew in sterile environments which indicated that starvation would not be a factor in survival of these strains. The number of organisms declined immediately in number in nonsterile lake water. However, they did survive or even grow in nonsterile sewage for a short period before declining in number. Biotic factors appeared to be influential for survival and mineralization of target compounds in many environments. The removal of protozoa, which prey on bacteria, improved survival of the added cells, but had no influence on the mineralization of 10 ..mu..g DCP/L. In comparison, degradation of 10 and 25 mg DCP/L stopped after a few days. Yeast nitrogen base appeared to overcome the lack of nutrient regeneration, a function attributed to protozoa. The additional nutrients increased toxicant mineralization, especially when seeded with appropriate species. Thus, protozoa may limit growth of added cells but appear to be needed for mineralization of higher concentrations of DCP.

  6. Comparative Genomics between Two Xenorhabdus bovienii Strains Highlights Differential Evolutionary Scenarios within an Entomopathogenic Bacterial Species

    PubMed Central

    Bisch, Gaëlle; Ogier, Jean-Claude; Médigue, Claudine; Rouy, Zoé; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2016-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Within Xenorhabdus bovienii species, the X. bovienii CS03 strain (Xb CS03) is nonvirulent when directly injected into lepidopteran insects, and displays a low virulence when associated with its Steinernema symbiont. The genome of Xb CS03 was sequenced and compared with the genome of a virulent strain, X. bovienii SS-2004 (Xb SS-2004). The genome size and content widely differed between the two strains. Indeed, Xb CS03 had a large genome containing several specific loci involved in the inhibition of competitors, including a few NRPS-PKS loci (nonribosomal peptide synthetases and polyketide synthases) producing antimicrobial molecules. Consistently, Xb CS03 had a greater antimicrobial activity than Xb SS-2004. The Xb CS03 strain contained more pseudogenes than Xb SS-2004. Decay of genes involved in the host invasion and exploitation (toxins, invasins, or extracellular enzymes) was particularly important in Xb CS03. This may provide an explanation for the nonvirulence of the strain when injected into an insect host. We suggest that Xb CS03 and Xb SS-2004 followed divergent evolutionary scenarios to cope with their peculiar life cycle. The fitness strategy of Xb CS03 would involve competitor inhibition, whereas Xb SS-2004 would quickly and efficiently kill the insect host. Hence, Xenorhabdus strains would have widely divergent host exploitation strategies, which impact their genome structure. PMID:26769959

  7. Interaction between common organic acids and trace nucleation species in the Earth's atmosphere.

    PubMed

    Xu, Yisheng; Nadykto, Alexey B; Yu, Fangqun; Herb, J; Wang, Wei

    2010-01-14

    Atmospheric aerosols formed via nucleation in the Earth's atmosphere play an important role in the aerosol radiative forcing associated directly with global climate changes and public health. Although it is well-known that atmospheric aerosol particles contain organic species, the chemical nature of and physicochemical processes behind atmospheric nucleation involving organic species remain unclear. In the present work, the interaction of common organic acids with molecular weights of 122, 116, 134, 88, 136, and 150 (benzoic, maleic, malic, pyruvic, phenylacetic, and tartaric acids) with nucleation precursors and charged trace species has been investigated. We found a moderate strong effect of the organic species on the stability of neutral and charged ionic species. In most cases, the free energies of the mixed H(2)SO(4)-organic acid dimer formation are within 1-1.5 kcal mol(-1) of the (H(2)SO(4))(NH(3)) formation energy. The interaction of the organic acids with trace ionic species is quite strong, and the corresponding free energies far exceed those of the (H(3)O(+))(H(2)SO(4)) and (H(3)O(+))(H(2)SO(4))(2) formation. These considerations lead us to conclude that the aforementioned organic acids may possess a substantial capability of stabilizing both neutral and positively charged prenucleation clusters, and thus, they should be studied further with regard to their involvement in the gas-to-particle conversion in the Earth's atmosphere.

  8. Bacterial intra-species gene loss occurs in a largely clocklike manner mostly within a pool of less conserved and constrained genes

    PubMed Central

    Bolotin, Evgeni; Hershberg, Ruth

    2016-01-01

    Gene loss is a major contributor to the evolution of bacterial gene content. Gene loss may occur as a result of shifts in environment leading to changes in the intensity and/or directionality of selection applied for the maintenance of specific genes. Gene loss may also occur in a more neutral manner, when gene functions are lost that were not subject to strong selection