Science.gov

Sample records for acid bacterial strains

  1. Method for construction of bacterial strains with increased succinic acid production

    DOEpatents

    Donnelly, Mark I.; Sanville-Millard, Cynthia; Chatterjee, Ranjini

    2000-01-01

    A fermentation process for producing succinic acid is provided comprising selecting a bacterial strain that does not produce succinic acid in high yield, disrupting the normal regulation of sugar metabolism of said bacterial strain, and combining the mutant bacterial strain and selected sugar in anaerobic conditions to facilitate production of succinic acid. Also provided is a method for changing low yield succinic acid producing bacteria to high yield succinic acid producing bacteria comprising selecting a bacterial strain having a phosphotransferase system and altering the phosphotransferase system so as to allow the bacterial strain to simultaneously metabolize different sugars.

  2. A bacterial strain with a unique quadruplet codon specifying non-native amino acids.

    PubMed

    Chatterjee, Abhishek; Lajoie, Marc J; Xiao, Han; Church, George M; Schultz, Peter G

    2014-08-18

    The addition of noncanonical amino acids to the genetic code requires unique codons not assigned to the 20 canonical amino acids. Among the 64 triplet codons, only the three nonsense "stop" codons have been used to encode non-native amino acids. Use of quadruplet "frame-shift" suppressor codons provides an abundant alternative but suffers from low suppression efficiency as a result of competing recognition of their first three bases by endogenous host tRNAs or release factors. Deletion of release factor 1 in a genomically recoded strain of E. coli (E. coli C321), in which all endogenous amber stop codons (UAG) are replaced with UAA, abolished UAG mediated translation termination. Here we show that a Methanocaldococcus jannaschii-derived frame-shift suppressor tRNA/aminoacyl-tRNA synthetase pair enhanced UAGN suppression efficiency in this recoded bacterial strain. These results demonstrate that efficient quadruplet codons for encoding non-native amino acids can be generated by eliminating competing triplet codon recognition at the ribosome. PMID:24867343

  3. Adaptive acid tolerance response of Vibrio parahaemolyticus as affected by acid adaptation conditions, growth phase, and bacterial strains.

    PubMed

    Chiang, Ming-Lun; Chou, Cheng-Chun; Chen, Hsi-Chia; Tseng, Yu-Ting; Chen, Ming-Ju

    2012-08-01

    Vibrio parahaemolyticus strain 690 was isolated from gastroenteritis patients. Its thermal and ethanol stress responses have been reported in our previous studies. In this study, we further investigated the effects of various acid adaptation conditions including pH (5.0-6.0) and time (30-90 min) on the acid tolerance in different growth phases of V. parahaemolyticus 690. Additionally, the adaptive acid tolerance among different V. parahaemolyticus strains was compared. Results indicated that the acid tolerance of V. parahaemolyticus 690 was significantly increased after acid adaptation at pH 5.5 and 6.0 for 30-90 min. Among the various acid adaptation conditions examined, V. parahaemolyticus 690 acid-adapted at pH 5.5 for 90 min exhibited the highest acid tolerance. The acid adaptation also influenced the acid tolerance of V. parahaemolyticus 690 in different growth phases with late-exponential phase demonstrating the greatest acid tolerance response (ATR) than other phases. Additionally, the results also showed that the induction of adaptive ATR varied with different strains of V. parahaemolyticus. An increase in acid tolerance of V. parahaemolyticus was observed after prior acid adaptation in five strains (556, 690, BCRC 13023, BCRC 13025, and BCRC 12864), but not in strains 405 and BCRC 12863. PMID:22827515

  4. New lactic acid bacterial strains from traditional Mongolian fermented milk products have altered adhesion to porcine gastric mucin depending on the carbon source.

    PubMed

    Kimoto-Nira, Hiromi; Yamasaki, Seishi; Sasaki, Keisuke; Moriya, Naoko; Takenaka, Akio; Suzuki, Chise

    2015-03-01

    Attachment of lactic acid bacteria to the mucosal surface of the gastrointestinal tract is a major property of probiotics. Here, we examined the ability of 21 lactic acid bacterial strains isolated from traditional fermented milk products in Mongolia to adhere to porcine gastric mucin in vitro. Higher attachment was observed with Lactobacillus delbrueckii subsp. bulgaricus strains 6-8 and 8-1 than with Lactobacillus rhamnosus GG (positive control). Lactococcus lactis subsp. cremoris strain 7-1 adhered to mucin as effectively as did strain GG. Heat inactivation decreased the adhesive ability of strains 6-8 and 8-1 but did not affect strain 7-1. The adhesion of strains 6-8, 7-1 and 8-1 was significantly inhibited when the cells were pretreated with periodate and trypsin, indicating that proteinaceous and carbohydrate-like cell surface compounds are involved in the adhesion of these strains. The adhesion of strain 7-1 was affected by the type of carbohydrate present in the growth medium, being higher with fructose than with lactose, galactose or xylose as the carbon source. The sugar content of 7-1 cells grown on various carbohydrates was negatively correlated with its adhesive ability. We provide new probiotic candidate strains and new information regarding carbohydrate preference that influences lactic acid bacterial adhesion to mucin. PMID:25186082

  5. Bacterial Strain Diversity Within Wounds

    PubMed Central

    Kirkup, Benjamin C.

    2015-01-01

    Significance: Rare bacterial taxa (taxa of low relative frequency) are numerous and ubiquitous in virtually any sample—including wound samples. In addition, even the high-frequency genera and species contain multiple strains. These strains, individually, are each only a small fraction of the total bacterial population. Against the view that wounds contain relatively few kinds of bacteria, this newly recognized diversity implies a relatively high rate of migration into the wound and the potential for diversification during infection. Understanding the biological and medical importance of these numerous taxa is an important new element of wound microbiology. Recent Advances: Only recently have these numerous strains been discovered; the technology to detect, identify, and characterize them is still in its infancy. Multiple strains of both gram-negative and gram-positive bacteria have been found in a single wound. In the few cases studied, the distribution of the bacteria suggests microhabitats and biological interactions. Critical Issues: The distribution of the strains, their phenotypic diversity, and their interactions are still largely uncharacterized. The technologies to investigate this level of genomic detail are still developing and have not been largely deployed to investigate wounds. Future Directions: As advanced metagenomics, single-cell genomics, and advanced microscopy develop, the study of wound microbiology will better address the complex interplay of numerous individually rare strains with both the host and each other. PMID:25566411

  6. Strain-level bacterial identification by CeO2-catalyzed MALDI-TOF MS fatty acid analysis and comparison to commercial protein-based methods

    PubMed Central

    Cox, C. R.; Jensen, K. R.; Saichek, N. R.; Voorhees, K. J.

    2015-01-01

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has emerged as a rapid approach for clinical bacterial identification. However, current protein-based commercial bacterial ID methods fall short when differentiating closely related species/strains. To address this shortcoming, we employed CeO2-catalyzed fragmentation of lipids to produce fatty acids using the energy inherent to the MALDI laser as a novel alternative to protein profiling. Fatty acid profiles collected from Enterobacteriaceae, Acinetobacter, and Listeria using CeO2-catalyzed metal oxide laser ionization (MOLI MS), processed by principal component analysis, and validated by leave–one-out cross-validation (CV), showed 100% correct classification at the species level and 98% at the strain level. In comparison, protein profile data from the same bacteria yielded 32%, 54% and 67% mean species-level accuracy using two MALDI-TOF MS platforms, respectively. In addition, several pathogens were misidentified by protein profiling as non-pathogens and vice versa. These results suggest novel CeO2-catalyzed lipid fragmentation readily produced (i) taxonomically tractable fatty acid profiles by MOLI MS, (ii) highly accurate bacterial classification and (iii) consistent strain-level ID for bacteria that were routinely misidentified by protein-based methods. PMID:26190224

  7. BACTERIAL OXIDATION OF DIPICOLINIC ACID

    PubMed Central

    Kobayashi, Yasuo; Arima, Kei

    1962-01-01

    Kobayashi, Yasuo (University of Tokyo, Tokyo, Japan) and Kei Arima. Bacterial oxidation of dipicolinic acid. II. Identification of α-ketoglutaric acid and 3-hydroxydipicolinic acid and some properties of cell-free extracts. J. Bacteriol. 84:765–771. 1962—When a dipicolinic acid (DPA)-decomposing bacterium, Achromobacter strain 1–2, was incubated at 30 C with shaking in a DPA solution containing 10−3m arsenite, a keto acid was accumulated. The 2,4-dinitrophenylhydrazone of this acid was synthesized and identified as α-ketoglutaric acid by paper chromatography, visible absorption spectrum, infrared analysis, elemental analysis, and mixed melting point. During this incubation, oxalic acid equivalent to the consumed dipicolinic acid was produced. A fluorescent material was also isolated from culture fluid and identified as 3-hydroxydipicolinic acid by paper chromatography and the ultraviolet absorption spectrum. Further, cell-free extracts were prepared by sonic oscillation. Ferrous ion and a reduced di- or triphosphopyridine nucleotide-generating system were proven to be required for enzymic oxidation of DPA. And 3-hydroxydipicolinic acid was also oxidized by this preparation. From the results obtained, a possible metabolic pathway of dipicolinic acid was proposed. PMID:14033954

  8. Safety assessment of potential probiotic lactic acid bacterial strains Lactobacillus rhamnosus HN001, Lb. acidophilus HN017, and Bifidobacterium lactis HN019 in BALB/c mice.

    PubMed

    Zhou, J S; Shu, Q; Rutherfurd, K J; Prasad, J; Birtles, M J; Gopal, P K; Gill, H S

    2000-05-25

    The general safety of immune-enhancing lactic acid bacteria (LAB) strains Lactobacillus rhamnosus HN001 (DR20), Lb. acidophilus HN017, and Bifidobacterium lactis HN019 (DR10) was investigated in a feeding trial. Groups of BALB/c mice were orally administered test LAB strains or the commercial reference strain Lb. acidophilus LA-1 at 2.5 x 10(9), 5 x 10(10) or 2.5 x 10(12) colony forming units (CFU)/kg body weight/day for 4 weeks. Throughout this time, their feed intake, water intake, and live body weight were monitored. At the end of the 4 week observation period, samples of blood, liver, spleen, kidney, mesenteric lymph nodes, and gut tissues (ileum, caecum, and colon) were collected to determine: haematological parameters (red blood cell and platelet counts, haemoglobin concentration, mean corpuscular volume, mean corpuscular haemoglobin, and mean corpuscular haemoglobin concentration); differential leukocyte counts; blood biochemistry (plasma total protein, albumin, cholesterol, and glucose); mucosal histology (epithelial cell height, mucosal thickness, and villus height); and bacterial translocation to extra-gut tissues (blood, liver, spleen, kidney and mesenteric lymph nodes). DNA finger printing techniques were used to identify any viable bacterial strains recovered from these tissues. The results demonstrated that 4 weeks consumption of these LAB strains had no adverse effects on animals' general health status, haematology, blood biochemistry, gut mucosal histology parameters, or the incidence of bacterial translocation. A few viable LAB cells were recovered from the tissues of animals in both control and test groups, but DNA fingerprinting did not identify any of these as the inoculated strains. The results obtained in this study suggest that the potentially probiotic LAB strains HN001, HN017, and HN019 are non-toxic for mice and are therefore likely to be safe for human use. PMID:10857928

  9. Isolation of Minicircular Deoxyribonucleic Acids from Wild Strains of Escherichia coli and their Relationship to other Bacterial Plasmids

    PubMed Central

    Goebel, Werner; Schrempf, Hildgund

    1972-01-01

    Supercoiled minicircular deoxyribonucleic acid (DNA) molecules with molecular weights of 1.8 × 106 and 2.3 × 106 have been isolated from two wild strains of Escherichia coli. DNA-DNA hybridization experiments indicate that these DNA molecules share extended homologies with the minicircular DNA of E. coli 15. The DNA of the colicinogenic factor E1 (ColE1) also hybridizes to a large extent with minicircular DNA of E. coli 15. In contrast, no hybridization could be detected with various large extrachromosomal DNA elements such as the colicinogenic factor V (ColV), the beta-hemolytic factor (Hly), or the P1-like DNA of E. coli 15. Two different insertion DNA species of E. coli integrated into λdg-DNA (λdg UPin 128, λdg UPin 308) do not show any annealing with minicircular DNA of E. coli 15. Images PMID:4340922

  10. Isolation and characterization of bacterial strains with the ability to utilize high concentrations of levulinic acid, a platform chemical from inedible biomass.

    PubMed

    Habe, Hiroshi; Sato, Shun; Morita, Tomotake; Fukuoka, Tokuma; Kirimura, Kohtaro; Kitamoto, Dai

    2015-01-01

    Nineteen levulinic acid (LA)-utilizing bacteria were isolated from environmental samples. Following examination of the use of 80 g/L LA by some isolated strains, Brevibacterium epidermidis LA39-2 consumed 62.6 g/L LA following 8 days incubation. The strain also utilized both 90 and 100 g/L LA, with consumption ratio of 84.3 and 53.3%, respectively, after 10 days incubation. PMID:25851167

  11. Bacterial Cyanuric Acid Hydrolase for Water Treatment.

    PubMed

    Yeom, Sujin; Mutlu, Baris R; Aksan, Alptekin; Wackett, Lawrence P

    2015-10-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  12. Bacterial Cyanuric Acid Hydrolase for Water Treatment

    PubMed Central

    Yeom, Sujin; Mutlu, Baris R.; Aksan, Alptekin

    2015-01-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  13. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03

    PubMed Central

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-01-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l-1. The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters. PMID:25253925

  14. Bacterial Decarboxylation of o-Phthalic Acids

    PubMed Central

    Taylor, Barrie F.; Ribbons, Douglas W.

    1983-01-01

    The decarboxylation of phthalic acids was studied with Bacillus sp. strain FO, a marine mixed culture ON-7, and Pseudomonas testosteroni. The mixed culture ON-7, when grown anaerobically on phthalate but incubated aerobically with chloramphenicol, quantitatively converted phthalic acid to benzoic acid. Substituted phthalic acids were also decarboxylated: 4,5-dihydroxyphthalic acid to protocatechuic acid; 4-hydroxyphthalic and 4-chlorophthalic acids to 3-hydroxybenzoic and 3-chlorobenzoic acids, respectively; and 3-fluorophthalic acid to 2-and 3-fluorobenzoic acids. Bacillus sp. strain FO gave similar results except that 4,5-dihydroxyphthalic acid was not metabolized, and both 3- and 4-hydroxybenzoic acids were produced from 4-hydroxyphthalic acid. P. testosteroni decarboxylated 4-hydroxyphthalate (to 3-hydroxybenzoate) and 4,5-dihydroxyphthalate but not phthalic acid and halogenated phthalates. Thus, P. testosteroni and the mixed culture ON-7 possessed 4,5-dihydroxyphthalic acid decarboxylase, previously described in P. testosteroni, that metabolized 4,5-dihydroxyphthalic acid and specifically decarboxylated 4-hydroxyphthalic acid to 3-hydroxybenzoic acid. The mixed culture ON-7 and Bacillus sp. strain FO also possessed a novel decarboxylase that metabolized phthalic acid and halogenated phthalates, but not 4,5-dihydroxyphthalate, and randomly decarboxylated 4-hydroxyphthalic acid. The decarboxylation of phthalic acid is suggested to involve an initial reduction to 1,2-dihydrophthalic acid followed by oxidative decarboxylation to benzoic acid. PMID:16346440

  15. Bacterial Lipoteichoic Acid Enhances Cryosurvival

    PubMed Central

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Scull, Erin; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2015-01-01

    Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. We show that lipoteichoic acid (LTA), a biopolymer in the cell wall of Gram-positive bacteria, can be added to B. subtilis cultures and increase freeze tolerance. At 1% w/v, LTA enables a 50% survival rate, similar to the results obtained with 1% w/v glycerol as measured with the resazurin cell viability assay. In the absence of added LTA or glycerol, a very small number of B. subtilis cells survive freezing. This suggests that an innate freeze tolerance mechanism exists. While cryoprotection can be provided by extracellular polymeric substances (EPS), our data demonstrate a role for LTA in cryoprotection. Currently, the exact mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. However, low temperature microscopy data show small ice crystals aligned along channels of liquid water. Our observations suggest that teichoic acids could protect liquid water within biofilms and planktonic bacteria, augmenting the role of brine while also raising the possibility for survival without brine present. PMID:25477208

  16. Antimicrobial effect against different bacterial strains and bacterial adaptation to essential oils used as feed additives

    PubMed Central

    Melo, Antonio Diego Brandão; Amaral, Amanda Figueiredo; Schaefer, Gustavo; Luciano, Fernando Bittencourt; de Andrade, Carla; Costa, Leandro Batista; Rostagno, Marcos Horácio

    2015-01-01

    The aim of this study was to evaluate the antimicrobial activity and determine the minimum bactericidal concentration (MBC) of the essential oils derived from Origanum vulgare (oregano), Melaleuca alternifolia (tea tree), Cinnamomum cassia (cassia), and Thymus vulgaris (white thyme) against Salmonella Typhimurium, Salmonella Enteritidis, Escherichia coli, Staphylococcus aureus and Enterococcus faecalis. The study also investigated the ability of these different bacterial strains to develop adaptation after repetitive exposure to sub-lethal concentrations of these essential oils. The MBC of the essential oils studied was determined by disc diffusion and broth dilution methods. All essential oils showed antimicrobial effect against all bacterial strains. In general, the development of adaptation varied according to the bacterial strain and the essential oil (tea tree > white thyme > oregano). Therefore, it is important to use essential oils at efficient bactericidal doses in animal feed, food, and sanitizers, since bacteria can rapidly develop adaptation when exposed to sub-lethal concentrations of these oils. PMID:26424908

  17. Antimicrobial effect against different bacterial strains and bacterial adaptation to essential oils used as feed additives.

    PubMed

    Melo, Antonio Diego Brandão; Amaral, Amanda Figueiredo; Schaefer, Gustavo; Luciano, Fernando Bittencourt; de Andrade, Carla; Costa, Leandro Batista; Rostagno, Marcos Horácio

    2015-10-01

    The aim of this study was to evaluate the antimicrobial activity and determine the minimum bactericidal concentration (MBC) of the essential oils derived from Origanum vulgare (oregano), Melaleuca alternifolia (tea tree), Cinnamomum cassia (cassia), and Thymus vulgaris (white thyme) against Salmonella Typhimurium, Salmonella Enteritidis, Escherichia coli, Staphylococcus aureus and Enterococcus faecalis. The study also investigated the ability of these different bacterial strains to develop adaptation after repetitive exposure to sub-lethal concentrations of these essential oils. The MBC of the essential oils studied was determined by disc diffusion and broth dilution methods. All essential oils showed antimicrobial effect against all bacterial strains. In general, the development of adaptation varied according to the bacterial strain and the essential oil (tea tree > white thyme > oregano). Therefore, it is important to use essential oils at efficient bactericidal doses in animal feed, food, and sanitizers, since bacteria can rapidly develop adaptation when exposed to sub-lethal concentrations of these oils. PMID:26424908

  18. [Isolation and characterazation of a carbazole-degrading bacterial strain].

    PubMed

    Zhang, Xiao-Fan; He, Yi-Liang

    2010-09-01

    A bacterial strain was isolated from soil samples using plate screening techniques. Results indicated this isolated were able to use carbazole as sole source of carbon and energy, simultaneously, including N-Methylcarbazole, 4-Hydroxycarbazole and 2,2'-Biphenol. It was identified as Flavobacterium sp. according to its morphology, and biochemical properties, and 16S rDNA sequence analysis. Utilization of carbazole by the isolates was confirmed by the increase in bacterial biomass and the decrease in substrate concentration in liquid cultures. The optimal pH and temperature for cell growth and carbazole degradation were 7.5 and 30 degrees C, respectively. Resting cells grown in Luria broth also showed activity for decomposing other heterocyclic compounds. In addition, biodegradation of carbazole was carried out with carbazole degrading strain KH-6. The results indicated that 90% of the carbazole could be degraded in the sterilized soil. And strain KH-6 could enhance the degradations of carbazole significantly. PMID:21072941

  19. Identification and characterisation of potential biofertilizer bacterial strains

    NASA Astrophysics Data System (ADS)

    Karagöz, Kenan; Kotan, Recep; Dadaşoǧlu, Fatih; Dadaşoǧlu, Esin

    2016-04-01

    In this study we aimed that isolation, identification and characterizations of PGPR strains from rhizosphere of legume plants. 188 bacterial strains isolated from different legume plants like clover, sainfoin and vetch in Erzurum province of Turkey. These three plants are cultivated commonly in the Erzurum province. It was screen that 50 out of 188 strains can fix nitrogen and solubilize phosphate. These strains were identified via MIS (Microbial identification system). According to MIS identification results, 40 out of 50 strains were identified as Bacillus, 5 as Pseudomonas, 3 as Paenibacillus, 1 as Acinetobacter, 1 as Brevibacterium. According to classical test results, while the catalase test result of all isolates are positive, oxidase, KOH and starch hydrolysis rest results are variable.

  20. Tannic acid degradation by Klebsiella strains isolated from goat feces

    PubMed Central

    Tahmourespour, Arezoo; Tabatabaee, Nooroldin; Khalkhali, Hossein; Amini, Imane

    2016-01-01

    Background and Objectives: Tannins are toxic polyphenols that either bind and precipitate or condense proteins. The high tannin content of some plants is the preliminary limitation of using them as a ruminant feed. So, the aim of this study was the isolation and characterization of tannic acid degrading bacterial strains from goat feces before and after feeding on Pistachio-Soft Hulls as tannin rich diet (TRD). Materials and Methods: Bacterial strains capable of utilizing tannic acid as sole carbon and energy source were isolated and characterized from goat feces before and after feeding on TRD. Tannase activity, maximum tolerable concentration and biodegradation potential were assessed. Results: Four tannase positive isolates were identified as Klebsiella pneumoniae. Isolated strains showed the maximum tolerable concentration of 64g/L of tannin. The tannic acid degradation percentage at a concentration of 15.0 g/L reached a maximum of 68% after 24 h incubation, and more than 98% after 72 h incubation. The pH of the medium also decreased along with tannic acid utilization. Conclusions: It is obvious that TRD induced adaptive responses. Thus, while the bacteria were able to degrade and detoxify the tannic acids, they had to adapt in the presence of high concentrations of tannic acid. So, these isolates have an amazing potential for application in bioremediation, waste water treatment, also reduction of tannins antinutritional effects in animal feeds. PMID:27092220

  1. Detoxification of mercury pollutant leached from spent fluorescent lamps using bacterial strains.

    PubMed

    Al-Ghouti, Mohammad A; Abuqaoud, Reem H; Abu-Dieyeh, Mohammed H

    2016-03-01

    The spent fluorescent lamps (SFLs) are being classified as a hazardous waste due to having mercury as one of its main components. Mercury is considered the second most toxic heavy metal (arsenic is the first) with harmful effects on animal nervous system as it causes different neurological disorders. In this research, the mercury from phosphor powder was leached, then bioremediated using bacterial strains isolated from Qatari environment. Leaching of mercury was carried out with nitric and hydrochloric acid solutions using two approaches: leaching at ambient conditions and microwave-assisted leaching. The results obtained from this research showed that microwave-assisted leaching method was significantly better in leaching mercury than the acid leaching where the mercury leaching efficiency reached 76.4%. For mercury bio-uptake, twenty bacterial strains (previously isolated and purified from petroleum oil contaminated soils) were sub-cultured on Luria Bertani (LB) plates with mercury chloride to check the bacterial tolerance to mercury. Seven of these twenty strains showed a degree of tolerance to mercury. The bio-uptake capacities of the promising strains were investigated using the mercury leached from the fluorescent lamps. Three of the strains (Enterobacter helveticus, Citrobacter amalonaticus, and Cronobacter muytjensii) showed bio-uptake efficiency ranged from 28.8% to 63.6%. PMID:26725036

  2. Carbazole degradation in the soil microcosm by tropical bacterial strains

    PubMed Central

    Salam, Lateef B.; Ilori, Matthew O.; Amund, Olukayode O.

    2015-01-01

    In a previous study, three bacterial strains isolated from tropical hydrocarbon-contaminated soils and phylogenetically identified as Achromobacter sp. strain SL1, Pseudomonas sp. strain SL4 and Microbacterium esteraromaticum strain SL6 displayed angular dioxygenation and mineralization of carbazole in batch cultures. In this study, the ability of these isolates to survive and enhance carbazole degradation in soil were tested in field-moist microcosms. Strain SL4 had the highest survival rate (1.8 x 107 cfu/g) after 30 days of incubation in sterilized soil, while there was a decrease in population density in native (unsterilized) soil when compared with the initial population. Gas chromatographic analysis after 30 days of incubation showed that in sterilized soil amended with carbazole (100 mg/kg), 66.96, 82.15 and 68.54% were degraded by strains SL1, SL4 and SL6, respectively, with rates of degradation of 0.093, 0.114 and 0.095 mg kg−1 h−1. The combination of the three isolates as inoculum in sterilized soil degraded 87.13% carbazole at a rate of 0.121 mg kg−1 h−1. In native soil amended with carbazole (100 mg/kg), 91.64, 87.29 and 89.13% were degraded by strains SL1, SL4 and SL6 after 30 days of incubation, with rates of degradation of 0.127, 0.121 and 0.124 mg kg−1 h−1, respectively. This study successfully established the survivability (> 106 cfu/g detected after 30 days) and carbazole-degrading ability of these bacterial strains in soil, and highlights the potential of these isolates as seed for the bioremediation of carbazole-impacted environments. PMID:26691461

  3. Use of colony-based bacterial strain typing for tracking the fate of Lactobacillus strains during human consumption

    PubMed Central

    2009-01-01

    Background The Lactic Acid Bacteria (LAB) are important components of the healthy gut flora and have been used extensively as probiotics. Understanding the cultivable diversity of LAB before and after probiotic administration, and being able to track the fate of administered probiotic isolates during feeding are important parameters to consider in the design of clinical trials to assess probiotic efficacy. Several methods may be used to identify bacteria at the strain level, however, PCR-based methods such as Random Amplified Polymorphic DNA (RAPD) are particularly suited to rapid analysis. We examined the cultivable diversity of LAB in the human gut before and after feeding with two Lactobacillus strains, and also tracked the fate of these two administered strains using a RAPD technique. Results A RAPD typing scheme was developed to genetically type LAB isolates from a wide range of species, and optimised for direct application to bacterial colony growth. A high-throughput strategy for fingerprinting the cultivable diversity of human faeces was developed and used to determine: (i) the initial cultivable LAB strain diversity in the human gut, and (ii) the fate of two Lactobacillus strains (Lactobacillus salivarius NCIMB 30211 and Lactobacillus acidophilus NCIMB 30156) contained within a capsule that was administered in a small-scale human feeding study. The L. salivarius strain was not cultivated from the faeces of any of the 12 volunteers prior to capsule administration, but appeared post-feeding in four. Strains matching the L. acidophilus NCIMB 30156 feeding strain were found in the faeces of three volunteers prior to consumption; after taking the Lactobacillus capsule, 10 of the 12 volunteers were culture positive for this strain. The appearance of both Lactobacillus strains during capsule consumption was statistically significant (p < 0.05). Conclusion We have shown that genetic strain typing of the cultivable human gut microbiota can be evaluated using a high

  4. Transforming microbial genotyping: a robotic pipeline for genotyping bacterial strains.

    PubMed

    O'Farrell, Brian; Haase, Jana K; Velayudhan, Vimalkumar; Murphy, Ronan A; Achtman, Mark

    2012-01-01

    Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST) of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS) consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of < €25 per strain. Since developing this pipeline, >200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost. PMID:23144721

  5. Transforming Microbial Genotyping: A Robotic Pipeline for Genotyping Bacterial Strains

    PubMed Central

    Velayudhan, Vimalkumar; Murphy, Ronan A.; Achtman, Mark

    2012-01-01

    Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST) of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS) consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of < €25 per strain. Since developing this pipeline, >200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost. PMID:23144721

  6. Lactic acid bacterial extract as a biogenic mineral growth modifier

    NASA Astrophysics Data System (ADS)

    Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal

    2009-04-01

    The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.

  7. Spray washing carcasses with alkaline solutions of lauric acid to reduce bacterial contamination

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ability of lauric acid (LA)-potassium hydroxide (KOH) solutions to reduce carcass bacterial contamination was examined. Skin of carcasses was inoculated with a cecal paste containing antibiotic resistant strains of Escherichia coli, Salmonella Typhimirum, and Campylobacter coli. In one trial, in...

  8. Influence of Root Exudates on the Bacterial Degradation of Chlorobenzoic Acids

    PubMed Central

    Lovecká, Petra; Dražková, Milena; Macková, Martina; Macek, Tomas

    2013-01-01

    Degradation of chlorobenzoic acids (e.g., products of microbial degradation of PCB) by strains of microorganisms isolated from PCB contaminated soils was assessed. From seven bulk-soil isolates two strains unique in ability to degrade a wider range of chlorobenzoic acids than others were selected, individually and even in a complex mixture of 11 different chlorobenzoic acids. Such a feature is lacking in most tested degraders. To investigate the influence of vegetation on chlorobenzoic acids degraders, root exudates of two plant species known for supporting PCB degradation in soil were tested. While with individual chlorobenzoic acids the presence of plant exudates leads to a decrease of degradation yield, in case of a mixture of chlorobenzoic acids either a change in bacterial degradation specificity, associated with 3- and 4-chlorobenzoic acid, or an extension of the spectrum of degraded chlorobenzoic acids was observed. PMID:24222753

  9. Biodegradation of crude oil by individual bacterial strains and a mixed bacterial consortium

    PubMed Central

    Santisi, Santina; Cappello, Simone; Catalfamo, Maurizio; Mancini, Giuseppe; Hassanshahian, Mehdi; Genovese, Lucrezia; Giuliano, Laura; Yakimov, Michail M.

    2015-01-01

    Three bacterial isolates identified as Alcanivorax borkumensis SK2, Rhodococcus erythropolis HS4 and Pseudomonas stutzeri SDM, based on 16S rRNA gene sequences, were isolated from crude oil enrichments of natural seawater. Single strains and four bacterial consortia designed by mixing the single bacterial cultures respectively in the following ratios: (Alcanivorax: Pseudomonas, 1:1), (Alcanivorax: Rhodococcus, 1:1), (Pseudomonas: Rhodococcus, 1:1), and (Alcanivorax: Pseudomonas: Rhodococcus, 1:1:1), were analyzed in order to evaluate their oil degrading capability. All experiments were carried out in microcosms systems containing seawater (with and without addition of inorganic nutrients) and crude oil (unique carbon source). Measures of total and live bacterial abundance, Card-FISH and quali-, quantitative analysis of hydrocarbons (GC-FID) were carried out in order to elucidate the co-operative action of mixed microbial populations in the process of biodegradation of crude oil. All data obtained confirmed the fundamental role of bacteria belonging to Alcanivorax genus in the degradation of linear hydrocarbons in oil polluted environments. PMID:26273252

  10. Drug resistance analysis of bacterial strains isolated from burn patients.

    PubMed

    Wang, L F; Li, J L; Ma, W H; Li, J Y

    2014-01-01

    This study aimed to analyze the spectrum and drug resistance of bacteria isolated from burn patients to provide a reference for rational clinical use of antibiotics. Up to 1914 bacterial strain specimens isolated from burn patients admitted to hospital between 2001 and 2010 were subjected to resistance monitoring by using the K-B paper disk method. Retrospective analysis was performed on drug resistance analysis of burn patients. The top eight bacterium strains according to detection rate. A total of 1355 strains of Gram-negative (G(-)) bacteria and 559 strains of Gram-positive (G(+)) bacteria were detected. The top eight bacterium strains, according to detection rate, were Acinetobacter baumannii, Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli, Staphylococcus epidermidis, Klebsiella pneumoniae, Enterobacter cloacae, and Enterococcus. Drug resistance rates were higher than 90% in A. baumannii, P. aeruginosa, S. epidermidis, and S. aureus, which accounted for 52.2, 21.7, 27.8, and 33.3%, respectively, of the entire sample. Those with drug resistance rates lower than 30% accounted for 4.3, 30.4, 16.7, and 16.7%, respectively. Multidrug-resistant S. aureus (MRSA) and methicillin-resistant S. epidermidis (MRSE) accounted for 49.2 and 76.4% of the S. epidermis and S. aureus resistance, respectively. Antibacterial drugs that had drug resistance rates to MRSE and MRSA higher than 90% accounted for 38.9 and 72.2%, respectively, whereas those with lower than 30% drug resistance rates accounted for 11.1 and 16.7%, respectively. The burn patients enrolled in the study were mainly infected with G(-) bacteria. These results strongly suggest that clinicians should practice rational use of antibiotics based on drug susceptibility test results. PMID:24535909

  11. Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

    PubMed Central

    Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo

    1988-01-01

    A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

  12. Quantification of Bacterial Fatty Acids by Extraction and Methylation

    PubMed Central

    Politz, Mark; Lennen, Rebecca; Pfleger, Brian

    2016-01-01

    This protocol describes two similar methods for the extraction and methylation of fatty acids from bacterial cultures. The acid derivatization protocol (Lennen et al., 2013; Bligh and Dyer, 1959) results in the extraction and methylation of all fatty acids, both free and bound, from a bacterial culture, while the base derivatization protocol (Lennen and Pfleger, 2013) captures only bound (phospholipid, acyl-thioester) species. After extraction into hexane, the lipids may be analyzed by gas chromatography.

  13. Pseudomonas chlororaphis Strain Sm3, Bacterial Antagonist of Pratylenchus penetrans.

    PubMed

    Hackenberg, C; Muehlkchen, A; Forge, T; Vrain, T

    2000-06-01

    The interaction of Pseudomonas chlororaphis strain Sm3 and the root-lesion nematode Pratylenchus penetrans was investigated in three separate greenhouse experiments with soils from southern British Columbia, Canada. The bacteria were applied to the roots of strawberry plants and planted in unpasteurized field soils, with natural or supplemented infestation of P. penetrans. Nematode suppression in roots was evident after 6 or 10 weeks in all experiments. Root or shoot growth were increased after 10 weeks in two experiments. Population dynamics of P. chlororaphis Sm3 in the rhizosphere was followed using an antibiotic-resistant mutant of P. chlororaphis Sm3. There was no apparent correlation between bacterial density in the rhizosphere and P. penetrans suppression in strawberry roots and rhizosphere soil, although the soil with the highest nematode reduction also had the largest P. chlororaphis Sm3 population in the rhizosphere. PMID:19270964

  14. Pseudomonas chlororaphis Strain Sm3, Bacterial Antagonist of Pratylenchus penetrans

    PubMed Central

    Hackenberg, Clemens; Muehlkchen, Andrea; Forge, Thomas; Vrain, Thierry

    2000-01-01

    The interaction of Pseudomonas chlororaphis strain Sm3 and the root-lesion nematode Pratylenchus penetrans was investigated in three separate greenhouse experiments with soils from southern British Columbia, Canada. The bacteria were applied to the roots of strawberry plants and planted in unpasteurized field soils, with natural or supplemented infestation of P. penetrans. Nematode suppression in roots was evident after 6 or 10 weeks in all experiments. Root or shoot growth were increased after 10 weeks in two experiments. Population dynamics of P. chlororaphis Sm3 in the rhizosphere was followed using an antibiotic-resistant mutant of P. chlororaphis Sm3. There was no apparent correlation between bacterial density in the rhizosphere and P. penetrans suppression in strawberry roots and rhizosphere soil, although the soil with the highest nematode reduction also had the largest P. chlororaphis Sm3 population in the rhizosphere. PMID:19270964

  15. A Catalytic DNA Activated by a Specific Strain of Bacterial Pathogen.

    PubMed

    Shen, Zhifa; Wu, Zaisheng; Chang, Dingran; Zhang, Wenqing; Tram, Kha; Lee, Christine; Kim, Peter; Salena, Bruno J; Li, Yingfu

    2016-02-01

    Pathogenic strains of bacteria are known to cause various infectious diseases and there is a growing demand for molecular probes that can selectively recognize them. Here we report a special DNAzyme (catalytic DNA), RFD-CD1, that shows exquisite specificity for a pathogenic strain of Clostridium difficile (C. difficile). RFD-CD1 was derived by an in vitro selection approach where a random-sequence DNA library was allowed to react with an unpurified molecular mixture derived from this strain of C. difficle, coupled with a subtractive selection strategy to eliminate cross-reactivities to unintended C. difficile strains and other bacteria species. RFD-CD1 is activated by a truncated version of TcdC, a transcription factor, that is unique to the targeted strain of C. difficle. Our study demonstrates for the first time that in vitro selection offers an effective approach for deriving functional nucleic acid probes that are capable of achieving strain-specific recognition of bacterial pathogens. PMID:26676768

  16. Bacterial cell wall-induced arthritis: chemical composition and tissue distribution of four Lactobacillus strains.

    PubMed

    Simelyte, E; Rimpiläinen, M; Lehtonen, L; Zhang, X; Toivanen, P

    2000-06-01

    To study what determines the arthritogenicity of bacterial cell walls, cell wall-induced arthritis in the rat was applied, using four strains of Lactobacillus. Three of the strains used proved to induce chronic arthritis in the rat; all were Lactobacillus casei. The cell wall of Lactobacillus fermentum did not induce chronic arthritis. All arthritogenic bacterial cell walls had the same peptidoglycan structure, whereas that of L. fermentum was different. Likewise, all arthritogenic cell walls were resistant to lysozyme degradation, whereas the L. fermentum cell wall was lysozyme sensitive. Muramic acid was observed in the liver, spleen, and lymph nodes in considerably larger amounts after injection of an arthritogenic L. casei cell wall than following injection of a nonarthritogenic L. fermentum cell wall. The L. casei cell wall also persisted in the tissues longer than the L. fermentum cell wall. The present results, taken together with those published previously, underline the possibility that the chemical structure of peptidoglycan is important in determining the arthritogenicity of the bacterial cell wall. PMID:10816508

  17. Phenotypic and phylogenetic characterization of an abamectin-degrading bacterial strain isolated from a citrus orchard.

    PubMed

    Ali, Shinawar Waseem; Yu, Fang-Bo; Haider, Muhammad Saleem; Yan, Xin; Li, Shun-Peng

    2013-01-01

    Bacterial strain GB-01 was isolated from abamectin-contaminated soils by continuous enrichment culture. The preliminary identification of strain GB-01 as a Burkholderia species was based mainly on simple biochemical and substrate utilization tests; however, these tests alone cannot accurately differentiate all the species within the genus Burkholderia. The strain GB-01 was subjected to taxonomic analysis through a polyphasic approach, in which phenotypic, genotypic, and phylogenetic information was gathered to conclude the classification of this microbe. Phenotypic information comes from basic bacteriological tests and substrate utilization patterns using the Biolog GN2 MicroPlating system and automated miniature biochemical test kits, i.e. API 20 NE, ID 32 GN and API 50 CH, as well as analyzing the whole cell fatty acid profile. Genotypic information was gathered from whole genome DNA base composition (G+C mol%), and DNA-DNA hybridization with its closest species, while phylogenetic information was collected from the comparative analysis of 16S rRNA and recA gene sequences. The results of polyphasic analysis concluded that strain GB-01 is an atypical strain of the Burkholderia diffusa species. PMID:23863292

  18. Bacterial strains isolated from river water having the ability to split alcohol ethoxylates by central fission.

    PubMed

    Budnik, Irena; Zembrzuska, Joanna; Lukaszewski, Zenon

    2016-07-01

    Alcohol ethoxylates (AE) are a major component of the surfactant stream discharged into surface water. The "central fission" of AE with the formation of poly(ethylene glycols) (PEG) is considered to be the dominant biodegradation pathway. However, information as to which bacterial strains are able to perform this reaction is very limited. The aim of this work was to establish whether such an ability is unique or common, and which bacterial strains are able to split AE used as a sole source of organic carbon. Four bacterial strains were isolated from river water and were identified on the basis of phylogenetic trees as Enterobacter strain Z2, Enterobacter strain Z3, Citrobacter freundii strain Z4, and Stenotrophomonas strain Z5. Sterilized river water and "artificial sewage" were used for augmentation of the isolated bacteria. The test was performed in bottles filled with a mineral salt medium spiked with surfactant C12E10 (10 mg L(-1)) and an inoculating suspension of the investigated bacterial strain. Sequential extraction of the tested samples by ethyl acetate and chloroform was used for separation of PEG from the water matrix. LC-MS was used for PEG determination on the basis of single-ion chromatograms. All four selected and investigated bacterial strains exhibit the ability to split fatty alcohol ethoxylates with the production of PEG, which is evidence that this property is a common one rather than specific to certain bacterial strains. However, this ability increases in the sequence: Stenotrophomonas strain Z5 < Enterobacter strain Z2 < Enterobacter strain Z3 = Citrobacter freundii strain Z4. Graphical Abstract Biodegradation by central fission of alcohol ethoxylates by bacterial strains isolated from river water. PMID:27053052

  19. Design of minimally strained nucleic Acid nanotubes.

    PubMed

    Sherman, William B; Seeman, Nadrian C

    2006-06-15

    A practical theoretical framework is presented for designing and classifying minimally strained nucleic acid nanotubes. The structures are based on the double crossover motif where each double-helical domain is connected to each of its neighbors via two or more Holliday-junction-like reciprocal exchanges, such that each domain is parallel to the main tube axis. Modeling is based on a five-parameter characterization of the segmented double-helical structure. Once the constraint equations have been derived, the primary design problem for a minimally strained N-domain structure is reduced to solving three simultaneous equations in 2N+2 variables. Symmetry analysis and tube merging then allow for the design of a wide variety of tubes, which can be tailored to satisfy requirements such as specific inner and outer radii, or multiple lobed structures. The general form of the equations allows similar techniques to be applied to various nucleic acid helices: B-DNA, A-DNA, RNA, DNA-PNA, or others. Possible applications for such tubes include nanoscale scaffolding as well as custom-shaped enclosures for other nano-objects. PMID:16581842

  20. Typing of Histoplasma capsulatum strains by fatty acid profile analysis

    PubMed Central

    Zarnowski, Robert; Miyazaki, Makoto; Dobrzyn, Agnieszka; Ntambi, James M.; Woods, Jon P.

    2009-01-01

    The performance of fatty acid profiling for strain differentiation of Histoplasma capsulatum was assessed. Total fatty acids were isolated from the yeast-phase cells of seven stock and two previously unreported clinical strains of H. capsulatum var. capsulatum, as well as from one unreported clinical strain and one stock strain of H. capsulatum var. duboisii, and one strain of each of three other dimorphic zoopathogenic fungal species, Blastomyces dermatitidis, Paracoccidioides brasiliensis and Sporothrix schenckii. Different colony morphology and pigmentation types of the H. capsulatum strains were also included. The most frequently occurring fatty acids were oleic, palmitic, stearic and linoleic acids. There were variations in the relative percentage fatty acid contents of H. capsulatum strains that could be used for strain identification and discrimination. Differentiation between H. capsulatum strains was achieved by the comparison of detected fatty acids accompanied by principal component analysis using calculated Varimax-rotated principal component loadings. Statistical analysis yielded three major principal components that explained over 94% of total variance in the data. All the strains of H. capsulatum var. capsulatum RFLP classes II and III were grouped into two distinct clusters: the heterogenic RFLP class I formed a large, but also well-defined group, whereas the outgroup strains of H. capsulatum var. duboisii, B. dermatitidis, P. brasiliensis and S. schenckii were shifted away. These data suggest that fatty acid profiling can be used in H. capsulatum strain classification and epidemiological studies that require strain differentiation at the intraspecies level. PMID:17510264

  1. Citramalic acid in cerebrospinal fluid of patients with bacterial meningitis.

    PubMed

    Perlman, S; Carr, S A

    1984-07-01

    Cerebrospinal fluid (CSF) from uninfected patients and from patients with bacterial and viral meningitis was analyzed by gas-liquid chromatography, with use of a flame ionization detector, and by gas chromatography-mass spectrometry. The resulting profiles were consistent and reproducible. Hydroxy acids were the compounds found in greatest abundance in both normal and infected CSF. Control experiments to establish the sensitivity and efficiency of the extraction and derivatization methods are also presented. Constituents of CSF from patients with bacterial meningitis differed quantitatively and qualitatively from those of CSF from uninfected patients or patients with nonbacterial infections. CSF from seven of eight patients with bacterial meningitis contained citramalic acid, a compound not previously identified in either normal or infected CSF. The implications of these findings are discussed. PMID:6145530

  2. Indole-3-acetic acid biosynthetic pathway and aromatic amino acid aminotransferase activities in Pantoea dispersa strain GPK.

    PubMed

    Kulkarni, G B; Nayak, A S; Sajjan, S S; Oblesha, A; Karegoudar, T B

    2013-05-01

    This investigation deals with the production of IAA by a bacterial isolate Pantoea dispersa strain GPK (PDG) identified by 16S rRNA gene sequence analysis. HPLC and Mass spectral analysis of metabolites from bacterial spent medium revealed that, IAA production by PDG is Trp-dependent and follows indole-3-pyruvic acid (IPyA) pathway. Substrate specificity study of aromatic amino acid aminotransferase (AAT) showed high activities, only when tryptophan (Trp) and α-ketoglutarate (α-kg) were used as substrates. AAT is highly specific for Trp and α-kg as amino group donor and acceptor, respectively. The effect of exogenous IAA on bacterial growth was established. Low concentration of exogenous IAA induced the growth, whereas high concentration decreased the growth of bacterium. PDG treatment significantly increased the root length, shoot length and dry mass of the chickpea and pigeon pea plants. PMID:23448265

  3. [[sup 3]H] Thymidine incorporation to estimate growth rates of anaerobic bacterial strains

    SciTech Connect

    Winding, A. )

    1992-08-01

    The incorporation of [[sup 3]H] thymidine by axenic cultures of anaerobic bacteria was investigated as a means to measure growth. The three fermentative strains and one of the methanogenic strains tested incorporated [[sup 3]H] thymidine during growth. It is concluded that the [[sup 3]H] thymidine incorporation method underestimates bacterial growth in anaerobic environments.

  4. Recurrent osteomyelitis caused by infection with different bacterial strains without obvious source of reinfection.

    PubMed

    Uçkay, Ilker; Assal, Mathieu; Legout, Laurence; Rohner, Peter; Stern, Richard; Lew, Daniel; Hoffmeyer, Pierre; Bernard, Louis

    2006-03-01

    Recurrence of osteomyelitis by the same bacterial strain is well known. We report three patients with a second episode of osteomyelitis at the same site caused by different strains of bacteria from the original. Formerly infected and altered bone surface might present a region of diminished resistance for a new infection. PMID:16517930

  5. Recurrent Osteomyelitis Caused by Infection with Different Bacterial Strains without Obvious Source of Reinfection

    PubMed Central

    Uçkay, Ilker; Assal, Mathieu; Legout, Laurence; Rohner, Peter; Stern, Richard; Lew, Daniel; Hoffmeyer, Pierre; Bernard, Louis

    2006-01-01

    Recurrence of osteomyelitis by the same bacterial strain is well known. We report three patients with a second episode of osteomyelitis at the same site caused by different strains of bacteria from the original. Formerly infected and altered bone surface might present a region of diminished resistance for a new infection. PMID:16517930

  6. Lysozyme-coated silver nanoparticles for differentiating bacterial strains on the basis of antibacterial activity

    NASA Astrophysics Data System (ADS)

    Ashraf, Sumaira; Chatha, Mariyam Asghar; Ejaz, Wardah; Janjua, Hussnain Ahmed; Hussain, Irshad

    2014-10-01

    Lysozyme, an antibacterial enzyme, was used as a stabilizing ligand for the synthesis of fairly uniform silver nanoparticles adopting various strategies. The synthesized particles were characterized using UV-visible spectroscopy, FTIR, dynamic light scattering (DLS), and TEM to observe their morphology and surface chemistry. The silver nanoparticles were evaluated for their antimicrobial activity against several bacterial species and various bacterial strains within the same species. The cationic silver nanoparticles were found to be more effective against Pseudomonas aeruginosa 3 compared to other bacterial species/strains investigated. Some of the bacterial strains of the same species showed variable antibacterial activity. The difference in antimicrobial activity of these particles has led to the conclusion that antimicrobial products formed from silver nanoparticles may not be equally effective against all the bacteria. This difference in the antibacterial activity of silver nanoparticles for different bacterial strains from the same species may be due to the genome islands that are acquired through horizontal gene transfer (HGT). These genome islands are expected to possess some genes that may encode enzymes to resist the antimicrobial activity of silver nanoparticles. These silver nanoparticles may thus also be used to differentiate some bacterial strains within the same species due to variable silver resistance of these variants, which may not possible by simple biochemical tests.

  7. Lysozyme-coated silver nanoparticles for differentiating bacterial strains on the basis of antibacterial activity

    PubMed Central

    2014-01-01

    Lysozyme, an antibacterial enzyme, was used as a stabilizing ligand for the synthesis of fairly uniform silver nanoparticles adopting various strategies. The synthesized particles were characterized using UV-visible spectroscopy, FTIR, dynamic light scattering (DLS), and TEM to observe their morphology and surface chemistry. The silver nanoparticles were evaluated for their antimicrobial activity against several bacterial species and various bacterial strains within the same species. The cationic silver nanoparticles were found to be more effective against Pseudomonas aeruginosa 3 compared to other bacterial species/strains investigated. Some of the bacterial strains of the same species showed variable antibacterial activity. The difference in antimicrobial activity of these particles has led to the conclusion that antimicrobial products formed from silver nanoparticles may not be equally effective against all the bacteria. This difference in the antibacterial activity of silver nanoparticles for different bacterial strains from the same species may be due to the genome islands that are acquired through horizontal gene transfer (HGT). These genome islands are expected to possess some genes that may encode enzymes to resist the antimicrobial activity of silver nanoparticles. These silver nanoparticles may thus also be used to differentiate some bacterial strains within the same species due to variable silver resistance of these variants, which may not possible by simple biochemical tests. PMID:25435831

  8. [Antibiotypes of bacterial strains isolated from patients at the intensive care units].

    PubMed

    Vega, S; Atencio, M P; Quintero, A; Sinclair, J; Toala, P

    1999-01-01

    The indiscriminate use of antibiotics in intensive care units has permitted the selection of multiple resistant bacterial strains in the hospital setting. Antibiograms present the sensitivity or resistance of these strains to drugs in current use. In this study, 100 bacterial strains were isolated from patients on medical and surgical ICU wards. The strains were identified by API-20E and sensitivity testing was performed by the E-test procedure. MIC were further analyzed with the WHONET software wich permits the identification of antibiotypes. Acinetobacter anitratus, Pseudomona aeruginosa and Enterobacter cloacae were the most resistant strains. Nine antibiotypes were determinated for A. Anitratus. Predominant strain presented antibiotypes with multiple resistance to ten antibiotics. P. aeruginosa presented 10 antibiotypes, the predominant one being CTX, CRO, CTX. Antibiotype determination allows phenotypic identification or resistance patterns in particular species as well as facilitates follow up and recognition of its epidemiological distribution. PMID:12442733

  9. Bacterial defluorination of 4-fluoroglutamic acid.

    PubMed

    Donnelly, Clár; Murphy, Cormac D

    2007-12-01

    Fluorinated amino acids are used as enzyme inhibitors, mechanistic probes and in the production of pharmacologically active peptides. Because enantiomerically pure 4-fluoroglutamate is difficult to prepare, the selective degradation of the L-isomer is a potentially convenient method of obtaining D-4-fluoroglutamate from the racemate. In this paper, we describe our investigations on the degradation of 4-fluoroglutamate by bacteria. Fluoride ion was detected in resting-cell cultures of a number of bacteria that were incubated with racemic 4-fluoroglutamate. Analysis of the culture supernatants by chiral gas chromatography-mass spectrometry revealed that only the L-isomer was degraded. The degradation of 4-fluoroglutamate was also examined in cell-free extracts of Streptomyces cattleya and Proteus mirabilis, and it was observed that equimolar concentrations of fluoride ion and ammonia were generated. The activity was located in the soluble fraction of cell extracts, thus is not related to the L-2-amino-4-chloro-4-pentenoic acid dehydrochlorinase previously identified in membrane fractions of P. mirabilis. PMID:17901951

  10. How Fitness Reduced, Antimicrobial Resistant Bacteria Survive and Spread: A Multiple Pig - Multiple Bacterial Strain Model

    PubMed Central

    Græsbøll, Kaare; Nielsen, Søren Saxmose; Toft, Nils; Christiansen, Lasse Engbo

    2014-01-01

    More than 30% of E. coli strains sampled from pig farms in Denmark over the last five years were resistant to the commonly used antimicrobial tetracycline. This raises a number of questions: How is this high level sustained if resistant bacteria have reduced growth rates? Given that there are multiple susceptible and resistant bacterial strains in the pig intestines, how can we describe their coexistence? To what extent does the composition of these multiple strains in individual pigs influence the total bacterial population of the pig pen? What happens to a complex population when antimicrobials are used? To investigate these questions, we created a model where multiple strains of bacteria coexist in the intestines of pigs sharing a pen, and explored the parameter limits of a stable system; both with and without an antimicrobial treatment. The approach taken is a deterministic bacterial population model with stochastic elements of bacterial distributions and transmission. The rates that govern the model are process-oriented to represent growth, excretion, and uptake from environment, independent of herd and meta-population structures. Furthermore, an entry barrier and elimination process for the individual strains in each pig were implemented. We demonstrate how competitive growth between multiple bacterial strains in individual pigs, and the transmission between pigs in a pen allow for strains of antimicrobial resistant bacteria to persist in a pig population to different extents, and how quickly they can become dominant if antimicrobial treatment is initiated. The level of spread depends in a non-linear way of the parameters that govern excretion and uptake. Furthermore, the sampling of initial distributions of strains and stochastic transmission events give rise to large variation in how homogenous and how resistant the bacterial population becomes. Most important: resistant bacteria are demonstrated to survive with a disadvantage in growth rate of well over 10

  11. Immune modulation of blood leukocytes in humans by lactic acid bacteria: criteria for strain selection.

    PubMed

    Schiffrin, E J; Brassart, D; Servin, A L; Rochat, F; Donnet-Hughes, A

    1997-08-01

    Lactic acid bacteria in food can transiently colonize the intestine and exert beneficial effects (probiotic). Survival during intestinal transit or adhesion to epithelium or both seem to be important for modifying the host's immune reactivity. Because Lactobacillus acidophilus strain La1 is adherent to enterocytes in vitro, we hypothesize that contact with immune cells may occur in vivo. However, Bifidobacterium bifidum strain Bb12, which shows high fecal colonization, is another potential immunomodulator. Twenty-eight volunteers were divided into two groups and given a fermented product containing one of the two strains. Lymphocyte subsets and leukocyte phagocytic activity were studied in blood. No modifications were detected in lymphocyte subsets. In contrast, phagocytosis of Escherichia coli ssp. was enhanced in both groups (P < 0.001 for both). Bacterial adhesion to enterocytes, fecal colonization, or both seem to be valuable selection criteria for immunomodulation. Antiinfective mechanisms of defense can be enhanced after ingestion of specific lactic acid bacteria strains. PMID:9250141

  12. Superhydrophobic poly(L-lactic acid) surface as potential bacterial colonization substrate

    PubMed Central

    2011-01-01

    Hydrophobicity is a very important surface property and there is a growing interest in the production and characterization of superhydrophobic surfaces. Accordingly, it was recently shown how to obtain a superhydrophobic surface using a simple and cost-effective method on a polymer named poly(L-lactic acid) (PLLA). To evaluate the ability of such material as a substrate for bacterial colonization, this work assessed the capability of different bacteria to colonize a biomimetic rough superhydrophobic (SH) PLLA surface and also a smooth hydrophobic (H) one. The interaction between these surfaces and bacteria with different morphologies and cell walls was studied using one strain of Staphylococcus aureus and one of Pseudomonas aeruginosa. Results showed that both bacterial strains colonized the surfaces tested, although significantly higher numbers of S. aureus cells were found on SH surfaces comparing to H ones. Moreover, scanning electron microscopy images showed an extracellular matrix produced by P. aeruginosa on SH PLLA surfaces, indicating that this bacterium is able to form a biofilm on such substratum. Bacterial removal through lotus leaf effect was also tested, being more efficient on H coupons than on SH PLLA ones. Overall, the results showed that SH PLLA surfaces can be used as a substrate for bacterial colonization and, thus, have an exceptional potential for biotechnology applications. PMID:22018163

  13. Modified MALDI MS fatty acid profiling for bacterial identification.

    PubMed

    Voorhees, Kent J; Jensen, Kirk R; McAlpin, Casey R; Rees, Jon C; Cody, Robert; Ubukata, Masaaki; Cox, Christopher R

    2013-07-01

    Bacterial fatty acid profiling is a well-established technique for bacterial identification. Ten bacteria were analyzed using both positive- and negative-ion modes with a modified matrix-assisted laser desorption ionization mass spectrometry (MALDI MS) approach using CaO as a matrix replacement (metal oxide laser ionization MS (MOLI MS)). The results show that reproducible lipid cleavage similar to thermal in situ tetramethyl ammonium hydroxide saponification/derivatization had occurred. Principal component analysis showed that replicates from each organism grouped in a unique space. Cross validation (CV) of spectra from both ionization modes resulted in greater than 94% validation of the data. When CV results were compared for the two ionization modes, negative-ion data produced a superior outcome. MOLI MS provides clinicians a rapid, reproducible and cost-effective bacterial diagnostic tool. PMID:23832941

  14. Lactic Acid Bacterial Starter Culture with Antioxidant and γ-Aminobutyric Acid Biosynthetic Activities Isolated from Flatfish-Sikhae Fermentation.

    PubMed

    Won, Yeong Geol; Yu, Hyun-Hee; Chang, Young-Hyo; Hwang, Han-Joon

    2015-12-01

    The aim of this study is to select a lactic acid bacterial strain as a starter culture for flatfish-Sikhae fermentation and to evaluate its suitability for application in a food system. Four strains of lactic acid bacteria isolated from commercial flatfish-Sikhae were identified and selected as starter culture candidates through investigation of growth rates, salt tolerance, food safety, and functional properties such as antioxidative and antimicrobial activities. The fermentation properties of the starter candidates were also examined in food systems prepared with these strains (candidate batch) in comparison with a spontaneous fermentation process without starter culture (control batch) at 15°C. The results showed that the candidate YG331 batch had better fermentation properties such as viable cell count, pH, and acidity than the other experimental batches, including the control batch. The results are expressed according to selection criteria based on a preliminary sensory evaluation and physiochemical investigation. Also, only a small amount of histamine was detected with the candidate YG331 batch. The radical scavenging activity of the candidate batches was better compared with the control batch, and especially candidate YG331 batch showed the best radical scavenging activity. Also, we isolated another starter candidate (identified as Lactobacillus brevis PM03) with γ-aminobutyric acid (GABA)-producing activity from commercial flatfish-Sikhae products. The sensory scores of the candidate YG331 batch were better than those of the other experimental batches in terms of flavor, color, and overall acceptance. In this study, we established selection criteria for the lactic acid bacterial starter for the flatfish-Sikhae production and finally selected candidate YG331 as the most suitable starter. PMID:26348620

  15. Volatile Emissions from Mycobacterium avium subsp. paratuberculosis Mirror Bacterial Growth and Enable Distinction of Different Strains

    PubMed Central

    Trefz, Phillip; Koehler, Heike; Klepik, Klaus; Moebius, Petra; Reinhold, Petra; Schubert, Jochen K.; Miekisch, Wolfram

    2013-01-01

    Control of paratuberculosis in livestock is hampered by the low sensitivity of established direct and indirect diagnostic methods. Like other bacteria, Mycobacterium avium subsp. paratuberculosis (MAP) emits volatile organic compounds (VOCs). Differences of VOC patterns in breath and feces of infected and not infected animals were described in first pilot experiments but detailed information on potential marker substances is missing. This study was intended to look for characteristic volatile substances in the headspace of cultures of different MAP strains and to find out how the emission of VOCs was affected by density of bacterial growth. One laboratory adapted and four field strains, three of MAP C-type and one MAP S-type were cultivated on Herrold’s egg yolk medium in dilutions of 10-0, 10-2, 10-4 and 10-6. Volatile substances were pre-concentrated from the headspace over the MAP cultures by means of Solid Phase Micro Extraction (SPME), thermally desorbed from the SPME fibers and separated and identified by means of GC-MS. Out of the large number of compounds found in the headspace over MAP cultures, 34 volatile marker substances could be identified as potential biomarkers for growth and metabolic activity. All five MAP strains could clearly be distinguished from blank culture media by means of emission patterns based on these 34 substances. In addition, patterns of volatiles emitted by the reference strain were significantly different from the field strains. Headspace concentrations of 2-ethylfuran, 2-methylfuran, 3-methylfuran, 2-pentylfuran, ethyl acetate, 1-methyl-1-H-pyrrole and dimethyldisulfide varied with density of bacterial growth. Analysis of VOCs emitted from mycobacterial cultures can be used to identify bacterial growth and, in addition, to differentiate between different bacterial strains. VOC emission patterns may be used to approximate bacterial growth density. In a perspective volatile marker substances could be used to diagnose MAP

  16. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors

    PubMed Central

    Getino, María; Fernández-López, Raúl; Palencia-Gándara, Carolina; Campos-Gómez, Javier; Sánchez-López, Jose M.; Martínez, Marta; Fernández, Antonio; de la Cruz, Fernando

    2016-01-01

    Bacterial conjugation is the main mechanism for the dissemination of multiple antibiotic resistance in human pathogens. This dissemination could be controlled by molecules that interfere with the conjugation process. A search for conjugation inhibitors among a collection of 1,632 natural compounds, identified tanzawaic acids A and B as best hits. They specially inhibited IncW and IncFII conjugative systems, including plasmids mobilized by them. Plasmids belonging to IncFI, IncI, IncL/M, IncX and IncH incompatibility groups were targeted to a lesser extent, whereas IncN and IncP plasmids were unaffected. Tanzawaic acids showed reduced toxicity in bacterial, fungal or human cells, when compared to synthetic conjugation inhibitors, opening the possibility of their deployment in complex environments, including natural settings relevant for antibiotic resistance dissemination. PMID:26812051

  17. Two UDP-glucuronic acid decarboxylases involved in the biosynthesis of a bacterial exopolysaccharide in Paenibacillus elgii.

    PubMed

    Li, Ou; Qian, Chao-Dong; Zheng, Dao-Qiong; Wang, Pin-Mei; Liu, Yu; Jiang, Xin-Hang; Wu, Xue-Chang

    2015-04-01

    Xylose is described as a component of bacterial exopolysaccharides in only a limited number of bacterial strains. A bacterial strain, Paenibacillus elgii, B69 was shown to be efficient in producing a xylose-containing exopolysaccharide. Sequence analysis was performed to identify the genes encoding the uridine diphosphate (UDP)-glucuronic acid decarboxylase required for the synthesis of UDP-xylose, the precursor of the exopolysaccharide. Two sequences, designated as Peuxs1 and Peuxs2, were found as the candidate genes for such enzymes. The activities of the UDP-glucuronic acid decarboxylases were proven by heterologous expression and real-time nuclear magnetic resonance analysis. The intracellular activity and effect of these genes on the synthesis of exopolysaccharide were further investigated by developing a thymidylate synthase based knockout system. This system was used to substitute the conventional antibiotic resistance gene system in P. elgii, a natural multi-antibiotic resistant strain. Results of intracellular nucleotide sugar analysis showed that the intracellular UDP-xylose and UDP-glucuronic acid levels were affected in Peuxs1 or Peuxs2 knockout strains. The knockout of either Peuxs1 or Peuxs2 reduced the polysaccharide production and changed the monosaccharide ratio. No polysaccharide was found in the Peuxs1/Peuxs2 double knockout strain. Our results show that P. elgii can be efficient in forming UDP-xylose, which is then used for the synthesis of xylose-containing exopolysaccharide. PMID:25573472

  18. Simultaneous production of acetic and gluconic acids by a thermotolerant Acetobacter strain during acetous fermentation in a bioreactor.

    PubMed

    Mounir, Majid; Shafiei, Rasoul; Zarmehrkhorshid, Raziyeh; Hamouda, Allal; Ismaili Alaoui, Mustapha; Thonart, Philippe

    2016-02-01

    The activity of bacterial strains significantly influences the quality and the taste of vinegar. Previous studies of acetic acid bacteria have primarily focused on the ability of bacterial strains to produce high amounts of acetic acid. However, few studies have examined the production of gluconic acid during acetous fermentation at high temperatures. The production of vinegar at high temperatures by two strains of acetic acid bacteria isolated from apple and cactus fruits, namely AF01 and CV01, respectively, was evaluated in this study. The simultaneous production of gluconic and acetic acids was also examined in this study. Biochemical and molecular identification based on a 16s rDNA sequence analysis confirmed that these strains can be classified as Acetobacter pasteurianus. To assess the ability of the isolated strains to grow and produce acetic acid and gluconic acid at high temperatures, a semi-continuous fermentation was performed in a 20-L bioreactor. The two strains abundantly grew at a high temperature (41°C). At the end of the fermentation, the AF01 and CV01 strains yielded acetic acid concentrations of 7.64% (w/v) and 10.08% (w/v), respectively. Interestingly, CV01 was able to simultaneously produce acetic and gluconic acids during acetic fermentation, whereas AF01 mainly produced acetic acid. In addition, CV01 was less sensitive to ethanol depletion during semi-continuous fermentation. Finally, the enzymatic study showed that the two strains exhibited high ADH and ALDH enzyme activity at 38°C compared with the mesophilic reference strain LMG 1632, which was significantly susceptible to thermal inactivation. PMID:26253254

  19. Pilot Screening to Determine Antimicrobial Synergies in a Multidrug-Resistant Bacterial Strain Library.

    PubMed

    Kim, Si-Hyun; Park, Chulmin; Chun, Hye-Sun; Lee, Dong-Gun; Choi, Jae-Ki; Lee, Hyo-Jin; Cho, Sung-Yeon; Park, Sun Hee; Choi, Su-Mi; Choi, Jung-Hyun; Yoo, Jin-Hong

    2016-07-01

    With the rise in multidrug-resistant (MDR) bacterial infections, there has been increasing interest in combinations of ≥2 antimicrobial agents with synergistic effects. We established an MDR bacterial strain library to screen for in vitro antimicrobial synergy by using a broth microdilution checkerboard method and high-throughput luciferase-based bacterial cell viability assay. In total, 39 MDR bacterial strains, including 23 carbapenem-resistant gram-negative bacteria, 9 vancomycin-intermediate Staphylococcus aureus, and 7 vancomycin-resistant Enterococcus faecalis, were used to screen for potential antimicrobial synergies. Synergies were more frequently identified with combinations of imipenem plus trimethoprim-sulfamethoxazole for carbapenem-resistant Acinetobacter baumannii in the library. To verify this finding, we tested 34 A. baumannii clinical isolates resistant to both imipenem and trimethoprim-sulfamethoxazole by the checkerboard method. The imipenem plus trimethoprim-sulfamethoxazole combination showed synergy in the treatment of 21 (62%) of the clinical isolates. The results indicate that pilot screening for antimicrobial synergy in the MDR bacterial strain library could be valuable in the selection of combination therapeutic regimens to treat MDR bacterial infections. Further studies are warranted to determine whether this screening system can be useful to screen for the combined effects of conventional antimicrobials and new-generation antimicrobials or nonantimicrobials. PMID:26974861

  20. Pilot Screening to Determine Antimicrobial Synergies in a Multidrug-Resistant Bacterial Strain Library

    PubMed Central

    Kim, Si-Hyun; Park, Chulmin; Chun, Hye-Sun; Choi, Jae-Ki; Lee, Hyo-Jin; Cho, Sung-Yeon; Park, Sun Hee; Choi, Su-Mi; Choi, Jung-Hyun; Yoo, Jin-Hong

    2016-01-01

    With the rise in multidrug-resistant (MDR) bacterial infections, there has been increasing interest in combinations of ≥2 antimicrobial agents with synergistic effects. We established an MDR bacterial strain library to screen for in vitro antimicrobial synergy by using a broth microdilution checkerboard method and high-throughput luciferase-based bacterial cell viability assay. In total, 39 MDR bacterial strains, including 23 carbapenem-resistant gram-negative bacteria, 9 vancomycin-intermediate Staphylococcus aureus, and 7 vancomycin-resistant Enterococcus faecalis, were used to screen for potential antimicrobial synergies. Synergies were more frequently identified with combinations of imipenem plus trimethoprim–sulfamethoxazole for carbapenem-resistant Acinetobacter baumannii in the library. To verify this finding, we tested 34 A. baumannii clinical isolates resistant to both imipenem and trimethoprim–sulfamethoxazole by the checkerboard method. The imipenem plus trimethoprim–sulfamethoxazole combination showed synergy in the treatment of 21 (62%) of the clinical isolates. The results indicate that pilot screening for antimicrobial synergy in the MDR bacterial strain library could be valuable in the selection of combination therapeutic regimens to treat MDR bacterial infections. Further studies are warranted to determine whether this screening system can be useful to screen for the combined effects of conventional antimicrobials and new-generation antimicrobials or nonantimicrobials. PMID:26974861

  1. Increasing viscosity and yields of bacterial exopolysaccharides by repeatedly exposing strains to ampicillin.

    PubMed

    Li, Ou; Liu, Ao; Lu, Cui; Zheng, Dao-qiong; Qian, Chao-dong; Wang, Pin-Mei; Jiang, Xin-Hang; Wu, Xue-Chang

    2014-09-22

    A universal method to enhance productivity and viscosity of bacterial exopolysaccharides was developed. The technique was based on the principle that ampicillin can inhibit the biosynthesis of peptidoglycan, which shares a common synthetic pathway with that of bacterial exopolysaccharides. Serial passages of three typical representatives of bacterial EPS-producing strains, namely Sphingomonas elodea, Xanthomonas campestris, and Paenibacillus elgii, were subjected to ampicillin, which was used as a stressor and a mutagen. These mutant strains are advantageous over other strains because of two major factors. First, all of the resulting strains were almost mutants with increase in EPS productivity and viscosity. Second, isolated serial strains showed different levels of increase in EPS production and viscosity to satisfy the different requirements of practical applications. No differences were observed in the monosaccharide composition produced by the mutant and parent strains; however, high-viscosity mutant strains exhibited higher molecular weights. The results confirmed that the developed method is a controlled universal one that can improve exopolysaccharides productivity and viscosity. PMID:24906747

  2. The Mechanism for Type I Interferon Induction by Mycobacterium tuberculosis is Bacterial Strain-Dependent.

    PubMed

    Wiens, Kirsten E; Ernst, Joel D

    2016-08-01

    Type I interferons (including IFNαβ) are innate cytokines that may contribute to pathogenesis during Mycobacterium tuberculosis (Mtb) infection. To induce IFNβ, Mtb must gain access to the host cytosol and trigger stimulator of interferon genes (STING) signaling. A recently proposed model suggests that Mtb triggers STING signaling through bacterial DNA binding cyclic GMP-AMP synthase (cGAS) in the cytosol. The aim of this study was to test the generalizability of this model using phylogenetically distinct strains of the Mtb complex (MTBC). We infected bone marrow derived macrophages with strains from MTBC Lineages 2, 4 and 6. We found that the Lineage 6 strain induced less IFNβ, and that the Lineage 2 strain induced more IFNβ, than the Lineage 4 strain. The strains did not differ in their access to the host cytosol and IFNβ induction by each strain required both STING and cGAS. We also found that the three strains shed similar amounts of bacterial DNA. Interestingly, we found that the Lineage 6 strain was associated with less mitochondrial stress and less mitochondrial DNA (mtDNA) in the cytosol compared with the Lineage 4 strain. Treating macrophages with a mitochondria-specific antioxidant reduced cytosolic mtDNA and inhibited IFNβ induction by the Lineage 2 and 4 strains. We also found that the Lineage 2 strain did not induce more mitochondrial stress than the Lineage 4 strain, suggesting that additional pathways contribute to higher IFNβ induction. These results indicate that the mechanism for IFNβ by Mtb is more complex than the established model suggests. We show that mitochondrial dynamics and mtDNA contribute to IFNβ induction by Mtb. Moreover, we show that the contribution of mtDNA to the IFNβ response varies by MTBC strain and that additional mechanisms exist for Mtb to induce IFNβ. PMID:27500737

  3. The Mechanism for Type I Interferon Induction by Mycobacterium tuberculosis is Bacterial Strain-Dependent

    PubMed Central

    Wiens, Kirsten E.; Ernst, Joel D.

    2016-01-01

    Type I interferons (including IFNαβ) are innate cytokines that may contribute to pathogenesis during Mycobacterium tuberculosis (Mtb) infection. To induce IFNβ, Mtb must gain access to the host cytosol and trigger stimulator of interferon genes (STING) signaling. A recently proposed model suggests that Mtb triggers STING signaling through bacterial DNA binding cyclic GMP-AMP synthase (cGAS) in the cytosol. The aim of this study was to test the generalizability of this model using phylogenetically distinct strains of the Mtb complex (MTBC). We infected bone marrow derived macrophages with strains from MTBC Lineages 2, 4 and 6. We found that the Lineage 6 strain induced less IFNβ, and that the Lineage 2 strain induced more IFNβ, than the Lineage 4 strain. The strains did not differ in their access to the host cytosol and IFNβ induction by each strain required both STING and cGAS. We also found that the three strains shed similar amounts of bacterial DNA. Interestingly, we found that the Lineage 6 strain was associated with less mitochondrial stress and less mitochondrial DNA (mtDNA) in the cytosol compared with the Lineage 4 strain. Treating macrophages with a mitochondria-specific antioxidant reduced cytosolic mtDNA and inhibited IFNβ induction by the Lineage 2 and 4 strains. We also found that the Lineage 2 strain did not induce more mitochondrial stress than the Lineage 4 strain, suggesting that additional pathways contribute to higher IFNβ induction. These results indicate that the mechanism for IFNβ by Mtb is more complex than the established model suggests. We show that mitochondrial dynamics and mtDNA contribute to IFNβ induction by Mtb. Moreover, we show that the contribution of mtDNA to the IFNβ response varies by MTBC strain and that additional mechanisms exist for Mtb to induce IFNβ. PMID:27500737

  4. Aflatoxin B1 binding by dairy strains of lactic acid bacteria and bifidobacteria.

    PubMed

    Peltonen, K; el-Nezami, H; Haskard, C; Ahokas, J; Salminen, S

    2001-10-01

    Various food commodities including dairy products may be contaminated with aflatoxins, which, even in small quantities, have detrimental effects on human and animal health. Several microorganisms have been reported to bind or degrade aflatoxins in foods and feeds. This study assessed the binding of aflatoxin B1 (AFB1) from contaminated solution by 20 strains of lactic acid bacteria and bifidobacteria. The selected strains are used in the food industry and comprised 12 Lactobacillus, five Bifidobacterium, and three Lactococcus strains. Bacteria and AFB1 were incubated (24 h, +37 degrees C) and the amount of unbound AFB1 was quantitated by HPLC. Between 5.6 and 59.7% AFB1 was bound from solution by these strains. Two Lactobacillus amylovorus strains and one Lactobacillus rhamnosus strain removed more than 50% AFB1 and were selected for further study. Bacterial binding of AFB1 by these strains was rapid, and more than 50% AFB1 was bound throughout a 72-h incubation period. Binding was reversible, and AFB1 was released by repeated aqueous washes. These findings further support the ability of specific strains of lactic acid bacteria to bind selected dietary contaminants. PMID:11699445

  5. Bacterial delta-aminolevulinic acid synthase activity is not essential for leghemoglobin formation in the soybean/Bradyrhizobium japonicum symbiosis

    SciTech Connect

    Guerinot, M.L.; Chelm, B.K.

    1986-03-01

    Previous studies of legume nodules have indicated that formation of the heme moiety of leghemoglobin is a function of the bacterial symbiont. The authors now show that a hemA mutant of Bradyrhizobium japonicum that cannot carry out the first step in heme biosynthesis forms fully effective nodules on soybeans. The bacterial mutant strain was constructed by first isolated the wild-type hemA gene encoding delta-aminolevulinic acid synthase (EC 2.3.1.37) from a cosmid library, using a fragment of the Rhizobium meliloti hemA gene as a hybridization probe. A deletion of the hemA gene region, generated in vitro, then was used to construct the analogous chromosomal mutation by gene-directed mutagenesis. The mutant strain had no delta-aminolevulinic acid synthase activity and was unable to grow in minimal medium unless delta-aminolevulinic acid was added. Despite its auxotrophy, the mutant strain incited nodules that appeared normal, contained heme, and were capable of high levels of acetylene reduction. These results rule out bacterial delta-aminolevulinic acid synthase activity as the exclusive source of delta-aminolevulinic acid for heme formation in soybean nodules.

  6. Transport processes and mutual interactions of three bacterial strains in saturated porous media

    NASA Astrophysics Data System (ADS)

    Stumpp, Christine; Lawrence, John R.; Hendry, M. Jim; Maloszewski, Pitor

    2010-05-01

    Transport processes of the bacterial strains Klebsiella oxytoca, Burkholderia cepacia G4PR-1 and Pseudomonas sp #5 were investigated in saturated column experiments to study the differences in transport characteristics and the mutual interactions of these strains during transport. Soil column experiments (114 mm long x 33 mm in diameter) were conducted with constant water velocities (3.9-5.7 cm/h) through a medium to coarse grained silica sand. All experiments were performed in freshly packed columns in quadruplicate. Chloride was used as tracer to determine the mean transit time, dispersivity and flow rate. It was injected as a pulse into the columns together with the bacterial strains suspended in artificial groundwater medium. In the first setup, each strain was investigated alone. In the second setup, transport processes were performed injecting two strains simultaneously. Finally, the transport characteristics were studied in successive experiments when one bacterium was resident on the sand grains prior to the introduction of the second strain. In all experiments the peak C/Co bacterial concentrations were attenuated with respect to the conservative tracer chloride and a well defined tailing was observed. A one dimensional mathematical model for advective-dispersive transport that accounts for irreversible and reversible sorption was used to analyze the bacterial breakthrough curves and tailing patterns. It was shown that the sorption parameters were different for the three strains that can be explained by the properties of the bacteria. For the species Klebsiella oxytoca and Burkholderia cepacia G4PR-the transport parameters were mostly in the same range independent of the experimental setup. However, Pseudomonas sp #5, which is a motile bacterium, showed differences in the breakthrough curves and sorption parameters during the experiments. The simultaneous and successive experiments indicated an influence on the reversible sorption processes when another

  7. Effect of probiotic bacterial strains of Lactobacillus, Bifidobacterium, and Enterococcus on enteroaggregative Escherichia coli.

    PubMed

    Miyazaki, Yoshibumi; Kamiya, Shigeru; Hanawa, Tomoko; Fukuda, Minoru; Kawakami, Hayato; Takahashi, Hidemi; Yokota, Hiroyuki

    2010-02-01

    The effects of nine probiotic strains of Lactobacillus, Bifidobacterium, and Enterococcus on the growth, adhesion activity, and biofilm formation of enteroaggregative Escherichia coli (EAggEC) were examined. The culture supernatant of the E. faecium strain, with or without pH adjustment to a neutral pH, had a strong bactericidal effect on EAggEC, including induction of membrane damage and cell lysis. Supernatants of the L. casei ss. casei and L. casei ss. rhamnosus strains also had a bactericidal effect on EAggEC, but this activity was abolished by pH adjustment to a neutral pH. No inhibitory effect of the culture supernatants of Bifidobacterium or E. faecalis strains was detected. Adhesion of EAggEC to intestinal epithelial cells was not inhibited by the bacterial strains tested. Two strains of L. casei enhanced EAggEC biofilm formation, which was characterized by increased bacterial proliferation. These results suggest that the three different bacterial species; Lactobacillus, Bifidobacterium, and Enterococcus, have different effects on EAggEC, and that further analysis is required for the practical use of these bacteria as probiotics against EAggEC infection. PMID:20054601

  8. Biodegradation of organochlorine pesticide endosulfan by bacterial strain Alcaligenes faecalis JBW4.

    PubMed

    Kong, Lingfen; Zhu, Shaoyuan; Zhu, Lusheng; Xie, Hui; Su, Kunchang; Yan, Tongxiang; Wang, Jun; Wang, Jinhua; Wang, Fenghua; Sun, Fengxia

    2013-11-01

    The recently discovered endosulfan-degrading bacterial strain Alcaligenesfaecalis JBW4 was isolated from activated sludge. This strain is able to use endosulfan as a carbon and energy source. The optimal conditions for the growth of strain JBW4 and for biodegradation by this strain were identified, and the metabolic products of endosulfan degradation were studied in detail. The maximum level of endosulfan biodegradation by strain JBW4 was obtained using broth at an initial pH of 7.0, an incubation temperature of 40 degreeC and an endosulfan concentration of 100 mg/L. The concentration of endosulfan was determined by gas chromatography. Strain JBW4 was able to degrade 87.5% of alpha-endosulfan and 83.9% of beta-endosulfan within 5 days. These degradation rates are much higher than the previously reported bacterial strains. Endosulfan diol and endosulfan lactone were the major metabolites detected by gas chromatography-mass spectrometry; endosulfan sulfate, which is a persistent and toxic metabolite, was not detected. These results suggested that A. faecalis JBW4 degrades endosulfan via a non-oxidative pathway. The biodegradation of endosulfan by A. faecalis is reported for the first time. Additionally, the present study indicates that strain JBW4 may have potential for the biodegradation of endosulfan residues. PMID:24552054

  9. Microbial Degradation of Chlorogenic Acid by a Sphingomonas sp. Strain.

    PubMed

    Ma, Yuping; Wang, Xiaoyu; Nie, Xueling; Zhang, Zhan; Yang, Zongcan; Nie, Cong; Tang, Hongzhi

    2016-08-01

    In order to elucidate the metabolism of chlorogenic acid by environmental microbes, a strain of Sphingomonas sp. isolated from tobacco leaves was cultured under various conditions, and chlorogenic acid degradation and its metabolites were investigated. The strain converting chlorogenic acid was newly isolated and identified as a Sphingomonas sp. strain by 16S rRNA sequencing. The optimal conditions for growth and chlorogenic acid degradation were 37 °C and pH 7.0 with supplementation of 1.5 g/l (NH4)2SO4 as the nitrogen source and 2 g/l chlorogenic acid as the sole carbon source. The maximum chlorogenic acid tolerating capability for the strain was 5 g/l. The main metabolites were identified as caffeic acid, shikimic acid, and 3,4-dihydroxybenzoic acid based on gas chromatography-mass spectrometry analysis. The analysis reveals the biotransformation mechanism of chlorogenic acid in microbial cells isolated from the environment. PMID:27068831

  10. 'Lascolabacter vaginalis' strain KHD1, a new bacterial species cultivated from human female genital tract.

    PubMed

    Diop, K; Mediannikov, O; Fournier, P-E; Raoult, D; Bretelle, F; Fenollar, F

    2016-09-01

    We present the major characteristics of 'Lascolabacter vaginalis' strain KHD1 (= CSUR P0109 = DSM 101752), a new member of the family Prevotellaceae that was cultivated from a vaginal sample of a 33-year-old woman with bacterial vaginosis. PMID:27358744

  11. Draft genome sequence of XANTHOMONAS ARBORICOLA strain 3004, causal agent of bacterial disease on barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report here the annotated genome sequence of XANTHOMONAS ARBORICOLA str. 3004, a Gram-negative phytopathogenic bacteria that includes several pathovars characterized by virulence specificity. Strain 3004 was isolated from barley leaves with symptoms of streak (bacterial blight) and also can infec...

  12. 'Olegusella massiliensis' strain KHD7, a new bacterial genus isolated from the female genital tract.

    PubMed

    Diop, K; Diop, A; Raoult, D; Fournier, P-E; Fenollar, F

    2016-07-01

    We report the main characteristics of 'Olegusella massiliensis' gen. nov., sp. nov., strain KHD7 (= CSUR P2268 = DSM 101849), a new member of the Coriobacteriaceae family isolated from the vaginal flora of a patient with bacterial vaginosis. PMID:27330814

  13. Limited diffusive fluxes of substrate facilitate coexistence of two competing bacterial strains.

    PubMed

    Dechesne, Arnaud; Or, Dani; Smets, Barth F

    2008-04-01

    Soils are known to support a great bacterial diversity down to the millimeter scale, but the mechanisms by which such a large diversity is sustained are largely unknown. A feature of unsaturated soils is that water usually forms thin, poorly-connected films, which limit solute diffusive fluxes. It has been proposed, but never unambiguously experimentally tested, that a low substrate diffusive flux would impact bacterial diversity, by promoting the coexistence between slow-growing bacteria and their potentially faster-growing competitors. We used a simple experimental system, based on a Petri dish and a perforated Teflon membrane to control diffusive fluxes of substrate (benzoate) whilst permitting direct observation of bacterial colonies. The system was inoculated with prescribed strains of Pseudomonas, whose growth was quantified by microscopic monitoring of the fluorescent proteins they produced. We observed that substrate diffusion limitation reduced the growth rate of the otherwise fast-growing Pseudomonas putida KT2440 strain. This strain out-competed Pseudomonas fluorescens F113 in liquid culture, but its competitive advantage was less marked on solid media, and even disappeared under conditions of low substrate diffusion. Low diffusive fluxes of substrate, characteristic of many unsaturated media (e.g. soils, food products), can thus promote bacterial coexistence in a competitive situation between two strains. This mechanism might therefore contribute to maintaining the noncompetitive diversity pattern observed in unsaturated soils. PMID:18312376

  14. Complete Genome Sequence of a Human Cytomegalovirus Strain AD169 Bacterial Artificial Chromosome Clone

    PubMed Central

    Ostermann, Eleonore; Spohn, Michael; Indenbirken, Daniela

    2016-01-01

    The complete sequence of the human cytomegalovirus strain AD169 (variant ATCC) cloned as a bacterial artificial chromosome (AD169-BAC, also known as HB15 or pHB15) was determined. The viral genome has a length of 230,290 bp and shows 52 nucleotide differences compared to a previously sequenced AD169varATCC clone. PMID:27034483

  15. Bacterial production of conjugated linoleic and linolenic Acid in foods: a technological challenge.

    PubMed

    Gorissen, Lara; Leroy, Frédéric; De Vuyst, Luc; De Smet, Stefaan; Raes, Katleen

    2015-01-01

    Conjugated linoleic acid (CLA) and conjugated linolenic acid (CLNA) isomers are present in foods derived from ruminants as a result of the respective linoleic acid (LA) and α-linolenic acid (LNA) metabolism by ruminal microorganisms and in animals' tissues. CLA and CLNA have isomer-specific, health-promoting properties, including anticarcinogenic, antiatherogenic, anti-inflammatory, and antidiabetic activity, as well as the ability to reduce body fat. Besides ruminal microorganisms, such as Butyrivibrio fibrisolvens, many food-grade bacteria, such as bifidobacteria, lactic acid bacteria (LAB), and propionibacteria, are able to convert LA and LNA to CLA and CLNA, respectively. Linoleate isomerase activity, responsible for this conversion, is strain-dependent and probably related to the ability of the producer strain to tolerate the toxic effects of LA and LNA. Since natural concentrations of CLA and CLNA in ruminal food products are relatively low to exert their health benefits, food-grade bacteria with linoleate isomerase activity could be used as starter or adjunct cultures to develop functional fermented dairy and meat products with increased levels of CLA and CLNA or included in fermented products as probiotic cultures. However, results obtained so far are below expectations due to technological bottlenecks. More research is needed to assess if bacterial production kinetics can be increased and can match food processing requirements. PMID:24915316

  16. No role for bacterially produced salicylic Acid in rhizobacterial induction of systemic resistance in Arabidopsis.

    PubMed

    Ran, L X; van Loon, L C; Bakker, P A H M

    2005-11-01

    ABSTRACT The role of bacterially produced salicylic acid (SA) in the induction of systemic resistance in plants by rhizobacteria is far from clear. The strong SA producer Pseudomonas fluorescens WCS374r induces resistance in radish but not in Arabidopsis thaliana, whereas application of SA leads to induction of resistance in both plant species. In this study, we compared P. fluorescens WCS374r with three other SA-producing fluorescent Pseudomonas strains, P. fluorescens WCS417r and CHA0r, and P. aeruginosa 7NSK2 for their abilities to produce SA under different growth conditions and to induce systemic resistance in A. thaliana against bacterial speck, caused by P. syringae pv. tomato. All strains produced SA in vitro, varying from 5 fg cell(-1) for WCS417r to >25 fg cell(-1) for WCS374r. Addition of 200 muM FeCl(3) to standard succinate medium abolished SA production in all strains. Whereas the incubation temperature did not affect SA production by WCS417r and 7NSK2, strains WCS374r and CHA0r produced more SA when grown at 33 instead of 28 degrees C. WCS417r, CHA0r, and 7NSK2 induced systemic resistance apparently associated with their ability to produce SA, but WCS374r did not. Conversely, a mutant of 7NSK2 unable to produce SA still triggered induced systemic resistance (ISR). The possible involvement of SA in the induction of resistance was evaluated using SA-nonaccumulating transgenic NahG plants. Strains WCS417r, CHA0r, and 7NSK2 induced resistance in NahG Arabidopsis. Also, WCS374r, when grown at 33 or 36 degrees C, triggered ISR in these plants, but not in ethylene-insensitive ein2 or in non-plant pathogenesis- related protein-expressing npr1 mutant plants, irrespective of the growth temperature of the bacteria. These results demonstrate that, whereas WCS374r can be manipulated to trigger ISR in Arabidopsis, SA is not the primary determinant for the induction of systemic resistance against bacterial speck disease by this bacterium. Also, for the other

  17. Emergence of potential superbug mycobacterium tuberculosis, lessons from new delhi mutant-1 bacterial strains.

    PubMed

    Nazir, Taha; Abraham, Suraj; Islam, Azharul

    2012-01-01

    Recent reports have shown that certain bacterial strains attain the New Delhi Metallo-beta-lactamase-1 (NDM-1) enzyme and become resistant to a broad range of antibiotics. Similarly, more dangerous "superbugs" of multi-drug resistant (MDR) and extensive drug resistant (XDR) Mycobacterium tuberculosis strains are gradually emerging through rapid genetic mutation caused by prescription non-compliance or unsupervised indiscriminate use of anti-tubercular drugs or other antibiotics. Mycobacterium tuberculosis cases have been reported in highly susceptible population groups including the aboriginal communities of US and Canada. In Canada alone, the total number of reported tuberculosis cases has decreased over the past decade. However, there is a steady increase in HIV cases in certain communities including the aboriginal communities. Reintroduction of MDR/XDR strains of tuberculosis is possible in these susceptible communities, which in turn may pose serious public health situation. MDR/XDR strains of tuberculosis are virtually untreatable using current anti-tubercular medication protocols. Thus, MDR/XDR tuberculosis presents a grave global public health threat. The unpredictable genetic mechanism involved in generating MDR/XDR resistant strains of Mycobacterium tuberculosis may pose greater challenges in developing appropriate treatment strategies. In this article, we briefly review potential genetic mechanism of emerging NDM-1 bacterial strains and draw a rationale parallel to the underlying genetic mechanism of MDR/XDR Mycobacterium tuberculosis strain development. PMID:23267308

  18. Biodegradation of Ochratoxin A by Bacterial Strains Isolated from Vineyard Soils.

    PubMed

    De Bellis, Palmira; Tristezza, Mariana; Haidukowski, Miriam; Fanelli, Francesca; Sisto, Angelo; Mulè, Giuseppina; Grieco, Francesco

    2015-12-01

    Ochratoxin A (OTA) is a mycotoxin with a main nephrotoxic activity contaminating several foodstuffs. In the present report, five soil samples collected from OTA-contaminated vineyards were screened to isolate microorganisms able to biodegrade OTA. When cultivated in OTA-supplemented medium, OTA was converted in OTα by 225 bacterial isolates. To reveal clonal relationships between isolates, molecular typing by using an automated rep-PCR system was carried out, thus showing the presence of 27 different strains (rep-PCR profiles). The 16S-rRNA gene sequence analysis of an isolate representative of each rep-PCR profiles indicated that they belonged to five bacterial genera, namely Pseudomonas, Leclercia, Pantoea, Enterobacter, and Acinetobacter. However, further evaluation of OTA-degrading activity by the 27 strains revealed that only Acinetobacter calcoaceticus strain 396.1 and Acinetobacter sp. strain neg1, consistently conserved the above property; their further characterization showed that they were able to convert 82% and 91% OTA into OTα in six days at 24 °C, respectively. The presence of OTα, as the unique OTA-degradation product was confirmed by LC-HRMS. This is the first report on OTA biodegradation by bacterial strains isolated from agricultural soils and carried out under aerobic conditions and moderate temperatures. These microorganisms might be used to detoxify OTA-contaminated feed and could be a new source of gene(s) for the development of a novel enzymatic detoxification system. PMID:26633497

  19. Biodegradation of Ochratoxin A by Bacterial Strains Isolated from Vineyard Soils

    PubMed Central

    De Bellis, Palmira; Tristezza, Mariana; Haidukowski, Miriam; Fanelli, Francesca; Sisto, Angelo; Mulè, Giuseppina; Grieco, Francesco

    2015-01-01

    Ochratoxin A (OTA) is a mycotoxin with a main nephrotoxic activity contaminating several foodstuffs. In the present report, five soil samples collected from OTA-contaminated vineyards were screened to isolate microorganisms able to biodegrade OTA. When cultivated in OTA-supplemented medium, OTA was converted in OTα by 225 bacterial isolates. To reveal clonal relationships between isolates, molecular typing by using an automated rep-PCR system was carried out, thus showing the presence of 27 different strains (rep-PCR profiles). The 16S-rRNA gene sequence analysis of an isolate representative of each rep-PCR profiles indicated that they belonged to five bacterial genera, namely Pseudomonas, Leclercia, Pantoea, Enterobacter, and Acinetobacter. However, further evaluation of OTA-degrading activity by the 27 strains revealed that only Acinetobacter calcoaceticus strain 396.1 and Acinetobacter sp. strain neg1, consistently conserved the above property; their further characterization showed that they were able to convert 82% and 91% OTA into OTα in six days at 24 °C, respectively. The presence of OTα, as the unique OTA-degradation product was confirmed by LC-HRMS. This is the first report on OTA biodegradation by bacterial strains isolated from agricultural soils and carried out under aerobic conditions and moderate temperatures. These microorganisms might be used to detoxify OTA-contaminated feed and could be a new source of gene(s) for the development of a novel enzymatic detoxification system. PMID:26633497

  20. [Isolation and characteristics of Panax ginseng autotoxin-degrading bacterial strains].

    PubMed

    Zhao, Dong-Yue; Li, Yong; Ding, Wan-Long

    2013-06-01

    In this study, traditional plate culturing method was used to isolate autotoxin-degrading microbial strains, and which were then identified by 16S rDNA homological analysis and morphological characteristics. Furthermore, the growth and autotoxin-degrading efficiency of them were analyzed by liquid culturing method and GC-MS to illustrate their autotoxin-degradation characteristics. As a result, five bacterial strains having autotoxin-degrading activity were isolated from 6-years ginseng nonrhizospheric soil successfully, and which can growth successfully by taking autotoxins added artificially as carbon source in liquid culturing condition. Results indicated that it was feasible to isolate autotoxin-degrading bacteria from ginseng nonrhizospheric soil, and the isolated bacterial strains can be used to degrade autotoxins in soils once planted Panax ginseng. PMID:24010281

  1. Decolorization of sulfonated azo dye Metanil Yellow by newly isolated bacterial strains: Bacillus sp. strain AK1 and Lysinibacillus sp. strain AK2.

    PubMed

    Anjaneya, O; Souche, S Yogesh; Santoshkumar, M; Karegoudar, T B

    2011-06-15

    Two different bacterial strains capable of decolorizing a highly water soluble azo dye Metanil Yellow were isolated from dye contaminated soil sample collected from Atul Dyeing Industry, Bellary, India. The individual bacterial strains Bacillus sp. AK1 and Lysinibacillus sp. AK2 decolorized Metanil Yellow (200 mg L(-1)) completely within 27 and 12h respectively. Various parameters like pH, temperature, NaCl and initial dye concentrations were optimized to develop an economically feasible decolorization process. The maximum concentration of Metanil Yellow (1000 mg L(-1)) was decolorized by strains AK2 and AK1 within 78 and 84 h respectively. These strains could decolorize Metanil Yellow over a broad pH range 5.5-9.0; the optimum pH was 7.2. The decolorization of Metanil Yellow was most efficient at 40°C and confirmed by UV-visible spectroscopy, TLC, HPLC and GC/MS analysis. Further, both the strains showed the involvement of azoreductase in the decolorization process. Phytotoxicity studies of catabolic products of Metanil Yellow on the seeds of chick pea and pigeon pea revealed much reduction in the toxicity of metabolites as compared to the parent dye. These results indicating the effectiveness of strains AK1 and AK2 for the treatment of textile effluents containing azo dyes. PMID:21470774

  2. Isolation of phenazine 1,6-di-carboxylic acid from Pseudomonas aeruginosa strain HRW.1-S3 and its role in biofilm-mediated crude oil degradation and cytotoxicity against bacterial and cancer cells.

    PubMed

    Dasgupta, Debdeep; Kumar, Abhinash; Mukhopadhyay, Balaram; Sengupta, Tapas K

    2015-10-01

    Pseudomonas sp. has long been known for production of a wide range of secondary metabolites during late exponential and stationary phases of growth. Phenazine derivatives constitute a large group of secondary metabolites produced by microorganisms including Pseudomonas sp. Phenazine 1,6-di-carboxylic acid (PDC) is one of such metabolites and has been debated for its origin from Pseudomonas sp. The present study describes purification and characterization of PDC isolated from culture of a natural isolate of Pseudomonas sp. HRW.1-S3 while grown in presence of crude oil as sole carbon source. The isolated PDC was tested for its effect on biofilm formation by another environmental isolate of Pseudomonas sp. DSW.1-S4 which lacks the ability to produce any phenazine compound. PDC showed profound effect on both planktonic as well as biofilm mode of growth of DSW.1-S4 at concentrations between 5 and 20 μM. Interestingly, PDC showed substantial cytotoxicity against three cancer cell lines and against both Gram-positive and Gram-negative bacteria. Thus, the present study not only opens an avenue to understand interspecific cooperation between Pseudomonas species which may lead its applicability in bioremediation, but also it signifies the scope of future investigation on PDC for its therapeutic applications. PMID:26051670

  3. Isolation of a Bacterial Strain Able To Degrade Branched Nonylphenol

    PubMed Central

    Tanghe, Tom; Dhooge, Willem; Verstraete, Willy

    1999-01-01

    Conventional enrichment of microorganisms on branched nonylphenol (NP) as only carbon and energy source yielded mixed cultures able to grow on the organic compound. However, plating yielded no single colonies capable, alone or in combination with other isolates, of degrading the NP in liquid culture. Therefore, a special approach was used, referred to as “serial dilution-plate resuspension,” to reduce culture complexity. In this way, one isolate, TTNP3, tentatively identified as a Sphingomonas sp., was found to be able to grow on NP in liquid culture. Remarkably, this isolate was able to be filtered through a 0.45-μm-pore-diameter filter. Moreover, isolate TTNP3 did not form visible colonies on mineral medium with NP, and it formed visible colonies on R2A agar only after a prolonged incubation of 1 week. High-performance liquid chromatography and gas chromatography-mass spectroscopy analysis of the culture media indicated that the strain starts the degradation of NP with a fission of the phenol ring and preferably uses the para isomer of NP and not the ortho isomer. No distinct accumulation of an intermediary product could be observed. PMID:9925611

  4. Strain typing of acetic acid bacteria responsible for vinegar production by the submerged elaboration method.

    PubMed

    Fernández-Pérez, Rocío; Torres, Carmen; Sanz, Susana; Ruiz-Larrea, Fernanda

    2010-12-01

    Strain typing of 103 acetic acid bacteria isolates from vinegars elaborated by the submerged method from ciders, wines and spirit ethanol, was carried on in this study. Two different molecular methods were utilised: pulsed field gel electrophoresis (PFGE) of total DNA digests with a number of restriction enzymes, and enterobacterial repetitive intergenic consensus (ERIC) - PCR analysis. The comparative study of both methods showed that restriction fragment PFGE of SpeI digests of total DNA was a suitable method for strain typing and for determining which strains were present in vinegar fermentations. Results showed that strains of the species Gluconacetobacter europaeus were the most frequent leader strains of fermentations by the submerged method in the studied vinegars, and among them strain R1 was the predominant one. Results showed as well that mixed populations (at least two different strains) occurred in vinegars from cider and wine, whereas unique strains were found in spirit vinegars, which offered the most stressing conditions for bacterial growth. PMID:20832673

  5. Characterization and bacterial adhesion of chitosan-perfluorinated acid films.

    PubMed

    Bierbrauer, Karina L; Alasino, Roxana V; Muñoz, Adrián; Beltramo, Dante M; Strumia, Miriam C

    2014-02-01

    We reported herein the study and characterization of films obtained by casting of chitosan solutions in perfluorinated acids, trifluoroacetic (TFA), perfluoropropionic (PFPA), and perfluorooctanoic (PFOA). The films were characterized by FTIR, solid state (13)C NMR, X-ray, AFM, contact angle, thermogravimetric effluent analysis by mass spectrometry, and rheology. The results showed a marked influence of chain length of the perfluorinated acids on the hydrophobic/hydrophilic ratio of the modified chitosan films which was evidenced by the different characteristics observed. The material that showed greater surface stability was chitosan-PFOA. Chitosan film with the addition of PFOA modifier became more hydrophobic, thus water vapor permeability diminished compared to chitosan films alone, this new material also depicted bacterial adhesion which, together with the features already described, proves its potential in applications for bioreactor coating. PMID:24189195

  6. Induced drought tolerance through wild and mutant bacterial strain Pseudomonas simiae in mung bean (Vigna radiata L.).

    PubMed

    Kumari, Sarita; Vaishnav, Anukool; Jain, Shekhar; Varma, Ajit; Choudhary, Devendra Kumar

    2016-01-01

    The present study focused on the overproducing mutant of a plant growth promoting rhizobacterium (PGPR) Pseudomonas simiae strain AU (MTCC-12057) for significant drought tolerance in mung bean plants. Five mutants namely AU-M1, AU-M2, AU-M3, AU-M4 and AU-M5 were made after treatment of wild type strain with N-methyl-N-nitro-N-nitrosoguanidine. Mutant strain AU-M4 was recorded for enhanced ACC deaminase (ACC-D) activity, indole acetic acid (IAA) production and inorganic phosphate (Pi) solubilization compared to wild strain and other four mutant strains under drought condition. AU-M4 showed higher phosphate solubilization index (8.17) together with higher ACC-D activity (98 nmol/mg/h) and IAA concentration (69.35 µg/ml) compared with the wild type P. simiae strain AU ACC-D activity (79 nmol/mg/h) and IAA concentration (38.98 µg/ml) respectively. In this report, we investigated the effect of both wild and mutant type bacterial strain on mung bean plants under drought stress. Results showed that mutant AU-M4 and wild type strain AU inoculated plants exhibited superior tolerance against drought stress, as shown by their enhanced plant biomass (fresh weight), higher water content, higher proline accumulation and lower osmotic stress injury. Mutant AU-M4 and wild strain AU inoculated plants reduced the ethylene level by 59 and 45% respectively, compared to the control under stress condition. Furthermore, bacterial inoculated plants showed enhanced induced systemic drought tolerance by reducing stomata size and net photosynthesis resulting higher water content in mung bean plants that may help in survival of plants during drought condition. To mitigate the effects of drought stress, use of PGPR will be needed to ensure sufficient production of food from crop plants. Taking current leads available, concerted future research is needed in this area, particularly on field evaluation with application of potential microorganisms. PMID:26712619

  7. Strained cycloalkynes as new protein sulfenic acid traps.

    PubMed

    Poole, Thomas H; Reisz, Julie A; Zhao, Weiling; Poole, Leslie B; Furdui, Cristina M; King, S Bruce

    2014-04-30

    Protein sulfenic acids are formed by the reaction of biologically relevant reactive oxygen species with protein thiols. Sulfenic acid formation modulates the function of enzymes and transcription factors either directly or through the subsequent formation of protein disulfide bonds. Identifying the site, timing, and conditions of protein sulfenic acid formation remains crucial to understanding cellular redox regulation. Current methods for trapping and analyzing sulfenic acids involve the use of dimedone and other nucleophilic 1,3-dicarbonyl probes that form covalent adducts with cysteine-derived protein sulfenic acids. As a mechanistic alternative, the present study describes highly strained bicyclo[6.1.0]nonyne (BCN) derivatives as concerted traps of sulfenic acids. These strained cycloalkynes react efficiently with sulfenic acids in proteins and small molecules yielding stable alkenyl sulfoxide products at rates more than 100× greater than 1,3-dicarbonyl reagents enabling kinetic competition with physiological sulfur chemistry. Similar to the 1,3-dicarbonyl reagents, the BCN compounds distinguish the sulfenic acid oxoform from the thiol, disulfide, sulfinic acid, and S-nitrosated forms of cysteine while displaying an acceptable cell toxicity profile. The enhanced rates demonstrated by these strained alkynes identify them as new bioorthogonal probes that should facilitate the discovery of previously unknown sulfenic acid sites and their parent proteins. PMID:24724926

  8. Effect of microstructure on anomalous strain-rate-dependent behaviour of bacterial cellulose hydrogel.

    PubMed

    Gao, Xing; Shi, Zhijun; Lau, Andrew; Liu, Changqin; Yang, Guang; Silberschmidt, Vadim V

    2016-05-01

    This study is focused on anomalous strain-rate-dependent behaviour of bacterial cellulose (BC) hydrogel that can be strain-rate insensitive, hardening, softening, or strain-rate insensitive in various ranges of strain rate. BC hydrogel consists of randomly distributed nanofibres and a large content of free water; thanks to its ideal biocompatibility, it is suitable for biomedical applications. Motivated by its potential applications in complex loading conditions of body environment, its time-dependent behaviour was studied by means of in-aqua uniaxial tension tests at constant temperature of 37 °C at various strain rates ranging from 0.000 1s(-1) to 0.3s(-1). Experimental results reflect anomalous strain-rate-dependent behaviour that was not documented before. Micro-morphological observations allowed identification of deformation mechanisms at low and high strain rates in relation to microstructural changes. Unlike strain-rate softening behaviours in other materials, reorientation of nanofibres and kinematics of free-water flow dominate the softening behaviour of BC hydrogel at high strain rates. PMID:26952406

  9. Characterization of rumen bacterial strains isolated from enrichments of rumen content in the presence of propolis.

    PubMed

    de Aguiar, Sílvia Cristina; Zeoula, Lucia Maria; do Prado, Odimari Pricila Pires; Arcuri, Pedro Braga; Forano, Evelyne

    2014-11-01

    Propolis presents many biological properties, including antibacterial activities, and has been proposed as an additive in ruminant nutrition. Twenty bacterial strains, previously isolated from enrichments of Brazilian cow rumen contents in the presence of different propolis extracts (LLOS), were characterized using phenotyping and 16S rRNA identification. Seven strains were assigned to Streptococcus sp., most likely S. bovis, and were all degrading starch. One amylolytic lactate-utilizing strain of Selenomonas ruminantium was also found. Two strains of Clostridium bifermentans were identified and showed proteolytic activity. Two strains were assigned to Mitsuokella jalaludinii and were saccharolytic. One strain belonged to a Bacillus species and seven strains were affiliated with Escherichia coli. All of the 20 strains were able to use many sugars, but none of them were able to degrade the polysaccharides carboxymethylcellulose and xylans. The effect of three propolis extracts (LLOS B1, C1 and C3) was tested on the in vitro growth of four representative isolates of S. bovis, E. coli, M. jalaludinii and C. bifermentans. The growth of S. bovis, E. coli and M. jalaludinii was not affected by the three propolis extracts at 1 mg ml(-1). C. bifermentans growth was completely inhibited at this LLOS concentration, but this bacterium was partially resistant at lower concentrations. LLOS C3, with the lower concentration of phenolic compounds, was a little less inhibitory than B1 and C1 on this strain. PMID:25172217

  10. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family.

    PubMed

    Broussard, Tyler C; Miller, Darcie J; Jackson, Pamela; Nourse, Amanda; White, Stephen W; Rock, Charles O

    2016-03-18

    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

  11. Rhodanobacter sp. Strain BPC1 in a Benzo[a]pyrene-Mineralizing Bacterial Consortium

    PubMed Central

    Kanaly, Robert A.; Harayama, Shigeaki; Watanabe, Kazuya

    2002-01-01

    A bacterial consortium which rapidly mineralizes benzo[a]pyrene when it is grown on a high-boiling-point diesel fuel distillate (HBD) was recovered from soil and maintained for approximately 3 years. Previous studies have shown that mobilization of benzo[a]pyrene into the supernatant liquid precedes mineralization of this compound (R. Kanaly, R. Bartha, K. Watanabe, and S. Harayama, Appl. Environ. Microbiol. 66:4205-4211, 2000). In the present study, we found that sterilized supernatant liquid filtrate (SSLF) obtained from the growing consortium stimulated mineralization of benzo[a]pyrene when it was readministered to a consortium inoculum without HBD. Following this observation, eight bacterial strains were isolated from the consortium, and SSLF of each of them was assayed for the ability to stimulate benzo[a]pyrene mineralization by the original consortium. The SSLF obtained from one strain, designated BPC1, most vigorously stimulated benzo[a]pyrene mineralization by the original consortium; its effect was more than twofold greater than the effect of the SSLF obtained from the original consortium. A 16S rRNA gene sequence analysis and biochemical tests identified strain BPC1 as a member of the genus Rhodanobacter, whose type strain, Rhodanobacter lindaniclasticus RP5557, which was isolated for its ability to grow on the pesticide lindane, is not extant. Strain BPC1 could not grow on lindane, benzo[a]pyrene, simple hydrocarbons, and HBD in pure culture. In contrast, a competitive PCR assay indicated that strain BPC1 grew in the consortium fed only HBD and benzo[a]pyrene. This growth of BPC1 was concomitant with growth of the total bacterial consortium and preceded the initiation of benzo[a]pyrene mineralization. These results suggest that strain BPC1 has a specialized niche in the benzo[a]pyrene-mineralizing consortium; namely, it grows on metabolites produced by fellow members and contributes to benzo[a]pyrene mineralization by increasing the bioavailability of

  12. Role of antioxidant enzymes in bacterial resistance to organic acids.

    PubMed

    Bruno-Bárcena, Jose M; Azcárate-Peril, M Andrea; Hassan, Hosni M

    2010-05-01

    Growth in aerobic environments has been shown to generate reactive oxygen species (ROS) and to cause oxidative stress in most organisms. Antioxidant enzymes (i.e., superoxide dismutases and hydroperoxidases) and DNA repair mechanisms provide protection against ROS. Acid stress has been shown to be associated with the induction of Mn superoxide dismutase (MnSOD) in Lactococcus lactis and Staphylococcus aureus. However, the relationship between acid stress and oxidative stress is not well understood. In the present study, we showed that mutations in the gene coding for MnSOD (sodA) increased the toxicity of lactic acid at pH 3.5 in Streptococcus thermophilus. The inclusion of the iron chelators 2,2'-dipyridyl (DIP), diethienetriamine-pentaacetic acid (DTPA), and O-phenanthroline (O-Phe) provided partial protection against 330 mM lactic acid at pH 3.5. The results suggested that acid stress triggers an iron-mediated oxidative stress that can be ameliorated by MnSOD and iron chelators. These findings were further validated in Escherichia coli strains lacking both MnSOD and iron SOD (FeSOD) but expressing a heterologous MnSOD from S. thermophilus. We also found that, in E. coli, FeSOD did not provide the same protection afforded by MnSOD and that hydroperoxidases are equally important in protecting the cells against acid stress. These findings may explain the ability of some microorganisms to survive better in acidified environments, as in acid foods, during fermentation and accumulation of lactic acid or during passage through the low pH of the stomach. PMID:20305033

  13. Catabolism of Arylboronic Acids by Arthrobacter nicotinovorans Strain PBA

    PubMed Central

    Negrete-Raymond, Ana C.; Weder, Barbara; Wackett, Lawrence P.

    2003-01-01

    Arthrobacter sp. strain PBA metabolized phenylboronic acid to phenol. The oxygen atom in phenol was shown to be derived from the atmosphere using 18O2. 1-Naphthalene-, 2-naphthalene-, 3-cyanophenyl-, 2,5-fluorophenyl-, and 3-thiophene-boronic acids were also transformed to monooxygenated products. The oxygen atom in the product was bonded to the ring carbon atom originally bearing the boronic acid substituent with all the substrates tested. PMID:12839810

  14. ANItools web: a web tool for fast genome comparison within multiple bacterial strains

    PubMed Central

    Han, Na; Qiang, Yujun; Zhang, Wen

    2016-01-01

    Background: Early classification of prokaryotes was based solely on phenotypic similarities, but modern prokaryote characterization has been strongly influenced by advances in genetic methods. With the fast development of the sequencing technology, the ever increasing number of genomic sequences per species offers the possibility for developing distance determinations based on whole-genome information. The average nucleotide identity (ANI), calculated from pair-wise comparisons of all sequences shared between two given strains, has been proposed as the new metrics for bacterial species definition and classification. Results: In this study, we developed the web version of ANItools (http://ani.mypathogen.cn/), which helps users directly get ANI values from online sources. A database covering ANI values of any two strains in a genus was also included (2773 strains, 1487 species and 668 genera). Importantly, ANItools web can automatically run genome comparison between the input genomic sequence and data sequences (Genus and Species levels), and generate a graphical report for ANI calculation results. Conclusion: ANItools web is useful for defining the relationship between bacterial strains, further contributing to the classification and identification of bacterial species using genome data. Database URL: http://ani.mypathogen.cn/ PMID:27270714

  15. Selection and Characterization of Cheonggukjang (Fast Fermented Soybean Paste)-Originated Bacterial Strains with a High Level of S-adenosyl-L-methionine Production and Probiotics Efficacy

    PubMed Central

    Park, Sunhyun; Kim, Min-Jeong; Hong, Jiyoung; Kim, Hyo-Jin; Yi, Sung-Hun

    2014-01-01

    Abstract This study was executed to develop probiotics producing S-adenosyl-L-methionine (SAMe), a methyl group donor in the 5-methyltetrahydrofolate methylation reaction in animal cells. SAMe is an essential substance in the synthesis, activation, and metabolism of hormones, neurotransmitters, nucleic acids, phospholipids, and cell membranes of animals. SAMe is also known as a nutritional supplement for improving human brain function. In this study, SAMe-producing strains were identified in six kinds of Cheonggukjang, and strains with excellent SAMe production were identified, with one strain in the Enterococcus genus and six strains in the Bacillus genus. Strains with a large amount of SAMe production included lactic acid bacteria, such as Enterococcus faecium, Enterococcus durans, and Enterococcus sanguinicola, as well as various strains in the Bacillus genus. The SAMe-overproducing strains showed antibacterial activity against some harmful microbes, in addition to weak acid resistance and strong bile resistance, indicating characteristics of probiotics. Cheonggukjang-originated beneficial bacterial strains overproducing SAMe may be commercially useful for manufacturing SAMe-rich foods. PMID:25268945

  16. Selection and characterization of Cheonggukjang (fast fermented soybean paste)-originated bacterial strains with a high level of S-adenosyl-L-methionine production and probiotics efficacy.

    PubMed

    Park, Sunhyun; Kim, Min-Jeong; Hong, Jiyoung; Kim, Hyo-Jin; Yi, Sung-Hun; Lee, Myung-Ki

    2014-11-01

    This study was executed to develop probiotics producing S-adenosyl-L-methionine (SAMe), a methyl group donor in the 5-methyltetrahydrofolate methylation reaction in animal cells. SAMe is an essential substance in the synthesis, activation, and metabolism of hormones, neurotransmitters, nucleic acids, phospholipids, and cell membranes of animals. SAMe is also known as a nutritional supplement for improving human brain function. In this study, SAMe-producing strains were identified in six kinds of Cheonggukjang, and strains with excellent SAMe production were identified, with one strain in the Enterococcus genus and six strains in the Bacillus genus. Strains with a large amount of SAMe production included lactic acid bacteria, such as Enterococcus faecium, Enterococcus durans, and Enterococcus sanguinicola, as well as various strains in the Bacillus genus. The SAMe-overproducing strains showed antibacterial activity against some harmful microbes, in addition to weak acid resistance and strong bile resistance, indicating characteristics of probiotics. Cheonggukjang-originated beneficial bacterial strains overproducing SAMe may be commercially useful for manufacturing SAMe-rich foods. PMID:25268945

  17. Amino Acid and Vitamin Requirements of Several Bacteroides Strains

    PubMed Central

    Quinto, Grace

    1966-01-01

    Nutritional studies were performed on nine Bacteroides strains, by use of the methodology and media of anaerobic rumen microbiology. Ristella perfoetens CCI required l-arginine hydrochloride, l-tryptophan, l-leucine, l-histidine hydrochloride, l-cysteine hydrochloride, dl-valine, dl-tyrosine, and the vitamin calcium-d-pantothenate, since scant turbidity developed in media without these nutrients. R. perfoetens was stimulated by glycine, dl-lysine hydrochloride, dl-isoleucine, l-proline, l-glutamic acid, dl-alanine, dl-phenylalanine, dl-methionine, and the vitamins nicotinamide and p-aminobenzoic acid, since maximal turbidity developed more slowly in media without these nutrients than in complete medium. Medium A-23, which was devised for R. perfoetens, contained salts, 0.0002% nicotinamide and calcium d-pantothenate, 0.00001% p-aminobenzoic acid, 0.044% l-tryptophan, 0.09% l-glutamic acid, and 0.1% of the other 13 amino acids listed above. Zuberella clostridiformis and seven strains of R. pseudoinsolita did not require vitamins, and showed no absolute requirement for any one amino acid. Various strains produced maximal turbidity more slowly in media deficient in l-proline, glycine, l-glutamic acid, dl-serine, l-histidine hydrochloride, dl-alanine, or l-cysteine hydrochloride, than in complete medium. These eight strains grew optimally in medium A-23 plus 0.1% dl-serine but without vitamins. PMID:16349673

  18. Isolation of two Pseudomonas strains producing pseudomonic acid A.

    PubMed

    Fritz, Eva; Fekete, Agnes; Lintelmann, Jutta; Schmitt-Kopplin, Philipe; Meckenstock, Rainer U

    2009-02-01

    Two novel Pseudomonas strains were isolated from groundwater sediment samples. The strains showed resistance against the antibiotics tetracycline, cephalothin, nisin, vancomycin, nalidixic acid, erythromycin, lincomycin, and penicillin and grew at temperatures between 15 and 37 degrees C and pH values from 4 to 10 with a maximum at pH 7 to 10. The 16S ribosomal RNA gene sequences and the substrate spectrum of the isolates revealed that the two strains belonged to the Pseudomonas fluorescens group. The supernatants of both strains had an antibiotic effect against Gram-positive bacteria and one Gram-negative strain. The effective substance was produced under standard cultivation conditions without special inducer molecules or special medium composition. The antibiotically active compound was identified as pseudomonic acid A by off-line high performance liquid chromatography (HPLC) and Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS). The measurement on ultra performance liquid chromatography (UPLC, UV-vis detection) confirmed the determination of pseudomonic acid A which was produced by both strains at 1.7-3.5mg/l. Our findings indicate that the ability to produce the antibiotic pseudomonic acid A (Mupirocin) is more spread among the pseudomonads then anticipated from the only producer known so far. PMID:19070447

  19. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  20. Effects of ruminal dosing of Holstein cows with Megasphaera elsdenii on milk fat production, ruminal chemistry, and bacterial strain persistence.

    PubMed

    Weimer, P J; Da Silva Cabral, L; Cacite, F

    2015-11-01

    Megasphaera elsdenii is a lactate-utilizing bacterium whose ruminal abundance has been shown to be greatly elevated during milk fat depression (MFD). To further examine this association, a total of 23 cannulated multiparous Holstein cows were examined in 3 experiments in which strains of M. elsdenii were directly dosed into the rumen (~2 × 10(12) cells/dose); control cows were dosed with sterile lactate-free culture medium. Cows were fed a total mixed ration (292 g of starch/kg of dry matter) that contained primarily corn silage, alfalfa silage, finely ground high-moisture corn, supplemental protein, and corn oil (3 g/kg of dry matter). Experiments differed in stage of lactation of the cows (early or late), dosing events (single dose, or 4 doses over a 5-d period), timing of dose (prefeed or 4 h postfeed), and M. elsdenii strain (laboratory strain YI9 or 3 strains isolated from cows in the same herd). Dry matter intake and milk yield and composition were measured from 5 to 0 d before dosing and 1 to 7d after first dosing, plus later time points that varied by experiment. Milk yield and composition were not affected by dosing. Megasphaera elsdenii was quantified in the liquid phase of ruminal contents by automated ribosomal intergenic spacer analysis, or by PCR with relative quantification (M. elsdenii 16S rRNA gene copy number as a percentage of total bacterial 16S rRNA gene copies). Neither the M. elsdenii-dosed or control cows displayed MFD after dosing, and in almost all cases M. elsdenii populations returned to low baseline levels (<0.02% of 16S rRNA gene copy number) within 24 h of dosing. This rapid decline in M. elsdenii also occurred in several cows that were dosed with a strain of M. elsdenii that had been isolated from that particular cow during a previous bout of MFD. Ruminal pH and total millimolar volatile fatty acids and lactate did not differ between dosed and control cows, although acetate-to-propionate ratio declined in both groups and butyrate

  1. Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt

    PubMed Central

    2012-01-01

    In the present study, two of the most toxic bacterial strains of Bacillus sphaericus against mosquito were identified with the most recent genetic techniques. The PCR product profiles indicated the presence of genes encoding Bin A, Bin B and Mtx1 in all analyzed strains; they are consistent with protein profiles. The preliminary bioinformatics analysis of the binary toxin genes sequence revealed that the open reading frames had high similarities when matched with nucleotides sequence in the database of other B. sphaericus strains. The biological activity of B. sphaericus strains varied according to growing medium, and cultivation time. The highest yield of viable counts, spores and larvicidal protein were attained after 5 days. Poly (P) medium achieved the highest yield of growth, sporulation, protein and larvicidal activity for all tested strains compared to the other tested media. The larvicidal protein produced by local strains (B. sphaericus EMCC 1931 and EMCC 1932) in P medium was more lethal against the 3rd instar larvae of Culex pipiens than that of reference strains (B. sphaericus 1593 and B. sphaericus 2297). The obtained results revealed that P medium was the most effective medium and will be used in future work in order to optimize large scale production of biocide by the locally isolated Bacillus sphaericus strains. PMID:22280528

  2. Allophanate hydrolase, not urease, functions in bacterial cyanuric acid metabolism.

    PubMed

    Cheng, Gang; Shapir, Nir; Sadowsky, Michael J; Wackett, Lawrence P

    2005-08-01

    Growth substrates containing an s-triazine ring are typically metabolized by bacteria to liberate 3 mol of ammonia via the intermediate cyanuric acid. Over a 25-year period, a number of original research papers and reviews have stated that cyanuric acid is metabolized in two steps to the 2-nitrogen intermediate urea. In the present study, allophanate, not urea, was shown to be the 2-nitrogen intermediate in cyanuric acid metabolism in all the bacteria examined. Six different experimental results supported this conclusion: (i) synthetic allophanate was shown to readily decarboxylate to form urea under acidic extraction and chromatography conditions used in previous studies; (ii) alkaline extraction methods were used to stabilize and detect allophanate in bacteria actively metabolizing cyanuric acid; (iii) the kinetic course of allophanate formation and disappearance was consistent with its being an intermediate in cyanuric acid metabolism, and no urea was observed in those experiments; (iv) protein extracts from cells grown on cyanuric acid contained allophanate hydrolase activity; (v) genes encoding the enzymes AtzE and AtzF, which produce and hydrolyze allophanate, respectively, were found in several cyanuric acid-metabolizing bacteria; and (vi) TrzF, an AtzF homolog found in Enterobacter cloacae strain 99, was cloned, expressed in Escherichia coli, and shown to have allophanate hydrolase activity. In addition, we have observed that there are a large number of genes homologous to atzF and trzF distributed in phylogenetically distinct bacteria. In total, the data indicate that s-triazine metabolism in a broad class of bacteria proceeds through allophanate via allophanate hydrolase, rather than through urea using urease. PMID:16085834

  3. Make Histri: reconstructing the exchange history of bacterial and archaeal type strains.

    PubMed

    Verslyppe, Bert; De Smet, Wim; De Baets, Bernard; De Vos, Paul; Dawyndt, Peter

    2011-07-01

    Each transfer of a microbial strain between a Biological Resource Center (BRC) and an individual researcher or another BRC imposes a risk of contamination or human error. Such artifacts jeopardize the quality of scientific results. In order to trace back possible scientific discrepancies that can be linked to failure of authenticity of the biological material involved, we launched the 'Make Histri' project that aims at reconstructing the exchange history ('Histri') of all bacterial and archaeal type strains as can be deduced from the information contained in BRC online catalogs. A Histri, visualized as a rooted tree, contains all known strain numbers attributed to the various cultures of a given strain, annotated with additional information about each transfer of microbial material. PMID:21514082

  4. Accumulation of Amino Acids in Rhizobium sp. Strain WR1001 in Response to Sodium Chloride Salinity

    PubMed Central

    Hua, Sui-Sheng T.; Tsai, Victor Y.; Lichens, Georgia M.; Noma, Amy T.

    1982-01-01

    Rhizobium sp. strain WR1001, isolated from the Sonoran Desert by Eskew and Ting, was found to be able to grow in defined medium containing NaCl up to 500 mM, a concentration approaching that of sea water. Therefore, it is a valuable strain for studying the biochemical basis of salt tolerance. Intracellular free glutamate was found to increase rapidly in response to osmotic stress by NaCl. It accounted for 88% of the amino acid pool when the bacterium was grown in 500 mM NaCl. The role of glutamate dehydrogenase in glutamate biosynthesis was examined in several Rhizobium strains. Both NADH- and NADPH-dependent glutamate dehydrogenase activities in various Rhizobium strains were observed. The range of activity differed considerably depending on the particular strain. KCl (500 mM) did not stimulate glutamate dehydrogenase activity, as reported in a number of bacterial strains by Measures. The low activity of glutamate dehydrogenase in Rhizobium sp. strain WR1001 apparently cannot fulfill a biosynthetic function of glutamate formation in response to medium NaCl concentrations. PMID:16346049

  5. Comparison of two multimetal resistant bacterial strains: Enterobacter sp. YSU and Stenotrophomonas maltophilia ORO2.

    PubMed

    Holmes, Andrew; Vinayak, Anubhav; Benton, Cherise; Esbenshade, Aaron; Heinselman, Carlisle; Frankland, Daniel; Kulkarni, Samatha; Kurtanich, Adrienne; Caguiat, Jonathan

    2009-11-01

    The Y-12 plant in Oak Ridge, TN, which manufactured nuclear weapons during World War II and the Cold War, contaminated East Fork Poplar Creek with heavy metals. The multimetal resistant bacterial strain, Stenotrophomonas maltophilia Oak Ridge strain O2 (S. maltophilia O2), was isolated from East Fork Poplar Creek. Sequence analysis of 16s rDNA suggested that our working strain of S. maltophilia O2 was a strain of Enterobacter. Phylogenetic tree analysis and biochemical tests confirmed that it belonged to an Enterobacter species. This new strain was named Enterobacter sp. YSU. Using a modified R3A growth medium, R3A-Tris, the Hg(II), Cd(II), Zn(II), Cu(II), Au(III), Cr(VI), Ag(I), As(III), and Se(IV) MICs for a confirmed strain of S. maltophilia O2 were 0.24, 0.33, 5, 5, 0.25, 7, 0.03, 14, and 40 mM, respectively, compared to 0.07, 0.24, 0.8, 3, 0.05, 0.4, 0.08, 14, and 40 mM, respectively, for Enterobacter sp. YSU. Although S. maltophilia O2 was generally more metal resistant than Enterobacter sp. YSU, in comparison to Escherichia coli strain HB101, Enterobacter sp. YSU was resistant to Hg(II), Cd(II), Zn(II), Au(III), Ag(I), As(III), and Se(IV). By studying metal resistances in these two strains, it may be possible to understand what makes one microorganism more metal resistant than another microorganism. This work also provided benchmark MICs that can be used to evaluate the metal resistance properties of other bacterial isolates from East Fork Poplar Creek and other metal contaminated sites. PMID:19688378

  6. A comparison of three bacterial strains for the remediation of town gas soils

    SciTech Connect

    Sauer, N.E.; Akkineni, D.K.; Cutright, T.J.

    1995-12-31

    The contamination of soils from polycyclic aromatic hydrocarbons (PAHs) is widespread. Although PAH contamination still occurs from current industrial processes, accidental spills, and leaking underground storage tanks, the main source of contamination is from abandoned town gas sites. To date there is a conservative estimate of 2500 town gas sites that require remediation. The most cost effective in-situ treatment for these sites is that of bioremediation. Experiments were conducted to compare the efficiencies of three bacterial strains for the remediation of an industrially PAH contaminated soil. Specifically, the efficiencies of Achromobacter sp., Mycobacterium sp., and Nocardia paraffinae were investigated. This paper will address the chemical specificity of each bacterial strains for the PAHs present.

  7. Bacterial Cellulose Production by Acetobacter xylinum Strains from Agricultural Waste Products

    NASA Astrophysics Data System (ADS)

    Kongruang, Sasithorn

    Bacterial cellulose is a biopolysaccharide produced from the bacteria, Acetobacter xylinum. Static batch fermentations for bacterial cellulose production were studied in coconut and pineapple juices under 30 °C in 5-1 fermenters by using three Acetobacter strains: A. xylinum TISTR 998, A. xylinum TISTR 975, and A. xylinum TISTR 893. Experiments were carried out to compare bacterial cellulose yields along with growth kinetic analysis. Results showed that A. xylinum TISTR 998 produced a bacterial cellulose yield of 553.33 g/l, while A. xylinum TISTR 893 produced 453.33 g/l and A. xylinum TISTR 975 produced 243.33 g/l. In pineapple juice, the yields for A. xylinum TISTR 893, 975, and 998 were 576.66, 546.66, and 520 g/l, respectively. The strain TISTR 998 showed the highest productivity when using coconut juice. Morphological properties of cellulose pellicles, in terms of texture and color, were also measured, and the textures were not significantly different among treatments.

  8. Application of Whole-Genome Sequencing for Bacterial Strain Typing in Molecular Epidemiology

    PubMed Central

    SenGupta, Dhruba J.; Cummings, Lisa A.; Land, Tyler A.; Hoogestraat, Daniel R.; Cookson, Brad T.

    2015-01-01

    Nosocomial infections pose a significant threat to patient health; however, the gold standard laboratory method for determining bacterial relatedness (pulsed-field gel electrophoresis [PFGE]) remains essentially unchanged 20 years after its introduction. Here, we explored bacterial whole-genome sequencing (WGS) as an alternative approach for molecular strain typing. We compared WGS to PFGE for investigating presumptive outbreaks involving three important pathogens: vancomycin-resistant Enterococcus faecium (n = 19), methicillin-resistant Staphylococcus aureus (n = 17), and Acinetobacter baumannii (n = 15). WGS was highly reproducible (average ≤ 0.39 differences between technical replicates), which enabled a functional, quantitative definition for determining clonality. Strain relatedness data determined by PFGE and WGS roughly correlated, but the resolution of WGS was superior (P = 5.6 × 10−8 to 0.016). Several discordant results were noted between the methods. A total of 28.9% of isolates which were indistinguishable by PFGE were nonclonal by WGS. For A. baumannii, a species known to undergo rapid horizontal gene transfer, 16.2% of isolate pairs considered nonidentical by PFGE were clonal by WGS. Sequencing whole bacterial genomes with single-nucleotide resolution demonstrates that PFGE is prone to false-positive and false-negative results and suggests the need for a new gold standard approach for molecular epidemiological strain typing. PMID:25631811

  9. Application of whole-genome sequencing for bacterial strain typing in molecular epidemiology.

    PubMed

    Salipante, Stephen J; SenGupta, Dhruba J; Cummings, Lisa A; Land, Tyler A; Hoogestraat, Daniel R; Cookson, Brad T

    2015-04-01

    Nosocomial infections pose a significant threat to patient health; however, the gold standard laboratory method for determining bacterial relatedness (pulsed-field gel electrophoresis [PFGE]) remains essentially unchanged 20 years after its introduction. Here, we explored bacterial whole-genome sequencing (WGS) as an alternative approach for molecular strain typing. We compared WGS to PFGE for investigating presumptive outbreaks involving three important pathogens: vancomycin-resistant Enterococcus faecium (n=19), methicillin-resistant Staphylococcus aureus (n=17), and Acinetobacter baumannii (n=15). WGS was highly reproducible (average≤0.39 differences between technical replicates), which enabled a functional, quantitative definition for determining clonality. Strain relatedness data determined by PFGE and WGS roughly correlated, but the resolution of WGS was superior (P=5.6×10(-8) to 0.016). Several discordant results were noted between the methods. A total of 28.9% of isolates which were indistinguishable by PFGE were nonclonal by WGS. For A. baumannii, a species known to undergo rapid horizontal gene transfer, 16.2% of isolate pairs considered nonidentical by PFGE were clonal by WGS. Sequencing whole bacterial genomes with single-nucleotide resolution demonstrates that PFGE is prone to false-positive and false-negative results and suggests the need for a new gold standard approach for molecular epidemiological strain typing. PMID:25631811

  10. Interaction between selected bacterial strains and Arabidopsis halleri modulates shoot proteome and cadmium and zinc accumulation

    PubMed Central

    Panigati, Monica; Furini, Antonella

    2011-01-01

    The effects of plant–microbe interactions between the hyperaccumulator Arabidopsis halleri and eight bacterial strains, isolated from the rhizosphere of A. halleri plants grown in a cadmium- and zinc-contaminated site, were analysed for shoot metal accumulation, shoot proteome, and the transcription of genes involved in plant metal homeostasis and hyperaccumulation. Cadmium and zinc concentrations were lower in the shoots of plants cultivated in the presence of these metals plus the selected bacterial strains compared with plants grown solely with these metals or, as previously reported, with plants grown with these metals plus the autochthonous rhizosphere-derived microorganisms. The shoot proteome of plants cultivated in the presence of these selected bacterial strains plus metals, showed an increased abundance of photosynthesis- and abiotic stress-related proteins (e.g. subunits of the photosynthetic complexes, Rubisco, superoxide dismutase, and malate dehydrogenase) counteracted by a decreased amount of plant defence-related proteins (e.g. endochitinases, vegetative storage proteins, and β-glucosidase). The transcription of several homeostasis genes was modulated by the microbial communities and by Cd and Zn content in the shoot. Altogether these results highlight the importance of plant-microbe interactions in plant protein expression and metal accumulation and emphasize the possibility of exploiting microbial consortia for increasing or decreasing shoot metal content. PMID:21357773

  11. Screening of species-specific lactic acid bacteria for veal calves multi-strain probiotic adjuncts.

    PubMed

    Ripamonti, Barbara; Agazzi, Alessandro; Bersani, Carla; De Dea, Paola; Pecorini, Chiara; Pirani, Silvia; Rebucci, Raffaella; Savoini, Giovanni; Stella, Simone; Stenico, Alberta; Tirloni, Erica; Domeneghini, Cinzia

    2011-06-01

    The selection of promising specific species of lactic acid bacteria with potential probiotic characteristics is of particular interest in producing multi species-specific probiotic adjuncts in veal calves rearing. The aim of the present work was to select and evaluate in vitro the functional activity of lactic acid bacteria, Bifidobacterium longum and Bacillus coagulans strains isolated from veal calves in order to assess their potential use as multi species-specific probiotics for veal calves. For this purpose, bacterial strains isolated from faeces collected from 40 healthy 50-day-calves, were identified by RiboPrinter and 16s rRNA gene sequence. The most frequent strains belonged to the species B. longum, Streptococcus bovis, Lactobacillus animalis and Streptococcus macedonicus. Among these, 7 strains were chosen for testing their probiotic characteristics in vitro. Three strains, namely L. animalis SB310, Lactobacillus paracasei subsp. paracasei SB137 and B. coagulans SB117 showed varying individual but promising capabilities to survive in the gastrointestinal tract, to adhere, to produce antimicrobial compounds. These three selected species-specific bacteria demonstrated in vitro, both singularly and mixed, the functional properties needed for their use as potential probiotics in veal calves. PMID:21619939

  12. Lactic acid bacteria colonization and clinical outcome after probiotic supplementation in conventionally treated bacterial vaginosis and vulvovaginal candidiasis.

    PubMed

    Ehrström, Sophia; Daroczy, Katalin; Rylander, Eva; Samuelsson, Carolina; Johannesson, Ulrika; Anzén, Bo; Påhlson, Carl

    2010-09-01

    This randomized double-blind placebo controlled study assessed the vaginal colonization of lactic acid bacteria and clinical outcome. Vaginal capsules containing L gasseri LN40, Lactobacillus fermentum LN99, L. casei subsp. rhamnosus LN113 and P. acidilactici LN23, or placebos were administered for five days to 95 women after conventional treatment of bacterial vaginosis and/or vulvovaginal candidiasis. Vulvovaginal examinations and vaginal samplings were performed before and after administration, after the first and second menstruation, and after six months. Presence of LN strains was assessed using RAPD analysis. LN strains were present 2-3 days after administration in 89% of the women receiving LN strains (placebo: 0%, p < 0.0001). After one menstruation 53% were colonized by at least one LN strain. Nine percent were still colonized six months after administration. Ninety-three percent of the women receiving LN strains were cured 2-3 days after administration (placebo: 83%), and 78% after one menstruation (placebo: 71%) (ns). The intervention group experienced less malodorous discharge 2-3 days after administration (p = 0.03) and after the second menstruation (p = 0.04), compared with placebo. In summary, five days of vaginal administration of LN strains after conventional treatment of bacterial vaginosis and/or vulvovaginal candidiasis lead to vaginal colonization, somewhat fewer recurrences and less malodorous discharge. PMID:20472091

  13. Characterization of certain bacterial strains for potential use as starter or probiotic cultures in dairy products.

    PubMed

    Monteagudo-Mera, A; Caro, I; Rodríguez-Aparicio, L B; Rúa, J; Ferrero, M A; García-Armesto, M R

    2011-08-01

    The present work was aimed at characterizing 12 strains of lactic acid bacteria (LAB) to obtain improved potential starter or probiotic cultures that could be used for making dairy products from ewe's milk and cow's milk. Eight strains with antimicrobial properties, isolated from ewe's milk and from cheese made from ewe's and/or cow's milk, were studied. They were identified as Enterococcus faecalis (five strains), Lactococcus lactis subsp. cremoris, Leuconostoc mesenteroides, and Lactobacillus paracasei subsp. paracasei (one strain of each species). Additionally, four strains were obtained from the American Type Culture Collection: Lactobacillus casei 393 (isolated from cheese), L. lactis subsp. lactis 11454 (origin nonspecified and a producer of nisin), and two strains isolated from human feces (L. paracasei subsp. paracasei 27092 and Lactobacillus rhamnosus 53103, antibacterial agent producer). All E. faecalis strains showed at least one virulence factor (either hemolysin or gelatinase), which emphasizes the importance of these studies in this species. Both L. lactis strains and most Lactobacillus spp. were good acidifiers in ewe's milk and cow's milk at 30°C. High β-galactosidase activity, as well as aminopeptidase activities that favor the development of desirable flavors in cheese, were detected in all Lactobacillus spp. strains. Furthermore, L. rhamnosus ATCC 53103 showed α-fucosidase activity (thought to help colonization of the intestine) and lack of α-glucosidase activity (a trait considered positive for diabetic and obese humans). This last enzymatic activity was also lacking in L. lactis ATCC 11454. L. mesenteroides was the only strain D(2)-lactic acid producer. The selection of any particular strain for probiotic or dairy cultures should be performed according to the technological and/or functional abilities needed. PMID:21819671

  14. Regional analysis of potential polychlorinated biphenyl degrading bacterial strains from China.

    PubMed

    Shuai, Jianjun; Yu, Xurun; Zhang, Jing; Xiong, Ai-Sheng; Xiong, Fei

    2016-01-01

    Polychlorinated biphenyls (PCBs), the chlorinated derivatives of biphenyl, are one of the most prevalent, highly toxic and persistent groups of contaminants in the environment. The objective of this study was to investigate the biodegradation of PCBs in northeastern (Heilongjiang Province), northern (Shanxi Province) and eastern China (Shanghai municipality). From these areas, nine soil samples were screened for PCB-degrading bacteria using a functional complementarity method. The genomic 16S rDNA locus was amplified and the products were sequenced to identify the bacterial genera. Seven Pseudomonas strains were selected to compare the capacity of bacteria from different regions to degrade biphenyl by HPLC. Compared to the biphenyl content in controls of 100%, the biphenyl content went down to 3.7% for strain P9-324, 36.3% for P2-11, and 20.0% for the other five strains. These results indicate that a longer processing time led to more degradation of biphenyl. PCB-degrading bacterial strains are distributed differently in different regions of China. PMID:27140507

  15. Draft Genome Sequence of Two Strains of Xanthomonas arboricola Isolated from Prunus persica Which Are Dissimilar to Strains That Cause Bacterial Spot Disease on Prunus spp.

    PubMed

    Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M; Cubero, Jaime

    2016-01-01

    The draft genome sequences of two strains of Xanthomonas arboricola, isolated from asymptomatic peach trees in Spain, are reported here. These strains are avirulent and do not belong to the same phylogroup as X. arboricola pv. pruni, a causal agent of bacterial spot disease of stone fruits and almonds. PMID:27609931

  16. Exposure to bacterial endotoxin generates a distinct strain of α-synuclein fibril.

    PubMed

    Kim, Changyoun; Lv, Guohua; Lee, Jun Sung; Jung, Byung Chul; Masuda-Suzukake, Masami; Hong, Chul-Suk; Valera, Elvira; Lee, He-Jin; Paik, Seung R; Hasegawa, Masato; Masliah, Eliezer; Eliezer, David; Lee, Seung-Jae

    2016-01-01

    A single amyloidogenic protein is implicated in multiple neurological diseases and capable of generating a number of aggregate "strains" with distinct structures. Among the amyloidogenic proteins, α-synuclein generates multiple patterns of proteinopathies in a group of diseases, such as Parkinson disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA). However, the link between specific conformations and distinct pathologies, the key concept of the strain hypothesis, remains elusive. Here we show that in the presence of bacterial endotoxin, lipopolysaccharide (LPS), α-synuclein generated a self-renewable, structurally distinct fibril strain that consistently induced specific patterns of synucleinopathies in mice. These results suggest that amyloid fibrils with self-renewable structures cause distinct types of proteinopathies despite the identical primary structure and that exposure to exogenous pathogens may contribute to the diversity of synucleinopathies. PMID:27488222

  17. Direct detection of fatty acid ethyl esters using low temperature plasma (LTP) ambient ionization mass spectrometry for rapid bacterial differentiation.

    PubMed

    Zhang, J Isabella; Costa, Anthony B; Tao, W Andy; Cooks, R Graham

    2011-08-01

    Low temperature plasma mass spectrometry (LTP-MS) was employed to detect fatty acid ethyl esters (FAEE) from bacterial samples directly. Positive ion mode FAEE mass spectrometric profiles of sixteen different bacterial samples were obtained without extraction or other sample preparation. In the range m/z 200-300, LTP mass spectra show highly reproducible and characteristic patterns. To identify the FAEE's associated with the characteristic peaks, accurate masses were recorded in the full scan mode using an LTQ/Orbitrap instrument, and tandem mass spectrometry was performed. Data were examined by principal component analysis (PCA) to determine the degree of differentiation possible amongst different bacterial species. Gram-positive and gram-negative bacteria are readily distinguished, and 11 out of 13 Salmonella strains show distinctive patterns. Growth media effects are observed but do not interfere with species recognition based on the PCA results. PMID:21706093

  18. Bacterial utilization of L-sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-08-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of

  19. Bacterial Utilization of L-sugars and D-amino Acids

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-01-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084

  20. Pectinolytic systems of two aerobic sporogenous bacterial strains with high activity on pectin.

    PubMed

    Soriano, Margarita; Diaz, Pilar; Pastor, F I Javier

    2005-02-01

    Strains Paenibacillus sp. BP-23 and Bacillus sp. BP-7, previously isolated from soil from a rice field, secreted high levels of pectinase activity in media supplemented with pectin. Production of pectinases in strain Paenibacillus sp. BP-23 showed catabolite repression, while in Bacillus sp. BP-7 production of pectin degrading enzymes was not negatively affected by glucose. The two strains showed lyase activities as the predominant pectinases, while hydrolase activity was very low. Analysis of Paenibacillus sp. BP-23 in SDS-polyacrylamide gels and zymograms showed five pectinase activity bands. The strict requirement of Ca(2+) for lyase activity of the strain indicates that correspond to pectate lyases. For Bacillus sp. BP-7, zymograms showed four bands of different size. The strain showed a Ca(2+) requirement for lyase activity on pectate but not on pectin, indicating that the pectinolytic system of Bacillus sp. BP-7 is comprised of pectate lyases and pectin lyases. The results show differences in pectin degrading systems between the two aerobic sporogenous bacterial strains studied. PMID:15717229

  1. Amylase activity of Aspergillus strains--producers of organic acids.

    PubMed

    Tsekova, K; Dentchev, D; Vicheva, A; Dekovska, M

    1993-01-01

    The ability of fungi from genus Aspergillus (producers of organic acids) to synthesize amylase enzymes (alpha-amylase and glucoamylase) was investigated. The productivity of the strains on Czapek-Dox agar and in liquid Czapec-Dox media with 3% soluble starch as a carbon source was established. PMID:8285132

  2. Rhizospheric Bacterial Strain Brevibacterium casei MH8a Colonizes Plant Tissues and Enhances Cd, Zn, Cu Phytoextraction by White Mustard

    PubMed Central

    Płociniczak, Tomasz; Sinkkonen, Aki; Romantschuk, Martin; Sułowicz, Sławomir; Piotrowska-Seget, Zofia

    2016-01-01

    Environmental pollution by heavy metals has become a serious problem in the world. Phytoextraction, which is one of the plant-based technologies, has attracted the most attention for the bioremediation of soils polluted with these contaminants. The aim of this study was to determine whether the multiple-tolerant bacterium, Brevibacterium casei MH8a isolated from the heavy metal-contaminated rhizosphere soil of Sinapis alba L., is able to promote plant growth and enhance Cd, Zn, and Cu uptake by white mustard under laboratory conditions. Additionally, the ability of the rifampicin-resistant spontaneous mutant of MH8a to colonize plant tissues and its mechanisms of plant growth promotion were also examined. In order to assess the ecological consequences of bioaugmentation on autochthonous bacteria, the phospholipid fatty acid (PLFA) analysis was used. The MH8a strain exhibited the ability to produce ammonia, 1-amino-cyclopropane-1-carboxylic acid deaminase, indole 3-acetic acid and HCN but was not able to solubilize inorganic phosphate and produce siderophores. Introduction of MH8a into soil significantly increased S. alba biomass and the accumulation of Cd (208%), Zn (86%), and Cu (39%) in plant shoots in comparison with those grown in non-inoculated soil. Introduced into the soil, MH8a was able to enter the plant and was found in the roots and leaves of inoculated plants thus indicating its endophytic features. PLFA analysis revealed that the MH8a that was introduced into soil had a temporary influence on the structure of the autochthonous bacterial communities. The plant growth-promoting features of the MH8a strain and its ability to enhance the metal uptake by white mustard and its long-term survival in soil as well as its temporary impact on autochthonous microorganisms make the strain a suitable candidate for the promotion of plant growth and the efficiency of phytoextraction. PMID:26909087

  3. Rhizospheric Bacterial Strain Brevibacterium casei MH8a Colonizes Plant Tissues and Enhances Cd, Zn, Cu Phytoextraction by White Mustard.

    PubMed

    Płociniczak, Tomasz; Sinkkonen, Aki; Romantschuk, Martin; Sułowicz, Sławomir; Piotrowska-Seget, Zofia

    2016-01-01

    Environmental pollution by heavy metals has become a serious problem in the world. Phytoextraction, which is one of the plant-based technologies, has attracted the most attention for the bioremediation of soils polluted with these contaminants. The aim of this study was to determine whether the multiple-tolerant bacterium, Brevibacterium casei MH8a isolated from the heavy metal-contaminated rhizosphere soil of Sinapis alba L., is able to promote plant growth and enhance Cd, Zn, and Cu uptake by white mustard under laboratory conditions. Additionally, the ability of the rifampicin-resistant spontaneous mutant of MH8a to colonize plant tissues and its mechanisms of plant growth promotion were also examined. In order to assess the ecological consequences of bioaugmentation on autochthonous bacteria, the phospholipid fatty acid (PLFA) analysis was used. The MH8a strain exhibited the ability to produce ammonia, 1-amino-cyclopropane-1-carboxylic acid deaminase, indole 3-acetic acid and HCN but was not able to solubilize inorganic phosphate and produce siderophores. Introduction of MH8a into soil significantly increased S. alba biomass and the accumulation of Cd (208%), Zn (86%), and Cu (39%) in plant shoots in comparison with those grown in non-inoculated soil. Introduced into the soil, MH8a was able to enter the plant and was found in the roots and leaves of inoculated plants thus indicating its endophytic features. PLFA analysis revealed that the MH8a that was introduced into soil had a temporary influence on the structure of the autochthonous bacterial communities. The plant growth-promoting features of the MH8a strain and its ability to enhance the metal uptake by white mustard and its long-term survival in soil as well as its temporary impact on autochthonous microorganisms make the strain a suitable candidate for the promotion of plant growth and the efficiency of phytoextraction. PMID:26909087

  4. Competitive Ability and Survival in Soil of Pseudomonas Strain 679-2, a Dominant, Nonobligate Bacterial Predator of Bacteria

    PubMed Central

    Casida, L. E.

    1992-01-01

    A copper-resistant, nonobligate, bacterial predator of bacteria was isolated from soil. It was a Pseudomonas species, designated strain 679-2. It attacked most other nonobligate bacterial predators and hence could control their predatory and other activities in nature. It also inhibited various fungi. It attached to prey cells and produced a toxic, copper-related, growth initiation factor like that produced by Cupriavidus necator. In addition, it produced a second, novel compound that was both antibacterial and antifungal. Strain 679-2 appeared to have only a very limited natural occurrence. It was found only in the soil from one small area in one field. It was absent on the leaves of the plant species that were examined. Regardless of its rarity, however, it was highly competitive in soil. An inoculum consisting of only a few cells added to soil multiplied rapidly to become a major component of the soil microflora within 24 h. A small amount of glutamic acid could be added along with the cells to stimulate production of the toxic compounds noted above, but this was not necessary. After this multiplication, or when large numbers of cells were added to soil, the numbers decreased only slowly during the next several months. Cell survival also was good on plant leaves. The survival in soil and on plant leaves occurred in both laboratory and field experiments. Other than desiccation, the natural mechanism for controlling the numbers or activities of strain 679-2 in soil is not known. The various characteristics of this bacterium, as noted above, are of particular interest because they indicate a possible use of the cells or inhibitor compounds for controlling organisms in soil or on plant surfaces. PMID:16348631

  5. Use of Fatty Acid Methyl Ester Profiles to Compare Copper-Tolerant and Copper-Sensitive Strains of Pantoea ananatis.

    PubMed

    Nischwitz, C; Gitaitis, R; Sanders, H; Langston, D; Mullinix, B; Torrance, R; Boyhan, G; Zolobowska, L

    2007-10-01

    acid/14-methylpentadecenoic acid) also had an impact on the differences observed between copper-sensitive parents and copper-resistant mutants. Finding these changes in bacterial fatty acid composition could lead to the development of a laboratory assay to identify copper-tolerant strains using gas chromatography as well as providing clues to further elucidate the mode of action of copper tolerance. PMID:18943688

  6. Cockroaches as a Source of High Bacterial Pathogens with Multidrug Resistant Strains in Gondar Town, Ethiopia

    PubMed Central

    Huruy, Kahsay; Muluye, Dagnachew; Feleke, Tigist; G/Silassie, Fisha; Ayalew, Getenet; Nagappan, Raja

    2016-01-01

    Background. Cockroaches are source of bacterial infections and this study was aimed to assess bacterial isolates and their antimicrobial profiles from cockroaches in Gondar town, Ethiopia. Methods. A total of 60 cockroaches were collected from March 1 to May 30, 2014, in Gondar town. Bacterial species were isolated from external and internal parts of cockroaches. Disk diffusion method was used to determine antibiotic susceptibility patterns. Data were entered and analyzed by using SPSS version 20; P values <0.005 were considered as statistically significant. Results. Of 181 identified bacteria species, 110 (60.8%) and 71 (39.2%) were identified from external and internal parts of cockroaches, respectively. Klebsiella pneumoniae 32 (17.7%), Escherichia coli 29 (16%), and Citrobacter spp. 27 (15%) were the predominant isolates. High resistance rate was observed to cotrimoxazole, 60 (33.1%), and least resistance rate was noted to ciprofloxacin, 2 (1.1%). Additionally, 116 (64.1%) of the isolates were MDR strains; Salmonella spp. were the leading MDR isolates (100%) followed by Enterobacter (90.5%) and Shigella spp. (76.9%). Conclusion. Cockroaches are the potential source of bacteria pathogens with multidrug resistant strains and hence effective preventive and control measures are required to minimize cockroach related infections. PMID:27340653

  7. Cockroaches as a Source of High Bacterial Pathogens with Multidrug Resistant Strains in Gondar Town, Ethiopia.

    PubMed

    Moges, Feleke; Eshetie, Setegn; Endris, Mengistu; Huruy, Kahsay; Muluye, Dagnachew; Feleke, Tigist; G/Silassie, Fisha; Ayalew, Getenet; Nagappan, Raja

    2016-01-01

    Background. Cockroaches are source of bacterial infections and this study was aimed to assess bacterial isolates and their antimicrobial profiles from cockroaches in Gondar town, Ethiopia. Methods. A total of 60 cockroaches were collected from March 1 to May 30, 2014, in Gondar town. Bacterial species were isolated from external and internal parts of cockroaches. Disk diffusion method was used to determine antibiotic susceptibility patterns. Data were entered and analyzed by using SPSS version 20; P values <0.005 were considered as statistically significant. Results. Of 181 identified bacteria species, 110 (60.8%) and 71 (39.2%) were identified from external and internal parts of cockroaches, respectively. Klebsiella pneumoniae 32 (17.7%), Escherichia coli 29 (16%), and Citrobacter spp. 27 (15%) were the predominant isolates. High resistance rate was observed to cotrimoxazole, 60 (33.1%), and least resistance rate was noted to ciprofloxacin, 2 (1.1%). Additionally, 116 (64.1%) of the isolates were MDR strains; Salmonella spp. were the leading MDR isolates (100%) followed by Enterobacter (90.5%) and Shigella spp. (76.9%). Conclusion. Cockroaches are the potential source of bacteria pathogens with multidrug resistant strains and hence effective preventive and control measures are required to minimize cockroach related infections. PMID:27340653

  8. The killing activity of microwaves on some non-sporogenic and sporogenic medically important bacterial strains.

    PubMed

    Najdovski, L; Dragas, A Z; Kotnik, V

    1991-12-01

    The killing activity of microwaves of 2450 MHz frequency and 325 W, 650 W and 1400 W power on some bacterial strains was investigated. Vegetative strains of Staphylococcus aureus, Streptococcus pyogenes Group A, Escherichia coli, Pseudomonas aeruginosa and Enterococcus faecalis and spores of Bacillus subtilis and Bacillis stearothermophilus in aqueous suspensions were exposed to 325 W and 650 W waves for different lengths of time. Enterococcus faecalis and spores of B. subtilis and B. stearothermophilus were exposed additionally to 1400 W waves in aqueous and 'dried' suspensions. Vegetative bacteria were promptly killed in 5 min or less, E. faecalis being slightly more resistant. Bacterial spores were only killed in aqueous suspension when a 1400 W setting was used for 10 to 20 min. Bacterial spores adhering to the tube walls after the aqueous suspension was poured out were reduced in number. We assume that the conventional microwave ovens available on the market may be used for a high level of disinfection but not for sterilization, and only then if sufficient water is present. PMID:1686036

  9. Bacterial production of free fatty acids from freshwater macroalgal cellulose

    PubMed Central

    Hoovers, Spencer W.; Marner, Wesley D.; Brownson, Amy K.; Lennen, Rebecca M.; Wittkopp, Tyler M.; Yoshitani, Jun; Zulkifly, Shahrizim; Graham, Linda E.; Chaston, Sheena D.; McMahon, Katherine D.

    2013-01-01

    The predominant strategy for using algae to produce biofuels relies on the overproduction of lipids in microalgae with subsequent conversion to biodiesel (methyl-esters) or green diesel (alkanes). Conditions that both optimize algal growth and lipid accumulation rarely overlap, and differences in growth rates can lead to wild species outcompeting the desired lipid-rich strains. Here, we demonstrate an alternative strategy in which cellulose contained in the cell walls of multicellular algae is used as a feedstock for cultivating biofuel-producing micro-organisms. Cellulose was extracted from an environmental sample of Cladophora glomerata-dominated periphyton that was collected from Lake Mendota, WI, USA. The resulting cellulose cake was hydrolyzed by commercial enzymes to release fermentable glucose. The hydrolysis mixture was used to formulate an undefined medium that was able to support the growth, without supplementation, of a free fatty acid (FFA)-overproducing strain of Escherichia coli (Lennen et. al 2010). To maximize free fatty acid production from glucose, an isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible vector was constructed to express the Umbellularia californica acyl–acyl carrier protein (ACP) thioesterase. Thioesterase expression was optimized by inducing cultures with 50 μM IPTG. Cell density and FFA titers from cultures grown on algae-based media reached 50% of those (~90 μg/mL FFA) cultures grown on rich Luria–Bertani broth supplemented with 0.2% glucose. In comparison, cultures grown in two media based on AFEX-pretreated corn stover generated tenfold less FFA than cultures grown in algae-based media. This study demonstrates that macroalgal cellulose is a potential carbon source for the production of biofuels or other microbially synthesized compounds. PMID:21643704

  10. Development of Fatty Acid-Producing Corynebacterium glutamicum Strains

    PubMed Central

    Takeno, Seiki; Takasaki, Manami; Urabayashi, Akinobu; Mimura, Akinori; Muramatsu, Tetsuhiro; Mitsuhashi, Satoshi

    2013-01-01

    To date, no information has been made available on the genetic traits that lead to increased carbon flow into the fatty acid biosynthetic pathway of Corynebacterium glutamicum. To develop basic technologies for engineering, we employed an approach that begins by isolating a fatty acid-secreting mutant without depending on mutagenic treatment. This was followed by genome analysis to characterize its genetic background. The selection of spontaneous mutants resistant to the palmitic acid ester surfactant Tween 40 resulted in the isolation of a desired mutant that produced oleic acid, suggesting that a single mutation would cause increased carbon flow down the pathway and subsequent excretion of the oversupplied fatty acid into the medium. Two additional rounds of selection of spontaneous cerulenin-resistant mutants led to increased production of the fatty acid in a stepwise manner. Whole-genome sequencing of the resulting best strain identified three specific mutations (fasR20, fasA63up, and fasA2623). Allele-specific PCR analysis showed that the mutations arose in that order. Reconstitution experiments with these mutations revealed that only fasR20 gave rise to oleic acid production in the wild-type strain. The other two mutations contributed to an increase in oleic acid production. Deletion of fasR from the wild-type strain led to oleic acid production as well. Reverse transcription-quantitative PCR analysis revealed that the fasR20 mutation brought about upregulation of the fasA and fasB genes encoding fatty acid synthases IA and IB, respectively, by 1.31-fold ± 0.11-fold and 1.29-fold ± 0.12-fold, respectively, and of the accD1 gene encoding the β-subunit of acetyl-CoA carboxylase by 3.56-fold ± 0.97-fold. On the other hand, the fasA63up mutation upregulated the fasA gene by 2.67-fold ± 0.16-fold. In flask cultivation with 1% glucose, the fasR20 fasA63up fasA2623 triple mutant produced approximately 280 mg of fatty acids/liter, which consisted mainly of oleic

  11. Antimicrobial Activity of Monoramnholipids Produced by Bacterial Strains Isolated from the Ross Sea (Antarctica).

    PubMed

    Tedesco, Pietro; Maida, Isabel; Palma Esposito, Fortunato; Tortorella, Emiliana; Subko, Karolina; Ezeofor, Chidinma Christiana; Zhang, Ying; Tabudravu, Jioji; Jaspars, Marcel; Fani, Renato; de Pascale, Donatella

    2016-05-01

    Microorganisms living in extreme environments represent a huge reservoir of novel antimicrobial compounds and possibly of novel chemical families. Antarctica is one of the most extraordinary places on Earth and exhibits many distinctive features. Antarctic microorganisms are well known producers of valuable secondary metabolites. Specifically, several Antarctic strains have been reported to inhibit opportunistic human pathogens strains belonging to Burkholderia cepacia complex (Bcc). Herein, we applied a biodiscovery pipeline for the identification of anti-Bcc compounds. Antarctic sub-sea sediments were collected from the Ross Sea, and used to isolate 25 microorganisms, which were phylogenetically affiliated to three bacterial genera (Psychrobacter, Arthrobacter, and Pseudomonas) via sequencing and analysis of 16S rRNA genes. They were then subjected to a primary cell-based screening to determine their bioactivity against Bcc strains. Positive isolates were used to produce crude extracts from microbial spent culture media, to perform the secondary screening. Strain Pseudomonas BNT1 was then selected for bioassay-guided purification employing SPE and HPLC. Finally, LC-MS and NMR structurally resolved the purified bioactive compounds. With this strategy, we achieved the isolation of three rhamnolipids, two of which were new, endowed with high (MIC < 1 μg/mL) and unreported antimicrobial activity against Bcc strains. PMID:27128927

  12. Antimicrobial Activity of Monoramnholipids Produced by Bacterial Strains Isolated from the Ross Sea (Antarctica) †

    PubMed Central

    Tedesco, Pietro; Maida, Isabel; Palma Esposito, Fortunato; Tortorella, Emiliana; Subko, Karolina; Ezeofor, Chidinma Christiana; Zhang, Ying; Tabudravu, Jioji; Jaspars, Marcel; Fani, Renato; de Pascale, Donatella

    2016-01-01

    Microorganisms living in extreme environments represent a huge reservoir of novel antimicrobial compounds and possibly of novel chemical families. Antarctica is one of the most extraordinary places on Earth and exhibits many distinctive features. Antarctic microorganisms are well known producers of valuable secondary metabolites. Specifically, several Antarctic strains have been reported to inhibit opportunistic human pathogens strains belonging to Burkholderia cepacia complex (Bcc). Herein, we applied a biodiscovery pipeline for the identification of anti-Bcc compounds. Antarctic sub-sea sediments were collected from the Ross Sea, and used to isolate 25 microorganisms, which were phylogenetically affiliated to three bacterial genera (Psychrobacter, Arthrobacter, and Pseudomonas) via sequencing and analysis of 16S rRNA genes. They were then subjected to a primary cell-based screening to determine their bioactivity against Bcc strains. Positive isolates were used to produce crude extracts from microbial spent culture media, to perform the secondary screening. Strain Pseudomonas BNT1 was then selected for bioassay-guided purification employing SPE and HPLC. Finally, LC-MS and NMR structurally resolved the purified bioactive compounds. With this strategy, we achieved the isolation of three rhamnolipids, two of which were new, endowed with high (MIC < 1 μg/mL) and unreported antimicrobial activity against Bcc strains. PMID:27128927

  13. [Advances in the progress of anti-bacterial biofilms properties of acetic acid].

    PubMed

    Gao, Xinxin; Jin, Zhenghua; Chen, Xinxin; Yu, Jia'ao

    2016-06-01

    Bacterial biofilms are considered to be the hindrance in the treatment of chronic wound, because of their tolerance toward antibiotics and other antimicrobial agents. They also have strong ability to escape from the host immune attack. Acetic acid, as a kind of organic weak acid, can disturb the biofilms by freely diffusing through the bacterial biofilms and bacterial cell membrane structure. Then the acid dissociates to release the hydrogen ions, leading to the disorder of the acid-base imbalance, change of protein conformation, and the degradation of the DNA within the membranes. This paper reviews the literature on the characteristics and treatment strategies of the bacterial biofilms and the acetic acid intervention on them, so as to demonstrate the roles acetic acid may play in the treatment of chronic wound, and thus provide a convincing treatment strategy for this kind of disease. PMID:27321493

  14. Complete Genome Sequence of Gluconacetobacter hansenii Strain NQ5 (ATCC 53582), an Efficient Producer of Bacterial Cellulose

    PubMed Central

    Pfeffer, Sarah; Mehta, Kalpa

    2016-01-01

    This study reports the release of the complete nucleotide sequence of Gluconacetobacter hansenii strain NQ5 (ATCC 53582). This strain was isolated by R. Malcolm Brown, Jr. in a sugar mill in North Queensland, Australia, and is an efficient producer of bacterial cellulose. The elucidation of the genome will contribute to the study of the molecular mechanisms necessary for cellulose biosynthesis. PMID:27516505

  15. Complete Genome Sequence of Gluconacetobacter hansenii Strain NQ5 (ATCC 53582), an Efficient Producer of Bacterial Cellulose.

    PubMed

    Pfeffer, Sarah; Mehta, Kalpa; Brown, R Malcolm

    2016-01-01

    This study reports the release of the complete nucleotide sequence of Gluconacetobacter hansenii strain NQ5 (ATCC 53582). This strain was isolated by R. Malcolm Brown, Jr. in a sugar mill in North Queensland, Australia, and is an efficient producer of bacterial cellulose. The elucidation of the genome will contribute to the study of the molecular mechanisms necessary for cellulose biosynthesis. PMID:27516505

  16. Comparative analysis of midgut bacterial communities of Aedes aegypti mosquito strains varying in vector competence to dengue virus.

    PubMed

    Charan, Shakti S; Pawar, Kiran D; Severson, David W; Patole, Milind S; Shouche, Yogesh S

    2013-07-01

    Differences in midgut bacterial communities of Aedes aegypti, the primary mosquito vector of dengue viruses (DENV), might influence the susceptibility of these mosquitoes to infection by DENV. As a first step toward addressing this hypothesis, comparative analysis of bacterial communities from midguts of mosquito strains with differential genetic susceptibility to DENV was performed. 16S rRNA gene libraries and real-time PCR approaches were used to characterize midgut bacterial community composition and abundance in three Aedes aegypti strains: MOYO, MOYO-R, and MOYO-S. Although Pseudomonas spp.-related clones were predominant across all libraries, some interesting and potentially significant differences were found in midgut bacterial communities among the three strains. Pedobacter sp.- and Janthinobacterium sp.-related phylotypes were identified only in the MOYO-R strain libraries, while Bacillus sp. was detected only in the MOYO-S strain. Rahnella sp. was found in MOYO-R and MOYO strains libraries but was absent in MOYO-S libraries. Both 16S rRNA gene library and real-time PCR approaches confirmed the presence of Pedobacter sp. only in the MOYO-R strain. Further, real-time PCR-based quantification of 16S rRNA gene copies showed bacterial abundance in midguts of the MOYO-R strain mosquitoes to be at least 10-100-folds higher than in the MOYO-S and MOYO strain mosquitoes. Our study identified some putative bacteria with characteristic physiological properties that could affect the infectivity of dengue virus. This analysis represents the first report of comparisons of midgut bacterial communities with respect to refractoriness and susceptibility of Aedes aegypti mosquitoes to DENV and will guide future efforts to address the potential interactive role of midgut bacteria of Aedes aegypti mosquitoes in determining vectorial capacity for DENV. PMID:23636307

  17. Bacterial Fatty Acid Synthesis and its Relationships with Polyketide Synthetic Pathways

    PubMed Central

    Cronan, John E.; Thomas, Jacob

    2014-01-01

    This review presents the most thoroughly studied bacterial fatty acid synthetic pathway, that of Escherichia coli and then discusses the exceptions to the E. coli pathway present in other bacteria. The known interrelationships between the fatty acid and polyketide synthetic pathways are also assessed, mainly in the Streptomyces group of bacteria. Finally, we present a compendium of methods for analysis of bacterial fatty acid synthetic pathways. PMID:19362649

  18. Strain ŽP - the first bacterial conjugation-based "kill"-"anti-kill" antimicrobial system.

    PubMed

    Starčič Erjavec, Marjanca; Petkovšek, Živa; Kuznetsova, Marina V; Maslennikova, Irina L; Žgur-Bertok, Darja

    2015-11-01

    As multidrug resistant bacteria pose one of the greatest risks to human health new alternative antibacterial agents are urgently needed. One possible mechanism that can be used as an alternative to traditional antibiotic therapy is transfer of killing agents via conjugation. Our work was aimed at providing a proof of principle that conjugation-based antimicrobial systems are possible. We constructed a bacterial conjugation-based "kill"-"anti-kill" antimicrobial system employing the well known Escherichia coli probiotic strain Nissle 1917 genetically modified to harbor a conjugative plasmid carrying the "kill" gene (colicin ColE7 activity gene) and a chromosomally encoded "anti-kill" gene (ColE7 immunity gene). The constructed strain acts as a donor in conjugal transfer and its efficiency was tested in several types of conjugal assays. Our results clearly demonstrate that conjugation-based antimicrobial systems can be highly efficient. PMID:26436830

  19. Exposure to bacterial endotoxin generates a distinct strain of α-synuclein fibril

    PubMed Central

    Kim, Changyoun; Lv, Guohua; Lee, Jun Sung; Jung, Byung Chul; Masuda-Suzukake, Masami; Hong, Chul-Suk; Valera, Elvira; Lee, He-Jin; Paik, Seung R.; Hasegawa, Masato; Masliah, Eliezer; Eliezer, David; Lee, Seung-Jae

    2016-01-01

    A single amyloidogenic protein is implicated in multiple neurological diseases and capable of generating a number of aggregate “strains” with distinct structures. Among the amyloidogenic proteins, α-synuclein generates multiple patterns of proteinopathies in a group of diseases, such as Parkinson disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA). However, the link between specific conformations and distinct pathologies, the key concept of the strain hypothesis, remains elusive. Here we show that in the presence of bacterial endotoxin, lipopolysaccharide (LPS), α-synuclein generated a self-renewable, structurally distinct fibril strain that consistently induced specific patterns of synucleinopathies in mice. These results suggest that amyloid fibrils with self-renewable structures cause distinct types of proteinopathies despite the identical primary structure and that exposure to exogenous pathogens may contribute to the diversity of synucleinopathies. PMID:27488222

  20. Identification and analysis of polyaromatic hydrocarbons (PAHs)--biodegrading bacterial strains from refinery soil of India.

    PubMed

    Chaudhary, Priyanka; Sahay, Harmesh; Sharma, Richa; Pandey, Alok Kumar; Singh, Shashi Bala; Saxena, A K; Nain, Lata

    2015-06-01

    Polyaromatic hydrocarbons (PAHs) utilizing bacteria were isolated from soils of seven sites of Mathura refinery, India. Twenty-six bacterial strains with different morphotypes were isolated. These strains were acclimatized to utilize a mixture of four polycyclic aromatic hydrocarbons, i.e., anthracene, fluorene, phenanthrene, and pyrene, each at 50 mg/L concentration as sole carbon source. Out of total isolates, 15 potent isolates were subjected to 16S rDNA sequencing and identified as a member of diverse genera, i.e., Bacillus, Acinetobacter, Stenotrophomonas, Alcaligenes, Lysinibacillus, Brevibacterium, Serratia, and Streptomyces. Consortium of four promising isolates (Acinetobacter, Brevibacterium, Serratia, and Streptomyces) were also investigated for bioremediation of PAH mixture. This consortium was proved to be efficient PAH degrader resulting in 40-70 % degradation of PAH within 7 days. Results of this study indicated that these genera may play an active role in bioremediation of PAHs. PMID:26026847

  1. Amino Acid Proximities in Two Sup35 Prion Strains Revealed by Chemical Cross-linking.

    PubMed

    Wong, Shenq-Huey; King, Chih-Yen

    2015-10-01

    Strains of the yeast prion [PSI] are different folding patterns of the same Sup35 protein, which stacks up periodically to form a prion fiber. Chemical cross-linking is employed here to probe different fiber structures assembled with a mutant Sup35 fragment. The photo-reactive cross-linker, p-benzoyl-l-phenylalanine (pBpa), was biosynthetically incorporated into bacterially prepared recombinant Sup(1-61)-GFP, containing the first 61 residues of Sup35, followed by the green fluorescent protein. Four methionine substitutions and two alanine substitutions were introduced at fixed positions in Sup(1-61) to allow cyanogen bromide cleavage to facilitate subsequent mass spectrometry analysis. Amyloid fibers of pBpa and Met/Ala-substituted Sup(1-61)-GFP were nucleated from purified yeast prion particles of two different strains, namely VK and VL, and shown to faithfully transmit specific strain characteristics to yeast expressing the wild type Sup35 protein. Intra- and intermolecular cross-linking were distinguished by tandem mass spectrometry analysis on fibers seeded from solutions containing equal amounts of (14)N- and (15)N-labeled protein. Fibers propagating the VL strain type exhibited intra- and intermolecular cross-linking between amino acid residues 3 and 28, as well as intra- and intermolecular linking between 32 and 55. Inter- and intramolecular cross-linking between residues 32 and 55 were detected in fibers propagating the VK strain type. Adjacencies of amino acid residues in space revealed by cross-linking were used to constrain possible chain folds of different [PSI] strains. PMID:26265470

  2. Effect of Lactobacillus strains (L. casei and L. Acidophillus Strains cerela) on bacterial overgrowth-related chronic diarrhea.

    PubMed

    Gaon, David; Garmendia, Carmen; Murrielo, Norberto O; de Cucco Games, Alfredo; Cerchio, Angel; Quintas, Ricardo; González, Silvia N; Oliver, Guillermo

    2002-01-01

    Small bowel bacterial overgrowth and related diarrhea is a condition that frequently accompanies anatomic disorders, surgically created blind loops or strictures with partial small bowel obstruction and although it is often controlled with antimicrobial therapy, alternative treatment may be needed. The aim of this study was to evaluate the efficacy of an oral probiotic preparation of 2 viable lyophilized strains of lactobacilli (1.5 g each) compared with placebo. Twenty two patients with proven overgrowth and chronic diarrhea are described. In random order and double-blind fashion, 2 groups of patients received identical capsules with both Lactobacillus casei and L. acidophillus strains CERELA (12 patients) (LC) and placebo (10 patients) (P) during three consecutive periods of 7 days each followed by a similar three periods of control after withdrawal. At the end of each period the mean daily number of stools, glucose breath H2 test, and symptoms were considered. Lactobacillus were investigated in feces in both groups at day 0 (baseline), on day 21 of treatment with LC and P and on day 21 after withdrawal. Compared with P a significant reduction in mean daily number of stools was achieved with LC (p < 0.005) at 15 days, and (p < 0.0005) at 21 days and the effect was sustained at 7 days and 15 days (p < 0.005) after withdrawal. With respect to breath H2 level a significant decrease in H2 concentration was noted at 7 days (p < 0.005) at 15 days, and 21 days (p < 0.0001) with LC and only a significant decrease (p < 0.005) was observed at 7 days after withdrawal. No significant changes were observed with respect to symptoms. The Lactobacillus CERELA strains were isolated from the feces in all patients LC (n = 12) on day 21, and by contrast no Lactobacillus were observed except in two patients out of seven patients after withdrawal. In summary, this study provides evidence that LC are effective for treatment of bacterial overgrowth--related chronic diarrhea, and suggest

  3. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens†

    PubMed Central

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R.; Barany, Francis

    2015-01-01

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft3). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic system

  4. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens.

    PubMed

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R; Barany, Francis; Soper, Steven A

    2012-09-21

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft(3)). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic

  5. A Locked Nucleic Acid (LNA)-Based Real-Time PCR Assay for the Rapid Detection of Multiple Bacterial Antibiotic Resistance Genes Directly from Positive Blood Culture

    PubMed Central

    Zhu, Lingxiang; Shen, Dingxia; Zhou, Qiming; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2015-01-01

    Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA)-based quantitative real-time PCR (LNA-qPCR) method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1–10 colony forming units (CFU) per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4%) were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates. PMID:25775001

  6. Biodegradation of the metallic carcinogen hexavalent chromium Cr(VI) by an indigenously isolated bacterial strain

    PubMed Central

    Mishra, Susmita

    2010-01-01

    Background: Hexavalent chromium [Cr(VI)], a potential mutagen and carcinogen, is regularly introduced into the environment through diverse anthropogenic activities, including electroplating, leather tanning, and pigment manufacturing. Human exposure to this toxic metal ion not only causes potential human health hazards but also affects other life forms. The World Health Organization, the International Agency for Research on Cancer, and the Environmental Protection Agency have determined that Cr(VI) compounds are known human carcinogens. The Sukinda valley in Jajpur District, Orissa, is known for its deposit of chromite ore, producing nearly 98% of the chromite ore in India and one of the prime open cast chromite ore mines in the world (CES, Orissa Newsletter). Materials and Methods: Our investigation involved microbial remediation of Cr(VI) without producing any byproduct. Bacterial cultures tolerating high concentrations of Cr were isolated from the soil sample collected from the chromite-contaminated sites of Sukinda, and their bioaccumulation properties were investigated. Strains capable of growing at 250 mg/L Cr(VI) were considered as Cr resistant. Results: The experimental investigation showed the maximum specific Cr uptake at pH 7 and temperature 30°C. At about 50 mg/L initial Cr(VI) concentrations, uptake of the selected potential strain exceeded 98% within 12 h of incubation. The bacterial isolate was identified by 16S rRNA sequencing as Brevebacterium casei. Conclusion: Results indicated promising approach for microbial remediation of effluents containing elevated levels of Cr(VI). PMID:20976016

  7. Substrate utilization profiles of bacterial strains in plankton from the River Warnow, a humic and eutrophic river in north Germany.

    PubMed

    Freese, Heike M; Eggert, Anja; Garland, Jay L; Schumann, Rhena

    2010-01-01

    Bacteria are very important degraders of organic substances in aquatic environments. Despite their influential role in the carbon (and many other element) cycle(s), the specific genetic identity of active bacteria is mostly unknown, although contributing phylogenetic groups had been investigated. Moreover, the degree to which phenotypic potential (i. e., utilization of environmentally relevant carbon substrates) is related to the genomic identity of bacteria or bacterial groups is unclear. The present study compared the genomic fingerprints of 27 bacterial isolates from the humic River Warnow with their ability to utilize 14 environmentally relevant substrates. Acetate was the only substrate utilized by all bacterial strains. Only 60% of the strains respired glucose, but this substrate always stimulated the highest bacterial activity (respiration and growth). Two isolates, both closely related to the same Pseudomonas sp., also had very similar substrate utilization patterns. However, similar substrate utilization profiles commonly belonged to genetically different strains (e.g., the substrate profile of Janthinobacterium lividum OW6/RT-3 and Flavobacterium sp. OW3/15-5 differed by only three substrates). Substrate consumption was sometimes totally different for genetically related isolates. Thus, the genomic profiles of bacterial strains were not congruent with their different substrate utilization profiles. Additionally, changes in pre-incubation conditions strongly influenced substrate utilization. Therefore, it is problematic to infer substrate utilization and especially microbial dissolved organic matter transformation in aquatic systems from bacterial molecular taxonomy. PMID:19936822

  8. Risk of Spontaneous Bacterial Peritonitis Associated With Gastric Acid Suppression

    PubMed Central

    Chang, Shy-Shin; Lai, Chih-Cheng; Lee, Meng-tse Gabriel; Lee, Yu-Chien; Tsai, Yi-Wen; Hsu, Wan-Ting; Lee, Chien-Chang

    2015-01-01

    Abstract The primary objective of this study was to determine the association between the use of gastric acid suppressants (GAS) and the risk of developing spontaneous bacterial peritonitis (SBP) in patients with advanced liver cirrhosis (LC). A case–control study nested within a cohort of 480,000 representatives of Taiwan National Health Insurance beneficiaries was carried out. A case was matched with 100 controls on age, gender, and index date of SBP diagnosis. GAS use was identified from the 1-year period before the index date. Conditional logistic regression analysis was used to adjust for various unbalanced covariates between users and nonusers of GAS. A total of 947 cases of SBP were identified among the 86,418 patients with advanced LC. A significant increased risk of developing SBP was found to be associated with current (within 30 days), and recent (within 30–90 day) use of 2 different classes of GAS: proton pump inhibitors (PPIs) and histamine 2 receptor antagonists (H2RAs). The confounder adjusted rate ratio (aRR) for the current use of PPIs was 2.77 (95%CI: 1.90–4.04) and H2RAs was 2.62 (95%CI: 2.00–3.42). The risk of SBP attenuated for the recent use of PPIs (aRR: 2.20, 95%CI: 1.60–3.02) or H2RAs (aRR: 1.72, 95%CI: 1.25–2.37). In addition, sensitivity analysis using hospitalized SBP as the primary outcome showed a similar risk for the current use of PPIs (aRR, 3.24; 95%CI: 2.08–5.05) and H2RAs (aRR 2.43; 95%CI 1.71–3.46). Furthermore, higher cumulative days of gastric acid suppression were associated with a higher risk of SBP (trend P < 0.0001). To conclude, exposure to GAS was associated with an increased risk of SBP in patients with advanced LC. The association was more pronounced in current PPI users compared with nonusers. PMID:26039135

  9. Aflatoxin B1 degradation by liquid cultures and lysates of three bacterial strains.

    PubMed

    Adebo, Oluwafemi Ayodeji; Njobeh, Patrick Berka; Sidu, Sibusiso; Tlou, Matsobane Godfrey; Mavumengwana, Vuyo

    2016-09-16

    Aflatoxin contamination remains a daunting issue to address in food safety. In spite of the efforts geared towards prevention and elimination of this toxin, it still persists in agricultural commodities. This has necessitated the search for other measures such as microbial degradation to combat this hazard. In this study, we investigated the biodegradation of aflatoxin B1 (AFB1), using lysates of three bacterial strains (Pseudomonas anguilliseptica VGF1, Pseudomonas fluorescens and Staphylococcus sp. VGF2) isolated from a gold mine aquifer. The bacterial cells were intermittently lysed in the presence and absence of protease inhibitors to obtain protease free lysates, subsequently incubated with AFB1 for 3, 6, 12, 24, and 48h to investigate whether any possible AFB1 degradation occurred using high performance liquid chromatography (HPLC) for detection. Results obtained revealed that after 6h of incubation, protease inhibited lysates of Staphylococcus sp. VGF2 demonstrated the highest degradation capacity of 100%, whereas P. anguilliseptica VGF1 and P. fluorescens lysates degraded AFB1 by 66.5 and 63%, respectively. After further incubation to 12h, no residual AFB1 was detected for all the lysates. Lower degrading ability was however observed for liquid cultures and uninhibited lysates. Data on cytotoxicity studies against human lymphocytes showed that the degraded products were less toxic than the parent AFB1. From this study, it can thus be deduced that the mechanism of degradation by these bacterial lysates is enzymatic. This study shows the efficacy of crude bacterial lysates for detoxifying AFB1 indicating potential for application in the food and feed industry. PMID:27294556

  10. Comparison of D-gluconic acid production in selected strains of acetic acid bacteria.

    PubMed

    Sainz, F; Navarro, D; Mateo, E; Torija, M J; Mas, A

    2016-04-01

    The oxidative metabolism of acetic acid bacteria (AAB) can be exploited for the production of several compounds, including D-gluconic acid. The production of D-gluconic acid in fermented beverages could be useful for the development of new products without glucose. In the present study, we analyzed nineteen strains belonging to eight different species of AAB to select those that could produce D-gluconic acid from D-glucose without consuming D-fructose. We tested their performance in three different media and analyzed the changes in the levels of D-glucose, D-fructose, D-gluconic acid and the derived gluconates. D-Glucose and D-fructose consumption and D-gluconic acid production were heavily dependent on the strain and the media. The most suitable strains for our purpose were Gluconobacter japonicus CECT 8443 and Gluconobacter oxydans Po5. The strawberry isolate Acetobacter malorum (CECT 7749) also produced D-gluconic acid; however, it further oxidized D-gluconic acid to keto-D-gluconates. PMID:26848948

  11. Marked intra-strain variation in response of Listeria monocytogenes dairy isolates to acid or salt stress and the effect of acid or salt adaptation on adherence to abiotic surfaces.

    PubMed

    Adrião, A; Vieira, M; Fernandes, I; Barbosa, M; Sol, M; Tenreiro, R P; Chambel, L; Barata, B; Zilhao, I; Shama, G; Perni, S; Jordan, S J; Andrew, P W; Faleiro, M L

    2008-03-31

    During food processing, and particularly in cheese manufacturing processes, Listeria monocytogenes may be exposed routinely to environments of low pH or high salt concentration. It has been suggested that these environmental conditions may contribute to bacterial adherence to abiotic surfaces and increased resistance to disinfection. In this study strains isolated from the environment of artisanal cheese-making dairies were used to investigate the behaviour of L. monocytogenes in response to acid and salt stress and clear differences between strains was observed. In planktonic culture, strains varied in resistance to low pH or high NaCl concentration and in the occurrence of an adaptive response to moderate acid or NaCl. There was dislocation in responses to salt and acid. Strains resistant, or adaptive, to acid were not resistant or adaptive to NaCl. The reverse also was observed. Exposure to moderate acid did not promote adherence to polystyrene but survival, at low pH or high NaCl concentration, of cells adherent to stainless steel was increased, even for strains that had no adaptive response planktonically, but the detail of these observations varied between strains. In contrast to acid adaptation, with some strains salt adaptation enhanced adherence of L. monocytogenes to polystyrene but this was not true for all strains. For some strains salt- or acid adaptation may enhance the survival of sessile cells exposed to hypochlorite disinfection. PMID:18258322

  12. Single bacterial strain capable of significant contribution to carbon cycling in the surface ocean

    NASA Astrophysics Data System (ADS)

    Pedler, Byron E.; Aluwihare, Lihini I.; Azam, Farooq

    2014-05-01

    Marine dissolved organic carbon (DOC) encompasses one of the largest reservoirs of carbon on Earth. Heterotrophic bacteria are the primary biotic force regulating the fate of this material, yet the capacity of individual strains to significantly contribute to carbon cycling is unknown. Here we quantified the ability of a single Alteromonas strain [Alteromonas sp. strain Scripps Institution of Oceanography (AltSIO)] to drawdown ambient DOC in a coastal ecosystem. In three experiments, AltSIO alone consumed the entire pool of labile DOC, defined here as the quantity consumed by the submicron size fraction of ambient microbial assemblages within 5 d. These findings demonstrate that complete removal of the labile DOC pool in coastal surface seawater can be achieved by a single taxon. During long-term incubations (>1 y) testing semilabile DOC consumption, AltSIO entered dormancy but remained viable, while the diverse assemblages continued to consume carbon. Given that AltSIO is a large bacterium and thus subject to increased grazing pressure, we sought to determine the ecological relevance of this phenotype. Growth dynamics in natural seawater revealed that AltSIO rapidly outgrew the native bacteria, and despite intense grazing pressure, was never eliminated from the population. A survey in the California Current Ecosystem revealed that large bacteria (≥40 fg Cṡcell-1) were persistent, accounting for up to 12% of total bacterial abundance and 24% of total bacterial biomass. We conclude that large, rapidly growing bacteria have the potential to disproportionately alter the fate of carbon in the mesotrophic ocean and play an important role in ecosystem function.

  13. Impact of microfluidic processing on bacterial ribonucleic acid expression

    PubMed Central

    Gandi, Senthil Kumar; Watson, David; Kersaudy-Kerhoas, Maïwenn; Bachmann, Till; Bridle, Helen

    2015-01-01

    Bacterial transcriptomics is widely used to investigate gene regulation, bacterial susceptibility to antibiotics, host-pathogen interactions, and pathogenesis. Transcriptomics is crucially dependent on suitable methods to isolate and detect bacterial RNA. Microfluidics offer ways of creating integrated point-of-care systems, analysing a sample from preparation, and RNA isolation to detection. A critical requirement for on-chip diagnostics to deliver on their promise is that mRNA expression is not altered via microfluidic sample processing. This article investigates the impact of the use of microfluidics upon RNA expression of bacteria isolated from blood, a key step towards proving the suitability of such systems for further development. PMID:26045727

  14. Influence of the acid type in the production of chitosan films reinforced with bacterial nanocellulose.

    PubMed

    Velásquez-Cock, J; Ramírez, E; Betancourt, S; Putaux, J-L; Osorio, M; Castro, C; Gañán, P; Zuluaga, R

    2014-08-01

    Chitosan films reinforced with bacterial cellulose (BC) nanoribbons were studied to understand the influence of acid (acetic and lactic acids) on the reinforcing effect. For both acids, the maximum concentration of the reinforcing constituent was 5wt% with respect to the dry weight of chitosan. The infrared spectra, mechanical properties, morphology and antimicrobial activity of the films were analyzed. The results showed a difference between the acids in their behavior and effect on the reinforcement, with a tensile strength of 12.3MPa for the acetic acid films and 3.3MPa for the lactic acid films. Additionally, the bacterial inhibition tests were shown to be positive for the lactic acid films and negative for the acetic acid films. Therefore, exchanging the acid used in these films may be desirable for certain applications. PMID:24875317

  15. Intraspecies Variation in the Emergence of Hyperinfectious Bacterial Strains in Nature

    PubMed Central

    House, John K.; Xie, Yi; Weimer, Bart C.; Sinsheimer, Robert L.; Mahan, Michael J.

    2012-01-01

    Salmonella is a principal health concern because of its endemic prevalence in food and water supplies, the rise in incidence of multi-drug resistant strains, and the emergence of new strains associated with increased disease severity. Insights into pathogen emergence have come from animal-passage studies wherein virulence is often increased during infection. However, these studies did not address the prospect that a select subset of strains undergo a pronounced increase in virulence during the infective process- a prospect that has significant implications for human and animal health. Our findings indicate that the capacity to become hypervirulent (100-fold decreased LD50) was much more evident in certain S. enterica strains than others. Hyperinfectious salmonellae were among the most virulent of this species; restricted to certain serotypes; and more capable of killing vaccinated animals. Such strains exhibited rapid (and rapidly reversible) switching to a less-virulent state accompanied by more competitive growth ex vivo that may contribute to maintenance in nature. The hypervirulent phenotype was associated with increased microbial pathogenicity (colonization; cytotoxin production; cytocidal activity), coupled with an altered innate immune cytokine response within infected cells (IFN-β; IL-1β; IL-6; IL-10). Gene expression analysis revealed that hyperinfectious strains display altered transcription of genes within the PhoP/PhoQ, PhoR/PhoB and ArgR regulons, conferring changes in the expression of classical virulence functions (e.g., SPI-1; SPI-2 effectors) and those involved in cellular physiology/metabolism (nutrient/acid stress). As hyperinfectious strains pose a potential risk to human and animal health, efforts toward mitigation of these potential food-borne contaminants may avert negative public health impacts and industry-associated losses. PMID:22511871

  16. A suite of recombinant luminescent bacterial strains for the quantification of bioavailable heavy metals and toxicity testing

    PubMed Central

    2009-01-01

    Background Recombinant whole-cell sensors have already proven useful in the assessment of the bioavailability of environmental pollutants like heavy metals and organic compounds. In this work 19 recombinant bacterial strains representing various Gram-positive (Staphylococcus aureus and Bacillus subtilis) and Gram-negative (Escherichia coli, Pseudomonas fluorescens) bacteria were constructed to express the luminescence encoding genes luxCDABE (from Photorhabdus luminescens) as a response to bioavailable heavy metals ("lights-on" metal sensors containing metal-response elements, 13 strains) or in a constitutive manner ("lights-off" constructs, 6 strains). Results The bioluminescence of all 13 "lights-on" metal sensor strains was expressed as a function of the sub-toxic metal concentrations enabling the quantitative determination of metals bioavailable for these strains. Five sensor strains, constructed for detecting copper and mercury, proved to be target metal specific, whereas eight other sensor strains were simultaneously induced by Cd2+, Hg2+, Zn2+and Pb2+. The lowest limits of determination of the "lights-on" sensor strains for the metals tested in this study were (μg l-1): 0.002 of CH3HgCl, 0.03 of HgCl2, 1.8 of CdCl2, 33 of Pb(NO3)2, 1626 of ZnSO4, 24 of CuSO4 and 340 of AgNO3. In general, the sensitivity of the "lights-on" sensor strains was mostly dependent on the metal-response element used while the selection of host bacterium played a relatively minor role. In contrast, toxicity of metals to the "lights-off" strains was only dependent on the bacterial host so that Gram-positive strains were remarkably more sensitive than Gram-negative ones. Conclusion The constructed battery of 19 recombinant luminescent bacterial strains exhibits several novel aspects as it contains i) metal sensor strains with similar metal-response elements in different host bacteria; ii) metal sensor strains with metal-response elements in different copies and iii) a "lights

  17. Data on true tRNA diversity among uncultured and bacterial strains.

    PubMed

    Rekadwad, Bhagwan N; Khobragade, Chandrahasya N

    2016-06-01

    Complete genome sequences of two uncultured archaea (BX649197 and CR937008) and 10 uncultured bacteria (AC160099, FP245538-FP245540, FP312972, FP312974-75, FP312977, FP312985 and NZ_JPJG01000067) were used for creation of digital data of tRNA. tRNAscan-SE and ENDMEMO GC calculating tools were used for detection of tRNA, drawing their structures and calculation of GC percent. Seven archaeal and 48 bacterial tRNA were detected from above 12 sequences. Four archaeal and 30 bacterial tRNA showed cove score more than 20% are called as true tRNA. Three tRNA of uncultured bacteria (AC160099) has the presence of the variable loop. The tRNA of FP245540, FP245575, FP245577 and FP245585 has one variable loop each. The true tRNA of archaea were Alanine, Arginine and Cysteine-type tRNA, while the majority of bacteria true tRNA classified as Alanine, Glutamic acid, Isoleucine, Leucine, Methionine, Phenylalanine, Proline and Valine-type tRNA with cove score ranged from 70% to 97.15%. Archaeal and bacterial have GC content approximately 43% and 34.7-63.3% respectively. Archaeal tRNA has 60.4-64.2% GC content. Similarly, bacterial tRNA contributed 49.3-66.3% GC content to the total GC content. This generated data is useful for studies on diversity of tRNA among prokaryotes. PMID:27222849

  18. Development of Amplified Fragment Length Polymorphism-Derived Functional Strain-Specific Markers To Assess the Persistence of 10 Bacterial Strains in Soil Microcosms▿

    PubMed Central

    Xiang, S.-R.; Cook, M.; Saucier, S.; Gillespie, P.; Socha, R.; Scroggins, R.; Beaudette, L. A.

    2010-01-01

    To augment the information on commercial microbial products, we investigated the persistence patterns of high-priority bacterial strains from the Canadian Domestic Substance List (DSL). Specific DNA markers for each of the 10 DSL bacterial strains were developed using the amplified fragment length polymorphism (AFLP) technique, and the fates of DSL strains introduced in soil were assessed by real-time quantitative PCR (qPCR). The results indicated that all DNA markers had high specificity at the functional strain level and that detection of the target microorganisms was sensitive at a detection limitation range from 1.3 × 102 to 3.25 × 105 CFU/g of dry soil. The results indicated that all introduced strains showed a trend toward a declining persistence in soil and could be categorized into three pattern types. The first type was long-term persistence exemplified by Pseudomonas stutzeri (ATCC 17587) and Pseudomonas denitrificans (ATCC 13867) strains. In the second pattern, represented by Bacillus subtilis (ATCC 6051) and Escherichia hermannii (ATCC 700368), the inoculated strain populations dropped dramatically below the detection threshold after 10 to 21 days, while in the third pattern there was a gradual decrease, with the population falling below the detectable level within the 180-day incubation period. These patterns indicate a selection effect of a microbial community related to the ecological function of microbial strains introduced in soil. As a key finding, the DSL strains can be quantitatively tracked in soil with high sensitivity and specificity at the functional strain level. This provides the basic evidence for further risk assessment of the priority DSL strains. PMID:20817796

  19. Bacterial flora of Tasmanian SIDS infants with special reference to pathogenic strains of Escherichia coli.

    PubMed Central

    Bettiol, S. S.; Radcliff, F. J.; Hunt, A. L.; Goldsmid, J. M.

    1994-01-01

    The general bacterial flora of 38 Tasmanian SIDS infants was examined together with faecal flora of 134 comparison infants ranging in age from birth to 6 months. The microflora of all specimens received was investigated with special emphasis on the toxigenic Escherichia coli (TEC). Samples were examined for verocytotoxigenic E. coli, free faecal verocytotoxin (FVT), heat labile toxin (LT) and heat stable toxin (ST) producers with the use of a Vero cell assay and commercial kits. The findings of this study revealed a high isolation rate (39%) of TEC from SIDS infants as compared to 1.5% from the healthy comparison infants. Atypical E. coli strains were also identified during the study, including E. coli A-D. An analysis of the same specimens for rotaviral and adenoviral antigens indicated that 30% of the SIDS cases were positive as compared to 20% in the comparison group. PMID:8150001

  20. Aerobic digestion of tannery wastewater in a sequential batch reactor by salt-tolerant bacterial strains

    NASA Astrophysics Data System (ADS)

    Durai, G.; Rajasimman, M.; Rajamohan, N.

    2011-09-01

    Among the industries generating hyper saline effluents, tanneries are prominent in India. Hyper saline wastewater is difficult to treat by conventional biological treatment methods. Salt-tolerant microbes can adapt to these conditions and degrade the organics in hyper saline wastewater. In this study, the performance of a bench scale aerobic sequencing batch reactor (SBR) was investigated to treat the tannery wastewater by the salt-tolerant bacterial strains namely Pseudomonas aeruginosa, Bacillus flexus, Exiguobacterium homiense and Styphylococcus aureus. The study was carried out under different operating conditions by changing the hydraulic retention time, organic loading rate and initial substrate concentration. From the results it was found that a maximum COD reduction of 90.4% and colour removal of 78.6% was attained. From this study it was found that the salt-tolerant microorganisms could improve the reduction efficiency of COD and colour of the tannery wastewater.

  1. Evidence of polyethylene biodegradation by bacterial strains from the guts of plastic-eating waxworms.

    PubMed

    Yang, Jun; Yang, Yu; Wu, Wei-Min; Zhao, Jiao; Jiang, Lei

    2014-12-01

    Polyethylene (PE) has been considered nonbiodegradable for decades. Although the biodegradation of PE by bacterial cultures has been occasionally described, valid evidence of PE biodegradation has remained limited in the literature. We found that waxworms, or Indian mealmoths (the larvae of Plodia interpunctella), were capable of chewing and eating PE films. Two bacterial strains capable of degrading PE were isolated from this worm's gut, Enterobacter asburiae YT1 and Bacillus sp. YP1. Over a 28-day incubation period of the two strains on PE films, viable biofilms formed, and the PE films' hydrophobicity decreased. Obvious damage, including pits and cavities (0.3-0.4 μm in depth), was observed on the surfaces of the PE films using scanning electron microscopy (SEM) and atomic force microscopy (AFM). The formation of carbonyl groups was verified using X-ray photoelectron spectroscopy (XPS) and microattenuated total reflectance/Fourier transform infrared (micro-ATR/FTIR) imaging microscope. Suspension cultures of YT1 and YP1 (10(8) cells/mL) were able to degrade approximately 6.1 ± 0.3% and 10.7 ± 0.2% of the PE films (100 mg), respectively, over a 60-day incubation period. The molecular weights of the residual PE films were lower, and the release of 12 water-soluble daughter products was also detected. The results demonstrated the presence of PE-degrading bacteria in the guts of waxworms and provided promising evidence for the biodegradation of PE in the environment. PMID:25384056

  2. Degradation and metabolism of hexazinone by two isolated bacterial strains from soil.

    PubMed

    Wang, Xuedong; Wang, Huili; Tan, Chengxia

    2005-12-01

    Two hexazinone-degrading bacterial strains were isolated from soil by enrichment culture technique, and identified as Pseudomonas sp. and Enterobacter cloacap. The two purified isolates, designated as WFX-1 and WFX-2, could rapidly degrade hexazinone with a half-life of 3.08 days and 2.95 days in mineral salt medium (MSM), while their mixed bacterial culture was found to degrade hexazinone, at an initial concentration of 50 microg/ml, by enhancing 2.3-fold over that when the isolates were used alone. Two microbial metabolites (A and D) were obtained by preparative TLC and identified on the basis of the spectral data of IR, 1H NMR and HPLC-ESI-MS, but both of them were known products as they had been reported in soil and vegetation metabolites of hexazinone. However, metabolites B and C were new degradates, whose molecular weights (MW) were 157 and 156, respectively, being reported from microbial metabolism for the first time. PMID:15987651

  3. Biodegradation of hexazinone by two isolated bacterial strains (WFX-1 and WFX-2).

    PubMed

    Wang, Xuedong; Zhou, Sumei; Wang, Huili; Yang, Shao

    2006-08-01

    Two hexazinone-degrading bacterial strains were isolated from soil by enrichment culture technique, and identified as Pseudomonas sp. and Enterobacter cloacap, respectively. The two purified isolates, designated as WFX-1 and WFX-2, could rapidly degrade hexazinone with half-lives of 3.08 and 2.95 days in mineral salts medium (hereafter referred to as MSM). In contrast, their mixed bacterial culture (herein abbreviated as MBC) was found to degrade hexazinone, at an initial concentration of 50 mg l(-1), by enhancing 2.3-fold over that when the isolates were used alone. The degradation of hexazinone by MBC in MSM clearly decreased concomitant with the increase of initial concentration, and the level of hexazinone that was toxic enough to totally inhibit degradation was in the range of 150-200 mg l(-1). The appropriately combined conditions for hexazinone degradation by MBC in MSM were studied, and found to be pH 5.5, 30 degrees C and at agitation of 120 rpm. The addition of MBC to soil had a greater impact on disappearance of hexazinone, which nearly increased fivefold over that of the control set. As a result, findings in the present investigation provide useful information for soil and water decontamination of hexazinone. PMID:16570230

  4. A Colanic Acid Operon Deletion Mutation Enhances Induction of Early Antibody Responses by Live Attenuated Salmonella Vaccine Strains

    PubMed Central

    Wang, Shifeng; Shi, Huoying; Li, Yuhua; Shi, Zhaoxing; Zhang, Xin; Baek, Chang-Ho; Mothershead, Tabor

    2013-01-01

    Colanic acid (CA) is a common exopolysaccharide produced by many genera in the Enterobacteriaceae. It is critical for biofilm formation on HEp-2 cells and on chicken intestinal tissue by Salmonella. In this study, we generated different CA synthesis gene mutants and evaluated the immune responses induced by these mutants. One of these mutations, Δ(wza-wcaM)8, which deleted the whole operon for CA synthesis, was introduced into two Salmonella vaccine strains attenuated by auxotrophic traits or by the regulated delayed attenuation strategy (RDAS). The mice immunized with the auxotrophic Salmonella vaccine strain with the deletion mutation Δ(wza-wcaM)8 developed higher vaginal IgA titers against the heterologous protective antigen and higher levels of antigen-specific IgA secretion cells in lungs. In Salmonella vaccine strains with RDAS, the strain with the Δ(wza-wcaM)8 mutation resulted in higher levels of protective antigen production during in vitro growth. Mice immunized with this strain developed higher serum IgG and mucosal IgA antibody responses at 2 weeks. This strain also resulted in better gamma interferon (IFN-γ) responses than the strain without this deletion at doses of 108 and 109 CFU. Thus, the mutation Δ(wza-wcaM)8 will be included in various recombinant attenuated Salmonella vaccine (RASV) strains with RDAS derived from Salmonella enterica serovar Paratyphi A and Salmonella enterica serovar Typhi to induce protective immunity against bacterial pathogens. PMID:23774599

  5. A colanic acid operon deletion mutation enhances induction of early antibody responses by live attenuated Salmonella vaccine strains.

    PubMed

    Wang, Shifeng; Shi, Huoying; Li, Yuhua; Shi, Zhaoxing; Zhang, Xin; Baek, Chang-Ho; Mothershead, Tabor; Curtiss, Roy

    2013-09-01

    Colanic acid (CA) is a common exopolysaccharide produced by many genera in the Enterobacteriaceae. It is critical for biofilm formation on HEp-2 cells and on chicken intestinal tissue by Salmonella. In this study, we generated different CA synthesis gene mutants and evaluated the immune responses induced by these mutants. One of these mutations, Δ(wza-wcaM)8, which deleted the whole operon for CA synthesis, was introduced into two Salmonella vaccine strains attenuated by auxotrophic traits or by the regulated delayed attenuation strategy (RDAS). The mice immunized with the auxotrophic Salmonella vaccine strain with the deletion mutation Δ(wza-wcaM)8 developed higher vaginal IgA titers against the heterologous protective antigen and higher levels of antigen-specific IgA secretion cells in lungs. In Salmonella vaccine strains with RDAS, the strain with the Δ(wza-wcaM)8 mutation resulted in higher levels of protective antigen production during in vitro growth. Mice immunized with this strain developed higher serum IgG and mucosal IgA antibody responses at 2 weeks. This strain also resulted in better gamma interferon (IFN-γ) responses than the strain without this deletion at doses of 10(8) and 10(9) CFU. Thus, the mutation Δ(wza-wcaM)8 will be included in various recombinant attenuated Salmonella vaccine (RASV) strains with RDAS derived from Salmonella enterica serovar Paratyphi A and Salmonella enterica serovar Typhi to induce protective immunity against bacterial pathogens. PMID:23774599

  6. Klebsiella sp. strain C2A isolated from olive oil mill waste is able to tolerate and degrade tannic acid in very high concentrations.

    PubMed

    Pepi, Milva; Cappelli, Serena; Hachicho, Nancy; Perra, Guido; Renzi, Monia; Tarabelli, Alessandro; Altieri, Roberto; Esposito, Alessandro; Focardi, Silvano E; Heipieper, Hermann J

    2013-06-01

    Four bacterial strains capable of growing in the presence of tannic acid as sole carbon and energy source were isolated from olive mill waste mixtures. 16S rRNA gene sequencing assigned them to the genus Klebsiella. The most efficient strain, Klebsiella sp. strain C2A, was able to degrade 3.5 g L(-1) tannic acid within 35 h with synthesizing gallic acid as main product. The capability of Klebsiella sp. strain C2A to produce tannase was evidenced at high concentrations of tannic acid up to 50 g L(-1) . The bacteria adapted to the toxicity of tannic acids by an increase in the membrane lipid fatty acids degree of saturation, especially in the presence of concentrations higher than 20 g L(-1) . The highly tolerant and adaptable bacterial strain characterized in this study could be used in bioremediation processes of wastes rich in polyphenols such as those derived from olive mills, winery or tanneries. PMID:23521025

  7. Decolourisation of Acid Orange 7 recalcitrant auto-oxidation coloured by-products using an acclimatised mixed bacterial culture.

    PubMed

    Bay, Hui Han; Lim, Chi Kim; Kee, Thuan Chien; Ware, Ismail; Chan, Giek Far; Shahir, Shafinaz; Ibrahim, Zaharah

    2014-03-01

    This study focuses on the biodegradation of recalcitrant, coloured compounds resulting from auto-oxidation of Acid Orange 7 (AO7) in a sequential facultative anaerobic-aerobic treatment system. A novel mixed bacterial culture, BAC-ZS, consisting of Brevibacillus panacihumi strain ZB1, Lysinibacillus fusiformis strain ZB2, and Enterococcus faecalis strain ZL bacteria were isolated from environmental samples. The acclimatisation of the mixed culture was carried out in an AO7 decolourised solution. The acclimatised mixed culture showed 98 % decolourisation within 2 h of facultative anaerobic treatment using yeast extract and glucose as co-substrate. Subsequent aerobic post treatment caused auto-oxidation reaction forming dark coloured compounds that reduced the percentage decolourisation to 73 %. Interestingly, further agitations of the mixed culture in the solution over a period of 48 h significantly decolourise the coloured compounds and increased the decolourisation percentage to 90 %. Analyses of the degradation compounds using UV-visible spectrophotometer, Fourier transform infrared spectroscopy (FTIR) and high performance liquid chromatography (HPLC) showed complete degradation of recalcitrant AO7 by the novel BAC-ZS. Phytotoxicity tests using Cucumis sativus confirmed the dye solution after post aerobic treatment were less toxic compared to the parent dye. The quantitative real-time PCR revealed that E. faecalis strain ZL was the dominant strain in the acclimatised mix culture. PMID:24293297

  8. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants.

    PubMed

    Berni Canani, Roberto; Sangwan, Naseer; Stefka, Andrew T; Nocerino, Rita; Paparo, Lorella; Aitoro, Rosita; Calignano, Antonio; Khan, Aly A; Gilbert, Jack A; Nagler, Cathryn R

    2016-03-01

    Dietary intervention with extensively hydrolyzed casein formula supplemented with Lactobacillus rhamnosus GG (EHCF+LGG) accelerates tolerance acquisition in infants with cow's milk allergy (CMA). We examined whether this effect is attributable, at least in part, to an influence on the gut microbiota. Fecal samples from healthy controls (n=20) and from CMA infants (n=19) before and after treatment with EHCF with (n=12) and without (n=7) supplementation with LGG were compared by 16S rRNA-based operational taxonomic unit clustering and oligotyping. Differential feature selection and generalized linear model fitting revealed that the CMA infants have a diverse gut microbial community structure dominated by Lachnospiraceae (20.5±9.7%) and Ruminococcaceae (16.2±9.1%). Blautia, Roseburia and Coprococcus were significantly enriched following treatment with EHCF and LGG, but only one genus, Oscillospira, was significantly different between infants that became tolerant and those that remained allergic. However, most tolerant infants showed a significant increase in fecal butyrate levels, and those taxa that were significantly enriched in these samples, Blautia and Roseburia, exhibited specific strain-level demarcations between tolerant and allergic infants. Our data suggest that EHCF+LGG promotes tolerance in infants with CMA, in part, by influencing the strain-level bacterial community structure of the infant gut. PMID:26394008

  9. Detection of low-abundance bacterial strains in metagenomic datasets by eigengenome partitioning.

    PubMed

    Cleary, Brian; Brito, Ilana Lauren; Huang, Katherine; Gevers, Dirk; Shea, Terrance; Young, Sarah; Alm, Eric J

    2015-10-01

    Analyses of metagenomic datasets that are sequenced to a depth of billions or trillions of bases can uncover hundreds of microbial genomes, but naive assembly of these data is computationally intensive, requiring hundreds of gigabytes to terabytes of RAM. We present latent strain analysis (LSA), a scalable, de novo pre-assembly method that separates reads into biologically informed partitions and thereby enables assembly of individual genomes. LSA is implemented with a streaming calculation of unobserved variables that we call eigengenomes. Eigengenomes reflect covariance in the abundance of short, fixed-length sequences, or k-mers. As the abundance of each genome in a sample is reflected in the abundance of each k-mer in that genome, eigengenome analysis can be used to partition reads from different genomes. This partitioning can be done in fixed memory using tens of gigabytes of RAM, which makes assembly and downstream analyses of terabytes of data feasible on commodity hardware. Using LSA, we assemble partial and near-complete genomes of bacterial taxa present at relative abundances as low as 0.00001%. We also show that LSA is sensitive enough to separate reads from several strains of the same species. PMID:26368049

  10. Biotransformation of tetracycline by a novel bacterial strain Stenotrophomonas maltophilia DT1.

    PubMed

    Leng, Yifei; Bao, Jianguo; Chang, Gaofeng; Zheng, Han; Li, Xingxing; Du, Jiangkun; Snow, Daniel; Li, Xu

    2016-11-15

    Although several abiotic processes have been reported that can transform antibiotics, little is known about whether and how microbiological processes may degrade antibiotics in the environment. This work isolated one tetracycline degrading bacterial strain, Stenotrophomonas maltophilia strain DT1, and characterized the biotransformation of tetracycline by DT1 under various environmental conditions. The biotransformation rate was the highest when the initial pH was 9 and the reaction temperature was at 30°C, and can be described using the Michaelis-Menten model under different initial tetracycline concentrations. When additional substrate was present, the substrate that caused increased biomass resulted in a decreased biotransformation rate of tetracycline. According to disk diffusion tests, the biotransformation products of tetracycline had lower antibiotic potency than the parent compound. Six possible biotransformation products were identified, and a potential biotransformation pathway was proposed that included sequential removal of N-methyl, carbonyl, and amine function groups. Results from this study can lead to better estimation of the fate and transport of antibiotics in the environment and has the potential to be utilized in designing engineering processes to remove tetracycline from water and soil. PMID:27420384

  11. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants

    DOE PAGESBeta

    Berni Canani, Roberto; Sangwan, Naseer; Stefka, Andrew T.; Nocerino, Rita; Paparo, Lorella; Aitoro, Rosita; Calignano, Antonio; Khan, Aly A.; Gilbert, Jack A.; Nagler, Cathryn R.

    2015-09-22

    Dietary intervention with extensively hydrolyzed casein formula supplemented with Lactobacillus rhamnosus GG (EHCF+LGG) accelerates tolerance acquisition in infants with cow’s milk allergy (CMA). We examined whether this effect is attributable, at least in part, to an influence on the gut microbiota. Fecal samples from healthy controls (n=20) and from CMA infants (n=19) before and after treatment with EHCF with (n=12) and without (n=7) supplementation with LGG were compared by 16S rRNA-based operational taxonomic unit clustering and oligotyping. Differential feature selection and generalized linear model fitting revealed that the CMA infants have a diverse gut microbial community structure dominated by Lachnospiraceaemore » (20.5±9.7%) and Ruminococcaceae (16.2±9.1%). Blautia, Roseburia and Coprococcus were significantly enriched following treatment with EHCF and LGG, but only one genus, Oscillospira, was significantly different between infants that became tolerant and those that remained allergic. However, most tolerant infants showed a significant increase in fecal butyrate levels, and those taxa that were significantly enriched in these samples, Blautia and Roseburia, exhibited specific strain-level demarcations between tolerant and allergic infants. As a result, our data suggest that EHCF+LGG promotes tolerance in infants with CMA, in part, by influencing the strain-level bacterial community structure of the infant gut.« less

  12. Increasing antibiotic resistance in preservative-tolerant bacterial strains isolated from cosmetic products.

    PubMed

    Orús, Pilar; Gomez-Perez, Laura; Leranoz, Sonia; Berlanga, Mercedes

    2015-03-01

    To ensure the microbiological quality, consumer safety and organoleptic properties of cosmetic products, manufacturers need to comply with defined standards using several preservatives and disinfectants. A drawback regarding the use of these preservatives is the possibility of generating cross-insusceptibility to other disinfectants or preservatives, as well as cross resistance to antibiotics. Therefore, the objective of this study was to understand the adaptive mechanisms of Enterobacter gergoviae, Pseudomonas putida and Burkholderia cepacia that are involved in recurrent contamination in cosmetic products containing preservatives. Diminished susceptibility to formaldehyde-donors was detected in isolates but not to other preservatives commonly used in the cosmetics industry, although increasing resistance to different antibiotics (β-lactams, quinolones, rifampicin, and tetracycline) was demonstrated in these strains when compared with the wild-type strain. The outer membrane protein modifications and efflux mechanism activities responsible for the resistance trait were evaluated. The development of antibiotic-resistant microorganisms due to the selective pressure from preservatives included in cosmetic products could be a risk for the emergence and spread of bacterial resistance in the environment. Nevertheless, the large contribution of disinfection and preservation cannot be denied in cosmetic products. PMID:26415667

  13. Rapid Identification of ESKAPE Bacterial Strains Using an Autonomous Microfluidic Device

    PubMed Central

    Ho, Jack Y.; Cira, Nate J.; Crooks, John A.; Baeza, Josue; Weibel, Douglas B.

    2012-01-01

    This article describes Bacteria ID Chips (‘BacChips’): an inexpensive, portable, and autonomous microfluidic platform for identifying pathogenic strains of bacteria. BacChips consist of a set of microchambers and channels molded in the elastomeric polymer, poly(dimethylsiloxane) (PDMS). Each microchamber is preloaded with mono-, di-, or trisaccharides and dried. Pressing the layer of PDMS into contact with a glass coverslip forms the device; the footprint of the device in this article is ∼6 cm2. After assembly, BacChips are degased under large negative pressure and are stored in vacuum-sealed plastic bags. To use the device, the bag is opened, a sample containing bacteria is introduced at the inlet of the device, and the degased PDMS draws the sample into the central channel and chambers. After the liquid at the inlet is consumed, air is drawn into the BacChip via the inlet and provides a physical barrier that separates the liquid samples in adjacent microchambers. A pH indicator is admixed with the samples prior to their loading, enabling the metabolism of the dissolved saccharides in the microchambers to be visualized. Importantly, BacChips operate without external equipment or instruments. By visually detecting the growth of bacteria using ambient light after ∼4 h, we demonstrate that BacChips with ten microchambers containing different saccharides can reproducibly detect the ESKAPE panel of pathogens, including strains of: Enterococcus faecalis, Enteroccocus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter aerogenes, and Enterobacter cloacae. This article describes a BacChip for point-of-care detection of ESKAPE pathogens and a starting point for designing multiplexed assays that identify bacterial strains from clinical samples and simultaneously determine their susceptibility to antibiotics. PMID:22848451

  14. Complete Genome Sequence of Lactobacillus rhamnosus Strain BPL5 (CECT 8800), a Probiotic for Treatment of Bacterial Vaginosis.

    PubMed

    Chenoll, Empar; Codoñer, Francisco M; Martinez-Blanch, Juan F; Ramón, Daniel; Genovés, Salvador; Menabrito, Marco

    2016-01-01

    ITALIC! Lactobacillus rhamnosusBPL5 (CECT 8800), is a probiotic strain suitable for the treatment of bacterial vaginosis. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insight into its functional activity. PMID:27103719

  15. Complete Genome Sequence of Lactobacillus rhamnosus Strain BPL5 (CECT 8800), a Probiotic for Treatment of Bacterial Vaginosis

    PubMed Central

    Codoñer, Francisco M.; Martinez-Blanch, Juan F.; Ramón, Daniel; Menabrito, Marco

    2016-01-01

    Lactobacillus rhamnosus BPL5 (CECT 8800), is a probiotic strain suitable for the treatment of bacterial vaginosis. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insight into its functional activity. PMID:27103719

  16. Discrimination of bacterial strains by Fourier-transform near-infrared spectroscopy using an aluminum oxide membrane

    NASA Astrophysics Data System (ADS)

    Rodriguez-Saona, Luis E.; Khambaty, Farukh M.; Fry, Francis S.; Calvey, Elizabeth M.

    2002-02-01

    To address the need for a fast and sensitive method for the detection of bacterial contamination in solutions, the use of Fourier-transform near infrared (FT-NIR) spectroscopy and multivariate pattern recognition techniques was evaluated. The complex cellular composition of bacteria yields FT-NIR vibrational transitions (overtone and combination bands) that might be useful for identification and sub-typing. Bacteria including strains of Escherichia coli spp., Pseudomonas aeruginosa, Bacillus spp. and Listeria innocua were evaluated. The harvested cells were treated with ethanol (70% v/v) to reduce the safety concerns when evaluating pathogenic strains. The bacterial cells were concentrated on an aluminum oxide membrane to obtain a thin bacterial film. Spectra were collected by FT-NIR by using a diffuse reflection-integrating sphere. This simple membrane filtration procedure generated reproducible FT-NIR spectra that can be used for rapid discrimination among closely related strains. Principal Component Analysis (PCA) of transformed spectra in the 5000-4000 cm-1 region exhibited clusters that discriminated between bacteria species at levels < 1 mg wet cells weight (approximately 106-107 CFU/mg). Variations in the growth conditions of the bacteria substantially affected the FT-NIR spectra and diminished the ability of PCA to differentiate among strains; this underscores the importance of developing robust sampling protocols. FT-NIR in conjunction with multivariate techniques can be used for the rapid and accurate evaluation of potential bacterial contamination in liquids with minimal sample manipulation.

  17. Enhanced treatment of tannery wastewater in an integrated multistage bioreactor (IMBR) by the predominant bacterial strains enriched from marine sediments.

    PubMed

    Huang, Guangdao; Fan, Guofeng; Liu, Guoguang

    2016-01-01

    An innovative integrated multistage bioreactor (IMBR) system, which was augmented with three predominant bacterial strains (Lactobacillus paracasei CL1107, Pichia jadinii CL1705, and Serratia marcescens CL1502) isolated from marine sediments, was developed to treat real tannery wastewater without performing physicochemical pretreatment, with the potential to reduce the generation of waste sludge and odors. The performance of the IMBR treatment system, with and without the inclusion of the predominant bacterial strains, was compared. The results indicated that the performance of the IMBR system without bioaugmentation by the predominant bacterial strains was poor. However, when in the presence of the predominant bacterial strains, the IMBR system exhibited high removal efficiencies of chemical oxygen demand (COD) (97%), NH4(+)-N (97.7%), and total nitrogen (TN) (90%). In addition, the system had the capacity for the simultaneous removal of organics and nitrogen, heterotrophic nitrification and denitrification being carried out concurrently, thereby avoiding the strong inhibition of high concentrations of COD on nitrification. The system possessed excellent adaptability and ability to resist influent loading fluctuations, and had a good alkalinity balance such that it could achieve a high NH4(+)-N, and TN removal efficiency without a supplement of external alkalinity. In addition, an empirical performance modeling of the IMBR system was analyzed. PMID:26901723

  18. Bacterial production and transformation of dissolved neutral sugars and amino acids in seawater

    NASA Astrophysics Data System (ADS)

    Jørgensen, L.; Lechtenfeld, O.; Benner, R.; Middelboe, M.; Stedmon, C. A.

    2014-04-01

    Dissolved organic matter (DOM) in the ocean consists of a heterogeneous mixture of molecules, most of which are of unknown origin. Neutral sugars and amino acids are among the few recognizable biomolecules in DOM, and the molecular composition of these biomolecules is shaped primarily by biological production and degradation processes. This study provides insight into the bioavailability of biomolecules as well as the chemical composition of DOM produced by bacteria. The molecular compositions of neutral sugars and amino acids were investigated in DOM produced by bacteria and in DOM remaining after long-term bacterial degradation. Results from bioassay incubations (32 days) with natural and artificial seawater, indicate that the molecular compositions following bacterial degradation are not strongly influenced by the initial substrate or bacterial community. The molecular composition of neutral sugars released by bacteria was characterized by a high glucose content (47 mol%) and heterogeneous contributions from other neutral sugars (3-14 mol%). DOM remaining after bacterial degradation was characterized by a high galactose content (33 mol%), followed by glucose (22 mol%) and the remaining neutral sugars (7-11 mol%). The ratio of D-amino acids to L-amino acids increased during the experiments as a response to bacterial degradation, and after 32 days the D/L ratios of aspartic acid, glutamic acid, serine and alanine reached around 0.79, 0.32, 0.30 and 0.51 in all treatments, respectively. The striking similarity in neutral sugar and amino acid compositions between natural and artificial seawater samples, suggests that the microbial carbon pump also applies for neutral sugars and amino acids and that bacterially-produced biomolecules persist for long periods in the ocean.

  19. Improving survival of probiotic bacteria using bacterial poly-γ-glutamic acid.

    PubMed

    Bhat, A R; Irorere, V U; Bartlett, T; Hill, D; Kedia, G; Charalampopoulos, D; Nualkaekul, S; Radecka, I

    2015-03-01

    A major hurdle in producing a useful probiotic food product is bacterial survival during storage and ingestion. The aim of this study was to test the effect of γ-PGA immobilisation on the survival of probiotic bacteria when stored in acidic fruit juice. Fruit juices provide an alternative means of probiotic delivery, especially to lactose intolerant individuals. In addition, the survival of γ-PGA-immobilised cells in simulated gastric juice was also assessed. Bifidobacteria strains (Bifidobacteria longum, Bifidobacteria breve), immobilised on 2.5% γ-PGA, survived significantly better (P<0.05) in orange and pomegranate juice for 39 and 11 days respectively, compared to free cells. However, cells survived significantly better (P<0.05) when stored in orange juice compared to pomegranate juice. Moreover, both strains, when protected with 2.5% γ-PGA, survived in simulated gastric juice (pH2.0) with a marginal reduction (<0.47 log CFU/ml) or no significant reduction in viable cells after 4h, whereas free cells died within 2h. In conclusion, this research indicates that γ-PGA can be used to protect Bifidobacteria cells in fruit juice, and could also help improve the survival of cells as they pass through the harsh conditions of the gastrointestinal tract (GIT). Following our previous report on the use of γ-PGA as a cryoprotectant for probiotic bacteria, this research further suggests that γ-PGA could be used to improve probiotic survival during the various stages of preparation, storage and ingestion of probiotic cells. PMID:25506798

  20. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  1. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, an d analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: (1) to assess the potential terrorist threat to U.S. agricultural crops, (2) to determine whether suitable assays exist to monitor that threat, and (3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  2. Bacterial wilt resistance in tomato, pepper, and eggplant: genetic resources respond to diverse strains in the Ralstonia solanacearum species complex.

    PubMed

    Lebeau, A; Daunay, M-C; Frary, A; Palloix, A; Wang, J-F; Dintinger, J; Chiroleu, F; Wicker, E; Prior, P

    2011-01-01

    Bacterial wilt, caused by strains belonging to the Ralstonia solanacearum species complex, inflicts severe economic losses in many crops worldwide. Host resistance remains the most effective control strategy against this disease. However, wilt resistance is often overcome due to the considerable variation among pathogen strains. To help breeders circumvent this problem, we assembled a worldwide collection of 30 accessions of tomato, eggplant and pepper (Core-TEP), most of which are commonly used as sources of resistance to R. solanacearum or for mapping quantitative trait loci. The Core-TEP lines were challenged with a core collection of 12 pathogen strains (Core-Rs2) representing the phylogenetic diversity of R. solanacearum. We observed six interaction phenotypes, from highly susceptible to highly resistant. Intermediate phenotypes resulted from the plants' ability to tolerate latent infections (i.e., bacterial colonization of vascular elements with limited or no wilting). The Core-Rs2 strains partitioned into three pathotypes on pepper accessions, five on tomato, and six on eggplant. A "pathoprofile" concept was developed to characterize the strain clusters, which displayed six virulence patterns on the whole set of Core-TEP host accessions. Neither pathotypes nor pathoprofiles were phylotype specific. Pathoprofiles with high aggressiveness were mainly found in strains from phylotypes I, IIB, and III. One pathoprofile included a strain that overcame almost all resistance sources. PMID:20795852

  3. Isolation and characterization of different bacterial strains for bioremediation of n-alkanes and polycyclic aromatic hydrocarbons.

    PubMed

    Guermouche M'rassi, A; Bensalah, F; Gury, J; Duran, R

    2015-10-01

    Crude oil is a common environmental pollutant composed of a large number of both aromatic and aliphatic hydrocarbons. Biodegradation is carried out by microbial communities that are important in determining the fate of pollutants in the environment. The intrinsic biodegradability of the hydrocarbons and the distribution in the environment of competent degrading microorganisms are crucial information for the implementation of bioremediation processes. In the present study, the biodegradation capacities of various bacteria toward aliphatic and aromatic hydrocarbons were determined. The purpose of the study was to isolate and characterize hydrocarbon-degrading bacteria from contaminated soil of a refinery in Arzew, Algeria. A collection of 150 bacterial strains was obtained; the bacterial isolates were identified by 16S rRNA gene sequencing and their ability to degrade hydrocarbon compounds characterized. The isolated strains were mainly affiliated to the Gamma-Proteobacteria class. Among them, Pseudomonas spp. had the ability to metabolize high molecular weight hydrocarbon compounds such as pristane (C19) at 35.11 % by strain LGM22 and benzo[a] pyrene (C20) at 33.93 % by strain LGM11. Some strains were able to grow on all the hydrocarbons tested including octadecane, squalene, phenanthrene, and pyrene. Some strains were specialized degrading only few substrates. In contrast, the strain LGM2 designated as Pseudomonas sp. was found able to degrade both linear and branched alkanes as well as low and high poly-aromatic hydrocarbons (PAHs). The alkB gene involved in alkane degradation was detected in LGM2 and other Pseudomonas-related isolates. The capabilities of the isolated bacterial strains to degrade alkanes and PAHs should be of great practical significance in bioremediation of oil-contaminated environments. PMID:25813636

  4. Production of Oxygenated Fatty Acids from Vegetable Oils by Flavobacterium sp. Strain DS5

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavobacterium sp. strain DS5 (NRRL B-14859) was used to convert two vegetable oils, olive oil and soybean oil, directly to oxygenated fatty acids such as 10-ketostearic acid (10-KSA) and 10-hydroxystearic acid (10-HSA). Lipase addition to the culture was required because strain DS5 did not induce ...

  5. Bacterial treatment of alkaline cement kiln dust using Bacillus halodurans strain KG1.

    PubMed

    Kunal; Rajor, Anita; Siddique, Rafat

    2016-01-01

    This study was conducted to isolate an acid-producing, alkaliphilic bacterium to reduce the alkalinity of cement industry waste (cement kiln dust). Gram-positive isolate KG1 grew well at pH values of 6-12, temperatures of 28-50°C, and NaCl concentrations of 0-16% and thus was further screened for its potential to reduce the pH of an alkaline medium. Phenotypic characteristics of the KG1 isolate were consistent with those of the genus Bacillus, and the highest level of 16S rRNA gene sequence similarity was found with Bacillus halodurans strain DSM 497 (94.7%). On the basis of its phenotypic characteristics and genotypic distinctiveness from other phylogenetic neighbors belonging to alkaliphilic Bacillus species, the isolated strain was designated B. halodurans strain KG1, with GenBank accession number JQ307184 (= NCIM 5439). Isolate KG1 reduced the alkalinity (by 83.64%) and the chloride content (by 86.96%) of cement kiln dust and showed a potential to be used in the cement industry for a variety of applications. PMID:26887220

  6. Bacterial treatment of alkaline cement kiln dust using Bacillus halodurans strain KG1

    PubMed Central

    Kunal; Rajor, Anita; Siddique, Rafat

    2016-01-01

    This study was conducted to isolate an acid-producing, alkaliphilic bacterium to reduce the alkalinity of cement industry waste (cement kiln dust). Gram-positive isolate KG1 grew well at pH values of 6–12, temperatures of 28–50 °C, and NaCl concentrations of 0–16% and thus was further screened for its potential to reduce the pH of an alkaline medium. Phenotypic characteristics of the KG1 isolate were consistent with those of the genus Bacillus, and the highest level of 16S rRNA gene sequence similarity was found with Bacillus halodurans strain DSM 497 (94.7%). On the basis of its phenotypic characteristics and genotypic distinctiveness from other phylogenetic neighbors belonging to alkaliphilic Bacillus species, the isolated strain was designated B. halodurans strain KG1, with GenBank accession number JQ307184 (= NCIM 5439). Isolate KG1 reduced the alkalinity (by 83.64%) and the chloride content (by 86.96%) of cement kiln dust and showed a potential to be used in the cement industry for a variety of applications. PMID:26887220

  7. Synergistic Degradation of Linuron by a Bacterial Consortium and Isolation of a Single Linuron-Degrading Variovorax Strain

    PubMed Central

    Dejonghe, Winnie; Berteloot, Ellen; Goris, Johan; Boon, Nico; Crul, Katrien; Maertens, Siska; Höfte, Monica; De Vos, Paul; Verstraete, Willy; Top, Eva M.

    2003-01-01

    The bacterial community composition of a linuron-degrading enrichment culture and the role of the individual strains in linuron degradation have been determined by a combination of methods, such as denaturing gradient gel electrophoresis of the total 16S rRNA gene pool, isolation and identification of strains, and biodegradation assays. Three strains, Variovorax sp. strain WDL1, Delftia acidovorans WDL34, and Pseudomonas sp. strain WDL5, were isolated directly from the linuron-degrading culture. In addition, subculture of this enrichment culture on potential intermediates in the degradation pathway of linuron (i.e., N,O-dimethylhydroxylamine and 3-chloroaniline) resulted in the isolation of, respectively, Hyphomicrobium sulfonivorans WDL6 and Comamonas testosteroni WDL7. Of these five strains, only Variovorax sp. strain WDL1 was able to use linuron as the sole source of C, N, and energy. WDL1 first converted linuron to 3,4-dichloroaniline (3,4-DCA), which transiently accumulated in the medium but was subsequently degraded. To the best of our knowledge, this is the first report of a strain that degrades linuron further than the aromatic intermediates. Interestingly, the rate of linuron degradation by strain WDL1 was lower than that for the consortium, but was clearly increased when WDL1 was coinoculated with each of the other four strains. D. acidovorans WDL34 and C. testosteroni WDL7 were found to be responsible for degradation of the intermediate 3,4-DCA, and H. sulfonivorans WDL6 was the only strain able to degrade N,O-dimethylhydroxylamine. The role of Pseudomonas sp. strain WDL5 needs to be further elucidated. The degradation of linuron can thus be performed by a single isolate, Variovorax sp. strain WDL1, but is stimulated by a synergistic interaction with the other strains isolated from the same linuron-degrading culture. PMID:12620840

  8. Comparison of effects of compost amendment and of single-strain inoculation on root bacterial communities of young cucumber seedlings.

    PubMed

    Ofek, Maya; Hadar, Yitzhak; Minz, Dror

    2009-10-01

    Compost amendment and inoculations with specific microorganisms are fundamentally different soil treatment methods, commonly used in agriculture for the improvement of plant growth and health. Although distinct, both methods affect the rhizosphere and the plant roots. In the present study we used a 16S rRNA gene approach to achieve an overview of early consequences of these treatments on the assemblage of plant root bacterial communities. For this purpose, cucumber seedlings were grown, under controlled conditions, in perlite potting mix amended with biosolid compost or straw compost, or inoculated with Streptomyces spp. A uniform trend of response of root bacterial communities for all treatments was observed. Root bacterial density, measured as bacterial targets per plant tef gene by real-time PCR, was reduced in 31 to 67%. In addition, increased taxonomic diversity accompanied shifts in composition (alpha-diversity). The magnitude of change in these parameters relative to the perlite control varied between the different treatments but not in relation to the treatment method (compost amendments versus inoculations). Similarity between the compositions of root and of potting mix bacterial communities (beta-diversity) was relatively unchanged. The abundance of Oxalobacteraceae was >50% of the total root bacterial community in the untreated perlite. Root domination by this group subsided >10-fold (straw compost) to >600-fold (Streptomyces sp. strain S1) after treatment. Thus, loss of dominance appears to be the major phenomenon underlining the response trend of the root bacterial communities. PMID:19700550

  9. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  10. Metabolism of Cyclohexane Carboxylic Acid by Alcaligenes Strain W1

    PubMed Central

    Taylor, David G.; Trudgill, Peter W.

    1978-01-01

    Thirty-three microorganisms capable of growth with cyclohexane carboxylate as the sole source of carbon were isolated from mud, water, and soil samples from the Aberystwyth area. Preliminary screening and whole-cell oxidation studies suggested that, with one exception, all of the strains metabolized the growth substrate by beta-oxidation of the coenzyme A ester. This single distinctive strain, able to oxidize rapidly trans-4-hydroxycyclohexane carboxylate, 4-ketocyclohexane carboxylate, p-hydroxybenzoate, and protocatechuate when grown with cyclohexane carboxylate, was classified as a strain of Alcaligenes and given the number W1. Enzymes capable of converting cyclohexane carboxylate to p-hydroxybenzoate were induced by growth with the alicyclic acid and included the first unambiguous specimen of a cyclohexane carboxylate hydroxylase. Because it is a very fragile protein, attempts to stabilize the cyclohexane carboxylate hydroxylase so that a purification procedure could be developed have consistently failed. In limited studies with crude cell extracts, we found that hydroxylation occurred at the 4 position, probably yielding the trans isomer of 4-hydroxycyclohexane carboxylate. Simultaneous measurement of oxygen consumption and reduced nicotinamide adenine dinucleotide oxidation, coupled with an assessment of reactant stoichiometry, showed the enzyme to be a mixed-function oxygenase. Mass spectral analysis enabled the conversion of cyclohexane carboxylate to p-hydroxybenzoate by cell extracts to be established unequivocally, and all of our data were consistent with the pathway: cyclohexane carboxylate → trans-4-hydroxycyclohexane carboxylate → 4-ketocyclohexane carboxylate → p-hydroxybenzoate. The further metabolism of p-hydroxybenzoate proceeded by meta fission and by the oxidative branch of the 2-hydroxy-4-carboxymuconic semialde-hyde-cleaving pathway. PMID:207665

  11. Bacterial Communities in Acidic and Circumneutral Streams †

    PubMed Central

    Palumbo, Anthony V.; Bogle, Mary Anna; Turner, Ralph R.; Elwood, Jerry W.; Mulholland, Patrick J.

    1987-01-01

    The relationship between pH and the abundance and activity of bacteria in streams was examined as part of a study of the effect of acidification on stream communities. Of the bacterial communities examined, the epilithic community appeared to be the most significantly affected by acidification. Microbial biomass, as quantified by measuring the ATP level, on rock surfaces was significantly correlated with pH. Also, bacterial production by the epilithic bacteria, indicated by incorporation of tritiated thymidine into DNA, was always higher at high-pH sites than at low-pH sites of the same stream order and elevation. Bacterioplankton concentrations varied between 0.53 × 105 and 9.42 × 105 cells · ml−1 in the first- to fourth-order streams examined. The bacterioplankton concentration in one sample from a spring was 0.17 × 105 cells · ml−1. Bacterioplankton concentrations were not correlated with pH but were significantly correlated with seston concentrations. The correlation with seston is a result of increases in particle-associated bacteria at high seston concentrations. The proportion of bacterioplankton attached to particles varied from 0 to 70%. Bacterial numbers and production in the sediments were significantly correlated with the organic content of the sediment rather than with the pH of the overlying water. Thus, reduced abundance and activity of bacteria as a result of acidification could be detected only for the relatively active community on rock surfaces; this community was exposed to the low pH because of the unbuffered nature of its environment. PMID:16347283

  12. Unified Theory of Bacterial Sialometabolism: How and Why Bacteria Metabolize Host Sialic Acids

    PubMed Central

    Vimr, Eric R.

    2013-01-01

    Sialic acids are structurally diverse nine-carbon ketosugars found mostly in humans and other animals as the terminal units on carbohydrate chains linked to proteins or lipids. The sialic acids function in cell-cell and cell-molecule interactions necessary for organismic development and homeostasis. They not only pose a barrier to microorganisms inhabiting or invading an animal mucosal surface, but also present a source of potential carbon, nitrogen, and cell wall metabolites necessary for bacterial colonization, persistence, growth, and, occasionally, disease. The explosion of microbial genomic sequencing projects reveals remarkable diversity in bacterial sialic acid metabolic potential. How bacteria exploit host sialic acids includes a surprisingly complex array of metabolic and regulatory capabilities that is just now entering a mature research stage. This paper attempts to describe the variety of bacterial sialometabolic systems by focusing on recent advances at the molecular and host-microbe-interaction levels. The hope is that this focus will provide a framework for further research that holds promise for better understanding of the metabolic interplay between bacterial growth and the host environment. An ability to modify or block this interplay has already yielded important new insights into potentially new therapeutic approaches for modifying or blocking bacterial colonization or infection. PMID:23724337

  13. Interaction of mouse splenocytes and macrophages with bacterial strains in vitro: the effect of age in the immune response.

    PubMed

    Van Beek, A A; Hoogerland, J A; Belzer, C; De Vos, P; De Vos, W M; Savelkoul, H F J; Leenen, P J M

    2016-01-01

    Probiotics influence the immune system, both at the local and systemic level. Recent findings suggest the relation between microbiota and the immune system alters with age. Our objective was to address direct effects of six bacterial strains on immune cells from young and aged mice: Lactobacillus plantarum WCFS1, Lactobacillus casei BL23, Lactococcus lactis MG1363, Bifidobacterium breve ATCC15700, Bifidobacterium infantis ATCC15697, and Akkermansia muciniphila ATCC BAA-835. We used splenocytes and naïve or interferon-γ-stimulated bone marrow-derived macrophages (BMDM) as responder populations. All tested bacterial strains induced phenotypic and cytokine responses in splenocytes and BMDM. Based on magnitude of the cellular inflammatory response and cytokine profiles, two subgroups of bacteria were identified, i.e. L. plantarum and L. casei versus B. breve, B. infantis, and A. muciniphila. The latter group of bacteria induced high levels of cytokines produced under inflammatory conditions, including tumour necrosis factor (TNF), interleukin (IL)-6 and IL-10. Responses to L. lactis showed features of both subgroups. In addition, we compared responses by splenocytes and BMDM derived from young mice to those of aged mice, and found that splenocytes and BMDM derived from aged mice had an increased IL-10 production and dysregulated IL-6 and TNF production compared to young immune cells. Overall, our study shows differential inflammatory responses to distinct bacterial strains, and profound age-dependent effects. These findings, moreover, support the view that immune environment importantly influences bacterial immune effects. PMID:26689225

  14. Selection of indigenous lactic acid bacteria to reinforce the intestinal microbiota of newly hatched chicken: relevance of in vitro and ex vivo methods for strains characterization.

    PubMed

    Babot, Jaime D; Argañaraz-Martínez, Eloy; Saavedra, Lucila; Apella, María C; Perez Chaia, Adriana

    2014-08-01

    Based on the natural benefits of the indigenous microbiota, lactic acid bacteria (LAB) from poultry origin were isolated from hens and broilers intestine, and their probiotic potential was further studied. The tolerance to digestion, adhesion, capture of a mannose-binding lectin, absence of virulent factors and antibiotic resistances were studied. Different in vitro and ex vivo assays were performed to select tolerant and adherent strains because standardized protocols have not been defined. Fourteen strains highly tolerant to gastrointestinal digestion were genetically identified. Hydrophobic surfaces were not required for the bacterial adhesion and only nine strains adhered ex vivo to the intestinal mucosa. Three strains captured a lectin of the same specificity of Type-1 fimbriae. Virulence factors were absent but some strains evidenced multiple antibiotic resistances. These results provide bases for a future standardization of methods for the selection of probiotic strains intended to reinforce the microbiota of newly hatched chickens. PMID:24975325

  15. Novel Intermediates of Acenaphthylene Degradation by Rhizobium sp. Strain CU-A1: Evidence for Naphthalene-1,8-Dicarboxylic Acid Metabolism

    PubMed Central

    Poonthrigpun, Siriwat; Pattaragulwanit, Kobchai; Paengthai, Sarunya; Kriangkripipat, Thanyanuch; Juntongjin, Kanchana; Thaniyavarn, Suthep; Petsom, Amorn; Pinphanichakarn, Pairoh

    2006-01-01

    The acenaphthylene-degrading bacterium Rhizobium sp. strain CU-A1 was isolated from petroleum-contaminated soil in Thailand. This strain was able to degrade 600 mg/liter acenaphthylene completely within three days. To elucidate the pathway for degradation of acenaphthylene, strain CU-A1 was mutagenized by transposon Tn5 in order to obtain mutant strains deficient in acenaphthylene degradation. Metabolites produced from Tn5-induced mutant strains B1, B5, and A53 were purified by thin-layer chromatography and silica gel column chromatography and characterized by mass spectrometry. The results suggested that this strain cleaved the fused five-membered ring of acenaphthylene to form naphthalene-1,8-dicarboxylic acid via acenaphthenequinone. One carboxyl group of naphthalene-1,8-dicarboxylic acid was removed to form 1-naphthoic acid which was transformed into salicylic acid before metabolization to gentisic acid. This work is the first report of complete acenaphthylene degradation by a bacterial strain. PMID:16957226

  16. Inhibition of bacterial activity in acid mine drainage

    NASA Astrophysics Data System (ADS)

    Singh, Gurdeep; Bhatnagar, Miss Mridula

    1988-12-01

    Acid mine drainage water give rise to rapid growth and activity of an iron- and sulphur- oxidizing bacterium Thiobacillus ferrooxidians which greatly accelerate acid producing reactions by oxidation of pyrite material associated with coal and adjoining strata. The role of this bacterium in production of acid mine drainage is described. This study presents the data which demonstrate the inhibitory effect of certain organic acids, sodium benzoate, sodium lauryl sulphate, quarternary ammonium compounds on the growth of the acidophilic aerobic autotroph Thiobacillus ferrooxidians. In each experiment, 10 milli-litres of laboratory developed culture of Thiobacillus ferrooxidians was added to 250 milli-litres Erlenmeyer flask containing 90 milli-litres of 9-k media supplemented with FeSO4 7H2O and organic compounds at various concentrations. Control experiments were also carried out. The treated and untreated (control) samples analysed at various time intervals for Ferrous Iron and pH levels. Results from this investigation showed that some organic acids, sodium benzoate, sodium lauryl sulphate and quarternary ammonium compounds at low concentration (10-2 M, 10-50 ppm concentration levels) are effective bactericides and able to inhibit and reduce the Ferrous Iron oxidation and acidity formation by inhibiting the growth of Thiobacillus ferrooxidians is also discussed and presented

  17. Biostimulation of the autochthonous bacterial community and bioaugmentation of selected bacterial strains for the depletion of Polycyclic Aromatic Hydrocarbons in a historically contaminated soil

    NASA Astrophysics Data System (ADS)

    DiGregorio, Simona; Ruffini Castglione, Monica; Gentini, Alessandro; Lorenzi, Roberto

    2015-04-01

    Polycyclic aromatic hydrocarbons (PAHs) are a large group of organic contaminants causing hazards to organisms including humans. The objective of the study was (1) to validate the biostimulation of the autochthonous bacterial population by the amendment of lignocellulosic matrices inoculated with white rot fungi, to be exploited for the depletion of PAHs (5687 ppm) in a historical contaminated soil. (2) to validate the isolation of autochthonous bacterial strains capable to use PAHs as sole carbon source and their massive bioaugmentation for PAH depletion in a historical contaminated soil. The validation has been performed at mesocosm and pilot scale (7 tons of soil in a biopile). The two approaches end up with the complete depletion of the PAHs. A genotoxicological assessment of the process and of the soil at the end of the process of decontamination has been performed. The process of soil decontamination showed an increase in the genotoxicity of either the soil and the deriving elutriates. The bioaugmetation of selected bacterial strains determined the complete detoxification of the decontaminated soil after 21 weeks. The microbial ecology of the system during the process of decontamination has been monitored.

  18. Rumen bacterial communities shift across a lactation in Holstein, Jersey and Holstein × Jersey dairy cows and correlate to rumen function, bacterial fatty acid composition and production parameters.

    PubMed

    Bainbridge, Melissa L; Cersosimo, Laura M; Wright, André-Denis G; Kraft, Jana

    2016-05-01

    Rumen bacteria form a dynamic, complex, symbiotic relationship with their host, degrading forages to provide volatile fatty acids (VFA) and other substrates as energy to the animal. The objectives were to characterize rumen bacteria in three genetic lines of primiparous dairy cattle, Holstein (HO,n= 7), Jersey (JE,n= 8), and HO × JE crossbreeds (CB,n= 7) across a lactation [3, 93, 183 and 273 days in milk (DIM)] and correlate these factors with VFA, bacterial cell membrane fatty acids (FA), and animal production (i.e. milk yield). This study employed Illumina MiSeq (v. 3) to investigate rumen bacterial communities and gas-liquid chromatography/mass spectroscopy to identify bacterial membrane FA. Lactation stage had a prominent effect on rumen bacterial communities, whereas genetics had a lesser effect on rumen bacteria. The FA composition of bacterial cell membranes was affected by both lactation stage and genetics. Few correlations existed between VFA and bacterial communities; however, moderate correlations occurred between milk yield, protein percentage, fat yield and rumen bacterial communities. Positive correlations were found between branched-chain FA (BCFA) in bacterial cell membranes and bacterial genera. In conclusion, bacterial communities and their FA compositions are more affected by stage of lactation than by genetics of dairy cow. PMID:26985012

  19. Amino Acid-Based Zwitterionic Polymer Surfaces Highly Resist Long-Term Bacterial Adhesion.

    PubMed

    Liu, Qingsheng; Li, Wenchen; Wang, Hua; Newby, Bi-Min Zhang; Cheng, Fang; Liu, Lingyun

    2016-08-01

    The surfaces or coatings that can effectively suppress bacterial adhesion in the long term are of critical importance for biomedical applications. Herein, a group of amino acid-based zwitterionic polymers (pAAZ) were investigated for their long-term resistance to bacterial adhesion. The polymers were derived from natural amino acids including serine, ornithine, lysine, aspartic acid, and glutamic acid. The pAAZ brushes were grafted on gold via the surface-initiated photoiniferter-mediated polymerization (SI-PIMP). Results show that the pAAZ coatings highly suppressed adsorption from the undiluted human serum and plasma. Long-term bacterial adhesion on these surfaces was investigated, using two kinds of representative bacteria [Gram-positive Staphylococcus epidermidis and Gram-negative Pseudomonas aeruginosa] as the model species. Results demonstrate that the pAAZ surfaces were highly resistant to bacterial adhesion after culturing for 1, 5, 9, or even 14 days, representing at least 95% reduction at all time points compared to the control unmodified surfaces. The bacterial accumulation on the pAAZ surfaces after 9 or 14 days was even lower than on the surfaces grafted with poly[poly(ethyl glycol) methyl ether methacrylate] (pPEGMA), one of the most common antifouling materials known to date. The pAAZ brushes also exhibited excellent structural stability in phosphate-buffered saline after incubation for 4 weeks. The bacterial resistance and stability of pAAZ polymers suggest they have good potential to be used for those applications where long-term suppression to bacterial attachment is desired. PMID:27397718

  20. Application of two bacterial strains for wastewater bioremediation and assessment of phenolics biodegradation.

    PubMed

    Paisio, Cintia E; Quevedo, María R; Talano, Melina A; González, Paola S; Agostini, Elizabeth

    2014-08-01

    The use of native bacteria is a useful strategy to decontaminate industrial effluents. In this work, two bacterial strains isolated from polluted environments constitutes a promising alternative since they were able to remove several phenolic compounds not only from synthetic solutions but also from effluents derived from a chemical industry and a tannery which are complex matrices. Acinetobacter sp. RTE 1.4 showed ability to completely remove 2-methoxyphenol (1000 mg/L) while Rhodococcus sp. CS 1 not only degrade the same concentration of this compound but also removed 4- chlorophenol, 2,4-dichlorophenol and pentachlorophenol with high efficiency. Moreover, both bacteria degraded phenols naturally present or even exogenously added at high concentrations in effluents from the chemical industry and a tannery in short time (up to 5 d). In addition, a significant reduction of biological oxygen demand and chemical oxygen demand values was achieved after 7 d of treatment for both effluents using Acinetobacter sp. RTE 1.4 and Rhodococcus sp. CS1, respectively. These results showed that Acinetobacter sp. RTE1.4 and Rhodococcus sp. CS 1 might be considered as useful biotechnological tools for an efficient treatment of different effluents, since they showed wide versatility to detoxify these complex matrices, even supplemented with high phenol concentrations. PMID:24956773

  1. Biodegradation potentiality of psychrophilic bacterial strain Oleispira antarctica RB-8(T).

    PubMed

    Gentile, G; Bonsignore, M; Santisi, S; Catalfamo, M; Giuliano, L; Genovese, L; Yakimov, M M; Denaro, R; Genovese, M; Cappello, S

    2016-04-15

    The present study is focused on assessing the growth and hydrocarbon-degrading capability of the psychrophilic strain Oleispira antarctica RB-8(T). This study considered six hydrocarbon mixtures that were tested for 22days at two different cultivation temperatures (4 and 15°C). During the incubation period, six sub-aliquots of each culture at different times were processed for total bacterial abundance and GC-FID (gas chromatography-flame ionization detection) hydrocarbon analysis. Results from DNA extraction and DAPI (4',6-diamidino-2-phenylindole) staining showed a linear increase during the first 18days of the experiment in almost all the substrates used; both techniques showed a good match, but the difference in values obtained was approximately one order of magnitude. GC-FID results revealed a substantial hydrocarbon degradation rate in almost all hydrocarbon sources and in particular at 15°C rather than 4°C (for commercial oil engine, oily waste, fuel jet, and crude oil). A more efficient degradation was observed in cultures grown with diesel and bilge water at 4°C. PMID:26912198

  2. Lectin microarray reveals binding profiles of Lactobacillus casei strains in a comprehensive analysis of bacterial cell wall polysaccharides.

    PubMed

    Yasuda, Emi; Tateno, Hiroaki; Hirabayashi, Jun; Hirabarashi, Jun; Iino, Tohru; Sako, Tomoyuki

    2011-07-01

    We previously showed a pivotal role of the polysaccharide (PS) moiety in the cell wall of the Lactobacillus casei strain Shirota (YIT 9029) as a possible immune modulator (E. Yasuda M. Serata, and T. Sako, Appl. Environ. Microbiol. 74:4746-4755, 2008). To distinguish PS structures on the bacterial cell surface of individual strains in relation to their activities, it would be useful to have a rapid and high-throughput methodology. Recently, a new technique called lectin microarray was developed for rapid profiling of glycosylation in eukaryotic polymers and cell surfaces. Here, we report on the development of a simple and sensitive method based on this technology for direct analysis of intact bacterial cell surface glycomes. The method involves labeling bacterial cells with SYTOX Orange before incubation with the lectin microarray. After washing, bound cells are directly detected using an evanescent-field fluorescence scanner in a liquid phase. Using this method, we compared the cell surface glycomes from 16 different strains of L. casei. The patterns of lectin-binding affinity of most strains were found to be unique. There appears to be two types of lectin-binding profiles: the first is characterized by a few lectins, and the other is characterized by multiple lectins with different specificities. We also showed a dramatic change in the lectin-binding profile of a YIT 9029 derivative with a mutation in the cps1C gene, encoding a putative glycosyltransferase. In conclusion, the developed technique provided a novel strategy for rapid profiling and, more importantly, differentiating numerous bacterial strains with relevance to the biological functions of PS. PMID:21602390

  3. Lectin Microarray Reveals Binding Profiles of Lactobacillus casei Strains in a Comprehensive Analysis of Bacterial Cell Wall Polysaccharides▿†

    PubMed Central

    Yasuda, Emi; Tateno, Hiroaki; Hirabarashi, Jun; Iino, Tohru; Sako, Tomoyuki

    2011-01-01

    We previously showed a pivotal role of the polysaccharide (PS) moiety in the cell wall of the Lactobacillus casei strain Shirota (YIT 9029) as a possible immune modulator (E. Yasuda M. Serata, and T. Sako, Appl. Environ. Microbiol. 74:4746-4755, 2008). To distinguish PS structures on the bacterial cell surface of individual strains in relation to their activities, it would be useful to have a rapid and high-throughput methodology. Recently, a new technique called lectin microarray was developed for rapid profiling of glycosylation in eukaryotic polymers and cell surfaces. Here, we report on the development of a simple and sensitive method based on this technology for direct analysis of intact bacterial cell surface glycomes. The method involves labeling bacterial cells with SYTOX Orange before incubation with the lectin microarray. After washing, bound cells are directly detected using an evanescent-field fluorescence scanner in a liquid phase. Using this method, we compared the cell surface glycomes from 16 different strains of L. casei. The patterns of lectin-binding affinity of most strains were found to be unique. There appears to be two types of lectin-binding profiles: the first is characterized by a few lectins, and the other is characterized by multiple lectins with different specificities. We also showed a dramatic change in the lectin-binding profile of a YIT 9029 derivative with a mutation in the cps1C gene, encoding a putative glycosyltransferase. In conclusion, the developed technique provided a novel strategy for rapid profiling and, more importantly, differentiating numerous bacterial strains with relevance to the biological functions of PS. PMID:21602390

  4. Isolation and characterization of a potential paraffin-wax degrading thermophilic bacterial strain Geobacillus kaustophilus TERI NSM for application in oil wells with paraffin deposition problems.

    PubMed

    Sood, Nitu; Lal, Banwari

    2008-02-01

    Paraffin deposition problems, that have plagued the oil industry, are currently remediated by mechanical and chemical means. However, since these methods are problematic, a microbiological approach has been considered. The bacteria, required for the mitigation of paraffin deposition problems, should be able to survive the high temperatures of oil wells and degrade the paraffins under low oxygen and nutrient conditions while sparing the low carbon chain paraffins. In this study, a thermophilic paraffinic wax degrading bacterial strain was isolated from a soil sample contaminated with paraffinic crude oil. The selected strain, Geobacillus TERI NSM, could degrade 600mg of paraffinic wax as the sole carbon source in 1000ml minimal salts medium in 7d at 55 degrees C. This strain was identified as Geobacillus kaustophilus by fatty acid methyl esters analysis and 16S rRNA full gene sequencing. G. kaustophilus TERI NSM showed 97% degradation of eicosane, 85% degradation of pentacosane and 77% degradation of triacontane in 10d when used as the carbon source. The strain TERI NSM could also degrade the paraffins of crude oil collected from oil wells that had a history of paraffin deposition problems. PMID:17942139

  5. Draft Genome Sequence of Criibacterium bergeronii gen. nov., sp. nov., Strain CCRI-22567T, Isolated from a Vaginal Sample from a Woman with Bacterial Vaginosis

    PubMed Central

    Maheux, Andrée F.; Bérubé, Ève; Boudreau, Dominique K.; Raymond, Frédéric; Corbeil, Jacques; Roy, Paul H.

    2016-01-01

    Criibacterium bergeronii gen. nov., sp. nov., CCRI-22567 is the type strain of the new genus Criibacterium. The strain was isolated from a woman with bacterial vaginosis. The genome assembly comprised 2,384,460 bp, with 34.4% G+C content. This is the first genome announcement of a strain belonging to the genus Criibacterium. PMID:27587833

  6. Draft Genome Sequence of Criibacterium bergeronii gen. nov., sp. nov., Strain CCRI-22567T, Isolated from a Vaginal Sample from a Woman with Bacterial Vaginosis.

    PubMed

    Maheux, Andrée F; Bérubé, Ève; Boudreau, Dominique K; Raymond, Frédéric; Corbeil, Jacques; Roy, Paul H; Boissinot, Maurice; Omar, Rabeea F

    2016-01-01

    Criibacterium bergeronii gen. nov., sp. nov., CCRI-22567 is the type strain of the new genus Criibacterium The strain was isolated from a woman with bacterial vaginosis. The genome assembly comprised 2,384,460 bp, with 34.4% G+C content. This is the first genome announcement of a strain belonging to the genus Criibacterium. PMID:27587833

  7. [Algicidal activity against red-tide algaes by marine bacterial strain N3 isolated from a HABs area, southern China].

    PubMed

    Shi, Rong-jun; Huang, Hong-hui; Qi, Zhan-hui; Hu, Wei-an; Tian, Zi-yang; Dai, Ming

    2013-05-01

    A marine algicidal bacterium N3 was isolated from a HABs area in Mirs Bay, a subtropical bay, in southern China. Algicidal activity and algicidal mode against Phaeodactylum tricornutum, Scrippsiella trochoidea, Prorocentrum micans and Skeletonema costatum were observed by the liquid infection method. The results showed that there were no algicidal activities against P. tricornutum and S. costatum. However, when the bacterial volume fractions were 2% and 10% , S. trochoidea and P. micans could be killed, respectively. S. trochoidea cells which were exposed to strain N3 became irregular in shape and the cellular components lost their integrity and were decomposed. While, the P. micans cells became inflated and the cellular components aggregated, followed by cell lysis. Strain N3 killed S. trochoidea and P. micans directly, and the algicidal activities of the bacterial strain N3 was concentration-dependent. To S. trochoidea, 2% (V/V) of bacteria in algae showed the strongest algicidal activity, all of the S. trochoidea cells were killed within 120 h. But the growth rates of cells, in the 1% and 0. 1% treatment groups, were only slightly lower than that in the control group. In all treatment groups, the densities of strain N3 were in declining trends. While, to P. micans, 10% and 5% of bacteria in algae showed strong algicidal activities, 78% and 70% of the S. trochoidea were killed within 120 h, respectively. However, the number of S. trochoidea after exposure to 1% of bacterial cultures still increased up to 5 incubation days. And in the three treatment groups, the densities of strain N3 experienced a decrease process. The isolated strain N3 was identified as Bacillus sp. by morphological observation, physiological and biochemical characterization, and homology comparisons based on 16S rRNA sequences. PMID:23914549

  8. Melatonin reduces bacterial translocation and apoptosis in trinitrobenzene sulphonic acid-induced colitis of rats

    PubMed Central

    Akcan, Alper; Kucuk, Can; Sozuer, Erdogan; Esel, Duygu; Akyildiz, Hizir; Akgun, Hulya; Muhtaroglu, Sabahattin; Aritas, Yucel

    2008-01-01

    AIM: To investigate the effects of exogenous melatonin on bacterial translocation and apoptosis in a rat ulcerative colitis model. METHODS: Rats were randomly assigned to three groups: groupI: control, group II: experimental colitis, group III: colitis plus melatonin treatment. On d 11 after colitis, plasma tumor necrosis factor-α, portal blood endotoxin levels, colon tissue myeloperoxidase and caspase-3 activity were measured. Bacterial translocation was quantified by blood, lymph node, liver and spleen culture. RESULTS: We observed a significantly reduced incidence of bacterial translocation to the liver, spleen, mesenteric lymph nodes, portal and systemic blood in animals treated with melatonin. Treatment with melatonin significantly decreased the caspase-3 activity in colonic tissues compared to that in trinitrobenzene sulphonic acid- treated rats (16.11 ± 2.46 vs 32.97 ± 3.91, P < 0.01). CONCLUSION: Melatonin has a protective effect on bacterial translocation and apoptosis. PMID:18240350

  9. Biotransformation of p-coumaric acid and 2,4-dichlorophenoxy acetic acid by Azotobacter sp. strain SSB81.

    PubMed

    Gauri, Samiran S; Mandal, Santi M; Dey, Satyahari; Pati, Bikas R

    2012-12-01

    A comprehensive study was made on biotransformation of p-coumaric acid and 2,4-dichlorophenoxyacetic acid by an Azotobacter sp. strain SSB81. The strain was able to tolerate a high amount of both the phenolic acids and p-coumaric acid degraded maximum (50%) than 2,4-D (29%) after five days of incubation. The intermediate products during transformation have been identified and quantified using UV-Vis and LC-MS/MS analysis. Para-coumaric acid was degraded via p-hydroxybenzoic acid and protocatechuic acid, a non-oxidative pathway whereas 2,4-D via 4-chlorophenoxyacetic acid, 4-chlorophenol and 4-chlorocatechol, an oxidative pathway. The results suggest that SSB81 developed both the oxidative and non-oxidative pathway to degrade the soil accumulated phenolic acids. Thus, Azotobacter provides an advantage to reduce the toxic level of soil accumulated phenolic acids in addition to increase the soil fertility. PMID:23127838

  10. Reactivity of sera from sheep immunised with individual outer membrane proteins of Bacteroides nodosus against heterologous bacterial strains.

    PubMed

    Emery, D L

    1984-09-01

    In order to identify those bacterial antigens which might be involved in immunity against ovine footrot, antisera were raised in sheep to 6 proteins in the outer membrane complex (OMC) of one strain of Bacteroides nodosus. Examination of the specificity of these antisera by Western blotting, crossed immunoelectrophoresis (XIEP) and IEP, revealed that they recognized the homologous OMC protein, but did not precipitate either undenatured pili or OMC, nor could they agglutinate the homologous bacteria. In contrast, anti-OMC and anti-pili sera could precipitate OMC or pili respectively, and agglutinate whole bacteria. Subsequent analysis of these sera against 5 strains of B. nodosus from different serogroups revealed that Proteins 1, 3 and 4 had a similar antigenic structure in all strains examined. The reactivity of anti-pili sera was restricted to homologous bacteria whereas anti-pilin sera (raised against denatured pili) also reacted with pilin from 2 of 3 heterologous strains. However, none of the patterns of staining or absorption of any of these sera matched the spectrum of cross-protection afforded by vaccination of sheep with B. nodosus strain 198 cells. The results question the role of individual OMC proteins in cross-protective immunity and may imply that interactions between several bacterial components are involved in the phenomenon. PMID:6208674

  11. Pan-proteomics, a concept for unifying quantitative proteome measurements when comparing closely-related bacterial strains.

    PubMed

    Broadbent, James A; Broszczak, Daniel A; Tennakoon, Imalka U K; Huygens, Flavia

    2016-04-01

    The comparison of proteomes between genetically heterogeneous bacterial strains may offer valuable insights into physiological diversity and function, particularly where such variation aids in the survival and virulence of clinically-relevant strains. However, reports of such comparisons frequently fail to account for underlying genetic variance. As a consequence, the current knowledge regarding bacterial physiological diversity at the protein level may be incomplete or inaccurate. To address this, greater consideration must be given to the impact of genetic heterogeneity on proteome comparisons. This may be possible through the use of pan-proteomics, an analytical concept that permits the ability to qualitatively and quantitatively compare the proteomes of genetically heterogeneous organisms. Limited examples of this emerging technology highlight currently unmet analytical challenges. In this article we define pan-proteomics, where its value lies in microbiology, and discuss the technical considerations critical to its successful execution and potential future application. PMID:26889693

  12. High-throughput genomic sequencing of cassava bacterial blight strains identifies conserved effectors to target for durable resistance.

    PubMed

    Bart, Rebecca; Cohn, Megan; Kassen, Andrew; McCallum, Emily J; Shybut, Mikel; Petriello, Annalise; Krasileva, Ksenia; Dahlbeck, Douglas; Medina, Cesar; Alicai, Titus; Kumar, Lava; Moreira, Leandro M; Rodrigues Neto, Júlio; Verdier, Valerie; Santana, María Angélica; Kositcharoenkul, Nuttima; Vanderschuren, Hervé; Gruissem, Wilhelm; Bernal, Adriana; Staskawicz, Brian J

    2012-07-10

    Cassava bacterial blight (CBB), incited by Xanthomonas axonopodis pv. manihotis (Xam), is the most important bacterial disease of cassava, a staple food source for millions of people in developing countries. Here we present a widely applicable strategy for elucidating the virulence components of a pathogen population. We report Illumina-based draft genomes for 65 Xam strains and deduce the phylogenetic relatedness of Xam across the areas where cassava is grown. Using an extensive database of effector proteins from animal and plant pathogens, we identify the effector repertoire for each sequenced strain and use a comparative sequence analysis to deduce the least polymorphic of the conserved effectors. These highly conserved effectors have been maintained over 11 countries, three continents, and 70 y of evolution and as such represent ideal targets for developing resistance strategies. PMID:22699502

  13. Colour removal from aqueous solutions of metal-complex azo dyes using bacterial cells of Shewanella strain J18 143.

    PubMed

    Li, Tie; Guthrie, James Thomas

    2010-06-01

    The decoloration treatment of textile dye effluents through biodegradation, using bacterial cells, has been studied as a possible means of solving some of the problems that are associated with the pollution of water sources by colorants. In this paper, the use of whole bacterial cells of Shewanella J18 143 for the reduction of aqueous solutions of selected mono-azo, metal-complex dyes, namely Irgalan Grey GLN, Irgalan Black RBLN and Irgalan Blue 3GL, was investigated. The effects of temperature, pH and dye concentration on colour removal were also investigated and shown to be important. The operative conditions for the removal of colour were 30 degrees C, at pH 6.8, with a final dye concentration of 0.12 g/L in the colour reduction system. This study provides an extension to the application of Shewanella strain J18 143 bacterial cells in the decoloration of textile wastewaters. PMID:20167478

  14. Introduction of a bacterial acetyl-CoA synthesis pathway improves lactic acid production in Saccharomyces cerevisiae.

    PubMed

    Song, Ji-Yoon; Park, Joon-Song; Kang, Chang Duk; Cho, Hwa-Young; Yang, Dongsik; Lee, Seunghyun; Cho, Kwang Myung

    2016-05-01

    Acid-tolerant Saccharomyces cerevisiae was engineered to produce lactic acid by expressing heterologous lactate dehydrogenase (LDH) genes, while attenuating several key pathway genes, including glycerol-3-phosphate dehydrogenase1 (GPD1) and cytochrome-c oxidoreductase2 (CYB2). In order to increase the yield of lactic acid further, the ethanol production pathway was attenuated by disrupting the pyruvate decarboxylase1 (PDC1) and alcohol dehydrogenase1 (ADH1) genes. Despite an increase in lactic acid yield, severe reduction of the growth rate and glucose consumption rate owing to the absence of ADH1 caused a considerable decrease in the overall productivity. In Δadh1 cells, the levels of acetyl-CoA, a key precursor for biologically applicable components, could be insufficient for normal cell growth. To increase the cellular supply of acetyl-CoA, we introduced bacterial acetylating acetaldehyde dehydrogenase (A-ALD) enzyme (EC 1.2.1.10) genes into the lactic acid-producing S. cerevisiae. Escherichia coli-derived A-ALD genes, mhpF and eutE, were expressed and effectively complemented the attenuated acetaldehyde dehydrogenase (ALD)/acetyl-CoA synthetase (ACS) pathway in the yeast. The engineered strain, possessing a heterologous acetyl-CoA synthetic pathway, showed an increased glucose consumption rate and higher productivity of lactic acid fermentation. The production of lactic acid was reached at 142g/L with production yield of 0.89g/g and productivity of 3.55gL(-1)h(-1) under fed-batch fermentation in bioreactor. This study demonstrates a novel approach that improves productivity of lactic acid by metabolic engineering of the acetyl-CoA biosynthetic pathway in yeast. PMID:26384570

  15. Intrauterine bacterial inoculation and level of dietary methionine alter amino acid metabolism in nulliparous yearling ewes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using an intrauterine bacterial inoculation method, our objective was to determine the effects of acute sepsis and level of dietary metabolizable-methionine on splanchnic metabolism of amino acids in ewes. Twenty-five nulliparous yearling Rambouillet-cross ewes (initial BW = 65.1 ± 0.6 kg), surgical...

  16. Effect of washing broiler carcasses in potassium hydroxide and lauric acid on native bacterial flora

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Experiments were conducted to examine the bactericidal effect of potassium hydroxide (KOH) and lauric acid (LA) on the native bacterial flora of broiler carcasses. Carcasses were placed in solutions of 1.0% KOH and 2.0 % LA or in distilled water (control) and washed by shaking for 1 min on a mechani...

  17. Role of lauric acid-potassium hydroxide concentration on bacterial contamination of spray washed broiler carcasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A series of experiments were conducted to examine reductions in bacterial contamination of broiler carcasses washed in a spray cabinet with various concentrations of lauric acid (LA)-potassium hydroxide (KOH) solutions. Fifty eviscerated carcasses and 5 ceca were obtained from the processing line of...

  18. Genome Sequence of a Copper-Resistant Strain of Acidovorax citrulli Causing Bacterial Fruit Blotch of Melons

    PubMed Central

    Wang, Tielin; Yang, Yuwen

    2015-01-01

    Bacterial fruit blotch (BFB) of melons is a seed-borne disease caused by Acidovorax citrulli. We determined the draft genome of A. citrulli Tw6. The strain was isolated from a watermelon collected from Beijing, China. The A. citrulli Tw6 genome contains 5,080,614 bp and has a G+C content of 68.7 mol%. PMID:25908132

  19. Relationship Between Bacterial Strain Type, Host Biomarkers, and Mortality in Clostridium difficile Infection

    PubMed Central

    Walker, A. Sarah; Eyre, David W.; Wyllie, David H.; Dingle, Kate E.; Griffiths, David; Shine, Brian; Oakley, Sarah; O'Connor, Lily; Finney, John; Vaughan, Alison; Crook, Derrick W.; Wilcox, Mark H.; Peto, Tim E. A.

    2013-01-01

    Background. Despite substantial interest in biomarkers, their impact on clinical outcomes and variation with bacterial strain has rarely been explored using integrated databases. Methods. From September 2006 to May 2011, strains isolated from Clostridium difficile toxin enzyme immunoassay (EIA)–positive fecal samples from Oxfordshire, United Kingdom (approximately 600 000 people) underwent multilocus sequence typing. Fourteen-day mortality and levels of 15 baseline biomarkers were compared between consecutive C. difficile infections (CDIs) from different clades/sequence types (STs) and EIA-negative controls using Cox and normal regression adjusted for demographic/clinical factors. Results. Fourteen-day mortality was 13% in 2222 adults with 2745 EIA-positive samples (median, 78 years) vs 5% in 20 722 adults with 27 550 EIA-negative samples (median, 74 years) (absolute attributable mortality, 7.7%; 95% CI, 6.4%–9.0%). Mortality was highest in clade 5 CDIs (25% [16 of 63]; polymerase chain reaction (PCR) ribotype 078/ST 11), then clade 2 (20% [111 of 560]; 99% PCR ribotype 027/ST 1) versus clade 1 (12% [137 of 1168]; adjusted P < .0001). Within clade 1, 14-day mortality was only 4% (3 of 84) in ST 44 (PCR ribotype 015) (adjusted P = .05 vs other clade 1). Mean baseline neutrophil counts also varied significantly by genotype: 12.4, 11.6, and 9.5 × 109 neutrophils/L for clades 5, 2 and 1, respectively, vs 7.0 × 109 neutrophils/L in EIA-negative controls (P < .0001) and 7.9 × 109 neutrophils/L in ST 44 (P = .08). There were strong associations between C. difficile-type-specific effects on mortality and neutrophil/white cell counts (rho = 0.48), C-reactive-protein (rho = 0.43), eosinophil counts (rho = −0.45), and serum albumin (rho = −0.47). Biomarkers predicted 30%–40% of clade-specific mortality differences. Conclusions. C. difficile genotype predicts mortality, and excess mortality correlates with genotype-specific changes in biomarkers, strongly

  20. Discovery and application of new bacterial strains for asymmetric synthesis of L-tert-butyl leucine in high enantioselectivity.

    PubMed

    Jin, Jian-Zhong; Chang, Dong-Liang; Zhang, Jie

    2011-06-01

    Discovery of new bacterial strains with fast identification in a miniaturized system was performed for the synthesis of optically active L-tert-butyl leucine. With tert-butyl leucine amide as nitrogen source, one bacterial strain with high conversion and high enantioselectivity was discovered among 120 isolated microorganisms from local soils and identified as Mycobacterium sp. JX009. Glucose and ammonium chloride were examined as the good carbon source and nitrogen source for the cells' growth separately. The cells grew better at 30 °C and at pH 7.5 with higher activity of 2,650 U/l in comparison with other conditions. Cells' stability was improved by immobilization on synthetic resin 0730 without pretreatment. Tert-butyl leucine amide (30 mM) was successfully hydrolyzed by immobilized cells and examined as the highest chemical concentration that cells could endure. After six reaction cycles, the immobilized cells retained 90% activity with production of L-tert-butyl leucine in 98% ee. The results firstly reported the application of new bacterial strain in the hydrolysis of tert-butyl leucine amide to produce optically active L-tert-butyl leucine in an efficient way with investigation in detail. PMID:21153891

  1. Butyric acid from anaerobic fermentation of lignocellulosic biomass hydrolysates by Clostridium sp. strain RPT-4213

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel Clostridium sp. strain RPT-4213 was found producing butyrate under strict anaerobic conditions. This strain produced 9.47 g L-1 butyric acid from MRS media (0.48 g/g glucose). RPT-4213 was also used to ferment dilute acid pretreated hydrolysates including wheat straw (WSH), corn fiber (CFH...

  2. Simultaneous transport of two bacterial strains in intact cores from Oyster, Virginia: biological effects and numerical modeling.

    PubMed

    Dong, Hailiang; Rothmel, Randi; Onstott, Tullis C; Fuller, Mark E; DeFlaun, Mary F; Streger, Sheryl H; Dunlap, Robb; Fletcher, Madilyn

    2002-05-01

    The transport characteristics of two adhesion-deficient, indigenous groundwater strains, Comamonas sp. strain DA001 and Erwinia herbicola OYS2-A, were studied by using intact sediment cores (7 by 50 cm) from Oyster, Va. Both strains are gram-negative rods (1.10 by 0.56 and 1.56 by 0.46 microm, respectively) with strongly hydrophilic membranes and a slightly negative surface charge. The two strains exhibited markedly different behaviors when they were transported through granular porous sediment. To eliminate any effects of physical and chemical heterogeneity on bacterial transport and thus isolate the biological effect, the two strains were simultaneously injected into the same core. DA001 cells were metabolically labeled with (35)S and tagged with a vital fluorescent stain, while OYS2-A cells were metabolically labeled with (14)C. The fast decay of (35)S allowed deconvolution of the two isotopes (and therefore the two strains). Dramatic differences in the transport behaviors were observed. The breakthrough of DA001 and the breakthrough of OYS2-A both occurred before the breakthrough of a conservative tracer (termed differential advection), with effluent recoveries of 55 and 30%, respectively. The retained bacterial concentration of OYS2-A in the sediment was twofold higher than that of DA001. Among the cell properties analyzed, the statistically significant differences between the two strains were cell length and diameter. The shorter, larger-diameter DA001 cells displayed a higher effluent recovery than the longer, smaller-diameter OYS2-A cells. CXTFIT modeling results indicated that compared to the DA001 cells, the OYS2-A cells experienced lower pore velocity, higher porosity, a higher attachment rate, and a lower detachment rate. All these factors may contribute to the observed differences in transport. PMID:11976080

  3. Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo

    PubMed Central

    McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda

    2016-01-01

    ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099

  4. Implications of Genome-Based Discrimination between Clostridium botulinum Group I and Clostridium sporogenes Strains for Bacterial Taxonomy

    PubMed Central

    Weigand, Michael R.; Pena-Gonzalez, Angela; Shirey, Timothy B.; Broeker, Robin G.; Ishaq, Maliha K.; Konstantinidis, Konstantinos T.

    2015-01-01

    Taxonomic classification of Clostridium botulinum is based on the production of botulinum neurotoxin (BoNT), while closely related, nontoxic organisms are classified as Clostridium sporogenes. However, this taxonomic organization does not accurately mirror phylogenetic relationships between these species. A phylogenetic reconstruction using 2,016 orthologous genes shared among strains of C. botulinum group I and C. sporogenes clearly separated these two species into discrete clades which showed ∼93% average nucleotide identity (ANI) between them. Clustering of strains based on the presence of variable orthologs revealed 143 C. sporogenes clade-specific genetic signatures, a subset of which were further evaluated for their ability to correctly classify a panel of presumptive C. sporogenes strains by PCR. Genome sequencing of several C. sporogenes strains lacking these signatures confirmed that they clustered with C. botulinum strains in a core genome phylogenetic tree. Our analysis also identified C. botulinum strains that contained C. sporogenes clade-specific signatures and phylogenetically clustered with C. sporogenes strains. The genome sequences of two bont/B2-containing strains belonging to the C. sporogenes clade contained regions with similarity to a bont-bearing plasmid (pCLD), while two different strains belonging to the C. botulinum clade carried bont/B2 on the chromosome. These results indicate that bont/B2 was likely acquired by C. sporogenes strains through horizontal gene transfer. The genome-based classification of these species used to identify candidate genes for the development of rapid assays for molecular identification may be applicable to additional bacterial species that are challenging with respect to their classification. PMID:26048939

  5. Analysis of Bacterial Diversity During Acetic Acid Fermentation of Tianjin Duliu Aged Vinegar by 454 Pyrosequencing.

    PubMed

    Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye

    2015-08-01

    The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process. PMID:25903266

  6. Seasonal changes in nitrogen-cycle gene abundances and in bacterial communities in acidic forest soils.

    PubMed

    Jung, Jaejoon; Yeom, Jinki; Han, Jiwon; Kim, Jisun; Park, Woojun

    2012-06-01

    The abundance of genes related to the nitrogen biogeochemical cycle and the microbial community in forest soils (bacteria, archaea, fungi) were quantitatively analyzed via real-time PCR using 11 sets of specific primers amplifying nifH, bacterial amoA, archaeal amoA, narG, nirS, nirK, norB, nosZ, bacterial 16S rRNA gene, archaeal 16S rRNA gene, and the ITS sequence of fungi. Soils were sampled from Bukhan Mountain from September of 2010 to July of 2011 (7 times). Bacteria were the predominant microbial community in all samples. However, the abundance of archaeal amoA was greater than bacterial amoA throughout the year. The abundances of nifH, nirS, nirK, and norB genes changed in a similar pattern, while narG and nosZ appeared in sensitive to the environmental changes. Clone libraries of bacterial 16S rRNA genes were constructed from summer and winter soil samples and these revealed that Acidobacteria was the most predominant phylum in acidic forest soil environments in both samples. Although a specific correlation of environmental factor and gene abundance was not verified by principle component analysis, our data suggested that the combination of biological, physical, and chemical characteristics of forest soils created distinct conditions favoring the nitrogen biogeochemical cycle and that bacterial communities in undisturbed acidic forest soils were quite stable during seasonal change. PMID:22752898

  7. Rapid, absolute, and simultaneous quantification of specific pathogenic strain and total bacterial cells using an ultrasensitive dual-color flow cytometer.

    PubMed

    Yang, Lingling; Wu, Lina; Zhu, Shaobin; Long, Yao; Hang, Wei; Yan, Xiaomei

    2010-02-01

    This paper describes a rapid and sensitive strategy for the absolute and simultaneous quantification of specific pathogenic strain and total bacterial cells in a mixture. A laboratory-built compact, high-sensitivity, dual channel flow cytometer (HSDCFCM) was modified to enable dual fluorescence detection. A bacterial cell mixture comprising heat-killed pathogenic Escherichia coli E. coli O157:H7 and harmless E. coli DH5alpha was used as a model system. Pathogenic E. coli O157:H7 cells were selectively labeled by red fluorescent probe via antibody-antigen interaction, and all bacterial cells were stained with membrane-permeable nucleic acid dye that fluoresces green. When each individual bacterium passes through the interrogating laser beam, E. coli O157:H7 emits both red and green fluorescence, while E. coli DH5alpha exhibits only green fluorescence. Because the fluorescence burst generated from each individual bacterial cell was easily distinguished from the background, accurate enumeration and consequently absolute quantification were achieved for both pathogenic and total bacterial cells. By using this strategy, accurate counting of bacteria at a density above 1.0 x 10(5) cells/mL can be accomplished with 1 min of data acquisition time after fluorescent staining. Excellent correlation between the concentrations measured by the HSDCFCM and the conventional plate-counting method were obtained for pure-cultured E. coli O157:H7 (R(2) = 0.9993) and E. coli DH5alpha (R(2) = 0.9998). Bacterial cell mixtures with varying proportions of E. coli O157:H7 and E. coli DH5alpha were measured with good ratio correspondence. We applied the established approach to detecting artificially contaminated drinking water samples; E. coli O157:H7 of 1.0 x 10(2) cells/mL were accurately quantified upon sample enrichment. It is believed that the proposed method will find wide applications in many fields demanding bacterial identification and quantification. PMID:20039721

  8. Isotope composition of sulphate in acid mine drainage as measure of bacterial oxidation

    USGS Publications Warehouse

    Taylor, B.E.; Wheeler, M.C.; Nordstrom, D.K.

    1984-01-01

    The formation of acid waters by oxidation of pyrite-bearing ore deposits, mine tailing piles, and coal measures is a complex biogeochemical process and is a serious environmental problem. We have studied the oxygen and sulphur isotope geochemistry of sulphides, sulphur, sulphate and water in the field and in experiments to identify sources of oxygen and reaction mechanisms of sulphate formation. Here we report that the oxygen isotope composition of sulphate in acid mine drainage shows a large variation due to differing proportions of atmospheric- and water-derived oxygen from both chemical and bacterially-mediated oxidation. 18O-enrichment of sulphate results from pyrite oxidation facilitated by Thiobacillus ferrooxidans in aerated environments. Oxygen isotope analysis may therefore be useful in monitoring the effectiveness of abatement programmes designed to inhibit bacterial oxidation. Sulphur isotopes show no significant fractionation between pyrite and sulphate, indicating the quantitative insignificance of intermediate oxidation states of sulphur under acid conditions. ?? 1984 Nature Publishing Group.

  9. Lethal effect of butylated hydroxyanisole as related to bacterial fatty acid composition.

    PubMed

    Post, L S; Davidson, P M

    1986-07-01

    Bacillus cereus, Clostridium perfringens, Staphylococcus aureus, Pseudomonas fluorescens, Pseudomonas fragi, Escherichia coli, and Salmonella "anatum" were challenged with butylated hydroxyanisole (BHA). Susceptibility was measured as the concentration of BHA required to cause a 90% reduction in bacterial survivors. Staphylococcus aureus LP and P. fragi were two of the most resistant species examined; C. perfringens and P. fluorescens were the most susceptible. Gram stain reaction was found not to be a strict indicator of bacterial susceptibility to BHA. There was no obvious relationship between individual fatty acids and susceptibility. The ratio of saturated to unsaturated fatty acids in the total lipid fraction of only the gram-positive species was related to susceptibility. The ratios of saturated to unsaturated fatty acids of other fractions were not related to susceptibility. PMID:2873790

  10. Differential neutrophil responses to bacterial stimuli: Streptococcal strains are potent inducers of heparin-binding protein and resistin-release

    PubMed Central

    Snäll, Johanna; Linnér, Anna; Uhlmann, Julia; Siemens, Nikolai; Ibold, Heike; Janos, Marton; Linder, Adam; Kreikemeyer, Bernd; Herwald, Heiko; Johansson, Linda; Norrby-Teglund, Anna

    2016-01-01

    Neutrophils are critical for the control of bacterial infections, but they may also contribute to disease pathology. Here we explore neutrophil responses, in particular the release of sepsis-associated factors heparin-binding protein (HBP) and resistin in relation to specific bacterial stimuli and sepsis of varying aetiology. Analyses of HBP and resistin in plasma of septic patients revealed elevated levels as compared to non-infected critically ill patients. HBP and resistin correlated significantly in septic patients, with the strongest association seen in group A streptococcal (GAS) cases. In vitro stimulation of human neutrophils revealed that fixed streptococcal strains induced significantly higher release of HBP and resistin, as compared to Staphylococcus aureus or Escherichia coli. Similarly, neutrophils stimulated with the streptococcal M1-protein showed a significant increase in co-localization of HBP and resistin positive granules as well as exocytosis of these factors, as compared to LPS. Using a GAS strain deficient in M1-protein expression had negligible effect on neutrophil activation, while a strain deficient in the stand-alone regulator MsmR was significantly less stimulatory as compared to its wild type strain. Taken together, the findings suggest that the streptococcal activation of neutrophils is multifactorial and involves, but is not limited to, proteins encoded by the FCT-locus. PMID:26887258

  11. Effects of jasmonic acid, ethylene, and salicylic acid signaling on the rhizosphere bacterial community of Arabidopsis thaliana.

    PubMed

    Doornbos, Rogier F; Geraats, Bart P J; Kuramae, Eiko E; Van Loon, L C; Bakker, Peter A H M

    2011-04-01

    Systemically induced resistance is a promising strategy to control plant diseases, as it affects numerous pathogens. However, since induced resistance reduces one or both growth and activity of plant pathogens, the indigenous microflora may also be affected by an enhanced defensive state of the plant. The aim of this study was to elucidate how much the bacterial rhizosphere microflora of Arabidopsis is affected by induced systemic resistance (ISR) or systemic acquired resistance (SAR). Therefore, the bacterial microflora of wild-type plants and plants affected in their defense signaling was compared. Additionally, ISR was induced by application of methyl jasmonate and SAR by treatment with salicylic acid or benzothiadiazole. As a comparative model, we also used wild type and ethylene-insensitive tobacco. Some of the Arabidopsis genotypes affected in defense signaling showed altered numbers of culturable bacteria in their rhizospheres; however, effects were dependent on soil type. Effects of plant genotype on rhizosphere bacterial community structure could not be related to plant defense because chemical activation of ISR or SAR had no significant effects on density and structure of the rhizosphere bacterial community. These findings support the notion that control of plant diseases by elicitation of systemic resistance will not significantly affect the resident soil bacterial microflora. PMID:21171889

  12. Simultaneous Extraction of Viral and Bacterial Nucleic Acids for Molecular Diagnostic Applications

    PubMed Central

    Kajiura, Lauren N.; Stewart, Scott D.; Dresios, John; Uyehara, Catherine F. T.

    2015-01-01

    Molecular detection of microbial pathogens in clinical samples requires the application of efficient sample lysis protocols and subsequent extraction and isolation of their nucleic acids. Here, we describe a simple and time-efficient method for simultaneous extraction of genomic DNA from gram-positive and -negative bacteria, as well as RNA from viral agents present in a sample. This method compared well with existing bacterial- and viral-specialized extraction protocols, worked reliably on clinical samples, and was not pathogen specific. This method may be used to extract DNA and RNA concurrently from viral and bacterial pathogens present in a sample and effectively detect coinfections in routine clinical diagnostics. PMID:26543438

  13. The effect of linoleic acid on the Sauvignon blanc fermentation by different wine yeast strains.

    PubMed

    Casu, Francesca; Pinu, Farhana R; Fedrizzi, Bruno; Greenwood, David R; Villas-Boas, Silas G

    2016-08-01

    The level of linoleic acid in the Sauvignon blanc (SB) grape juice affects the development of different aroma compounds during fermentation by Saccharomyces cerevisiae EC1118, including key varietal thiols such as 3-mercaptohexanol (3MH) and 3-mercaptohexyl acetate (3MHA). However, it is still unknown if linoleic acid would affect in a similar way other commonly used S. cerevisiae wine strains. Here we investigated the effect of grape juice linoleic acid on the development of aroma compounds and other metabolites of SB wines using different wine yeast strains: EC1118, AWRI796 and VIN13. Linoleic acid clearly affected the levels of acetylated aroma compounds, several amino acids, and antioxidant molecules, independent of yeast strain, but the production of 3MH was affected by linoleic acid in a strain-specific manner. Moreover, the supplementation of deuterium-labelled 3MH also affected the production of varietal thiols in a strain-specific way. Linoleic acid reduced the acetylation process probably by inhibiting an acetyltransferase, an effect that was independent of the yeast strain. However, regulation of the 3MH biosynthesis is strain-specific, which suggests a mindful consideration not only towards the wine yeast but also to the linoleic acid concentration in the grape juice in order to obtain the desired wine aroma characteristics. PMID:27364827

  14. Evaluation of toxic effects of several carboxylic acids on bacterial growth by toxicodynamic modelling

    PubMed Central

    2011-01-01

    Background Effects of organic acids on microbial fermentation are commonly tested in investigations about metabolic behaviour of bacteria. However, they typically provide only descriptive information without modelling the influence of acid concentrations on bacterial kinetics. Results We developed and applied a mathematical model (secondary model) to capture the toxicological effects of those chemicals on kinetic parameters that define the growth of bacteria in batch cultures. Thus, dose-response kinetics were performed with different bacteria (Leuconostoc mesenteroides, Carnobacterium pisicola, Escherichia coli, Bacillus subtilis and Listonella anguillarum) exposed at increasing concentrations of individual carboxylic acids (formic, acetic, propionic, butyric and lactic). In all bioassays the acids affected the maximum bacterial load (Xm) and the maximum growth rate (vm) but only in specific cases the lag phase (λ) was modified. Significance of the parameters was always high and in all fermentations the toxicodynamic equation was statistically consistent and had good predictability. The differences between D and L-lactic acid effects were significant for the growth of E. coli, L. mesenteroides and C. piscicola. In addition, a global parameter (EC50,τ) was used to compare toxic effects and provided a realistic characterization of antimicrobial agents using a single value. Conclusions The effect of several organic acids on the growth of different bacteria was accurately studied and perfectly characterized by a bivariate equation which combines the basis of dose-response theory with microbial growth kinetics (secondary model). The toxicity of carboxylic acids was lower with the increase of the molecular weight of these chemicals. PMID:22118421

  15. Protein Expression Profile of an Environmentally Important Bacterial Strain: the Chromate Response of Arthrobacter Species Strain FB24

    SciTech Connect

    Henne, Kristene L.; Turse, Joshua E.; Nakatsu, C. H.; Konopka, Allan

    2011-05-03

    The global proteomic response of Arthrobacter sp. strain FB24 to different levels of chromate stress was evaluated with both two-dimensional gel electrophoresis (2-DGE) and liquid chromatography coupled to tandem mass spectrometry (LC/LC-MS/MS) [Henne et al. 2009b]. Proteome coverage of 22% and 71% was obtained with 2-DGE and LC/LC-MS/MS, respectively. The strong response of strain FB24 to chromate suggests a condition of sulfur limitation, which could be driven by competition for the sulfate transporter by the structurally similar chromate ion. Additionally, the involvement of genes hypothesized to be directly involved in chromate resistance in strain FB24 was supported at the protein level.

  16. Differentiation of xanthomonads causing the bacterial leaf spot of poinsettia in China from the pathotype strain of Xanthomonas axonopodis pv. poinsettiicola *

    PubMed Central

    Li, Bin; Xie, Guan-lin; Swings, J.

    2005-01-01

    In October 2003, a new bacterial disease with symptoms similar to those caused by Xanthomonas axonopodis pv. poinsettiicola was observed on poinsettia leaves at a flower nursery in Zhejiang Province of China. Three Xanthomonas strains were isolated from infected plants and classified as X. axonopodis. They were differentiated from the pathotype strain LMG849 of X. axonopodis pv. poinsettiicola causing bacterial leaf spot of poinsettia by comparison of pathogenicity, substrate utilization and BOX-PCR genomic fingerprints. PMID:15909325

  17. Optimization of Culture Parameters for Maximum Polyhydroxybutyrate Production by Selected Bacterial Strains Isolated from Rhizospheric Soils.

    PubMed

    Lathwal, Priyanka; Nehra, Kiran; Singh, Manpreet; Jamdagni, Pragati; Rana, Jogender S

    2015-01-01

    The enormous applications of conventional non-biodegradable plastics have led towards their increased usage and accumulation in the environment. This has become one of the major causes of global environmental concern in the present century. Polyhydroxybutyrate (PHB), a biodegradable plastic is known to have properties similar to conventional plastics, thus exhibiting a potential for replacing conventional non-degradable plastics. In the present study, a total of 303 different bacterial isolates were obtained from soil samples collected from the rhizospheric area of three crops, viz., wheat, mustard and sugarcane. All the isolates were screened for PHB (Poly-3-hydroxy butyric acid) production using Sudan Black staining method, and 194 isolates were found to be PHB positive. Based upon the amount of PHB produced, the isolates were divided into three categories: high, medium and low producers. Representative isolates from each category were selected for biochemical characterization; and for optimization of various culture parameters (carbon source, nitrogen source, C/N ratio, different pH, temperature and incubation time periods) for maximizing PHB accumulation. The highest PHB yield was obtained when the culture medium was supplemented with glucose as the carbon source, ammonium sulphate at a concentration of 1.0 g/l as the nitrogen source, and by maintaining the C/N ratio of the medium as 20:1. The physical growth parameters which supported maximum PHB accumulation included a pH of 7.0, and an incubation temperature of 30 degrees C for a period of 48 h. A few isolates exhibited high PHB accumulation under optimized conditions, thus showing a potential for their industrial exploitation. PMID:26638531

  18. Biomimetic Synthesis of Selenium Nanospheres by Bacterial Strain JS-11 and Its Role as a Biosensor for Nanotoxicity Assessment: A Novel Se-Bioassay

    PubMed Central

    Dwivedi, Sourabh; AlKhedhairy, Abdulaziz A.; Ahamed, Maqusood; Musarrat, Javed

    2013-01-01

    Selenium nanoparticles (Se-NPs) were synthesized by green technology using the bacterial isolate Pseudomonas aeruginosa strain JS-11. The bacteria exhibited significant tolerance to selenite (SeO32−) up to 100 mM concentration with an EC50 value of 140 mM. The spent medium (culture supernatant) contains the potential of reducing soluble and colorless SeO32− to insoluble red elemental selenium (Se0) at 37°C. Characterization of red Se° product by use of UV-Vis spectroscopy, X-ray diffraction (XRD), atomic force microscopy (AFM) and transmission electron microscopy (TEM) with energy dispersive X-ray spectrum (EDX) analysis revealed the presence of stable, predominantly monodispersed and spherical selenium nanoparticles (Se-NPs) of an average size of 21 nm. Most likely, the metabolite phenazine-1-carboxylic acid (PCA) released by strain JS-11 in culture supernatant along with the known redox agents like NADH and NADH dependent reductases are responsible for biomimetic reduction of SeO32− to Se° nanospheres. Based on the bioreduction of a colorless solution of SeO32− to elemental red Se0, a high throughput colorimetric bioassay (Se-Assay) was developed for parallel detection and quantification of nanoparticles (NPs) cytotoxicity in a 96 well format. Thus, it has been concluded that the reducing power of the culture supernatant of strain JS-11 could be effectively exploited for developing a simple and environmental friendly method of Se-NPs synthesis. The results elucidated that the red colored Se° nanospheres may serve as a biosensor for nanotoxicity assessment, contemplating the inhibition of SeO32− bioreduction process in NPs treated bacterial cell culture supernatant, as a toxicity end point. PMID:23483909

  19. TolC is important for bacterial survival and oxidative stress response in Salmonella enterica serovar Choleraesuis in an acidic environment.

    PubMed

    Lee, Jen-Jie; Wu, Ying-Chen; Kuo, Chih-Jung; Hsuan, Shih-Ling; Chen, Ter-Hsin

    2016-09-25

    The outer membrane protein TolC, which is one of the key components of several multidrug efflux pumps, is thought to be involved in various independent systems in Enterobacteriaceae. Since the acidic environment of the stomach is an important protection barrier against foodborne pathogen infections in hosts, we evaluated whether TolC played a role in the acid tolerance of Salmonella enterica serovar Choleraesuis. Comparison of the acid tolerance of the tolC mutant and the parental wild-type strain showed that the absence of TolC limits the ability of Salmonella to sustain life under extreme acidic conditions. Additionally, the mutant exhibited morphological changes during growth in an acidic medium, leading to the conflicting results of cell viability measured by spectrophotometry and colony-forming unit counting. Reverse-transcriptional-PCR analysis indicated that acid-related molecules, apparatus, or enzymes and oxidation-induced factors were significantly affected by the acidic environment in the null-tolC mutant. The elongated cellular morphology was restored by adding antioxidants to the culture medium. Furthermore, we found that increased cellular antioxidative activity provides an overlapping protection against acid killing, demonstrating the complexity of the bacterial acid stress response. Our findings reinforce the multifunctional characteristics of TolC in acid tolerance or oxidative stress resistance and support the correlative protection mechanism between oxygen- and acid-mediated stress responses in Salmonella enterica serovar Choleraesuis. PMID:27599929

  20. Protozoan, Bacterial, and Volatile Fatty Acid Changes Associated with Feeding Tylosin

    PubMed Central

    Satapathy, N.; Purser, D. B.

    1967-01-01

    Tylosin was fed to two of six wethers for 79 days, to a second two for only 28 days, and not at all to a third pair (controls). The addition of tylosin to the daily feed resulted in a rapid twofold increase in protozoal concentration and a change in the composition or characteristics, or both, of the bacterial population. The results indicate that the bacterial population was modified to the extent of about 80%. Total acid concentrations were initially depressed but appeared to be greater than those in control animals at the termination of the experiment. Deletion of tylosin from the ration resulted in a rapid decrease in protozoal concentrations, whereas changes in the bacterial population did not occur for a further 30 days. PMID:16349756

  1. Bacterial d-amino acid oxidases: Recent findings and future perspectives

    PubMed Central

    Takahashi, Shouji; Abe, Katsumasa; Kera, Yoshio

    2015-01-01

    D-Amino acid oxidase (DAO) is a flavin enzyme that catalyzes the oxidative deamination of d-amino acids. This enzyme has been studied extensively both biochemically and structurally as a model for the oxidase-dehydrogenase class of flavoproteins. This enzyme also has various applications, such as the determination of d-amino acids and production of building blocks for a number of pharmaceuticals. DAO has been found mainly in eukaryotic organisms and has been suggested to play a significant role in various cellular processes, one of which includes neurotransmission in the human brain. In contrast, this enzyme has not been identified in prokaryotic organisms. Some studies have recently identified and characterized DAO enzyme in some actinobacteria. In addition, a genome database search reveals a wide distribution of DAO homologous genes in this bacterial group. The bacterial DAOs characterized so far have certain distinct properties in comparison to eukaryotic DAOs. These enzymes also exhibit some important applicable properties, suggesting that bacteria could be used as a source for obtaining novel and useful DAOs. The physiological function of bacterial DAO have been proposed to include the degradation of non-canonical d-amino acids released from cell wall, but is still largely unknown and need to be studied in depth. PMID:25996186

  2. Changes in ruminal bacterial community composition following feeding of alfalfa ensiled with a lactic acid bacterial inoculant.

    PubMed

    Mohammed, R; Stevenson, D M; Beauchemin, K A; Muck, R E; Weimer, P J

    2012-01-01

    Some silage inoculants help to improve silage quality and promote an increase in milk production, possibly through altering the rumen microflora. We hypothesized that rumen bacterial community composition (BCC) would be different in cows fed alfalfa ensiled with the inoculant Lactobacillus plantarum MTD/1 (LP) compared with those fed alfalfa ensiled without the inoculant (Ctrl). Eight ruminally cannulated Holstein cows were allotted to 2 diets (Ctrl or LP) in a double crossover design with four 28-d periods. Diets were formulated to contain (% dry matter basis) 28.0% neutral detergent fiber and 16.2% crude protein, and contained alfalfa silage, 50.9; corn silage, 20.6; high-moisture shelled corn, 21.4; soy hulls, 4.7; plus minerals and vitamins, 2.4. Ruminal digesta were collected just before feeding on 3 consecutive days near the end of each period, and were separated into solid and liquid phases. Microbial DNA was extracted from each phase, amplified by PCR using domain-level bacterial primers, and subjected to automated ribosomal intergenic spacer analysis. The pH was 4.56 and 4.86 and the lactate-to-acetate ratio 9.8 and 4.4, respectively, for the treated and untreated alfalfa silages. Dry matter intakes and milk production data were not influenced by diets but showed a cow effect. Total volatile fatty acids (mM) tended to be greater for LP compared with Ctrl. Individual volatile fatty acids were not influenced by diets but showed a significant cow effect. Ruminal acetate (mol/100 mol) and acetate-to-propionate ratio were lower and propionate (mol/100 mol) greater for the 2 milk fat-depressed (MFD; <3.2% fat content) cows compared with the other 6 cows. Correspondence analysis of the 265 peaks in the automated ribosomal intergenic spacer analysis profile across the 188 samples revealed that the first 2 components contributed 7.1 and 3.8% to the total variation in the profile. The ordination points representing the liquid and solid phases clustered separately

  3. Bacterial community compositions in sediment polluted by perfluoroalkyl acids (PFAAs) using Illumina high-throughput sequencing.

    PubMed

    Sun, Yajun; Wang, Tieyu; Peng, Xiawei; Wang, Pei; Lu, Yonglong

    2016-06-01

    The characterization of bacterial community compositions and the change in perfluoroalkyl acids (PFAAs) along a natural river distribution system were explored in the present study. Illumina high-throughput sequencing was used to explore bacterial community diversity and structure in sediment polluted by PFAAs from the Xiaoqing River, the area with concentrated fluorochemical facilities in China. The concentration of PFAAs was in the range of 8.44-465.60 ng/g dry weight (dw) in sediment. Perfluorooctanoic acid (PFOA) was the dominant PFAA in all samples, which accounted for 94.2 % of total PFAAs. High-level PFOA could lead to an obvious increase in relative abundance of Proteobacteria, ε-Proteobacteria, Thiobacillus, and Sulfurimonas and the decrease in relative abundance of other bacteria. Redundancy analysis revealed that PFOA played an important role in the formation of bacterial community, and PFOA at higher concentration could reduce the diversity of bacterial community. When the concentration of PFOA was below 100 ng/g dw in sediment, no significant effect on microbial community structure was observed. Thiobacillus and Sulfurimonas were positively correlated with the concentration of PFOA, suggesting that both genera were resistant to PFOA contamination. PMID:26780047

  4. Comparative Study of Bacterial Communities in Nepenthes Pitchers and Their Correlation to Species and Fluid Acidity.

    PubMed

    Kanokratana, Pattanop; Mhuanthong, Wuttichai; Laothanachareon, Thanaporn; Tangphatsornruang, Sithichoke; Eurwilaichitr, Lily; Kruetreepradit, Trongtham; Mayes, Shawn; Champreda, Verawat

    2016-08-01

    Pitchers are specialized digestive organs of carnivorous plants which evolved for trapping prey and represent a unique environment harboring hidden diversity of unexplored microbes forming transient hydrolytic microcosms. In this study, the diversity of bacterial communities in the pitcher fluids of seven local Nepenthes found in Thailand was assessed by tagged 16S ribosomal RNA (rRNA) gene amplicon sequencing on an Ion PGM™ platform. A total of 1,101,000 filtered sequences were obtained which were taxonomically classified into 20 phyla, 48 classes, 72 orders, 153 families, and 442 genera while the remainder (1.43 %) could not be assigned to any existing taxa. Proteobacteria represented the predominant members in closed pitchers and more diversified bacterial taxa particularly Bacteriodetes and Actinobacteria, showed increasing abundance in open pitchers containing insect bodies. Principal coordinate analysis revealed that distribution of bacterial taxa was not significantly related to the Nepenthes species but strongly correlated to the pH of the pitcher fluids (pH 1.7-6.7). Acidicella was a highly dominant bacterial genus in acidic pitcher fluids while Dyella and Mycobacterium were also common genera in most pitchers. A unique microbial community structure was found in Nepenthes ampullaria which could reflect their adaptation to digest leaf litter, in addition to insect prey. The work revealed the highly unexplored nature of bacterial microcosms in Nepenthes pitcher fluids and provides insights into their community structure in this unique ecological system. PMID:27287538

  5. Comparative analysis of bacterial community and antibiotic-resistant strains in different developmental stages of the housefly (Musca domestica).

    PubMed

    Wei, Ting; Hu, Jun; Miyanaga, Kazuhiko; Tanji, Yasunori

    2013-02-01

    The housefly (Musca domestica) is an important host for a variety of bacteria, including some pathogenic and antibiotic-resistant strains. To further investigate the relationship between the housefly and the bacteria it harbors, it is necessary to understand the fate of microorganisms during the larval metamorphosis. The major bacterial communities in three developmental stages of the housefly (maggot, pupa, and adult fly) were investigated by a culture-independent method, polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis of 16S rRNA genes. The bacteria that were identified using DGGE analysis spanned phyla Proteobacteria, Firmicutes, and Bacteroidetes. Changes in the predominant genera were observed during the housefly development. Bacteroides, Koukoulia, and Schineria were detected in maggots, Neisseria in pupae, and Macrococcus, Lactococcus, and Kurthia in adult flies. Antibiotic-resistant bacteria were screened using a selective medium and tested for antibiotic susceptibility. Most resistant isolates from maggots and pupae were classified as Proteus spp., while those from adult flies were much more diverse and spanned 12 genera. Among 20 tested strains across the three stages, 18 were resistant to at least two antibiotics. Overall, we demonstrated that there are changes in the major bacterial communities and antibiotic-resistant strains as the housefly develops. PMID:22526786

  6. [Isolation and identification of a bacterial strain JS018 capable of degrading several kinds of organophosphate pesticides].

    PubMed

    Jiang, Yu-Ji; Deng, You-Jin; Liu, Xin-Rui; Xie, Bao-Gui; Hu, Fang-Ping

    2006-06-01

    Organophosphate pesticides are used widely all over the world and play an important role in plant pest control. However these pesticides are considered as pollutants and harmful to human health. To search for microorganisms that can degrade organophosphate pesticides with high efficiency, a bacterial strain, coded as JS018, was isolated and screened from the soil in the vicinity of Shanming Pesticides Factory, Shanming, Fujian. Laboratory tests showed that the bacterium could degrade several kinds of organophosphate pesticides, such as Parathion-methyl and phoxin. The strain's degrading rates on phoxin, Parathion-methyl, hostathion and dichlorvos in LB liquid fermentation medium for 36 h were 99%, 96%, 80.4% and 69.0% respectively. The bacterial colonies on LB plate appeared shiny and pale-pink in color. The bacteria were Gram-negative coccoids, 0.5 - 0.7 microm in diameter. They grew well at 30 - 38 degrees C and pH 7.0 - 9.0. The optimal temperature and pH for cell growth was 32 degrees C and pH 7.5 - 8.0, respectively. They did not grow in medium containing 6% or more NaCl. The antibiotic susceptibility tests showed that the strain was resistant to ampicillin, penicillin and lincomycin. It was sensitive to kanamycin, tetracycline and gentamicin. Laboratory tests also showed that the strain could ferment D-glucose, trehalose, melezitose and ethanol. It was negative in the production of indole and hydrogen sulfide. It could not liquefy gelatin, utilize citrate, nor ferment L-arabinose, sucrose, D-mannitol, D-xylose, fructose, D-galactose, maltose or lactose. The catalase, urease and nitrate reduction were positive. Based on its morphological, physiological and biochemical properties as well as the 16S rDNA sequence analysis result, the strain was tentatively identified as Roseomonas sp. PMID:16933622

  7. PLANT MICROBIOME. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa.

    PubMed

    Lebeis, Sarah L; Paredes, Sur Herrera; Lundberg, Derek S; Breakfield, Natalie; Gehring, Jase; McDonald, Meredith; Malfatti, Stephanie; Glavina del Rio, Tijana; Jones, Corbin D; Tringe, Susannah G; Dangl, Jeffery L

    2015-08-21

    Immune systems distinguish "self" from "nonself" to maintain homeostasis and must differentially gate access to allow colonization by potentially beneficial, nonpathogenic microbes. Plant roots grow within extremely diverse soil microbial communities but assemble a taxonomically limited root-associated microbiome. We grew isogenic Arabidopsis thaliana mutants with altered immune systems in a wild soil and also in recolonization experiments with a synthetic bacterial community. We established that biosynthesis of, and signaling dependent on, the foliar defense phytohormone salicylic acid is required to assemble a normal root microbiome. Salicylic acid modulates colonization of the root by specific bacterial families. Thus, plant immune signaling drives selection from the available microbial communities to sculpt the root microbiome. PMID:26184915

  8. Cloning of a very virulent plus, 686 strain of Marek's disease virus as a bacterial artificial chromosome.

    PubMed

    Reddy, Sanjay M; Sun, Aijun; Khan, Owais A; Lee, Lucy F; Lupiani, Blanca

    2013-06-01

    Bacterial artificial chromosome (BAC) vectors were first developed to facilitate propagation and manipulation of large DNA fragments. This technology was later used to clone full-length genomes of large DNA viruses to study viral gene function. Marek's disease virus (MDV) is a highly oncogenic herpesvirus that causes rapid induction of T-cell lymphomas in chickens. Based on the virus's ability to cause disease in vaccinated chickens, MDV strains are classified into pathotypes, with the most virulent strains belonging to the very virulent plus (vv+) pathotype. Here we report the construction of BAC clones of 686 (686-BAC), a vv+ strain of MDV. Transfection of DNA isolated from two independent clones into duck embryo fibroblasts resulted in recovery of infectious virus. Pathogenesis studies showed that the BAC-derived 686 viruses were more virulent than Md5, a vv strain of MDV. With the use of a two-step red-mediated mutagenesis process, both copies of viral interleukin 8 (vIL-8) were deleted from the MDV genome, showing that 686-BACs were amenable to mutagenesis techniques. The generation of BAC clones from a vv+ strain of MDV is a significant step toward understanding molecular basis of MDV pathogenesis. PMID:23901763

  9. Identification of a New Marine Bacterial Strain SD8 and Optimization of Its Culture Conditions for Producing Alkaline Protease

    PubMed Central

    Cui, Hongxia; Yang, Muyang; Wang, Liping; Xian, Cory J.

    2015-01-01

    While much attention has been given to marine microorganisms for production of enzymes, which in general are relatively more stable and active compared to those from plants and animals, studies on alkaline protease production from marine microorganisms have been very limited. In the present study, the alkaline protease producing marine bacterial strain SD8 isolated from sea muds in the Geziwo Qinhuangdao sea area of China was characterized and its optimal culture conditions were investigated. Strain SD8 was initially classified to belong to genus Pseudomonas by morphological, physiological and biochemical characterizations, and then through 16S rDNA sequence it was identified to be likely Pseudomonas hibiscicola. In addition, the culture mediums, carbon sources and culture conditions of strain SD8 were optimized for maximum production of alkaline protease. Optimum enzyme production (236U/mL when cultured bacteria being at 0.75 mg dry weight/mL fermentation broth) was obtained when the isolate at a 3% inoculum size was grown in LB medium at 20 mL medium/100mL Erlenmeyer flask for 48h culture at 30°C with an initial of pH 7.5. This was the first report of strain Pseudomonas hibiscicola secreting alkaline protease, and the data for its optimal cultural conditions for alkaline protease production has laid a foundation for future exploration for the potential use of SD8 strain for alkaline protease production. PMID:26716833

  10. Identification of a New Marine Bacterial Strain SD8 and Optimization of Its Culture Conditions for Producing Alkaline Protease.

    PubMed

    Cui, Hongxia; Yang, Muyang; Wang, Liping; Xian, Cory J

    2015-01-01

    While much attention has been given to marine microorganisms for production of enzymes, which in general are relatively more stable and active compared to those from plants and animals, studies on alkaline protease production from marine microorganisms have been very limited. In the present study, the alkaline protease producing marine bacterial strain SD8 isolated from sea muds in the Geziwo Qinhuangdao sea area of China was characterized and its optimal culture conditions were investigated. Strain SD8 was initially classified to belong to genus Pseudomonas by morphological, physiological and biochemical characterizations, and then through 16S rDNA sequence it was identified to be likely Pseudomonas hibiscicola. In addition, the culture mediums, carbon sources and culture conditions of strain SD8 were optimized for maximum production of alkaline protease. Optimum enzyme production (236U/mL when cultured bacteria being at 0.75 mg dry weight/mL fermentation broth) was obtained when the isolate at a 3% inoculum size was grown in LB medium at 20 mL medium/100mL Erlenmeyer flask for 48h culture at 30°C with an initial of pH 7.5. This was the first report of strain Pseudomonas hibiscicola secreting alkaline protease, and the data for its optimal cultural conditions for alkaline protease production has laid a foundation for future exploration for the potential use of SD8 strain for alkaline protease production. PMID:26716833

  11. Characterization of a bacterial strain capable of degrading DDT congeners and its use in bioremediation of contaminated soil.

    PubMed

    Fang, Hua; Dong, Bin; Yan, Hu; Tang, Feifan; Yu, Yunlong

    2010-12-15

    A bacterial strain DDT-6 (D6) capable of utilizing dichlorodiphenyltrichloroethane (DDT), dichlorodiphenyldichloroethane (DDD), and dichlorodiphenyldichloroethylene (DDE) (DDTs) as its sole carbon and energy source was isolated and identified as Sphingobacterium sp. The degradation of DDTs by strain D6 in mineral salt medium and in field soil was investigated. The half-lives of the degradation of DDTs increased with increasing concentration ranging from 1 to 50 mg L(-1). Favorable degradation conditions for DDTs by strain D6 were found to be pH 7.0 and 30°C. The degradation of DDTs by strain D6 was found to be statistically significantly enhanced (p ≤ 0.05) by the addition of glucose. Based on the metabolites detected, a pathway was proposed for DDT degradation in which it undergoes dechlorination, hydrogenation, dioxygenation, decarboxylation, hydroxylation, and phenyl ring-cleavage reactions to complete the mineralization process. The addition of strain D6 into the contaminated soils was found to statistically significantly enhance (p ≤ 0.05) the degradation of DDTs. The results indicate that the isolate D6 can be used successfully for the removal or detoxification of residues of DDTs in contaminated soil. PMID:20828928

  12. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain

    PubMed Central

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Micklem, Chris N.; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S.; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-01-01

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae. Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology. PMID:27247386

  13. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain.

    PubMed

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Abbott, James; Micklem, Chris N; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-06-14

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology. PMID:27247386

  14. Biodegradation and detoxification of melanoidin from distillery effluent using an aerobic bacterial strain SAG5 of Alcaligenes faecalis.

    PubMed

    Santal, Anita Rani; Singh, N P; Saharan, Baljeet Singh

    2011-10-15

    Distillery effluent retains very dark brown color even after anaerobic treatment due to presence of various water soluble, recalcitrant and coloring compounds mainly melanoidins. In laboratory conditions, melanoidin decolorizing bacteria was isolated and optimized the cultural conditions at various incubation temperatures, pH, carbon sources, nitrogen sources and combined effect of both carbon and nitrogen sources. The optimum decolorization (72.6 ± 0.56%) of melanoidins was achieved at pH 7.5 and temperature 37 °C on 5th day of cultivation. The toxicity evaluation with mung bean (Vigna radiata) revealed that the raw distillery effluent was environmentally highly toxic as compared to biologically treated distillery effluent, which indicated that the effluent after bacterial treatment is environmentally safe. This proves to be novel biological treatment technique for biodegradation and detoxification of melanoidin from distillery effluent using the bacterial strain SAG(5). PMID:21880418

  15. Evaluation of antibacterial activity of crude protein extracts from seeds of six different medical plants against standard bacterial strains

    PubMed Central

    Al Akeel, Raid; Al-Sheikh, Yazeed; Mateen, Ayesha; Syed, Rabbani; Janardhan, K.; Gupta, V.C.

    2013-01-01

    A huge group of natural antimicrobial compounds are active against a large spectrum of bacterial strains causing infectious threat. The present study was conducted to investigate the crude extracts of antimicrobial protein and peptide efficacy from six medicinal plant seeds. Extraction was carried out in Sodium phosphate citrate buffer, and Sodium acetate buffer using different pH. Antimicrobial activities of these plants were determined by the microbiological technique using Agar well diffusion Assay. Extremely strong activity was observed in the seed extracts of Allium ascolinicum extracted in sodium phosphate citrate buffer at pH (5.8) against Proteus vulgaris, Escherichia coli and Staphylococcus aureus with zone of inhibition 17 mm, 17 mm and 15 mm and Rumex vesicarius at pH (7.6), Ammi majus at pH (6.8), Cichorium intybus at pH (7.4) and Cucumis sativus at pH (7.8) also showed better sensitivity against the bacterial strains with zone of inhibition ranges 16–10 mm and some of the strains were found to be resistant. Antibacterial activity pattern of different plant extracts prepared in sodium acetate buffer pH (6.5), among all the plant seed extracts used Foeniculum vulgare had shown good inhibition in all the bacterial strains used, with zone of inhibition ranges 11–12.5 mm, The extracts of C. intybus and C. sativus were found to be effective with zone of inhibition 11–6 mm and some of the strains were found to be resistant. Most of the strains found to have shown better sensitivity compared with the standard antibiotic Chloramphenicol (25 mcg). Our results showed that the plants used for our study are the richest source for antimicrobial proteins and peptides and they may be used for industrial extraction and isolation of antimicrobial compounds which may find a place in medicine industry as constituents of antibiotics. PMID:24600307

  16. Evaluation of antibacterial activity of crude protein extracts from seeds of six different medical plants against standard bacterial strains.

    PubMed

    Al Akeel, Raid; Al-Sheikh, Yazeed; Mateen, Ayesha; Syed, Rabbani; Janardhan, K; Gupta, V C

    2014-04-01

    A huge group of natural antimicrobial compounds are active against a large spectrum of bacterial strains causing infectious threat. The present study was conducted to investigate the crude extracts of antimicrobial protein and peptide efficacy from six medicinal plant seeds. Extraction was carried out in Sodium phosphate citrate buffer, and Sodium acetate buffer using different pH. Antimicrobial activities of these plants were determined by the microbiological technique using Agar well diffusion Assay. Extremely strong activity was observed in the seed extracts of Allium ascolinicum extracted in sodium phosphate citrate buffer at pH (5.8) against Proteus vulgaris, Escherichia coli and Staphylococcus aureus with zone of inhibition 17 mm, 17 mm and 15 mm and Rumex vesicarius at pH (7.6), Ammi majus at pH (6.8), Cichorium intybus at pH (7.4) and Cucumis sativus at pH (7.8) also showed better sensitivity against the bacterial strains with zone of inhibition ranges 16-10 mm and some of the strains were found to be resistant. Antibacterial activity pattern of different plant extracts prepared in sodium acetate buffer pH (6.5), among all the plant seed extracts used Foeniculum vulgare had shown good inhibition in all the bacterial strains used, with zone of inhibition ranges 11-12.5 mm, The extracts of C. intybus and C. sativus were found to be effective with zone of inhibition 11-6 mm and some of the strains were found to be resistant. Most of the strains found to have shown better sensitivity compared with the standard antibiotic Chloramphenicol (25 mcg). Our results showed that the plants used for our study are the richest source for antimicrobial proteins and peptides and they may be used for industrial extraction and isolation of antimicrobial compounds which may find a place in medicine industry as constituents of antibiotics. PMID:24600307

  17. Screening of lactic acid bacteria from Indonesia reveals glucansucrase and fructansucrase genes in two different Weissella confusa strains from soya.

    PubMed

    Malik, Amarila; Radji, Maksum; Kralj, Slavko; Dijkhuizen, Lubbert

    2009-11-01

    Homopolysaccharide (glucan and fructan) synthesis from sucrose by sucrase enzymes in lactic acid bacteria (LAB) has been well studied in the genera Leuconostoc, Streptococcus and Lactobacillus. This study aimed to identify and characterize genes encoding glucansucrase/glucosyltransferase (GTF) and fructansucrases/fructosyltransferase (FTF) enzymes from genomic DNA of 'rare' Indonesian exopolysaccharide-producing LAB. From a total of 63 exopolysaccharide-producing LAB isolates obtained from foods, beverages and environmental samples, 18 isolates showing the most slimy and mucoid colony morphologies on sucrose were chosen for further study. By comparing bacterial growth on De Man, Rogosa and Sharpe (MRS)-sucrose with that on MRS-raffinose, and using the results of a previous PCR screening study with degenerate primer pairs targeting the conserved catalytic domain of GTFs, various strains were identified as producers of fructan (13), of glucan only (five) or as potential producers of both glucan and fructan (nine). Here, we report the characteristics of three gtf genes and one ftf gene obtained from Weissella confusa strains MBF8-1 and MBF8-2. Strain MBF8-1 harbored two putative gtf genes with high sequence similarity to GTFB of Lactobacillus reuteri 121 and GTF180 of L. reuteri 180, respectively. Strain MBF8-2 possessed single gtf and ftf genes with high sequence similarity to GTFKg3 of Lactobacillus fermentum Kg3 and DSRWC of Weissella cibaria, and FTF levansucrase of L. reuteri 121, respectively. PMID:19758326

  18. Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar.

    PubMed

    Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng

    2016-05-01

    Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites. PMID:26754813

  19. Inhibitory activity of Salvadora persica extracts against oral bacterial strains associated with periodontitis: An in-vitro study

    PubMed Central

    Amir Alireza, Rasouli Ghahroudi; Afsaneh, Rezaei; Seied Hosein, Mohseni Salehifard; Siamak, Yaghoobee; Afshin, Khorsand; Zeinab, Kadkhoda; Mahvash, Moosavi Jazi; Amir Reza, Rokn

    2014-01-01

    Aims The use of natural plant extracts in pharmacology, medicine and dental hygiene has found a growing interest in modern scientific research. Salvadora persica is a natural tree whose fibrous branches have been approved by the World Health Organization for oral hygiene. Periodontitis is a highly prevalent adult gingival disease that leads to bone destruction and connective tissue attachment loss. The aim of this research was assessment the antimicrobial activities of methanolic extract of Salvadora persica (miswak) on isolated strains from the oral fluid. Methods In practical section, 50 female university students (21.4 ± 1 year) participated in the study. Based on examination by a periodontist, they were grouped into (Group I, n = 21) and (Group II, n = 29) i.e. with and without periodontitis respectively. Their un-stimulated saliva samples were obtained in sterile tubes. While three bacterial genera, Staphylococcus, Streptococcus and Lactobacillus were identified in all subjects, Enterococcus and Escherichia were only detected in Group I. Results A statistically significant difference in colonization levels between the two groups was observed. The effect of methanolic extract of S. persica against oral bacterial strains isolated from saliva was investigated using agar disc diffusion and microdilution methods. Although methanolic extract of S. persica was effective on growth inhibition of all strains, it was significantly more effective on Gram positive bacteria than Gram negative ones. Conclusions Effective substances present in S. persica extracts, exhibit a broad range of antibacterial activity and affect almost all bacterial species regardless of the Gram-staining nature. PMID:25737914

  20. Diverse Bacterial PKS Sequences Derived From Okadaic Acid-Producing Dinoflagellates

    PubMed Central

    Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S.

    2008-01-01

    Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum. PMID:18728765

  1. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    PubMed Central

    Lui, Clarissa; Cady, Nathaniel C.; Batt, Carl A.

    2009-01-01

    The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform. PMID:22412335

  2. Spray washing carcasses with alkaline solutions of lauric acid to reduce bacterial contamination.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The effect of spray washing carcasses with lauric acid (LA)-potassium hydroxide (KOH) on bacteria recovered from whole-carcass-rinsates (WCR) was examined. Skin of carcasses was inoculated with a cecal paste containing antibiotic resistant strains of Escherichia coli, Salmonella Typhimirum, and Camp...

  3. Isolation and characterization of rhamnolipid-producing bacterial strains from a biodiesel facility.

    PubMed

    Rooney, Alejandro P; Price, Neil P J; Ray, Karen J; Kuo, Tsung-Min

    2009-06-01

    Novel strains of rhamnolipid-producing bacteria were isolated from soils at a biodiesel facility on the basis of their ability to grow on glycerol as a sole carbon source. Strains were identified as Acinetobacter calcoaceticus, Enterobacter asburiae, Enterobacter hormaechei, Pantoea stewartii, and Pseudomonas aeruginosa. The strains of the former five species were found to produce rhamnolipids in quantities the same as, or similar to, coisolated strains of P. aeruginosa. Measurements of surface tension revealed that that emulsifying properties of these strains were similar to levels displayed by rhamnolipids produced by P. aeruginosa. Results of matrix-assisted laser desorption/ionization time-of-flight MS analyses revealed that the predominant compounds made by all strains were C10-C10 mono- and dirhamnolipids. Notably, E. hormaechei and one strain of A. calcoaceticus produced rhamnolipids in amounts similar to the pseudomonads. As all strains examined were from the same taxonomic class of Proteobacteria, further examination of this group may reveal many additional species not previously known to produce rhamnolipids in addition to novel strains of species currently known to produce rhamnolipids. PMID:19473254

  4. Screening of Non- Saccharomyces cerevisiae Strains for Tolerance to Formic Acid in Bioethanol Fermentation

    PubMed Central

    Oshoma, Cyprian E.; Greetham, Darren; Louis, Edward J.; Smart, Katherine A.; Phister, Trevor G.; Powell, Chris; Du, Chenyu

    2015-01-01

    Formic acid is one of the major inhibitory compounds present in hydrolysates derived from lignocellulosic materials, the presence of which can significantly hamper the efficiency of converting available sugars into bioethanol. This study investigated the potential for screening formic acid tolerance in non-Saccharomyces cerevisiae yeast strains, which could be used for the development of advanced generation bioethanol processes. Spot plate and phenotypic microarray methods were used to screen the formic acid tolerance of 7 non-Saccharomyces cerevisiae yeasts. S. kudriavzeii IFO1802 and S. arboricolus 2.3319 displayed a higher formic acid tolerance when compared to other strains in the study. Strain S. arboricolus 2.3319 was selected for further investigation due to its genetic variability among the Saccharomyces species as related to Saccharomyces cerevisiae and availability of two sibling strains: S. arboricolus 2.3317 and 2.3318 in the lab. The tolerance of S. arboricolus strains (2.3317, 2.3318 and 2.3319) to formic acid was further investigated by lab-scale fermentation analysis, and compared with S. cerevisiae NCYC2592. S. arboricolus 2.3319 demonstrated improved formic acid tolerance and a similar bioethanol synthesis capacity to S. cerevisiae NCYC2592, while S. arboricolus 2.3317 and 2.3318 exhibited an overall inferior performance. Metabolite analysis indicated that S. arboricolus strain 2.3319 accumulated comparatively high concentrations of glycerol and glycogen, which may have contributed to its ability to tolerate high levels of formic acid. PMID:26284784

  5. Screening of Non- Saccharomyces cerevisiae Strains for Tolerance to Formic Acid in Bioethanol Fermentation.

    PubMed

    Oshoma, Cyprian E; Greetham, Darren; Louis, Edward J; Smart, Katherine A; Phister, Trevor G; Powell, Chris; Du, Chenyu

    2015-01-01

    Formic acid is one of the major inhibitory compounds present in hydrolysates derived from lignocellulosic materials, the presence of which can significantly hamper the efficiency of converting available sugars into bioethanol. This study investigated the potential for screening formic acid tolerance in non-Saccharomyces cerevisiae yeast strains, which could be used for the development of advanced generation bioethanol processes. Spot plate and phenotypic microarray methods were used to screen the formic acid tolerance of 7 non-Saccharomyces cerevisiae yeasts. S. kudriavzeii IFO1802 and S. arboricolus 2.3319 displayed a higher formic acid tolerance when compared to other strains in the study. Strain S. arboricolus 2.3319 was selected for further investigation due to its genetic variability among the Saccharomyces species as related to Saccharomyces cerevisiae and availability of two sibling strains: S. arboricolus 2.3317 and 2.3318 in the lab. The tolerance of S. arboricolus strains (2.3317, 2.3318 and 2.3319) to formic acid was further investigated by lab-scale fermentation analysis, and compared with S. cerevisiae NCYC2592. S. arboricolus 2.3319 demonstrated improved formic acid tolerance and a similar bioethanol synthesis capacity to S. cerevisiae NCYC2592, while S. arboricolus 2.3317 and 2.3318 exhibited an overall inferior performance. Metabolite analysis indicated that S. arboricolus strain 2.3319 accumulated comparatively high concentrations of glycerol and glycogen, which may have contributed to its ability to tolerate high levels of formic acid. PMID:26284784

  6. Fragmented Lactic Acid Bacterial Cells Activate Peroxisome Proliferator-Activated Receptors and Ameliorate Dyslipidemia in Obese Mice.

    PubMed

    Nakamura, Futoshi; Ishida, Yu; Sawada, Daisuke; Ashida, Nobuhisa; Sugawara, Tomonori; Sakai, Manami; Goto, Tsuyoshi; Kawada, Teruo; Fujiwara, Shigeru

    2016-03-30

    Recent studies suggest that peroxisome proliferator-activated receptor (PPAR) activation ameliorates metabolic disorders, including dyslipidemia. To identify an effective PPAR agonist, we screened the in vitro PPARα/γ activation ability of organic solvent extracts from food-oriented bacterial strains belonging to 5 genera and 32 species, including lactic acid bacteria, and of these, Lactobacillus amylovorus CP1563 demonstrated the highest PPARα/γ agonist activity. We also found that physical fragmentation of the strain could substitute organic solvent extraction for the expression of CP1563 activity in vitro. For functional food manufacturing, we selected the fragmented CP1563 and conducted subsequent animal experiments. In an obese mouse model, we found that treatment with fragmented CP1563 for 12 weeks decreased the levels of low-density lipoprotein (LDL)-cholesterol and triglyceride in plasma, significantly decreased the atherosclerosis index, and increased the plasma high-density lipoprotein (HDL)-cholesterol level. Thus, we conclude that fragmented CP1563 may be a candidate for the prevention and treatment of dyslipidemia. PMID:26927959

  7. Mutations in y-aminobutyric acid (GABA) transaminase genes in plants or Pseudomonas syringae reduce bacterial virulence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pseudomonas syringae pv. tomato DC3000 is a bacterial pathogen of Arabidopsis and tomato that grows in the apoplast. The non-protein amino acid '-amino butyric acid (GABA) is produced by Arabidopsis and tomato and is the most abundant amino acid in the apoplastic fluid of tomato. The DC3000 genome h...

  8. Gene-related strain variation of Staphylococcus aureus for homologous resistance response to acid stress.

    PubMed

    Lee, Soomin; Ahn, Sooyeon; Lee, Heeyoung; Kim, Won-Il; Kim, Hwang-Yong; Ryu, Jae-Gee; Kim, Se-Ri; Choi, Kyoung-Hee; Yoon, Yohan

    2014-10-01

    This study investigated the effect of adaptation of Staphylococcus aureus strains to the acidic condition of tomato in response to environmental stresses, such as heat and acid. S. aureus ATCC 13565, ATCC 14458, ATCC 23235, ATCC 27664, and NCCP10826 habituated in tomato extract at 35°C for 24 h were inoculated in tryptic soy broth. The culture suspensions were then subjected to heat challenge or acid challenge at 60°C and pH 3.0, respectively, for 60 min. In addition, transcriptional analysis using quantitative real-time PCR was performed to evaluate the expression level of acid-shock genes, such as clpB, zwf, nuoF, and gnd, from five S. aureus strains after the acid habituation of strains in tomato at 35°C for 15 min and 60 min in comparison with that of the nonhabituated strains. In comparison with the nonhabituated strains, the five tomato-habituated S. aureus strains did not show cross protection to heat, but tomato-habituated S. aureus ATCC 23235 showed acid resistance. In quantitative real-time-PCR analysis, the relative expression levels of acid-shock genes (clpB, zwf, nuoF, and gnd) were increased the most in S. aureus ATCC 23235 after 60 min of tomato habituation, but there was little difference in the expression levels among the five S. aureus strains after 15 min of tomato habituation. These results indicate that the variation of acid resistance of S. aureus is related to the expression of acid-shock genes during acid habituation. PMID:25285500

  9. Protein, cell and bacterial response to atmospheric pressure plasma grafted hyaluronic acid on poly(methylmethacrylate).

    PubMed

    D'Sa, Raechelle A; Raj, Jog; Dickinson, Peter J; McMahon, M Ann S; McDowell, David A; Meenan, Brian J

    2015-11-01

    Hyaluronic acid (HA) has been immobilised on poly(methyl methacrylate) (PMMA) surfaces using a novel dielectric barrier discharge (DBD) plasma process for the purposes of repelling protein, cellular and bacterial adhesion in the context of improving the performance of ophthalmic devices. Grafting was achieved by the following steps: (1) treatment of the PMMA with a DBD plasma operating at atmospheric pressure, (2) amine functionalisation of the activated polymer surface by exposure to a 3-aminopropyltrimethoxysilane (APTMS) linker molecule and (3) reaction of HA with the surface bound amine. The mechanism and effectiveness of the grafting process was verified by surface analysis. XPS data indicates that the APTMS linker molecule binds to PMMA via the Si-O chemistry and has the required pendant amine moiety. The carboxylic acid moiety on HA then binds with this -NH2 group via standard carbodiimide chemistry. ToF-SIMS confirms the presence of a coherent HA layer the microstructure of which is verified by AFM. The plasma grafted HA coating surfaces showed a pronounced decrease in protein and cellular adhesion when tested with bovine serum albumin and human corneal epithelial cells, respectively. The ability of these coatings to resist bacterial adhesion was established using Staphylococcus aureus NTC8325. Interestingly, the coatings did not repel bacterial adhesion, indicating that the mechanism of adhesion of bacterial cells is different to that for the surface interactions of mammalian cells. It is proposed that this difference is a consequence of the specific HA conformation that occurs under the conditions employed here. Hence, it is apparent that the microstructure/architecture of the HA coatings is an important factor in fabricating surfaces intended to repel proteins, mammalian and bacterial cells. PMID:26449450

  10. Voice Prosthetic Biofilm Formation and Candida Morphogenic Conversions in Absence and Presence of Different Bacterial Strains and Species on Silicone-Rubber

    PubMed Central

    van der Mei, Henny C.; Buijssen, Kevin J. D. A.; van der Laan, Bernard F. A. M.; Ovchinnikova, Ekatarina; Geertsema-Doornbusch, Gésinda I.; Atema-Smit, Jelly; van de Belt-Gritter, Betsy; Busscher, Henk J.

    2014-01-01

    Morphogenic conversion of Candida from a yeast to hyphal morphology plays a pivotal role in the pathogenicity of Candida species. Both Candida albicans and Candida tropicalis, in combination with a variety of different bacterial strains and species, appear in biofilms on silicone-rubber voice prostheses used in laryngectomized patients. Here we study biofilm formation on silicone-rubber by C. albicans or C. tropicalis in combination with different commensal bacterial strains and lactobacillus strains. In addition, hyphal formation in C. albicans and C. tropicalis, as stimulated by Rothia dentocariosa and lactobacilli was evaluated, as clinical studies outlined that these bacterial strains have opposite results on the clinical life-time of silicone-rubber voice prostheses. Biofilms were grown during eight days in a silicone-rubber tube, while passing the biofilms through episodes of nutritional feast and famine. Biofilms consisting of combinations of C. albicans and a bacterial strain comprised significantly less viable organisms than combinations comprising C. tropicalis. High percentages of Candida were found in biofilms grown in combination with lactobacilli. Interestingly, L. casei, with demonstrated favorable effects on the clinical life-time of voice prostheses, reduced the percentage hyphal formation in Candida biofilms as compared with Candida biofilms grown in absence of bacteria or grown in combination with R. dentocariosa, a bacterial strain whose presence is associated with short clinical life-times of voice prostheses. PMID:25111806

  11. [Cephalosporin-Acid Synthetase of Escherichia coli Strain VKPM B-10182: Genomic Context, Gene Identification, Producer Strain Production].

    PubMed

    Eldarov M, A; Sklyarenko, A V; Mardanov, A V; Beletsky, A V; Zhgun, A A; Dumina, M V; Medvedeva, N V; Satarova, D E; Ravin, N V; Yarockii, S V

    2015-01-01

    An enzyme of cephalosporin-acid synthetase produced by the E. coli strain VKPM B-10182 has specificity for the synthesis of β-lactam antibiotics of the cephalosporin acids class (cefazolin, cefalotin, cefezole etc.). A comparison of the previously determined genomic sequence of E. coli VKPM B-10182 with a genome of the parent E. coli strain ATCC 9637 was performed. Multiple mutations indicating the long selection history of the strain were detected, including mutations in the genes of RNase and β-lactamases that could enhance the level of enzyme synthesis and reduce the degree of degradation of the synthesized cephalosporin acids. The CASA gene--a direct homolog of the penicillin G-acylase gene--was identified by bioinformatics methods. The homology of the gene was confirmed by gene cloning and the expression and determination of its enzymatic activity in the reaction of cefazolin synthesis. The CASA gene was isolated and cloned into the original expression vector, resulting in an effective E. coli BL2l(DE3) pMD0107 strain producing CASA. PMID:26596082

  12. Pseudomonas reactans, a bacterial strain isolated from the intestinal flora of Blattella germanica with anti-Beauveria bassiana activity.

    PubMed

    Zhang, Fan; Huang, Yan Hong; Liu, Shu Zhen; Zhang, Lei; Li, Bo Tai; Zhao, Xiao Xu; Fu, Ying; Liu, Jian Jun; Zhang, Xue Xia

    2013-06-01

    Anti-Beauveria bassiana activity of aqueous fecal extracts from conventional German cockroaches [Blattella germanica (L.)] was detected, but was not detected in samples from germ-free German cockroaches. Subsequently, bacterial strain BGI-14 was isolated from the gut of conventional German cockroaches and was identified as Pseudomonas reactans based on 16S rDNA sequence. The strain BGI-14 not only inhibited the germination of conidia, but also inhibited the growth of B. bassiana hyphae. Further studies demonstrated that B. bassiana infections in German cockroaches orally treated with the extracts of BGI-14 fermentation were significantly weakened. Compared with the control group, the cumulative mortality rate of treatment group was reduced by 10.3% at 20 d postinoculation. These studies imply that intestinal flora with anti-B. bassiana activity might contribute to resistance of infection by entomopathogenic fungi. PMID:23726054

  13. Effect of different concentrations of acetic, citric, and propionic acid dipping solutions on bacterial contamination of raw chicken skin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial contamination of raw, processed poultry may include spoilage bacteria and foodborne pathogens. We evaluated different combinations of organic acid (OA) wash solutions for their ability to reduce bacterial contamination of raw chicken skin and to inhibit growth of spoilage bacteria and path...

  14. Isolating and evaluating lactic acid bacteria strains for effectiveness of Leymus chinensis silage fermentation.

    PubMed

    Zhang, Q; Li, X J; Zhao, M M; Yu, Z

    2014-10-01

    Five LAB strains were evaluated using the acid production ability test, morphological observation, Gram staining, physiological, biochemical and acid tolerance tests. All five strains (LP1, LP2, LP3, LC1 and LC2) grew at pH 4·0, and LP1 grew at 15°C. Strains LP1, LP2 and LP3 were identified as Lactobacillus plantarum, whereas LC1 and LC2 were classified as Lactobacillus casei by sequencing 16S rDNA. The five isolated strains and two commercial inoculants (PS and CL) were added to native grass and Leymus chinensis (Trin.) Tzvel. for ensiling. All five isolated strains decreased the pH and ammonia nitrogen content, increased the lactic acid content and LP1, LP2 and LP3 increased the acetic content and lactic/acetic acid ratio of L. chinensis silage significantly. The five isolated strains and two commercial inoculants decreased the butyric acid content of the native grass silage. LP2 treatment had lower butyric acid content and ammonia nitrogen content than the other treatments. The five isolated strains improved the quality of L. chinensis silage. The five isolated strains and the two commercial inoculants were not effective in improving the fermentation quality of the native grass silage, but LP2 performed better comparatively. Significance and impact of the study: Leymus chinensis is an important grass in China and Russia, being the primary grass of the short grassland 'steppe' regions of central Asia. However, it has been difficult to make high-quality silage of this species because of low concentration of water-soluble carbohydrates (WSC). Isolating and evaluating lactic acid bacteria strains will be helpful for improving the silage quality of this extensively grown species. PMID:24888497

  15. Isolation and Characterization of Rhamnolipid-Producing Bacterial Strains from a Biodiesel Facility

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel strains of rhamnolipid-producing bacteria were isolated from soils at a biodiesel facility on the basis of their ability to grow on glycerol as a sole carbon source. Strains were identified as Acinetobacter calcoaceticus, Enterobacter asburiae, E. hormaecheii, Pantoea stewartii and Pseudomona...

  16. Use of Response Surface Methodology to Optimize Culture Conditions for Hydrogen Production by an Anaerobic Bacterial Strain from Soluble Starch

    NASA Astrophysics Data System (ADS)

    Kieu, Hoa Thi Quynh; Nguyen, Yen Thi; Dang, Yen Thi; Nguyen, Binh Thanh

    2016-05-01

    Biohydrogen is a clean source of energy that produces no harmful byproducts during combustion, being a potential sustainable energy carrier for the future. Therefore, biohydrogen produced by anaerobic bacteria via dark fermentation has attracted attention worldwide as a renewable energy source. However, the hydrogen production capability of these bacteria depends on major factors such as substrate, iron-containing hydrogenase, reduction agent, pH, and temperature. In this study, the response surface methodology (RSM) with central composite design (CCD) was employed to improve the hydrogen production by an anaerobic bacterial strain isolated from animal waste in Phu Linh, Soc Son, Vietnam (PL strain). The hydrogen production process was investigated as a function of three critical factors: soluble starch concentration (8 g L-1 to 12 g L-1), ferrous iron concentration (100 mg L-1 to 200 mg L-1), and l-cysteine concentration (300 mg L-1 to 500 mg L-1). RSM analysis showed that all three factors significantly influenced hydrogen production. Among them, the ferrous iron concentration presented the greatest influence. The optimum hydrogen concentration of 1030 mL L-1 medium was obtained with 10 g L-1 soluble starch, 150 mg L-1 ferrous iron, and 400 mg L-1 l-cysteine after 48 h of anaerobic fermentation. The hydrogen concentration produced by the PL strain was doubled after using RSM. The obtained results indicate that RSM with CCD can be used as a technique to optimize culture conditions for enhancement of hydrogen production by the selected anaerobic bacterial strain. Hydrogen production from low-cost organic substrates such as soluble starch using anaerobic fermentation methods may be one of the most promising approaches.

  17. Butyric acid from anaerobic fermentation of lignocellulosic biomass hydrolysates by Clostridium tyrobutyricum strain RPT-4213

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A newly isolated Clostridium sp. strain RPT-4213 was found to produce butyrate under anaerobic conditions. Fermentations using Lactobacilli MRS Broth produced 9.47 g L-1 butyric acid from glucose (0.48 g/g glucose). However, the strain was not capable of utilizing five carbon sugars. To assess the a...

  18. Natural history of the infant gut microbiome and impact of antibiotic treatment on bacterial strain diversity and stability.

    PubMed

    Yassour, Moran; Vatanen, Tommi; Siljander, Heli; Hämäläinen, Anu-Maaria; Härkönen, Taina; Ryhänen, Samppa J; Franzosa, Eric A; Vlamakis, Hera; Huttenhower, Curtis; Gevers, Dirk; Lander, Eric S; Knip, Mikael; Xavier, Ramnik J

    2016-06-15

    The gut microbial community is dynamic during the first 3 years of life, before stabilizing to an adult-like state. However, little is known about the impact of environmental factors on the developing human gut microbiome. We report a longitudinal study of the gut microbiome based on DNA sequence analysis of monthly stool samples and clinical information from 39 children, about half of whom received multiple courses of antibiotics during the first 3 years of life. Whereas the gut microbiome of most children born by vaginal delivery was dominated by Bacteroides species, the four children born by cesarean section and about 20% of vaginally born children lacked Bacteroides in the first 6 to 18 months of life. Longitudinal sampling, coupled with whole-genome shotgun sequencing, allowed detection of strain-level variation as well as the abundance of antibiotic resistance genes. The microbiota of antibiotic-treated children was less diverse in terms of both bacterial species and strains, with some species often dominated by single strains. In addition, we observed short-term composition changes between consecutive samples from children treated with antibiotics. Antibiotic resistance genes carried on microbial chromosomes showed a peak in abundance after antibiotic treatment followed by a sharp decline, whereas some genes carried on mobile elements persisted longer after antibiotic therapy ended. Our results highlight the value of high-density longitudinal sampling studies with high-resolution strain profiling for studying the establishment and response to perturbation of the infant gut microbiome. PMID:27306663

  19. Strain Dependent Genetic Networks for Antibiotic-Sensitivity in a Bacterial Pathogen with a Large Pan-Genome.

    PubMed

    van Opijnen, Tim; Dedrick, Sandra; Bento, José

    2016-09-01

    The interaction between an antibiotic and bacterium is not merely restricted to the drug and its direct target, rather antibiotic induced stress seems to resonate through the bacterium, creating selective pressures that drive the emergence of adaptive mutations not only in the direct target, but in genes involved in many different fundamental processes as well. Surprisingly, it has been shown that adaptive mutations do not necessarily have the same effect in all species, indicating that the genetic background influences how phenotypes are manifested. However, to what extent the genetic background affects the manner in which a bacterium experiences antibiotic stress, and how this stress is processed is unclear. Here we employ the genome-wide tool Tn-Seq to construct daptomycin-sensitivity profiles for two strains of the bacterial pathogen Streptococcus pneumoniae. Remarkably, over half of the genes that are important for dealing with antibiotic-induced stress in one strain are dispensable in another. By confirming over 100 genotype-phenotype relationships, probing potassium-loss, employing genetic interaction mapping as well as temporal gene-expression experiments we reveal genome-wide conditionally important/essential genes, we discover roles for genes with unknown function, and uncover parts of the antibiotic's mode-of-action. Moreover, by mapping the underlying genomic network for two query genes we encounter little conservation in network connectivity between strains as well as profound differences in regulatory relationships. Our approach uniquely enables genome-wide fitness comparisons across strains, facilitating the discovery that antibiotic responses are complex events that can vary widely between strains, which suggests that in some cases the emergence of resistance could be strain specific and at least for species with a large pan-genome less predictable. PMID:27607357

  20. Synthesis of a novel acrylated abietic acid-g-bacterial cellulose hydrogel by gamma irradiation.

    PubMed

    Abeer, Muhammad Mustafa; Amin, Mohd Cairul Iqbal Mohd; Lazim, Azwan Mat; Pandey, Manisha; Martin, Claire

    2014-09-22

    Acrylated abietic acid (acrylated AbA) and acrylated abietic acid-grafted bacterial cellulose pH sensitive hydrogel (acrylated AbA-g-BC) were prepared by a one-pot synthesis. The successful dimerization of acrylic acid (AA) and abietic acid (AbA) and grafting of the dimer onto bacterial cellulose (BC) was confirmed by 13C solid state NMR as well as FT-IR. X-ray diffraction analysis showed characteristic peaks for AbA and BC; further, there was no effect of increasing amorphous AA content on the overall crystallinity of the hydrogel. Differential scanning calorimetry revealed a glass transition temperature of 80°C. Gel fraction and swelling studies gave insight into the features of the hydrogel, suggesting that it was suitable for future applications such as drug delivery. Scanning electron microscopy observations showed an interesting interpenetrating network within the walls of hydrogel samples with the lowest levels of AA and gamma radiation doses. Cell viability test revealed that the synthesized hydrogel is safe for future use in biomedical applications. PMID:24906785

  1. Microbial production of amino acids and derived chemicals: synthetic biology approaches to strain development.

    PubMed

    Wendisch, Volker F

    2014-12-01

    Amino acids are produced at the multi-million-ton-scale with fermentative production of l-glutamate and l-lysine alone being estimated to amount to more than five million tons in the year 2013. Metabolic engineering constantly improves productivities of amino acid producing strains, mainly Corynebacterium glutamicum and Escherichia coli strains. Classical mutagenesis and screening have been accelerated by combination with intracellular metabolite sensing. Synthetic biology approaches have allowed access to new carbon sources to realize a flexible feedstock concept. Moreover, new pathways for amino acid production as well as fermentative production of non-native compounds derived from amino acids or their metabolic precursors were developed. These include dipeptides, α,ω-diamines, α,ω-diacids, keto acids, acetylated amino acids and ω-amino acids. PMID:24922334

  2. Production of putrescine-capped stable silver nanoparticle: its characterization and antibacterial activity against multidrug-resistant bacterial strains

    NASA Astrophysics Data System (ADS)

    Saha, Saswati; Gupta, Bhaskar; Gupta, Kamala; Chaudhuri, Mahua Ghosh

    2016-04-01

    Integration of biology with nanotechnology is now becoming attention-grabbing area of research. The antimicrobial potency of silver has been eminent from antiquity. Due to the recent desire for the enhancement of antibacterial efficacy of silver, various synthesis methods of silver in their nano dimensions are being practiced using a range of capping material. The present work highlights a facile biomimetic approach for production of silver nanoparticle being capped and stabilized by putrescine, possessing a diameter of 10-25 ± 1.5 nm. The synthesized nanoparticles have been analyzed spectrally and analytically. Morphological studies are carried out by high-resolution transmission electron microscopy and crystallinity by selected area electron diffraction patterns. Moreover, the elemental composition of the capped nanoparticles was confirmed by energy-dispersive X-ray spectroscopy analysis. A comparative study (zone of inhibition and minimum inhibitory concentration) regarding the interactions and antibacterial potentiality of the capped silver nanoparticles with respect to the bare ones reveal the efficiency of the capped one over the bare one. The bacterial kinetic study was executed to monitor the interference of nanoparticles with bacterial growth rate. The results also highlight the efficacy of putrescine-capped silver nanoparticles as effective growth inhibitors against multi-drug resistant human pathogenic bacterial strains, which may, thus, potentially be applicable as an effective antibacterial control system to fight diseases.

  3. Removal of two waterborne pathogenic bacterial strains by activated carbon particles prior to and after charge modification.

    PubMed

    Busscher, Henk J; Dijkstra, Rene J B; Engels, Eefje; Langworthy, Don E; Collias, Dimitris I; Bjorkquist, David W; Mitchell, Michael D; Van der Mei, Henny C

    2006-11-01

    Waterborne diseases constitute a threat to public health despite costly treatment measures aimed at removing pathogenic microorganisms from potable water supplies. This paper compared the removal of Raoultella terrigena ATCC 33257 and Escherichia coli ATCC 25922 by negatively and positively charged types of activated carbon particles. Both strains display bimodal negative zeta-potential distributions in stabilized water. Carbon particles were suspended to an equivalent external geometric surface area of 700 cm2 in 250 mL of a bacterial suspension, with shaking. Samples were taken after different durations for plate counting. Initial removal rates were less elevated for the positively charged carbon particle than expected, yielding the conclusion that bacterial adhesion under shaking is mass-transport limited. After 360 min, however, the log-reduction of the more negatively charged R. terrigena in suspension was largest for the positively charged carbon particles as compared with the negatively charged ones, although conditioning in ultrapure or tap water of positively charged carbon particles for 21 days eliminated the favorable effect of the positive charge due to counterion adsorption from the water. Removal of the less negatively charged E. coli was less affected by aging of the (positively charged) carbon particles, confirming the role of electrostatic interactions in bacterial removal by activated carbon particles. The microporous, negatively charged coconut carbon performed less than the mesoporous, positively charged carbon particle prior to conditioning but did not suffer from loss of effect after conditioning in ultrapure or tap water. PMID:17144313

  4. Effect of acid adaptation on the environmental stress tolerance of three strains of Vibrio parahaemolyticus.

    PubMed

    Chiang, Ming-Lun; Chen, Hsi-Chia; Wu, Chieh; Chen, Ming-Ju

    2014-04-01

    Three strains of Vibrio parahaemolyticus (690, BCRC 13023, and BCRC 13025), involved in foodborne outbreaks in Taiwan, were subjected to acid adaptation at pH 5.5 for 90 min. The effects of acid adaptation on the tolerance of V. parahaemolyticus to various environmental stresses, including heat (47°C), cold (4°C and -20°C), ethanol (8%), high salt (20% NaCl), and hydrogen peroxide (20 ppm) were examined. Results showed that acid adaptation increased the thermal tolerance of the three test strains of V. parahaemolyticus, while it did not affect their cold tolerance. Acid adaptation also increased the ethanol tolerance in V. parahaemolyticus 690 and BCRC 13025, but not in BCRC 13023. Differences in the tolerance to high salts were noted among the three strains after prior acid adaptation. However, these acid-adapted V. parahaemolyticus strains were more susceptible to hydrogen peroxide than their nonadapted controls. These findings demonstrated that acid adaption responses of V. parahaemolyticus varied among strains and types of stress challenge. PMID:24410096

  5. Growth and survival of various strains of enterohemorrhagic Escherichia coli in hydrochloric and acetic acid.

    PubMed

    McKellar, R C; Knight, K P

    1999-12-01

    Nineteen strains of enterohemorrhagic Escherichia coli isolated from humans and foods were examined for their ability to grow and survive at low pH in organic (acetic) and mineral (HCl) acids. Strains were subcultured in tryptic soy broth adjusted to various pH values (3.75 to 4.75 for HCl and 4.75 to 5.75 for acetic acid) and incubated for 72 h at 37 degrees C to determine the minimum growth pH value. Minimum pH values for growth of 4.25 and 5.5 were found for HCl and acetic acid, respectively. Strains were also exposed to pH 2.0 (HCl) and pH 4.0 (acetic acid) for up to 24 h at 37 degrees C to assess their ability to survive. HCl was a more effective inhibitor after 6 h of exposure, whereas acetic acid was more effective after 24 h. Outbreak strains survived acid treatment significantly (P < or = 0.05) better than strains isolated from fermented or high-pH foods or animal or human isolates. Significant (P < or = 0.05) differences among serotypes and between O157:H7 and other serotypes were apparent after 3 or 6 h of exposure to acids. PMID:10606153

  6. EFFECTS OF BACTERIAL LIGNIN PEROXIDASE ON ORGANIC CARBON MINERALIZATION IN SOIL, USING RECOMBINANT STREPTOMYCES STRAINS

    EPA Science Inventory

    Purified lignin peroxidase was added to sterile and nonsterile silt loam soil to study the effects of bacterial lignin peroxidase ALip-P3 of Streptomyces viridosporus T7A on the rate of organic carbon turnover in soil. ignin peroxidase ALip-P3 appears to affect the short-term tur...

  7. Molecular characterization of Xanthomonas strains responsible for bacterial leaf spot of tomato in Ethiopia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial spot of tomato (BST) is a major constraint to tomato production in Ethiopia and many other countries leading to significant crop losses. In the present study, using pathogenicity tests, sensitivity to copper and streptomycin, and multilocus sequence analysis, a diverse group of Xanthomonas...

  8. Inoculation methods using Rhodococcus erythropolis strain P30 affects bacterial assisted phytoextraction capacity of Nicotiana tabacum.

    PubMed

    Álvarez-López, V; Prieto-Fernández, A; Janssen, J; Herzig, R; Vangronsveld, J; Kidd, P S

    2016-01-01

    In this study different bacterial inoculation methods were tested for tobacco plants growing in a mine-soil contaminated with Pb, Zn, and Cd. The inoculation methods evaluated were: seed inoculation, soil inoculation, dual soil inoculation event, and seed+soil inoculation. Each inoculum was added at two bacterial densities (10(6) CFUs mL(-1) and 10(8) CFUs mL(-1)). The objectives were to evaluate whether or not the mode of inoculation or the number of applied microorganisms influences plant response. The most pronounced bacterial-induced effect was found for biomass production, and the soil inoculation treatment (using 10(6) CFUs mL(-1)) led to the highest increase in shoot dry weight yield (up to 45%). Bacterial-induced effects on shoot metal concentrations were less pronounced; although a positive effect was found on shoot Pb concentration when using 10(8) CFUs mL(-1) in the soil inoculation (29% increase) and in the seed+soil inoculation (34% increase). Also shoot Zn concentration increased by 24% after seed inoculation with 10(6) CFUs mL(-1). The best effects on the total metal yield were not correlated with an increasing number of inoculated bacteria. In fact the best results were found after a single soil inoculation using the lower cellular density of 10(6) CFUs mL(-1). PMID:26552496

  9. Genome Sequence of Acidovorax citrulli Group 1 Strain pslb65 Causing Bacterial Fruit Blotch of Melons

    PubMed Central

    Wang, Tielin; Sun, Baixin; Yang, Yuwen

    2015-01-01

    Acidovorax citrulli is typed into two groups, mainly based on the host. We determined the draft genome of A. citrulli group 1 strain pslb65. The strain was isolated from melon collected from Xinjiang province, China. The A. citrulli pslb65 genome contains 4,903,443 bp and has a G+C content of 68.8 mol%. PMID:25908136

  10. Comparative Genomics between Two Xenorhabdus bovienii Strains Highlights Differential Evolutionary Scenarios within an Entomopathogenic Bacterial Species

    PubMed Central

    Bisch, Gaëlle; Ogier, Jean-Claude; Médigue, Claudine; Rouy, Zoé; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2016-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Within Xenorhabdus bovienii species, the X. bovienii CS03 strain (Xb CS03) is nonvirulent when directly injected into lepidopteran insects, and displays a low virulence when associated with its Steinernema symbiont. The genome of Xb CS03 was sequenced and compared with the genome of a virulent strain, X. bovienii SS-2004 (Xb SS-2004). The genome size and content widely differed between the two strains. Indeed, Xb CS03 had a large genome containing several specific loci involved in the inhibition of competitors, including a few NRPS-PKS loci (nonribosomal peptide synthetases and polyketide synthases) producing antimicrobial molecules. Consistently, Xb CS03 had a greater antimicrobial activity than Xb SS-2004. The Xb CS03 strain contained more pseudogenes than Xb SS-2004. Decay of genes involved in the host invasion and exploitation (toxins, invasins, or extracellular enzymes) was particularly important in Xb CS03. This may provide an explanation for the nonvirulence of the strain when injected into an insect host. We suggest that Xb CS03 and Xb SS-2004 followed divergent evolutionary scenarios to cope with their peculiar life cycle. The fitness strategy of Xb CS03 would involve competitor inhibition, whereas Xb SS-2004 would quickly and efficiently kill the insect host. Hence, Xenorhabdus strains would have widely divergent host exploitation strategies, which impact their genome structure. PMID:26769959

  11. Comparative Genomics between Two Xenorhabdus bovienii Strains Highlights Differential Evolutionary Scenarios within an Entomopathogenic Bacterial Species.

    PubMed

    Bisch, Gaëlle; Ogier, Jean-Claude; Médigue, Claudine; Rouy, Zoé; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2016-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Within Xenorhabdus bovienii species, the X. bovienii CS03 strain (Xb CS03) is nonvirulent when directly injected into lepidopteran insects, and displays a low virulence when associated with its Steinernema symbiont. The genome of Xb CS03 was sequenced and compared with the genome of a virulent strain, X. bovienii SS-2004 (Xb SS-2004). The genome size and content widely differed between the two strains. Indeed, Xb CS03 had a large genome containing several specific loci involved in the inhibition of competitors, including a few NRPS-PKS loci (nonribosomal peptide synthetases and polyketide synthases) producing antimicrobial molecules. Consistently, Xb CS03 had a greater antimicrobial activity than Xb SS-2004. The Xb CS03 strain contained more pseudogenes than Xb SS-2004. Decay of genes involved in the host invasion and exploitation (toxins, invasins, or extracellular enzymes) was particularly important in Xb CS03. This may provide an explanation for the nonvirulence of the strain when injected into an insect host. We suggest that Xb CS03 and Xb SS-2004 followed divergent evolutionary scenarios to cope with their peculiar life cycle. The fitness strategy of Xb CS03 would involve competitor inhibition, whereas Xb SS-2004 would quickly and efficiently kill the insect host. Hence, Xenorhabdus strains would have widely divergent host exploitation strategies, which impact their genome structure. PMID:26769959

  12. Listeria monocytogenes varies among strains to maintain intracellular pH homeostasis under stresses by different acids as analyzed by a high-throughput microplate-based fluorometry

    PubMed Central

    Cheng, Changyong; Yang, Yongchun; Dong, Zhimei; Wang, Xiaowen; Fang, Chun; Yang, Menghua; Sun, Jing; Xiao, Liya; Fang, Weihuan; Song, Houhui

    2015-01-01

    Listeria monocytogenes, a food-borne pathogen, has the capacity to maintain intracellular pH (pHi) homeostasis in acidic environments, but the underlying mechanisms remain elusive. Here, we report a simple microplate-based fluorescent method to determine pHi of listerial cells that were prelabeled with the fluorescent dye carboxyfluorescein diacetate N-succinimidyl ester and subjected to acid stress. We found that L. monocytogenes responds differently among strains toward organic and inorganic acids to maintain pHi homeostasis. The capacity of L. monocytogenes to maintain pHi at extracellular pH 4.5 (pHex) was compromised in the presence of acetic acid and lactic acid, but not by hydrochloric acid and citric acid. Organic acids exhibited more inhibitory effects than hydrochloric acid at certain pH conditions. Furthermore, the virulent stains L. monocytogenes EGDe, 850658 and 10403S was more resistant to acidic stress than the avirulent M7 which showed a defect in maintaining pHi homeostasis. Deletion of sigB, a stress-responsive alternative sigma factor from 10403S, markedly altered intracellular pHi homeostasis, and showed a significant growth and survival defect under acidic conditions. Thus, this work provides new insights into bacterial survival mechanism to acidic stresses. PMID:25667585

  13. Bioremediation of Cd and carbendazim co-contaminated soil by Cd-hyperaccumulator Sedum alfredii associated with carbendazim-degrading bacterial strains.

    PubMed

    Xiao, Wendan; Wang, Huan; Li, Tingqiang; Zhu, Zhiqiang; Zhang, Jie; He, Zhenli; Yang, Xiaoe

    2013-01-01

    The objective of this study was to develop a bioremediation strategy for cadmium (Cd) and carbendazim co-contaminated soil using a hyperaccumulator plant (Sedum alfredii) combined with carbendazim-degrading bacterial strains (Bacillus subtilis, Paracoccus sp., Flavobacterium and Pseudomonas sp.). A pot experiment was conducted under greenhouse conditions for 180 days with S. alfredii and/or carbendazim-degrading strains grown in soil artificially polluted with two levels of contaminants (low level, 1 mg kg(-1) Cd and 21 mg kg(-1) carbendazim; high level, 6 mg kg(-1) Cd and 117 mg kg(-1) carbendazim). Cd removal efficiencies were 32.3-35.1 % and 7.8-8.2 % for the low and high contaminant level, respectively. Inoculation with carbendazim-degrading bacterial strains significantly (P < 0.05) increased Cd removal efficiencies at the low level. The carbendazim removal efficiencies increased by 32.1-42.5 % by the association of S. alfredii with carbendazim-degrading bacterial strains, as compared to control, regardless of contaminant level. Cultivation with S. alfredii and inoculation of carbendazim-degrading bacterial strains increased soil microbial biomass, dehydrogenase activities and microbial diversities by 46.2-121.3 %, 64.2-143.4 %, and 2.4-24.7 %, respectively. Polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis revealed that S. alfredii stimulated the activities of Flavobacteria and Bradyrhizobiaceae. The association of S. alfredii with carbendazim-degrading bacterial strains enhanced the degradation of carbendazim by changing microbial activity and community structure in the soil. The results demonstrated that association of S. alfredii with carbendazim-degrading bacterial strains is promising for remediation of Cd and carbendazim co-contaminated soil. PMID:22529002

  14. Accuracy, reproducibility, and interpretation of fatty acid methyl ester profiles of model bacterial communities

    USGS Publications Warehouse

    Kidd, Haack S.; Garchow, H.; Odelson, D.A.; Forney, L.J.; Klug, M.J.

    1994-01-01

    We determined the accuracy and reproducibility of whole-community fatty acid methyl ester (FAME) analysis with two model bacterial communities differing in composition by using the Microbial ID, Inc. (MIDI), system. The biomass, taxonomic structure, and expected MIDI-FAME profiles under a variety of environmental conditions were known for these model communities a priori. Not all members of each community could be detected in the composite profile because of lack of fatty acid 'signatures' in some isolates or because of variations (approximately fivefold) in fatty acid yield across taxa. MIDI- FAME profiles of replicate subsamples of a given community were similar in terms of fatty acid yield per unit of community dry weight and relative proportions of specific fatty acids. Principal-components analysis (PCA) of MIDI-FAME profiles resulted in a clear separation of the two different communities and a clustering of replicates of each community from two separate experiments on the first PCA axis. The first PCA axis accounted for 57.1% of the variance in the data and was correlated with fatty acids that varied significantly between communities and reflected the underlying community taxonomic structure. On the basis of our data, community fatty acid profiles can be used to assess the relative similarities and differences of microbial communities that differ in taxonomic composition. However, detailed interpretation of community fatty acid profiles in terms of biomass or community taxonomic composition must be viewed with caution until our knowledge of the quantitative and qualitative distribution of fatty acids over a wide variety of taxa and the effects of growth conditions on fatty acid profiles is more extensive.

  15. Biotechnological production of caffeic acid by bacterial cytochrome P450 CYP199A2.

    PubMed

    Furuya, Toshiki; Arai, Yuka; Kino, Kuniki

    2012-09-01

    Caffeic acid is a biologically active molecule that has various beneficial properties, including antioxidant, anticancer, and anti-inflammatory activities. In this study, we explored the catalytic potential of a bacterial cytochrome P450, CYP199A2, for the biotechnological production of caffeic acid. When the CYP199A2 enzyme was reacted with p-coumaric acid, it stoichiometrically produced caffeic acid. The crystal structure of CYP199A2 shows that Phe at position 185 is situated directly above, and only 6.35 Å from, the heme iron. This F185 residue was replaced with hydrophobic or hydroxylated amino acids using site-directed mutagenesis to create mutants with novel and improved catalytic properties. In whole-cell assays with the known substrate of CYP199A2, 2-naphthoic acid, only the wild-type enzyme hydroxylated 2-naphthoic acid at the C-7 and C-8 positions, whereas all of the active F185 mutants exhibited a preference for C-5 hydroxylation. Interestingly, several F185 mutants (F185V, F185L, F185I, F185G, and F185A mutants) also acquired the ability to hydroxylate cinnamic acid, which was not hydroxylated by the wild-type enzyme. These results demonstrate that F185 is an important residue that controls the regioselectivity and the substrate specificity of CYP199A2. Furthermore, Escherichia coli cells expressing the F185L mutant exhibited 5.5 times higher hydroxylation activity for p-coumaric acid than those expressing the wild-type enzyme. By using the F185L whole-cell catalyst, the production of caffeic acid reached 15 mM (2.8 g/liter), which is the highest level so far attained in biotechnological production of this compound. PMID:22729547

  16. Different strains of Saccharomyces cerevisiae differ in their effects on ruminal bacterial numbers in vitro and in sheep.

    PubMed

    Newbold, C J; Wallace, R J; Chen, X B; McIntosh, F M

    1995-06-01

    A ruminal simulation device (Rusitec) was used to compare the effects of Saccharomyces cerevisiae strains NCYC 240, NCYC 694, NCYC 1026, NCYC 1088, and Yea-Sacc (a commercial product containing S. cerevisiae) on ruminal fermentation. S. cerevisiae NCYC 240, NCYC 1088, NCYC 1026, and NCYC 694 were grown on malt extract at 30 degrees C in aerated fed-batch culture and harvested along with spent growth medium by freeze-drying. Each vessel received daily 20 g of a basal diet consisting of hay, barley, molasses, fishmeal, and a minerals/vitamins mixture at 500, 299.5, 100, 91, and 9.5 g/kg of DM, respectively. Yeast preparations (500 mg/d) were added along with the feed. S. cerevisiae NCYC 240, NCYC 1026, and Yea-Sacc stimulated total and cellulolytic bacterial numbers, whereas S. cerevisiae NCYC 694 and NCYC 1088 had no effect on the numbers of bacteria. The effects of S. cerevisiae NCYC 240, NCYC 1026, and Yea-Sacc on ruminal fermentation were further investigated in vivo using ruminally cannulated sheep fed 1.5 kg/d of the diet used in Rusitec, supplemented with 2 g/d of yeast culture. All treatments tended to stimulate total and cellulolytic bacterial numbers. However, the stimulation was only statistically significant for S. cerevisiae NCYC 1026 with total bacterial numbers and S. cerevisiae NCYC 240 with cellulolytic bacteria (P < .05). Increased bacterial numbers were associated with an increase in the rate of straw degradation in the rumen and a nonsignificant (P > .05) increase in the excretion of purine derivatives in the urine, measured as an index of microbial nitrogen leaving the rumen.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7673076

  17. A novel immunity system for bacterial nucleic acid degrading toxins and its recruitment in various eukaryotic and DNA viral systems

    PubMed Central

    Zhang, Dapeng; Iyer, Lakshminarayan M.; Aravind, L.

    2011-01-01

    The use of nucleases as toxins for defense, offense or addiction of selfish elements is widely encountered across all life forms. Using sensitive sequence profile analysis methods, we characterize a novel superfamily (the SUKH superfamily) that unites a diverse group of proteins including Smi1/Knr4, PGs2, FBXO3, SKIP16, Syd, herpesviral US22, IRS1 and TRS1, and their bacterial homologs. Using contextual analysis we present evidence that the bacterial members of this superfamily are potential immunity proteins for a variety of toxin systems that also include the recently characterized contact-dependent inhibition (CDI) systems of proteobacteria. By analyzing the toxin proteins encoded in the neighborhood of the SUKH superfamily we predict that they possess domains belonging to diverse nuclease and nucleic acid deaminase families. These include at least eight distinct types of DNases belonging to HNH/EndoVII- and restriction endonuclease-fold, and RNases of the EndoU-like and colicin E3-like cytotoxic RNases-folds. The N-terminal domains of these toxins indicate that they are extruded by several distinct secretory mechanisms such as the two-partner system (shared with the CDI systems) in proteobacteria, ESAT-6/WXG-like ATP-dependent secretory systems in Gram-positive bacteria and the conventional Sec-dependent system in several bacterial lineages. The hedgehog-intein domain might also release a subset of toxic nuclease domains through auto-proteolytic action. Unlike classical colicin-like nuclease toxins, the overwhelming majority of toxin systems with the SUKH superfamily is chromosomally encoded and appears to have diversified through a recombination process combining different C-terminal nuclease domains to N-terminal secretion-related domains. Across the bacterial superkingdom these systems might participate in discriminating `self’ or kin from `non-self’ or non-kin strains. Using structural analysis we demonstrate that the SUKH domain possesses a versatile

  18. Effect of acidic electrolyzed water-induced bacterial inhibition and injury in live clam (Venerupis philippinarum) and mussel (Mytilus edulis).

    PubMed

    Al-Qadiri, Hamzah M; Al-Holy, Murad A; Shiroodi, Setareh Ghorban; Ovissipour, Mahmoudreza; Govindan, Byju N; Al-Alami, Nivin; Sablani, Shyam S; Rasco, Barbara

    2016-08-16

    The effect of acidic electrolyzed water (AEW) on inactivating Escherichia coli O104:H4, Listeria monocytogenes, Aeromonas hydrophila, Vibrio parahaemolyticus and Campylobacter jejuni in laboratory contaminated live clam (Venerupis philippinarum) and mussel (Mytilus edulis) was investigated. The initial levels of bacterial contamination were: in clam 4.9 to 5.7log10CFU/g, and in mussel 5.1 to 5.5log10CFU/g. Two types of AEW were used for treatment time intervals of 1 and 2h: strong (SAEW) with an available chlorine concentration (ACC) of 20mg/L, pH=3.1, and an oxidation-reduction potential (ORP) of 1150mV, and weak (WAEW) at ACC of 10mg/L, pH=3.55 and ORP of 950mV. SAEW and WAEW exhibited significant inhibitory activity against inoculated bacteria in both shellfish species with significant differences compared to saline solutions treatments (1-2% NaCl) and untreated controls (0h). SAEW showed the largest inhibitory activity, the extent of reduction (log10CFU/g) ranged from 1.4-1.7 for E. coli O104:H4; 1.0-1.6 for L. monocytogenes; 1.3-1.6 for A. hydrophila; 1.0-1.5 for V. parahaemolyticus; and 1.5-2.2 for C. jejuni in both types of shellfish. In comparison, significantly (P<0.05) lower inhibitory effect of WAEW was achieved compared to SAEW, where the extent of reduction (log10CFU/g) ranged from 0.7-1.1 for E. coli O104:H4; 0.6-0.9 for L. monocytogenes; 0.6-1.3 for A. hydrophila; 0.7-1.3 for V. parahaemolyticus; and 0.8-1.9 for C. jejuni in both types of shellfish. Among all bacterial strains examined in this study, AEW induced less bacterial injury (~0.1-1.0log10CFU/g) and more inactivation effect. This study revealed that AEW (10-20mg/L ACC) could be used to reduce bacterial contamination in live clam and mussel, which may help control possible unhygienic practices during production and processing of shellfish without apparent changes in the quality of the shellfish. PMID:27208583

  19. Quantitative analysis of the lactic acid and acetaldehyde produced by Streptococcus thermophilus and Lactobacillus bulgaricus strains isolated from traditional Turkish yogurts using HPLC.

    PubMed

    Gezginc, Y; Topcal, F; Comertpay, S; Akyol, I

    2015-03-01

    The present study was conducted to evaluate the lactic acid- and acetaldehyde-producing abilities of lactic acid bacterial species isolated from traditionally manufactured Turkish yogurts using HPLC. The lactic acid bacterial species purified from the yogurts were the 2 most widely used species in industrial yogurt production: Streptococcus thermophilus and Lactobacillus bulgaricus. These bacteria have the ability to ferment hexose sugars homofermentatively to generate lactic acid and some carbonyl compounds, such as acetaldehyde through pyruvate metabolism. The levels of the compounds produced during fermentation influence the texture and the flavor of the yogurt and are themselves influenced by the chemical composition of the milk, processing conditions, and the metabolic activity of the starter culture. In the study, morphological, biochemical, and molecular characteristics were employed to identify the bacteria obtained from homemade yogurts produced in different regions of Turkey. A collection of 91 Strep. thermophilus and 35 L. bulgaricus strains were investigated for their lactic acid- and acetaldehyde-formation capabilities in various media such as cow milk, LM17 agar, and aerobic-anaerobic SM17 agar or de Man, Rogosa, and Sharpe agar. The amounts of the metabolites generated by each strain in all conditions were quantified by HPLC. The levels were found to vary depending on the species, the strain, and the growth conditions used. Whereas lactic acid production ranged between 0 and 77.9 mg/kg for Strep. thermophilus strains, it ranged from 0 to 103.5 mg/kg for L. bulgaricus. Correspondingly, the ability to generate acetaldehyde ranged from 0 to 105.9 mg/kg in Strep. thermophilus and from 0 to 126.9 mg/kg in L. bulgaricus. Our study constitutes the first attempt to determine characteristics of the wild strains isolated from traditional Turkish yogurts, and the approach presented here, which reveals the differences in metabolite production abilities of the

  20. Butyric acid fermentation from pretreated and hydrolysed wheat straw by an adapted Clostridium tyrobutyricum strain

    PubMed Central

    Baroi, G N; Baumann, I; Westermann, P; Gavala, H N

    2015-01-01

    Butyric acid is a valuable building-block for the production of chemicals and materials and nowadays it is produced exclusively from petroleum. The aim of this study was to develop a suitable and robust strain of Clostridium tyrobutyricum that produces butyric acid at a high yield and selectivity from lignocellulosic biomasses. Pretreated (by wet explosion) and enzymatically hydrolysed wheat straw (PHWS), rich in C6 and C5 sugars (71.6 and 55.4 g l−1 of glucose and xylose respectively), was used as substrate. After one year of serial selections, an adapted strain of C. tyrobutyricum was developed. The adapted strain was able to grow in 80% (v v−1) PHWS without addition of yeast extract compared with an initial tolerance to less than 10% PHWS and was able to ferment both glucose and xylose. It is noticeable that the adapted C. tyrobutyricum strain was characterized by a high yield and selectivity to butyric acid. Specifically, the butyric acid yield at 60–80% PHWS lie between 0.37 and 0.46 g g−1 of sugar, while the selectivity for butyric acid was as high as 0.9–1.0 g g−1 of acid. Moreover, the strain exhibited a robust response in regards to growth and product profile at pH 6 and 7. PMID:26230610

  1. Translation quality control is critical for bacterial responses to amino acid stress

    PubMed Central

    Bullwinkle, Tammy J.; Ibba, Michael

    2016-01-01

    Gene expression relies on quality control for accurate transmission of genetic information. One mechanism that prevents amino acid misincorporation errors during translation is editing of misacylated tRNAs by aminoacyl-tRNA synthetases. In the absence of editing, growth is limited upon exposure to excess noncognate amino acid substrates and other stresses, but whether these physiological effects result solely from mistranslation remains unclear. To explore if translation quality control influences cellular processes other than protein synthesis, an Escherichia coli strain defective in Tyr-tRNAPhe editing was used. In the absence of editing, cellular levels of aminoacylated tRNAPhe were elevated during amino acid stress, whereas in the wild-type strain these levels declined under the same growth conditions. In the editing-defective strain, increased levels of aminoacylated tRNAPhe led to continued synthesis of the PheL leader peptide and attenuation of pheA transcription under amino acid stress. Consequently, in the absence of editing, activation of the phenylalanine biosynthetic operon becomes less responsive to phenylalanine limitation. In addition to raising aminoacylated tRNA levels, the absence of editing lowered the amount of deacylated tRNAPhe in the cell. This reduction in deacylated tRNA was accompanied by decreased synthesis of the second messenger guanosine tetraphosphate and limited induction of stringent response-dependent gene expression in editing-defective cells during amino acid stress. These data show that a single quality-control mechanism, the editing of misacylated aminoacyl-tRNAs, provides a critical checkpoint both for maintaining the accuracy of translation and for determining the sensitivity of transcriptional responses to amino acid stress. PMID:26858451

  2. Rice bacterial endophytes: isolation of a collection, identification of beneficial strains and microbiome analysis.

    PubMed

    Bertani, Iris; Abbruscato, Pamela; Piffanelli, Pietro; Subramoni, Sujatha; Venturi, Vittorio

    2016-06-01

    Endophytes are harmless or beneficial microorganisms that live inside plants between cells. The relationship they develop with the plant as well as their potential role in plant health is at large unexplored and it is believed that the opportunity to find new and interesting endophytes among the large variety of plants is great. Here, we present the isolation and analysis of a large collection of endophytes from one cultivar of rice grown in Italy. A total 1318 putative endophytes were isolated from roots, leaves and stems from rice grown in submerged and dry conditions and a working collection of 229 isolates was created. Among these, several isolates were confirmed to be endophytes and a few displayed the trait of plant growth promotion. A cultivation independent analysis via 16S rDNA amplicons of the bacterial community of the endosphere was also performed providing information on bacterial diversity in the rice endopshere. PMID:27038229

  3. Isolation of bacterial cellulose nanocrystalline from pineapple peel waste: Optimization of acid concentration in the hydrolysis method

    NASA Astrophysics Data System (ADS)

    Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik

    2016-02-01

    Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.

  4. Relation between bacterial strain resistance to solvents and biodesulfurization activity in organic medium.

    PubMed

    Bouchez-Naïtali, Murielle; Abbad-Andaloussi, Samir; Warzywoda, Michel; Monot, Frédéric

    2004-09-01

    Microorganisms used in biodesulfurization of petroleum products have to withstand high concentrations of hydrocarbons. The capacities of seven desulfurizing strains of Rhodococcus to be active in the presence of solvents were evaluated. Octanol and toluene (log P=2.9) were selected as toxic solvents. The effect of the solvents was determined by measuring either inhibition of growth or the decrease in respiratory activity of the cells. Differences among strains in their resistance to solvent responses were observed, but these variations were dependent on the test used. Resistance to solvents was then compared to the capacity of the different strains to retain biodesulfurization activity in the presence of hexadecane. Inhibition of desulfurization by high concentrations of hexadecane was found to be well correlated to the sensitivity of the strains to respiration inhibition by toluene, but not to growth inhibition. This result also showed that the respirometric test was a rapid and reliable test to select solvent-resistant strains for use as resting cells in biocatalysis processes, such as biodesulfurization, in organic media. PMID:15133641

  5. Culturable bacterial microbiota of Plagiodera versicolora (L.) (Coleoptera: Chrysomelidae) and virulence of the isolated strains.

    PubMed

    Demirci, Meryem; Sevim, Elif; Demir, İsmail; Sevim, Ali

    2013-05-01

    Plagiodera versicolora (Laicharting, 1781) (Coleoptera: Chrysomelidae) is an important forest pest which damages many trees such as willow, poplar, and hazelnut. In order to find new microbes that can be utilized as a possible microbial control agent against this pest, we investigated the culturable bacterial flora of it and tested the isolated bacteria against P. versicolora larvae and adults. We were able to isolate nine bacteria from larvae and adults. The isolates were characterized using a combination of morphological, biochemical, and physiological methods. Additionally, we sequenced the partial sequence of the 16S rRNA gene to verify conventional identification results. Based on characterization studies, the isolates were identified as Staphylococcus sp. Pv1, Rahnella sp. Pv2, Rahnella sp. Pv3, Rahnella sp. Pv4, Rahnella sp. Pv5, Pantoea agglomerans Pv6, Staphylococcus sp. Pv7, Micrococcus luteus Pv8, and Rahnella sp. Pv9. The highest insecticidal activity against larvae and adults was obtained from M. luteus Pv8 with 50 and 40 % mortalities within 10 days after treatment, respectively. Extracellular enzyme activity of the bacterial isolates such as amylase, proteinase, lipase, cellulose, and chitinase was also determined. Consequently, our results show that M. luteus Pv8 might be a good candidate as a possible microbial control agent against P. versicolora and were discussed with respect to biocontrol potential of the bacterial isolates. PMID:23054688

  6. Enhanced production of bacterial cellulose by using Gluconacetobacter hansenii NCIM 2529 strain under shaking conditions.

    PubMed

    Mohite, Bhavna V; Salunke, Bipinchandra K; Patil, Satish V

    2013-03-01

    Bacterial cellulose (BC), a biopolymer, due to its unique properties is valuable for production of vital products in food, textile, medicine, and agriculture. In the present study, the optimal fermentation conditions for enhanced BC production by Gluconacetobacter hansenii NCIM 2529 were investigated under shaking conditions. The investigation on media components and culture parameters revealed that 2 % (w/v) sucrose as carbon source, 0.5 % (w/v) potassium nitrate as nitrogen source, 0.4 % (w/v) disodium phosphate as phosphate source, 0.04 % (w/v) magnesium sulfate, and 0.8 % (w/v) calcium chloride as trace elements, pH5.0, temperature 25 °C, and agitation speed 170 rpm with 6 days of fermentation period are optimal for maximum BC production. Production of BC using optimized media components and culture parameters was 1.66 times higher (5.0 g/l) than initial non optimized media (3.0 g/l). Fourier transform infrared spectroscopy spectrum and comparison with the available literature suggests that the produced component by G. hansenii in the present study is pure bacterial cellulose. The specific action of cellulase out of the investigated hydrolytic enzymes (cellulase, amylase, and protease) further confirmed purity of the produced BC. These findings give insight into conditions necessary for enhanced production of bacterial cellulose, which can be used for a variety of applications. PMID:23319186

  7. Biodegradation of semiconductor volatile organic compounds by four novel bacterial strains: a kinetic analysis.

    PubMed

    Su, Tien-Tsai; Lin, Chi-Wen; I, Yet-Po; Wu, Chih-Hung

    2012-09-01

    This study isolated pure microorganisms for further bioreactor applications. Four novel strains of Pseudomonas citronellolis YAIP521, Paracoccus versutus HSAC51, Burkholderia sp. HUEL671, and Pseudomonas aeruginosa JUPG561 were isolated and tested for biodegradation of isopropyl alcohol (IPA), acetone, ethyl lactate (EL), and propylene glycol mono methyl ether acetate (PGMEA), respectively. The maximum biodegradation rates for IPA, acetone, EL, and PGMEA were 5.27, 3.87, 26.86, and 48.93 mg L(-1) h(-1), respectively. The Haldane kinetic parameters determined for these strains when degrading targeted volatile organic compounds were maximum specific growth rate, half-saturation constant, and inhibition constant. The isolated strains have potential application in various bioreactors. The kinetic parameters obtained in this study provide a basis for further bioreactor experiments. PMID:22322527

  8. The Genomic Sequence of the Oral Pathobiont Strain NI1060 Reveals Unique Strategies for Bacterial Competition and Pathogenicity

    PubMed Central

    Jiao, Yizu; Hasegawa, Mizuho; Moon, Henry; Núñez, Gabriel; Inohara, Naohiro; Raes, Jeroen

    2016-01-01

    Strain NI1060 is an oral bacterium responsible for periodontitis in a murine ligature-induced disease model. To better understand its pathogenicity, we have determined the complete sequence of its 2,553,982 bp genome. Although closely related to Pasteurella pneumotropica, a pneumonia-associated rodent commensal based on its 16S rRNA, the NI1060 genomic content suggests that they are different species thriving on different energy sources via alternative metabolic pathways. Genomic and phylogenetic analyses showed that strain NI1060 is distinct from the genera currently described in the family Pasteurellaceae, and is likely to represent a novel species. In addition, we found putative virulence genes involved in lipooligosaccharide synthesis, adhesins and bacteriotoxic proteins. These genes are potentially important for host adaption and for the induction of dysbiosis through bacterial competition and pathogenicity. Importantly, strain NI1060 strongly stimulates Nod1, an innate immune receptor, but is defective in two peptidoglycan recycling genes due to a frameshift mutation. The in-depth analysis of its genome thus provides critical insights for the development of NI1060 as a prime model system for infectious disease. PMID:27409077

  9. Control Efficacy of an Endophytic Bacillus amyloliquefaciens Strain BZ6-1 against Peanut Bacterial Wilt, Ralstonia solanacearum

    PubMed Central

    Liang, Guobin

    2014-01-01

    We aimed to isolate and identify endophytic bacteria that might have efficacy against peanut bacterial wilt (BW) caused by Ralstonia solanacearum. Thirty-seven endophytic strains were isolated from healthy peanut plants in R. solanacearum-infested fields and eight showed antagonistic effects against R. solanacearum. Strain BZ6-1 with the highest antimicrobial activity was identified as Bacillus amyloliquefaciens based on morphology, biochemistry, and 16S rRNA analysis. Culture conditions of BZ6-1 were optimized using orthogonal test method and inhibitory zone diameter in dual culture plate assay reached 34.2 mm. Furthermore, main antimicrobial substances of surfactin and fengycin A homologues produced by BZ6-1 were analyzed by high performance liquid chromatography electrospray ionization tandem mass spectrometry. Finally, pot experiments were adopted to test the control efficiency of BZ6-1 against peanut BW. Disease incidence decreased significantly from 84.5% in the control to 12.1% with addition of 15 mL (108 cfu mL−1) culture broth for each seedling, suggesting the feasibility of strain BZ6-1 in the biological control of peanut plants BW. PMID:24527448

  10. The Genomic Sequence of the Oral Pathobiont Strain NI1060 Reveals Unique Strategies for Bacterial Competition and Pathogenicity.

    PubMed

    Darzi, Youssef; Jiao, Yizu; Hasegawa, Mizuho; Moon, Henry; Núñez, Gabriel; Inohara, Naohiro; Raes, Jeroen

    2016-01-01

    Strain NI1060 is an oral bacterium responsible for periodontitis in a murine ligature-induced disease model. To better understand its pathogenicity, we have determined the complete sequence of its 2,553,982 bp genome. Although closely related to Pasteurella pneumotropica, a pneumonia-associated rodent commensal based on its 16S rRNA, the NI1060 genomic content suggests that they are different species thriving on different energy sources via alternative metabolic pathways. Genomic and phylogenetic analyses showed that strain NI1060 is distinct from the genera currently described in the family Pasteurellaceae, and is likely to represent a novel species. In addition, we found putative virulence genes involved in lipooligosaccharide synthesis, adhesins and bacteriotoxic proteins. These genes are potentially important for host adaption and for the induction of dysbiosis through bacterial competition and pathogenicity. Importantly, strain NI1060 strongly stimulates Nod1, an innate immune receptor, but is defective in two peptidoglycan recycling genes due to a frameshift mutation. The in-depth analysis of its genome thus provides critical insights for the development of NI1060 as a prime model system for infectious disease. PMID:27409077

  11. Control efficacy of an endophytic Bacillus amyloliquefaciens strain BZ6-1 against peanut bacterial Wilt, Ralstonia solanacearum.

    PubMed

    Wang, Xiaobing; Liang, Guobin

    2014-01-01

    We aimed to isolate and identify endophytic bacteria that might have efficacy against peanut bacterial wilt (BW) caused by Ralstonia solanacearum. Thirty-seven endophytic strains were isolated from healthy peanut plants in R. solanacearum-infested fields and eight showed antagonistic effects against R. solanacearum. Strain BZ6-1 with the highest antimicrobial activity was identified as Bacillus amyloliquefaciens based on morphology, biochemistry, and 16S rRNA analysis. Culture conditions of BZ6-1 were optimized using orthogonal test method and inhibitory zone diameter in dual culture plate assay reached 34.2 mm. Furthermore, main antimicrobial substances of surfactin and fengycin A homologues produced by BZ6-1 were analyzed by high performance liquid chromatography electrospray ionization tandem mass spectrometry. Finally, pot experiments were adopted to test the control efficiency of BZ6-1 against peanut BW. Disease incidence decreased significantly from 84.5% in the control to 12.1% with addition of 15 mL (10(8) cfu mL(-1)) culture broth for each seedling, suggesting the feasibility of strain BZ6-1 in the biological control of peanut plants BW. PMID:24527448

  12. [Construction and evaluation of an engineered bacterial strain for producing lipopeptide under anoxic conditions].

    PubMed

    Liang, Xiao-long; Zhao, Feng; Shi, Rong-jiu; Ban, Yun-he; Zhou, Ji-dong; Han, Si-qin; Zhang, Ying

    2015-08-01

    Biosurfactant-facilitated oil recovery is one of the most important aspects of microbial enhanced oil recovery (MEOR). However, the biosurfactant production by biosurfactant-producing microorganisms, most of which are aerobes, is severely suppressed due to the in-situ anoxic conditions within oil reservoirs. In this research, we successfully engineered a strain JD-3, which could grow rapidly and produce lipopeptide under anoxic conditions, by protoplast confusion using a Bacillus amyloliquefaciens strain BQ-2 which produces biosurfactant aerobically, and a facultative anaerobic Pseudomonas stutzeri strain DQ-1 as parent strains. The alignment of 16S rDNA sequence (99% similarity) and comparisons of cell colony morphology showed that fusant JD-3 was closer to the parental strain B. amyloliquefaciens BQ-2. The surface tension of culture broth of fusant JD-3, after 36-hour cultivation under anaerobic conditions, decreased from initially 63.0 to 32.5 mN · m(-1). The results of thin layer chromatography and infrared spectrum analysis demonstrated that the biosurfactant produced by JD-3 was lipopeptide. The surface-active lipopeptide had a low critical micelle concentration (CMC) of 90 mg · L(-1) and presented a good ability to emulsify various hydrocarbons such as crude oil, liquid paraffin, and kerosene. Strain JD-3 could utilize peptone as nitrogen source and sucrose, glucose, glycerin or other common organics as carbon sources for anaerobic lipopeptide synthesis. The subculture of fusant JD-3 showed a stable lipopeptide-producing ability even after ten serial passages. All these results indicated that fusant JD-3 holds a great potential to microbially enhance oil recovery under anoxic conditions. PMID:26685621

  13. The strains recommended for use in the bacterial reverse mutation test (OECD guideline 471) can be certified as non-genetically modified organisms.

    PubMed

    Sugiyama, Kei-Ichi; Yamada, Masami; Awogi, Takumi; Hakura, Atsushi

    2016-01-01

    The bacterial reverse mutation test, commonly called Ames test, is used worldwide. In Japan, the genetically modified organisms (GMOs) are regulated under the Cartagena Domestic Law, and organisms obtained by self-cloning and/or natural occurrence would be exempted from the law case by case. The strains of Salmonella typhimurium and Escherichia coli recommended for use in the bacterial reverse mutation test (OECD guideline 471), have been considered as non-GMOs because they can be constructed by self-cloning or naturally occurring bacterial strains, or do not disturb the biological diversity. The present article explains the reasons why these tester strains should be classified as non-GMOs. PMID:27350822

  14. Bacillus rubiinfantis sp. nov. strain mt2T, a new bacterial species isolated from human gut

    PubMed Central

    Tidjiani Alou, M.; Rathored, J.; Khelaifia, S.; Michelle, C.; Brah, S.; Diallo, B.A.; Raoult, D.; Lagier, J.-C.

    2015-01-01

    Bacillus rubiinfantis sp. nov. strain mt2T is the type strain of B. rubiinfantis sp. nov., isolated from the fecal flora of a child with kwashiorkor in Niger. It is Gram-positive facultative anaerobic rod belonging to the Bacillaceae family. We describe the features of this organism alongside the complete genome sequence and annotation. The 4 311 083 bp long genome (one chromosome but no plasmid) contains 4028 protein-coding gene and 121 RNA genes including nine rRNA genes. PMID:27076912

  15. Metabolic evolution of Escherichia coli strains that produce organic acids

    DOEpatents

    Grabar, Tammy; Gong, Wei; Yocum, R Rogers

    2014-10-28

    This invention relates to the metabolic evolution of a microbial organism previously optimized for producing an organic acid in commercially significant quantities under fermentative conditions using a hexose sugar as sole source of carbon in a minimal mineral medium. As a result of this metabolic evolution, the microbial organism acquires the ability to use pentose sugars derived from cellulosic materials for its growth while retaining the original growth kinetics, the rate of organic acid production and the ability to use hexose sugars as a source of carbon. This invention also discloses the genetic change in the microorganism that confers the ability to use both the hexose and pentose sugars simultaneously in the production of commercially significant quantities of organic acids.

  16. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

    2002-01-01

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which has been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

  17. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, M.; Millard, C.S.; Stols, L.

    1998-06-23

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which as been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria. 2 figs.

  18. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

    1998-01-01

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which as been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

  19. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

    2001-09-25

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which has been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

  20. Isolation and characterization of a bacterial strain that degrades cis-dichloroethenein the absence of aromatic inducers.

    PubMed

    Yonezuka, Kenta; Araki, Naoto; Shimodaira, Jun; Ohji, Shoko; Hosoyama, Akira; Numata, Mitsuru; Yamazoe, Atsushi; Kasai, Daisuke; Masai, Eiji; Fujita, Nobuyuki; Ezaki, Takayuki; Fukuda, Masao

    2016-07-14

    Bacteria capable of degrading cis-dichloroethene (cDCE) were screened from cDCE-contaminated soil, and YKD221, a bacterial strain that exhibited a higher growth on minimal salt agar plates in the presence of cDCE than in the absence of cDCE, were isolated. Phylogenetic studies of the 16S rRNA as well as gyrB, rpoD, and recA in YKD221 indicated that this strain is closely related to the type strains of Pseudomonas plecoglossicida, monteilii, and putida. An average nucleotide identity analysis indicated that YKD221 is most closely related to P. putida strains, including the type strain, which suggests that YKD221 belongs to P. putida. Although the genome of YKD221 was very similar to that of P. putida F1, a toluene-degrading strain, the YKD221 genome has 15 single-nucleotide polymorphisms and 4 insertions compared with the F1 genome. YKD221 caused the release of sufficient chloride ions from cDCE to suggest that the strain is able to completely dechlorinate and degrade cDCE. YKD221 also degraded trichloroethene but was unable to degrade trans-dichloroethene and tetrachloroethene. The degradation activity of YKD221 was elevated after growth on toluene. Inactivation of todC1, which encodes for a large subunit of the catalytic terminal component in toluene dioxygenase, resulted in a complete loss of growth on toluene and cDCE degradation activity. This is the first evidence of the involvement of todC1C2BA-coded toluene dioxygenase in cDCE degradation. YKD221 did not appear to grow on cDCE in a minimal salt liquid medium. However, YKD221 did exhibit an enhanced increase in cell concentration and volume of cells during growth on minimal salt agar plates with cDCE when first grown in LB medium. This behavior appears to have led us to misinterpret our initial results on YKD221 as an indication of improved growth in the presence of cDCE. PMID:27211831

  1. Trace Amounts of Furan-2-Carboxylic Acids Determine the Quality of Solid Agar Plates for Bacterial Culture

    PubMed Central

    Hara, Shintaro; Isoda, Reika; Tahvanainen, Teemu; Hashidoko, Yasuyuki

    2012-01-01

    Background Many investigators have recognised that a significant proportion of environmental bacteria exist in a viable but non-culturable state on agar plates, and some researchers have also noticed that some of such bacteria clearly recover their growth on matrices other than agar. However, the reason why agar is unsuitable for the growth of some bacteria has not been addressed. Methodology/Principal Findings According to the guide of a bioassay for swarming inhibition, we identified 5-hydroxymethylfuran-2-carboxylic acid (5-HMFA) and furan-2-carboxylic acid (FA) as factors that inhibit bacterial swarming and likely inhibit extracellular polysaccharide production on agar. The furan-2-carboxylic acids 5-HMFA and FA effectively inhibited the swarming and swimming of several environmental bacteria at concentrations of 1.8 and 2.3 µg L−1 (13 and 21 nmol L−1), respectively, which are equivalent to the concentrations of these compounds in 0.3% agar. On Luria-Bertani (LB) plates containing 1.0% agar that had been previously washed with MeOH, a mixture of 5-HMFA and FA in amounts equivalent to their original concentrations in the unwashed agar repressed the swarming of Escherichia coli K12 strain W3110, a representative swarming bacterium. Conclusions/Significance Agar that contains trace amounts of 5-HMFA and FA inhibits the proliferation of some slow-growing or difficult-to-culture bacteria on the plates, but it is useful for single colony isolation due to the ease of identification of swarmable bacteria as the non-swarmed colonies. PMID:22848437

  2. Characterization of bacterial pectinolytic strains involved in the water retting process.

    PubMed

    Tamburini, Elena; León, Alicia Gordillo; Perito, Brunella; Mastromei, Giorgio

    2003-09-01

    Pectinolytic microorganisms involved in the water retting process were characterized. Cultivable mesophilic anaerobic and aerobic bacteria were isolated from unretted and water-retted material. A total of 104 anaerobic and 23 aerobic pectinolytic strains were identified. Polygalacturonase activity was measured in the supernatant of cell cultures; 24 anaerobic and nine aerobic isolates showed an enzymatic activity higher than the reference strains Clostridium felsineum and Bacillus subtilis respectively. We performed the first genotypic characterization of the retting microflora by a 16S amplified ribosomal DNA restriction analysis (ARDRA). Anaerobic isolates were divided into five different groups, and the aerobic isolates were clustered into three groups. 84.6% of the anaerobic and 82.6% of the aerobic isolates consisted of two main haplotypes. Partial 16S rRNA gene sequences were determined for 12 strains, representative of each haplotype. All anaerobic strains were assigned to the Clostridium genus, whereas the aerobic isolates were assigned to either the Bacillus or the Paenibacillus genus. Anaerobic isolates with high polygalacturonase (PG) activity belong to two clearly distinct phylogenetic clusters related to C. acetobutylicum-C. felsineum and C. saccharobutylicum species. Aerobic isolates with high PG activity belong to two clearly distinct phylogenetic clusters related to B. subtilisT and B. pumilusT. PMID:12919408

  3. Arsenic-tolerant, arsenite-oxidising bacterial strains in the contaminated soils of West Bengal, India.

    PubMed

    Majumder, Aparajita; Bhattacharyya, K; Bhattacharyya, S; Kole, S C

    2013-10-01

    As biological agents represent an affordable alternative to costly metal decontamination technologies, we isolated arsenic (As) oxidising bacteria from the As-contaminated soils of West Bengal, India. These strains were closely related to various species of Bacillus and Geobacillus based on their 16S rRNA gene sequences. They were found to be hyper-resistant to both As(V) (167-400 mM) and As(III) (16-47 mM). Elevated rates of As(III) oxidation (278-1250 μM h(-1)) and arsenite oxidase activity (2.1-12.5 nM min(-1) mg(-1) protein) were observed in these isolates. Screening identified four strains as superior As-oxidisers. Among them, AMO-10 completely (100%) oxidised 30 mM of As(III) within 24 h. The presence of the aoxB gene was confirmed in the screened isolates. Phylogenetic tree construction based on the aoxB sequence revealed that two strains, AGO-S5 and AGH-02, clustered with Achromobacter and Variovorax, whereas the other two (AMO-10 and ADP-25) remained unclustered. The increased rate of As(III) oxidation by these native strains might be exploited for the remediation of As in contaminated environments. Notably, this study presents the first correlation regarding the presence of the aoxB gene and As(III) oxidation ability in Geobacillus stearothermophilus. PMID:23876545

  4. Rapid fluorometric quantification of bacterial cells using Redsafe nucleic acid stain

    PubMed Central

    Khalili, Ehsan; Hosseini, Vahid; Solhi, Roya; Aminian, Mahdi

    2015-01-01

    Background and Objectives: Numerous procedures in biology and medicine require the counting of cells. Direct enumeration of Colony Forming Units (CFUs) is time-consuming and dreary accurate cell counting on plates with high numbers of CFUs is error prone. In this study we report a new indirect cell counting method that was developed based on the use of Redsafe fluorometric assay. The usefulness of Redsafe, a nucleic acid stain, in liquid medium is based on the binding of the fluorescent dye to DNA. Materials and Methods: Redsafe fluorometric assay was evaluated in comparison with MTT colorimetric assay as a colourimetric assay for enumeration of bacterial cells. Results: Obtained results showed that fluorometric assay threshold for LB grown E. coli is 6×104 CFU/ml. Redsafe fluorescent assay can be used as a rapid and inexpensive method for bacterial enumeration and quantification with increased sensitivity. Conclusion: The sensitivity of the Redsafe fluorometric assay for detection and enumeration of bacterial cells was 2-log-unit more than that was observed for the MTT assay. PMID:26885332

  5. Bacterial community dynamics during industrial malting, with an emphasis on lactic acid bacteria.

    PubMed

    Justé, A; Malfliet, S; Waud, M; Crauwels, S; De Cooman, L; Aerts, G; Marsh, T L; Ruyters, S; Willems, K; Busschaert, P; Lievens, B

    2014-05-01

    Characterization of the microflora during malting is an essential step towards process management and optimization. Up till now, however, microbial characterization in the malting process has mostly been done using culture-dependent methods, probably leading to biased estimates of microbial diversity. The aim of this study was to characterize the bacterial communities using two culture-independent methods, including Terminal Restriction Fragment Length Polymorphism (T-RFLP) and 454 pyrosequencing, targeting the 16S rRNA gene. Studied samples originated from two harvest years and two malting houses malting the same batch of barley. Besides targeting the entire bacterial community (T-RFLP), emphasis was put on lactic acid bacteria (LAB) (T-RFLP and 454 pyrosequencing). The overall bacterial community richness was limited, but the community structure changed during the process. Zooming in on the LAB community using 454 pyrosequencing revealed a total of 47 species-level operational taxonomic units (OTUs). LAB diversity appeared relatively limited since 88% of the sequences were covered by the same five OTUs (representing members of Weissella, Lactobacillus and Leuconostoc) present in all samples investigated. Fluctuations in the relative abundances of the dominant LAB were observed with the process conditions. In addition, both the year of harvest and malting house influenced the LAB community structure. PMID:24387850

  6. Stereospecificity of reactions catalyzed by bacterial D-amino acid transaminase.

    PubMed

    Martínez del Pozo, A; Merola, M; Ueno, H; Manning, J M; Tanizawa, K; Nishimura, K; Soda, K; Ringe, D

    1989-10-25

    The spectral shift from 420 to 338 nm when pure bacterial D-amino acid transaminase binds D-amino acid substrates is also exhibited in part by high concentrations of L-amino acids (L-alanine and L-glutamate) but not by simple dicarboxylic acids or monoamines. Slow processing of L-alanine to D-alanine was observed both by coupled enzymatic assays using D-amino acid oxidase and by high pressure liquid chromatography analysis employing an optically active chromophore (Marfey's reagent). When the acceptor for L-alanine was alpha-ketoglutarate, D-glutamate was also formed. This minor activity of the transaminase involved both homologous (L-alanine and D-alanine) and heterologous (L-alanine and D-glutamate) substrate pairs and was a function of the nature of the keto acid acceptor. In the presence of alpha-ketoisovalerate, DL-alanine was almost completely processed to D-valine; within the limits of the assay no L-valine was detected. With alpha-ketoisocaproate, 90% of the DL-alanine was converted to D-leucine. In the mechanism of this transaminase reaction, there may be more stereoselective constraints for the protonation of the quinonoid intermediate during the second half-reaction of the transamination reaction, i.e. the donation of the amino group from the pyridoxamine 5'-phosphate coenzyme to a second keto acid acceptor, than during removal of the alpha proton in the initial steps of the reaction pathway. Thus, with this D-amino acid transaminase, the discrete steps of transamination ensure fidelity of the stereospecificity of reaction pathway. PMID:2808352

  7. [Generation of nalidixic acid-resistant strains and signature-tagged mutants of Actinobacillus pleuropneumoniae].

    PubMed

    Shang, Lin; Li, Wei; Li, Liangjun; Li, Lu; Zhang, Sihua; Li, Tingting; Li, Yaokun; Liu, Lei; Guo, Zhiwei; Zhou, Rui; Chen, Huanchun

    2008-01-01

    Actinobacillus pleuropneumoniae is a very important respiratory pathogen for swine and causes great economic losses in pig industry worldwide. Signature-tagged mutagenesis (STM) is an effective method to identify virulence genes in bacteria. In this study, we selected nalidixic acid-resistant strains of APP serotypes 1 and 3 by in vitro cultivation, and used as receipt strains for constructing transposon mutants by mating with E. coli CC 118 lambdapir or S17-1 lambdapir containing mini-Tn10 tag plasmids pLOF/TAG1-48, with or without the help of E. coli DH5alpha (pRK2073). We screened mutant strains by antibiotics selection, PCR and Southern blot identification. Our data revealed that nalidixic acid-resistance of APP strains could easily be induced in vitro and the resistance was due to the mutation in the DNA gyrase A subunit gene gyrA. In the mating experiments, the bi-parental mating was more effective and easier than tri-parental mating. Different APP strains showed a different mating and transposon efficiency in the bi-parental mating, with the strains of serotype 1 much higher than serotype 3 and the reference strain of serotype 3 higher than the field strains. These data were helpful for the construction of STM mutants and pickup of virulence genes of APP. PMID:18338580

  8. Ultralong C100 Mycolic Acids Support the Assignment of Segniliparus as a New Bacterial Genus

    PubMed Central

    Layre, Emilie; Sweet, Lindsay; Young, David C.; Posey, James E.; Butler, W. Ray; Moody, D. Branch

    2012-01-01

    Mycolic acid-producing bacteria isolated from the respiratory tract of human and non-human mammals were recently assigned as a distinct genus, Segniliparus, because they diverge from rhodococci and mycobacteria in genetic and chemical features. Using high accuracy mass spectrometry, we determined the chemical composition of 65 homologous mycolic acids in two Segniliparus species and separately analyzed the three subclasses to measure relative chain length, number and stereochemistry of unsaturations and cyclopropyl groups within each class. Whereas mycobacterial mycolate subclasses are distinguished from one another by R groups on the meromycolate chain, Segniliparus species synthesize solely non-oxygenated α-mycolates with high levels of cis unsaturation. Unexpectedly Segniliparus α-mycolates diverge into three subclasses based on large differences in carbon chain length with one bacterial culture producing mycolates that range from C58 to C100. Both the overall chain length (C100) and the chain length diversity (C42) are larger than previously seen for mycolic acid-producing organisms and provide direct chemical evidence for assignment of Segniliparus as a distinct genus. Yet, electron microscopy shows that the long and diverse mycolates pack into a typical appearing membrane. Therefore, these new and unexpected extremes of mycolic acid chemical structure raise questions about the modes of mycolic acid packing and folding into a membrane. PMID:22720018

  9. Dissolved total hydrolyzable enantiomeric amino acids in precipitation: Implications on bacterial contributions to atmospheric organic matter

    NASA Astrophysics Data System (ADS)

    Yan, Ge; Kim, Guebuem; Kim, Jeonghyun; Jeong, Yu-Sik; Kim, Young Il

    2015-03-01

    We analyzed dissolved organic carbon (DOC), dissolved organic nitrogen (DON), and dissolved enantiomeric amino acids in precipitation samples collected at two sites in Korea over a one-year period. The average concentrations of DOC, DON, and total hydrolyzable amino acids at Seoul (an inland urban area) were lower than those at Uljin (a coastal rural area). The different bulk compositions of dissolved organic matter (DOM) at these two sites (reflected by qualitative indicators) were mainly attributed to differences in contributing sources. The D-enantiomers of four individual amino acids (aspartic acid, glutamic acid, serine, and alanine) were ubiquitously present, with average enantiomeric (D/L) ratios of 0.34, 0.26, 0.21, and 0.61 for Seoul, and 0.18, 0.11, 0.09, and 0.31 for Uljin, respectively. The much higher D/L ratios observed at Seoul than at Uljin might result from more advanced diagenetic stages as well as higher contributions from bacteria inhabiting terrestrial environments. The C- and N-normalized yields of D-alanine in DOM of our samples were found to be comparable to literature values reported for aquatic systems, where a significant portion of DOM was suggested to be of bacterial origin. Our study suggests that bacteria and their remnants might constitute an important fraction of OM in the atmosphere, contributing significantly to the quality of atmospheric OM and its post-depositional bioavailability in the surface ecosystems.

  10. Genomic comparisons between paired bacterial strains with strong and weak GC skews.

    PubMed

    Song, Tie-Jun; Wang, Yue; Shen, Jian-Gen; Pan, Jian-Ping; Huang, Jun

    2014-02-01

    A majority of known eubacterial genomes are characteristic of GC skew, i.e., the leading strand has exceeding number of G over C. The cause of this compositional bias is still not very clear. In this study, we chose five pairs of genomes from distantly related bacterial genera, i.e., Buchnera, Haemophilus, Mycoplasma, Mycobacterium, and Synechococcus, each containing one with strong GC skew and the other with weak GC skew. Through comparison of the orthologous genes in these genera, we found that neither chromosomal rearrangement nor CDS skew has direct relationship with GC skew. PMID:23457112

  11. In Vitro Antibacterial Spectrum of Sodium Selenite against Selected Human Pathogenic Bacterial Strains

    PubMed Central

    Alam, Mohammad Firoz; Safhi, Mohammed M.; Moni, Sivakumar Sivagurunathan; Jabeen, Aamena

    2016-01-01

    The objective of this investigation was to predict the antibacterial properties of sodium selenite against selected human pathogens. A group of six human bacterial pathogens including Staphylococcus aureus, Streptococcus pyogenes, Bacillus subtilis, Escherichia coli, Pseudomonas aeruginosa, and Klebsiella planticola were utilized for screening. The spectrum of activity was qualified based on zone of inhibition. Our study demonstrated that sodium selenite exhibits a strong spectrum of activity against Bacillus subtilis, Staphylococcus aureus, Escherichia coli, and Klebsiella planticola. The spectrum of activity was compared with standard ciprofloxacin disc (5 μg/disc) and observed to have satisfactory effect. PMID:27066293

  12. Biodegradable water absorbent synthesized from bacterial poly(amino acid)s.

    PubMed

    Kunioka, Masao

    2004-03-15

    Biodegradable hydrogels prepared by gamma-irradiation from microbial poly(amino acid)s have been studied. pH-Sensitive hydrogels were prepared by the gamma-irradiation of poly(gamma-glutamic acid) (PGA) produced by Bacillus subtilis and poly(epsilon-lysine) (PL) produced by Streptomyces albulus in aqueous solutions. When the gamma-irradiation dose was 19 kGy or more, and the concentration of PGA in water was 2 wt.-% or more, transparent hydrogels could be produced. For the 19 kGy dose, the produced hydrogel was very weak, however, the specific water content (wt. of absorbed water/wt. of dry hydrogel) of this PGA hydrogel was approximately 3,500. The specific water content decreased to 200, increasing when the gamma-irradiation dose was over 100 kGy. Under acid conditions or upon the addition of electrolytes, the PGA hydrogels shrunk. The PGA hydrogel was pH-sensitive and the change in the volume of the hydrogel depended on the pH value outside the hydrogel in the swelling medium. This PGA hydrogel was hydrodegradable and biodegradable. A new novel purifier reagent (coagulant), made from the PGA hydrogels, for contaminated turbid water has been found and developed by Japanese companies. A very small amount of this coagulant (only 2 ppm in turbid water) with poly(aluminum chloride) can be used for the purification of turbid water. A PL aqueous solution also can change into a hydrogel by gamma-irradiation. The specific water content of the PL hydrogel ranged from 20 to 160 depending on the preparation conditions. Under acid conditions, the PL hydrogel swelled because of the ionic repulsion of the protonated amino groups in the PL molecules. The rate of enzymatic degradation of the respective PL hydrogels by a neutral protease was much faster than the rate of simple hydrolytic degradation. PMID:15468223

  13. Genomic Survey of Pathogenicity Determinants and VNTR Markers in the Cassava Bacterial Pathogen Xanthomonas axonopodis pv. Manihotis Strain CIO151

    PubMed Central

    Arrieta-Ortiz, Mario L.; Rodríguez-R, Luis M.; Pérez-Quintero, Álvaro L.; Poulin, Lucie; Díaz, Ana C.; Arias Rojas, Nathalia; Trujillo, Cesar; Restrepo Benavides, Mariana; Bart, Rebecca; Boch, Jens; Boureau, Tristan; Darrasse, Armelle; David, Perrine; Dugé de Bernonville, Thomas; Fontanilla, Paula; Gagnevin, Lionel; Guérin, Fabien; Jacques, Marie-Agnès; Lauber, Emmanuelle; Lefeuvre, Pierre; Medina, Cesar; Medina, Edgar; Montenegro, Nathaly; Muñoz Bodnar, Alejandra; Noël, Laurent D.; Ortiz Quiñones, Juan F.; Osorio, Daniela; Pardo, Carolina; Patil, Prabhu B.; Poussier, Stéphane; Pruvost, Olivier; Robène-Soustrade, Isabelle; Ryan, Robert P.; Tabima, Javier; Urrego Morales, Oscar G.; Vernière, Christian; Carrere, Sébastien; Verdier, Valérie; Szurek, Boris; Restrepo, Silvia; López, Camilo

    2013-01-01

    Xanthomonas axonopodis pv. manihotis (Xam) is the causal agent of bacterial blight of cassava, which is among the main components of human diet in Africa and South America. Current information about the molecular pathogenicity factors involved in the infection process of this organism is limited. Previous studies in other bacteria in this genus suggest that advanced draft genome sequences are valuable resources for molecular studies on their interaction with plants and could provide valuable tools for diagnostics and detection. Here we have generated the first manually annotated high-quality draft genome sequence of Xam strain CIO151. Its genomic structure is similar to that of other xanthomonads, especially Xanthomonas euvesicatoria and Xanthomonas citri pv. citri species. Several putative pathogenicity factors were identified, including type III effectors, cell wall-degrading enzymes and clusters encoding protein secretion systems. Specific characteristics in this genome include changes in the xanthomonadin cluster that could explain the lack of typical yellow color in all strains of this pathovar and the presence of 50 regions in the genome with atypical nucleotide composition. The genome sequence was used to predict and evaluate 22 variable number of tandem repeat (VNTR) loci that were subsequently demonstrated as polymorphic in representative Xam strains. Our results demonstrate that Xanthomonas axonopodis pv. manihotis strain CIO151 possesses ten clusters of pathogenicity factors conserved within the genus Xanthomonas. We report 126 genes that are potentially unique to Xam, as well as potential horizontal transfer events in the history of the genome. The relation of these regions with virulence and pathogenicity could explain several aspects of the biology of this pathogen, including its ability to colonize both vascular and non-vascular tissues of cassava plants. A set of 16 robust, polymorphic VNTR loci will be useful to develop a multi-locus VNTR analysis

  14. Genomic survey of pathogenicity determinants and VNTR markers in the cassava bacterial pathogen Xanthomonas axonopodis pv. Manihotis strain CIO151.

    PubMed

    Arrieta-Ortiz, Mario L; Rodríguez-R, Luis M; Pérez-Quintero, Álvaro L; Poulin, Lucie; Díaz, Ana C; Arias Rojas, Nathalia; Trujillo, Cesar; Restrepo Benavides, Mariana; Bart, Rebecca; Boch, Jens; Boureau, Tristan; Darrasse, Armelle; David, Perrine; Dugé de Bernonville, Thomas; Fontanilla, Paula; Gagnevin, Lionel; Guérin, Fabien; Jacques, Marie-Agnès; Lauber, Emmanuelle; Lefeuvre, Pierre; Medina, Cesar; Medina, Edgar; Montenegro, Nathaly; Muñoz Bodnar, Alejandra; Noël, Laurent D; Ortiz Quiñones, Juan F; Osorio, Daniela; Pardo, Carolina; Patil, Prabhu B; Poussier, Stéphane; Pruvost, Olivier; Robène-Soustrade, Isabelle; Ryan, Robert P; Tabima, Javier; Urrego Morales, Oscar G; Vernière, Christian; Carrere, Sébastien; Verdier, Valérie; Szurek, Boris; Restrepo, Silvia; López, Camilo; Koebnik, Ralf; Bernal, Adriana

    2013-01-01

    Xanthomonas axonopodis pv. manihotis (Xam) is the causal agent of bacterial blight of cassava, which is among the main components of human diet in Africa and South America. Current information about the molecular pathogenicity factors involved in the infection process of this organism is limited. Previous studies in other bacteria in this genus suggest that advanced draft genome sequences are valuable resources for molecular studies on their interaction with plants and could provide valuable tools for diagnostics and detection. Here we have generated the first manually annotated high-quality draft genome sequence of Xam strain CIO151. Its genomic structure is similar to that of other xanthomonads, especially Xanthomonas euvesicatoria and Xanthomonas citri pv. citri species. Several putative pathogenicity factors were identified, including type III effectors, cell wall-degrading enzymes and clusters encoding protein secretion systems. Specific characteristics in this genome include changes in the xanthomonadin cluster that could explain the lack of typical yellow color in all strains of this pathovar and the presence of 50 regions in the genome with atypical nucleotide composition. The genome sequence was used to predict and evaluate 22 variable number of tandem repeat (VNTR) loci that were subsequently demonstrated as polymorphic in representative Xam strains. Our results demonstrate that Xanthomonas axonopodis pv. manihotis strain CIO151 possesses ten clusters of pathogenicity factors conserved within the genus Xanthomonas. We report 126 genes that are potentially unique to Xam, as well as potential horizontal transfer events in the history of the genome. The relation of these regions with virulence and pathogenicity could explain several aspects of the biology of this pathogen, including its ability to colonize both vascular and non-vascular tissues of cassava plants. A set of 16 robust, polymorphic VNTR loci will be useful to develop a multi-locus VNTR analysis

  15. Bis(aminomethyl)phosphinic Acid, a Highly Promising Scaffold for the Development of Bacterial Urease Inhibitors

    PubMed Central

    2014-01-01

    Inhibitors of bacterial ureases are considered to be promising compounds in the treatment of infections caused by Helicobacter pylori in the gastric tract and/or by urealytic bacteria (e.g., Proteus species) in the urinary tract. A new, extended transition state scaffold, bis(aminomethyl)phosphinic acid, was successfully explored for the construction of effective enzyme inhibitors. A reliable methodology for the synthesis of phosphinate analogues in a three-component Mannich-type reaction was elaborated. The obtained molecules were assayed against ureases purified from Sporosarcina pasteurii and Proteus mirabilis, and aminomethyl(N-n-hexylaminomethyl)phosphinic acid was found to be the most potent inhibitor, with a Ki = 108 nM against the S. pasteurii enzyme. PMID:25699141

  16. Bis(aminomethyl)phosphinic Acid, a Highly Promising Scaffold for the Development of Bacterial Urease Inhibitors.

    PubMed

    Macegoniuk, Katarzyna; Dziełak, Anna; Mucha, Artur; Berlicki, Łukasz

    2015-02-12

    Inhibitors of bacterial ureases are considered to be promising compounds in the treatment of infections caused by Helicobacter pylori in the gastric tract and/or by urealytic bacteria (e.g., Proteus species) in the urinary tract. A new, extended transition state scaffold, bis(aminomethyl)phosphinic acid, was successfully explored for the construction of effective enzyme inhibitors. A reliable methodology for the synthesis of phosphinate analogues in a three-component Mannich-type reaction was elaborated. The obtained molecules were assayed against ureases purified from Sporosarcina pasteurii and Proteus mirabilis, and aminomethyl(N-n-hexylaminomethyl)phosphinic acid was found to be the most potent inhibitor, with a K i = 108 nM against the S. pasteurii enzyme. PMID:25699141

  17. Synergistic and Additive Effect of Oregano Essential Oil and Biological Silver Nanoparticles against Multidrug-Resistant Bacterial Strains.

    PubMed

    Scandorieiro, Sara; de Camargo, Larissa C; Lancheros, Cesar A C; Yamada-Ogatta, Sueli F; Nakamura, Celso V; de Oliveira, Admilton G; Andrade, Célia G T J; Duran, Nelson; Nakazato, Gerson; Kobayashi, Renata K T

    2016-01-01

    Bacterial resistance to conventional antibiotics has become a clinical and public health problem, making therapeutic decisions more challenging. Plant compounds and nanodrugs have been proposed as potential antimicrobial alternatives. Studies have shown that oregano (Origanum vulgare) essential oil (OEO) and silver nanoparticles have potent antibacterial activity, also against multidrug-resistant strains; however, the strong organoleptic characteristics of OEO and the development of resistance to these metal nanoparticles can limit their use. This study evaluated the antibacterial effect of a two-drug combination of biologically synthesized silver nanoparticles (bio-AgNP), produced by Fusarium oxysporum, and OEO against Gram-positive and Gram-negative bacteria, including multidrug-resistant strains. OEO and bio-AgNP showed bactericidal effects against all 17 strains tested, with minimal inhibitory concentrations (MIC) ranging from 0.298 to 1.193 mg/mL and 62.5 to 250 μM, respectively. Time-kill curves indicated that OEO acted rapidly (within 10 min), while the metallic nanoparticles took 4 h to kill Gram-negative bacteria and 24 h to kill Gram-positive bacteria. The combination of the two compounds resulted in a synergistic or additive effect, reducing their MIC values and reducing the time of action compared to bio-AgNP used alone, i.e., 20 min for Gram-negative bacteria and 7 h for Gram-positive bacteria. Scanning electron microscopy (SEM) revealed similar morphological alterations in Staphylococcus aureus (non-methicillin-resistant S. aureus, non-MRSA) cells exposed to three different treatments (OEO, bio-AgNP and combination of the two), which appeared cell surface blebbing. Individual and combined treatments showed reduction in cell density and decrease in exopolysaccharide matrix compared to untreated bacterial cells. It indicated that this composition have an antimicrobial activity against S. aureus by disrupting cells. Both compounds showed very low

  18. Synergistic and Additive Effect of Oregano Essential Oil and Biological Silver Nanoparticles against Multidrug-Resistant Bacterial Strains

    PubMed Central

    Scandorieiro, Sara; de Camargo, Larissa C.; Lancheros, Cesar A. C.; Yamada-Ogatta, Sueli F.; Nakamura, Celso V.; de Oliveira, Admilton G.; Andrade, Célia G. T. J.; Duran, Nelson; Nakazato, Gerson; Kobayashi, Renata K. T.

    2016-01-01

    Bacterial resistance to conventional antibiotics has become a clinical and public health problem, making therapeutic decisions more challenging. Plant compounds and nanodrugs have been proposed as potential antimicrobial alternatives. Studies have shown that oregano (Origanum vulgare) essential oil (OEO) and silver nanoparticles have potent antibacterial activity, also against multidrug-resistant strains; however, the strong organoleptic characteristics of OEO and the development of resistance to these metal nanoparticles can limit their use. This study evaluated the antibacterial effect of a two-drug combination of biologically synthesized silver nanoparticles (bio-AgNP), produced by Fusarium oxysporum, and OEO against Gram-positive and Gram-negative bacteria, including multidrug-resistant strains. OEO and bio-AgNP showed bactericidal effects against all 17 strains tested, with minimal inhibitory concentrations (MIC) ranging from 0.298 to 1.193 mg/mL and 62.5 to 250 μM, respectively. Time-kill curves indicated that OEO acted rapidly (within 10 min), while the metallic nanoparticles took 4 h to kill Gram-negative bacteria and 24 h to kill Gram-positive bacteria. The combination of the two compounds resulted in a synergistic or additive effect, reducing their MIC values and reducing the time of action compared to bio-AgNP used alone, i.e., 20 min for Gram-negative bacteria and 7 h for Gram-positive bacteria. Scanning electron microscopy (SEM) revealed similar morphological alterations in Staphylococcus aureus (non-methicillin-resistant S. aureus, non-MRSA) cells exposed to three different treatments (OEO, bio-AgNP and combination of the two), which appeared cell surface blebbing. Individual and combined treatments showed reduction in cell density and decrease in exopolysaccharide matrix compared to untreated bacterial cells. It indicated that this composition have an antimicrobial activity against S. aureus by disrupting cells. Both compounds showed very low

  19. Antibacterial efficacy of the seed extracts of Melia azedarach against some hospital isolated human pathogenic bacterial strains

    PubMed Central

    Khan, Abdul Viqar; Ahmed, Qamar Uddin; Mir, M Ramzan; Shukla, Indu; Khan, Athar Ali

    2011-01-01

    Objective To investigate the antibacterial potential of the polar and non-polar extracts of the seeds of Melia azedarach (M. azedarach) L. (Meliaceae) against eighteen hospital isolated human pathogenic bacterial strains. Methods Petrol, benzene, ethyl acetate, methanol, and aqueous extracts at five different concentrations (1, 2, 5, 10 and 15 mg/mL) were evaluated. Disk diffusion method was followed to evaluate the antibacterial efficacy. Results All extracts of the seeds demonstrated significant antibacterial activity against tested pathogens. Among all extracts, ethyl acetate extract revealed the highest inhibition comparatively. The present study also favored the traditional uses reported earlier. Conclusions Results of this study strongly confirm that the seed extracts of M. azedarach could be effective antibiotics, both in controlling gram-positive and gram-negative human pathogenic infections. PMID:23569812

  20. Inhaled hyaluronic acid as ancillary treatment in children with bacterial acute rhinopharyngitis.

    PubMed

    Varricchio, A; Capasso, M; Avvisati, F; Varricchio, A M; De Lucia, A; Brunese, F P; Ciprandi, G

    2014-01-01

    Acute rhinopharyngitis (ARP) is the most common upper respiratory infection in children and represents a social problem for both the pharmaco-economic impact and a burden for the family. Topical antibiotic therapy is usually effective in bacterial ARP, but ancillary treatment might improve its efficacy. Hyaluronic acid (HA) is a promising molecule that has been recently proposed in upper respiratory disorders. Therefore, the purpose of this study was to evaluate the effects of ancillary HA treatment in children with bacterial ARP. Globally, 51 children (27 males, mean age 5.9 ± 2.1 years) with bacterial ARP were enrolled in the study. At baseline, children were randomly assigned to the treatment with: 125 mg of thiamphenicol diluted in 4 mL of saline isotonic solution twice daily (group A) or with 125 mg of thiamphenicol plus 4 ml of sodium hyaluronate 0.2% plus xylitol 5% (Aluneb, Sakura Italia) twice daily (group B) administered by the nasal device Rinowash (Airliquide Medical System, Italy) and connected to an aerosol nebulizer with pneumatic compressor (1.5 bar per 5 L/min) Nebula (Airliquide Medical System, Italy), for 10 days. sVAS, nasopharyngeal spotting, neutrophils and bacteria were assessed at baseline and after the treatment. Both treatments induced significant reduction of symptom perception, spotting, neutrophil and bacteria count. However, thiamphenicol plus HA was able to significantly induce a greater effect on sVAS (p=0.006), neutrophil count (p=0.01), and bacteria count (p=0.0003) than thiamphenicol alone. In conclusion, this study provides the first evidence that intranasal HA, as ancillary treatment, may be able to improve topical antibiotic efficacy in children with bacterial ARP. PMID:25316142

  1. [Effect of strains and parts on amino acids of Dendrobium officinale].

    PubMed

    Liu, Zhen-peng; Guo, Ying-ying; Iu, Jing-jing; Si, Jin-ping; Wu, Ling-shang; Zhang, Xin-feng

    2015-04-01

    The aim of the paper is to reveals the variations of Dendrobium officinale amino acids in different strains and parts for breeding excellent varieties, and providing scientific basis for the expanding of medicinal or edible parts. The contents of 17 amino acids in 11 strains of D. officinale were determined by hydrochloric acid hydrolysis method. The total amino acids content of leaves was from 6.76 to 7.97 g per 100 g, and the stems was from 1.61 to 2.44 g per 100 g. As the content of amino acids in leaves was significantly higher than that of stems, and the composition was close to the ideal protein standard proposed by FAO/WHO. The leaves of D. officinale had the good prospect for the development of functional foods. The 9 x 66 strain which with high yield and polysaccharide content had the highest amino acids content both in stems and leaves, indicated crossbreeding could improve the quality of varieties. Compared the amino acids content of D. officinale in two main harvest periods, the harvest time has a significant impact on amino acids content of D. officinale. This study demonstrates that the harvesting time of D. officinale stems is suitable for leaves as well, which is the period before bolssom. PMID:26281581

  2. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities.

    PubMed

    Huete-Stauffer, Tamara M; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  3. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities

    PubMed Central

    Huete-Stauffer, Tamara M.; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G.

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  4. High Frequency and Diversity of Antimicrobial Activities Produced by Nasal Staphylococcus Strains against Bacterial Competitors

    PubMed Central

    Janek, Daniela; Zipperer, Alexander; Kulik, Andreas; Krismer, Bernhard; Peschel, Andreas

    2016-01-01

    The human nasal microbiota is highly variable and dynamic often enclosing major pathogens such as Staphylococcus aureus. The potential roles of bacteriocins or other mechanisms allowing certain bacterial clones to prevail in this nutrient-poor habitat have hardly been studied. Of 89 nasal Staphylococcus isolates, unexpectedly, the vast majority (84%) was found to produce antimicrobial substances in particular under habitat-specific stress conditions, such as iron limitation or exposure to hydrogen peroxide. Activity spectra were generally narrow but highly variable with activities against certain nasal members of the Actinobacteria, Proteobacteria, Firmicutes, or several groups of bacteria. Staphylococcus species and many other Firmicutes were insusceptible to most of the compounds. A representative bacteriocin was identified as a nukacin-related peptide whose inactivation reduced the capacity of the producer Staphylococcus epidermidis IVK45 to limit growth of other nasal bacteria. Of note, the bacteriocin genes were found on mobile genetic elements exhibiting signs of extensive horizontal gene transfer and rearrangements. Thus, continuously evolving bacteriocins appear to govern bacterial competition in the human nose and specific bacteriocins may become important agents for eradication of notorious opportunistic pathogens from human microbiota. PMID:27490492

  5. Differential fusion expression and purification of a cystatin in two different bacterial strains.

    PubMed

    Gholizadeh, A

    2013-01-01

    To date, the identification of the novel multifunctional properties of cysteine proteinase inhibitors "known as cystatins" is the great of interests for molecular biologists. The efficient production, purification and correctly folded form of these proteins are the most important requirements for their any basic research. To the best of our knowledge, maltose-binding protein (MBP) fusion tags are being used to overcome the impediment to their heterologous recombinant expression in Escherichia coli as insoluble and bio-inactive inclusion bodies. In the present work, to evaluate the expression efficiency of a cystatin molecule in E. coli cells by using MBP tags, the expression of Celosia cystatin was studied in two different strains of this bacterium. The quantitative analysis results based on the one-step purification yield of the fused product showed the excellency of the E. coli TB1 strain in comparison to E. coli DH5alpha for the high-level production of active product. PMID:24455860

  6. Algal and Bacterial Activities in Acidic (pH 3) Strip Mine Lakes

    PubMed Central

    Gyure, Ruth A.; Konopka, Allan; Brooks, Austin; Doemel, William

    1987-01-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H2S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H2S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by [14C]glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake. PMID:16347430

  7. [The research progress of succinic acid fermentation strains].

    PubMed

    Wang, Qing-Zhao; Zhao, Xue-Ming

    2007-07-01

    The potential of succinic acid as an important chemical intermediates had been realized and fermentation is one of the best ways to make it possible in economical aspect. Fermentation organism is the key part of the fermentation method. The updated research developments of fermentation organisms and the fermentation characteristics and problems of them were reviewed and analyzed in this paper. Finally,the development future of fermenation organism was forecasted. PMID:17822024

  8. Control of Shigatoxin-producing Escherichia coli in cheese by dairy bacterial strains.

    PubMed

    Callon, Cécile; Arliguie, Céline; Montel, Marie-Christine

    2016-02-01

    Bio-preservation could be a valuable way to control Shigatoxin-producing Escherichia coli (STEC) in cheese. To this end, 41 strains were screened for their inhibitory potential on model cheese curd and on pasteurized and raw milk uncooked pressed cheeses. Strains of Lactococcus lactis, Lactococcus garvieae, Leuconostoc pseudomesenteroides, Leuconostoc citreum, Lactobacillus sp, Carnobacterium mobile, Enterococcus faecalis, Enterococcus faecium, Macrococcus caseolyticus and Hafnia alvei reduced STEC O26:H11 counts by 1.4-2.5 log cfu g(-1) and to a lesser extent STEC O157:H7 counts in pasteurized milk cheeses. Some strains can act in synergy to inhibit STEC in raw milk uncooked pressed cheeses. Inhibitory associations had no adverse effect on the sensory characteristics of these cheeses. The association of H. alvei, Lactobacillus plantarum and Lc. lactis was the most inhibitory: after inoculation of this consortium into milk, STEC O26:H11 and O157:H7, inoculated at 2 log cfu ml(-1), were reduced by up to 3 log cfu g(-1) in ripened cheese. Inhibition in cheese cannot be predicted from H2O2 production in BHI medium, decreased pH or milk reduction. It is not clear what role the rapid decrease in pH during the first 6 h may play in the inhibition. Further studies will be needed to determine the nature of the inhibition. PMID:26678131

  9. Towards a tolerance toolkit: Gene expression signatures enabling the emergence of resistant bacterial strains

    NASA Astrophysics Data System (ADS)

    Erickson, Keesha; Chatterjee, Anushree

    2014-03-01

    Microbial pathogens are able to rapidly acquire tolerance to chemical toxins. Developing next-generation antibiotics that impede the emergence of resistance will help avoid a world-wide health crisis. Conversely, the ability to induce rapid tolerance gains could lead to high-yielding strains for sustainable production of biofuels and commodity chemicals. Achieving these goals requires an understanding of the general mechanisms allowing microbes to become resistant to diverse toxins. We apply top-down and bottom-up methodologies to identify biological network changes leading to adaptation and tolerance. Using a top-down approach, we perform evolution experiments to isolate resistant strains, collect samples for transcriptomic and proteomic analysis, and use the omics data to inform mathematical gene regulatory models. Using a bottom-up approach, we build and test synthetic genetic devices that enable increased or decreased expression of selected genes. Unique patterns in gene expression are identified in cultures actively gaining resistance, especially in pathways known to be involved with stress response, efflux, and mutagenesis. Genes correlated with tolerance could potentially allow the design of resistance-free antibiotics or robust chemical production strains.

  10. Assessment of Heat Resistance of Bacterial Spores from Food Product Isolates by Fluorescence Monitoring of Dipicolinic Acid Release

    PubMed Central

    Kort, Remco; O'Brien, Andrea C.; van Stokkum, Ivo H. M.; Oomes, Suus J. C. M.; Crielaard, Wim; Hellingwerf, Klaas J.; Brul, Stanley

    2005-01-01

    This study is aimed at the development and application of a convenient and rapid optical assay to monitor the wet-heat resistance of bacterial endospores occurring in food samples. We tested the feasibility of measuring the release of the abundant spore component dipicolinic acid (DPA) as a probe for heat inactivation. Spores were isolated from the laboratory type strain Bacillus subtilis 168 and from two food product isolates, Bacillus subtilis A163 and Bacillus sporothermodurans IC4. Spores from the lab strain appeared much less heat resistant than those from the two food product isolates. The decimal reduction times (D values) for spores from strains 168, A163, and IC4 recovered on Trypticase soy agar were 1.4, 0.7, and 0.3 min at 105°C, 120°C, and 131°C, respectively. The estimated Z values were 6.3°C, 6.1°C, and 9.7°C, respectively. The extent of DPA release from the three spore crops was monitored as a function of incubation time and temperature. DPA concentrations were determined by measuring the emission at 545 nm of the fluorescent terbium-DPA complex in a microtiter plate fluorometer. We defined spore heat resistance as the critical DPA release temperature (Tc), the temperature at which half the DPA content has been released within a fixed incubation time. We found Tc values for spores from Bacillus strains 168, A163, and IC4 of 108°C, 121°C, and 131°C, respectively. On the basis of these observations, we developed a quantitative model that describes the time and temperature dependence of the experimentally determined extent of DPA release and spore inactivation. The model predicts a DPA release rate profile for each inactivated spore. In addition, it uncovers remarkable differences in the values for the temperature dependence parameters for the rate of spore inactivation, DPA release duration, and DPA release delay. PMID:16000762

  11. Acetic Acid Acts as a Volatile Signal To Stimulate Bacterial Biofilm Formation

    PubMed Central

    Chen, Yun; Gozzi, Kevin; Yan, Fang

    2015-01-01

    ABSTRACT Volatiles are small air-transmittable chemicals with diverse biological activities. In this study, we showed that volatiles produced by the bacterium Bacillus subtilis had a profound effect on biofilm formation of neighboring B. subtilis cells that grew in proximity but were physically separated. We further demonstrated that one such volatile, acetic acid, is particularly potent in stimulating biofilm formation. Multiple lines of genetic evidence based on B. subtilis mutants that are defective in either acetic acid production or transportation suggest that B. subtilis uses acetic acid as a metabolic signal to coordinate the timing of biofilm formation. Lastly, we investigated how B. subtilis cells sense and respond to acetic acid in regulating biofilm formation. We showed the possible involvement of three sets of genes (ywbHG, ysbAB, and yxaKC), all encoding putative holin-antiholin-like proteins, in cells responding to acetic acid and stimulating biofilm formation. All three sets of genes were induced by acetate. A mutant with a triple mutation of those genes showed a severe delay in biofilm formation, whereas a strain overexpressing ywbHG showed early and robust biofilm formation. Results of our studies suggest that B. subtilis and possibly other bacteria use acetic acid as a metabolic signal to regulate biofilm formation as well as a quorum-sensing-like airborne signal to coordinate the timing of biofilm formation by physically separated cells in the community. PMID:26060272

  12. Interaction of Aeromonas Strains with Lactic Acid Bacteria via Caco-2 Cells

    PubMed Central

    Hatje, E.; Neuman, C.

    2014-01-01

    The genus Aeromonas includes some species that have now been identified as human pathogens of significant medical importance. We investigated the ability of 13 selected Aeromonas strains belonging to nine species isolated from clinical cases (n = 5), environmental waters (n = 5), and fish (n = 3) to adhere to and translocate Caco-2 cells in the absence and presence of two lactic acid bacteria (LAB), i.e., Lactobacillus acidophilus and Bifidobacterium breve. Aeromonas isolates were also assessed for their cytotoxicity, the presence of virulence genes, and hemolysin production. Among the clinical isolates, one strain of Aeromonas veronii biovar veronii and two strains of Aeromonas hydrophila carried cytotoxin (act), heat-labile toxin (alt), hemolysin (hlyA), and aerolysin (aerA) genes, were cytotoxic to Vero cells, produced hemolysin, and showed higher adherence to Caco-2 cells. In contrast, this was seen in only one environmental strain, a strain of A. veronii biovar sobria. When Aeromonas strains were coinoculated with LAB onto Caco-2 cells, their level of adhesion was reduced. However, their rate of translocation in the presence of LAB increased and was significantly (P < 0.05) higher among fish strains. We suggest that either the interaction between Aeromonas and LAB strains could have a detrimental effect on the Caco-2 cells, allowing the Aeromonas to translocate more readily, or the presence of the LAB stimulated the Aeromonas strains to produce more toxins and/or increase their translocation rate. PMID:24242240

  13. Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.

    2012-07-01

    Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.

  14. Acetic Acid Bacterial Biota of the Pink Sugar Cane Mealybug, Saccharococcus sacchari, and Its Environs

    PubMed Central

    Ashbolt, Nicholas J.; Inkerman, Peter A.

    1990-01-01

    Saccharococcus sacchari is the primary colonizer of the developing “sterile” tissue between the leaf sheath and stem of sugar cane. The honeydew secreted by the mealybugs is acidic (about pH 3) and supports an atypical epiphytic microbiota dominated by acetobacter-like bacteria and acidophilic yeast species. However, Erwinia and Leuconostoc species predominate within the leaf sheath pocket region when the mealybugs die out. The unidentified acetobacters were readily isolated from S. sacchari throughout its life cycle and from other genera of mealybugs on sugar cane and various other plants, both above and below ground. No other insect present on sugar cane was a significant vector of acetic acid bacteria. The major factors restricting microbial diversity within the environs of mealybugs were considered to be yeast activity along with bacterial production of acetic acid, ketogluconic acids, and gamma-pyrones, in association with their lowering of pH. The microbial products may aid in suppressing the attack by the parasitic mold Aspergillus parasiticus on mealybugs but could act as attractants for the predatory fruit fly Cacoxenus perspicax. PMID:16348144

  15. Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.

    PubMed

    Kaul, Tiffany K; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V; Kapahi, Pankaj; Gill, Matthew S

    2014-01-01

    The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit. PMID:24475206

  16. Development of a bacterial bioassay for atrazine and cyanuric acid detection

    PubMed Central

    Hua, Anna; Gueuné, Hervé; Cregut, Mickaël; Thouand, Gérald; Durand, Marie-José

    2015-01-01

    The s-triazine herbicides are compounds which can disseminate into soils and water. Due to their toxic effects on living organisms, their concentrations in drinking water are legislated by WHO recommendations. Here we have developed for the first time, to the best of our knowledge, an alternative method for physicochemical quantification using two bioluminescent bacterial biosensors: E. coli SM003 for cyanuric acid detection and E. coli SM004 for both atrazine and cyanuric acid detection. The concentration of cyanuric acid detection for E. coli SM003 ranges from 7.83 μM to 2.89 mM, and for E. coli SM004 ranges from 0.22 to 15 μM. Moreover, atrazine detection by E. coli SM004 ranges from 1.08 to 15 μM. According to WHO recommendations, the cyanuric acid detection range is sensitive enough to discriminate between polluted and drinking water. Nevertheless, the detection of atrazine by E. coli SM004 is only applicable for high concentrations of contaminants. PMID:25852669

  17. Utilization of corncob acid hydrolysate for bacterial cellulose production by Gluconacetobacter xylinus.

    PubMed

    Huang, Chao; Yang, Xiao-Yan; Xiong, Lian; Guo, Hai-Jun; Luo, Jun; Wang, Bo; Zhang, Hai-Rong; Lin, Xiao-Qing; Chen, Xin-De

    2015-02-01

    In this study, corncob acid hydrolysate was used as a substrate for bacterial cellulose (BC) production by Gluconacetobacter xylinus. After 2 weeks' static fermentation, a BC yield of 4 g/L could be obtained. Both effects of medium composition and fermentation condition on the BC production were evaluated. Most extra substrates (carbon and nitrogen sources) except mannitol, butyric acid, and levulinic acid showed no effect on the improvement of BC yield. Fermentation condition including fermentation mode, inoculation concentration, and initial pH showed certain influence on the BC yield and thus should be well controlled. The analysis by field emission scanning electron microscope (FE-SEM), Fourier transform infrared spectroscopy (FTIR), and X-ray diffraction (XRD) showed that the BC sample had obvious nano-network structure, clear functional groups that were found in cellulose, and relatively high crystallinity and crystallinity index value. Moreover, the BC sample had great water-holding capacity. Overall, corncob acid hydrolysate could be one promising substrate for BC production. PMID:25422061

  18. Diversity of Lactobacillus reuteri Strains in Converting Glycerol into 3-Hydroxypropionic Acid.

    PubMed

    Burgé, G; Saulou-Bérion, C; Moussa, M; Pollet, B; Flourat, A; Allais, F; Athès, V; Spinnler, H E

    2015-10-01

    The present study aims at comparing the performances of three Lactobacillus reuteri strains (DSM 20016, DSM 17938, and ATCC 53608) in producing 3-hydroxypropionic acid (3-HP) from glycerol and at exploring inhibition phenomena during this bioconversion. Differences were highlighted between the three strains in terms of 3-HP production yield, kinetics of substrate consumption, and metabolite production. With a maximal productivity in non-optimal conditions (free pH) around 2 g.L(-1).h(-1) of 3-HP and 4 g.L(-1).h(-1) of 3-hydroxypropionaldehyde (3-HPA) depending on the strain, this study confirmed the potential of L. reuteri for the biotechnological production of 3-HP. Moreover, the molar ratios of 3-HP to 1,3-propanediol (1,3-PDO) obtained for the three strains (comprised between 1.25 and 1.65) showed systematically a higher 3-HP production. From these results, the DSM 17938 strain appeared to be the most promising strain. The impact of glycerol bioconversion on the bacteria's physiological state (a decrease of around 40 % in DSM 17938 cells showing an enzymatic activity after 3 h) and survival (total loss of cultivability after 2 or 3 h depending on the strains) was revealed and discussed. The effect of each metabolite on L. reuteri DSM 17938 was further investigated, displaying a drastic inhibition caused by 3-HPA, while 3-HP induced lower impact and only at acidic pH. PMID:26319567

  19. Lactic Acid Production from Pretreated Hydrolysates of Corn Stover by a Newly Developed Bacillus coagulans Strain.

    PubMed

    Jiang, Ting; Qiao, Hui; Zheng, Zhaojuan; Chu, Qiulu; Li, Xin; Yong, Qiang; Ouyang, Jia

    2016-01-01

    An inhibitor-tolerance strain, Bacillus coagulans GKN316, was developed through atmospheric and room temperature plasma (ARTP) mutation and evolution experiment in condensed dilute-acid hydrolysate (CDH) of corn stover. The fermentabilities of other hydrolysates with B. coagulans GKN316 and the parental strain B. coagulans NL01 were assessed. When using condensed acid-catalyzed steam-exploded hydrolysate (CASEH), condensed acid-catalyzed liquid hot water hydrolysate (CALH) and condensed acid-catalyzed sulfite hydrolysate (CASH) as substrates, the concentration of lactic acid reached 45.39, 16.83, and 18.71 g/L by B. coagulans GKN316, respectively. But for B. coagulans NL01, only CASEH could be directly fermented to produce 15.47 g/L lactic acid. The individual inhibitory effect of furfural, 5-hydroxymethylfurfural (HMF), vanillin, syringaldehyde and p-hydroxybenzaldehyde (pHBal) on xylose utilization by B. coagulans GKN316 was also studied. The strain B. coagulans GKN316 could effectively convert these toxic inhibitors to the less toxic corresponding alcohols in situ. These results suggested that B. coagulans GKN316 was well suited to production of lactic acid from undetoxified lignocellulosic hydrolysates. PMID:26863012

  20. Succinic acid production from xylose mother liquor by recombinant Escherichia coli strain

    PubMed Central

    Wang, Honghui; Pan, Jiachuan; Wang, Jing; Wang, Nan; Zhang, Jie; Li, Qiang; Wang, Dan; Zhou, Xiaohua

    2014-01-01

    Succinic acid (1,4-butanedioic acid) is identified as one of important building-block chemicals. Xylose mother liquor is an abundant industrial residue in xylitol biorefining industry. In this study, xylose mother liquor was utilized to produce succinic acid by recombinant Escherichia coli strain SD121, and the response surface methodology was used to optimize the fermentation media. The optimal conditions of succinic acid fermentation were as follows: 82.62 g L−1 total initial sugars, 42.27 g L−1 MgCO3 and 17.84 g L−1 yeast extract. The maximum production of succinic acid was 52.09 ± 0.21 g L−1 after 84 h with a yield of 0.63 ± 0.03 g g−1 total sugar, approaching the predicted value (53.18 g L−1). It was 1.78-fold of the production of that obtained with the basic medium. This was the first report on succinic acid production from xylose mother liquor by recombinant E. coli strains with media optimization using response surface methodology. This work suggested that the xylose mother liquor could be an alternative substrate for the economical production of succinic acid by recombinant E. coli strains. PMID:26019590

  1. Lactic Acid Production from Pretreated Hydrolysates of Corn Stover by a Newly Developed Bacillus coagulans Strain

    PubMed Central

    Jiang, Ting; Qiao, Hui; Zheng, Zhaojuan; Chu, Qiulu; Li, Xin; Yong, Qiang; Ouyang, Jia

    2016-01-01

    An inhibitor-tolerance strain, Bacillus coagulans GKN316, was developed through atmospheric and room temperature plasma (ARTP) mutation and evolution experiment in condensed dilute-acid hydrolysate (CDH) of corn stover. The fermentabilities of other hydrolysates with B. coagulans GKN316 and the parental strain B. coagulans NL01 were assessed. When using condensed acid-catalyzed steam-exploded hydrolysate (CASEH), condensed acid-catalyzed liquid hot water hydrolysate (CALH) and condensed acid-catalyzed sulfite hydrolysate (CASH) as substrates, the concentration of lactic acid reached 45.39, 16.83, and 18.71 g/L by B. coagulans GKN316, respectively. But for B. coagulans NL01, only CASEH could be directly fermented to produce 15.47 g/L lactic acid. The individual inhibitory effect of furfural, 5-hydroxymethylfurfural (HMF), vanillin, syringaldehyde and p-hydroxybenzaldehyde (pHBal) on xylose utilization by B. coagulans GKN316 was also studied. The strain B. coagulans GKN316 could effectively convert these toxic inhibitors to the less toxic corresponding alcohols in situ. These results suggested that B. coagulans GKN316 was well suited to production of lactic acid from undetoxified lignocellulosic hydrolysates. PMID:26863012

  2. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120

    PubMed Central

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-01-01

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion. PMID:25915115

  3. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120.

    PubMed

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-01-01

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion. PMID:25915115

  4. Bioconversion of styrene to poly(hydroxyalkanoate) (PHA) by the new bacterial strain Pseudomonas putida NBUS12.

    PubMed

    Tan, Giin-Yu Amy; Chen, Chia-Lung; Ge, Liya; Li, Ling; Tan, Swee Ngin; Wang, Jing-Yuan

    2015-01-01

    Styrene is a toxic pollutant commonly found in waste effluents from plastic processing industries. We herein identified and characterized microorganisms for bioconversion of the organic eco-pollutant styrene into a valuable biopolymer medium-chain-length poly(hydroxyalkanoate) (mcl-PHA). Twelve newly-isolated styrene-degrading Pseudomonads were obtained and partial phaC genes were detected by PCR in these isolates. These isolates assimilated styrene to produce mcl-PHA, forming PHA contents between 0.05±0.00 and 23.10±3.25% cell dry mass (% CDM). The best-performing isolate was identified as Pseudomonas putida NBUS12. A genetic analysis of 16S rDNA and phaZ genes revealed P. putida NBUS12 as a genetically-distinct strain from existing phenotypically-similar bacterial strains. This bacterium achieved a final biomass of 1.28±0.10 g L(-1) and PHA content of 32.49±2.40% CDM. The extracted polymer was mainly comprised of 3-hydroxyhexanoate (C6 ), 3-hydroxyoctanoate (C8 ), 3-hydroxydecanoate (C10 ), 3-hydroxydodecanoate (C12 ), and 3-hydroxytetradecanoate (C14 ) monomers at a ratio of 2:42:1257:17:1. These results collectively suggested that P. putida NBUS12 is a promising candidate for the biotechnological conversion of styrene into mcl-PHA. PMID:25740622

  5. Mouse hepatitis virus strain UAB infection enhances resistance to Salmonella typhimurium in mice by inducing suppression of bacterial growth.

    PubMed Central

    Fallon, M T; Benjamin, W H; Schoeb, T R; Briles, D E

    1991-01-01

    We have previously shown that intranasal infection of mice with mouse hepatitis virus (MHV) strain UAB (MHV-UAB) increases their resistance to Salmonella typhimurium injected intravenously 6 days later. To study how salmonella resistance was induced, BALB/cAnNCr mice were infected with salmonella strains carrying specific genetic alterations. One set of studies compared the effect of MHV infection on subsequent salmonella infections with AroA- (avirulent) and Aro+ (virulent) salmonellae. Unlike its effect on Aro+ salmonellae, MHV failed to reduce the number of AroA- salmonellae recovered from mice. Because AroA- S. typhimurium shows almost no growth in vivo, this failure indicated that the effect of MHV on salmonella resistance required growth of the infecting salmonellae. In other studies, the effect of MHV infection on both growth and killing were monitored simultaneously in mice with growing salmonellae carrying a single copy of the temperature-sensitive pHSG422 plasmid, which is unable to replicate in vivo. MHV infection reduced salmonella growth but caused no increase in salmonella killing. MHV infection of mice given wild-type salmonellae also resulted in no increase in salmonella killing 4 h after salmonella challenge. These studies demonstrate that MHV-UAB infection increases host resistance to salmonellae by enhancing suppression of bacterial growth instead of by increasing the amount of salmonella killing. PMID:1847697

  6. Bioconversion of Styrene to Poly(hydroxyalkanoate) (PHA) by the New Bacterial Strain Pseudomonas putida NBUS12

    PubMed Central

    Tan, Giin-Yu Amy; Chen, Chia-Lung; Ge, Liya; Li, Ling; Tan, Swee Ngin; Wang, Jing-Yuan

    2015-01-01

    Styrene is a toxic pollutant commonly found in waste effluents from plastic processing industries. We herein identified and characterized microorganisms for bioconversion of the organic eco-pollutant styrene into a valuable biopolymer medium-chain-length poly(hydroxyalkanoate) (mcl-PHA). Twelve newly-isolated styrene-degrading Pseudomonads were obtained and partial phaC genes were detected by PCR in these isolates. These isolates assimilated styrene to produce mcl-PHA, forming PHA contents between 0.05±0.00 and 23.10±3.25% cell dry mass (% CDM). The best-performing isolate was identified as Pseudomonas putida NBUS12. A genetic analysis of 16S rDNA and phaZ genes revealed P. putida NBUS12 as a genetically-distinct strain from existing phenotypically-similar bacterial strains. This bacterium achieved a final biomass of 1.28±0.10 g L−1 and PHA content of 32.49±2.40% CDM. The extracted polymer was mainly comprised of 3-hydroxyhexanoate (C6 ), 3-hydroxyoctanoate (C8 ), 3-hydroxydecanoate (C10 ), 3-hydroxydodecanoate (C12 ), and 3-hydroxytetradecanoate (C14 ) monomers at a ratio of 2:42:1257:17:1. These results collectively suggested that P. putida NBUS12 is a promising candidate for the biotechnological conversion of styrene into mcl-PHA. PMID:25740622

  7. Detection of traces of tetracyclines from fish with a bioluminescent sensor strain incorporating bacterial luciferase reporter genes.

    PubMed

    Pellinen, Teijo; Bylund, Göran; Virta, Marko; Niemi, Anneli; Karp, Matti

    2002-08-14

    Bioluminescent Escherichia coli K-12 strain for the specific detection of the tetracycline family of antimicrobial agents was optimized to work with fish samples. The biosensing strain contains a plasmid incorporating the bacterial luciferase operon of Photorhabdus luminescens under the control of the tetracycline responsive element from transposon Tn10 (Korpela et al. Anal. Chem. 1998, 70, 4457-4462). The extraction procedure of oxytetracycline from rainbow trout (Oncorhynchus mykiss) tissue was optimized. There was neither need for centrifugation of homogenized tissue nor use of organic solvents. The lowest levels of detection of tetracycline and oxytetracycline from spiked fish tissue were 20 and 50 microg/kg, respectively, in a 2-h assay. The optimized assay protocol was tested with fish that were given a single oral dose of high and low concentrations of oxytetracycline. The assay was able to detect oxytetracycline residues below the European Union maximum residue limits, and the results correlated well with those obtained by conventional HPLC (R = 0.81). PMID:12166964

  8. Genome sequencing and systems biology analysis of a lipase-producing bacterial strain.

    PubMed

    Li, N; Li, D D; Zhang, Y Z; Yuan, Y Z; Geng, H; Xiong, L; Liu, D L

    2016-01-01

    Lipase-producing bacteria are naturally-occurring, industrially-relevant microorganisms that produce lipases, which can be used to synthesize biodiesel from waste oils. The efficiency of lipase expression varies between various microbial strains. Therefore, strains that can produce lipases with high efficiency must be screened, and the conditions of lipase metabolism and optimization of the production process in a given environment must be thoroughly studied. A high efficiency lipase-producing strain was isolated from the sediments of Jinsha River, identified by 16S rRNA sequence analysis as Serratia marcescens, and designated as HS-L5. A schematic diagram of the genome sequence was constructed by high-throughput genome sequencing. A series of genes related to lipid degradation were identified by functional gene annotation through sequence homology analysis. A genome-scale metabolic model of HS-ML5 was constructed using systems biology techniques. The model consisted of 1722 genes and 1567 metabolic reactions. The topological graph of the genome-scale metabolic model was compared to that of conventional metabolic pathways using a visualization software and KEGG database. The basic components and boundaries of the tributyrin degradation subnetwork were determined, and its flux balance analyzed using Matlab and COBRA Toolbox to simulate the effects of different conditions on the catalytic efficiency of lipases produced by HS-ML5. We proved that the catalytic activity of microbial lipases was closely related to the carbon metabolic pathway. As production and catalytic efficiency of lipases varied greatly with the environment, the catalytic efficiency and environmental adaptability of microbial lipases can be improved by proper control of the production conditions. PMID:27050954

  9. Efficient free fatty acid production in engineered Escherichia coli strains using soybean oligosaccharides as feedstock.

    PubMed

    Wang, Dan; Wu, Hui; Thakker, Chandresh; Beyersdorf, Jared; Bennett, George N; San, Ka-Yiu

    2015-01-01

    To be competitive with current petrochemicals, microbial synthesis of free fatty acids can be made to rely on a variety of renewable resources rather than on food carbon sources, which increase its attraction for governments and companies. Industrial waste soybean meal is an inexpensive feedstock, which contains soluble sugars such as stachyose, raffinose, sucrose, glucose, galactose, and fructose. Free fatty acids were produced in this report by introducing an acyl-ACP carrier protein thioesterase and (3R)-hydroxyacyl-ACP dehydratase into E. coli. Plasmid pRU600 bearing genes involved in raffinose and sucrose metabolism was also transformed into engineered E. coli strains, which allowed more efficient utilization of these two kinds of specific oligosaccharide present in the soybean meal extract. Strain ML103 (pRU600, pXZ18Z) produced ~1.60 and 2.66 g/L of free fatty acids on sucrose and raffinose, respectively. A higher level of 2.92 g/L fatty acids was obtained on sugar mixture. The fatty acid production using hydrolysate obtained from acid or enzyme based hydrolysis was evaluated. Engineered strains just produced ~0.21 g/L of free fatty acids with soybean meal acid hydrolysate. However, a fatty acid production of 2.61 g/L with a high yield of 0.19 g/g total sugar was observed on an enzymatic hydrolysate. The results suggest that complex mixtures of oligosaccharides derived from soybean meal can serve as viable feedstock to produce free fatty acids. Enzymatic hydrolysis acts as a much more efficient treatment than acid hydrolysis to facilitate the transformation of industrial waste from soybean processing to high value added chemicals. PMID:25919701

  10. Kinetics of D-lactic acid production by Sporolactobacillus sp. strain CASD using repeated batch fermentation.

    PubMed

    Zhao, Bo; Wang, Limin; Li, Fengsong; Hua, Dongliang; Ma, Cuiqing; Ma, Yanhe; Xu, Ping

    2010-08-01

    D-lactic acid was produced by Sporolactobacillus sp. strain CASD in repeated batch fermentation with one- and two-reactor systems. The strain showed relatively high energy consumption in its growth-related metabolism in comparison with other lactic acid producers. When the fermentation was repeated with 10% (v/v) of previous culture to start a new batch, D-lactic acid production shifted from being cell-maintenance-dependent to cell-growth-dependent. In comparison with the one-reactor system, D-lactic acid production increased approximately 9% in the fourth batch of the two-reactor system. Strain CASD is an efficient D-lactic acid producer with increased growth rate at the early stage of repeated cycles, which explains the strain's physiological adaptation to repeated batch culture and improved performance in the two-reactor fermentation system. From a kinetic point of view, two-reactor fermentation system was shown to be an alternative for conventional one-reactor repeated batch operation. PMID:20374976

  11. Bacterial Community Structure of Acid-Impacted Lakes: What Controls Diversity?▿ †

    PubMed Central

    Percent, Sascha F.; Frischer, Marc E.; Vescio, Paul A.; Duffy, Ellen B.; Milano, Vincenzo; McLellan, Maggie; Stevens, Brett M.; Boylen, Charles W.; Nierzwicki-Bauer, Sandra A.

    2008-01-01

    Although it is recognized that acidification of freshwater systems results in decreased overall species richness of plants and animals, little is known about the response of aquatic microbial communities to acidification. In this study we examined bacterioplankton community diversity and structure in 18 lakes located in the Adirondack Park (in the state of New York in the United States) that were affected to various degrees by acidic deposition and assessed correlations with 31 physical and chemical parameters. The pH of these lakes ranged from 4.9 to 7.8. These studies were conducted as a component of the Adirondack Effects Assessment Program supported by the U.S. Environmental Protection Agency. Thirty-one independent 16S rRNA gene libraries consisting of 2,135 clones were constructed from epilimnion and hypolimnion water samples. Bacterioplankton community composition was determined by sequencing and amplified ribosomal DNA restriction analysis of the clone libraries. Nineteen bacterial classes representing 95 subclasses were observed, but clone libraries were dominated by representatives of the Actinobacteria and Betaproteobacteria classes. Although the diversity and richness of bacterioplankton communities were positively correlated with pH, the overall community composition assessed by principal component analysis was not. The strongest correlations were observed between bacterioplankton communities and lake depth, hydraulic retention time, dissolved inorganic carbon, and nonlabile monomeric aluminum concentrations. While there was not an overall correlation between bacterioplankton community structure and pH, several bacterial classes, including the Alphaproteobacteria, were directly correlated with acidity. These results indicate that unlike more identifiable correlations between acidity and species richness for higher trophic levels, controls on bacterioplankton community structure are likely more complex, involving both direct and indirect processes. PMID

  12. Lactic acid bacteria activating innate immunity improve survival in bacterial infection model of silkworm.

    PubMed

    Nishida, Satoshi; Ono, Yasuo; Sekimizu, Kazuhisa

    2016-02-01

    Lactic acid bacteria (LAB) have been thought to be helpful for human heath in the gut as probiotics. It recently was noted that activity of LAB stimulating immune systems is important. Innate immune systems are conserved in mammals and insects. Silkworm has innate immunity in response to microbes. Microbe-associated molecular pattern (ex. peptidoglycan and β-glucan) induces a muscle contraction of silkworm larva. In this study, we established an efficient method to isolate lactic acid bacteria derived from natural products. We selected a highly active LAB to activate the innate immunity in silkworm by using the silkworm muscle contraction assay, as well. The assay revealed that Lactococcus lactis 11/19-B1 was highly active on the stimulation of the innate immunity in silkworm. L. lactis 11/19-B1 solely fermented milk with casamino acid and glucose. This strain would be a starter strain to make yogurt. Compared to commercially available yogurt LAB, L. lactis 11/19-B1 has higher activity on silkworm contraction. Silkworm normally ingested an artificial diet mixed with L. lactis 11/19-B1 or a yogurt fermented with L. lactis 11/19-B1. Interestingly, silkworms that ingested the LAB showed tolerance against the pathogenicity of Pseudomonas aeruginosa. These data suggest that Lactococcus lactis 11/19-B1 would be expected to be useful for making yogurt and probiotics to activate innate immunity. PMID:26971556

  13. Growth kinetics of a diesel-degrading bacterial strain from petroleum-contaminated soil.

    PubMed

    Dahalan, S F A; Yunus, I; Johari, W L W; Shukor, M Y; Halmi, M I E; Shamaan, N A; Syed, M A

    2014-03-01

    A diesel-degrading bacterium was isolated from a diesel-contaminated site in Selangor, Malaysia. The isolate was tentatively identified as Acinetobacter sp. strain DRY12 based on partial 16S rDNA molecular phylogeny and Biolog GN microplate panels and Microlog database. Optimum growth occurred from 3 to 5% diesel and the strain was able to tolerate as high as 8% diesel. The optimal pH that supported growth of the bacterium was between pH 7.5 to 8.0. The isolate exhibited optimal growth in between 30 and 35 degrees C. The best nitrogen source was potassium nitrate (between 0.6 and 0.9% (w/v)) followed by ammonium chloride, sodium nitrite and ammonium sulphate in descending order. An almost complete removal of diesel components was seen from the reduction in hydrocarbon peaks observed using Solid Phase Microextraction Gas Chromatography analysis after 10 days of incubation. The best growth kinetic model to fit experimental data was the Haldane model of substrate inhibiting growth with a correlation coefficient value of 0.97. The maximum growth rate- micromax was 0.039 hr(-1) while the saturation constant or half velocity constant Ks and inhibition constant Ki, were 0.387% and 4.46%, respectively. MATH assays showed that 75% of the bacterium was found in the hexadecane phase indicating that the bacterium was hydrophobic. The characteristics of this bacterium make it useful for bioremediation works in the Tropics. PMID:24665769

  14. Methods for producing 3-hydroxypropionic acid and other products

    DOEpatents

    Lynch, Michael D.; Gill, Ryan T.; Lipscomb, Tanya E. W.

    2016-07-12

    This invention relates to metabolically engineered microorganism strains, such as bacterial strains, in which there is an increased utilization of malonyl-CoA for production of a chemical product, which includes 3-hydroxypropionic acid.

  15. Adaptive laboratory evolution of ethanologenic Zymomonas mobilis strain tolerant to furfural and acetic acid inhibitors.

    PubMed

    Shui, Zong-Xia; Qin, Han; Wu, Bo; Ruan, Zhi-yong; Wang, Lu-shang; Tan, Fu-Rong; Wang, Jing-Li; Tang, Xiao-Yu; Dai, Li-Chun; Hu, Guo-Quan; He, Ming-Xiong

    2015-07-01

    Furfural and acetic acid from lignocellulosic hydrolysates are the prevalent inhibitors to Zymomonas mobilis during cellulosic ethanol production. Developing a strain tolerant to furfural or acetic acid inhibitors is difficul by using rational engineering strategies due to poor understanding of their underlying molecular mechanisms. In this study, strategy of adaptive laboratory evolution (ALE) was used for development of a furfural and acetic acid-tolerant strain. After three round evolution, four evolved mutants (ZMA7-2, ZMA7-3, ZMF3-2, and ZMF3-3) that showed higher growth capacity were successfully obtained via ALE method. Based on the results of profiling of cell growth, glucose utilization, ethanol yield, and activity of key enzymes, two desired strains, ZMA7-2 and ZMF3-3, were achieved, which showed higher tolerance under 7 g/l acetic acid and 3 g/l furfural stress condition. Especially, it is the first report of Z. mobilis strain that could tolerate higher furfural. The best strain, Z. mobilis ZMF3-3, has showed 94.84% theoretical ethanol yield under 3-g/l furfural stress condition, and the theoretical ethanol yield of ZM4 is only 9.89%. Our study also demonstrated that ALE method might also be used as a powerful metabolic engineering tool for metabolic engineering in Z. mobilis. Furthermore, the two best strains could be used as novel host for further metabolic engineering in cellulosic ethanol or future biorefinery. Importantly, the two strains may also be used as novel-tolerant model organisms for the genetic mechanism on the "omics" level, which will provide some useful information for inverse metabolic engineering. PMID:25935346

  16. Clostridium strain which produces acetic acid from waste gases

    DOEpatents

    Gaddy, J.L.

    1997-01-14

    A method and apparatus are disclosed for converting waste gases from industrial processes such as oil refining, carbon black, coke, ammonia, and methanol production, into useful products. The method includes introducing the waste gases into a bioreactor where they are fermented to various organic acids or alcohols by anaerobic bacteria within the bioreactor. These valuable end products are then recovered, separated and purified. In an exemplary recovery process, the bioreactor raffinate is passed through an extraction chamber into which one or more non-inhibitory solvents are simultaneously introduced to extract the product. Then, the product is separated from the solvent by distillation. Gas conversion rates can be maximized by use of centrifuges, hollow fiber membranes, or other means of ultrafiltration to return entrained anaerobic bacteria from the bioreactor raffinate to the bioreactor itself, thus insuring the highest possible cell concentration. 4 figs.

  17. Draft Genome Sequence of Paracoccus sp. MKU1, a New Bacterial Strain Isolated from an Industrial Effluent with Potential for Bioremediation

    PubMed Central

    Nisha, Kamaldeen Nasrin; Sridhar, Jayavel; Varalakshmi, Perumal; Ashokkumar, Balasubramaniem

    2016-01-01

    Paracoccus sp. MKU1, a novel dimethylformamide degrading bacterial strain was originally isolated from an industrial effluent, Tirupur region, Tamil Nadu, India. Here, we report the draft genome sequence of Paracoccus sp. MKU1, which could provide the genetic insights on its evolution and application of this versatile bacterium for effective degradation of xenobiotics and thus in bioremediation. PMID:27326263

  18. Draft Genome Sequence of Paracoccus sp. MKU1, a New Bacterial Strain Isolated from an Industrial Effluent with Potential for Bioremediation.

    PubMed

    Nisha, Kamaldeen Nasrin; Sridhar, Jayavel; Varalakshmi, Perumal; Ashokkumar, Balasubramaniem

    2016-01-01

    Paracoccus sp. MKU1, a novel dimethylformamide degrading bacterial strain was originally isolated from an industrial effluent, Tirupur region, Tamil Nadu, India. Here, we report the draft genome sequence of Paracoccus sp. MKU1, which could provide the genetic insights on its evolution and application of this versatile bacterium for effective degradation of xenobiotics and thus in bioremediation. PMID:27326263

  19. Multilocus sequence analysis of xanthomonads causing bacterial spot of tomato and pepper plants reveals strains generated by recombination among species and recent global spread of Xanthomonas gardneri.

    PubMed

    Timilsina, Sujan; Jibrin, Mustafa O; Potnis, Neha; Minsavage, Gerald V; Kebede, Misrak; Schwartz, Allison; Bart, Rebecca; Staskawicz, Brian; Boyer, Claudine; Vallad, Gary E; Pruvost, Olivier; Jones, Jeffrey B; Goss, Erica M

    2015-02-01

    Four Xanthomonas species are known to cause bacterial spot of tomato and pepper, but the global distribution and genetic diversity of these species are not well understood. A collection of bacterial spot-causing strains from the Americas, Africa, Southeast Asia, and New Zealand were characterized for genetic diversity and phylogenetic relationships using multilocus sequence analysis of six housekeeping genes. By examining strains from different continents, we found unexpected phylogeographic patterns, including the global distribution of a single multilocus haplotype of X. gardneri, possible regional differentiation in X. vesicatoria, and high species diversity on tomato in Africa. In addition, we found evidence of multiple recombination events between X. euvesicatoria and X. perforans. Our results indicate that there have been shifts in the species composition of bacterial spot pathogen populations due to the global spread of dominant genotypes and that recombination between species has generated genetic diversity in these populations. PMID:25527544

  20. Enhanced Acid Tolerance in Bifidobacterium longum by Adaptive Evolution: Comparison of the Genes between the Acid-Resistant Variant and Wild-Type Strain.

    PubMed

    Jiang, Yunyun; Ren, Fazheng; Liu, Songling; Zhao, Liang; Guo, Huiyuan; Hou, Caiyun

    2016-03-28

    Acid stress can affect the viability of probiotics, especially Bifidobacterium. This study aimed to improve the acid tolerance of Bifidobacterium longum BBMN68 using adaptive evolution. The stress response, and genomic differences of the parental strain and the variant strain were compared by acid stress. The highest acid-resistant mutant strain (BBMN68m) was isolated from more than 100 asexual lines, which were adaptive to the acid stress for 10(th), 20(th), 30(th), 40(th), and 50(th) repeats, respectively. The variant strain showed a significant increase in acid tolerance under conditions of pH 2.5 for 2 h (from 7.92 to 4.44 log CFU/ml) compared with the wildtype strain (WT, from 7.87 to 0 log CFU/ml). The surface of the variant strain was also smoother. Comparative whole-genome analysis showed that the galactosyl transferase D gene (cpsD, bbmn68_1012), a key gene involved in exopolysaccharide (EPS) synthesis, was altered by two nucleotides in the mutant, causing alteration in amino acids, pI (from 8.94 to 9.19), and predicted protein structure. Meanwhile, cpsD expression and EPS production were also reduced in the variant strain (p < 0.05) compared with WT, and the exogenous WT-EPS in the variant strain reduced its acid-resistant ability. These results suggested EPS was related to acid responses of BBMN68. PMID:26608165

  1. Antibacterial action of doped CoFe2O4 nanocrystals on multidrug resistant bacterial strains.

    PubMed

    Velho-Pereira, S; Noronha, A; Mathias, A; Zakane, R; Naik, V; Naik, P; Salker, A V; Naik, S R

    2015-01-01

    The bactericidal effect of pristine and doped cobalt ferrite nanoparticles has been evaluated against multiple drug resistant clinical strains by assessing the number of colony-forming units (CFU). Monophasic polycrystalline ferrites have been prepared by the malate-glycolate sol-gel autocombustion method as confirmed by the X-ray diffraction study. Various changes occurring during the preparative stages have been demonstrated using TG-DTA analysis which is well complemented by the FTIR spectroscopy. The antibacterial studies carried out demonstrate a bactericidal effect of the nanoparticles wherein the number of CFU has been found to decrease with doping. Cellular distortions have been revealed through SEM. Variation in the number of CFU with dopant type has also been reported herein. PMID:25953569

  2. Bacterial strains isolated from eggs and their resistance to currently used antibiotics: is there a health hazard for consumers?

    PubMed

    Papadopoulou, C; Dimitriou, D; Levidiotou, S; Gessouli, H; Panagiou, A; Golegou, S; Antoniades, G

    1997-01-01

    In order to study the putative transfer of antibiotic resistance from poultry to humans, hens' eggs were examined for the presence of various pathogens. Staphylococcus, Enterobacter, Escherichia, Proteus and Pseudomonas spp. were the most frequently isolated genera. Sensitivity tests, performed with the Kirby-Bauer technique, showed the presence of resistant strains of Staphylococcus aureus (to penicillin-G, tetracycline, erythromycin, clindamycin, cefalosporins, oxacillin, gentamycin, chloramphenicol and tobramycin), Enterococcus faecalis (to ampicillin, ciprofloxacin, clindamycin, gentamycin and tetracyclin), Escherichia coli (to tetracycline, erythromycin, ampicillin and cefalosporins), Enterobacter cloacae (to ampicillin, amoxycillin plus clavunalic acid, erythromycin and tetracycline), Pseudomonas stutzeri (to erythromycin and chlorampenicol) and Citrobacter freundii (to ampicillin, amoxycillin plus clavunalic acid, cefalosporins and co-trimoxazole). PMID:9023039

  3. Functional role of pyruvate kinase from Lactobacillus bulgaricus in acid tolerance and identification of its transcription factor by bacterial one-hybrid

    PubMed Central

    Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling

    2015-01-01

    Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5′-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5′-TGTAAGCCCTAACA-3′) upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network. PMID:26581248

  4. Strain improvement of Lactobacillus lactis for D-lactic acid production.

    PubMed

    Joshi, D S; Singhvi, M S; Khire, J M; Gokhale, D V

    2010-04-01

    Three mutants, isolated by repeated UV mutagenesis of Lactobacillus lactis NCIM 2368, produced increased D: -lactic acid concentrations. These mutants were compared with the wild type using 100 g hydrolyzed cane sugar/l in the fermentation medium. One mutant, RM2-24, produced 81 g lactic acid/l which was over three times that of the wild type. The highest D: -lactic acid (110 g/l) in batch fermentation was obtained with 150 g cane sugar/l with a 73% lactic acid yield. The mutant utilizes cellobiose efficiently, converting it into D-lactic acid suggesting the presence of cellobiase. Thus, this strain could be used to obtain D-lactic acid from cellulosic materials that are pre-hydrolyzed with cellulase. PMID:20033833

  5. Probiotic potential of selected lactic acid bacteria strains isolated from Brazilian kefir grains.

    PubMed

    Leite, A M O; Miguel, M A L; Peixoto, R S; Ruas-Madiedo, P; Paschoalin, V M F; Mayo, B; Delgado, S

    2015-06-01

    A total of 34 lactic acid bacteria isolates from 4 different Brazilian kefir grains were identified and characterized among a group of 150 isolates, using the ability to tolerate acidic pH and resistance to bile salts as restrictive criteria for probiotic potential. All isolates were identified by amplified ribosomal DNA restriction analysis and 16S rDNA sequencing of representative amplicons. Eighteen isolates belonged to the species Leuconostoc mesenteroides, 11 to Lactococcus lactis (of which 8 belonged to subspecies cremoris and 3 to subspecies lactis), and 5 to Lactobacillus paracasei. To exclude replicates, a molecular typing analysis was performed by combining repetitive extragenic palindromic-PCR and random amplification of polymorphic DNA techniques. Considering a threshold of 90% similarity, 32 different strains were considered. All strains showed some antagonistic activity against 4 model food pathogens. In addition, 3 Lc. lactis strains and 1 Lb. paracasei produced bacteriocin-like inhibitory substances against at least 2 indicator organisms. Moreover, 1 Lc. lactis and 2 Lb. paracasei presented good total antioxidative activity. None of these strains showed undesirable enzymatic or hemolytic activities, while proving susceptible or intrinsically resistant to a series of clinically relevant antibiotics. The Lb. paracasei strain MRS59 showed a level of adhesion to human Caco-2 epithelial cells comparable with that observed for Lactobacillus rhamnosus GG. Taken together, these properties allow the MRS59 strain to be considered a promising probiotic candidate. PMID:25841972

  6. Seasonal changes in dominant bacterial taxa from acidic peatlands of the Atlantic Rain Forest.

    PubMed

    Etto, Rafael Mazer; Cruz, Leonardo Magalhães; da Conceição Jesus, Ederson; Galvão, Carolina Weigert; Galvão, Franklin; de Souza, Emanuel Maltempi; de Oliveira Pedrosa, Fábio; Reynaud Steffens, Maria Berenice

    2014-09-01

    The acidic peatlands of southern Brazil are essential for maintenance of the Atlantic Rain Forest, one of the 25 hot-spots of biodiversity in the world. While these ecosystems are closely linked to conservation issues, their microbial community ecology and composition remain unknown. In this work, histosol samples were collected from three acidic peatland regions during dry and rainy seasons and their chemical and microbial characteristics were evaluated. Culturing and culture-independent approaches based on SSU rRNA gene pyrosequencing were used to survey the bacterial community and to identify environmental factors affecting the biodiversity and microbial metabolic potential of the Brazilian peatlands. All acidic peatlands were dominated by the Acidobacteria phylum (56-22%) followed by Proteobacteria (28-12%). The OTU richness of these phyla and the abundance of their Gp1, Gp2, Gp3, Gp13, Rhodospirillales and Caulobacteriales members varied according to the period of collection and significantly correlated with the rainy season. However, despite changes in acidobacterial and proteobacterial communities, rainfall did not affect the microbial metabolic potential of the southern Brazilian Atlantic Rain Forest peatlands, as judged by the metabolic capabilities of the microbial community. PMID:24893336

  7. Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

    PubMed

    Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

    2015-07-01

    The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells. PMID:25940300

  8. Antagonistic effects of α-tocopherol and ursolic acid on model bacterial membranes.

    PubMed

    Broniatowski, Marcin; Flasiński, Michał; Hąc-Wydro, Katarzyna

    2015-10-01

    α-tocopherol (Toc), the most active component of vitamin E can exert antagonistic effects disabling the therapy of cancers and bacterial infections. Such antagonisms were observed also between Toc and bioactive pentacyclic triterpenes (PT) exhibiting anticancer and antibacterial properties. Both Toc and PT are water-insoluble membrane active substances. Thus, our idea was to emulate their interactions with model Escherichia coli membranes. E. coli inner membranes were selected for the experiments because their lipid composition is quite simple and well characterized and the two main components are phosphatidylethanolamine and phosphatidylglycerol. As a model of E. coli membranes we applied Langmuir monolayers formed by the E. coli total extract of polar lipids (Etotal) as well as by the main lipid components: phosphatidylethanolamine (POPE) and phosphatidylglycerol (ECPG). The antagonistic effects of ursolic acid (Urs) and Toc were investigated with the application of ternary Langmuir monolayers formed by Urs, Toc and one of the phospholipids POPE or ECPG. Our studies indicated that the affinities of Urs and Toc towards the POPE molecule are comparable; whereas there are profound differences in the interactions of Urs and Toc with ECPG. Thus, the model experiments prove that in the case of E. coli membrane, the differences in the interactions between Urs and Toc with the anionic bacterial phosphatidylglycerol can be the key factor responsible for the antagonistic effects observed between PT and Toc in vivo. PMID:26003534

  9. Viability and Effects on Bacterial Proteins by Oral Rinses with Hypochlorous Acid as Active Ingredient.

    PubMed

    Castillo, Diana Marcela; Castillo, Yormaris; Delgadillo, Nathaly Andrea; Neuta, Yineth; Jola, Johana; Calderón, Justo Leonardo; Lafaurie, Gloria Inés

    2015-10-01

    This study investigated the effect of hypochlorous acid (HOCl) rinses and chlorhexidine (CHX) on the bacterial viability of S. mutans, A. israelii, P. gingivalis, A. actinomycetemcomitans, E. corrodens, C. rectus, K. oxytoca, K. pneumoniae and E. cloacae. The percentage of live bacteria was tested by fluorescence method using Live/Dead kit(r) and BacLight (Molecular Probes(r)) and compared between groups by the Kruskal-Wallis and U Mann-Whitney tests with Bonferroni correction (p value<0.012). The effect of HOCl and CHX on total proteins of P. gingivalis and S. mutans was determined by SDS-PAGE. CHX showed a higher efficacy than HOCl against S. mutans, A. israelii, E. corrodens and E. cloacae (p<0.001) while HOCl was more effective than CHX against P. gingivalis, A. actinomycetemcomitans, C. rectus and K. oxytoca (p=0.001). CHX and HOCl had similar efficacy against K. pneumoniae. Proteins of P. gingivalis and S. mutans were affected similarly by HOCl and CHX. HOCl reduced the bacterial viability especially in periodontopathic bacteria, which may support its use in the control of subgingival biofilm in periodontal patients. PMID:26647939

  10. Draft Genome Sequence of the Butyric Acid Producer Clostridium tyrobutyricum Strain CIP I-776 (IFP923)

    PubMed Central

    Clément, Benjamin; Lopes Ferreira, Nicolas

    2016-01-01

    Here, we report the draft genome sequence of Clostridium tyrobutyricum CIP I-776 (IFP923), an efficient producer of butyric acid. The genome consists of a single chromosome of 3.19 Mb and provides useful data concerning the metabolic capacities of the strain. PMID:26941139

  11. SPECIES AND STRAIN COMPARISONS OF IMMUNOSUPPRESION BY 2-METHOXYETHANOL AND 2-METHOXYACETIC ACID

    EPA Science Inventory

    2-Methoxyethanol (ME) and its principal metabolite 2-methoxyacetic acid (MAA) have been shown in our laboratory to be immunosuppressive in male Fischer 344 rats. n this study several strains of 12 week old female rats and mice were used to compare the immunosuppressive activity o...

  12. The effect of ionizing radiation on amino acids and bacterial spores in different geo- and cosmochemical environments

    NASA Astrophysics Data System (ADS)

    Kminek, Gerhard

    In this thesis I have investigated the impact of ionizing radiation from the environment on the stability of bacterial spores and amino acids. I measured the radiolysis constant of amino acids and the inactivation constant of bacterial spores. To put these results in the context of a natural setting, I have selected four different cases and calculated the radiation environment for meteorites, the Martian subsurface, terrestrial halite fluid inclusions, and fossil bones. Bacterial spores exhibit a remarkable resistance to adverse environments and are the best example for the long-term survival of life forms. On a molecular level, amino acids are of particular interest because of their importance in biochemistry and their stability in the environment. The significance of amino acids, however, goes back to a time before life existed. The exogenous delivery of amino acids by meteorites might have been essential to provide the required supply of organic molecules for the origin of life on the Earth. There is one common threat, however, to the preservation of amino acids and bacterial spores in all known terrestrial and extraterrestrial environments: ionizing radiation. Amino acids in meteorites are exposed to radiation from internal radioactivity and space radiation. I show that this radiation decomposes substantial amounts of amino acids over time, indicating a higher exogenous delivery of amino acids to the early Earth. The total radiodecomposition since the synthesis of amino acids is between 23 and 68%. Radiodecomposition induces a certain fractionation in favor of smaller amino acids. Fossil bones show a post-mortem uranium uptake. My results suggest a substantial radiodecomposition of amino acids on a 10 million year time scale. Age determination based on racemization of amino acids will be affected in fossil bones that are older than 1--30 million years. My results on the stability of bacterial spores in halite fluid inclusions and on Mars suggest that radiation

  13. Bacterial GRAS domain proteins throw new light on gibberellic acid response mechanisms

    PubMed Central

    Zhang, Dapeng; Iyer, Lakshminarayan M.; Aravind, L.

    2012-01-01

    Summary: Gibberellic acids (GAs) are key plant hormones, regulating various aspects of growth and development, which have been at the center of the ‘green revolution’. GRAS family proteins, the primary players in GA signaling pathways, remain poorly understood. Using sequence-profile searches, structural comparisons and phylogenetic analysis, we establish that the GRAS family first emerged in bacteria and belongs to the Rossmann fold methyltransferase superfamily. All bacterial and a subset of plant GRAS proteins are likely to function as small-molecule methylases. The remaining plant versions have lost one or more AdoMet (SAM)-binding residues while preserving their substrate-binding residues. We predict that GRAS proteins might either modify or bind small molecules such as GAs or their derivatives. Contact: aravind@ncbi.nlm.nih.gov Supplementary Information: Supplementary Material for this article is available at Bioinformatics online. PMID:22829623

  14. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites.

    PubMed

    Koh, Ara; De Vadder, Filipe; Kovatcheva-Datchary, Petia; Bäckhed, Fredrik

    2016-06-01

    A compelling set of links between the composition of the gut microbiota, the host diet, and host physiology has emerged. Do these links reflect cause-and-effect relationships, and what might be their mechanistic basis? A growing body of work implicates microbially produced metabolites as crucial executors of diet-based microbial influence on the host. Here, we will review data supporting the diverse functional roles carried out by a major class of bacterial metabolites, the short-chain fatty acids (SCFAs). SCFAs can directly activate G-coupled-receptors, inhibit histone deacetylases, and serve as energy substrates. They thus affect various physiological processes and may contribute to health and disease. PMID:27259147

  15. Polymeric Cryogel-Based Boronate Affinity Chromatography for Separation of Ribonucleic Acid from Bacterial Extracts.

    PubMed

    Shakya, Akhilesh Kumar; Srivastava, Akshay; Kumar, Ashok

    2015-01-01

    Three-dimensional monolithic columns are preferred stationary phase in column chromatography. Conventional columns based on silica or particles are efficient in bioseparation though associated with limitations of nonspecific interaction and uneven porosity that causes high mass transfer resistance for the movement of big molecules. Cryogels as a monolith column have shown promising application in bioseparation. Cryogels column can be synthesized in the form of a monolith at sub-zero temperature through gelation of pre-synthesized polymers or polymerization of monomers. Cryogels are macroporous and mechanically stable materials. They have open interconnected micron-sized pores with a wide range of porosity (10-200 μm). Current protocol demonstrated the ability of poly(hydroxymethyl methacrylate)-co-vinylphenyl boronic acid p(HEMA-co-VPBA) cryogel matrix for selective separation of RNA from the bacterial crude extract. PMID:26623972

  16. Inhibition of acidic mine drainage using anti-bacterial substances. Technical report (Final)

    SciTech Connect

    Sherrard, J.H.; Kavanaugh, R.G.; Stroebel, P.S.; Stallard, M.L.

    1990-04-01

    Laboratory experiments were carried out to evaluate the effectiveness of antibacterial substances and antibiotics against Thiobacillus ferrooxidans, the organism responsible for bacterial mediated acidic mine drainage. Twenty-two antibiotics and two antibacterial substances were evaluated. The most promising compound, N-Serve, was evaluated further in column studies. A column study was completed using coal mine waste and hard rock mine waste spoils. Eight columns containing 7 kg of each spoil were established using varying concentrations of N-Serve applied to the spoils. The columns were leached once a week with one inch of rain (distilled water). Effluent was collected and monitored for water quality parameters. Only the highest N-Serve dose produced column leachates significantly better in quality than that of the control columns.

  17. Role of Salicylic Acid and Benzoic Acid in Flowering of a Photoperiod-Insensitive Strain, Lemna paucicostata LP6 1

    PubMed Central

    Khurana, Jitendra P.; Cleland, Charles F.

    1992-01-01

    Lemna paucicostata LP6 does not normally flower when grown on basal Bonner-Devirian medium, but substantial flowering is obtained when 10 μm salicylic acid (SA) or benzoic acid is added to the medium. Benzoic acid is somewhat more effective than SA, and the threshold level of both SA and benzoic acid required for flower initiation is reduced as the pH of the medium is lowered to 4.0. SA- or benzoic acid-induced flowering is enhanced in the simultaneous presence of 6-benzylaminopurine (BAP), although BAP per se does not influence flowering in strain LP6. Continuous presence of SA or benzoic acid in the culture medium is essential to obtain maximal flowering. A short-term treatment of the plants (for first 24 h) with 10 μm SA or benzoic acid, followed by culture in the basal medium containing 1 μm BAP can, however, stimulate profuse flowering. Benzoic acid is more effective than SA, and the effect is more pronounced at pH 4 than at 5.5. Thus, under these conditions, flowering is of an inductive nature. Experiments with [14C]SA and [14C]benzoic acid have provided evidence that at pH 4 there is relatively more uptake of benzoic acid than SA, thus leading to an increased flowering response. The data obtained from the experiments designed to study the mobility of [14C]SA and [14C]-benzoic acid from mother to daughter fronds indicate that there is virtually no mobility of SA or benzoic acid between fronds. PMID:16653155

  18. Mechanism of biosynthesis of unsaturated fatty acids in Pseudomonas sp. strain E-3, a psychrotrophic bacterium

    SciTech Connect

    Wada, M.; Fukunaga, N.; Sasaki, S. )

    1989-08-01

    Biosynthesis of palmitic, palmitoleic, and cis-vaccenic acids in Pseudomonas sp. strain E-3 was investigated with in vitro and in vivo systems. (1-{sup 14}C)palmitic acid was aerobically converted to palmitoleate and cis-vaccenate, and the radioactivities on their carboxyl carbons were 100 and 43%, respectively, of the total radioactivity in the fatty acids. Palmitoyl coenzyme A desaturase activity was found in the membrane fraction. (1-{sup 14}C)stearic acid was converted to octadecenoate and C16 fatty acids. The octadecenoate contained oleate and cis-vaccenate, but only oleate was produced in the presence of cerulenin. (1-{sup 14}C)lauric acid was aerobically converted to palmitate, palmitoleate, and cis-vaccenate. Under anaerobic conditions, palmitate (62%), palmitoleate (4%), and cis-vaccenate (34%) were produced from (1-{sup 14}C)acetic acid, while they amounted to 48, 39, and 14%, respectively, under aerobic conditions. In these incorporation experiments, 3 to 19% of the added radioactivity was detected in released {sup 14}CO{sub 2}, indicating that part of the added fatty acids were oxidatively decomposed. Partially purified fatty acid synthetase produced saturated and unsaturated fatty acids with chain lengths of C10 to C18. These results indicated that both aerobic and anaerobic mechanisms for the synthesis of unsaturated fatty acid are operating in this bacterium.

  19. Presence of a loner strain maintains cooperation and diversity in well-mixed bacterial communities.

    PubMed

    Inglis, R F; Biernaskie, J M; Gardner, A; Kümmerli, R

    2016-01-13

    Cooperation and diversity abound in nature despite cooperators risking exploitation from defectors and superior competitors displacing weaker ones. Understanding the persistence of cooperation and diversity is therefore a major problem for evolutionary ecology, especially in the context of well-mixed populations, where the potential for exploitation and displacement is greatest. Here, we demonstrate that a 'loner effect', described by economic game theorists, can maintain cooperation and diversity in real-world biological settings. We use mathematical models of public-good-producing bacteria to show that the presence of a loner strain, which produces an independent but relatively inefficient good, can lead to rock-paper-scissor dynamics, whereby cooperators outcompete loners, defectors outcompete cooperators and loners outcompete defectors. These model predictions are supported by our observations of evolutionary dynamics in well-mixed experimental communities of the bacterium Pseudomonas aeruginosa. We find that the coexistence of cooperators and defectors that produce and exploit, respectively, the iron-scavenging siderophore pyoverdine, is stabilized by the presence of loners with an independent iron-uptake mechanism. Our results establish the loner effect as a simple and general driver of cooperation and diversity in environments that would otherwise favour defection and the erosion of diversity. PMID:26763707

  20. Presence of a loner strain maintains cooperation and diversity in well-mixed bacterial communities

    PubMed Central

    Inglis, R. F.; Biernaskie, J. M.; Gardner, A.; Kümmerli, R.

    2016-01-01

    Cooperation and diversity abound in nature despite cooperators risking exploitation from defectors and superior competitors displacing weaker ones. Understanding the persistence of cooperation and diversity is therefore a major problem for evolutionary ecology, especially in the context of well-mixed populations, where the potential for exploitation and displacement is greatest. Here, we demonstrate that a ‘loner effect’, described by economic game theorists, can maintain cooperation and diversity in real-world biological settings. We use mathematical models of public-good-producing bacteria to show that the presence of a loner strain, which produces an independent but relatively inefficient good, can lead to rock–paper–scissor dynamics, whereby cooperators outcompete loners, defectors outcompete cooperators and loners outcompete defectors. These model predictions are supported by our observations of evolutionary dynamics in well-mixed experimental communities of the bacterium Pseudomonas aeruginosa. We find that the coexistence of cooperators and defectors that produce and exploit, respectively, the iron-scavenging siderophore pyoverdine, is stabilized by the presence of loners with an independent iron-uptake mechanism. Our results establish the loner effect as a simple and general driver of cooperation and diversity in environments that would otherwise favour defection and the erosion of diversity. PMID:26763707

  1. Characterization of a novel oxyfluorfen-degrading bacterial strain Chryseobacterium aquifrigidense and its biochemical degradation pathway.

    PubMed

    Zhao, Huanhuan; Xu, Jun; Dong, Fengshou; Liu, Xingang; Wu, Yanbing; Wu, Xiaohu; Zheng, Yongquan

    2016-08-01

    Persistent use of the diphenyl ether herbicides oxyfluorfen may seriously increase the health risks and ecological safety problems. A newly bacterium R-21 isolated from active soil was able to degrade and utilize oxyfluorfen as the sole carbon source. R-21 was identified as Chryseobacterium aquifrigidense by morphology, physiobiochemical characteristics, and genetic analysis. Under the optimum cultural conditions (pH 6.9, temperature 33.4 °C, and inoculum size 0.2 g L(-1)), R-21 could degrade 92.1 % of oxyfluorfen at 50 mg L(-1) within 5 days. During oxyfluorfen degradation, six metabolites were detected and identified by atmospheric pressure gas chromatography coupled to quadrupole-time of flight mass spectrometry and ultra-performance liquid chromatography coupled to quadrupole-time of flight mass spectrometry, and a plausible degradation pathway was deduced. Strain R-21 is a promising potential in bioremediation of oxyfluorfen-contaminated environments. PMID:27079576

  2. [Isolation of a monocrotophos-degrading bacterial strain and characterization of enzymatic degradation].

    PubMed

    Jia, Kai-Zhi; Li, Xiao-Hui; He, Jian; Gu, Li-Feng; Ma, Ji-Ping; Li, Shun-Peng

    2007-04-01

    A monocrotophos [dimethyl (E)-1-2-methylcarbamoylvinylphosphate or MCP] -degrading strain named as M-1 was isolated from sludge collected from the wastewater treatment pool of a pesticide factory and identified as Paracoccus sp. according to its morphology and biochemical properties and 16S rDNA sequence analysis. Using MCP as a sole carbon source, M-1 was able to degrade MCP(100 mg x L(-1)) by 92.47% in 24 h. The key enzyme(s) involved in the initial biodegradation of monocrotophos in M-1 was shown to be constitutively expressed cytosolic proteins and showed the greatest activity at pH 8.0 and 25 degrees C, with its Michaelis-Mentn's constant (K(m)) and maximum degradation rate (V(max)) of 0.29 micromol x mL(-1) and 682.12 micromol (min x mg)(-1) respectively. This degrading enzyme(s) was sensitive to high temperature, but kept high activity under alkaline conditions. PMID:17639959

  3. Growth promotion and colonization of switchgrass (Panicum virgatum) cv. Alamo by bacterial endophyte Burkholderia phytofirmans strain PsJN

    PubMed Central

    2012-01-01

    Background Switchgrass is one of the most promising bioenergy crop candidates for the US. It gives relatively high biomass yield and can grow on marginal lands. However, its yields vary from year to year and from location to location. Thus it is imperative to develop a low input and sustainable switchgrass feedstock production system. One of the most feasible ways to increase biomass yields is to harness benefits of microbial endophytes. Results We demonstrate that one of the most studied plant growth promoting bacterial endophytes, Burkholderia phytofirmans strain PsJN, is able to colonize and significantly promote growth of switchgrass cv. Alamo under in vitro, growth chamber, and greenhouse conditions. In several in vitro experiments, the average fresh weight of PsJN-inoculated plants was approximately 50% higher than non-inoculated plants. When one-month-old seedlings were grown in a growth chamber for 30 days, the PsJN-inoculated Alamo plants had significantly higher shoot and root biomass compared to controls. Biomass yield (dry weight) averaged from five experiments was 54.1% higher in the inoculated treatment compared to non-inoculated control. Similar results were obtained in greenhouse experiments with transplants grown in 4-gallon pots for two months. The inoculated plants exhibited more early tillers and persistent growth vigor with 48.6% higher biomass than controls. We also found that PsJN could significantly promote growth of switchgrass cv. Alamo under sub-optimal conditions. However, PsJN-mediated growth promotion in switchgrass is genotype specific. Conclusions Our results show B. phytofirmans strain PsJN significantly promotes growth of switchgrass cv. Alamo under different conditions, especially in the early growth stages leading to enhanced production of tillers. This phenomenon may benefit switchgrass establishment in the first year. Moreover, PsJN significantly stimulated growth of switchgrass cv. Alamo under sub-optimal conditions

  4. Lactic acid bacteria strains exert immunostimulatory effect on H. pylori-induced dendritic cells.

    PubMed

    Wiese, Małgorzata; Eljaszewicz, Andrzej; Helmin-Basa, Anna; Andryszczyk, Marek; Motyl, Ilona; Wieczyńska, Jolanta; Gackowska, Lidia; Kubiszewska, Izabela; Januszewska, Milena; Michałkiewicz, Jacek

    2015-01-01

    The aim of this study was to find out if selected lactic acid bacteria (LAB) strains (antagonistic or nonantagonistic against H. pylori in vitro) would differ in their abilities to modulate the DCs maturation profiles reflected by their phenotype and cytokine expression patterns. Methods. Monocyte-derived DCs maturation was elicited by their direct exposure to the LAB strains of L. rhamnosus 900 or L. paracasei 915 (antagonistic and nonantagonistic to H. pylori, resp.), in the presence or absence of H. pylori strain cagA+. The DCs maturation profile was assessed on the basis of surface markers expression and cytokines production. Results. We observed that the LAB strains and the mixtures of LAB with H. pylori are able to induce mature DCs. At the same time, the L. paracasei 915 leads to high IL-10/IL-12p70 cytokine ratio, in contrast to L. rhamnosus 900. Conclusions. This study showed that the analyzed lactobacilli strains are more potent stimulators of DC maturation than H. pylori. Interestingly from the two chosen LAB strains the antagonistic to H. pylori-L. rhamnosus strain 900 has more proinflammatory and probably antibactericidal properties. PMID:25759836

  5. Omega-3 fatty acid production from enzyme saccharified hemp hydrolysate using a novel marine thraustochytrid strain.

    PubMed

    Gupta, Adarsha; Abraham, Reinu E; Barrow, Colin J; Puri, Munish

    2015-05-01

    In this work, a newly isolated marine thraustochytrid strain, Schizochytrium sp. DT3, was used for omega-3 fatty acid production by growing on lignocellulose biomass obtained from local hemp hurd (Cannabis sativa) biomass. Prior to enzymatic hydrolysis, hemp was pretreated with sodium hydroxide to open the biomass structure for the production of sugar hydrolysate. The thraustochytrid strain was able to grow on the sugar hydrolysate and accumulated polyunsaturated fatty acids (PUFAs). At the lowest carbon concentration of 2%, the PUFAs productivity was 71% in glucose and 59% in the sugars hydrolysate, as a percentage of total fatty acids. Saturated fatty acids (SFAs) levels were highest at about 49% of TFA using 6% glucose as the carbon source. SFAs of 41% were produced using 2% of SH. This study demonstrates that SH produced from lignocellulose biomass is a potentially useful carbon source for the production of omega-3 fatty acids in thraustochytrids, as demonstrated using the new strain, Schizochytrium sp. DT3. PMID:25497057

  6. Raman and surface-enhanced Raman spectroscopy of amino acids and nucleotide bases for target bacterial vibrational mode identification

    NASA Astrophysics Data System (ADS)

    Guicheteau, Jason; Argue, Leanne; Hyre, Aaron; Jacobson, Michele; Christesen, Steven D.

    2006-05-01

    Raman and surface-enhanced Raman spectroscopy (SERS) studies of bacteria have reported a wide range of vibrational mode assignments associated with biological material. We present Raman and SER spectra of the amino acids phenylalanine, tyrosine, tryptophan, glutamine, cysteine, alanine, proline, methionine, asparagine, threonine, valine, glycine, serine, leucine, isoleucine, aspartic acid and glutamic acid and the nucleic acid bases adenosine, guanosine, thymidine, and uridine to better characterize biological vibrational mode assignments for bacterial target identification. We also report spectra of the bacteria Bacillus globigii, Pantoea agglomerans, and Yersinia rhodei along with band assignments determined from the reference spectra obtained.

  7. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    PubMed Central

    Rhee, Mun Su; Moritz, Brélan E.; Xie, Gary; Glavina del Rio, T.; Dalin, E.; Tice, H.; Bruce, D.; Goodwin, L.; Chertkov, O.; Brettin, T.; Han, C.; Detter, C.; Pitluck, S.; Land, Miriam L.; Patel, Milind; Ou, Mark; Harbrucker, Roberta; Ingram, Lonnie O.; Shanmugam, K. T.

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 °C and pH 5.0 and ferments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 °C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemicellulose. This bacterium is also considered as a potential probiotic. Complete genome sequence of a representative strain, B. coagulans strain 36D1, is presented and discussed. PMID:22675583

  8. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    SciTech Connect

    Xie, Gary; Dalin, Eileen; Tice, Hope; Chertkov, Olga; Land, Miriam L

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer-ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi-cellulose. This bacterium is also considered as a potential probiotic. Complete genome squence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  9. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    SciTech Connect

    Rhee, Mun Su; Moritz, Brelan E.; Xie, Gary; Glavina Del Rio, Tijana; Dalin, Eileen; Tice, Hope; Bruce, David; Goodwin, Lynne A.; Chertkov, Olga; Brettin, Thomas S; Han, Cliff; Detter, J. Chris; Pitluck, Sam; Land, Miriam L; Patel, Milind; Ou, Mark; Harbrucker, Roberta; Ingram, Lonnie O.; Shanmugam, Keelnathan T.

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer- ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this spo- rogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attrac- tive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi- cellulose. This bacterium is also considered as a potential probiotic. Complete genome se- quence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  10. Survey of duckweed diversity in Lake Chao and total fatty acid, triacylglycerol, profiles of representative strains.

    PubMed

    Tang, J; Li, Y; Ma, J; Cheng, J J

    2015-09-01

    Lemnaceae (duckweeds) are widely distributed aquatic flowering plants. Their high growth rate, starch content and suitability for bioremediation make them potential feedstock for biofuels. However, few natural duckweed resources have been investigated in China, and there is no information about total fatty acid (TFA) and triacylglycerol (TAG) composition of duckweeds from China. Here, the genetic diversity of a natural duckweed population collected from Lake Chao, China, was investigated using multilocus sequence typing (MLST). The 54 strains were categorised into four species in four genera, representing 12 distinct sequence types. Strains representing Lemna aequinoctialis and Spirodela polyrhiza were predominant. Interestingly, a surprisingly high degree of genetic diversification within L. aequinoctialis was observed. The four duckweed species revealed a uniform fatty acid composition, with three fatty acids, palmitic acid, linoleic acid and linolenic acid, accounting for more than 80% of the TFA. The TFA in biomass varied among species, ranging from 1.05% (of dry weight, DW) for L. punctata and S. polyrhiza to 1.62% for Wolffia globosa. The four duckweed species contained similar TAG contents, 0.02% mg · DW(-1). The fatty acid profiles of TAG were different from those of TFA, and also varied among the four species. The survey investigated the genetic diversity of duckweeds from Lake Chao, and provides an initial insight into TFA and TAG of four duckweed species, indicating that intraspecific and interspecific variations exist in the content and composition of both TFA and TAG in comparison with other studies. PMID:25950142

  11. Screening of marine bacterial producers of polyunsaturated fatty acids and optimisation of production.

    PubMed

    Abd El Razak, Ahmed; Ward, Alan C; Glassey, Jarka

    2014-02-01

    Water samples from three different environments including Mid Atlantic Ridge, Red Sea and Mediterranean Sea were screened in order to isolate new polyunsaturated fatty acids (PUFAs) bacterial producers especially eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Two hundred and fifty-one isolates were screened for PUFA production and among them the highest number of producers was isolated from the Mid-Atlantic Ridge followed by the Red Sea while no producers were found in the Mediterranean Sea samples. The screening strategy included a simple colourimetric method followed by a confirmation via GC/MS. Among the tested producers, an isolate named 66 was found to be a potentially high PUFA producer producing relatively high levels of EPA in particular. A Plackett-Burman statistical design of experiments was applied to screen a wide number of media components identifying glycerol and whey as components of a production medium. The potential low-cost production medium was optimised by applying a response surface methodology to obtain the highest productivity converting industrial by-products into value-added products. The maximum achieved productivity of EPA was 20 mg/g, 45 mg/l, representing 11% of the total fatty acids, which is approximately five times more than the amount produced prior to optimisation. The production medium composition was 10.79 g/l whey and 6.87 g/l glycerol. To our knowledge, this is the first investigation of potential bacteria PUFA producers from Mediterranean and Red Seas providing an evaluation of a colourimetric screening method as means of rapid screening of a large number of isolates. PMID:24292901

  12. Plant growth promotion by inoculation with selected bacterial strains versus mineral soil supplements.

    PubMed

    Wernitznig, S; Adlassnig, W; Sprocati, A R; Turnau, K; Neagoe, A; Alisi, C; Sassmann, S; Nicoara, A; Pinto, V; Cremisini, C; Lichtscheidl, I

    2014-01-01

    In the process of remediation of mine sites, the establishment of a vegetation cover is one of the most important tasks. This study tests two different approaches to manipulate soil properties in order to facilitate plant growth. Mine waste from Ingurtosu, Sardinia, Italy rich in silt, clay, and heavy metals like Cd, Cu, and Zn was used in a series of greenhouse experiments. Bacteria with putative beneficial properties for plant growth were isolated from this substrate, propagated and consortia of ten strains were used to inoculate the substrate. Alternatively, sand and volcanic clay were added. On these treated and untreated soils, seeds of Helianthus annuus, of the native Euphorbia pithyusa, and of the grasses Agrostis capillaris, Deschampsia flexuosa and Festuca rubra were germinated, and the growth of the seedlings was monitored. The added bacteria established well under all experimental conditions and reduced the extractability of most metals. In association with H. annuus, E. pithyusa and D. flexuosa bacteria improved microbial activity and functional diversity of the original soil. Their effect on plant growth, however, was ambiguous and usually negative. The addition of sand and volcanic clay, on the other hand, had a positive effect on all plant species except E. pithyusa. Especially the grasses experienced a significant benefit. The effects of a double treatment with both bacteria and sand and volcanic clay were rather negative. It is concluded that the addition of mechanical support has great potential to boost revegetation of mining sites though it is comparatively expensive. The possibilities offered by the inoculation of bacteria, on the other hand, appear rather limited. PMID:23990253

  13. [Efficacy and safety of clavulanic acid/amoxicillin (1: 14) dry syrup in the treatment of children with acute bacterial rhinosinusitis].

    PubMed

    Sugita, Rinya; Yamamoto, Shuichi; Motoyama, Hidekatsu; Yarita, Masao

    2015-06-01

    To demonstrate clinical value of clavulanic acid/amoxicillin (CVA/AMPC) 1:14 combination dry syrup for acute bacterial rhinosinusitis (ABRS), the efficacy and safety were evaluated in a multicenter, open-label, uncontrolled study in 27 children with ABRS. The proportion of subjects who were 'cured' at the test of cure as the primary endpoint was 88.5%. In subjects with a major pathogenic bacteria at baseline (i.e., Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis) bacterial eradication was achieved in ≥ 80% of the subjects with the exception of β-lactamase non-producing ampicillin resistant H. influenzae: BLNAR and β-lactamase producing ampicillin resistant H. influenzae: BLPAR (β-lactamase producing amoxicillin/clavulanic acid resistant H. influenzae: BLPACR). The MIC of CVA/AMPC (1:14) was not higher than 4 μg/mL for all pathogens except one strain each of BLNAR and BLPAR (BLPACR). Drug-related adverse events were reported in 19% of patients (5/27 patients). All of the reported drug-related adverse events were classified as gastrointestinal disorders that have been commonly reported with antibacterial drugs. These results indicate that CVA/AMPC (1:14) was clinically useful for the treatment of ABRS and is also suggested that was effective especially for the treatment of ABRS in children caused by beta-lactamase-producing bacteria including M. catarrhalis. PMID:26349117

  14. Transcriptional profile of glucose-shocked and acid-adapted strains of Streptococcus mutans.

    PubMed

    Baker, J L; Abranches, J; Faustoferri, R C; Hubbard, C J; Lemos, J A; Courtney, M A; Quivey, R

    2015-12-01

    The aciduricity of Streptococcus mutans is an important virulence factor of the organism, required to both out-compete commensal oral microorganisms and cause dental caries. In this study, we monitored transcriptional changes that occurred as a continuous culture of either an acid-tolerant strain (UA159) or an acid-sensitive strain (fabM::Erm) moved from steady-state growth at neutral pH, experienced glucose-shock and acidification of the culture, and transitioned to steady-state growth at low pH. Hence, the timing of elements of the acid tolerance response (ATR) could be observed and categorized as acute vs. adaptive ATR mechanisms. Modulation of branched chain amino acid biosynthesis, DNA/protein repair mechanisms, reactive oxygen species metabolizers and phosphoenolpyruvate:phosphotransferase systems occurred in the initial acute phase, immediately following glucose-shock, while upregulation of F1 F0 -ATPase did not occur until the adaptive phase, after steady-state growth had been re-established. In addition to the archetypal ATR pathways mentioned above, glucose-shock led to differential expression of genes suggesting a re-routing of resources away from the synthesis of fatty acids and proteins, and towards synthesis of purines, pyrimidines and amino acids. These adjustments were largely transient, as upon establishment of steady-state growth at acidic pH, transcripts returned to basal expression levels. During growth at steady-state pH 7, fabM::Erm had a transcriptional profile analogous to that of UA159 during glucose-shock, indicating that even during growth in rich media at neutral pH, the cells were stressed. These results, coupled with a recently established collection of deletion strains, provide a starting point for elucidation of the acid tolerance response in S. mutans. PMID:26042838

  15. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants

    SciTech Connect

    Berni Canani, Roberto; Sangwan, Naseer; Stefka, Andrew T.; Nocerino, Rita; Paparo, Lorella; Aitoro, Rosita; Calignano, Antonio; Khan, Aly A.; Gilbert, Jack A.; Nagler, Cathryn R.

    2015-09-22

    Dietary intervention with extensively hydrolyzed casein formula supplemented with Lactobacillus rhamnosus GG (EHCF+LGG) accelerates tolerance acquisition in infants with cow’s milk allergy (CMA). We examined whether this effect is attributable, at least in part, to an influence on the gut microbiota. Fecal samples from healthy controls (n=20) and from CMA infants (n=19) before and after treatment with EHCF with (n=12) and without (n=7) supplementation with LGG were compared by 16S rRNA-based operational taxonomic unit clustering and oligotyping. Differential feature selection and generalized linear model fitting revealed that the CMA infants have a diverse gut microbial community structure dominated by Lachnospiraceae (20.5±9.7%) and Ruminococcaceae (16.2±9.1%). Blautia, Roseburia and Coprococcus were significantly enriched following treatment with EHCF and LGG, but only one genus, Oscillospira, was significantly different between infants that became tolerant and those that remained allergic. However, most tolerant infants showed a significant increase in fecal butyrate levels, and those taxa that were significantly enriched in these samples, Blautia and Roseburia, exhibited specific strain-level demarcations between tolerant and allergic infants. As a result, our data suggest that EHCF+LGG promotes tolerance in infants with CMA, in part, by influencing the strain-level bacterial community structure of the infant gut.

  16. Colloidal precipitates related to Acid Mine Drainage: bacterial diversity and micro fungi-heavy metal interactions

    NASA Astrophysics Data System (ADS)

    Lucchetti, G.; Carbone, C.; Consani, S.; Zotti, M.; Di Piazza, S.; Pozzolini, M.; Giovine, M.

    2015-12-01

    In Acid Mine Drainage (AMD) settings colloidal precipitates control the mobility of Potential Toxic Elements (PTEs). Mineral-contaminant relationships (i.e. adsorption, ion-exchange, desorption) are rarely pure abiotic processes. Microbes, mainly bacteria and microfungi, can catalyze several reactions modifying the element speciation, as well as the bioavailability of inorganic pollutants. Soil, sediments, and waters heavily polluted with PTEs through AMD processes are a potential reservoir of extremophile bacteria and fungi exploitable for biotechnological purposes. Two different AMD related colloids, an ochraceous precipitate (deposited in weakly acidic conditions, composed by nanocrystalline goethite) and a greenish-blue precipitate (deposited at near-neutral pH, composed by allophane + woodwardite) were sampled. The aims of this work were to a) characterize the mycobiota present in these colloidal minerals by evaluating the presence of alive fungal propagules and extracting bacteria DNA; b) verify the fungal strains tolerance, and bioaccumulation capability on greenish-blue and ZnSO4 enriched media; c) evaluate potential impact of bacteria in the system geochemistry. The preliminary results show an interesting and selected mycobiota able to survive under unfavourable environmental conditions. A significant number of fungal strains were isolated in pure culture. Among them, species belonging to Penicillium and Trichoderma genera were tested on both greenish-blue and ZnSO4 enriched media. The results show a significant tolerance and bioaccumulation capability to some PTEs. The same colloidal precipitates were processed to extract bacteria DNA by using a specific procedure developed for sediments. The results give a good yield of nucleic acids and a positive PCR amplification of 16S rDNA accomplished the first step for future metagenomic analyses.

  17. Metatranscriptomic analysis of lactic acid bacterial gene expression during kimchi fermentation.

    PubMed

    Jung, Ji Young; Lee, Se Hee; Jin, Hyun Mi; Hahn, Yoonsoo; Madsen, Eugene L; Jeon, Che Ok

    2013-05-15

    Barcode-based 16S rRNA gene pyrosequencing showed that the kimchi microbiome was dominated by six lactic acid bacteria (LAB), Leuconostoc (Lc.) mesenteroides, Lactobacillus (Lb.) sakei, Weissella (W.) koreensis, Lc. gelidum, Lc. carnosum, and Lc. gasicomitatum. Therefore, we used completed genome sequences of representatives of these bacteria to investigate metatranscriptomic gene-expression profiles during kimchi fermentation. Total mRNA was extracted from kimchi samples taken at five time points during a 29 day-fermentation. Nearly all (97.7%) of the metagenome sequences that were recruited on all LAB genomes of GenBank mapped onto the six LAB strains; this high coverage rate indicated that this approach for assessing processes carried out by the kimchi microbiome was valid. Expressed mRNA sequences (as cDNA) were determined using Illumina GA IIx. Assignment of mRNA sequences to metabolic genes using MG-RAST revealed the prevalence of carbohydrate metabolism and lactic acid fermentation. The mRNA sequencing reads were mapped onto genomes of the six LAB strains, which showed that Lc. mesenteroides was most active during the early-stage fermentation, whereas gene expression by Lb. sakei and W. koreensis was high during later stages. However, gene expression by Lb. sakei decreased rapidly at 25 days of fermentation, which was possibly caused by bacteriophage infection of the Lactobacillus species. Many genes related to carbohydrate transport and hydrolysis and lactate fermentation were actively expressed, which indicated typical heterolactic acid fermentation. Mannitol dehydrogenase-encoding genes (mdh) were identified from all Leuconostoc species and especially Lc. mesenteroides, which harbored three copies (two copies on chromosome and one copy on plasmid) of mdh with different expression patterns. These results contribute to knowledge of the active populations and gene expression in the LAB community responsible for an important fermentation process. PMID

  18. Effect of multiple washing in salicylic acid on the bacterial flora of the skin of processed broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Experiments were conducted to determine changes in the bacterial flora of the skin of processed broilers after each of five consecutive washings in solutions of the keratolytic agent, salicylic acid. Skin samples from commercially processed broiler carcasses were divided into 3 groups and washed in ...

  19. Effect of various concentrations of potassium hydroxide and lauric acid on native bacterial flora of broiler carcasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Experiments were conducted to determine the bactericidal effect of various concentrations of potassium hydroxide (KOH)-lauric acid (LA) solutions on the native bacterial flora of broiler carcasses. A mixture of 1.0% KOH and 2.0% LA (wt/vol) was prepared, and then filter sterilized by passage through...

  20. Physiological characterization of the high malic acid-producing Aspergillus oryzae strain 2103a-68.

    PubMed

    Knuf, Christoph; Nookaew, Intawat; Remmers, Ilse; Khoomrung, Sakda; Brown, Stephen; Berry, Alan; Nielsen, Jens

    2014-04-01

    Malic acid is a C₄ dicarboxylic acid that is currently mainly used in the food and beverages industry as an acidulant. Because of the versatility of the group of C₄ dicarboxylic acids, the chemical industry has a growing interest in this chemical compound. As malic acid will be considered as a bulk chemical, microbial production requires organisms that sustain high rates, yields, and titers. Aspergillus oryzae is mainly known as an industrial enzyme producer, but it was also shown that it has a very competitive natural production capacity for malic acid. Recently, an engineered A. oryzae strain, 2103a-68, was presented which overexpressed pyruvate carboxylase, malate dehydrogenase, and a malic acid transporter. In this work, we report a detailed characterization of this strain including detailed rates and yields under malic acid production conditions. Furthermore, transcript levels of the genes of interest and corresponding enzyme activities were measured. On glucose as carbon source, 2103a-68 was able to secrete malic acid at a maximum specific production rate during stationary phase of 1.87 mmol (g dry weight (DW))⁻¹ h⁻¹ and with a yield of 1.49 mol mol⁻¹. Intracellular fluxes were obtained using ¹³C flux analysis during exponential growth, supporting the success of the metabolic engineering strategy of increasing flux through the reductive cytosolic tricarboxylic acid (rTCA) branch. Additional cultivations using xylose and a glucose/xylose mixture demonstrated that A. oryzae is able to efficiently metabolize pentoses and hexoses to produce malic acid at high titers, rates, and yields. PMID:24413918

  1. In Silico Phylogenetic Analysis and Molecular Modelling Study of 2-Haloalkanoic Acid Dehalogenase Enzymes from Bacterial and Fungal Origin

    PubMed Central

    Satpathy, Raghunath; Konkimalla, V. B.; Ratha, Jagnyeswar

    2016-01-01

    2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA), conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K) and aspartate (D) residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models. PMID:26880911

  2. [Study on cooperating degradation of cypermethrin and 3-phenoxybenzoic acid by two bacteria strains].

    PubMed

    Xu, Yu-Xin; Sun, Ji-Quan; Li, Xiao-Hui; Li, Shun-Peng; Chen, Yi

    2007-10-01

    The microbial cooperated reaction is one of the most important forms of microbial degradation of organic pollutants. Although there were many research reports of cooperating degradation, less report on the microbial cooperated of pyrethroid degradation to be found. We have isolated one degrading-bacteria strain named CDT3 for degradation of cypermethrin, which can degraded the cypermethrin into 3-PBA and DCVA. At the same time, we also isolated another degrading-bacteria strain named as PBM11, which could get multiplication on 3-PBA as its C source and energy source. The cooperative degradation process of cypermethrin and 3-Phenoxybenzoic acid (3-PBA) using the two degrading-bacteria strain CDT3 and PBM11 was investigated. An obvious inhibition to the cypermethrin degrading-bacterium strain CDT3 (Rhodococcus sp.) by its metabolic mediate 3-PBA was found; meanwhile there is no effect on the growth of 3-PBA degrading-bacterium strain PBM11 (Pesudomonas sp.) when the concentration of cypermethrin was lower than 200 mg/L. The degradation rate of cypermethrin by both strain CDT3 and PBM11 was higher than that by CDT3 alone. The biomass of PBM11 increased along with the degradation of cypermethrin and 3-PBA, but that of CDT3 not. There was no the accumulation of 3-PBA when the simultaneous addition of strain CDT3 and PBM11, however, an obvious one within 24h if inoculation of strain PBM11 was later 24h after inoculation of strain CDT3, Subsequently the 3-PBA was degraded rapidly by strain PBM11. The strains CDT3 and PBM11 showed some characteristics of co-metabolism, however it is not actual degradation form of co-metabolism. For examples, although the degrading sub product of cypermethrin by CDT3 could be utilized, the multiplication of PBM11 could not enhance the multiplication of CDT3, implied there is no obvious relationship between the two strains. Also, to add PBM11 could eliminate the inhibition of 3-PBA to CDT3. Thus, the cooperating degradation of strains CDT3

  3. Topological characterization of a bacterial cellulose-acrylic acid polymeric matrix.

    PubMed

    Halib, N; Mohd Amin, M C I; Ahmad, I; Abrami, M; Fiorentino, S; Farra, R; Grassi, G; Musiani, F; Lapasin, R; Grassi, M

    2014-10-01

    This paper focuses on the micro- and nano-topological organization of a hydrogel, constituted by a mixture of bacterial cellulose and acrylic acid, and intended for biomedical applications. The presence of acrylic acid promotes the formation of two interpenetrated continuous phases: the primary "pores phase" (PP) containing only water and the secondary "polymeric network phase" (PNP) constituted by the polymeric network swollen by the water. Low field Nuclear Magnetic Resonance (LF NMR), rheology, Scanning Electron Microscopy (SEM) and release tests were used to determine the characteristics of the two phases. In particular, we found that this system is a strong hydrogel constituted by 81% (v/v) of PP phase the remaining part being occupied by the PNP phase. Pores diameters span in the range 10-100 μm, the majority of them (85%) falling in the range 30-90 μm. The high PP phase tortuosity indicates that big pores are not directly connected to each other, but their connection is realized by a series of interconnected small pores that rend the drug path tortuous. The PNP is characterized by a polymer volume fraction around 0.73 while mesh size is around 3 nm. The theoretical interpretation of the experimental data coming from the techniques panel adopted, yielded to the micro- and nano-organization of our hydrogel. PMID:24932712

  4. Effects of Abiotic Factors on the Phylogenetic Diversity of Bacterial Communities in Acidic Thermal Springs▿

    PubMed Central

    Mathur, Jayanti; Bizzoco, Richard W.; Ellis, Dean G.; Lipson, David A.; Poole, Alexander W.; Levine, Richard; Kelley, Scott T.

    2007-01-01

    Acidic thermal springs offer ideal environments for studying processes underlying extremophile microbial diversity. We used a carefully designed comparative analysis of acidic thermal springs in Yellowstone National Park to determine how abiotic factors (chemistry and temperature) shape acidophile microbial communities. Small-subunit rRNA gene sequences were PCR amplified, cloned, and sequenced, by using evolutionarily conserved bacterium-specific primers, directly from environmental DNA extracted from Amphitheater Springs and Roaring Mountain sediment samples. Energy-dispersive X-ray spectroscopy, X-ray diffraction, and colorimetric assays were used to analyze sediment chemistry, while an optical emission spectrometer was used to evaluate water chemistry and electronic probes were used to measure the pH, temperature, and Eh of the spring waters. Phylogenetic-statistical analyses found exceptionally strong correlations between bacterial community composition and sediment mineral chemistry, followed by weaker but significant correlations with temperature gradients. For example, sulfur-rich sediment samples contained a high diversity of uncultured organisms related to Hydrogenobaculum spp., while iron-rich sediments were dominated by uncultured organisms related to a diverse array of gram-positive iron oxidizers. A detailed analysis of redox chemistry indicated that the available energy sources and electron acceptors were sufficient to support the metabolic potential of Hydrogenobaculum spp. and iron oxidizers, respectively. Principal-component analysis found that two factors explained 95% of the genetic diversity, with most of the variance attributable to mineral chemistry and a smaller fraction attributable to temperature. PMID:17220248

  5. Effects of abiotic factors on the phylogenetic diversity of bacterial communities in acidic thermal springs.

    PubMed

    Mathur, Jayanti; Bizzoco, Richard W; Ellis, Dean G; Lipson, David A; Poole, Alexander W; Levine, Richard; Kelley, Scott T

    2007-04-01

    Acidic thermal springs offer ideal environments for studying processes underlying extremophile microbial diversity. We used a carefully designed comparative analysis of acidic thermal springs in Yellowstone National Park to determine how abiotic factors (chemistry and temperature) shape acidophile microbial communities. Small-subunit rRNA gene sequences were PCR amplified, cloned, and sequenced, by using evolutionarily conserved bacterium-specific primers, directly from environmental DNA extracted from Amphitheater Springs and Roaring Mountain sediment samples. Energy-dispersive X-ray spectroscopy, X-ray diffraction, and colorimetric assays were used to analyze sediment chemistry, while an optical emission spectrometer was used to evaluate water chemistry and electronic probes were used to measure the pH, temperature, and E(h) of the spring waters. Phylogenetic-statistical analyses found exceptionally strong correlations between bacterial community composition and sediment mineral chemistry, followed by weaker but significant correlations with temperature gradients. For example, sulfur-rich sediment samples contained a high diversity of uncultured organisms related to Hydrogenobaculum spp., while iron-rich sediments were dominated by uncultured organisms related to a diverse array of gram-positive iron oxidizers. A detailed analysis of redox chemistry indicated that the available energy sources and electron acceptors were sufficient to support the metabolic potential of Hydrogenobaculum spp. and iron oxidizers, respectively. Principal-component analysis found that two factors explained 95% of the genetic diversity, with most of the variance attributable to mineral chemistry and a smaller fraction attributable to temperature. PMID:17220248

  6. Enhanced Degradation of Diesel in the Rhizosphere of after Inoculation with Diesel-Degrading and Plant Growth-Promoting Bacterial Strains.

    PubMed

    Balseiro-Romero, María; Gkorezis, Panagiotis; Kidd, Petra S; Vangronsveld, Jaco; Monterroso, Carmen

    2016-05-01

    The association of plants and rhizospheric bacteria provides a successful strategy to clean up contaminated soils. The purpose of this work was to enhance diesel degradation in rhizosphere by inoculation with selected bacterial strains: a diesel degrader (D), plant growth-promoting (PGP) strains, or a combination (D+PGP). Plants were set up in pots with the A or B horizon of an umbric Cambisol (A and B) spiked with diesel (1.25%, w/w). After 1 mo, the dissipation of diesel range organics (DRO) with respect to = 0 (i.e., 1 wk after preparing the pots with the seedlings) concentration was significantly higher in inoculated than in noninoculated (NI) pots: The highest DRO losses were found in A D+PGP pots (close to 15-20% higher than NI) and in B D pots (close to 10% higher). The water-extractable DRO fraction was significantly higher at = 30 d (15-25%) compared with = 0 (<5%), probably due to the effects of plant root exudates and biosurfactants produced by the degrader strain. The results of this experiment reflect the importance of the partnerships between plants and bacterial inoculants and demonstrate the relevance of the effect of bacterial biosurfactants and plant root exudates on contaminant bioavailability, a key factor for enhancing diesel rhizodegradation. The association of lupine with D and PGP strains resulted in a promising combination for application in the rhizoremediation of soils with moderate diesel contamination. PMID:27136159

  7. Bioremediation using Novosphingobium strain DY4 for 2,4-dichlorophenoxyacetic acid-contaminated soil and impact on microbial community structure.

    PubMed

    Dai, Yu; Li, Ningning; Zhao, Qun; Xie, Shuguang

    2015-04-01

    The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) is commonly used for weed control. The ubiquity of 2,4-D has gained increasing environmental concerns. Biodegradation is an attractive way to clean up 2,4-D in contaminated soil. However, information on the bioaugmentation trial for remediating contaminated soil is still very limited. The impact of bioaugmentation using 2,4-D-degraders on soil microbial community remains unknown. The present study investigated the bioremediation potential of a novel degrader (strain DY4) for heavily 2,4-D-polluted soil and its bioaugmentation impact on microbial community structure. The strain DY4 was classified as a Novosphingobium species within class Alphaproteobacteria and harbored 2,4-D-degrading TfdAα gene. More than 50 and 95 % of the herbicide could be dissipated in bioaugmented soil (amended with 200 mg/kg 2,4-D) respectively in 3-4 and 5-7 days after inoculation of Novosphingobium strain DY4. A significant growth of the strain DY4 was observed in bioaugmented soil with the biodegradation of 2,4-D. Moreover, herbicide application significantly altered soil bacterial community structure but bioaumentation using the strain DY4 showed a relatively weak impact. PMID:25743701

  8. A Nonluminescent and Highly Virulent Vibrio harveyi Strain Is Associated with “Bacterial White Tail Disease” of Litopenaeus vannamei Shrimp

    PubMed Central

    Zhou, Junfang; Fang, Wenhong; Yang, Xianle; Zhou, Shuai; Hu, Linlin; Li, Xincang; Qi, Xinyong; Su, Hang; Xie, Layue

    2012-01-01

    Recurrent outbreaks of a disease in pond-cultured juvenile and subadult Litopenaeus vannamei shrimp in several districts in China remain an important problem in recent years. The disease was characterized by “white tail” and generally accompanied by mass mortalities. Based on data from the microscopical analyses, PCR detection and 16S rRNA sequencing, a new Vibrio harveyi strain (designated as strain HLB0905) was identified as the etiologic pathogen. The bacterial isolation and challenge tests demonstrated that the HLB0905 strain was nonluminescent but highly virulent. It could cause mass mortality in affected shrimp during a short time period with a low dose of infection. Meanwhile, the histopathological and electron microscopical analysis both showed that the HLB0905 strain could cause severe fiber cell damages and striated muscle necrosis by accumulating in the tail muscle of L. vannamei shrimp, which led the affected shrimp to exhibit white or opaque lesions in the tail. The typical sign was closely similar to that caused by infectious myonecrosis (IMN), white tail disease (WTD) or penaeid white tail disease (PWTD). To differentiate from such diseases as with a sign of “white tail” but of non-bacterial origin, the present disease was named as “bacterial white tail disease (BWTD)”. Present study revealed that, just like IMN and WTD, BWTD could also cause mass mortalities in pond-cultured shrimp. These results suggested that some bacterial strains are changing themselves from secondary to primary pathogens by enhancing their virulence in current shrimp aquaculture system. PMID:22383954

  9. Efficient fermentation of Pinus sp. acid hydrolysates by an ethanologenic strain of Escherichia coli

    SciTech Connect

    Barbosa, M.F.S. de; Ingram, L.O. ); Beck, M.J. ); Fein, J.E.; Potts, D. )

    1992-04-01

    Process conditions for the acid hydrolysis of pine hemicellulose and cellulose have been described which provide a biocompatible sugar solution. By using an improved strain of recombinant Escherichia coli, strain KO11, hydrolysates supplemented with yeast extract and tryptone nutrients were converted to ethanol with an efficiency of 85% to over 100% on the basis of monomer sugar content (approximately 72 g/liter) and with the production of 35 g of ethanol per liter in 48 h. In the process described, approximately 347 liters of ethanol could be produced per dry metric ton of lignocellulose.

  10. Dietary supplementation of usnic acid, an antimicrobial compound in lichens, does not affect rumen bacterial diversity or density in reindeer.

    PubMed

    Glad, Trine; Barboza, Perry; Mackie, Roderick I; Wright, André-Denis G; Brusetti, Lorenzo; Mathiesen, Svein D; Sundset, Monica A

    2014-06-01

    Reindeer (Rangifer tarandus tarandus) may include large proportions of lichens in their winter diet. These dietary lichens are rich in phenolic secondary compounds, the most well-known being the antimicrobial usnic acid. Previous studies have shown that reindeer host rumen bacteria resistant to usnic acid and that usnic acid is quickly detoxified in their rumen. In the present study, reindeer (n = 3) were sampled before, during, and after usnic acid supplementation to determine the effect on their rumen microbial ecology. Ad libitum intake of usnic acid averaged up to 278 mg/kg body mass. Population densities of rumen bacteria and methanogenic archaea determined by real-time PCR, ranged from 1.36 × 10(9) to 11.8 × 10(9) and 9.0 × 10(5) to 1.35 × 10(8) cells/g wet weight, respectively, and the two populations did not change significantly during usnic acid supplementation (repeated measures ANOVA) or vary significantly between the rumen liquid and particle fraction (paired t test). Rumen bacterial community structure determined by denaturing gradient gel electrophoresis did not change in response to intake of usnic acid. Firmicutes (38.7 %) and Bacteriodetes (27.4 %) were prevalent among the 16S rRNA gene sequences (n = 62) from the DGGE gels, but representatives of the phyla Verrucomicrobia (14.5 %) and Proteobacteria (1.6 %) were also detected. Rapid detoxification of the usnic acid or resistance to usnic acid may explain why the diversity of the dominant bacterial populations and the bacterial density in the reindeer rumen does not change during usnic acid supplementation. PMID:24509720

  11. Engineering E. coli strain for conversion of short chain fatty acids to bioalcohols

    PubMed Central

    2013-01-01

    Background Recent progress in production of various biofuel precursors and molecules, such as fatty acids, alcohols and alka(e)nes, is a significant step forward for replacing the fossil fuels with renewable fuels. A two-step process, where fatty acids from sugars are produced in the first step and then converted to corresponding biofuel molecules in the second step, seems more viable and attractive at this stage. We have engineered an Escherichia coli strain to take care of the second step for converting short chain fatty acids into corresponding alcohols by using butyrate kinase (Buk), phosphotransbutyrylase (Ptb) and aldehyde/alcohol dehydrogenase (AdhE2) from Clostridium acetobutylicum. Results The engineered E. coli was able to convert butyric acid and other short chain fatty acids of chain length C3 to C7 into corresponding alcohols and the efficiency of conversion varied with different E. coli strain type. Glycerol proved to be a better donor of ATP and electron as compared to glucose for converting butyric acid to butanol. The engineered E. coli was able to tolerate up to 100 mM butyric acid and produced butanol with the conversion rate close to 100% under anaerobic condition. Deletion of native genes, such as fumarate reductase (frdA) and alcohol dehydrogenase (adhE), responsible for side products succinate and ethanol, which act as electron sink and could compete with butyric acid uptake, did not improve the butanol production efficiency. Indigenous acyl-CoA synthetase (fadD) was found to play no role in the conversion of butyric acid to butanol. Engineered E. coli was cultivated in a bioreactor under controlled condition where 60 mM butanol was produced within 24 h of cultivation. A continuous bioreactor with the provision of cell recycling allowed the continuous production of butanol at the average productivity of 7.6 mmol/l/h until 240 h. Conclusions E. coli engineered with the pathway from C. acetobutylicum could efficiently convert butyric acid

  12. Escherichia coli O157:H7 strains isolated from environmental sources differ significantly in acid resistance compared to human outbreak strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A number of studies on the influence of acid on Escherichia coli O157:H7 have shown considerable strain differences, but limited information has been reported to compare the acid resistance based on the different sources of E. coli O157:H7 isolates. The purpose of this study was to determine the sur...

  13. Capsular Sialic Acid of Streptococcus suis Serotype 2 Binds to Swine Influenza Virus and Enhances Bacterial Interactions with Virus-Infected Tracheal Epithelial Cells

    PubMed Central

    Wang, Yingchao; Gagnon, Carl A.; Savard, Christian; Music, Nedzad; Srednik, Mariela; Segura, Mariela; Lachance, Claude; Bellehumeur, Christian

    2013-01-01

    Streptococcus suis serotype 2 is an important swine bacterial pathogen, and it is also an emerging zoonotic agent. It is unknown how S. suis virulent strains, which are usually found in low quantities in pig tonsils, manage to cross the first host defense lines to initiate systemic disease. Influenza virus produces a contagious infection in pigs which is frequently complicated by bacterial coinfections, leading to significant economic impacts. In this study, the effect of a preceding swine influenza H1N1 virus (swH1N1) infection of swine tracheal epithelial cells (NTPr) on the ability of S. suis serotype 2 to adhere to, invade, and activate these cells was evaluated. Cells preinfected with swH1N1 showed bacterial adhesion and invasion levels that were increased more than 100-fold compared to those of normal cells. Inhibition studies confirmed that the capsular sialic acid moiety is responsible for the binding to virus-infected cell surfaces. Also, preincubation of S. suis with swH1N1 significantly increased bacterial adhesion to/invasion of epithelial cells, suggesting that S. suis also uses swH1N1 as a vehicle to invade epithelial cells when the two infections occur simultaneously. Influenza virus infection may facilitate the transient passage of S. suis at the respiratory tract to reach the bloodstream and cause bacteremia and septicemia. S. suis may also increase the local inflammation at the respiratory tract during influenza infection, as suggested by an exacerbated expression of proinflammatory mediators in coinfected cells. These results give new insight into the complex interactions between influenza virus and S. suis in a coinfection model. PMID:24082069

  14. Strain-Specific Synthesis of Mycophenolic Acid by Penicillium roqueforti in Blue-Veined Cheese

    PubMed Central

    Engel, Günter; von Milczewski, Karl Ernst; Prokopek, Dieter; Teuber, Michael

    1982-01-01

    Twenty of 80 strains of Penicillium roqueforti were able to produce up to 600 mg of mycophenolic acid (MPA) liter−1 in 2% yeast extract-5% sucrose broth. Sixty-two of these strains had been isolated from the main blue-veined cheese varieties of western Europe or from starter cultures. Of these 62 dairy strains, only 7 had MPA-producing potential in vitro. These seven strains had all been isolated during the period 1975 to 1981 from the blue cheese of one individual factory. In cheese from the market, MPA (up to 5 mg kg−1) was only found in samples of this same factory. With MPA-producing and -nonproducing strains for the experimental manufacture of blue cheese, MPA synthesis in cheese was only detected with strains which form MPA in yeast extract-sucrose broth. The maximum MPA level at 4 mg kg−1 was similar to that in commercial cheese. Toxicity of MPA was tested with two established human cell lines (Detroit 98 and Girardi Heart) and one established pig kidney cell line (AmII). PMID:16346004

  15. Regulation of host weight gain and lipid metabolism by bacterial bile acid modification in the gut.

    PubMed

    Joyce, Susan A; MacSharry, John; Casey, Patrick G; Kinsella, Michael; Murphy, Eileen F; Shanahan, Fergus; Hill, Colin; Gahan, Cormac G M

    2014-05-20

    Alterations in the gastrointestinal microbiota have been implicated in obesity in mice and humans, but the key microbial functions influencing host energy metabolism and adiposity remain to be determined. Despite an increased understanding of the genetic content of the gastrointestinal microbiome, functional analyses of common microbial gene sets are required. We established a controlled expression system for the parallel functional analysis of microbial alleles in the murine gut. Using this approach we show that bacterial bile salt hydrolase (BSH) mediates a microbe-host dialogue that functionally regulates host lipid metabolism and plays a profound role in cholesterol metabolism and weight gain in the host. Expression of cloned BSH enzymes in the gastrointestinal tract of gnotobiotic or conventionally raised mice significantly altered plasma bile acid signatures and regulated transcription of key genes involved in lipid metabolism (Pparγ, Angptl4), cholesterol metabolism (Abcg5/8), gastrointestinal homeostasis (RegIIIγ), and circadian rhythm (Dbp, Per1/2) in the liver or small intestine. High-level expression of BSH in conventionally raised mice resulted in a significant reduction in host weight gain, plasma cholesterol, and liver triglycerides, demonstrating the overall impact of elevated BSH activity on host physiology. In addition, BSH activity in vivo varied according to BSH allele group, indicating that subtle differences in activity can have significant effects on the host. In summary, we demonstrate that bacterial BSH activity significantly impacts the systemic metabolic processes and adiposity in the host and represents a key mechanistic target for the control of obesity and hypercholesterolemia. PMID:24799697

  16. Reversible Bacterial Adhesion on Mixed Poly(dimethylaminoethyl methacrylate)/Poly(acrylamidophenyl boronic acid) Brush Surfaces.

    PubMed

    Xiong, Xinhong; Wu, Zhaoqiang; Yu, Qian; Xue, Lulu; Du, Jun; Chen, Hong

    2015-11-10

    A simple and versatile method for the preparation of surfaces to control bacterial adhesion is described. Substrates were first treated with two catechol-based polymerization initiators, one for thermal initiation and one for visible-light photoinitiation. Graft polymerization in sequence of dimethylaminoethyl methacrylate (DMAEMA) and 3-acrylamidebenzene boronic acid (BA) from the surface-bound initiators to form mixed polymer brushes on the substrate was then carried out. The PDMAEMA grafts were thermally initiated and the PBA grafts were visible-light-photoinitiated. Gold, poly(vinyl chloride) (PVC), and poly(dimethylsiloxane) (PDMS) were used as model substrates. X-ray photoelectron spectroscopy (XPS), Fourier transform infrared (FT-IR), and ellipsometry analysis confirmed the successful grafting of PDMAEMA/PBA mixed brushes. We demonstrated that the resulting surfaces showed charge-reversal properties in response to change of pH. The transition in surface charge at a specific pH allowed the surface to be reversibly switched from bacteria-adhesive to bacteria-resistant. At pH 4.5, below the isoelectric points (IEP, pH 5.3) of the mixed brushes, the surfaces are positively charged and the negatively charged Gram-positive S. aureus adheres at high density (2.6 × 10(6) cells/cm(2)) due to attractive electrostatic interactions. Subsequently, upon increasing the pH to 9.0 to give negatively charged polymer brush surface, ∼90% of the adherent bacteria are released from the surface, presumably due to repulsive electrostatic interactions. This approach provides a simple method for the preparation of surfaces on which bacterial adhesion can be controlled and is applicable to a wide variety of substrates. PMID:26509287

  17. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    PubMed Central

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-01-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains. PMID:26691589

  18. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-01-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains. PMID:26691589

  19. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-12-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

  20. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    SciTech Connect

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-10-23

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  1. Mechanism of acid tolerance in a rhizobium strain isolated from Pueraria lobata (Willd.) Ohwi.

    PubMed

    Lei, Zhang; Jian-ping, Gu; Shi-qing, Wei; Ze-yang, Zhou; Chao, Zhang; Yongxiong, Yu

    2011-06-01

    The Rhizobium sp. strain PR389 was isolated from the root nodules of Pueraria lobata (Willd.) Ohwi, which grows in acidic (pH 4.6) yellow soil of the Jinyun Mountains of Beibei, Chongqing, China. While rhizobia generally have a pH range of 6.5-7.5 for optimum growth, strain PR389 grew in a liquid yeast extract - mannitol agar medium at pH 4.6, as well as in a pH 4.1 soil suspension, suggesting acid tolerance in this specific strain of rhizobium . However, at pH 4.6, the lag phase before vigorous growth was 40 h compared with 4 h under neutral conditions (pH 7.0). For PR389, the generation time after the lag phase remained the same at different pH levels despite the different durations of the lag phase. Except in the pH 4.4 treatment, the pH of the culturing media increased from 4.6, 4.8, 5.0, and 5.5 to neutral and slightly alkaline after 70 h of culture. Chloramphenicol was added to determine if protein production was involved in the increasing pH process. Chloramphenicol significantly inhibited PR389 growth under acid stress but had little effect under neutral conditions. Proton flux measured during a short acid shock (pH 3.8) revealed that this strain has an intrinsic ability to prevent H(+) from entering cells when compared with acid-sensitive rhizobia. We propose that the mechanism for acid tolerance in PR389 involves both intracellular and extracellular processes. When the extracellular pH is lower than pH 4.4, the cell membrane blocks hydrogen from entering the cell. When the pH exceeds 4.4, the rhizobium strain has the ability to raise the extracellular pH, thereby, potentially decreasing the toxicity of aluminum in acid soil. PMID:21635219

  2. Microcystin-degrading activity of an indigenous bacterial strain Stenotrophomonas acidaminiphila MC-LTH2 isolated from Lake Taihu.

    PubMed

    Yang, Fei; Zhou, Yuanlong; Yin, Lihong; Zhu, Guangcan; Liang, Geyu; Pu, Yuepu

    2014-01-01

    Microcystin-LR (MC-LR) and microcystin-RR (MC-RR) produced by harmful cyanobacterial blooms (HCBs) pose substantial threats to the ecosystem and public health due to their potential hepatotoxicity. Degradation of microcystins (MCs) by indigenous bacteria represents a promising method for removing MCs from fresh water without harming the aquatic environment, but only a few microcystin (MC)-degrading bacteria have been isolated and had their mechanisms reported. This study aimed to isolate indigenous bacteria from Lake Taihu, and investigate the capability and mechanism of MC degradation by these bacteria. During a Microcystis bloom, an indigenous MC-degrading bacterium designated MC-LTH2 was successfully isolated from Lake Taihu, and identified as Stenotrophomonas acidaminiphila based on phylogenetic analysis. In the presence of MC-LR together with MC-RR, the strain MC-LTH2 was capable of totally degrading both simultaneously in 8 days, at rates of 3.0 mg/(L⋅d) and 5.6 mg/(L⋅d), respectively. The degradation rates of MCs were dependent on temperature, pH, and initial MC concentration. Adda (3-amino-9-methoxy-2, 6, 8-trimethyl-10-phenyldeca-4, 6-dienoic acid) was detected as an intermediate degradation product of MCs using high performance liquid chromatography coupled with time-of-flight mass spectrometry (HPLC-TOF-MS). To the best of our knowledge, this is the first report of Stenotrophomonas acidaminiphila capable of degrading two MC analogues and other compounds containing Adda residue completely under various conditions, although the mlrA gene in the strain was not detected. These results indicate the Stenotrophomonas acidaminiphila strain MC-LTH2 possesses a significant potential to be used in bioremediation of water bodies contaminated by MC-LR and MC-RR, and is potentially involved in the degradation of MCs during the disappearance of the HCBs in Lake Taihu. PMID:24416455

  3. Comparative Genomic and Phenotypic Characterization of Pathogenic and Non-Pathogenic Strains of Xanthomonas arboricola Reveals Insights into the Infection Process of Bacterial Spot Disease of Stone Fruits

    PubMed Central

    Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M.

    2016-01-01

    Xanthomonas arboricola pv. pruni is the causal agent of bacterial spot disease of stone fruits, a quarantinable pathogen in several areas worldwide, including the European Union. In order to develop efficient control methods for this disease, it is necessary to improve the understanding of the key determinants associated with host restriction, colonization and the development of pathogenesis. After an initial characterization, by multilocus sequence analysis, of 15 strains of X. arboricola isolated from Prunus, one strain did not group into the pathovar pruni or into other pathovars of this species and therefore it was identified and defined as a X. arboricola pv. pruni look-a-like. This non-pathogenic strain and two typical strains of X. arboricola pv. pruni were selected for a whole genome and phenotype comparative analysis in features associated with the pathogenesis process in Xanthomonas. Comparative analysis among these bacterial strains isolated from Prunus spp. and the inclusion of 15 publicly available genome sequences from other pathogenic and non-pathogenic strains of X. arboricola revealed variations in the phenotype associated with variations in the profiles of TonB-dependent transporters, sensors of the two-component regulatory system, methyl accepting chemotaxis proteins, components of the flagella and the type IV pilus, as well as in the repertoire of cell-wall degrading enzymes and the components of the type III secretion system and related effectors. These variations provide a global overview of those mechanisms that could be associated with the development of bacterial spot disease. Additionally, it pointed out some features that might influence the host specificity and the variable virulence observed in X. arboricola. PMID:27571391

  4. Comparative Genomic and Phenotypic Characterization of Pathogenic and Non-Pathogenic Strains of Xanthomonas arboricola Reveals Insights into the Infection Process of Bacterial Spot Disease of Stone Fruits.

    PubMed

    Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M; Cubero, Jaime

    2016-01-01

    Xanthomonas arboricola pv. pruni is the causal agent of bacterial spot disease of stone fruits, a quarantinable pathogen in several areas worldwide, including the European Union. In order to develop efficient control methods for this disease, it is necessary to improve the understanding of the key determinants associated with host restriction, colonization and the development of pathogenesis. After an initial characterization, by multilocus sequence analysis, of 15 strains of X. arboricola isolated from Prunus, one strain did not group into the pathovar pruni or into other pathovars of this species and therefore it was identified and defined as a X. arboricola pv. pruni look-a-like. This non-pathogenic strain and two typical strains of X. arboricola pv. pruni were selected for a whole genome and phenotype comparative analysis in features associated with the pathogenesis process in Xanthomonas. Comparative analysis among these bacterial strains isolated from Prunus spp. and the inclusion of 15 publicly available genome sequences from other pathogenic and non-pathogenic strains of X. arboricola revealed variations in the phenotype associated with variations in the profiles of TonB-dependent transporters, sensors of the two-component regulatory system, methyl accepting chemotaxis proteins, components of the flagella and the type IV pilus, as well as in the repertoire of cell-wall degrading enzymes and the components of the type III secretion system and related effectors. These variations provide a global overview of those mechanisms that could be associated with the development of bacterial spot disease. Additionally, it pointed out some features that might influence the host specificity and the variable virulence observed in X. arboricola. PMID:27571391

  5. Use of poly(lactic acid) amendments to promote the bacterial fixation of metals in zinc smelter tailings.

    PubMed

    Edenborn, H M

    2004-04-01

    The ability of poly(lactic acid) (PLA) to serve as a long-term source of lactic acid for bacterial sulfate reduction activity in zinc smelter tailings was investigated. Solid PLA polymers mixed in water hydrolyzed abiotically to release lactic acid into solution over an extended period of time. The addition of both PLA and gypsum was required for indigenous bacteria to lower redox potential, raise pH, and stimulate sulfate reduction activity in highly oxidized smelter tailings after one year of treatment. Bioavailable cadmium, copper, lead and zinc were all lowered significantly in PLA/gypsum treated soil, but PLA amendments alone increased the bioavailability of lead, nickel and zinc. Similar PLA amendments may be useful in constructed wetlands and reactive barrier walls for the passive treatment of mine drainage, where enhanced rates of bacterial sulfate reduction are desirable. PMID:14693443

  6. Bacterial inoculants of forage grasses that enhance degradation of 2-chlorobenzoic acid in soil

    SciTech Connect

    Siciliano, S.D.; Germida, J.J.

    1997-06-01

    Biological remediation of contaminated soil is an effective method of reducing risk to human and ecosystem health. Bacteria and plants might be used to enhance remediation of soil pollutants in situ. This study assessed the potential of bacteria, plants, and plant-bacteria associations to remediate 2-chlorobenzoic acid (2CBA) contaminated soil. Initially, grass viability was assessed in 2CBA-contaminated soil. Soil was contaminated with 2CBA, forage grasses were grown under growth chamber conditions for 42 or 60 d, and the 2CBA concentration in soil was determined by gas chromatography. Only five of 16 forage grasses grew in 2CBA-treated soil. Growth of Bromus inermis had no effect on 2CBA concentration, whereas Agropyron intermedium, B. biebersteinii, A. riparum, and Elymus dauricus decreased 2CBA relative to nonplanted control soil by 32 to 42%. The 12 bacteria isolates were screened for their ability to promote the germination of the five grasses in 2CBA-contaminated soil. Inoculation of A. riparum with Pseudomonas aeruginosa strain R75, a proven plant growth-promoting rhizobacterium, increased seed germination by 80% and disappearance of 2CBA by 20% relative to noninoculated plants. Inoculation of E. dauricus with a mixture of P. savastanoi strain CB35, a 2CBA-degrading bacterium, and P. aeruginosa strain R75 increased disappearance of 2CBA by 112% relative to noninoculated plants. No clear relationship between enhanced 2CBA disappearance and increased plant biomass was found. These results suggest that specific plant-microbial systems can be developed to enhance remediation of pollutants in soil.

  7. Rhizosphere bacterial carbon turnover is higher in nucleic acids than membrane lipids: implications for understanding soil carbon cycling

    PubMed Central

    Malik, Ashish A.; Dannert, Helena; Griffiths, Robert I.; Thomson, Bruce C.; Gleixner, Gerd

    2015-01-01

    Using a pulse chase 13CO2 plant labeling experiment we compared the flow of plant carbon into macromolecular fractions of rhizosphere soil microorganisms. Time dependent 13C dilution patterns in microbial cellular fractions were used to calculate their turnover time. The turnover times of microbial biomolecules were found to vary: microbial RNA (19 h) and DNA (30 h) turned over fastest followed by chloroform fumigation extraction-derived soluble cell lysis products (14 days), while phospholipid fatty acids (PLFAs) had the slowest turnover (42 days). PLFA/NLFA 13C analyses suggest that both mutualistic arbuscular mycorrhizal and saprophytic fungi are dominant in initial plant carbon uptake. In contrast, high initial 13C enrichment in RNA hints at bacterial importance in initial C uptake due to the dominance of bacterial derived RNA in total extracts of soil RNA. To explain this discrepancy, we observed low renewal rate of bacterial lipids, which may therefore bias lipid fatty acid based interpretations of the role of bacteria in soil microbial food webs. Based on our findings, we question current assumptions regarding plant-microbe carbon flux and suggest that the rhizosphere bacterial contribution to plant assimilate uptake could be higher. This highlights the need for more detailed quantitative investigations with nucleic acid biomarkers to further validate these findings. PMID:25914679

  8. Acid resistance and response to pH-induced stress in two Lactobacillus plantarum strains with probiotic potential.

    PubMed

    Šeme, H; Gjuračić, K; Kos, B; Fujs, Š; Štempelj, M; Petković, H; Šušković, J; Bogovič Matijašić, B; Kosec, G

    2015-01-01

    Two new Lactobacillus plantarum strains, KR6-DSM 28780 and M5 isolated from sour turnip and traditional dried fresh cheese, respectively, were evaluated for species identity, antibiotic susceptibility, resistance to gastrointestinal conditions and adaptive response to low pH. Resistance mechanisms involved in the adaptation to acid-induced stress in these two strains were investigated by quantitative PCR of the atpA, cfa1, mleS and hisD genes. In addition to absence of antibiotic resistance, the two L. plantarum strains showed excellent survival rates at pH values as low as 2.4. Adaptive response to low pH was clearly observed in both strains; strain KR6 was superior to M5, as demonstrated by its ability to survive during 3 h incubation at pH 2.0 upon adaptation to moderately acidic conditions. In contrast, acid adaptation did not significantly affect the survival rate during simulated passage through the gastrointestinal tract. In both strains, induction of histidine biosynthesis (hisD) was upregulated during the acid adaptation response. In addition, significant upregulation of the cfa1 gene, involved in modulation of membrane fatty acid composition, was observed during the adaptation phase in strain KR6 but not in strain M5. Cells adapted to moderately acidic conditions also showed a significantly increased viability after the lyophilisation procedure, a cross-protection phenomenon providing additional advantage in probiotic application. PMID:25380802

  9. An uncooked vegan diet shifts the profile of human fecal microflora: computerized analysis of direct stool sample gas-liquid chromatography profiles of bacterial cellular fatty acids.

    PubMed Central

    Peltonen, R; Ling, W H; Hänninen, O; Eerola, E

    1992-01-01

    The effect of an uncooked extreme vegan diet on fecal microflora was studied by direct stool sample gas-liquid chromatography (GLC) of bacterial cellular fatty acids and by quantitative bacterial culture by using classical microbiological techniques of isolation, identification, and enumeration of different bacterial species. Eighteen volunteers were divided randomly into two groups. The test group received an uncooked vegan diet for 1 month and a conventional diet of mixed Western type for the other month of the study. The control group consumed a conventional diet throughout the study period. Stool samples were collected. Bacterial cellular fatty acids were extracted directly from the stool samples and measured by GLC. Computerized analysis of the resulting fatty acid profiles was performed. Such a profile represents all bacterial cellular fatty acids in a sample and thus reflects its microflora and can be used to detect changes, differences, or similarities of bacterial flora between individual samples or sample groups. GLC profiles changed significantly in the test group after the induction and discontinuation of the vegan diet but not in the control group at any time, whereas quantitative bacterial culture did not detect any significant change in fecal bacteriology in either of the groups. The results suggest that an uncooked extreme vegan diet alters the fecal bacterial flora significantly when it is measured by direct stool sample GLC of bacterial fatty acids. PMID:1482187

  10. Bioconversion of kitchen garbage to lactic acid by two wild strains of Lactobacillus species.

    PubMed

    Wang, Qunhui; Wang, Xuming; Wang, Xiaoqiang; Ma, Hongzhi; Ren, Nanqi

    2005-01-01

    To enhance lactic acid (LA) production from kitchen garbage, which is a raw material for biodegradable plastics production, the application of high-performance lactic acid bacteria (LAB) as inocula was investigated. Two wild strains of Lactobacillus species, designated as TH165 and TD175, were isolated and screened from kitchen garbage. Strain TH165 was capable of hydrolyzing starch to produce LA; 49.5% of starch was broken down in fermentation medium containing 8.52 g/L of soluble starch, and 4.01 g/L of LA was produced after 24 h fermentation at 37 degrees C without pH control. Strain TD175 could produce 16.06 g/L of LA, 66.9% higher than that of Lactobacillus bulgaricus ACCC11058 in fermentation medium containing 2.0% glucose at 30 degrees C without pH control. Furthermore, coinoculation of strains TH165 and TD175 enhanced the LA production, resulting in 33.80 g/L of LA concentration and 0.46 g/g (DW) of LA yield from nonautoclaved kitchen garbage after 72 h fermentation with pH maintained at 5.5-6.0, values 36.9% higher than those of the fermentation without inoculum (control). This study shows that enhancement of LA production from kitchen garbage can be realized by using high-performance LAB. This recycling system is conducive to clear away pollutants and to reduce cost of LA production. PMID:16194915

  11. A possible mechanism of action of plant growth-promoting rhizobacteria (PGPR) strain Bacillus pumilus WP8 via regulation of soil bacterial community structure.

    PubMed

    Kang, Yijun; Shen, Min; Wang, Huanli; Zhao, Qingxin

    2013-01-01

    According to the traditional view, establishment and maintenance of critical population densities in the rhizosphere was the premise of PGPR to exert growth-promoting effects. In light of the facts that soil bacterial community structures can be changed by some PGPR strains including Bacillus pumilus WP8, we hypothesize that regulation of soil bacterial community structure is one of the plant growth-promoting mechanisms of B. pumilus WP8, rather than depending on high-density cells in soil. In this study, denaturing gradient gel electrophoresis (PCR-DGGE) was performed to evaluate the relationship between changes in soil bacterial community structure and growth-promoting effect on the seedling growth of fava beans (Vicia faba L.) during three successive cultivations. We found that B. pumilus WP8 lacks capacity to reproduce in large enough numbers to survive in bulk soil more than 40 days, yet the bacterial community structures were gradually influenced by inoculation of WP8, especially on dominant populations. Despite WP8 being short-lived, it confers the ability of steadily promoting fava bean seedling growth on soil during the whole growing period for at least 90 days. Pseudomonas chlororaphis RA6, another tested PGPR strain, exists in large numbers for at least 60 days but less than 90 days, whilst giving rise to slight influence on bacterial community structure. In addition, along with the extinction of RA6 cells in bulk soils, the effect of growth promotion disappeared simultaneously. Furthermore, the increment of soil catalase activity from WP8 treatment implied the ability to stimulate soil microbial activity, which may be the reason why the dominant population changed and increased as time passed. Our study suggests that regulation of treated soil bacterial community structure may be another possible action mechanism. PMID:24005176

  12. Biosynthesis of Polyunsaturated Fatty Acids in the Oleaginous Marine Diatom Fistulifera sp. Strain JPCC DA0580

    PubMed Central

    Liang, Yue; Maeda, Yoshiaki; Sunaga, Yoshihiko; Muto, Masaki; Matsumoto, Mitsufumi; Yoshino, Tomoko; Tanaka, Tsuyoshi

    2013-01-01

    Studies of polyunsaturated fatty acid (PUFA) biosynthesis in microalgae are of great importance for many reasons, including the production of biofuel and variable omega 3-long chain PUFAs. The elucidation of the PUFA biosynthesis pathway is necessary for bioengineering to increase or decrease PUFA content in certain microalgae. In this study, we identified the PUFA synthesis pathway in the oleaginous marine diatom, Fistulifera sp. strain JPCC DA0580, a promising candidate for biodiesel production. The data revealed not only the presence of the desaturases and elongases involved in eicosapentaenoic acid (EPA) synthesis, but also the unexpected localization of ω3-desaturase expression in the chloroplast. This suggests that this microalga might perform the final step of EPA synthesis in the chloroplast and not in the endoplasmic reticulum (ER) like other diatoms. The detailed fatty acid profile suggests that the EPA was synthesized only through the ω6-pathway in this strain, which was also different from other diatoms. Finally, the transcriptome analysis demonstrated an overall down-regulation of desaturases and elongases over incubation time. These genetic features might explain the decrease of PUFA percentage over incubation time in this strain. The important insights into metabolite synthesis acquired here will be useful for future metabolic engineering to control PUFA content in this diatom. PMID:24335525

  13. Magnetic resonance tells microbiology where to go; bacterial teichoic acid protects liquid water at sub-zero temperatures

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Wickham, Jason R.; Eastman, Margaret A.; Harrison, William; Pereira, Mark P.; Brown, Eric D.

    2008-08-01

    Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, although, with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as high salt concentration (brine veins) and adhesion to particulates or ice crystal defects. Teichoic acid is a phosphodiester polymer ubiquitous in Gram positive bacteria, composing 50% of the mass of the bacterial cell wall and excreted into the extracellular space of biofilm communities. We have found that when bound to the peptidoglycan cell wall (wall teichoic acid) or as a free molecule (lipoteichoic acid), teichoic acid is surrounded by liquid water at temperatures significantly below freezing. Using solid-state NMR, we are unable to collect 31P CPMAS spectra for frozen solutions of lipoteichoic acid at temperatures above -60 °C. For wall teichoic acid in D2O, signals are not seen above -30 °C. These results can be explained by the presence of liquid water, which permits rapid molecular motion to remove 1H/31P dipolar coupling. 2H quadrupole echo NMR spectroscopy reveals that both liquid and solid water are present. We suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.

  14. Rosmarinic acid is a homoserine lactone mimic produced by plants that activates a bacterial quorum-sensing regulator.

    PubMed

    Corral-Lugo, Andrés; Daddaoua, Abdelali; Ortega, Alvaro; Espinosa-Urgel, Manuel; Krell, Tino

    2016-01-01

    Quorum sensing is a bacterial communication mechanism that controls genes, enabling bacteria to live as communities, such as biofilms. Homoserine lactone (HSL) molecules function as quorum-sensing signals for Gram-negative bacteria. Plants also produce previously unidentified compounds that affect quorum sensing. We identified rosmarinic acid as a plant-derived compound that functioned as an HSL mimic. In vitro assays showed that rosmarinic acid bound to the quorum-sensing regulator RhlR of Pseudomonas aeruginosa PAO1 and competed with the bacterial ligand N-butanoyl-homoserine lactone (C4-HSL). Furthermore, rosmarinic acid stimulated a greater increase in RhlR-mediated transcription in vitro than that of C4-HSL. In P. aeruginosa, rosmarinic acid induced quorum sensing-dependent gene expression and increased biofilm formation and the production of the virulence factors pyocyanin and elastase. Because P. aeruginosa PAO1 infection induces rosmarinic acid secretion from plant roots, our results indicate that rosmarinic acid secretion is a plant defense mechanism to stimulate a premature quorum-sensing response. P. aeruginosa is a ubiquitous pathogen that infects plants and animals; therefore, identification of rosmarinic acid as an inducer of premature quorum-sensing responses may be useful in agriculture and inform human therapeutic strategies. PMID:26732761

  15. Sequencing of a 1,3-1,4-beta-D-glucanase (lichenase) from the anaerobic fungus Orpinomyces strain PC-2: properties of the enzyme expressed in Escherichia coli and evidence that the gene has a bacterial origin.

    PubMed Central

    Chen, H; Li, X L; Ljungdahl, L G

    1997-01-01

    A 971-bp cDNA, designated licA, was obtained from a library of Orpinomyces sp. strain PC-2 constructed in Escherichia coli. It had an open reading frame of 738 nucleotides encoding LicA (1,3-1,4-beta-D-glucanase; lichenase) (EC 3.2.1.73) of 245 amino acids with a calculated molecular mass of 27,929 Da. The deduced amino acid sequence had high homology with bacterial beta-glucanases, particularly in the central regions and toward the C-terminal halves of bacterial enzymes. LicA had no homology with plant beta-glucanases. The genomic DNA region coding for LicA was devoid of introns. More than 95% of the recombinant beta-glucanase produced in E. coli cells was found in the culture medium and periplasmic space. A N-terminal signal peptide of 29 amino residues was cleaved from the enzyme secreted from Orpinomyces, whereas 21 amino acid residues of the signal peptide were removed when the enzyme was produced by E. coli. The beta-glucanase produced by E. coli was purified from the culture medium. It had a molecular mass of 27 kDa on sodium dodecyl sulfate-polyacrylamide gels. The Km and Vmax values with lichenin as the substrate at pH 6.0 and 40 degrees C were 0.75 mg/ml and 3,790 micromol/min/mg, respectively. With barley beta-glucan as the substrate, the corresponding values were 0.91 mg/ml and 5,320 micromol/min/mg. This enzyme did not hydrolyze laminarin, carboxymethylcellulose, pustulan, or xylan. The main products of lichenin and barley beta-glucan hydrolysis were triose and tetraose. LicA represented the first 1,3-1,4-beta-D-glucanase reported from fungi. The results presented suggest that licA of Orpinomyces had a bacterial origin. PMID:9324248

  16. DIFFERENTIAL VOLATILE EMISSIONS AND SALICYLIC ACID LEVELS FROM TOBACCO PLANTS IN RESPONSE TO DIFFERENT STRAINS OF PSEUDOMONAS SYRINGAE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pathogen-induced plant responses include changes in both volatile and non-volatile secondary metabolites. To investigate the role of bacterial pathogenesis in plant volatile emissions, tobacco plants, Nicotiana tabacum K326, were inoculated with virulent, avirulent, and mutant strains of Pseudomona...

  17. A Lactobacillus acidophilus strain of human gastrointestinal microbiota origin elicits killing of enterovirulent Salmonella enterica Serovar Typhimurium by triggering lethal bacterial membrane damage.

    PubMed

    Coconnier-Polter, Marie-Hélène; Liévin-Le Moal, Vanessa; Servin, Alain L

    2005-10-01

    The human gastrointestinal microbiota produces antagonistic activities against gastrointestinal bacterial pathogens. We undertook a study to investigate the mechanism(s) by which a Lactobacillus acidophilus strain of human microbiota origin antagonizes the gram-negative enteroinvasive pathogen Salmonella enterica serovar Typhimurium. We showed that the cell-free culture supernatant of L. acidophilus strain LB (LB-CFCS) induced the following effects in S. enterica SL1344: (i) a decrease in intracellular ATP that paralleled bacterial death, (ii) the release of lipopolysaccharide, (iii) permeabilization of the bacterial membrane, and (iv) an increase in the sensitivity of Salmonella to the lytic action of sodium dodecyl sulfate. Finally, we showed using two mutant strains of Salmonella, PhoP MS7953s and PmrA JKS1170, that the two-component regulatory systems PhoP-PhoQ and PmrA-PmrB that regulate the mechanisms of resistance to antibacterial agents in Salmonella did not influence the anti-Salmonella effect of LB-CFCS. PMID:16204528

  18. A novel thermoalkalostable esterase from Acidicaldus sp. strain USBA-GBX-499 with enantioselectivity isolated from an acidic hot springs of Colombian Andes.

    PubMed

    López, Gina; Chow, Jennifer; Bongen, Patrick; Lauinger, Benjamin; Pietruszka, Jörg; Streit, Wolfgang R; Baena, Sandra

    2014-10-01

    Several thermo- and mesoacidophilic bacterial strains that revealed high lipolytic activity were isolated from water samples derived from acidic hot springs in Los Nevados National Natural Park (Colombia). A novel lipolytic enzyme named 499EST was obtained from the thermoacidophilic alpha-Proteobacterium Acidicaldus USBA-GBX-499. The gene estA encoded a 313-amino-acid protein named 499EST. The deduced amino acid sequence showed the highest identity (58 %) with a putative α/β hydrolase from Acidiphilium sp. (ZP_08632277.1). Sequence alignments and phylogenetic analysis indicated that 499EST is a new member of the bacterial esterase/lipase family IV. The esterase reveals its optimum catalytic activity at 55 °C and pH 9.0. Kinetic studies showed that 499EST preferentially hydrolyzed middle-length acyl chains (C6-C8), especially p-nitrophenyl (p-NP) caproate (C6). Its thermostability and activity were strongly enhanced by adding 6 mM FeCl3. High stability in the presence of water-miscible solvents such as dimethyl sulfoxide and glycerol was observed. This enzyme also exhibits stability under harsh environmental conditions and enantioselectivity towards naproxen and ibuprofen esters, yielding the medically relevant (S)-enantiomers. In conclusion, according to our knowledge, 499EST is the first thermoalkalostable esterase derived from a Gram-negative thermoacidophilic bacterium. PMID:24818691

  19. Production of indole-3-acetic acid by the cyanobacterium Arthrospira platensis strain MMG-9.

    PubMed

    Ahmed, Mehboob; Stal, Lucas; Hasnain, Shahida

    2010-09-01

    The filamentous cyanobacterium Arthrospira platensis strain MMG-9 was isolated from a rice field. The ability of this strain to synthesize the bioactive compound indole-3-acetic acid (IAA) was demonstrated. IAA was extracted from the culture A. platensis strain MMG-9 and its identity was confirmed by thin layer chromatography (TLC) as well as by high performance liquid chromatography (HPLC). The IAA precursor L-tryptophan was required for IAA biosynthesis. Released IAA increased with the increase of the initial concentration of L-tryptophan in the medium and with the incubation time. A. platensis strain MMG-9 accumulates more IAA than it released it into the medium. The bioactivity of the secreted IAA was shown by its effect on the formation of roots by Pisum sativum. There was a significant positive effect of the supernatant of cultures of A. platensis strain MMG-9 on the number of lateral roots of P. sativum while a negative effect on root length was observed. PMID:20890089

  20. Dihydrolipoic but not alpha-lipoic acid affects susceptibility of eukaryotic cells to bacterial invasion.

    PubMed

    Bozhokina, Ekaterina; Khaitlina, Sofia; Gamaley, Irina

    2015-05-01

    Sensitivity of eukaryotic cells to facultative pathogens can depend on physiological state of host cells. Previously we have shown that pretreatment of HeLa cells with N-acetylcysteine (NAC) makes the cells 2-3-fold more sensitive to invasion by the wild-type Serratia grimesii and recombinant Escherichia coli expressing gene of actin-specific metalloprotease grimelysin [1]. To evaluate the impact of chemically different antioxidants, in the present work we studied the effects of α-Lipoic acid (LA) and dihydrolipoic acid (DHLA) on efficiency of S. grimesii and recombinant E. coli expressing grimelysin gene to penetrate into HeLa and CaCo cells. Similarly to the effect of NAC, pretreatment of HeLa and CaCo cells with 0.6 or 1.25 mM DHLA increased the entry of grimelysin producing bacteria by a factor of 2.5 and 3 for the wild-type S. grimesii and recombinant E. coli, respectively. In contrast, pretreatment of the cells with 0.6 or 1.25 mM LA did not affect the bacteria uptake. The increased invasion of HeLa and CaCo cells correlated with the enhanced expression of E-cadherin and β-catenin genes, whereas expression of these genes in the LA-treated cells was not changed. Comparison of these results suggests that it is sulfhydryl group of DHLA that promotes efficient modification of cell properties assisting bacterial uptake. We assume that the NAC- and DHLA-induced stimulation of the E-cadherin-catenin pathway contributes to the increased internalization of the grimelysin producing bacteria within transformed cells. PMID:25817791

  1. A comprehensive study on the behavior of a novel bacterial strain Acinetobacter guillouiae for bioremediation of divalent copper.

    PubMed

    Majumder, Subhajit; Gangadhar, Gayathri; Raghuvanshi, Smita; Gupta, Suresh

    2015-09-01

    Biological methods have been successfully used to mitigate heavy metal pollution problem in wastewater. The present study was aimed towards isolation of a novel indigenous bacterial strain, Acinetobacter guillouiae from activated sludge and its subsequent application in remediation of copper (Cu(2+)) from aqueous solution. Kinetic study of bioremediation was performed for initial Cu(2+) concentrations ranging from 40 to 150 mg L(-1). Optimum values of nutrient dosage, pH, macronutrients [Nitrogen (N)-Phosphorus (P)-Potassium (K)] dosage, aerobic and facultative anaerobic conditions, temperature, and inoculum volume were determined by conducting separate batch bioremediation studies at 80 mg L(-1) initial concentration of Cu(2+). Kinetic study showed that A. guillouiae removed 98.7 % Cu(2+) for 80 mg L(-1) initial concentration of Cu(2+) after 16 h at an optimum solution pH of 7.0. Results also revealed that A. guillouiae showed maximum growth at double the standard composition of N, P and standard composition of K in nutrient dosage. Experimental data obtained in present study were utilized to validate different growth kinetic models such as Monod, Powell, Haldane, Luong, and Edwards. Growth kinetics of A. guillouiae was better understood by Luong model (R (2) = 0.97). Higher values of coefficient of determination (R (2) = 0.97-0.99) confirmed the suitability of the three-half-order kinetic model for representing the Cu(2+) bioremediation. A. guillouiae showed a robust removal mechanism for the bioremediation of Cu(2+). PMID:26017755

  2. Diagnosis of bacterial vaginosis by a new multiplex peptide nucleic acid fluorescence in situ hybridization method

    PubMed Central

    Machado, António; Castro, Joana; Cereija, Tatiana; Almeida, Carina

    2015-01-01

    Bacterial vaginosis (BV) is one of most common vaginal infections. However, its diagnosis by classical methods reveals low specificity. Our goal was to evaluate the accuracy diagnosis of 150 vaginal samples with research gold standard methods and our Peptide Nucleic Acid (PNA) probes by Fluorescence in situ Hybridization (FISH) methodology. Also, we described the first PNA-FISH methodology for BV diagnosis, which provides results in approximately 3 h. The results showed a sensitivity of 84.6% (95% confidence interval (CI), from 64.3 to 95.0%) and a specificity of 97.6% (95% CI [92.6–99.4%]), demonstrating the higher specificity of the PNA-FISH method and showing false positive results in BV diagnosis commonly obtained by the classical methods. This methodology combines the specificity of PNA probes for Lactobacillus species and G. vaginalis visualization and the calculation of the microscopic field by Nugent score, allowing a trustful evaluation of the bacteria present in vaginal microflora and avoiding the occurrence of misleading diagnostics. Therefore, the PNA-FISH methodology represents a valuable alternative for BV diagnosis. PMID:25737820

  3. The FXR agonist obeticholic acid prevents gut barrier dysfunction and bacterial translocation in cholestatic rats.

    PubMed

    Verbeke, Len; Farre, Ricard; Verbinnen, Bert; Covens, Kris; Vanuytsel, Tim; Verhaegen, Jan; Komuta, Mina; Roskams, Tania; Chatterjee, Sagnik; Annaert, Pieter; Vander Elst, Ingrid; Windmolders, Petra; Trebicka, Jonel; Nevens, Frederik; Laleman, Wim

    2015-02-01

    Bacterial translocation (BTL) drives pathogenesis and complications of cirrhosis. Farnesoid X-activated receptor (FXR) is a key transcription regulator in hepatic and intestinal bile metabolism. We studied potential intestinal FXR dysfunction in a rat model of cholestatic liver injury and evaluated effects of obeticholic acid (INT-747), an FXR agonist, on gut permeability, inflammation, and BTL. Rats were gavaged with INT-747 or vehicle during 10 days after bile-duct ligation and then were assessed for changes in gut permeability, BTL, and tight-junction protein expression, immune cell recruitment, and cytokine expression in ileum, mesenteric lymph nodes, and spleen. Auxiliary in vitro BTL-mimicking experiments were performed with Transwell supports. Vehicle-treated bile duct-ligated rats exhibited decreased FXR pathway expression in both jejunum and ileum, in association with increased gut permeability through increased claudin-2 expression and related to local and systemic recruitment of natural killer cells resulting in increased interferon-γ expression and BTL. After INT-747 treatment, natural killer cells and interferon-γ expression markedly decreased, in association with normalized permeability selectively in ileum (up-regulated claudin-1 and occludin) and a significant reduction in BTL. In vitro, interferon-γ induced increased Escherichia coli translocation, which remained unaffected by INT-747. In experimental cholestasis, FXR agonism improved ileal barrier function by attenuating intestinal inflammation, leading to reduced BTL and thus demonstrating a crucial protective role for FXR in the gut-liver axis. PMID:25592258

  4. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  5. Diagnosis of bacterial vaginosis by a new multiplex peptide nucleic acid fluorescence in situ hybridization method.

    PubMed

    Machado, António; Castro, Joana; Cereija, Tatiana; Almeida, Carina; Cerca, Nuno

    2015-01-01

    Bacterial vaginosis (BV) is one of most common vaginal infections. However, its diagnosis by classical methods reveals low specificity. Our goal was to evaluate the accuracy diagnosis of 150 vaginal samples with research gold standard methods and our Peptide Nucleic Acid (PNA) probes by Fluorescence in situ Hybridization (FISH) methodology. Also, we described the first PNA-FISH methodology for BV diagnosis, which provides results in approximately 3 h. The results showed a sensitivity of 84.6% (95% confidence interval (CI), from 64.3 to 95.0%) and a specificity of 97.6% (95% CI [92.6-99.4%]), demonstrating the higher specificity of the PNA-FISH method and showing false positive results in BV diagnosis commonly obtained by the classical methods. This methodology combines the specificity of PNA probes for Lactobacillus species and G. vaginalis visualization and the calculation of the microscopic field by Nugent score, allowing a trustful evaluation of the bacteria present in vaginal microflora and avoiding the occurrence of misleading diagnostics. Therefore, the PNA-FISH methodology represents a valuable alternative for BV diagnosis. PMID:25737820

  6. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  7. Stable Isotope Peptide Mass Spectrometry To Decipher Amino Acid Metabolism in Dehalococcoides Strain CBDB1

    PubMed Central

    Marco-Urrea, Ernest; Seifert, Jana; von Bergen, Martin

    2012-01-01

    Dehalococcoides species are key players in the anaerobic transformation of halogenated solvents at contaminated sites. Here, we analyze isotopologue distributions in amino acid pools from peptides of Dehalococcoides strain CBDB1 after incubation with 13C-labeled acetate or bicarbonate as a carbon source. The resulting data were interpreted with regard to genome annotations to identify amino acid biosynthesis pathways. In addition to using gas chromatography-mass spectrometry (GC-MS) for analyzing derivatized amino acids after protein hydrolysis, we introduce a second, much milder method, in which we directly analyze peptide masses after tryptic digest and peptide fragments by nano-liquid chromatography-electrospray ionization-tandem mass spectrometry (nano-LC-ESI-MS/MS). With this method, we identify isotope incorporation patterns for 17 proteinaceous amino acids, including proline, cysteine, lysine, and arginine, which escaped previous analyses in Dehalococcoides. Our results confirmed lysine biosynthesis via the α-aminoadipate pathway, precluding lysine formation from aspartate. Similarly, the isotopologue pattern obtained for arginine provided biochemical evidence of its synthesis from glutamate. Direct peptide MS/MS analysis of the labeling patterns of glutamine and asparagine, which were converted to glutamate and aspartate during protein hydrolysis, gave biochemical evidence of their precursors and confirmed glutamate biosynthesis via a Re-specific citrate synthase. By addition of unlabeled free amino acids to labeled cells, we show that in strain CBDB1 none of the 17 tested amino acids was incorporated into cell mass, indicating that they are all synthesized de novo. Our approach is widely applicable and provides a means to analyze amino acid metabolism by studying specific proteins even in mixed consortia. PMID:22661690

  8. The plant pathogenic fungus Gaeumannomyces graminis var. tritici improves bacterial growth and triggers early gene regulations in the biocontrol strain Pseudomonas fluorescens Pf29Arp.

    PubMed

    Barret, M; Frey-Klett, P; Boutin, M; Guillerm-Erckelboudt, A-Y; Martin, F; Guillot, L; Sarniguet, A

    2009-01-01

    In soil, some antagonistic rhizobacteria contribute to reduce root diseases caused by phytopathogenic fungi. Direct modes of a