Science.gov

Sample records for acid bacterial strains

  1. Method for construction of bacterial strains with increased succinic acid production

    DOEpatents

    Donnelly, Mark I.; Sanville-Millard, Cynthia; Chatterjee, Ranjini

    2000-01-01

    A fermentation process for producing succinic acid is provided comprising selecting a bacterial strain that does not produce succinic acid in high yield, disrupting the normal regulation of sugar metabolism of said bacterial strain, and combining the mutant bacterial strain and selected sugar in anaerobic conditions to facilitate production of succinic acid. Also provided is a method for changing low yield succinic acid producing bacteria to high yield succinic acid producing bacteria comprising selecting a bacterial strain having a phosphotransferase system and altering the phosphotransferase system so as to allow the bacterial strain to simultaneously metabolize different sugars.

  2. Comparative biocidal activity of peracetic acid, benzalkonium chloride and ortho-phthalaldehyde on 77 bacterial strains.

    PubMed

    Bridier, A; Briandet, R; Thomas, V; Dubois-Brissonnet, F

    2011-07-01

    Despite numerous reports on biocide activities, it is often difficult to have a reliable and relevant overview of bacterial resistance to disinfectants because each work challenges a limited number of strains and tested methods are often different. The aim of this study was to evaluate the bactericidal activity of three different disinfectants commonly used in industrial or medical environments (peracetic acid, benzalkonium chloride and ortho-phthalaldehyde) against 77 bacterial strains from different origins using one standard test method (NF EN 1040). Results highlight the existence of high interspecific variability of resistance to disinfectants and, contrary to widespread belief, Gram-positive strains generally appeared more resistant than Gram-negative strains. Resistance was also variable among strains of the same species such as Bacillus subtilis to peracetic acid, Pseudomonas aeruginosa to benzalkonium chloride and Staphylococcus aureus to ortho-phthalaldehyde.

  3. Acute oral toxicity and bacterial translocation studies on potentially probiotic strains of lactic acid bacteria.

    PubMed

    Zhou, J S; Shu, Q; Rutherfurd, K J; Prasad, J; Gopal, P K; Gill, H S

    2000-01-01

    Three potentially probiotic lactic acid bacteria (LAB) strains, Lactobacillus rhamnosus HN001 (DR20(TM)), Lb. acidophilus HN017 and Bifidobacterium lactis HN019 (DR10()), have recently been identified and characterized. The present study was designed to evaluate the acute oral toxicity of these strains to mice, and also to investigate bacterial translocation and gut mucosal pathology in BALB/c mice fed HN019, HN001 or HN017 for 8 consecutive days at a high dose of 10(11)cfu/mouse/day. Results showed that these probiotic strains had no adverse effect on general health status, feed intake, body weight gain and intestinal mucosal morphology (villus height, crypt depth, epithelial cell height and mucosal thickness). No viable bacteria were recovered from blood and tissue samples (mesenteric lymph nodes, liver and spleen) of mice, and no treatment-associated illness or death was observed. According to these results, the oral LD(50) of HN019, HN001 and HN017 is more than 50g/kg/day for mice, and their acceptable daily intake (ADI) value is 35g dry bacteria per day for a 70-kg person. This suggests that the probiotic strains HN019, HN001 and HN017 are non-pathogenic and likely to be safe for human consumption.

  4. New lactic acid bacterial strains from traditional Mongolian fermented milk products have altered adhesion to porcine gastric mucin depending on the carbon source.

    PubMed

    Kimoto-Nira, Hiromi; Yamasaki, Seishi; Sasaki, Keisuke; Moriya, Naoko; Takenaka, Akio; Suzuki, Chise

    2015-03-01

    Attachment of lactic acid bacteria to the mucosal surface of the gastrointestinal tract is a major property of probiotics. Here, we examined the ability of 21 lactic acid bacterial strains isolated from traditional fermented milk products in Mongolia to adhere to porcine gastric mucin in vitro. Higher attachment was observed with Lactobacillus delbrueckii subsp. bulgaricus strains 6-8 and 8-1 than with Lactobacillus rhamnosus GG (positive control). Lactococcus lactis subsp. cremoris strain 7-1 adhered to mucin as effectively as did strain GG. Heat inactivation decreased the adhesive ability of strains 6-8 and 8-1 but did not affect strain 7-1. The adhesion of strains 6-8, 7-1 and 8-1 was significantly inhibited when the cells were pretreated with periodate and trypsin, indicating that proteinaceous and carbohydrate-like cell surface compounds are involved in the adhesion of these strains. The adhesion of strain 7-1 was affected by the type of carbohydrate present in the growth medium, being higher with fructose than with lactose, galactose or xylose as the carbon source. The sugar content of 7-1 cells grown on various carbohydrates was negatively correlated with its adhesive ability. We provide new probiotic candidate strains and new information regarding carbohydrate preference that influences lactic acid bacterial adhesion to mucin.

  5. Bacterial Growth on Aminoalkylphosphonic Acids

    PubMed Central

    Harkness, Donald R.

    1966-01-01

    Harkness, Donald R. (University of Miami School of Medicine, Miami, Fla.). Bacterial growth on aminoalkylphosphonic acids. J. Bacteriol. 92:623–627. 1966.—Of 10 bacterial strains tested, 9 were found to be able to utilize the phosphorus of at least one of eight different aminoalkylphosphonic acids for growth, indicating that the ability to catabolize the carbon–phosphorus (C–P) bond is widespread among bacteria. Several organisms gave comparable growth rates as well as cell yields when an equimolar amount of either Pi or 2-aminoethylphosphonic acid (2-AEP) was added to the medium. No compounds containing C–P bonds were detected in Escherichia coli B grown on 2-AEP32-orthophosphate. No degradation of phosphonates by cell-free extracts or suspensions of dried cells was demonstrated. The direct involvement of alkaline phosphatases in cleaving the C–P bond was excluded. PMID:5922537

  6. Safety assessment of potential probiotic lactic acid bacterial strains Lactobacillus rhamnosus HN001, Lb. acidophilus HN017, and Bifidobacterium lactis HN019 in BALB/c mice.

    PubMed

    Zhou, J S; Shu, Q; Rutherfurd, K J; Prasad, J; Birtles, M J; Gopal, P K; Gill, H S

    2000-05-25

    The general safety of immune-enhancing lactic acid bacteria (LAB) strains Lactobacillus rhamnosus HN001 (DR20), Lb. acidophilus HN017, and Bifidobacterium lactis HN019 (DR10) was investigated in a feeding trial. Groups of BALB/c mice were orally administered test LAB strains or the commercial reference strain Lb. acidophilus LA-1 at 2.5 x 10(9), 5 x 10(10) or 2.5 x 10(12) colony forming units (CFU)/kg body weight/day for 4 weeks. Throughout this time, their feed intake, water intake, and live body weight were monitored. At the end of the 4 week observation period, samples of blood, liver, spleen, kidney, mesenteric lymph nodes, and gut tissues (ileum, caecum, and colon) were collected to determine: haematological parameters (red blood cell and platelet counts, haemoglobin concentration, mean corpuscular volume, mean corpuscular haemoglobin, and mean corpuscular haemoglobin concentration); differential leukocyte counts; blood biochemistry (plasma total protein, albumin, cholesterol, and glucose); mucosal histology (epithelial cell height, mucosal thickness, and villus height); and bacterial translocation to extra-gut tissues (blood, liver, spleen, kidney and mesenteric lymph nodes). DNA finger printing techniques were used to identify any viable bacterial strains recovered from these tissues. The results demonstrated that 4 weeks consumption of these LAB strains had no adverse effects on animals' general health status, haematology, blood biochemistry, gut mucosal histology parameters, or the incidence of bacterial translocation. A few viable LAB cells were recovered from the tissues of animals in both control and test groups, but DNA fingerprinting did not identify any of these as the inoculated strains. The results obtained in this study suggest that the potentially probiotic LAB strains HN001, HN017, and HN019 are non-toxic for mice and are therefore likely to be safe for human use.

  7. Different Flour Microbial Communities Drive to Sourdoughs Characterized by Diverse Bacterial Strains and Free Amino Acid Profiles

    PubMed Central

    Celano, Giuseppe; De Angelis, Maria; Minervini, Fabio; Gobbetti, Marco

    2016-01-01

    This work aimed to investigate whether different microbial assemblies in flour may influence the microbiological and biochemical characteristics of traditional sourdough. To reach this purpose, members of lactic acid bacteria, enterobacteria, and yeasts were isolated from durum wheat flour. Secondly, the isolated microorganisms (Pediococcus pentosaceus, Saccharomyces cerevisiae, Pantoea agglomerans, and Escherichia hermannii) were inoculated in doughs prepared with irradiated flour (gamma rays at 10 kGy), so that eight different microbial assemblies were obtained. Two non-inoculated controls were prepared, one of which (C-IF) using irradiated flour and the other (C) using non-irradiated flour. As shown by plate counts, irradiation of flour caused total inactivation of yeasts and a decrease of all the other microbial populations. However, acidification occurred also in the dough C-IF, due to metabolic activity of P. pentosaceus that had survived irradiation. After six fermentations, P. pentosaceus was the dominant lactic acid bacterium species in all the sourdoughs produced with irradiated flour (IF). Yet, IF-based sourdoughs broadly differed from each other in terms of strains of P. pentosaceus, probably due to the different microorganisms initially inoculated. Quantitative and qualitative differences of free amino acids concentration were found among the sourdoughs, possibly because of different microbial communities. In addition, as shown by culture-independent analysis (16S metagenetics), irradiation of flour lowered and modified microbial diversity of sourdough ecosystem. PMID:27877165

  8. [Effect of polymer complexons based on vinylpyrrolidone copolymers with vinyliminodiacetic acid and methacrtloylacetone on the antibiotic sensitivity of antibiotic-resistant bacterial strains].

    PubMed

    Afinogenov, G E; Panarin, E F; Kopeĭkin, V V

    1978-05-01

    Polymer complexons, such as copolymers of vinylpyrrolidone with vinyliminodiacetic acid and metacryloilacetone changed the permeability of the bacterial cell wall due to chelating of the metalic ions contained in the cell wall. An increase in the bacterial sensitivity to chloretracycline, methicillin, ampicillin and methicillin was observed in the presence of the above complexons.

  9. Bacteriocins and novel bacterial strains.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poultry is thought to be a significant source of Campylobacter in human disease. We evaluated anti-Campylobacter activity among 365 Bacillus and Paenibacillus isolates from poultry. One novel antagonistic Bacillus circulans and three Paenibacillus polymyxa strains were identified and further studi...

  10. Investigation of lactic acid bacterial strains for meat fermentation and the product's antioxidant and angiotensin-I-converting-enzyme inhibitory activities.

    PubMed

    Takeda, Shiro; Matsufuji, Hisashi; Nakade, Koji; Takenoyama, Shin-Ichi; Ahhmed, Abdulatef; Sakata, Ryoichi; Kawahara, Satoshi; Muguruma, Michio

    2016-08-02

    In the lactic acid bacteria (LAB) strains screened from our LAB collection, Lactobacillus (L.) sakei strain no. 23 and L. curvatus strain no. 28 degraded meat protein and tolerated salt and nitrite in vitro. Fermented sausages inoculated strains no. 23 and no. 28 showed not only favorable increases in viable LAB counts and reduced pH, but also the degradation of meat protein. The sausages fermented with these strains showed significantly higher antioxidant activity than those without LAB or fermented by each LAB type strain. Angiotensin-I-converting-enzyme (ACE) inhibitory activity was also significantly higher in the sausages fermented with strain no. 23 than in those fermented with the type strain. Higher ACE inhibitory activity was also observed in the sausages fermented with strain no. 28, but did not differ significantly from those with the type strain. An analysis of the proteolysis and degradation products formed by each LAB in sausages suggested that those bioactivities yielded fermentation products such as peptides. Therefore, LAB starters that can adequately ferment meat, such as strains no. 23 and no. 28, should contribute to the production of bioactive compounds in meat products.

  11. Bacterial Cyanuric Acid Hydrolase for Water Treatment

    PubMed Central

    Yeom, Sujin; Mutlu, Baris R.; Aksan, Alptekin

    2015-01-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  12. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03

    PubMed Central

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-01-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l-1. The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters. PMID:25253925

  13. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03.

    PubMed

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-05-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l(-1). The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters.

  14. Spontaneous bacterial peritonitis due to a group IIk-2 strain.

    PubMed Central

    Dhawan, V K; Rajashekaraiah, K R; Metzger, W I; Rice, T W; Kallick, C A

    1980-01-01

    This paper describes a patient with spontaneous bacterial peritonitis caused by a group IIk-2 strain. No other organism was isolated from the peritoneal fluid cultured aerobically and anaerobically. PMID:7381015

  15. Genome Sequence of Bacterial Interference Strain Staphylococcus aureus 502A.

    PubMed

    Parker, Dane; Narechania, Apurva; Sebra, Robert; Deikus, Gintaras; Larussa, Samuel; Ryan, Chanelle; Smith, Hannah; Prince, Alice; Mathema, Barun; Ratner, Adam J; Kreiswirth, Barry; Planet, Paul J

    2014-04-10

    Staphylococcus aureus 502A was a strain used in bacterial interference programs during the 1960s and early 1970s. Infants were deliberately colonized with 502A with the goal of preventing colonization with more invasive strains. We present the completed genome sequence of this organism.

  16. Influence of bacterial strains on bone infection.

    PubMed

    Cordero, J; Munuera, L; Folgueira, M D

    1996-07-01

    Experiments were performed on 120 rabbits to compare the probability of infection after bone surgery without an implant, with polymethylmethacrylate, and with autografts. Staphylococcus aureus phage type 94/96, isolated from a human osteomyelitis, was instilled into the intramedullar cavity after reaming of the femoral canal and before insertion of the implant. The different 50% infective doses were determined for each of the groups for comparative purposes. The bacterial concentrations required to produce infection in femora without an implant were two times less than those necessary in femora implanted with polymethylmethacrylate. The bone graft required bacterial concentrations nine times less than those necessary to infect femora containing polymethylmethacrylate and four times less than those required to infect femora without an implant. The results presented here confirm that the susceptibility to infection in orthopaedic surgery is not only material dependent but also bacteria dependent.

  17. Purification of bacterial genomic DNA in less than 20 min using chelex-100 microwave: examples from strains of lactic acid bacteria isolated from soil samples.

    PubMed

    Reyes-Escogido, Lourdes; Balam-Chi, Mario; Rodríguez-Buenfil, Ingrid; Valdés, Jesús; Kameyama, Luis; Martínez-Pérez, Francisco

    2010-11-01

    We established a Chelex 100-Microwave method for the purification of bacterial genomic DNA (gDNA) in less than 20 min with high yield and good quality, useful for multiple purposes. It combines Chelex 100, proteinase K, RNase A and heating in a microwave oven. The resulting gDNA was used directly to identify bacterial species of the Order Lactobacillales by means of PCR amplification of their 16S rDNA gene, isolated from sediments on the Yucatan Peninsula, Mexico. This method produced gDNA free of phenolic and protein residual contaminants from 100 of these isolated bacteria. 16S rDNA amplification and sequencing showed Pediococcus acidilactici to prevail in inland lagoons, and Pediococcus pentosaceus, Lactobacillus plantarum, Lactobacillus sp., and Lactobacillus fermentum to be most abundant in the soils of livestock farms. The combination of Chelex 100, enzymes and microwave heating used in the Chelex 100-Microwave method produced large amounts of highly pure gDNA from Gram-positive and Gram-negative bacteria, in less than 20 min.

  18. Amylolytic bacterial lactic acid fermentation - a review.

    PubMed

    Reddy, Gopal; Altaf, Md; Naveena, B J; Venkateshwar, M; Kumar, E Vijay

    2008-01-01

    Lactic acid, an enigmatic chemical has wide applications in food, pharmaceutical, leather, textile industries and as chemical feed stock. Novel applications in synthesis of biodegradable plastics have increased the demand for lactic acid. Microbial fermentations are preferred over chemical synthesis of lactic acid due to various factors. Refined sugars, though costly, are the choice substrates for lactic acid production using Lactobacillus sps. Complex natural starchy raw materials used for production of lactic acid involve pretreatment by gelatinization and liquefaction followed by enzymatic saccharification to glucose and subsequent conversion of glucose to lactic acid by Lactobacillus fermentation. Direct conversion of starchy biomass to lactic acid by bacteria possessing both amylolytic and lactic acid producing character will eliminate the two step process to make it economical. Very few amylolytic lactic acid bacteria with high potential to produce lactic acid at high substrate concentrations are reported till date. In this view, a search has been made for various amylolytic LAB involved in production of lactic acid and utilization of cheaply available renewable agricultural starchy biomass. Lactobacillus amylophilus GV6 is an efficient and widely studied amylolytic lactic acid producing bacteria capable of utilizing inexpensive carbon and nitrogen substrates with high lactic acid production efficiency. This is the first review on amylolytic bacterial lactic acid fermentations till date.

  19. Bacterial lipoteichoic acid enhances cryosurvival.

    PubMed

    Rice, Charles V; Middaugh, Amy; Wickham, Jason R; Friedline, Anthony; Thomas, Kieth J; Scull, Erin; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2015-03-01

    Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. We show that lipoteichoic acid (LTA), a biopolymer in the cell wall of Gram-positive bacteria, can be added to B. subtilis cultures and increase freeze tolerance. At 1 % w/v, LTA enables a 50 % survival rate, similar to the results obtained with 1 % w/v glycerol as measured with the resazurin cell viability assay. In the absence of added LTA or glycerol, a very small number of B. subtilis cells survive freezing. This suggests that an innate freeze tolerance mechanism exists. While cryoprotection can be provided by extracellular polymeric substances, our data demonstrate a role for LTA in cryoprotection. Currently, the exact mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. However, low temperature microscopy data show small ice crystals aligned along channels of liquid water. Our observations suggest that teichoic acids could protect liquid water within biofilms and planktonic bacteria, augmenting the role of brine while also raising the possibility for survival without brine present.

  20. Bacterial Lipoteichoic Acid Enhances Cryosurvival

    PubMed Central

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Scull, Erin; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2015-01-01

    Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. We show that lipoteichoic acid (LTA), a biopolymer in the cell wall of Gram-positive bacteria, can be added to B. subtilis cultures and increase freeze tolerance. At 1% w/v, LTA enables a 50% survival rate, similar to the results obtained with 1% w/v glycerol as measured with the resazurin cell viability assay. In the absence of added LTA or glycerol, a very small number of B. subtilis cells survive freezing. This suggests that an innate freeze tolerance mechanism exists. While cryoprotection can be provided by extracellular polymeric substances (EPS), our data demonstrate a role for LTA in cryoprotection. Currently, the exact mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. However, low temperature microscopy data show small ice crystals aligned along channels of liquid water. Our observations suggest that teichoic acids could protect liquid water within biofilms and planktonic bacteria, augmenting the role of brine while also raising the possibility for survival without brine present. PMID:25477208

  1. Degradation of Cyanophycin by Sedimentibacter hongkongensis Strain KI and Citrobacter amalonaticus Strain G Isolated from an Anaerobic Bacterial Consortium

    PubMed Central

    Obst, Martin; Krug, Andreas; Luftmann, Heinrich; Steinbüchel, Alexander

    2005-01-01

    Using a combination of various enrichment techniques, the strictly anaerobic, gram-positive, endospore-forming bacterium Sedimentibacter hongkongensis strain KI as revealed by 16S rRNA analysis and the gram-negative enterobacterium Citrobacter amalonaticus strain G as revealed by physiological tests were isolated from an anaerobic cyanophycin (CGP)-degrading bacterial consortium. S. hongkongensis strain KI is the first anaerobic bacterium with the ability to hydrolyze CGP to β-Asp-Arg and β-Asp-Lys dipeptides, as revealed by electrospray ionization-mass spectrometry and reversed-phase high-performance liquid chromatography analysis. However, these primary accumulated hydrolysis products were only partially used by S. hongkongensis strain KI, and significant growth on CGP did not occur. On the other hand, C. amalonaticus strain G did not degrade CGP but grew on the β-linked iso-dipeptides formed in vitro by enzymatic CGP degradation or in vivo by metabolic activity of S. hongkongensis strain KI. Dipeptide utilization occurred at the highest rate if both strains were used in cocultivation experiments with CGP, indicating that cooperation between different bacteria occurs in anaerobic natural environments for complete CGP turnover. The amino acids obtained from the cleavage of dipeptides were fermented to ethanol, acetic acid, and succinic acid, as revealed by gas chromatographic analysis and by spectrophotometric enzyme assays. PMID:16000772

  2. Genome engineering and gene expression control for bacterial strain development.

    PubMed

    Song, Chan Woo; Lee, Joungmin; Lee, Sang Yup

    2015-01-01

    In recent years, a number of techniques and tools have been developed for genome engineering and gene expression control to achieve desired phenotypes of various bacteria. Here we review and discuss the recent advances in bacterial genome manipulation and gene expression control techniques, and their actual uses with accompanying examples. Genome engineering has been commonly performed based on homologous recombination. During such genome manipulation, the counterselection systems employing SacB or nucleases have mainly been used for the efficient selection of desired engineered strains. The recombineering technology enables simple and more rapid manipulation of the bacterial genome. The group II intron-mediated genome engineering technology is another option for some bacteria that are difficult to be engineered by homologous recombination. Due to the increasing demands on high-throughput screening of bacterial strains having the desired phenotypes, several multiplex genome engineering techniques have recently been developed and validated in some bacteria. Another approach to achieve desired bacterial phenotypes is the repression of target gene expression without the modification of genome sequences. This can be performed by expressing antisense RNA, small regulatory RNA, or CRISPR RNA to repress target gene expression at the transcriptional or translational level. All of these techniques allow efficient and rapid development and screening of bacterial strains having desired phenotypes, and more advanced techniques are expected to be seen.

  3. Antimicrobial effect against different bacterial strains and bacterial adaptation to essential oils used as feed additives

    PubMed Central

    Melo, Antonio Diego Brandão; Amaral, Amanda Figueiredo; Schaefer, Gustavo; Luciano, Fernando Bittencourt; de Andrade, Carla; Costa, Leandro Batista; Rostagno, Marcos Horácio

    2015-01-01

    The aim of this study was to evaluate the antimicrobial activity and determine the minimum bactericidal concentration (MBC) of the essential oils derived from Origanum vulgare (oregano), Melaleuca alternifolia (tea tree), Cinnamomum cassia (cassia), and Thymus vulgaris (white thyme) against Salmonella Typhimurium, Salmonella Enteritidis, Escherichia coli, Staphylococcus aureus and Enterococcus faecalis. The study also investigated the ability of these different bacterial strains to develop adaptation after repetitive exposure to sub-lethal concentrations of these essential oils. The MBC of the essential oils studied was determined by disc diffusion and broth dilution methods. All essential oils showed antimicrobial effect against all bacterial strains. In general, the development of adaptation varied according to the bacterial strain and the essential oil (tea tree > white thyme > oregano). Therefore, it is important to use essential oils at efficient bactericidal doses in animal feed, food, and sanitizers, since bacteria can rapidly develop adaptation when exposed to sub-lethal concentrations of these oils. PMID:26424908

  4. Antimicrobial effect against different bacterial strains and bacterial adaptation to essential oils used as feed additives.

    PubMed

    Melo, Antonio Diego Brandão; Amaral, Amanda Figueiredo; Schaefer, Gustavo; Luciano, Fernando Bittencourt; de Andrade, Carla; Costa, Leandro Batista; Rostagno, Marcos Horácio

    2015-10-01

    The aim of this study was to evaluate the antimicrobial activity and determine the minimum bactericidal concentration (MBC) of the essential oils derived from Origanum vulgare (oregano), Melaleuca alternifolia (tea tree), Cinnamomum cassia (cassia), and Thymus vulgaris (white thyme) against Salmonella Typhimurium, Salmonella Enteritidis, Escherichia coli, Staphylococcus aureus and Enterococcus faecalis. The study also investigated the ability of these different bacterial strains to develop adaptation after repetitive exposure to sub-lethal concentrations of these essential oils. The MBC of the essential oils studied was determined by disc diffusion and broth dilution methods. All essential oils showed antimicrobial effect against all bacterial strains. In general, the development of adaptation varied according to the bacterial strain and the essential oil (tea tree > white thyme > oregano). Therefore, it is important to use essential oils at efficient bactericidal doses in animal feed, food, and sanitizers, since bacteria can rapidly develop adaptation when exposed to sub-lethal concentrations of these oils.

  5. Identification and characterisation of potential biofertilizer bacterial strains

    NASA Astrophysics Data System (ADS)

    Karagöz, Kenan; Kotan, Recep; Dadaşoǧlu, Fatih; Dadaşoǧlu, Esin

    2016-04-01

    In this study we aimed that isolation, identification and characterizations of PGPR strains from rhizosphere of legume plants. 188 bacterial strains isolated from different legume plants like clover, sainfoin and vetch in Erzurum province of Turkey. These three plants are cultivated commonly in the Erzurum province. It was screen that 50 out of 188 strains can fix nitrogen and solubilize phosphate. These strains were identified via MIS (Microbial identification system). According to MIS identification results, 40 out of 50 strains were identified as Bacillus, 5 as Pseudomonas, 3 as Paenibacillus, 1 as Acinetobacter, 1 as Brevibacterium. According to classical test results, while the catalase test result of all isolates are positive, oxidase, KOH and starch hydrolysis rest results are variable.

  6. Detoxification of mercury pollutant leached from spent fluorescent lamps using bacterial strains.

    PubMed

    Al-Ghouti, Mohammad A; Abuqaoud, Reem H; Abu-Dieyeh, Mohammed H

    2016-03-01

    The spent fluorescent lamps (SFLs) are being classified as a hazardous waste due to having mercury as one of its main components. Mercury is considered the second most toxic heavy metal (arsenic is the first) with harmful effects on animal nervous system as it causes different neurological disorders. In this research, the mercury from phosphor powder was leached, then bioremediated using bacterial strains isolated from Qatari environment. Leaching of mercury was carried out with nitric and hydrochloric acid solutions using two approaches: leaching at ambient conditions and microwave-assisted leaching. The results obtained from this research showed that microwave-assisted leaching method was significantly better in leaching mercury than the acid leaching where the mercury leaching efficiency reached 76.4%. For mercury bio-uptake, twenty bacterial strains (previously isolated and purified from petroleum oil contaminated soils) were sub-cultured on Luria Bertani (LB) plates with mercury chloride to check the bacterial tolerance to mercury. Seven of these twenty strains showed a degree of tolerance to mercury. The bio-uptake capacities of the promising strains were investigated using the mercury leached from the fluorescent lamps. Three of the strains (Enterobacter helveticus, Citrobacter amalonaticus, and Cronobacter muytjensii) showed bio-uptake efficiency ranged from 28.8% to 63.6%.

  7. Carbazole degradation in the soil microcosm by tropical bacterial strains

    PubMed Central

    Salam, Lateef B.; Ilori, Matthew O.; Amund, Olukayode O.

    2015-01-01

    In a previous study, three bacterial strains isolated from tropical hydrocarbon-contaminated soils and phylogenetically identified as Achromobacter sp. strain SL1, Pseudomonas sp. strain SL4 and Microbacterium esteraromaticum strain SL6 displayed angular dioxygenation and mineralization of carbazole in batch cultures. In this study, the ability of these isolates to survive and enhance carbazole degradation in soil were tested in field-moist microcosms. Strain SL4 had the highest survival rate (1.8 x 107 cfu/g) after 30 days of incubation in sterilized soil, while there was a decrease in population density in native (unsterilized) soil when compared with the initial population. Gas chromatographic analysis after 30 days of incubation showed that in sterilized soil amended with carbazole (100 mg/kg), 66.96, 82.15 and 68.54% were degraded by strains SL1, SL4 and SL6, respectively, with rates of degradation of 0.093, 0.114 and 0.095 mg kg−1 h−1. The combination of the three isolates as inoculum in sterilized soil degraded 87.13% carbazole at a rate of 0.121 mg kg−1 h−1. In native soil amended with carbazole (100 mg/kg), 91.64, 87.29 and 89.13% were degraded by strains SL1, SL4 and SL6 after 30 days of incubation, with rates of degradation of 0.127, 0.121 and 0.124 mg kg−1 h−1, respectively. This study successfully established the survivability (> 106 cfu/g detected after 30 days) and carbazole-degrading ability of these bacterial strains in soil, and highlights the potential of these isolates as seed for the bioremediation of carbazole-impacted environments. PMID:26691461

  8. Bayesian identification of bacterial strains from sequencing data.

    PubMed

    Sankar, Aravind; Malone, Brandon; Bayliss, Sion C; Pascoe, Ben; Méric, Guillaume; Hitchings, Matthew D; Sheppard, Samuel K; Feil, Edward J; Corander, Jukka; Honkela, Antti

    2016-08-01

    Rapidly assaying the diversity of a bacterial species present in a sample obtained from a hospital patient or an environmental source has become possible after recent technological advances in DNA sequencing. For several applications it is important to accurately identify the presence and estimate relative abundances of the target organisms from short sequence reads obtained from a sample. This task is particularly challenging when the set of interest includes very closely related organisms, such as different strains of pathogenic bacteria, which can vary considerably in terms of virulence, resistance and spread. Using advanced Bayesian statistical modelling and computation techniques we introduce a novel pipeline for bacterial identification that is shown to outperform the currently leading pipeline for this purpose. Our approach enables fast and accurate sequence-based identification of bacterial strains while using only modest computational resources. Hence it provides a useful tool for a wide spectrum of applications, including rapid clinical diagnostics to distinguish among closely related strains causing nosocomial infections. The software implementation is available at https://github.com/PROBIC/BIB.

  9. Bayesian identification of bacterial strains from sequencing data

    PubMed Central

    Sankar, Aravind; Malone, Brandon; Bayliss, Sion C.; Pascoe, Ben; Méric, Guillaume; Hitchings, Matthew D.; Sheppard, Samuel K.; Feil, Edward J.; Corander, Jukka

    2016-01-01

    Rapidly assaying the diversity of a bacterial species present in a sample obtained from a hospital patient or an environmental source has become possible after recent technological advances in DNA sequencing. For several applications it is important to accurately identify the presence and estimate relative abundances of the target organisms from short sequence reads obtained from a sample. This task is particularly challenging when the set of interest includes very closely related organisms, such as different strains of pathogenic bacteria, which can vary considerably in terms of virulence, resistance and spread. Using advanced Bayesian statistical modelling and computation techniques we introduce a novel pipeline for bacterial identification that is shown to outperform the currently leading pipeline for this purpose. Our approach enables fast and accurate sequence-based identification of bacterial strains while using only modest computational resources. Hence it provides a useful tool for a wide spectrum of applications, including rapid clinical diagnostics to distinguish among closely related strains causing nosocomial infections. The software implementation is available at https://github.com/PROBIC/BIB. PMID:28348870

  10. Diversity of Streptococcus mutans strains in bacterial interspecies interactions.

    PubMed

    Li, Xiaolan; Hoogenkamp, Michel A; Ling, Junqi; Crielaard, Wim; Deng, Dong Mei

    2014-02-01

    Biofilms are matrix-enclosed microbial population adhere to each other and to surfaces. Compared to planktonic bacterial cells, biofilm cells show much higher levels of antimicrobial resistance. We aimed to investigate Streptococcus mutans strain diversity in biofilm formation and chlorhexidine (CHX) resistance of single S. mutans and dual S. mutans-Enterococcus faecalis biofilms. Four clinical S. mutans strains (C180-2, C67-1, HG723 and UA159) formed 24-h biofilms with or without an E. faecalis strain. These biofilms were treated for 10 min with 0.025% CHX. Biofilm formation, CHX resistance and S.mutans-E. faecalis interactions were evaluated by biomass staining, resazurin metabolism, viable count and competition agar assays. The main finding is that the presence of E. faecalis generally reduced all dual-species biofilm formation, but the proportions of S. mutans in the dual-species biofilms as well as CHX resistance displayed a clear S. mutans strain dependence. In particular, decreased resistance against CHX was observed in dual S. mutans C67-1 biofilms, while increased resistance was found in dual S. mutans UA159 biofilms. In conclusion, the interaction of S. mutans with E. faecalis in biofilms varies between strains, which underlines the importance of studying strain diversity in inter-species virulence modulation and biofilm antimicrobial resistance.

  11. Transforming Microbial Genotyping: A Robotic Pipeline for Genotyping Bacterial Strains

    PubMed Central

    Velayudhan, Vimalkumar; Murphy, Ronan A.; Achtman, Mark

    2012-01-01

    Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST) of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS) consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of < €25 per strain. Since developing this pipeline, >200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost. PMID:23144721

  12. Drug resistance analysis of bacterial strains isolated from burn patients.

    PubMed

    Wang, L F; Li, J L; Ma, W H; Li, J Y

    2014-01-22

    This study aimed to analyze the spectrum and drug resistance of bacteria isolated from burn patients to provide a reference for rational clinical use of antibiotics. Up to 1914 bacterial strain specimens isolated from burn patients admitted to hospital between 2001 and 2010 were subjected to resistance monitoring by using the K-B paper disk method. Retrospective analysis was performed on drug resistance analysis of burn patients. The top eight bacterium strains according to detection rate. A total of 1355 strains of Gram-negative (G(-)) bacteria and 559 strains of Gram-positive (G(+)) bacteria were detected. The top eight bacterium strains, according to detection rate, were Acinetobacter baumannii, Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli, Staphylococcus epidermidis, Klebsiella pneumoniae, Enterobacter cloacae, and Enterococcus. Drug resistance rates were higher than 90% in A. baumannii, P. aeruginosa, S. epidermidis, and S. aureus, which accounted for 52.2, 21.7, 27.8, and 33.3%, respectively, of the entire sample. Those with drug resistance rates lower than 30% accounted for 4.3, 30.4, 16.7, and 16.7%, respectively. Multidrug-resistant S. aureus (MRSA) and methicillin-resistant S. epidermidis (MRSE) accounted for 49.2 and 76.4% of the S. epidermis and S. aureus resistance, respectively. Antibacterial drugs that had drug resistance rates to MRSE and MRSA higher than 90% accounted for 38.9 and 72.2%, respectively, whereas those with lower than 30% drug resistance rates accounted for 11.1 and 16.7%, respectively. The burn patients enrolled in the study were mainly infected with G(-) bacteria. These results strongly suggest that clinicians should practice rational use of antibiotics based on drug susceptibility test results.

  13. Biodegradation of crude oil by individual bacterial strains and a mixed bacterial consortium

    PubMed Central

    Santisi, Santina; Cappello, Simone; Catalfamo, Maurizio; Mancini, Giuseppe; Hassanshahian, Mehdi; Genovese, Lucrezia; Giuliano, Laura; Yakimov, Michail M.

    2015-01-01

    Three bacterial isolates identified as Alcanivorax borkumensis SK2, Rhodococcus erythropolis HS4 and Pseudomonas stutzeri SDM, based on 16S rRNA gene sequences, were isolated from crude oil enrichments of natural seawater. Single strains and four bacterial consortia designed by mixing the single bacterial cultures respectively in the following ratios: (Alcanivorax: Pseudomonas, 1:1), (Alcanivorax: Rhodococcus, 1:1), (Pseudomonas: Rhodococcus, 1:1), and (Alcanivorax: Pseudomonas: Rhodococcus, 1:1:1), were analyzed in order to evaluate their oil degrading capability. All experiments were carried out in microcosms systems containing seawater (with and without addition of inorganic nutrients) and crude oil (unique carbon source). Measures of total and live bacterial abundance, Card-FISH and quali-, quantitative analysis of hydrocarbons (GC-FID) were carried out in order to elucidate the co-operative action of mixed microbial populations in the process of biodegradation of crude oil. All data obtained confirmed the fundamental role of bacteria belonging to Alcanivorax genus in the degradation of linear hydrocarbons in oil polluted environments. PMID:26273252

  14. Lactic acid bacterial extract as a biogenic mineral growth modifier

    NASA Astrophysics Data System (ADS)

    Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal

    2009-04-01

    The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.

  15. Pseudomonas chlororaphis Strain Sm3, Bacterial Antagonist of Pratylenchus penetrans

    PubMed Central

    Hackenberg, Clemens; Muehlkchen, Andrea; Forge, Thomas; Vrain, Thierry

    2000-01-01

    The interaction of Pseudomonas chlororaphis strain Sm3 and the root-lesion nematode Pratylenchus penetrans was investigated in three separate greenhouse experiments with soils from southern British Columbia, Canada. The bacteria were applied to the roots of strawberry plants and planted in unpasteurized field soils, with natural or supplemented infestation of P. penetrans. Nematode suppression in roots was evident after 6 or 10 weeks in all experiments. Root or shoot growth were increased after 10 weeks in two experiments. Population dynamics of P. chlororaphis Sm3 in the rhizosphere was followed using an antibiotic-resistant mutant of P. chlororaphis Sm3. There was no apparent correlation between bacterial density in the rhizosphere and P. penetrans suppression in strawberry roots and rhizosphere soil, although the soil with the highest nematode reduction also had the largest P. chlororaphis Sm3 population in the rhizosphere. PMID:19270964

  16. Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

    PubMed Central

    Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo

    1988-01-01

    A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

  17. Influence of Root Exudates on the Bacterial Degradation of Chlorobenzoic Acids

    PubMed Central

    Lovecká, Petra; Dražková, Milena; Macková, Martina; Macek, Tomas

    2013-01-01

    Degradation of chlorobenzoic acids (e.g., products of microbial degradation of PCB) by strains of microorganisms isolated from PCB contaminated soils was assessed. From seven bulk-soil isolates two strains unique in ability to degrade a wider range of chlorobenzoic acids than others were selected, individually and even in a complex mixture of 11 different chlorobenzoic acids. Such a feature is lacking in most tested degraders. To investigate the influence of vegetation on chlorobenzoic acids degraders, root exudates of two plant species known for supporting PCB degradation in soil were tested. While with individual chlorobenzoic acids the presence of plant exudates leads to a decrease of degradation yield, in case of a mixture of chlorobenzoic acids either a change in bacterial degradation specificity, associated with 3- and 4-chlorobenzoic acid, or an extension of the spectrum of degraded chlorobenzoic acids was observed. PMID:24222753

  18. CAMBer: an approach to support comparative analysis of multiple bacterial strains

    PubMed Central

    2011-01-01

    Background There is a large amount of inconsistency in gene structure annotations of bacterial strains. This inconsistency is a frustrating impedance to effective comparative genomic analysis of bacterial strains in promising applications such as gaining insights into bacterial drug resistance. Results Here, we propose CAMBer as an approach to support comparative analysis of multiple bacterial strains. CAMBer produces what we called multigene families. Each multigene family reveals genes that are in one-to-one correspondence in the bacterial strains, thereby permitting their annotations to be integrated. We present results of our method applied to three human pathogens: Escherichia coli, Mycobacterium tuberculosis and Staphylococcus aureus. Conclusions As a result, more accurate and more comprehensive annotations of the bacterial strains can be produced. PMID:21989220

  19. Saponaria officinalis L. extract: Surface active properties and impact on environmental bacterial strains.

    PubMed

    Smułek, Wojciech; Zdarta, Agata; Pacholak, Amanda; Zgoła-Grześkowiak, Agnieszka; Marczak, Łukasz; Jarzębski, Maciej; Kaczorek, Ewa

    2017-02-01

    Plant-derived surfactants are characterised by low toxicity, high biodegradability and environmental compatibility. They therefore have many applications; for instance, they can be used in bioremediation to accelerate biodegradation processes, especially of hydrophobic pollutants. This paper analyses the properties of an extract from Saponaria officinalis L. containing saponins and its impact on bacterial strains isolated from soil, as well as its potential for application in hydrocarbon bioremediation. The tested extract from Saponaria officinalis L. contains gypsogenin, hederagenin, hydroxyhederagenin and quillaic acid aglycone structures and demonstrates good emulsification properties. Contact with the extract led to modification of bacterial cell surface properties. A decrease in cell surface hydrophobicity and an increase in membrane permeability were recorded in the experiments. An increase of up to 63% in diesel oil biodegradation was also recorded for Pseudomonas putida DA1 on addition of 1gL(-1) of saponins from Saponaria officinalis L. Saponaria extract showed no toxic impact on the tested environmental bacterial strains at the concentration used in the biodegradation process.

  20. New bacterial strain of the genus Ochrobactrum with glyphosate-degrading activity.

    PubMed

    Hadi, Faranak; Mousavi, Amir; Noghabi, Kambiz Akbari; Tabar, Hadi Ghaderi; Salmanian, Ali Hatef

    2013-01-01

    Thirty bacterial strains with various abilities to utilize glyphosate as the sole phosphorus source were isolated from farm soils using the glyphosate enrichment cultivation technique. Among them, a strain showing a remarkable glyphosate-degrading activity was identified by biochemical features and 16S rRNA sequence analysis as Ochrobactrum sp. (GDOS). Herbicide (3 mM) degradation was induced by phosphate starvation, and was completed within 60 h. Aminomethylphosphonic acid was detected in the exhausted medium, suggesting glyphosate oxidoreductase as the enzyme responsible for herbicide breakdown. As it grew even in the presence of glyphosate concentrations as high as 200 mM, Ochrobactrum sp. could be used for bioremediation purposes and treatment of heavily contaminated soils.

  1. A Catalytic DNA Activated by a Specific Strain of Bacterial Pathogen

    PubMed Central

    Shen, Zhifa; Wu, Zaisheng; Chang, Dingran; Zhang, Wenqing; Tram, Kha; Lee, Christine; Kim, Peter; Salena, Bruno J.

    2015-01-01

    Abstract Pathogenic strains of bacteria are known to cause various infectious diseases and there is a growing demand for molecular probes that can selectively recognize them. Here we report a special DNAzyme (catalytic DNA), RFD‐CD1, that shows exquisite specificity for a pathogenic strain of Clostridium difficile (C. difficile). RFD‐CD1 was derived by an in vitro selection approach where a random‐sequence DNA library was allowed to react with an unpurified molecular mixture derived from this strain of C. difficle, coupled with a subtractive selection strategy to eliminate cross‐reactivities to unintended C. difficile strains and other bacteria species. RFD‐CD1 is activated by a truncated version of TcdC, a transcription factor, that is unique to the targeted strain of C. difficle. Our study demonstrates for the first time that in vitro selection offers an effective approach for deriving functional nucleic acid probes that are capable of achieving strain‐specific recognition of bacterial pathogens. PMID:26676768

  2. Bacterial strains isolated from river water having the ability to split alcohol ethoxylates by central fission.

    PubMed

    Budnik, Irena; Zembrzuska, Joanna; Lukaszewski, Zenon

    2016-07-01

    Alcohol ethoxylates (AE) are a major component of the surfactant stream discharged into surface water. The "central fission" of AE with the formation of poly(ethylene glycols) (PEG) is considered to be the dominant biodegradation pathway. However, information as to which bacterial strains are able to perform this reaction is very limited. The aim of this work was to establish whether such an ability is unique or common, and which bacterial strains are able to split AE used as a sole source of organic carbon. Four bacterial strains were isolated from river water and were identified on the basis of phylogenetic trees as Enterobacter strain Z2, Enterobacter strain Z3, Citrobacter freundii strain Z4, and Stenotrophomonas strain Z5. Sterilized river water and "artificial sewage" were used for augmentation of the isolated bacteria. The test was performed in bottles filled with a mineral salt medium spiked with surfactant C12E10 (10 mg L(-1)) and an inoculating suspension of the investigated bacterial strain. Sequential extraction of the tested samples by ethyl acetate and chloroform was used for separation of PEG from the water matrix. LC-MS was used for PEG determination on the basis of single-ion chromatograms. All four selected and investigated bacterial strains exhibit the ability to split fatty alcohol ethoxylates with the production of PEG, which is evidence that this property is a common one rather than specific to certain bacterial strains. However, this ability increases in the sequence: Stenotrophomonas strain Z5 < Enterobacter strain Z2 < Enterobacter strain Z3 = Citrobacter freundii strain Z4. Graphical Abstract Biodegradation by central fission of alcohol ethoxylates by bacterial strains isolated from river water.

  3. Impacts of hydrophilic colanic acid on bacterial attachment to microfiltration membranes and subsequent membrane biofouling.

    PubMed

    Yoshida, Keitaro; Tashiro, Yosuke; May, Thithiwat; Okabe, Satoshi

    2015-06-01

    In order to examine the interactions between physicochemical properties of specific extracellular polymeric substances (EPS) and membrane biofouling, we investigated the impacts of hydrophilic colanic acid, as a model extracellular polysaccharide component, on initial bacterial attachment to different microfiltration (MF) membranes and membrane biofouling by using Escherichia coli strains producing different amounts of colanic acid. In a newly designed microtiter plate assay, the bacterial attachment by an E. coli strain RcsF(+), which produces massive amounts of colanic acid, decreased only to a hydrophobic membrane because the colanic acid made cell surfaces more hydrophilic, resulting in low cell attachment to hydrophobic membranes. The bench-scale cross-flow filtration tests followed by filtration resistance measurement revealed that RcsF(+) caused severe irreversible membrane fouling (i.e., pore-clogging), whereas less extracellular polysaccharide-producing strains caused moderate but reversible fouling to all membranes used in this study. Further cross-flow filtration tests indicated that colanic acid liberated in the bulk phase could rapidly penetrate pre-accumulated biomass layers (i.e., biofilms) and then directly clogged membrane pores. These results indicate that colanic acid, a hydrophilic extracellular polysaccharide, and possible polysaccharides with similar characteristics with colanic acid are considered as a major cause of severe irreversible membrane fouling (i.e., pore-clogging) regardless of biofilm formation (dynamic membrane).

  4. Strain typing of acetic acid bacteria responsible for vinegar production by the submerged elaboration method.

    PubMed

    Fernández-Pérez, Rocío; Torres, Carmen; Sanz, Susana; Ruiz-Larrea, Fernanda

    2010-12-01

    Strain typing of 103 acetic acid bacteria isolates from vinegars elaborated by the submerged method from ciders, wines and spirit ethanol, was carried on in this study. Two different molecular methods were utilised: pulsed field gel electrophoresis (PFGE) of total DNA digests with a number of restriction enzymes, and enterobacterial repetitive intergenic consensus (ERIC) - PCR analysis. The comparative study of both methods showed that restriction fragment PFGE of SpeI digests of total DNA was a suitable method for strain typing and for determining which strains were present in vinegar fermentations. Results showed that strains of the species Gluconacetobacter europaeus were the most frequent leader strains of fermentations by the submerged method in the studied vinegars, and among them strain R1 was the predominant one. Results showed as well that mixed populations (at least two different strains) occurred in vinegars from cider and wine, whereas unique strains were found in spirit vinegars, which offered the most stressing conditions for bacterial growth.

  5. The bacterial transformation of abietic acid

    PubMed Central

    Cross, B. E.; Myers, P. L.

    1968-01-01

    An Alcaligenes species, which was isolated from soil, can utilize abietic acid as its sole carbon source. During growth, the bacterium transforms abietic acid into 5α-hydroxyabietic acid (I, R=OH), a product considered to be 7β-hydroxy-13-isopropyl-8ξ-podocarp-13-en-15-oic acid (II, R=H) and a compound, C20H28O3, which is believed to be an epoxy-γ-lactone. PMID:5665894

  6. Rapid identification and discrimination of bacterial strains by laser induced breakdown spectroscopy and neural networks.

    PubMed

    Manzoor, S; Moncayo, S; Navarro-Villoslada, F; Ayala, J A; Izquierdo-Hornillos, R; de Villena, F J Manuel; Caceres, J O

    2014-04-01

    Identification and discrimination of bacterial strains of same species exhibiting resistance to antibiotics using laser induced breakdown spectroscopy (LIBS) and neural networks (NN) algorithm is reported. The method has been applied to identify 40 bacterial strains causing hospital acquired infections (HAI), i.e. Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumoniae, Salmonella typhimurium, Salmonella pullurum and Salmonella salamae. The strains analyzed included both isolated from clinical samples and constructed in laboratory that differ in mutations as a result of their resistance to one or more antibiotics. Small changes in the atomic composition of the bacterial strains, as a result of their mutations and genetic variations, were detected by the LIBS-NN methodology and led to their identification and classification. This is of utmost importance because solely identification of bacterial species is not sufficient for disease diagnosis and identification of the actual strain is also required. The proposed method was successfully able to discriminate strains of the same bacterial species. The optimized NN models provided reliable bacterial strain identification with an index of spectral correlation higher than 95% for the samples analyzed, showing the potential and effectiveness of the method to address the safety and social-cost HAI-related issue.

  7. Production of volatile aroma compounds by bacterial strains isolated from different surface-ripened French cheeses.

    PubMed

    Deetae, Pawinee; Bonnarme, Pascal; Spinnler, Henry E; Helinck, Sandra

    2007-10-01

    Twelve bacterial strains belonging to eight taxonomic groups: Brevibacterium linens, Microbacterium foliorum, Arthrobacter arilaitensis, Staphylococcus cohnii, Staphylococcus equorum, Brachybacterium sp., Proteus vulgaris and Psychrobacter sp., isolated from different surface-ripened French cheeses, were investigated for their abilities to generate volatile aroma compounds. Out of 104 volatile compounds, 54 volatile compounds (identified using dynamic headspace technique coupled with gas chromatography-mass spectrometry [GC-MS]) appeared to be produced by the different bacteria on a casamino acid medium. Four out of eight species used in this study: B. linens, M. foliorum, P. vulgaris and Psychrobacter sp. showed a high flavouring potential. Among these four bacterial species, P. vulgaris had the greatest capacity to produce not only the widest varieties but also the highest quantities of volatile compounds having low olfactive thresholds such as sulphur compounds. Branched aldehydes, alcohols and esters were produced in large amounts by P. vulgaris and Psychrobacter sp. showing their capacity to breakdown the branched amino acids. This investigation shows that some common but rarely mentioned bacteria present on the surface of ripened cheeses could play a major role in cheese flavour formation and could be used to produce cheese flavours.

  8. Visualized analysis of cellular fatty acid profiles of Vibrio parahaemolyticus strains under cold stress.

    PubMed

    Jia, Juntao; Chen, Ying; Jiang, Yinghui; Tang, Jing; Yang, Lijun; Liang, Chengzhu; Jia, Zhen; Zhao, Liqing

    2014-08-01

    Vibrio parahaemolyticus is a common foodborne bacterial pathogen, which survives in cold environments and is sometimes difficult to culture. Fatty acid analysis under cold stress was conducted for several V. parahaemolyticus strains using gas chromatography/mass spectrometry, and the results were compared with those of the controls. All the fatty acid profiles obtained were visualized by multidimensional scaling (MDS) and self-organized map (SOM). It was observed that the fatty acid profiles of V. parahaemolyticus substantially changed under cold stress. The percentage of methyl palmitate remarkably decreased and that of methyl palmitoleate (except for two strains) and methyl oleate increased. These findings demonstrate the role of fatty acids in cold stress. The changes in the fatty acid profiles illustrated by MDS and SOM could differentiate strains under cold stress from the controls and can potentially lead to a method of detecting injured cold-stressed V. parahaemolyticus.

  9. Bioremediation potential of a highly mercury resistant bacterial strain Sphingobium SA2 isolated from contaminated soil.

    PubMed

    Mahbub, Khandaker Rayhan; Krishnan, Kannan; Megharaj, Mallavarapu; Naidu, Ravi

    2016-02-01

    A mercury resistant bacterial strain, SA2, was isolated from soil contaminated with mercury. The 16S rRNA gene sequence of this isolate showed 99% sequence similarity to the genera Sphingobium and Sphingomonas of α-proteobacteria group. However, the isolate formed a distinct phyletic line with the genus Sphingobium suggesting the strain belongs to Sphingobium sp. Toxicity studies indicated resistance to high levels of mercury with estimated EC50 values 4.5 mg L(-1) and 44.15 mg L(-1) and MIC values 5.1 mg L(-1) and 48.48 mg L(-1) in minimal and rich media, respectively. The strain SA2 was able to volatilize mercury by producing mercuric reductase enzyme which makes it potential candidate for remediating mercury. ICP-QQQ-MS analysis of Hg supplemented culture solutions confirmed that almost 79% mercury in the culture suspension was volatilized in 6 h. A very small amount of mercury was observed to accumulate in cell pellets which was also evident according to ESEM-EDX analysis. The mercuric reductase gene merA was amplified and sequenced. The deduced amino acid sequence demonstrated sequence homology with α-proteobacteria and Ascomycota group.

  10. Mutagenicity spectra in bacterial strains of airborne and engine exhaust particulate extracts.

    PubMed

    Crebelli, R; Fuselli, S; Conti, G; Conti, L; Carere, A

    1991-12-01

    The mutagenicity spectra of the organic extracts of both airborne particulate matter and diesel and gasoline soot particles were determined using a battery of 9 bacterial strains of different genetic specificity. The assays with crude extracts and with fractionated acidic, neutral and basic components revealed striking differences in the patterns of mutagenic responses produced by each of the complex mixtures investigated. The mutagenicity of air particulate matter was shown to depend mainly on direct-acting acidic and neutral compounds, with a lesser contribution of basic promutagens which required exogenous metabolic activation by liver S9. The assays with a diesel soot extract indicated the prevailing contribution of direct-acting acidic and neutral compounds, and suggested an important role also for nitro derivatives other than nitropyrenes. The gasoline exhaust was characterized by powerful promutagenic compounds, belonging to either the acidic, neutral or basic fractions. The implications of these results are discussed with respect to the contribution of engine exhausts to air pollution, and the possible use of mutagenicity spectra in the analysis of environmental complex mixtures.

  11. Screening of bacterial strains isolated from uranium mill tailings porewaters for bioremediation purposes.

    PubMed

    Sánchez-Castro, Iván; Amador-García, Ahinara; Moreno-Romero, Cristina; López-Fernández, Margarita; Phrommavanh, Vannapha; Nos, Jeremy; Descostes, Michael; Merroun, Mohamed L

    2017-01-01

    The present work characterizes at different levels a number of bacterial strains isolated from porewaters sampled in the vicinity of two French uranium tailing repositories. The 16S rRNA gene from 33 bacterial isolates, corresponding to the different morphotypes recovered, was almost fully sequenced. The resulting sequences belonged to 13 bacterial genera comprised in the phyla Firmicutes, Actinobacteria and Proteobacteria. Further characterization at physiological level and metals/metalloid tolerance provided evidences for an appropriate selection of bacterial strains potentially useful for immobilization of uranium and other common contaminants. By using High Resolution Transmission Electron Microscope (HRTEM), this potential ability to immobilize uranium as U phosphate mineral phases was confirmed for the bacterial strains Br3 and Br5 corresponding to Arthrobacter sp. and Microbacterium oxydans, respectively. Scanning Transmission Electron Microscope- High-Angle Annular Dark-Field (STEM-HAADF) analysis showed U accumulates on the surface and within bacterial cytoplasm, in addition to the extracellular space. Energy Dispersive X-ray (EDX) element-distribution maps demonstrated the presence of U and P within these accumulates. These results indicate the potential of certain bacterial strains isolated from porewaters of U mill tailings for immobilizing uranium, likely as uranium phosphates. Some of these bacterial isolates might be considered as promising candidates in the design of uranium bioremediation strategies.

  12. Biodegradation of Picolinic Acid by a Newly Isolated Bacterium Alcaligenes faecalis Strain JQ135.

    PubMed

    Qiu, Jiguo; Zhang, Junjie; Zhang, Yanting; Wang, Yuhong; Tong, Lu; Hong, Qing; He, Jian

    2017-04-01

    We isolated a bacterial strain JQ135 from municipal wastewater, which was capable of efficiently degrading picolinic acid (PA). Based on the physico-biochemical characteristics and 16S rDNA analysis, strain JQ135 was identified as Alcaligenes faecalis. In addition, strain JQ135 produced an orange pigment when cultured in the Luria-Bertani medium, which is different from the previously reported strains of A. faecalis. During the degradation of PA by the resting strain JQ135 cells, only one intermediate, 6-hydroxypicolinic acid (6HPA), was detected by ultraviolet spectrophotometry, high-pressure liquid chromatography, and liquid chromatography-mass spectrometry. A random transposon mutagenesis library of strain JQ135 was constructed. One mutant, Mut-G31, could convert PA into 6HPA without further degradation. The disrupted gene (orf2) was amplified from Mut-G31, and its product showed 32% identity to the 3-deoxy-D-manno-octulosonic acid kinase (KdkA) from Haemophilus influenzae. Results from complementation analysis confirmed that GTG was the initiation codon of the kdkA-like orf2, and that it was essential for PA biodegradation by strain JQ135. This study provides the first genetic evidence for the bacterial degradation of PA.

  13. Fatty acid profiling to characterize California strains of Xylella fastidiosa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Different strains of Xylella fastidiosa cause diseases such as Pierce’s disease of grapevine, citrus variegated chlorosis, and bacterial leaf scorch of hardwoods. However, more research is needed to better define subspecies and strains of X. fastidiosa to improve both regulations concerning this bac...

  14. Influence of bacterial strains isolated from lead-polluted soil and their interactions with arbuscular mycorrhizae on the growth of Trifolium pratense L. under lead toxicity.

    PubMed

    Vivas, A; Azcón, R; Biró, B; Barea, J M; Ruiz-Lozano, J M

    2003-10-01

    We isolated two bacterial strains from an experimentally lead (Pb)-polluted soil in Hungary, 10 years after soil contamination. These strains represented the two most abundant cultivable bacterial groups in such soil, and we tested their influence on Trifolium pratense L. growth and on the functioning of native mycorrhizal fungi under Pb toxicity in a second Pb-spiked soil. Our results showed that bacterial strain A enhanced plant growth, nitrogen and phosphorus accumulations, nodule formation, and mycorrhizal infection, demonstrating its plant-growth-promoting activity. In addition, strain A decreased the amount of Pb absorbed by plants, when expressed on a root weight basis, because of increased root biomass due to the production of indoleacetic acid. The positive effect of strain A was not only evident after a single inoculation but also in dual inoculation with arbuscular mycorrhizal fungi. Strain A also exhibited higher tolerance than strain B when cultivated under increasing Pb levels in the spiked soil. Molecular identification unambiguously placed strain A within the genus Brevibacillus. We showed that it is important to select the most tolerant and efficient bacterial strain for co-inoculation with arbuscular mycorrhizal fungi to promote effective symbiosis and thus stimulate plant growth under adverse environmental conditions, such as heavy-metal contamination.

  15. Isolation and characterization of bacterial strains Paenibacillus sp. and Bacillus sp. for kraft lignin decolorization from pulp paper mill waste.

    PubMed

    Chandra, Ram; Singh, Shail; Krishna Reddy, M M; Patel, D K; Purohit, Hemant J; Kapley, Atya

    2008-12-01

    Eight aerobic bacterial strains were isolated from pulp paper mill waste and screened for tolerance of kraft lignin (KL) using the nutrient enrichment technique in mineral salt media (MSM) agar plate (15 g/L) amended with different concentrations of KL (100, 200, 300, 400, 500, 600 ppm) along with 1% glucose and 0.5% peptone (w/v) as additional carbon and nitrogen sources. The strains ITRC S6 and ITRC S8 were found to have the most potential for tolerance of the highest concentration of KL. These organisms were characterized by biochemical tests and further 16S rRNA gene (rDNA) sequencing, which showed 96.5% and 95% sequence similarity of ITRC S(6) and ITRC S(8) and confirmed them as Paenibacillus sp. and Bacillus sp., respectively. KL decolorization was routinely monitored with a spectrophotometer and further confirmed by HPLC analysis. Among eight strains, ITRC S(6) and ITRC S(8) were found to degrade 500 mg/L of KL up to 47.97% and 65.58%, respectively, within 144 h of incubation in the presence of 1% glucose and 0.5% (w/v) peptone as a supplementary source of carbon and nitrogen. In the absence of glucose and peptone, these bacteria were unable to utilize KL. The analysis of lignin degradation products by GC-MS analysis revealed the formation of various acids as lignin monomers which resulted in a decrease in pH and a major change in the chromatographic profile of the bacterial degraded sample as compared to the control clear indications of biochemical modification of KL due to the bacterial ligninolytic system by ITRC S(6), namely, acetic acid, propanoic acid, butanoic acid, guaiacol, hexanoic acid, and ITRC S(8), namely acetic acid, propanoic acid, ethanedioic acid, furan carboxylic acid, 2-propanoic acid, butanoic acid, 3-acetoxybutyric acid, propanedioic acid, acetoguiacone, 1,2,3-thiadiazole, 5-carboxaldixime, 4-hydroxy-3,5-dimethoxyphenol, and dibutyl phthalate, indicating the bacterium characteristic to degrade G and S units of lignin polymer.

  16. Lysozyme-coated silver nanoparticles for differentiating bacterial strains on the basis of antibacterial activity

    NASA Astrophysics Data System (ADS)

    Ashraf, Sumaira; Chatha, Mariyam Asghar; Ejaz, Wardah; Janjua, Hussnain Ahmed; Hussain, Irshad

    2014-10-01

    Lysozyme, an antibacterial enzyme, was used as a stabilizing ligand for the synthesis of fairly uniform silver nanoparticles adopting various strategies. The synthesized particles were characterized using UV-visible spectroscopy, FTIR, dynamic light scattering (DLS), and TEM to observe their morphology and surface chemistry. The silver nanoparticles were evaluated for their antimicrobial activity against several bacterial species and various bacterial strains within the same species. The cationic silver nanoparticles were found to be more effective against Pseudomonas aeruginosa 3 compared to other bacterial species/strains investigated. Some of the bacterial strains of the same species showed variable antibacterial activity. The difference in antimicrobial activity of these particles has led to the conclusion that antimicrobial products formed from silver nanoparticles may not be equally effective against all the bacteria. This difference in the antibacterial activity of silver nanoparticles for different bacterial strains from the same species may be due to the genome islands that are acquired through horizontal gene transfer (HGT). These genome islands are expected to possess some genes that may encode enzymes to resist the antimicrobial activity of silver nanoparticles. These silver nanoparticles may thus also be used to differentiate some bacterial strains within the same species due to variable silver resistance of these variants, which may not possible by simple biochemical tests.

  17. Lysozyme-coated silver nanoparticles for differentiating bacterial strains on the basis of antibacterial activity

    PubMed Central

    2014-01-01

    Lysozyme, an antibacterial enzyme, was used as a stabilizing ligand for the synthesis of fairly uniform silver nanoparticles adopting various strategies. The synthesized particles were characterized using UV-visible spectroscopy, FTIR, dynamic light scattering (DLS), and TEM to observe their morphology and surface chemistry. The silver nanoparticles were evaluated for their antimicrobial activity against several bacterial species and various bacterial strains within the same species. The cationic silver nanoparticles were found to be more effective against Pseudomonas aeruginosa 3 compared to other bacterial species/strains investigated. Some of the bacterial strains of the same species showed variable antibacterial activity. The difference in antimicrobial activity of these particles has led to the conclusion that antimicrobial products formed from silver nanoparticles may not be equally effective against all the bacteria. This difference in the antibacterial activity of silver nanoparticles for different bacterial strains from the same species may be due to the genome islands that are acquired through horizontal gene transfer (HGT). These genome islands are expected to possess some genes that may encode enzymes to resist the antimicrobial activity of silver nanoparticles. These silver nanoparticles may thus also be used to differentiate some bacterial strains within the same species due to variable silver resistance of these variants, which may not possible by simple biochemical tests. PMID:25435831

  18. Probiotic Activity of a Bacterial Strain Isolated from Ancient Permafrost Against Salmonella Infection in Mice.

    PubMed

    Fursova, O; Potapov, V; Brouchkov, A; Pogorelko, G; Griva, G; Fursova, N; Ignatov, S

    2012-09-01

    Bacillus cereus strain F, collected from relict permafrost located in Siberia, was analyzed for probiotic activity in the mouse Salmonella enterica model. Viable bacterial cells were found in frozen soils taken at Mammoth Mountain in Yakutia from a depth below the level of seasonal thawing. Geological data indicated the absence of a thawing within millions of years of deposited soils, which helped to ensure the ancient origin of our sample. According to DNA analysis, bacterial cells collected from the relict permafrost appeared to be B. cereus strain F. The morphology of these bacteria was analyzed using atomic force microscopy. B. cereus strain F was assessed as a nonpathogenic bacterium by evaluation of its pathogenicity. A S. enterica model is described in mice after per oral inoculation and serves as a model for the human carrier state. Using this model, probiotic activity by the bacterial strain isolated from the ancient permafrost has been shown against Salmonella infection in mice.

  19. Bacterial degradation of m-nitrobenzoic acid.

    PubMed Central

    Nadeau, L J; Spain, J C

    1995-01-01

    Pseudomonas sp. strain JS51 grows on m-nitrobenzoate (m-NBA) with stoichiometric release of nitrite. m-NBA-grown cells oxidized m-NBA and protocatechuate but not 3-hydroxybenzoate, 4-hydroxy-3-nitrobenzoate, 4-nitrocatechol, and 1,2,4-benzenetriol. Protocatechuate accumulated transiently when succinate-grown cells were transferred to media containing m-NBA. Respirometric experiments indicated that the conversion of m-NBA to protocatechuate required 1 mol of oxygen per mol of substrate. Conversions conducted in the presence of 18O2 showed the incorporation of both atoms of molecular oxygen into protocatechuate. Extracts of m-NBA-grown cells cleaved protocatechuate to 2-hydroxy-4-carboxymuconic semialdehyde. These results provide rigorous proof that m-NBA is initially oxidized by a dioxygenase to produce protocatechuate which is further degraded by a 4,5-dioxygenase. PMID:7574625

  20. Heterokaryosis between Aspergillus oryzae cyclopiazonic acid-defective strains: method for estimating the risk of inducing toxin production among cyclopiazonic acid-defective industrial strains.

    PubMed Central

    Benkhemmar, O; Gaudemer, F; Bouvier-Fourcade, I

    1985-01-01

    Aspergillus oryzae strains are used extensively in the food industry. Some of these strains excrete alpha-cyclopiazonic acid (CPA), a mycotoxin which may provoke toxicoses in rats. Physicochemical methods may reveal the presence of this toxin, but they are inadequate to screen CPA-nonproducing (CPA-) strains. CPA production is revealed by either bacterial growth inhibition or alkalinization of the culture medium. This first biological property was used to devise a time-saving screening method to isolate mutants affected in their ability to produce CPA. The second method was used as a further test. After N-methyl-N'-nitro-N-nitrosoguanidine treatment, we isolated CPA- mutants from CPA producer strains (CPA+) and CPA+ mutants from CPA- strains. The mutants unable to produce CPA may be used in the food industry to reduce or eliminate the risk of intoxication in humans. Heterokaryon formation between different mutant strains was carried out to evaluate the risks of obtaining CPA from a mixture of mutants modified in their ability to synthesize this toxin. Pairings between two CPA+ strains always gave rise to CPA+ heterokaryons. Pairings between CPA+ and CPA- strains led, most often, to CPA+ heterokaryons. This could be directly correlated to the more frequent genotype (CPA+) in the heterokaryon. CPA hypoproducer and hyperproducer heterokaryons were obtained. Pairings between CPA- strains always gave rise to CPA- heterokaryons. These results suggest that the risks of producing this toxin from two CPA- individuals are not high. PMID:4083874

  1. Bacterial Diversity at an Acid Mine Drainage Site in Maine

    NASA Astrophysics Data System (ADS)

    Gaynor, J.; Sawyer, T.; Riley, F. E.; Moulton, K. D.; Rothschild, L. J.; Duboise, S. M.

    2010-04-01

    Bacterial diversity in acidic mine drainage at a historic Maine iron mining site was investigated by isolation of environmental DNA, PCR amplification of the V3 region of the 16S rRNA gene, denaturing gradient gel electrophoresis, and DNA sequencing.

  2. How Fitness Reduced, Antimicrobial Resistant Bacteria Survive and Spread: A Multiple Pig - Multiple Bacterial Strain Model

    PubMed Central

    Græsbøll, Kaare; Nielsen, Søren Saxmose; Toft, Nils; Christiansen, Lasse Engbo

    2014-01-01

    More than 30% of E. coli strains sampled from pig farms in Denmark over the last five years were resistant to the commonly used antimicrobial tetracycline. This raises a number of questions: How is this high level sustained if resistant bacteria have reduced growth rates? Given that there are multiple susceptible and resistant bacterial strains in the pig intestines, how can we describe their coexistence? To what extent does the composition of these multiple strains in individual pigs influence the total bacterial population of the pig pen? What happens to a complex population when antimicrobials are used? To investigate these questions, we created a model where multiple strains of bacteria coexist in the intestines of pigs sharing a pen, and explored the parameter limits of a stable system; both with and without an antimicrobial treatment. The approach taken is a deterministic bacterial population model with stochastic elements of bacterial distributions and transmission. The rates that govern the model are process-oriented to represent growth, excretion, and uptake from environment, independent of herd and meta-population structures. Furthermore, an entry barrier and elimination process for the individual strains in each pig were implemented. We demonstrate how competitive growth between multiple bacterial strains in individual pigs, and the transmission between pigs in a pen allow for strains of antimicrobial resistant bacteria to persist in a pig population to different extents, and how quickly they can become dominant if antimicrobial treatment is initiated. The level of spread depends in a non-linear way of the parameters that govern excretion and uptake. Furthermore, the sampling of initial distributions of strains and stochastic transmission events give rise to large variation in how homogenous and how resistant the bacterial population becomes. Most important: resistant bacteria are demonstrated to survive with a disadvantage in growth rate of well over 10

  3. Breeding lines and host QTL interaction with bacterial strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to common bacterial blight (CBB) is controlled by more than 20 QTL (Miklas and Singh, 2007). A QTL on Pv10 linked to SAP6 SCAR markers is derived from common bean. Higher levels of resistance associated with BC420 QTL on Pv06 (Yu et al., 2000) and SU91-CG11 QTL on Pv08 (Pedraza et al., 20...

  4. Nitric oxide levels regulate the immune response of Drosophila melanogaster reference laboratory strains to bacterial infections.

    PubMed

    Eleftherianos, Ioannis; More, Kareen; Spivack, Stephanie; Paulin, Ethan; Khojandi, Arman; Shukla, Sajala

    2014-10-01

    Studies on the innate immune response against microbial infections in Drosophila melanogaster involve mutant strains and their reference strains that act as experimental controls. We used five standard D. melanogaster laboratory reference strains (Oregon R, w1118, Canton-S, Cinnabar Brown, and Yellow White [YW]) and investigated their response against two pathogenic bacteria (Photorhabdus luminescens and Enterococcus faecalis) and two nonpathogenic bacteria (Escherichia coli and Micrococcus luteus). We detected high sensitivity among YW flies to bacterial infections and increased bacterial growth compared to the other strains. We also found variation in the transcription of certain antimicrobial peptide genes among strains, with Oregon and YW infected flies showing the highest and lowest gene transcription levels in most cases. We show that Oregon and w1118 flies possess more circulating hemocytes and higher levels of phenoloxidase activity than the other strains upon infection with the nonpathogenic bacteria. We further observed reduced fat accumulation in YW flies infected with the pathogenic bacteria, which suggests a possible decline in physiological condition. Finally, we found that nitrite levels are significantly lower in infected and uninfected YW flies compared to w1118 flies and that nitric oxide synthase mutant flies in YW background are more susceptible to bacterial infection compared to mutants in w1118 background. Therefore, increased sensitivity of YW flies to bacterial infections can be partly attributed to lower levels of nitric oxide. Such studies will significantly contribute toward a better understanding of the genetic variation between D. melanogaster reference strains.

  5. Nitric Oxide Levels Regulate the Immune Response of Drosophila melanogaster Reference Laboratory Strains to Bacterial Infections

    PubMed Central

    More, Kareen; Spivack, Stephanie; Paulin, Ethan; Khojandi, Arman; Shukla, Sajala

    2014-01-01

    Studies on the innate immune response against microbial infections in Drosophila melanogaster involve mutant strains and their reference strains that act as experimental controls. We used five standard D. melanogaster laboratory reference strains (Oregon R, w1118, Canton-S, Cinnabar Brown, and Yellow White [YW]) and investigated their response against two pathogenic bacteria (Photorhabdus luminescens and Enterococcus faecalis) and two nonpathogenic bacteria (Escherichia coli and Micrococcus luteus). We detected high sensitivity among YW flies to bacterial infections and increased bacterial growth compared to the other strains. We also found variation in the transcription of certain antimicrobial peptide genes among strains, with Oregon and YW infected flies showing the highest and lowest gene transcription levels in most cases. We show that Oregon and w1118 flies possess more circulating hemocytes and higher levels of phenoloxidase activity than the other strains upon infection with the nonpathogenic bacteria. We further observed reduced fat accumulation in YW flies infected with the pathogenic bacteria, which suggests a possible decline in physiological condition. Finally, we found that nitrite levels are significantly lower in infected and uninfected YW flies compared to w1118 flies and that nitric oxide synthase mutant flies in YW background are more susceptible to bacterial infection compared to mutants in w1118 background. Therefore, increased sensitivity of YW flies to bacterial infections can be partly attributed to lower levels of nitric oxide. Such studies will significantly contribute toward a better understanding of the genetic variation between D. melanogaster reference strains. PMID:25047850

  6. [Bound amino acids in local strains of Trichomonas vaginalis].

    PubMed

    Tsvetkova, A; Osinovski, E; Vasilevska, M

    1990-01-01

    Amino acid composition of water-soluble and water-insoluble proteins of 8 strains of Tr. vaginalis is studied. 17 amino acids are found in both protein hydrolyzates. Despite the complete coincidence of their qualitative compositions there are reliable differences in the quantitative contents of some amino acids. Differences in the contents of main amino acids of water-soluble proteins of different strains reflect the belonging of the latter to different sero-groups. No reliable differences in the quantitative contents of amino acids of both water-soluble and water-insoluble proteins in strains belonging to one sero-group are recognised.

  7. Recovery of succinic acid produced by fermentation of a metabolically engineered Mannheimia succiniciproducens strain.

    PubMed

    Song, Hyohak; Huh, Yun Suk; Lee, Sang Yup; Hong, Won Hi; Hong, Yeon Ki

    2007-12-01

    There have recently been much advances in the production of succinic acid, an important four-carbon dicarboxylic acid for many industrial applications, by fermentation of several natural and engineered bacterial strains. Mannheimia succiniciproducens MBEL55E isolated from bovine rumen is able to produce succinic acid with high efficiency, but also produces acetic, formic and lactic acids just like other anaerobic succinic acid producers. We recently reported the development of an engineered M. succiniciproducens LPK7 strain which produces succinic acid as a major fermentation product while producing much reduced by-products. Having an improved succinic acid producer developed, it is equally important to develop a cost-effective downstream process for the recovery of succinic acid. In this paper, we report the development of a simpler and more efficient method for the recovery of succinic acid. For the recovery of succinic acid from the fermentation broth of LPK7 strain, a simple process composed of a single reactive extraction, vacuum distillation, and crystallization yielded highly purified succinic acid (greater than 99.5% purity, wt%) with a high yield of 67.05wt%. When the same recovery process or even multiple reactive extraction steps were applied to the fermentation broth of MBEL55E, lower purity and yield of succinic acid were obtained. These results suggest that succinic acid can be purified in a cost-effective manner by using the fermentation broth of engineered LPK7 strain, showing the importance of integrating the strain development, fermentation and downstream process for optimizing the whole processes for succinic acid production.

  8. Progress in lactic acid bacterial phage research

    PubMed Central

    2014-01-01

    Research on lactic acid bacteria (LAB) has advanced significantly over the past number of decades and these developments have been driven by the parallel advances in technologies such as genomics, bioinformatics, protein expression systems and structural biology, combined with the ever increasing commercial relevance of this group of microorganisms. Some of the more significant and impressive outputs have been in the domain of bacteriophage-host interactions which provides a prime example of the cutting-edge model systems represented by LAB research. Here, we present a retrospective overview of the key advances in LAB phage research including phage-host interactions and co-evolution. We describe how in many instances this knowledge can be pivotal in creating real improvements in the application of LAB cultures in commercial practice. PMID:25185514

  9. Raman discrimination of bacterial strains using multilayered microcavity substrates

    NASA Astrophysics Data System (ADS)

    Sharma, Shiv K.; Dykes, Ava C.; Misra, Anupam K.; Kamemoto, Lori E.; Bates, David E.

    2011-05-01

    Surface-enhanced Raman scattering (SERS) utilizing colloidal silver and gold has been demonstrated to provide a rapid means of measuring the Raman spectra of microorganisms in the fingerprint region. In this study, we have introduced microcavity substrates coated with alternating layers of silver and gold thin films for measuring the Raman spectra of four strains of E. coli. These microcavitiy substrates have been prepared by placing glass microspheres between two polished aluminum substrates and pressing them together using a standard lab press. After removing the glass microspheres from the substrates, the substrates have been coated with 15 to 70 nm thick films of chromium, silver and gold in a precise order. The cavities were evaluated for SERS enhancement by measuring Raman spectra of dilute rhodamine 6G (R6G) down to 10-8 M. With these microcavities, we have investigated the SERS spectra of four chemically competent strains of E. coli (One Shot OmniMAX 2-T1, Mach1-T1, Stbl3, and TOP10). Replicate SERS spectra of all the four e-coli strains show excellent reproducibility. Visual examination of the spectra, however, reveals differences in the spectra of these strains. To confirm this observation, we have used multivariate analysis for positive identification and discrimination between the strains.

  10. Engineering of bacterial strains and their products for cancer therapy.

    PubMed

    Bernardes, Nuno; Chakrabarty, Ananda M; Fialho, Arsenio M

    2013-06-01

    The use of live bacteria in cancer therapies offers exciting possibilities. Nowadays, an increasing number of genetically engineered bacteria are emerging in the field, with applications both in therapy and diagnosis. In parallel, purified bacterial products are also gaining relevance as new classes of bioactive products to treat and prevent cancer growth and metastasis. In the first part of the article, we review the latest findings regarding the use of live bacteria and products as anti-cancer agents, paying special attention to immunotoxins, proteins, and peptides. In particular, we focus on the recent results of using azurin or its derived peptide as anticancer therapeutic agents. In the second part, we discuss the challenges of using metagenomic techniques as a distinctive approach for discovering new anti-cancer agents from bacterial origin.

  11. Characteristics of bacterial strains inhabiting the wood of coniferous trees.

    PubMed

    Gajewska, Julitta; Miszczyk, Anita; Markiewicz, Zdzisław

    2004-01-01

    The presented studies embraced samples of wood chips from coniferous trees which contained layers of duramen, alburnum and bark. Microbiological analysis involved qualitative and quantitative determination of bacterial flora inhabiting the studied wood material. The wood chips were found to contain primarily species belonging to the genera Bacillus and Pseudomonas. The presence of the potentially pathogenic species Bacillus cereus 1, Sphingomonas paucimobilis, Aeromonas salmonicida and Chryseomonas luteola was also demonstrated.

  12. [BACILLUS STRAINS'S SCREENING--ACTIVE ANTAGONISTS OF BACTERIAL AND FUNGAL PHYTOPATHOGENS].

    PubMed

    Grabova, A Yu; Dragovoz, I V; Kruchkova, L A; Pasichnik, L A; Avdeeva, L V

    2015-01-01

    Antagonistic activity 100 strains of Bacillus bacteria towards to museum and actual strains of phytopathogenic bacteria and fungy was defined. Relation between level of antagonistic activity to phytopathogenic bacteria and genus accessory of the last was shown. The medium level of antagonism to fungal phytopathogens at 30% of the studied strains of Bacillus bacteria was shown. 5 strains of Bacillus sp. with high and medium levels of antagonism to phytopathogens bacterial and fungy nature was selected and considered as perspective for creation of biological preparations for plant protection.

  13. Screening of Lactobacillus strains of domestic goose origin against bacterial poultry pathogens for use as probiotics.

    PubMed

    Dec, Marta; Puchalski, Andrzej; Urban-Chmiel, Renata; Wernicki, Andrzej

    2014-10-01

    Lactobacilli are natural inhabitants of human and animal mucous membranes, including the avian gastrointestinal tract. Recently, increasing attention has been given to their probiotic, health-promoting capacities, among which their antagonistic potential against pathogens plays a key role. A study was conducted to evaluate probiotic properties of Lactobacillus strains isolated from feces or cloacae of domestic geese. Among the 104 examined isolates, previously identified to the species level by whole-cell matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and analysis of 16S-23S regions of rDNA, dominated Lactobacillus salivarius (35%), followed by Lactobacillus johnsonii (18%) and Lactobacillus ingluviei (11%). All lactobacilli were screened for antimicrobial activity toward Salmonella Enteritidis, Escherichia coli, Clostridium perfringens, Staphylococcus aureus, Pasteurella multocida, and Riemerella anatipestifer using the agar slab method and the well diffusion method. Lactobacillus salivarius and Lactobacillus plantarum exhibited particularly strong antagonism toward all of the indicator strains. In the agar slab method, the highest sensitivity to Lactobacillus was observed in R. anatipestifer and P. multocida, and the lowest in E. coli and S. aureus. The ability to produce H₂O₂was exhibited by 92% of isolates, but there was no correlation between the rate of production of this reactive oxygen species and the antimicrobial activity of Lactobacillus sp. All lactobacilli showed resistance to pH 3.0 and 3.5 and to 2% bile. The data demonstrate that Lactobacillus isolates from geese may have probiotic potential in reducing bacterial infections. The antibacterial activity of the selected lactobacilli is mainly due to lactic acid production by these bacteria. The selected Lactobacillus strains that strongly inhibited the growth of pathogenic bacteria, and were also resistant to low pH and bile salts, can potentially restore the balance

  14. Superhydrophobic poly(L-lactic acid) surface as potential bacterial colonization substrate

    PubMed Central

    2011-01-01

    Hydrophobicity is a very important surface property and there is a growing interest in the production and characterization of superhydrophobic surfaces. Accordingly, it was recently shown how to obtain a superhydrophobic surface using a simple and cost-effective method on a polymer named poly(L-lactic acid) (PLLA). To evaluate the ability of such material as a substrate for bacterial colonization, this work assessed the capability of different bacteria to colonize a biomimetic rough superhydrophobic (SH) PLLA surface and also a smooth hydrophobic (H) one. The interaction between these surfaces and bacteria with different morphologies and cell walls was studied using one strain of Staphylococcus aureus and one of Pseudomonas aeruginosa. Results showed that both bacterial strains colonized the surfaces tested, although significantly higher numbers of S. aureus cells were found on SH surfaces comparing to H ones. Moreover, scanning electron microscopy images showed an extracellular matrix produced by P. aeruginosa on SH PLLA surfaces, indicating that this bacterium is able to form a biofilm on such substratum. Bacterial removal through lotus leaf effect was also tested, being more efficient on H coupons than on SH PLLA ones. Overall, the results showed that SH PLLA surfaces can be used as a substrate for bacterial colonization and, thus, have an exceptional potential for biotechnology applications. PMID:22018163

  15. Specificity of monoclonal antibodies to strains of Dickeya sp. that cause bacterial heart rot of pineapple.

    PubMed

    Peckham, Gabriel D; Kaneshiro, Wendy S; Luu, Van; Berestecky, John M; Alvarez, Anne M

    2010-10-01

    During a severe outbreak of bacterial heart rot that occurred in pineapple plantations on Oahu, Hawaii, in 2003 and years following, 43 bacterial strains were isolated from diseased plants or irrigation water and identified as Erwinia chrysanthemi (now Dickeya sp.) by phenotypic, molecular, and pathogenicity assays. Rep-PCR fingerprint patterns grouped strains from pineapple plants and irrigation water into five genotypes (A-E) that differed from representatives of other Dickeya species, Pectobacterium carotovorum and other enteric saprophytes isolated from pineapple. Monoclonal antibodies produced following immunization of mice with virulent type C Dickeya sp. showed only two specificities. MAb Pine-1 (2D11G1, IgG1 with kappa light chain) reacted to all 43 pineapple/water strains and some reference strains (D. dianthicola, D. chrysanthemi, D. paradisiaca, some D. dadantii, and uncharacterized Dickeya sp.) but did not react to reference strains of D. dieffenbachiae, D. zeae, or one of the two Malaysian pineapple strains. MAb Pine-2 (2A7F2, IgG3 with kappa light chain) reacted to all type B, C, and D strains but not to any A or E strains or any reference strains except Dickeya sp. isolated from Malaysian pineapple. Pathogenicity tests showed that type C strains were more aggressive than type A strains when inoculated during cool months. Therefore, MAb Pine-2 distinguishes the more virulent type C strains from less virulent type A pineapple strains and type E water strains. MAbs with these two specificities enable development of rapid diagnostic tests that will distinguish the systemic heart rot pathogen from opportunistic bacteria associated with rotted tissues. Use of the two MAbs in field assays also permits the monitoring of a known subpopulation and provides additional decision tools for disease containment and management practices.

  16. Pilot Screening to Determine Antimicrobial Synergies in a Multidrug-Resistant Bacterial Strain Library

    PubMed Central

    Kim, Si-Hyun; Park, Chulmin; Chun, Hye-Sun; Choi, Jae-Ki; Lee, Hyo-Jin; Cho, Sung-Yeon; Park, Sun Hee; Choi, Su-Mi; Choi, Jung-Hyun; Yoo, Jin-Hong

    2016-01-01

    With the rise in multidrug-resistant (MDR) bacterial infections, there has been increasing interest in combinations of ≥2 antimicrobial agents with synergistic effects. We established an MDR bacterial strain library to screen for in vitro antimicrobial synergy by using a broth microdilution checkerboard method and high-throughput luciferase-based bacterial cell viability assay. In total, 39 MDR bacterial strains, including 23 carbapenem-resistant gram-negative bacteria, 9 vancomycin-intermediate Staphylococcus aureus, and 7 vancomycin-resistant Enterococcus faecalis, were used to screen for potential antimicrobial synergies. Synergies were more frequently identified with combinations of imipenem plus trimethoprim–sulfamethoxazole for carbapenem-resistant Acinetobacter baumannii in the library. To verify this finding, we tested 34 A. baumannii clinical isolates resistant to both imipenem and trimethoprim–sulfamethoxazole by the checkerboard method. The imipenem plus trimethoprim–sulfamethoxazole combination showed synergy in the treatment of 21 (62%) of the clinical isolates. The results indicate that pilot screening for antimicrobial synergy in the MDR bacterial strain library could be valuable in the selection of combination therapeutic regimens to treat MDR bacterial infections. Further studies are warranted to determine whether this screening system can be useful to screen for the combined effects of conventional antimicrobials and new-generation antimicrobials or nonantimicrobials. PMID:26974861

  17. The Use of Laser-Induced Breakdown Spectroscopy for Distinguishing Between Bacterial Pathogen Species and Strains

    PubMed Central

    Multari, Rosalie A.; Cremers, David A.; Dupre, Joanne M.; Gustafson, John E.

    2013-01-01

    Laser-induced breakdown spectroscopy (LIBS) was used in a blind study to successfully differentiate bacterial pathogens, both species and strain. The pathogens used for the study were chosen and prepared by one set of researchers. The LIBS data were collected and analyzed by another set of researchers. The latter researchers had no knowledge of the sample identities other than that (1) the first five of fifteen samples were unique (not replicates) and (2) the remaining ten samples consisted of two replicates of each of the first five samples. Using only chemometric analysis of the LIBS data, the ten replicate bacterial samples were successfully matched to each of the first five samples. The results of this blind study show it is possible to differentiate the bacterial pathogens Escherichia coli, three clonal methicillin-resistant Staphylococcus aureus (MRSA) strains, and one unrelated MRSA strain using LIBS. This is an important finding because it demonstrates that LIBS can be used to determine bacterial pathogen species within a defined sample set and can be used to differentiate between clonal relationships among strains of a single multiple-antibiotic-resistant bacterial species. Such a capability is important for the development of LIBS instruments for use in medical, water, and food safety applications. PMID:20615288

  18. Influence of temperature, oxygen and bacterial strain identity on the association of Campylobacter jejuni with Acanthamoeba castellanii.

    PubMed

    Baré, Julie; Sabbe, Koen; Huws, Sharon; Vercauteren, Dries; Braeckmans, Kevin; van Gremberghe, Ineke; Favoreel, Herman; Houf, Kurt

    2010-11-01

    Campylobacteriosis is the most frequently reported foodborne disease in the industrialized world, mainly through consumption of contaminated chicken meat. To date, no information is available on the primary infection sources of poultry. In this study, the ability of five Campylobacter jejuni strains with different invasion potential towards Caco-2 cells to survive and replicate in the protozoan Acanthamoeba castellanii was tested under simulated in situ conditions (i.e. chicken broiler houses). Results indicate that environmental conditions play a crucial role in C. jejuni-A. castellanii interactions. Co-culture in general did not result in an increase of either bacteria or amoebae. However, co-culture with Acanthamoeba did result in a delayed decline and an increased long-term survival of Campylobacter. Bacterial strain-specific effects were observed, with higher survival rates for low-invasive strains. The presence of C. jejuni in general did not affect A. castellanii viability, except at 37 °C under microaerobic conditions, where the presence of the reference and low-invasive Campylobacter strains resulted in a significant decline in amoebal viability. Confocal laser scanning microscopy revealed that intra-amoebal campylobacters were not always colocated with acidic organelles, suggesting potential bacterial interference with digestive processes. As Acanthamoeba enhances the persistence of C. jejuni, the presence of the amoeba in broiler house environments may have important implications for the ecology and epidemiology of this food pathogen.

  19. Lactic Acid Bacterial Starter Culture with Antioxidant and γ-Aminobutyric Acid Biosynthetic Activities Isolated from Flatfish-Sikhae Fermentation.

    PubMed

    Won, Yeong Geol; Yu, Hyun-Hee; Chang, Young-Hyo; Hwang, Han-Joon

    2015-12-01

    The aim of this study is to select a lactic acid bacterial strain as a starter culture for flatfish-Sikhae fermentation and to evaluate its suitability for application in a food system. Four strains of lactic acid bacteria isolated from commercial flatfish-Sikhae were identified and selected as starter culture candidates through investigation of growth rates, salt tolerance, food safety, and functional properties such as antioxidative and antimicrobial activities. The fermentation properties of the starter candidates were also examined in food systems prepared with these strains (candidate batch) in comparison with a spontaneous fermentation process without starter culture (control batch) at 15°C. The results showed that the candidate YG331 batch had better fermentation properties such as viable cell count, pH, and acidity than the other experimental batches, including the control batch. The results are expressed according to selection criteria based on a preliminary sensory evaluation and physiochemical investigation. Also, only a small amount of histamine was detected with the candidate YG331 batch. The radical scavenging activity of the candidate batches was better compared with the control batch, and especially candidate YG331 batch showed the best radical scavenging activity. Also, we isolated another starter candidate (identified as Lactobacillus brevis PM03) with γ-aminobutyric acid (GABA)-producing activity from commercial flatfish-Sikhae products. The sensory scores of the candidate YG331 batch were better than those of the other experimental batches in terms of flavor, color, and overall acceptance. In this study, we established selection criteria for the lactic acid bacterial starter for the flatfish-Sikhae production and finally selected candidate YG331 as the most suitable starter.

  20. Ohr plays a central role in bacterial responses against fatty acid hydroperoxides and peroxynitrite.

    PubMed

    Alegria, Thiago G P; Meireles, Diogo A; Cussiol, José R R; Hugo, Martín; Trujillo, Madia; de Oliveira, Marcos Antonio; Miyamoto, Sayuri; Queiroz, Raphael F; Valadares, Napoleão Fonseca; Garratt, Richard C; Radi, Rafael; Di Mascio, Paolo; Augusto, Ohara; Netto, Luis E S

    2017-01-10

    Organic hydroperoxide resistance (Ohr) enzymes are unique Cys-based, lipoyl-dependent peroxidases. Here, we investigated the involvement of Ohr in bacterial responses toward distinct hydroperoxides. In silico results indicated that fatty acid (but not cholesterol) hydroperoxides docked well into the active site of Ohr from Xylella fastidiosa and were efficiently reduced by the recombinant enzyme as assessed by a lipoamide-lipoamide dehydrogenase-coupled assay. Indeed, the rate constants between Ohr and several fatty acid hydroperoxides were in the 10(7)-10(8) M(-1)⋅s(-1) range as determined by a competition assay developed here. Reduction of peroxynitrite by Ohr was also determined to be in the order of 10(7) M(-1)⋅s(-1) at pH 7.4 through two independent competition assays. A similar trend was observed when studying the sensitivities of a ∆ohr mutant of Pseudomonas aeruginosa toward different hydroperoxides. Fatty acid hydroperoxides, which are readily solubilized by bacterial surfactants, killed the ∆ohr strain most efficiently. In contrast, both wild-type and mutant strains deficient for peroxiredoxins and glutathione peroxidases were equally sensitive to fatty acid hydroperoxides. Ohr also appeared to play a central role in the peroxynitrite response, because the ∆ohr mutant was more sensitive than wild type to 3-morpholinosydnonimine hydrochloride (SIN-1 , a peroxynitrite generator). In the case of H2O2 insult, cells treated with 3-amino-1,2,4-triazole (a catalase inhibitor) were the most sensitive. Furthermore, fatty acid hydroperoxide and SIN-1 both induced Ohr expression in the wild-type strain. In conclusion, Ohr plays a central role in modulating the levels of fatty acid hydroperoxides and peroxynitrite, both of which are involved in host-pathogen interactions.

  1. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors

    PubMed Central

    Getino, María; Fernández-López, Raúl; Palencia-Gándara, Carolina; Campos-Gómez, Javier; Sánchez-López, Jose M.; Martínez, Marta; Fernández, Antonio; de la Cruz, Fernando

    2016-01-01

    Bacterial conjugation is the main mechanism for the dissemination of multiple antibiotic resistance in human pathogens. This dissemination could be controlled by molecules that interfere with the conjugation process. A search for conjugation inhibitors among a collection of 1,632 natural compounds, identified tanzawaic acids A and B as best hits. They specially inhibited IncW and IncFII conjugative systems, including plasmids mobilized by them. Plasmids belonging to IncFI, IncI, IncL/M, IncX and IncH incompatibility groups were targeted to a lesser extent, whereas IncN and IncP plasmids were unaffected. Tanzawaic acids showed reduced toxicity in bacterial, fungal or human cells, when compared to synthetic conjugation inhibitors, opening the possibility of their deployment in complex environments, including natural settings relevant for antibiotic resistance dissemination. PMID:26812051

  2. Uptake of phenylacetic acid by two strains of Penicillium chrysogenum.

    PubMed

    Eriksen, S H; Soderblom, T B; Jensen, B; Olsen, J

    1998-11-05

    Uptake of phenylacetic acid, the side-chain precursor of benzylpenicillin, was studied in Penicillium chrysogenum Wisconsin 54-1255 and in a strain yielding high levels of penicillin. In penicillin fermentations with the high-yielding strain, 100% recovery of phenylacetic acid in benzylpenicillin was found, whereas in the Wisconsin strain only 17% of the supplied phenylacetic acid was incorporated into benzylpenicillin while the rest was metabolized. Accumulation of total phenylacetic acid-derived carbon in the cells was nonsaturable in both strains at high external concentrations of phenylacetic acid (250-3500 microM), and in the high-yielding strain at low phenylacetic acid concentrations (2. 8-100 microM), indicating that phenylacetic acid enters the cells by simple diffusion, as concluded earlier for P. chrysogenum by other authors. However, at low external concentrations of phenylacetic acid saturable accumulation appeared in the Wisconsin strain. HPLC-analyses of cell extracts from the Wisconsin strain showed that phenylacetic acid was metabolized immediately after entry into the cells and different [14C]-labeled metabolites were detected in the cells. Up to approximately 50% of the accumulated phenylacetic acid was metabolized during the transport-assay period, the conversion having an impact on the uptake experiments. Nevertheless, accumulation of free unchanged phenylacetic acid in the cells showed saturation kinetics, suggesting the possible involvement of a high-affinity carrier in uptake of phenylacetic acid in P. chrysogenum Wisconsin 54-1255. At high concentrations of phenylacetic acid, contribution to uptake by this carrier is minor in comparison to simple diffusion and therefore, of no importance in the industrial production of penicillin.

  3. Recent advances in inhibitors of bacterial fatty acid synthesis type II (FASII) system enzymes as potential antibacterial agents.

    PubMed

    Wang, Yi; Ma, Shutao

    2013-10-01

    Bacterial infections are a constant and serious threat to human health. With the increase of multidrug resistance of clinically pathogenic bacteria, common antibiotic therapies have been less effective. Fatty acid synthesis type II (FASII) system enzymes are essential for bacterial membrane lipid biosynthesis and represent increasingly promising targets for the discovery of antibacterial agents with new mechanisms of action. This review highlights recent advances in inhibitors of bacterial FASII as potential antibacterial agents, paying special attention to the activities, mechanisms, and structure-activity relationships of those inhibitors that mainly target β-ketoacyl-ACP synthase, β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydratase, and enoyl-ACP reductase. Although inhibitors with low nanomolar and selective activity against various bacterial FASII have entered clinical trials, further research is needed to expand upon both available and yet unknown scaffolds to identify new FASII inhibitors that may have antibacterial potential, particularly against resistant bacterial strains.

  4. Simultaneous production of acetic and gluconic acids by a thermotolerant Acetobacter strain during acetous fermentation in a bioreactor.

    PubMed

    Mounir, Majid; Shafiei, Rasoul; Zarmehrkhorshid, Raziyeh; Hamouda, Allal; Ismaili Alaoui, Mustapha; Thonart, Philippe

    2016-02-01

    The activity of bacterial strains significantly influences the quality and the taste of vinegar. Previous studies of acetic acid bacteria have primarily focused on the ability of bacterial strains to produce high amounts of acetic acid. However, few studies have examined the production of gluconic acid during acetous fermentation at high temperatures. The production of vinegar at high temperatures by two strains of acetic acid bacteria isolated from apple and cactus fruits, namely AF01 and CV01, respectively, was evaluated in this study. The simultaneous production of gluconic and acetic acids was also examined in this study. Biochemical and molecular identification based on a 16s rDNA sequence analysis confirmed that these strains can be classified as Acetobacter pasteurianus. To assess the ability of the isolated strains to grow and produce acetic acid and gluconic acid at high temperatures, a semi-continuous fermentation was performed in a 20-L bioreactor. The two strains abundantly grew at a high temperature (41°C). At the end of the fermentation, the AF01 and CV01 strains yielded acetic acid concentrations of 7.64% (w/v) and 10.08% (w/v), respectively. Interestingly, CV01 was able to simultaneously produce acetic and gluconic acids during acetic fermentation, whereas AF01 mainly produced acetic acid. In addition, CV01 was less sensitive to ethanol depletion during semi-continuous fermentation. Finally, the enzymatic study showed that the two strains exhibited high ADH and ALDH enzyme activity at 38°C compared with the mesophilic reference strain LMG 1632, which was significantly susceptible to thermal inactivation.

  5. Transport processes and mutual interactions of three bacterial strains in saturated porous media

    NASA Astrophysics Data System (ADS)

    Stumpp, Christine; Lawrence, John R.; Hendry, M. Jim; Maloszewski, Pitor

    2010-05-01

    Transport processes of the bacterial strains Klebsiella oxytoca, Burkholderia cepacia G4PR-1 and Pseudomonas sp #5 were investigated in saturated column experiments to study the differences in transport characteristics and the mutual interactions of these strains during transport. Soil column experiments (114 mm long x 33 mm in diameter) were conducted with constant water velocities (3.9-5.7 cm/h) through a medium to coarse grained silica sand. All experiments were performed in freshly packed columns in quadruplicate. Chloride was used as tracer to determine the mean transit time, dispersivity and flow rate. It was injected as a pulse into the columns together with the bacterial strains suspended in artificial groundwater medium. In the first setup, each strain was investigated alone. In the second setup, transport processes were performed injecting two strains simultaneously. Finally, the transport characteristics were studied in successive experiments when one bacterium was resident on the sand grains prior to the introduction of the second strain. In all experiments the peak C/Co bacterial concentrations were attenuated with respect to the conservative tracer chloride and a well defined tailing was observed. A one dimensional mathematical model for advective-dispersive transport that accounts for irreversible and reversible sorption was used to analyze the bacterial breakthrough curves and tailing patterns. It was shown that the sorption parameters were different for the three strains that can be explained by the properties of the bacteria. For the species Klebsiella oxytoca and Burkholderia cepacia G4PR-the transport parameters were mostly in the same range independent of the experimental setup. However, Pseudomonas sp #5, which is a motile bacterium, showed differences in the breakthrough curves and sorption parameters during the experiments. The simultaneous and successive experiments indicated an influence on the reversible sorption processes when another

  6. Two UDP-glucuronic acid decarboxylases involved in the biosynthesis of a bacterial exopolysaccharide in Paenibacillus elgii.

    PubMed

    Li, Ou; Qian, Chao-Dong; Zheng, Dao-Qiong; Wang, Pin-Mei; Liu, Yu; Jiang, Xin-Hang; Wu, Xue-Chang

    2015-04-01

    Xylose is described as a component of bacterial exopolysaccharides in only a limited number of bacterial strains. A bacterial strain, Paenibacillus elgii, B69 was shown to be efficient in producing a xylose-containing exopolysaccharide. Sequence analysis was performed to identify the genes encoding the uridine diphosphate (UDP)-glucuronic acid decarboxylase required for the synthesis of UDP-xylose, the precursor of the exopolysaccharide. Two sequences, designated as Peuxs1 and Peuxs2, were found as the candidate genes for such enzymes. The activities of the UDP-glucuronic acid decarboxylases were proven by heterologous expression and real-time nuclear magnetic resonance analysis. The intracellular activity and effect of these genes on the synthesis of exopolysaccharide were further investigated by developing a thymidylate synthase based knockout system. This system was used to substitute the conventional antibiotic resistance gene system in P. elgii, a natural multi-antibiotic resistant strain. Results of intracellular nucleotide sugar analysis showed that the intracellular UDP-xylose and UDP-glucuronic acid levels were affected in Peuxs1 or Peuxs2 knockout strains. The knockout of either Peuxs1 or Peuxs2 reduced the polysaccharide production and changed the monosaccharide ratio. No polysaccharide was found in the Peuxs1/Peuxs2 double knockout strain. Our results show that P. elgii can be efficient in forming UDP-xylose, which is then used for the synthesis of xylose-containing exopolysaccharide.

  7. Biodegradation of organochlorine pesticide endosulfan by bacterial strain Alcaligenes faecalis JBW4.

    PubMed

    Kong, Lingfen; Zhu, Shaoyuan; Zhu, Lusheng; Xie, Hui; Su, Kunchang; Yan, Tongxiang; Wang, Jun; Wang, Jinhua; Wang, Fenghua; Sun, Fengxia

    2013-11-01

    The recently discovered endosulfan-degrading bacterial strain Alcaligenesfaecalis JBW4 was isolated from activated sludge. This strain is able to use endosulfan as a carbon and energy source. The optimal conditions for the growth of strain JBW4 and for biodegradation by this strain were identified, and the metabolic products of endosulfan degradation were studied in detail. The maximum level of endosulfan biodegradation by strain JBW4 was obtained using broth at an initial pH of 7.0, an incubation temperature of 40 degreeC and an endosulfan concentration of 100 mg/L. The concentration of endosulfan was determined by gas chromatography. Strain JBW4 was able to degrade 87.5% of alpha-endosulfan and 83.9% of beta-endosulfan within 5 days. These degradation rates are much higher than the previously reported bacterial strains. Endosulfan diol and endosulfan lactone were the major metabolites detected by gas chromatography-mass spectrometry; endosulfan sulfate, which is a persistent and toxic metabolite, was not detected. These results suggested that A. faecalis JBW4 degrades endosulfan via a non-oxidative pathway. The biodegradation of endosulfan by A. faecalis is reported for the first time. Additionally, the present study indicates that strain JBW4 may have potential for the biodegradation of endosulfan residues.

  8. Simultaneous Microcystis Algicidal and Microcystin Degrading Capability by a Single Acinetobacter Bacterial Strain.

    PubMed

    Li, Hong; Ai, Hainan; Kang, Li; Sun, Xingfu; He, Qiang

    2016-11-01

    Measures for removal of toxic harmful algal blooms often cause lysis of algal cells and release of microcystins (MCs). In this study, Acinetobacter sp. CMDB-2 that exhibits distinct algal lysing activity and MCs degradation capability was isolated. The physiological response and morphological characteristics of toxin-producing Microcystis aeruginosa, the dynamics of intra- and extracellular MC-LR concentration were studied in an algal/bacterial cocultured system. The results demonstrated that Acinetobacter sp. CMDB-2 caused thorough decomposition of algal cells and impairment of photosynthesis within 24 h. Enhanced algal lysis and MC-LR release appeared with increasing bacterial density from 1 × 10(3) to 1 × 10(7) cells/mL; however, the MC-LR was reduced by nearly 94% within 14 h irrespective of bacterial density. Measurement of extracellular and intracellular MC-LR revealed that the toxin was decreased by 92% in bacterial cell incubated systems relative to control and bacterial cell-free filtrate systems. The results confirmed that the bacterial metabolite caused 92% lysis of Microcystis aeruginosa cells, whereas the bacterial cells were responsible for approximately 91% reduction of MC-LR. The joint efforts of the bacterium and its metabolite accomplished the sustainable removal of algae and MC-LR. This is the first report of a single bacterial strain that achieves these dual actions.

  9. Identification of bacterial strains by laboratories participating in the Deutsches Krebsforschungszentrum quality assurance programme.

    PubMed

    Boot, R; Reubsaet, F A G

    2007-10-01

    The quality assurance programme (QAP) of the Deutsches Krebsforschungszentrum (DKFZ) is a proficiency testing system developed to service the laboratory animal discipline. QAP comprises the quarterly distribution of two bacterial strains originating from various species of animals for identification to the species level and antibiotic susceptibility testing. We compared identification results reported by QAP participants over the years 1996-2004 with those obtained by the Dutch Bacterial Diagnostics reference laboratory on 68 samples comprising 71 bacterial strains and a fungus. Significant differences were found in the frequency of reported and correct identifications when bacteria were assigned to different groups based on morphology by Gram stain and on origin (animal versus environmental, rodent and rabbit versus other animal species, pathogen versus non-pathogens). Rodent and rabbit pathogens yielded 73% correct identifications, and with all bacterial strains only 60% of the identifications were correct. We assume that most QAP participants were from laboratory animal diagnostic laboratories. If this is true, the capabilities of laboratories in the laboratory animal discipline to correctly identify bacterial species are well below what are considered acceptable limits for human diagnostic laboratories. The distribution of cultured bacteria circumvents the most difficult step in the microbiological monitoring of animals, namely primary culture from clinical samples. We propose to set up a QAP that comprises the distribution of specimens mimicking clinical samples normally submitted to laboratory animal diagnostic laboratories.

  10. Draft genome sequence of XANTHOMONAS ARBORICOLA strain 3004, causal agent of bacterial disease on barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report here the annotated genome sequence of XANTHOMONAS ARBORICOLA str. 3004, a Gram-negative phytopathogenic bacteria that includes several pathovars characterized by virulence specificity. Strain 3004 was isolated from barley leaves with symptoms of streak (bacterial blight) and also can infec...

  11. Characterization of antibiotic resistant and enzyme producing bacterial strains isolated from the Arabian Sea.

    PubMed

    Tallur, Preeti N; Sajjan, Dayanand B; Mulla, Sikandar I; Talwar, Manjunatha P; Pragasam, A; Nayak, Vinayak M; Ninnekar, Harichandra Z; Bhat, Shivanand S

    2016-06-01

    Marine bacteria are known to produce many bioactive molecules and extracellular enzymes of commercial importance. We have investigated the bacterial diversity of the coastal area of Karwar, Karnataka State, India. Among these bacterial isolates, five bacterial strains were selected and identified by their morphological, biochemical characteristics and phylogenetic analysis based on 16S rRNA gene sequences. The identified bacterial isolates, Bacillus toyonensis PNTB1, Lysinibacillus sphaericus PTB, Vibrio vulnificus PMD, Shewanella MPTDBS, and Pseudomonas chlororaphis PNTB were characterized for their tolerance to salt and antibiotics. Vibrio vulnificus PMD showed maximum tolerance at higher concentration of salt than other bacteria. These bacterial strains were screened for the production of extracellular enzymes such as lipase, cellulase, pectinase, tannase, chitinase, and L-glutaminase. Vibrio vulnificus showed maximum production of L-glutaminase enzyme. Bacillus toyonensis PNTB1 shows lipase, CM-cellulase and chitinase activities. These isolated bacterial cultures were also utilized most of the aromatic compounds at 7 mM. These findings indicate the organisms present in this zone may have more potential applications in bioremediation, agricultural, industrial, and therapeutics.

  12. Emergence of potential superbug mycobacterium tuberculosis, lessons from new delhi mutant-1 bacterial strains.

    PubMed

    Nazir, Taha; Abraham, Suraj; Islam, Azharul

    2012-01-01

    Recent reports have shown that certain bacterial strains attain the New Delhi Metallo-beta-lactamase-1 (NDM-1) enzyme and become resistant to a broad range of antibiotics. Similarly, more dangerous "superbugs" of multi-drug resistant (MDR) and extensive drug resistant (XDR) Mycobacterium tuberculosis strains are gradually emerging through rapid genetic mutation caused by prescription non-compliance or unsupervised indiscriminate use of anti-tubercular drugs or other antibiotics. Mycobacterium tuberculosis cases have been reported in highly susceptible population groups including the aboriginal communities of US and Canada. In Canada alone, the total number of reported tuberculosis cases has decreased over the past decade. However, there is a steady increase in HIV cases in certain communities including the aboriginal communities. Reintroduction of MDR/XDR strains of tuberculosis is possible in these susceptible communities, which in turn may pose serious public health situation. MDR/XDR strains of tuberculosis are virtually untreatable using current anti-tubercular medication protocols. Thus, MDR/XDR tuberculosis presents a grave global public health threat. The unpredictable genetic mechanism involved in generating MDR/XDR resistant strains of Mycobacterium tuberculosis may pose greater challenges in developing appropriate treatment strategies. In this article, we briefly review potential genetic mechanism of emerging NDM-1 bacterial strains and draw a rationale parallel to the underlying genetic mechanism of MDR/XDR Mycobacterium tuberculosis strain development.

  13. Microbial Degradation of Chlorogenic Acid by a Sphingomonas sp. Strain.

    PubMed

    Ma, Yuping; Wang, Xiaoyu; Nie, Xueling; Zhang, Zhan; Yang, Zongcan; Nie, Cong; Tang, Hongzhi

    2016-08-01

    In order to elucidate the metabolism of chlorogenic acid by environmental microbes, a strain of Sphingomonas sp. isolated from tobacco leaves was cultured under various conditions, and chlorogenic acid degradation and its metabolites were investigated. The strain converting chlorogenic acid was newly isolated and identified as a Sphingomonas sp. strain by 16S rRNA sequencing. The optimal conditions for growth and chlorogenic acid degradation were 37 °C and pH 7.0 with supplementation of 1.5 g/l (NH4)2SO4 as the nitrogen source and 2 g/l chlorogenic acid as the sole carbon source. The maximum chlorogenic acid tolerating capability for the strain was 5 g/l. The main metabolites were identified as caffeic acid, shikimic acid, and 3,4-dihydroxybenzoic acid based on gas chromatography-mass spectrometry analysis. The analysis reveals the biotransformation mechanism of chlorogenic acid in microbial cells isolated from the environment.

  14. Triacetic acid lactone production in industrial Saccharomyces yeast strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...

  15. Production of mycophenolic acid by Penicillium roqueforti strains.

    PubMed Central

    Lafont, P; Debeaupuis, J P; Gaillardin, M; Payen, J

    1979-01-01

    Sixteen strains of Penicillium roqueforti Thom, isolated from blue-molded cheeses, were studied. In vitro, all of these strains produced mycophenolic acid, some on the order of 0.8 to 4 mg/g od dry culture. The greatest yields were obtained after 10 days of incubation of cultures at 15 degrees C. However, under some experimental conditions, mycophenolic acid was not alone responsible for the toxicity of culture extracts to chicken embryos. PMID:453818

  16. Comparative Proteomics of Tandem Mass Spectrometry Analyses for Bacterial Strains Identification and Differentiation

    DTIC Science & Technology

    2012-02-01

    induced dissociation (CID), Electron transfer dissociation , or post-source decay (PSD) of ionized tryptic peptides derived from bacterial proteins , i.e...fingerprints of the bacterial proteins , i.e. MALDI-TOF-MS technique, or amino acid sequences, from tandem MS/MS analysis, of proteins from collision ...William 2002), present in biological threat microorganisms. The vast amount of protein and peptide data generated from a typical LC- tandem MS

  17. Bacterial strains isolated from PCB-contaminated sediments and their use for bioaugmentation strategy in microcosms.

    PubMed

    Dudášová, Hana; Lukáčová, Lucia; Murínová, Slavomíra; Puškárová, Andrea; Pangallo, Domenico; Dercová, Katarína

    2014-04-01

    This study was focused on the characterization of 15 bacterial strains isolated from long-term PCB-contaminated sediment located at the Strážsky canal in eastern part of Slovakia, in the surroundings of a former PCB producer. PCB-degrading strains were isolated and identified as Microbacterium oleivorans, Stenotrophomonas maltophilia, Brevibacterium sp., Ochrobactrum anthropi, Pseudomonas mandelii, Rhodococcus sp., Achromobacter xylosoxidans, Stenotrophomonas sp., Ochrobactrum sp., Pseudomonas aeruginosa, and Starkeya novella by the 16S rRNA gene sequence phylogenetic analysis. This study presents a newly isolated bacterial strain S. novella with PCB-degrading ability in liquid medium as well as in sediment. For A. xylosoxidans, the bphA gene was identified. The best growth ability in the presence of all sole carbon sources (biphenyl and PCBs vapor) was obtained for Ochrobactrum sp. and Rhodococcus sp. Uncultured Achromobacter sp. showed the highest potential for bioaugmentation of PCB-contaminated sediment.

  18. Bacterial production of conjugated linoleic and linolenic Acid in foods: a technological challenge.

    PubMed

    Gorissen, Lara; Leroy, Frédéric; De Vuyst, Luc; De Smet, Stefaan; Raes, Katleen

    2015-01-01

    Conjugated linoleic acid (CLA) and conjugated linolenic acid (CLNA) isomers are present in foods derived from ruminants as a result of the respective linoleic acid (LA) and α-linolenic acid (LNA) metabolism by ruminal microorganisms and in animals' tissues. CLA and CLNA have isomer-specific, health-promoting properties, including anticarcinogenic, antiatherogenic, anti-inflammatory, and antidiabetic activity, as well as the ability to reduce body fat. Besides ruminal microorganisms, such as Butyrivibrio fibrisolvens, many food-grade bacteria, such as bifidobacteria, lactic acid bacteria (LAB), and propionibacteria, are able to convert LA and LNA to CLA and CLNA, respectively. Linoleate isomerase activity, responsible for this conversion, is strain-dependent and probably related to the ability of the producer strain to tolerate the toxic effects of LA and LNA. Since natural concentrations of CLA and CLNA in ruminal food products are relatively low to exert their health benefits, food-grade bacteria with linoleate isomerase activity could be used as starter or adjunct cultures to develop functional fermented dairy and meat products with increased levels of CLA and CLNA or included in fermented products as probiotic cultures. However, results obtained so far are below expectations due to technological bottlenecks. More research is needed to assess if bacterial production kinetics can be increased and can match food processing requirements.

  19. Isolation of phenazine 1,6-di-carboxylic acid from Pseudomonas aeruginosa strain HRW.1-S3 and its role in biofilm-mediated crude oil degradation and cytotoxicity against bacterial and cancer cells.

    PubMed

    Dasgupta, Debdeep; Kumar, Abhinash; Mukhopadhyay, Balaram; Sengupta, Tapas K

    2015-10-01

    Pseudomonas sp. has long been known for production of a wide range of secondary metabolites during late exponential and stationary phases of growth. Phenazine derivatives constitute a large group of secondary metabolites produced by microorganisms including Pseudomonas sp. Phenazine 1,6-di-carboxylic acid (PDC) is one of such metabolites and has been debated for its origin from Pseudomonas sp. The present study describes purification and characterization of PDC isolated from culture of a natural isolate of Pseudomonas sp. HRW.1-S3 while grown in presence of crude oil as sole carbon source. The isolated PDC was tested for its effect on biofilm formation by another environmental isolate of Pseudomonas sp. DSW.1-S4 which lacks the ability to produce any phenazine compound. PDC showed profound effect on both planktonic as well as biofilm mode of growth of DSW.1-S4 at concentrations between 5 and 20 μM. Interestingly, PDC showed substantial cytotoxicity against three cancer cell lines and against both Gram-positive and Gram-negative bacteria. Thus, the present study not only opens an avenue to understand interspecific cooperation between Pseudomonas species which may lead its applicability in bioremediation, but also it signifies the scope of future investigation on PDC for its therapeutic applications.

  20. Characterization and evaluation of Bacillus amyloliquefaciens strain WF02 regarding its biocontrol activities and genetic responses against bacterial wilt in two different resistant tomato cultivars.

    PubMed

    Huang, Chu-Ning; Lin, Chan-Pin; Hsieh, Feng-Chia; Lee, Sook-Kuan; Cheng, Kuan-Chen; Liu, Chi-Te

    2016-11-01

    Bacillus amyloliquefaciens strain WF02, isolated from soil collected at Wufeng Mountain, Taiwan, has siderophore-producing ability and in vitro antagonistic activity against bacterial wilt pathogen. To determine the impact of plant genotype on biocontrol effectiveness, we treated soil with this strain before infecting susceptible (L390) and moderately resistant (Micro-Tom) tomato cultivars with Ralstonia solanacearum strain Pss4. We also compared the efficacy of this strain with that of commercial Bacillus subtilis strain Y1336. Strain WF02 provided longer lasting protection against R. solanacearum than did strain Y1336 and controlled the development of wilt in both cultivars. To elucidate the genetic responses in these plants under WF02 treatment, we analyzed the temporal expression of defense-related genes in leaves. The salicylic acid pathway-related genes phenylalanine ammonia-lyase and pathogenesis-related protein 1a were up-regulated in both cultivars, whereas expression of the jasmonic acid pathway-related gene lipoxygenase was only elevated in the susceptible tomato cultivar (L390). These results suggest that WF02 can provide protection against bacterial wilt in tomato cultivars with different levels of disease resistance via direct and indirect modes of action.

  1. Conversion of cysteine to 3-mercaptopyruvic acid by bacterial aminotransferases.

    PubMed

    Andreeßen, Christina; Gerlt, Vanessa; Steinbüchel, Alexander

    2017-04-01

    3-Mercaptopyruvate (3MPy), a structural analog of 3-mercaptopropionic acid, is a precursor compound for biosynthesis of polythioesters in bacteria. The cost-effectiveness and sustainability of the whole process could be greatly improved by using the cysteine degradation pathway for an intracellular supply of 3MPy. Transamination of cysteine to its corresponding α-keto acid 3MPy is catalyzed by cysteine aminotransferases (CAT). However, CAT activity has so far not been described for bacterial aminotransferases (AT), and it was unknown whether they can be applied for the conversion of cysteine to 3MPy. In this study, we selected eight bacterial aminotransferases based on sequence homology to CAT of Rattus norvegicus (Got1). The aminotransferases included four aspartate aminotransferases (AATs) and four aromatic amino acid aminotransferases (ArATs) from Advenella mimigardefordensis DPN7, Escherichia coli MG1655, Shimwellia blattae ATCC 33430, Ralstonia eutropha H16 and Paracoccus denitrificans PD1222. For a more detailed characterization, all selected AAT or ArAT encoding genes were heterologously expressed in E. coli and purified. CAT activity was detected for all aminotransferases when a novel continuous coupled enzyme assay was applied. Kinetic studies revealed the highest catalytic efficiency of 5.1mM/s for AAT from A. mimigardefordensis. Formation of 3MPy from cysteine could additionally be verified by an optimized approach using derivatization of 3MPy with the Girard T reagent and liquid chromatography-mass spectrometry analyses.

  2. Bacterial conversion of phenylalanine and aromatic carboxylic acids into dihydrodiols.

    PubMed Central

    Wegst, W; Tittmann, U; Eberspächer, J; Lingens, F

    1981-01-01

    Strain E of chloridazon-degrading bacteria, when grown on L-phenylalanine accumulates cis-2,3-dihydro-2,3-dihydroxyphenylalanine. In experiments with resting cells and during growth the bacterium converts the aromatic carboxylic acids phenylacetate, phenylpropionate, phenylbutyrate and phenyl-lactate into the corresponding cis-2,3-dihydrodiol compounds. The amino acids L-phenylalanine, N-acetyl-L-phenylalanine and t-butyloxycarbonyl-L-phenylalanine were also transformed into dihydrodiols. All seven dihydrodiols, thus obtained, were characterized both by conventional analytical techniques and by the ability to serve as substrates for a cis-dihydrodiol dehydrogenase. PMID:7306016

  3. Bacterial conversion of phenylalanine and aromatic carboxylic acids into dihydrodiols.

    PubMed

    Wegst, W; Tittmann, U; Eberspächer, J; Lingens, F

    1981-03-15

    Strain E of chloridazon-degrading bacteria, when grown on L-phenylalanine accumulates cis-2,3-dihydro-2,3-dihydroxyphenylalanine. In experiments with resting cells and during growth the bacterium converts the aromatic carboxylic acids phenylacetate, phenylpropionate, phenylbutyrate and phenyl-lactate into the corresponding cis-2,3-dihydrodiol compounds. The amino acids L-phenylalanine, N-acetyl-L-phenylalanine and t-butyloxycarbonyl-L-phenylalanine were also transformed into dihydrodiols. All seven dihydrodiols, thus obtained, were characterized both by conventional analytical techniques and by the ability to serve as substrates for a cis-dihydrodiol dehydrogenase.

  4. Induced drought tolerance through wild and mutant bacterial strain Pseudomonas simiae in mung bean (Vigna radiata L.).

    PubMed

    Kumari, Sarita; Vaishnav, Anukool; Jain, Shekhar; Varma, Ajit; Choudhary, Devendra Kumar

    2016-01-01

    The present study focused on the overproducing mutant of a plant growth promoting rhizobacterium (PGPR) Pseudomonas simiae strain AU (MTCC-12057) for significant drought tolerance in mung bean plants. Five mutants namely AU-M1, AU-M2, AU-M3, AU-M4 and AU-M5 were made after treatment of wild type strain with N-methyl-N-nitro-N-nitrosoguanidine. Mutant strain AU-M4 was recorded for enhanced ACC deaminase (ACC-D) activity, indole acetic acid (IAA) production and inorganic phosphate (Pi) solubilization compared to wild strain and other four mutant strains under drought condition. AU-M4 showed higher phosphate solubilization index (8.17) together with higher ACC-D activity (98 nmol/mg/h) and IAA concentration (69.35 µg/ml) compared with the wild type P. simiae strain AU ACC-D activity (79 nmol/mg/h) and IAA concentration (38.98 µg/ml) respectively. In this report, we investigated the effect of both wild and mutant type bacterial strain on mung bean plants under drought stress. Results showed that mutant AU-M4 and wild type strain AU inoculated plants exhibited superior tolerance against drought stress, as shown by their enhanced plant biomass (fresh weight), higher water content, higher proline accumulation and lower osmotic stress injury. Mutant AU-M4 and wild strain AU inoculated plants reduced the ethylene level by 59 and 45% respectively, compared to the control under stress condition. Furthermore, bacterial inoculated plants showed enhanced induced systemic drought tolerance by reducing stomata size and net photosynthesis resulting higher water content in mung bean plants that may help in survival of plants during drought condition. To mitigate the effects of drought stress, use of PGPR will be needed to ensure sufficient production of food from crop plants. Taking current leads available, concerted future research is needed in this area, particularly on field evaluation with application of potential microorganisms.

  5. Biological control of bacterial wilt in Arabidopsis thaliana involves abscissic acid signalling.

    PubMed

    Feng, Dong Xin; Tasset, Céline; Hanemian, Mathieu; Barlet, Xavier; Hu, Jian; Trémousaygue, Dominique; Deslandes, Laurent; Marco, Yves

    2012-06-01

    Means to control bacterial wilt caused by the phytopathogenic root bacteria Ralstonia solanacearum are limited. Mutants in a large cluster of genes (hrp) involved in the pathogenicity of R. solanacearum were successfully used in a previous study as endophytic biocontrol agents in challenge inoculation experiments on tomato. However, the molecular mechanisms controlling this resistance remained unknown. We developed a protection assay using Arabidopsis thaliana as a model plant and analyzed the events underlying the biological control by genetic, transcriptomic and molecular approaches. High protection rates associated with a significant decrease in the multiplication of R. solanacearum were observed in plants pre-inoculated with a ΔhrpB mutant strain. Neither salicylic acid, nor jasmonic acid/ethylene played a role in the establishment of this resistance. Microarray analysis showed that 26% of the up-regulated genes in protected plants are involved in the biosynthesis and signalling of abscissic acid (ABA). In addition 21% of these genes are constitutively expressed in the irregular xylem cellulose synthase mutants (irx), which present a high level of resistance to R. solanacearum. We propose that inoculation with the ΔhrpB mutant strain generates a hostile environment for subsequent plant colonization by a virulent strain of R. solanacearum.

  6. An integrated metagenomics pipeline for strain profiling reveals novel patterns of bacterial transmission and biogeography

    PubMed Central

    Nayfach, Stephen; Rodriguez-Mueller, Beltran; Garud, Nandita

    2016-01-01

    We present the Metagenomic Intra-species Diversity Analysis System (MIDAS), which is an integrated computational pipeline for quantifying bacterial species abundance and strain-level genomic variation, including gene content and single-nucleotide polymorphisms (SNPs), from shotgun metagenomes. Our method leverages a database of more than 30,000 bacterial reference genomes that we clustered into species groups. These cover the majority of abundant species in the human microbiome but only a small proportion of microbes in other environments, including soil and seawater. We applied MIDAS to stool metagenomes from 98 Swedish mothers and their infants over one year and used rare SNPs to track strains between hosts. Using this approach, we found that although species compositions of mothers and infants converged over time, strain-level similarity diverged. Specifically, early colonizing bacteria were often transmitted from an infant’s mother, while late colonizing bacteria were often transmitted from other sources in the environment and were enriched for spore-formation genes. We also applied MIDAS to 198 globally distributed marine metagenomes and used gene content to show that many prevalent bacterial species have population structure that correlates with geographic location. Strain-level genetic variants present in metagenomes clearly reveal extensive structure and dynamics that are obscured when data are analyzed at a coarser taxonomic resolution. PMID:27803195

  7. Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco.

    PubMed

    Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Juergen

    2013-11-01

    Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance.

  8. Isolation of bacterial strains from bovine fecal microflora capable of degradation of ceftiofur.

    PubMed

    Rafii, Fatemeh; Williams, Anna J; Park, Miseon; Sims, Lillie M; Heinze, Thomas M; Cerniglia, Carl E; Sutherland, John B

    2009-10-20

    Ceftiofur, a third-generation cephalosporin used to treat bacterial infections in animals, is degraded in bovine feces but the specific bacteria involved are unknown. To find the bacteria involved in ceftiofur metabolism, the bovine fecal microflora was screened. Twenty-one nonidentical strains of bovine fecal bacteria were isolated on media containing 1-32 microg ml(-1) of ceftiofur. The cultures were incubated with 5 microg ml(-1) ceftiofur for different times, then centrifuged and analyzed by high-performance liquid chromatography. Three strains of Bacillus spp., two strains of Roseomonas spp., and one strain of Azospirillum sp. metabolized 5 microg ml(-1) ceftiofur in broth cultures in less than 24h; ten other strains of Roseomonas and one strain of Bacillus pumilus had metabolized it by 120 h. After the ceftiofur had been metabolized by these bacteria, the filter-sterilized supernatants of centrifuged cultures no longer inhibited the growth of a ceftiofur-sensitive strain of Kocuria rhizophila, which indicated that ceftiofur had been transformed to compounds without bactericidal activity. Each isolate was also found to be able to grow in the presence of other beta-lactams, and a nitrocefin assay showed beta-lactamase activity in the 17 strains that metabolized ceftiofur. The results show that some beta-lactamase-producing bacteria from the bovine fecal microflora are capable of transforming ceftiofur to metabolites lacking bactericidal activity.

  9. A preliminary report of phylogenetic diversity of bacterial strains isolated from marine creatures.

    PubMed

    Kurahashi, Midori; Yokota, Akira

    2002-10-01

    Bacterial diversity among marine creatures, especially molluscs, as a source for searching out novel lineages of bacteria, was studied. Marine creatures were collected at the coasts of the Kanto area in Japan. A total of 116 strains of bacteria were isolated from the intestines of 19 species of marine creatures includings molluscs, pisces and protochordata. Partial sequencing of 16S rDNA revealed that most of the isolates belonged to the gamma subclass of the Proteobacteria and Cytophaga-Flavobacterium-Bacteroides group. The BLAST searches revealed that the complete 16S rDNA sequence of 17 strains out of 116 isolates showed less than 94% similarity with 16S rDNA sequences deposited in the database. Four strains out of the 17 isolates belonged to the Rhodobacter group, 8 strains to the Alteromonas group, and the remaining 5 strains to the Cytophaga-Flavobacterium-Bacteroides group. Phylogenetic positions of 6 strains belonging to the Alteromonas group, which were isolated from different marine creatures, were close to each other, and represented a novel 16S rDNA lineage within the gamma subclass of Proteobacteria. Therefore, it may be inferred that these 6 strains belong to a new genus of Proteobacteria. Phylogenetic positions of the other strains are also independent from neighboring taxa, and they were suggested to respectively form a novel lineage. From these results, it is clear that the biodiversity of bacteria in marine creatures is much wider than was previously thought, and unknown microbiological resources are buried in these organisms.

  10. Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt

    PubMed Central

    2012-01-01

    In the present study, two of the most toxic bacterial strains of Bacillus sphaericus against mosquito were identified with the most recent genetic techniques. The PCR product profiles indicated the presence of genes encoding Bin A, Bin B and Mtx1 in all analyzed strains; they are consistent with protein profiles. The preliminary bioinformatics analysis of the binary toxin genes sequence revealed that the open reading frames had high similarities when matched with nucleotides sequence in the database of other B. sphaericus strains. The biological activity of B. sphaericus strains varied according to growing medium, and cultivation time. The highest yield of viable counts, spores and larvicidal protein were attained after 5 days. Poly (P) medium achieved the highest yield of growth, sporulation, protein and larvicidal activity for all tested strains compared to the other tested media. The larvicidal protein produced by local strains (B. sphaericus EMCC 1931 and EMCC 1932) in P medium was more lethal against the 3rd instar larvae of Culex pipiens than that of reference strains (B. sphaericus 1593 and B. sphaericus 2297). The obtained results revealed that P medium was the most effective medium and will be used in future work in order to optimize large scale production of biocide by the locally isolated Bacillus sphaericus strains. PMID:22280528

  11. Comparison of two multimetal resistant bacterial strains: Enterobacter sp. YSU and Stenotrophomonas maltophilia ORO2.

    PubMed

    Holmes, Andrew; Vinayak, Anubhav; Benton, Cherise; Esbenshade, Aaron; Heinselman, Carlisle; Frankland, Daniel; Kulkarni, Samatha; Kurtanich, Adrienne; Caguiat, Jonathan

    2009-11-01

    The Y-12 plant in Oak Ridge, TN, which manufactured nuclear weapons during World War II and the Cold War, contaminated East Fork Poplar Creek with heavy metals. The multimetal resistant bacterial strain, Stenotrophomonas maltophilia Oak Ridge strain O2 (S. maltophilia O2), was isolated from East Fork Poplar Creek. Sequence analysis of 16s rDNA suggested that our working strain of S. maltophilia O2 was a strain of Enterobacter. Phylogenetic tree analysis and biochemical tests confirmed that it belonged to an Enterobacter species. This new strain was named Enterobacter sp. YSU. Using a modified R3A growth medium, R3A-Tris, the Hg(II), Cd(II), Zn(II), Cu(II), Au(III), Cr(VI), Ag(I), As(III), and Se(IV) MICs for a confirmed strain of S. maltophilia O2 were 0.24, 0.33, 5, 5, 0.25, 7, 0.03, 14, and 40 mM, respectively, compared to 0.07, 0.24, 0.8, 3, 0.05, 0.4, 0.08, 14, and 40 mM, respectively, for Enterobacter sp. YSU. Although S. maltophilia O2 was generally more metal resistant than Enterobacter sp. YSU, in comparison to Escherichia coli strain HB101, Enterobacter sp. YSU was resistant to Hg(II), Cd(II), Zn(II), Au(III), Ag(I), As(III), and Se(IV). By studying metal resistances in these two strains, it may be possible to understand what makes one microorganism more metal resistant than another microorganism. This work also provided benchmark MICs that can be used to evaluate the metal resistance properties of other bacterial isolates from East Fork Poplar Creek and other metal contaminated sites.

  12. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family*

    PubMed Central

    Broussard, Tyler C.; Miller, Darcie J.; Jackson, Pamela; Nourse, Amanda; White, Stephen W.; Rock, Charles O.

    2016-01-01

    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

  13. Production of thermostable protease enzyme in wastewater sludge using thermophilic bacterial strains isolated from sludge.

    PubMed

    Chenel, J P; Tyagi, R D; Surampalli, R Y

    2008-01-01

    The volume of sludge produced annually is very high and poses serious disposal problems. The traditional methods of sludge disposal produce secondary pollutants. Therefore, the alternate or suitable solution is reuse of sludge in an ecofriendly approach. Biotechnology is an interesting tool to add value to the processes involved in wastewater and wastewater sludge disposal/reuse. In this context, a study was carried out on thermophilic bacterial strains that produce thermostable proteases. The bacterial strains were first isolated from municipal wastewater sludge. In contrast to the conventional strains used in industries, like Bacillus sp., the new strains were Gram-Negative type. In semi-synthetic medium, a maximal protease activity of 5.25 IU/ml (International Unit per ml) was obtained at a pH of 8.2 and at a temperature of 60 degrees C, which is higher than the stability temperature of 37 degrees C for a similar protease obtained from the conventional producer Bacillus licheniformis. Moreover, growth and protease activity of the strains were tested in wastewater sludge. It is expected that the complexity of sludge could stimulate/enhance the protease production and their characteristics. In conclusion, reuse of wastewater sludge will help to reduce their quantity as well as the value-added products produced will replace chemical products used in industries.

  14. A comparison of three bacterial strains for the remediation of town gas soils

    SciTech Connect

    Sauer, N.E.; Akkineni, D.K.; Cutright, T.J.

    1995-12-31

    The contamination of soils from polycyclic aromatic hydrocarbons (PAHs) is widespread. Although PAH contamination still occurs from current industrial processes, accidental spills, and leaking underground storage tanks, the main source of contamination is from abandoned town gas sites. To date there is a conservative estimate of 2500 town gas sites that require remediation. The most cost effective in-situ treatment for these sites is that of bioremediation. Experiments were conducted to compare the efficiencies of three bacterial strains for the remediation of an industrially PAH contaminated soil. Specifically, the efficiencies of Achromobacter sp., Mycobacterium sp., and Nocardia paraffinae were investigated. This paper will address the chemical specificity of each bacterial strains for the PAHs present.

  15. Bacterial Cellulose Production by Acetobacter xylinum Strains from Agricultural Waste Products

    NASA Astrophysics Data System (ADS)

    Kongruang, Sasithorn

    Bacterial cellulose is a biopolysaccharide produced from the bacteria, Acetobacter xylinum. Static batch fermentations for bacterial cellulose production were studied in coconut and pineapple juices under 30 °C in 5-1 fermenters by using three Acetobacter strains: A. xylinum TISTR 998, A. xylinum TISTR 975, and A. xylinum TISTR 893. Experiments were carried out to compare bacterial cellulose yields along with growth kinetic analysis. Results showed that A. xylinum TISTR 998 produced a bacterial cellulose yield of 553.33 g/l, while A. xylinum TISTR 893 produced 453.33 g/l and A. xylinum TISTR 975 produced 243.33 g/l. In pineapple juice, the yields for A. xylinum TISTR 893, 975, and 998 were 576.66, 546.66, and 520 g/l, respectively. The strain TISTR 998 showed the highest productivity when using coconut juice. Morphological properties of cellulose pellicles, in terms of texture and color, were also measured, and the textures were not significantly different among treatments.

  16. Reduction of pollutants in pulp paper mill effluent treated by PCP-degrading bacterial strains.

    PubMed

    Chandra, Ram; Raj, Abhay; Yadav, Sangeeta; Patel, Devendra Kumar

    2009-08-01

    Two PCP-degrading bacterial strains, Bacillus cereus (ITRC-S6) and Serratia marcescens (ITRC-S7) were used for the treatment of pulp and paper mill effluent at conditions; 1.0% glucose and 0.5% peptone at 30 +/- 1 degrees C at 120 rpm for 168 h of incubation. These two bacterial strains effectively reduced colour (45-52%), lignin (30-42%), BOD (40-70%), COD (50-60%), total phenol (32-40%) and PCP (85-90%) within 168 h of incubation. However, the highest reduction in colour (62%), lignin (54%), BOD (70%), COD (90%), total phenol (90%) and PCP (100%) was recorded by mixed culture treatment. The bacterial mechanism for the degradation of pulp and paper mill effluent may be explained by an increase in the cells biomass using added co-substrates resulting liberation of significant amount of chloride due to bacterial dechlorination of chlorolignins and chlorophenols this showed reduction in colour, lignin and toxicity in the effluent. Further, GC-MS analysis of ethyl acetate-extractable compounds from treated pulp paper mill effluent reinforces the bacterium capability for the degradation of lignin and pentachlorophenol, as many aromatic compounds such as 2-chlorophenol, 2, 4, 6-trichlorophenol and tetrachlorohydroquinone, 6-chlorohydroxyquinol and tetrachlorohydroquinone detected which were not present in the untreated effluent.

  17. Synergistic efficacy of Bisbenzimidazole and Carbonyl Cyanide 3-Chlorophenylhydrazone combination against MDR bacterial strains

    PubMed Central

    Sinha, Devapriya; Pandey, Stuti; Singh, Raja; Tiwari, Vinod; Sad, Kirti; Tandon, Vibha

    2017-01-01

    Activation of efflux systems and the formation of biofilm are majorly adapted by microbes to resist antimicrobial agents. PPEF (bisbenzimidazole) targeting topoisomerase IA is observed to be an effective bactericidal agent against both Gram-positive and Gram-negative bacterial strains and thus can be developed as potent broad-spectrum antibiotic against MDR strains. PPEF treatment did not cause target specific mutation instead it leads to up-regulation of efflux gene in E. coli K12 as a mechanism of resistance. Microscopy, fluorescence spectroscopy and flow cytometry result demonstrate higher accumulation of PPEF in efflux gene deleted E. coli K12 mutants, and also suggest that Carbonyl Cyanide 3-Chlorophenylhydrazone (CCCP), resist the efflux of PPEF, and thus increases efficacy of PPEF. Herein, we report, PPEF and CCCP synergistically killed the persistent bacterial cells, which are not killed by PPEF alone. The above two compounds together inhibited biofilm formation, eradicate preformed biofilms and kills the biofilm cells of P. aeruginosa. PPEF and CCCP together reduced bacterial load of E. coli ATCC25922 by 6 log10 in neutropenic thigh infection model of balb/c mice. Present study suggests that combination therapy could be a promising antimicrobial strategy to handle MDR pathogenic strains. PMID:28303897

  18. Biological treatment of tannery wastewater by using salt-tolerant bacterial strains

    PubMed Central

    Sivaprakasam, Senthilkumar; Mahadevan, Surianarayanan; Sekar, Sudharshan; Rajakumar, Susheela

    2008-01-01

    Background High salinity (1–10% w/v) of tannery wastewater makes it difficult to be treated by conventional biological treatment. Salt tolerant microbes can adapt to these saline conditions and degrade the organics in saline wastewater. Results Four salt tolerant bacterial strains isolated from marine and tannery saline wastewater samples were identified as Pseudomonas aeruginosa, Bacillus flexus, Exiguobacterium homiense and Staphylococcus aureus. Growth factors of the identified strains were optimized. Tannery saline wastewater obtained from a Common Effluent Treatment Plant (CETP) near Chennai (southern India) was treated with pure and mixed consortia of four salt tolerant bacterial strains. Experiments with optimized conditions and varying salt content (between 2 and 10% (w/v) were conducted. Salt inhibition effects on COD removal rate were noted. Comparative analysis was made by treating the tannery saline wastewater with activated sludge obtained from CETP and with natural habitat microbes present in raw tannery saline wastewater. Conclusion Salt tolerant bacterial mixed consortia showed appreciable biodegradation at all saline concentrations (2%, 4%, 6%, 8% and 10% w/v) with 80% COD reduction in particular at 8% salinity level the consortia could be used as suitable working cultures for tannery saline wastewater treatment. PMID:18445252

  19. Effect of Nalidixic Acid and Hydroxyurea on Division Ability of Escherichia coli fil+ and lon− Strains

    PubMed Central

    Kantor, George J.; Deering, R. A.

    1968-01-01

    Short periods of incubation in medium containing nalidixic acid or hydroxyurea, followed by a return to normal growth conditions, induced filament formation in Escherichia coli B (fil+) and AB1899NM (lon−) but not in B/r (fil−) and AB1157 (lon+). These drugs reversibly stopped deoxyribonucleic acid (DNA) synthesis with little or no effect on ribonucleic acid (RNA) synthesis or mass increase. The initial imbalance caused by incubation in these drugs was the same for B and B/r as was macromolecular synthesis following a return to normal growth conditions. DNA degradation caused by nalidixic acid was measured and found to be the same for B and B/r. Hydroxyurea caused no DNA degradation in these two strains. Survival curves as determined under various conditions by colony formation suggested that the property of filament formation was responsible for the extrasensitivity of fil+ and lon− strains to either nalidixic acid or hydroxyurea. E. coli B was more sensitive to either drug than was B/r or Bs-1. Pantoyl lactone or liquid holding treatment aided division and colony formation of nalidixic acid-treated B but had no effect on B/r. Likewise, the filament-former AB1899NM was more sensitive to nalidixic acid than was the non-filament-former AB1157. The sensitivity of B/r and Bs-1 to nalidixic acid was nearly the same except at longer times in nalidixic acid, when Bs-1 appeared more resistant. Even though nalidixic acid, hydroxyurea, and ultraviolet light may produce quite different molecular alterations in E. coli, they all cause a metabolic imbalance resulting in a lowered ratio of DNA to RNA and protein. We propose that it is this imbalance per se rather than any specific primary chemical or photochemical alterations which leads to filament formation by some genetically susceptible bacterial strains such as lon− and fil+. PMID:4867744

  20. Sequence analysis of pooled bacterial samples enables identification of strain variation in group A streptococcus

    PubMed Central

    Weldatsadik, Rigbe G.; Wang, Jingwen; Puhakainen, Kai; Jiao, Hong; Jalava, Jari; Räisänen, Kati; Datta, Neeta; Skoog, Tiina; Vuopio, Jaana; Jokiranta, T. Sakari; Kere, Juha

    2017-01-01

    Knowledge of the genomic variation among different strains of a pathogenic microbial species can help in selecting optimal candidates for diagnostic assays and vaccine development. Pooled sequencing (Pool-seq) is a cost effective approach for population level genetic studies that require large numbers of samples such as various strains of a microbe. To test the use of Pool-seq in identifying variation, we pooled DNA of 100 Streptococcus pyogenes strains of different emm types in two pools, each containing 50 strains. We used four variant calling tools (Freebayes, UnifiedGenotyper, SNVer, and SAMtools) and one emm1 strain, SF370, as a reference genome. In total 63719 SNPs and 164 INDELs were identified in the two pools concordantly by at least two of the tools. Majority of the variants (93.4%) from six individually sequenced strains used in the pools could be identified from the two pools and 72.3% and 97.4% of the variants in the pools could be mined from the analysis of the 44 complete Str. pyogenes genomes and 3407 sequence runs deposited in the European Nucleotide Archive respectively. We conclude that DNA sequencing of pooled samples of large numbers of bacterial strains is a robust, rapid and cost-efficient way to discover sequence variation. PMID:28361960

  1. In vivo selection to identify bacterial strains with enhanced ecological performance in synbiotic applications.

    PubMed

    Krumbeck, Janina A; Maldonado-Gomez, María X; Martínez, Inés; Frese, Steven A; Burkey, Thomas E; Rasineni, Karuna; Ramer-Tait, Amanda E; Harris, Edward N; Hutkins, Robert W; Walter, Jens

    2015-04-01

    One strategy for enhancing the establishment of probiotic bacteria in the human intestinal tract is via the parallel administration of a prebiotic, which is referred to as a synbiotic. Here we present a novel method that allows a rational selection of putative probiotic strains to be used in synbiotic applications: in vivo selection (IVS). This method consists of isolating candidate probiotic strains from fecal samples following enrichment with the respective prebiotic. To test the potential of IVS, we isolated bifidobacteria from human subjects who consumed increasing doses of galactooligosaccharides (GOS) for 9 weeks. A retrospective analysis of the fecal microbiota of one subject revealed an 8-fold enrichment in Bifidobacterium adolescentis strain IVS-1 during GOS administration. The functionality of GOS to support the establishment of IVS-1 in the gastrointestinal tract was then evaluated in rats administered the bacterial strain alone, the prebiotic alone, or the synbiotic combination. Strain-specific quantitative real-time PCR showed that the addition of GOS increased B. adolescentis IVS-1 abundance in the distal intestine by nearly 2 logs compared to rats receiving only the probiotic. Illumina 16S rRNA sequencing not only confirmed the increased establishment of IVS-1 in the intestine but also revealed that the strain was able to outcompete the resident Bifidobacterium population when provided with GOS. In conclusion, this study demonstrated that IVS can be used to successfully formulate a synergistic synbiotic that can substantially enhance the establishment and competitiveness of a putative probiotic strain in the gastrointestinal tract.

  2. In Vivo Selection To Identify Bacterial Strains with Enhanced Ecological Performance in Synbiotic Applications

    PubMed Central

    Krumbeck, Janina A.; Maldonado-Gomez, María X.; Martínez, Inés; Frese, Steven A.; Burkey, Thomas E.; Rasineni, Karuna; Ramer-Tait, Amanda E.; Harris, Edward N.; Hutkins, Robert W.

    2015-01-01

    One strategy for enhancing the establishment of probiotic bacteria in the human intestinal tract is via the parallel administration of a prebiotic, which is referred to as a synbiotic. Here we present a novel method that allows a rational selection of putative probiotic strains to be used in synbiotic applications: in vivo selection (IVS). This method consists of isolating candidate probiotic strains from fecal samples following enrichment with the respective prebiotic. To test the potential of IVS, we isolated bifidobacteria from human subjects who consumed increasing doses of galactooligosaccharides (GOS) for 9 weeks. A retrospective analysis of the fecal microbiota of one subject revealed an 8-fold enrichment in Bifidobacterium adolescentis strain IVS-1 during GOS administration. The functionality of GOS to support the establishment of IVS-1 in the gastrointestinal tract was then evaluated in rats administered the bacterial strain alone, the prebiotic alone, or the synbiotic combination. Strain-specific quantitative real-time PCR showed that the addition of GOS increased B. adolescentis IVS-1 abundance in the distal intestine by nearly 2 logs compared to rats receiving only the probiotic. Illumina 16S rRNA sequencing not only confirmed the increased establishment of IVS-1 in the intestine but also revealed that the strain was able to outcompete the resident Bifidobacterium population when provided with GOS. In conclusion, this study demonstrated that IVS can be used to successfully formulate a synergistic synbiotic that can substantially enhance the establishment and competitiveness of a putative probiotic strain in the gastrointestinal tract. PMID:25616794

  3. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  4. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  5. Production and Reutilization of Fluorescent Dissolved Organic Matter by a Marine Bacterial Strain, Alteromonas macleodii

    PubMed Central

    Goto, Shuji; Tada, Yuya; Suzuki, Koji; Yamashita, Youhei

    2017-01-01

    The recalcitrant fraction of marine dissolved organic matter (DOM) plays an important role in carbon storage on the earth’s surface. Bacterial production of recalcitrant DOM (RDOM) has been proposed as a carbon sequestration process. It is still unclear whether bacterial physiology can affect RDOM production. In this study, we conducted a batch culture using the marine bacterial isolate Alteromonas macleodii, a ubiquitous gammaproteobacterium, to evaluate the linkage between bacterial growth and DOM production. Glucose (1 mmol C L-1) was used as the sole carbon source, and the bacterial number, the DOM concentration in terms of carbon, and the excitation–emission matrices (EEMs) of DOM were monitored during the 168-h incubation. The incubation period was partitioned into the exponential growth (0–24 h) and stationary phases (24–168 h) based on the growth curve. Although the DOM concentration decreased during the exponential growth phase due to glucose consumption, it remained stable during the stationary phase, corresponding to approximately 4% of the initial glucose in terms of carbon. Distinct fluorophores were not evident in the EEMs at the beginning of the incubation, but DOM produced by the strain exhibited five fluorescent peaks during exponential growth. Two fluorescent peaks were similar to protein-like fluorophores, while the others could be categorized as humic-like fluorophores. All fluorophores increased during the exponential growth phase. The tryptophan-like fluorophore decreased during the stationary phase, suggesting that the strain reused the large exopolymer. The tyrosine-like fluorophore seemed to be stable during the stationary phase, implying that the production of tyrosine-containing small peptides through the degradation of exopolymers was correlated with the reutilization of the tyrosine-like fluorophore. Two humic-like fluorophores that showed emission maxima at the longer wavelength (525 nm) increased during the stationary phase

  6. Characterization of certain bacterial strains for potential use as starter or probiotic cultures in dairy products.

    PubMed

    Monteagudo-Mera, A; Caro, I; Rodríguez-Aparicio, L B; Rúa, J; Ferrero, M A; García-Armesto, M R

    2011-08-01

    The present work was aimed at characterizing 12 strains of lactic acid bacteria (LAB) to obtain improved potential starter or probiotic cultures that could be used for making dairy products from ewe's milk and cow's milk. Eight strains with antimicrobial properties, isolated from ewe's milk and from cheese made from ewe's and/or cow's milk, were studied. They were identified as Enterococcus faecalis (five strains), Lactococcus lactis subsp. cremoris, Leuconostoc mesenteroides, and Lactobacillus paracasei subsp. paracasei (one strain of each species). Additionally, four strains were obtained from the American Type Culture Collection: Lactobacillus casei 393 (isolated from cheese), L. lactis subsp. lactis 11454 (origin nonspecified and a producer of nisin), and two strains isolated from human feces (L. paracasei subsp. paracasei 27092 and Lactobacillus rhamnosus 53103, antibacterial agent producer). All E. faecalis strains showed at least one virulence factor (either hemolysin or gelatinase), which emphasizes the importance of these studies in this species. Both L. lactis strains and most Lactobacillus spp. were good acidifiers in ewe's milk and cow's milk at 30°C. High β-galactosidase activity, as well as aminopeptidase activities that favor the development of desirable flavors in cheese, were detected in all Lactobacillus spp. strains. Furthermore, L. rhamnosus ATCC 53103 showed α-fucosidase activity (thought to help colonization of the intestine) and lack of α-glucosidase activity (a trait considered positive for diabetic and obese humans). This last enzymatic activity was also lacking in L. lactis ATCC 11454. L. mesenteroides was the only strain D(2)-lactic acid producer. The selection of any particular strain for probiotic or dairy cultures should be performed according to the technological and/or functional abilities needed.

  7. Screening of species-specific lactic acid bacteria for veal calves multi-strain probiotic adjuncts.

    PubMed

    Ripamonti, Barbara; Agazzi, Alessandro; Bersani, Carla; De Dea, Paola; Pecorini, Chiara; Pirani, Silvia; Rebucci, Raffaella; Savoini, Giovanni; Stella, Simone; Stenico, Alberta; Tirloni, Erica; Domeneghini, Cinzia

    2011-06-01

    The selection of promising specific species of lactic acid bacteria with potential probiotic characteristics is of particular interest in producing multi species-specific probiotic adjuncts in veal calves rearing. The aim of the present work was to select and evaluate in vitro the functional activity of lactic acid bacteria, Bifidobacterium longum and Bacillus coagulans strains isolated from veal calves in order to assess their potential use as multi species-specific probiotics for veal calves. For this purpose, bacterial strains isolated from faeces collected from 40 healthy 50-day-calves, were identified by RiboPrinter and 16s rRNA gene sequence. The most frequent strains belonged to the species B. longum, Streptococcus bovis, Lactobacillus animalis and Streptococcus macedonicus. Among these, 7 strains were chosen for testing their probiotic characteristics in vitro. Three strains, namely L. animalis SB310, Lactobacillus paracasei subsp. paracasei SB137 and B. coagulans SB117 showed varying individual but promising capabilities to survive in the gastrointestinal tract, to adhere, to produce antimicrobial compounds. These three selected species-specific bacteria demonstrated in vitro, both singularly and mixed, the functional properties needed for their use as potential probiotics in veal calves.

  8. Engineering of bacterial strains and vectors for the production of plasmid DNA.

    PubMed

    Bower, Diana M; Prather, Kristala L J

    2009-04-01

    The demand for plasmid DNA (pDNA) is anticipated to increase significantly as DNA vaccines and non-viral gene therapies enter phase 3 clinical trials and are approved for use. This increased demand, along with renewed interest in pDNA as a therapeutic vector, has motivated research targeting the design of high-yield, cost-effective manufacturing processes. An important aspect of this research is engineering bacterial strains and plasmids that are specifically suited to the production of plasmid biopharmaceuticals. This review will survey recent innovations in strain and vector engineering that aim to improve plasmid stability, enhance product safety, increase yield, and facilitate downstream purification. While these innovations all seek to enhance pDNA production, they can vary in complexity from subtle alterations of the host genome or vector backbone to the investigation of non-traditional host strains for higher pDNA yields.

  9. Draft Genome Sequence of Two Strains of Xanthomonas arboricola Isolated from Prunus persica Which Are Dissimilar to Strains That Cause Bacterial Spot Disease on Prunus spp.

    PubMed Central

    Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M.

    2016-01-01

    The draft genome sequences of two strains of Xanthomonas arboricola, isolated from asymptomatic peach trees in Spain, are reported here. These strains are avirulent and do not belong to the same phylogroup as X. arboricola pv. pruni, a causal agent of bacterial spot disease of stone fruits and almonds. PMID:27609931

  10. A role for coenzyme M (2-mercaptoethanesulfonic acid) in a bacterial pathway of aliphatic epoxide carboxylation

    PubMed Central

    Allen, Jeffrey R.; Clark, Daniel D.; Krum, Jonathan G.; Ensign, Scott A.

    1999-01-01

    The bacterial metabolism of short-chain aliphatic alkenes occurs via oxidation to epoxyalkanes followed by carboxylation to β-ketoacids. Epoxyalkane carboxylation requires four enzymes (components I–IV), NADPH, NAD+, and a previously unidentified nucleophilic thiol. In the present work, coenzyme M (2-mercaptoethanesulfonic acid), a compound previously found only in the methanogenic Archaea where it serves as a methyl group carrier and activator, has been identified as the thiol and central cofactor of aliphatic epoxide carboxylation in the Gram-negative bacterium Xanthobacter strain Py2. Component I catalyzed the addition of coenzyme M to epoxypropane to form a β-hydroxythioether, 2-(2-hydroxypropylthio)ethanesulfonate. Components III and IV catalyzed the NAD+-dependent stereoselective dehydrogenation of R- and S-enantiomers of 2-(2-hydroxypropylthio)ethanesulfonate to form 2-(2-ketopropylthio)ethanesulfonate. Component II catalyzed the NADPH-dependent cleavage and carboxylation of the β-ketothioether to form acetoacetate and coenzyme M. These findings evince a newfound versatility for coenzyme M as a carrier and activator of alkyl groups longer in chain-length than methane, a function for coenzyme M in a catabolic pathway of hydrocarbon oxidation, and the presence of coenzyme M in the bacterial domain of the phylogenetic tree. These results serve to unify bacterial and Archaeal metabolism further and showcase diverse biological functions for an elegantly simple organic molecule. PMID:10411892

  11. Antimicrobial Resistance and Plasmid Profile of Bacterial Strains Isolated from the Urbanized Eltsovka-1 River (Russia).

    PubMed

    Lobova, Tatiana I; Yemelyanova, Elena; Andreeva, Irina S; Puchkova, Larisa I; Repin, Vladimir Ye

    2015-08-01

    Antimicrobial resistance and plasmid profile of Gram-positive and Gram-negative bacterial strains isolated from the urbanized Eltsovka-1 River (Russia) were investigated. Sequencing of the 16S rRNA of of G+ strains showed 99-100% identity to that of Bacillus aerophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, Bacillus anthrancis, Bacillus barbaricus, Bacillus cereus, Bacillus flexus, Bacillus indriensis, Bacillus stratosphericus, Bacillus subtilis subsp. subtilis, Bacillus thuringiensis, Streptomyces albidoflavus, Streptomyces albus, Streptomyces exfoliatus, Streptomyces odorifer, and Streptomyces sampsonii. Sequencing of the 16S rRNA of G-strains was similar in 99-100% to that of Aeromonas bestiarum, Aeromonas encheleia, Aeromonas hydrophila, A. hydrophila subsp. anaerogenes, A. hydrophila subsp. dhakensis, Aeromonas media, Aeromonas molluscorum, Aeromonas popoffii, Aeromonas salmonicida subsp. masoucida, A. salmonicida subsp. pectinolytica, A. salmonicida subsp. salmonicida, Aeromonas punctata, Aeromonas sobria, and Shewanella putrefaciens. The highest percentage (88.4%) of strains was resistant to polymyxin B followed by 69% to lincomycin, 61.5% to benzilpenicillin, 57.7% to ampicillin, and 50% to carbenicillin. A low level of resistance (4%) was found to kanamycin (8%), to streptomycin (11.5%), to neomycin and tetracycline, and (15%) to erythromycin. No resistance was found to gentamycin, monomycin, and chloroamphenicol. The majority (80.7%) of strains was multidrug-resistant. Ninety-two percent of all strains carried plasmid DNA of various sizes.

  12. Development of unique bacterial strains for use as positive controls in the food microbiology testing laboratory.

    PubMed

    Blais, Burton W; Martinez-Perez, Amalia; Gauthier, Martine; Allain, Raymond; Pagotto, Franco; Tyler, Kevin

    2008-11-01

    Nalidixic acid-resistant (NalR) mutants of Salmonella enterica serovar Berta and Escherichia coli O157:H7 were derived from wild-type laboratory cultures to serve as distinguishable control strains for routine use in food microbiology testing programs. The prevalence of the NalR phenotype among different bacteria was verified using panels of related and unrelated strains with the ability to grow vigorously on plating media containing nalidixic acid, being restricted to the NalR mutants. The NalR phenotype was stable in both mutant strains over several generations in the absence of selective pressure and enabled their differentiation from wild-type bacteria on the basis of their ability to grow on plating media containing nalidixic acid. A similar approach for the development of a distinguishable Listeria monocytogenes control strain was not possible due to the inherent resistance of this organism to nalidixic acid. Instead, an L. monocytogenes isolate with rare genotypic and serologic features was identified as a possible candidate to serve as a unique and distinguishable positive control strain.

  13. Bacterial carbon-phosphorus lyase: products, rates, and regulation of phosphonic and phosphinic acid metabolism.

    PubMed Central

    Wackett, L P; Shames, S L; Venditti, C P; Walsh, C T

    1987-01-01

    Carbon-phosphorus bond cleavage activity, found in bacteria that utilize alkyl- and phenylphosphonic acids, has not yet been obtained in a cell-free system. Given this constraint, a systematic examination of in vivo C-P lyase activity has been conducted to develop insight into the C-P cleavage reaction. Six bacterial strains were obtained by enrichment culture, identified, and characterized with respect to their phosphonic acid substrate specificity. One isolate, Agrobacterium radiobacter, was shown to cleave the carbon-phosphorus bond of a wide range of substrates, including fosfomycin, glyphosate, and dialkyl phosphinic acids. Furthermore, this organism processed vinyl-, propenyl-, and propynylphosphonic acids, a previously uninvestigated group, to ethylene, propene, and propyne, respectively. A determination of product stoichiometries revealed that both C-P bonds of dimethylphosphinic acid are cleaved quantitatively to methane and, furthermore, that the extent of C-P bond cleavage correlated linearly with the specific growth rate for a range of substrates. The broad substrate specificity of Agrobacterium C-P lyase and the comprehensive characterization of the in vivo activity make this an attractive system for further biochemical and mechanistic experiments. In addition, the failure to observe the activity in a group of gram-positive bacteria holds open the possibility that a periplasmic component may be required for in vivo expression of C-P lyase activity. PMID:3804975

  14. Rhizospheric Bacterial Strain Brevibacterium casei MH8a Colonizes Plant Tissues and Enhances Cd, Zn, Cu Phytoextraction by White Mustard

    PubMed Central

    Płociniczak, Tomasz; Sinkkonen, Aki; Romantschuk, Martin; Sułowicz, Sławomir; Piotrowska-Seget, Zofia

    2016-01-01

    Environmental pollution by heavy metals has become a serious problem in the world. Phytoextraction, which is one of the plant-based technologies, has attracted the most attention for the bioremediation of soils polluted with these contaminants. The aim of this study was to determine whether the multiple-tolerant bacterium, Brevibacterium casei MH8a isolated from the heavy metal-contaminated rhizosphere soil of Sinapis alba L., is able to promote plant growth and enhance Cd, Zn, and Cu uptake by white mustard under laboratory conditions. Additionally, the ability of the rifampicin-resistant spontaneous mutant of MH8a to colonize plant tissues and its mechanisms of plant growth promotion were also examined. In order to assess the ecological consequences of bioaugmentation on autochthonous bacteria, the phospholipid fatty acid (PLFA) analysis was used. The MH8a strain exhibited the ability to produce ammonia, 1-amino-cyclopropane-1-carboxylic acid deaminase, indole 3-acetic acid and HCN but was not able to solubilize inorganic phosphate and produce siderophores. Introduction of MH8a into soil significantly increased S. alba biomass and the accumulation of Cd (208%), Zn (86%), and Cu (39%) in plant shoots in comparison with those grown in non-inoculated soil. Introduced into the soil, MH8a was able to enter the plant and was found in the roots and leaves of inoculated plants thus indicating its endophytic features. PLFA analysis revealed that the MH8a that was introduced into soil had a temporary influence on the structure of the autochthonous bacterial communities. The plant growth-promoting features of the MH8a strain and its ability to enhance the metal uptake by white mustard and its long-term survival in soil as well as its temporary impact on autochthonous microorganisms make the strain a suitable candidate for the promotion of plant growth and the efficiency of phytoextraction. PMID:26909087

  15. Competitive ability and survival in soil of Pseudomonas strain 679-2, a dominant, nonobligate bacterial predator of bacteria

    SciTech Connect

    Casida, L.E. )

    1992-01-01

    A copper-resistant, nonobligate, bacterial predator of bacteria was isolated from soil. It was a Pseudomonas species, designated strain 679-2. It attacked most other nonobligate bacterial predators and hence could control their predatory and other activities in nature. It also inhibited various fungi. It attached to prey cells and produced a toxic, copper-related, growth initiation factor like that produced by Cupriavidus necator. In addition, it produced a second, novel compound that was both antibacterial and antifungal. Strain 679-2 appeared to have only a very limited natural occurrence. It was found only in the soil from one small area in one field. It was absent on the leaves of the plant species that were examined. An inoculum consisting of only a few cells added to soil multiplied rapidly to become a major component of the soil microflora within 24 h. A small amount of glutamic acid could be added along with the cells to stimulate production of the toxic compounds noted above, but this was not necessary. After this multiplication, or when large numbers of cells were added to soil, the numbers decreased only slowly during the next several months. Cell survival also was good on plant leaves. The survival in soil and on plant leaves occurred in both laboratory and field experiments. Other than desiccation, the natural mechanism for controlling the numbers or activities of strain 679-2 in soil is not known. The various characteristics of this bacterium, as noted above, are of particular interest because they indicate a possible use of the cells or inhibitor compounds for controlling organisms in soil or on plant surfaces.

  16. Cockroaches as a Source of High Bacterial Pathogens with Multidrug Resistant Strains in Gondar Town, Ethiopia

    PubMed Central

    Huruy, Kahsay; Muluye, Dagnachew; Feleke, Tigist; G/Silassie, Fisha; Ayalew, Getenet; Nagappan, Raja

    2016-01-01

    Background. Cockroaches are source of bacterial infections and this study was aimed to assess bacterial isolates and their antimicrobial profiles from cockroaches in Gondar town, Ethiopia. Methods. A total of 60 cockroaches were collected from March 1 to May 30, 2014, in Gondar town. Bacterial species were isolated from external and internal parts of cockroaches. Disk diffusion method was used to determine antibiotic susceptibility patterns. Data were entered and analyzed by using SPSS version 20; P values <0.005 were considered as statistically significant. Results. Of 181 identified bacteria species, 110 (60.8%) and 71 (39.2%) were identified from external and internal parts of cockroaches, respectively. Klebsiella pneumoniae 32 (17.7%), Escherichia coli 29 (16%), and Citrobacter spp. 27 (15%) were the predominant isolates. High resistance rate was observed to cotrimoxazole, 60 (33.1%), and least resistance rate was noted to ciprofloxacin, 2 (1.1%). Additionally, 116 (64.1%) of the isolates were MDR strains; Salmonella spp. were the leading MDR isolates (100%) followed by Enterobacter (90.5%) and Shigella spp. (76.9%). Conclusion. Cockroaches are the potential source of bacteria pathogens with multidrug resistant strains and hence effective preventive and control measures are required to minimize cockroach related infections. PMID:27340653

  17. Cockroaches as a Source of High Bacterial Pathogens with Multidrug Resistant Strains in Gondar Town, Ethiopia.

    PubMed

    Moges, Feleke; Eshetie, Setegn; Endris, Mengistu; Huruy, Kahsay; Muluye, Dagnachew; Feleke, Tigist; G/Silassie, Fisha; Ayalew, Getenet; Nagappan, Raja

    2016-01-01

    Background. Cockroaches are source of bacterial infections and this study was aimed to assess bacterial isolates and their antimicrobial profiles from cockroaches in Gondar town, Ethiopia. Methods. A total of 60 cockroaches were collected from March 1 to May 30, 2014, in Gondar town. Bacterial species were isolated from external and internal parts of cockroaches. Disk diffusion method was used to determine antibiotic susceptibility patterns. Data were entered and analyzed by using SPSS version 20; P values <0.005 were considered as statistically significant. Results. Of 181 identified bacteria species, 110 (60.8%) and 71 (39.2%) were identified from external and internal parts of cockroaches, respectively. Klebsiella pneumoniae 32 (17.7%), Escherichia coli 29 (16%), and Citrobacter spp. 27 (15%) were the predominant isolates. High resistance rate was observed to cotrimoxazole, 60 (33.1%), and least resistance rate was noted to ciprofloxacin, 2 (1.1%). Additionally, 116 (64.1%) of the isolates were MDR strains; Salmonella spp. were the leading MDR isolates (100%) followed by Enterobacter (90.5%) and Shigella spp. (76.9%). Conclusion. Cockroaches are the potential source of bacteria pathogens with multidrug resistant strains and hence effective preventive and control measures are required to minimize cockroach related infections.

  18. Identification of Electrode Respiring, Hydrocarbonoclastic Bacterial Strain Stenotrophomonas maltophilia MK2 Highlights the Untapped Potential for Environmental Bioremediation

    PubMed Central

    Venkidusamy, Krishnaveni; Megharaj, Mallavarapu

    2016-01-01

    Electrode respiring bacteria (ERB) possess a great potential for many biotechnological applications such as microbial electrochemical remediation systems (MERS) because of their exoelectrogenic capabilities to degrade xenobiotic pollutants. Very few ERB have been isolated from MERS, those exhibited a bioremediation potential toward organic contaminants. Here we report once such bacterial strain, Stenotrophomonas maltophilia MK2, a facultative anaerobic bacterium isolated from a hydrocarbon fed MERS, showed a potent hydrocarbonoclastic behavior under aerobic and anaerobic environments. Distinct properties of the strain MK2 were anaerobic fermentation of the amino acids, electrode respiration, anaerobic nitrate reduction and the ability to metabolize n-alkane components (C8–C36) of petroleum hydrocarbons (PH) including the biomarkers, pristine and phytane. The characteristic of diazoic dye decolorization was used as a criterion for pre-screening the possible electrochemically active microbial candidates. Bioelectricity generation with concomitant dye decolorization in MERS showed that the strain is electrochemically active. In acetate fed microbial fuel cells (MFCs), maximum current density of 273 ± 8 mA/m2 (1000 Ω) was produced (power density 113 ± 7 mW/m2) by strain MK2 with a coulombic efficiency of 34.8%. Further, the presence of possible alkane hydroxylase genes (alkB and rubA) in the strain MK2 indicated that the genes involved in hydrocarbon degradation are of diverse origin. Such observations demonstrated the potential of facultative hydrocarbon degradation in contaminated environments. Identification of such a novel petrochemical hydrocarbon degrading ERB is likely to offer a new route to the sustainable bioremedial process of source zone contamination with simultaneous energy generation through MERS. PMID:28018304

  19. Bacterial Utilization of L-sugars and D-amino Acids

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-01-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084

  20. Bacterial utilization of L-sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-08-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of

  1. Antimicrobial Activity of Monoramnholipids Produced by Bacterial Strains Isolated from the Ross Sea (Antarctica) †

    PubMed Central

    Tedesco, Pietro; Maida, Isabel; Palma Esposito, Fortunato; Tortorella, Emiliana; Subko, Karolina; Ezeofor, Chidinma Christiana; Zhang, Ying; Tabudravu, Jioji; Jaspars, Marcel; Fani, Renato; de Pascale, Donatella

    2016-01-01

    Microorganisms living in extreme environments represent a huge reservoir of novel antimicrobial compounds and possibly of novel chemical families. Antarctica is one of the most extraordinary places on Earth and exhibits many distinctive features. Antarctic microorganisms are well known producers of valuable secondary metabolites. Specifically, several Antarctic strains have been reported to inhibit opportunistic human pathogens strains belonging to Burkholderia cepacia complex (Bcc). Herein, we applied a biodiscovery pipeline for the identification of anti-Bcc compounds. Antarctic sub-sea sediments were collected from the Ross Sea, and used to isolate 25 microorganisms, which were phylogenetically affiliated to three bacterial genera (Psychrobacter, Arthrobacter, and Pseudomonas) via sequencing and analysis of 16S rRNA genes. They were then subjected to a primary cell-based screening to determine their bioactivity against Bcc strains. Positive isolates were used to produce crude extracts from microbial spent culture media, to perform the secondary screening. Strain Pseudomonas BNT1 was then selected for bioassay-guided purification employing SPE and HPLC. Finally, LC-MS and NMR structurally resolved the purified bioactive compounds. With this strategy, we achieved the isolation of three rhamnolipids, two of which were new, endowed with high (MIC < 1 μg/mL) and unreported antimicrobial activity against Bcc strains. PMID:27128927

  2. Adhesion of different bacterial strains to low-temperature plasma treated biomedical PVC catheter surfaces.

    PubMed

    Yousefi Rad, A; Ayhan, H; Kisa, U; Pişkin, E

    1998-01-01

    In this study, firstly five different bacteria (i.e. Coagulase positive and negative staphylococcus, Streptococcus pyogenes, Escherichia coli, Pseudomonas aeruginosa) with their different strains were isolated and used. The contact angle, surface free energy, p-xylene adhesion, and zeta potential of these bacteria were in the range of 43-69 deg, 45.4-61.8 erg cm(-2), 2.3-80.3%, and from -650.2 to + 17.5 mV, respectively. Most of the bacteria were negatively charged. Attachment of these bacteria to PVC catheter and its DMAEMA- and AAc-plasma treated forms were investigated. Bacterial attachment to the hydrophobic PVC catheter was high. Both plasma treatments caused significant drops in bacterial attachment in most of the cases. The effects of AAc-plasma treatment was more significant.

  3. Efficacy of Aqueous and Methanolic Extracts of Rheum Spiciformis against Pathogenic Bacterial and Fungal Strains

    PubMed Central

    Dar, Khalid Bashir; Bhat, Aashiq Hussain; Amin, Shajrul; Anees, Suhail; Masood, Akbar; Zargar, Mohammed Iqbal

    2016-01-01

    Introduction Rheum spiciformis is a newly identified edible medicinal plant of genus Rheum. The plant is used to treat various diseases on traditional levels in Kashmir Valley, India. Aim To evaluate the phytochemical screening, antibacterial and antifungal potential of aqueous and methanolic extracts of Rheum spiciformis, a traditionally used edible medicinal plant. Materials and Methods Methanolic and aqueous extracts of Rheum spiciformis were tested for their antimicrobial activities against six bacterial strains namely Bacillus subtilis, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Proteus vulgaris and Escherichia coli and four fungal strains Penicillium chrysogenum, Aspergillus fumigatus, Candida albicans and Saccharomyces cerevisiae. The susceptibility of microbial strains to the two extracts was determined using agar well diffusion method. Phytochemical screening was carried out by using various standard procedures. Results Methanolic extract showed potent antimicrobial activity as compared to aqueous extract at the concentrations of 10, 30, 50, 80 and 100mg/ml. The most susceptible bacterial strains were Staphylococcus aureus with zone of inhibition (25±0.10mm), Klebsiella pneumonia (23±0.25mm), Proteus vulgaris (22±0.10mm) at the concentration of 100mg/ml. Aqueous extracts at the higher concentration were found effective against Proteus vulgaris and Bacillus subtilis with zone of inhibition (17±0.24mm) and (17±0.10mm), respectively. Among fungal strains the most susceptible were Aspergillus fumigatus (21±0.10mm), Saccharomyces cerevisiae (20±0.20mm) and Penicillium Chrysogenum (17±0.15mm) at the concentration of 100mg/ml methanol extract. The zone of inhibition for aqueous extract against fungal strains ranged between 14±0.13mm to 16±0.19mm at the highest concentration of plant extract. Phytochemical analysis revealed the presence of various secondary metabolites like flavonoids, saponins, volatile oils, phenols, steroids

  4. Complete Genome Sequence of Gluconacetobacter hansenii Strain NQ5 (ATCC 53582), an Efficient Producer of Bacterial Cellulose

    PubMed Central

    Pfeffer, Sarah; Mehta, Kalpa

    2016-01-01

    This study reports the release of the complete nucleotide sequence of Gluconacetobacter hansenii strain NQ5 (ATCC 53582). This strain was isolated by R. Malcolm Brown, Jr. in a sugar mill in North Queensland, Australia, and is an efficient producer of bacterial cellulose. The elucidation of the genome will contribute to the study of the molecular mechanisms necessary for cellulose biosynthesis. PMID:27516505

  5. Bacterial production of free fatty acids from freshwater macroalgal cellulose.

    PubMed

    Hoover, Spencer W; Marner, Wesley D; Brownson, Amy K; Lennen, Rebecca M; Wittkopp, Tyler M; Yoshitani, Jun; Zulkifly, Shahrizim; Graham, Linda E; Chaston, Sheena D; McMahon, Katherine D; Pfleger, Brian F

    2011-07-01

    The predominant strategy for using algae to produce biofuels relies on the overproduction of lipids in microalgae with subsequent conversion to biodiesel (methyl-esters) or green diesel (alkanes). Conditions that both optimize algal growth and lipid accumulation rarely overlap, and differences in growth rates can lead to wild species outcompeting the desired lipid-rich strains. Here, we demonstrate an alternative strategy in which cellulose contained in the cell walls of multicellular algae is used as a feedstock for cultivating biofuel-producing microorganisms. Cellulose was extracted from an environmental sample of Cladophora glomerata-dominated periphyton that was collected from Lake Mendota, WI, USA. The resulting cellulose cake was hydrolyzed by commercial enzymes to release fermentable glucose. The hydrolysis mixture was used to formulate an undefined medium that was able to support the growth, without supplementation, of a free fatty acid (FFA)-overproducing strain of Escherichia coli (Lennen et. al 2010). To maximize free fatty acid production from glucose, an isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible vector was constructed to express the Umbellularia californica acyl-acyl carrier protein (ACP) thioesterase. Thioesterase expression was optimized by inducing cultures with 50 μM IPTG. Cell density and FFA titers from cultures grown on algae-based media reached 50% of those (∼90 μg/mL FFA) cultures grown on rich Luria-Bertani broth supplemented with 0.2% glucose. In comparison, cultures grown in two media based on AFEX-pretreated corn stover generated tenfold less FFA than cultures grown in algae-based media. This study demonstrates that macroalgal cellulose is a potential carbon source for the production of biofuels or other microbially synthesized compounds.

  6. Bacterial production of free fatty acids from freshwater macroalgal cellulose

    PubMed Central

    Hoovers, Spencer W.; Marner, Wesley D.; Brownson, Amy K.; Lennen, Rebecca M.; Wittkopp, Tyler M.; Yoshitani, Jun; Zulkifly, Shahrizim; Graham, Linda E.; Chaston, Sheena D.; McMahon, Katherine D.

    2013-01-01

    The predominant strategy for using algae to produce biofuels relies on the overproduction of lipids in microalgae with subsequent conversion to biodiesel (methyl-esters) or green diesel (alkanes). Conditions that both optimize algal growth and lipid accumulation rarely overlap, and differences in growth rates can lead to wild species outcompeting the desired lipid-rich strains. Here, we demonstrate an alternative strategy in which cellulose contained in the cell walls of multicellular algae is used as a feedstock for cultivating biofuel-producing micro-organisms. Cellulose was extracted from an environmental sample of Cladophora glomerata-dominated periphyton that was collected from Lake Mendota, WI, USA. The resulting cellulose cake was hydrolyzed by commercial enzymes to release fermentable glucose. The hydrolysis mixture was used to formulate an undefined medium that was able to support the growth, without supplementation, of a free fatty acid (FFA)-overproducing strain of Escherichia coli (Lennen et. al 2010). To maximize free fatty acid production from glucose, an isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible vector was constructed to express the Umbellularia californica acyl–acyl carrier protein (ACP) thioesterase. Thioesterase expression was optimized by inducing cultures with 50 μM IPTG. Cell density and FFA titers from cultures grown on algae-based media reached 50% of those (~90 μg/mL FFA) cultures grown on rich Luria–Bertani broth supplemented with 0.2% glucose. In comparison, cultures grown in two media based on AFEX-pretreated corn stover generated tenfold less FFA than cultures grown in algae-based media. This study demonstrates that macroalgal cellulose is a potential carbon source for the production of biofuels or other microbially synthesized compounds. PMID:21643704

  7. Exposure to bacterial endotoxin generates a distinct strain of α-synuclein fibril

    PubMed Central

    Kim, Changyoun; Lv, Guohua; Lee, Jun Sung; Jung, Byung Chul; Masuda-Suzukake, Masami; Hong, Chul-Suk; Valera, Elvira; Lee, He-Jin; Paik, Seung R.; Hasegawa, Masato; Masliah, Eliezer; Eliezer, David; Lee, Seung-Jae

    2016-01-01

    A single amyloidogenic protein is implicated in multiple neurological diseases and capable of generating a number of aggregate “strains” with distinct structures. Among the amyloidogenic proteins, α-synuclein generates multiple patterns of proteinopathies in a group of diseases, such as Parkinson disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA). However, the link between specific conformations and distinct pathologies, the key concept of the strain hypothesis, remains elusive. Here we show that in the presence of bacterial endotoxin, lipopolysaccharide (LPS), α-synuclein generated a self-renewable, structurally distinct fibril strain that consistently induced specific patterns of synucleinopathies in mice. These results suggest that amyloid fibrils with self-renewable structures cause distinct types of proteinopathies despite the identical primary structure and that exposure to exogenous pathogens may contribute to the diversity of synucleinopathies. PMID:27488222

  8. Characterization and purification of a bacterial chlorogenic acid esterase detected during the extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots.

    PubMed

    Negrel, Jonathan; Javelle, Francine; Morandi, Dominique; Lucchi, Géraldine

    2016-12-01

    A Gram-negative bacterium able to grow using chlorogenic acid (5-caffeoylquinic acid) as sole carbon source has been isolated from the roots of tomato plants inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis. An intracellular esterase exhibiting very high affinity (Km = 2 μM) for chlorogenic acid has been extracted and purified by FPLC from the chlorogenate-grown cultures of this bacterium. The molecular mass of the purified esterase determined by SDS-PAGE was 61 kDa and its isoelectric point determined by chromatofocusing was 7.75. The esterase hydrolysed chlorogenic acid analogues (caffeoylshikimate, and the 4- and 3-caffeoylquinic acid isomers), feruloyl esterases substrates (methyl caffeate and methyl ferulate), and even caffeoyl-CoA in vitro but all of them were less active than chlorogenic acid, demonstrating that the esterase is a genuine chlorogenic acid esterase. It was also induced when the bacterial strain was cultured in the presence of hydroxycinnamic acids (caffeic, p-coumaric or ferulic acid) as sole carbon source, but not in the presence of simple phenolics such as catechol or protocatechuic acid, nor in the presence of organic acids such as succinic or quinic acids. The purified esterase was remarkably stable in the presence of methanol, rapid formation of methyl caffeate occurring when its activity was measured in aqueous solutions containing 10-60% methanol. Our results therefore show that this bacterial chlorogenase can catalyse the transesterification reaction previously detected during the methanolic extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots. Data are presented suggesting that colonisation by Rhizophagus irregularis could increase chlorogenic acid exudation from tomato roots, especially in nutrient-deprived plants, and thus favour the growth of chlorogenate-metabolizing bacteria on the root surface or in the mycorhizosphere.

  9. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens.

    PubMed

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R; Barany, Francis; Soper, Steven A

    2012-09-21

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft(3)). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic

  10. [Colonization and disease control and fruit preservation functions of endophytic bacterial strains in lychee].

    PubMed

    Cai, Xue-qing; Chen, Wei; Lin, Na; Lin, Tong; Hu, Fang-ping

    2011-08-01

    By spraying the GFP-marked endophytic bacterial strains BS-2-gfp and TB2-gfp, this paper studied their colonization in lychee organs and the functions of the strains in disease control and fruit preservation. The BS-2-gfp and TB2-gfp could colonize and propagate in lychee leaves, flowers, un-matured fruits, and matured fruits, and transfer from the flowers to un-matured fruits. The colonization of BS-2-gfp and TB2-gfp in lychee leaves varied with season and growth stage, being larger in quantity and longer in duration in spring than in autumn. The colonization quantity and duration of the strains also differed in other organs. Both the BS-2-gfp and the TB2-gfp could be isolated and recovered from lychee leaves after 37 d inoculation, the BS-2-gfp could not be isolated from the flowers after inoculation for 10 d, and the BS-2-gfp and TB2-gfp had the largest colonization quantity in matured fruits. The colonization quantity of TB2-gfp in lychee pericarp reached to the maximum (1.90 x 10(6) CFU x g(-1) FM) when the disease index of litchi downy blight had a sharp increase, and, compared with BS-2-gfp, the TB2-gfp had better fruit preservation efficiency, and its colonization quantity in lychee pericarp was also higher. It was suggested that there was a positive correlation between the colonization quantity of test bacterial strains in lychee pericarp and the disease control and fruit preservation effect.

  11. A novel production process for optically pure L-lactic acid from kitchen refuse using a bacterial consortium at high temperatures.

    PubMed

    Tashiro, Yukihiro; Matsumoto, Hiroko; Miyamoto, Hirokuni; Okugawa, Yuki; Pramod, Poudel; Miyamoto, Hisashi; Sakai, Kenji

    2013-10-01

    We investigated L-lactic acid production in static batch fermentation of kitchen refuse using a bacterial consortium from marine-animal-resource (MAR) composts at temperatures ranging from 30 to 65 °C. At relatively low temperatures butyric acid accumulated, whereas at higher temperatures L-lactic acid was produced. In particular, fermentation at 50 °C produced 34.5 g L(-1) L-lactic acid with 90% lactic acid selectivity and 100% optical purity. Denaturing gradient gel electrophoresis indicated that dominant bacteria present in the original MAR composts diminished rapidly and Bacillus coagulans strains became the dominant contributors to L-lactic acid production at 45, 50 and 55 °C. This is the first report of the achievement of 100% optical purity of L-lactic acid using a bacterial consortium.

  12. Selective growth promotion of bloom-forming raphidophyte Heterosigma akashiwo by a marine bacterial strain.

    PubMed

    Higashi, Aiko; Fujitani, Yoshiko; Nakayama, Natsuko; Tani, Akio; Ueki, Shoko

    2016-12-01

    Algal bloom is typically caused by aberrant propagation of a single species, resulting in its predomination in the local population. While environmental factors including temperature and eutrophication are linked to bloom, the precise mechanism of its formation process is still obscure. Here, we isolated a bacterial strain that promotes growth of Heterosigma akashiwo, a Raphidophyceae that causes harmful algal blooms. Based on 16S rRNA gene sequence, the strain was identified as Altererythrobacter ishigakiensis, a member of the class Alphaproteobacteria. When added to culture, this strain facilitated growth of H. akashiwo and increased its cell culture yield significantly. Importantly, this strain did not affect the growth of other raphidophytes, Chattonella ovate and C. antiqua, indicating that it promotes growth of H. akashiwo in a species-specific manner. We also found that, in co-culture, H. akashiwo suppressed the growth of C. ovate. When A. ishigakiensis was added to the mixed culture, H. akashiwo growth was facilitated while C. ovate propagation was markedly suppressed, indicating that the presence of the bacterium enhances the dominance of H. akashiwo over C. ovate. This is the first example of selective growth promotion of H. akashiwo by a marine bacterium, and may exemplify importance of symbiotic bacterium on algal bloom forming process in general.

  13. [Advances in the progress of anti-bacterial biofilms properties of acetic acid].

    PubMed

    Gao, Xinxin; Jin, Zhenghua; Chen, Xinxin; Yu, Jia'ao

    2016-06-01

    Bacterial biofilms are considered to be the hindrance in the treatment of chronic wound, because of their tolerance toward antibiotics and other antimicrobial agents. They also have strong ability to escape from the host immune attack. Acetic acid, as a kind of organic weak acid, can disturb the biofilms by freely diffusing through the bacterial biofilms and bacterial cell membrane structure. Then the acid dissociates to release the hydrogen ions, leading to the disorder of the acid-base imbalance, change of protein conformation, and the degradation of the DNA within the membranes. This paper reviews the literature on the characteristics and treatment strategies of the bacterial biofilms and the acetic acid intervention on them, so as to demonstrate the roles acetic acid may play in the treatment of chronic wound, and thus provide a convincing treatment strategy for this kind of disease.

  14. How fitness reduced, antimicrobial resistant bacteria survive and spread: a multiple pig-multiple bacterial strain model.

    PubMed

    Græsbøll, Kaare; Nielsen, Søren Saxmose; Toft, Nils; Christiansen, Lasse Engbo

    2014-01-01

    More than 30% of E. coli strains sampled from pig farms in Denmark over the last five years were resistant to the commonly used antimicrobial tetracycline. This raises a number of questions: How is this high level sustained if resistant bacteria have reduced growth rates? Given that there are multiple susceptible and resistant bacterial strains in the pig intestines, how can we describe their coexistence? To what extent does the composition of these multiple strains in individual pigs influence the total bacterial population of the pig pen? What happens to a complex population when antimicrobials are used? To investigate these questions, we created a model where multiple strains of bacteria coexist in the intestines of pigs sharing a pen, and explored the parameter limits of a stable system; both with and without an antimicrobial treatment. The approach taken is a deterministic bacterial population model with stochastic elements of bacterial distributions and transmission. The rates that govern the model are process-oriented to represent growth, excretion, and uptake from environment, independent of herd and meta-population structures. Furthermore, an entry barrier and elimination process for the individual strains in each pig were implemented. We demonstrate how competitive growth between multiple bacterial strains in individual pigs, and the transmission between pigs in a pen allow for strains of antimicrobial resistant bacteria to persist in a pig population to different extents, and how quickly they can become dominant if antimicrobial treatment is initiated. The level of spread depends in a non-linear way of the parameters that govern excretion and uptake. Furthermore, the sampling of initial distributions of strains and stochastic transmission events give rise to large variation in how homogenous and how resistant the bacterial population becomes. Most important: resistant bacteria are demonstrated to survive with a disadvantage in growth rate of well over 10%.

  15. Evidence of polyethylene biodegradation by bacterial strains from the guts of plastic-eating waxworms.

    PubMed

    Yang, Jun; Yang, Yu; Wu, Wei-Min; Zhao, Jiao; Jiang, Lei

    2014-12-02

    Polyethylene (PE) has been considered nonbiodegradable for decades. Although the biodegradation of PE by bacterial cultures has been occasionally described, valid evidence of PE biodegradation has remained limited in the literature. We found that waxworms, or Indian mealmoths (the larvae of Plodia interpunctella), were capable of chewing and eating PE films. Two bacterial strains capable of degrading PE were isolated from this worm's gut, Enterobacter asburiae YT1 and Bacillus sp. YP1. Over a 28-day incubation period of the two strains on PE films, viable biofilms formed, and the PE films' hydrophobicity decreased. Obvious damage, including pits and cavities (0.3-0.4 μm in depth), was observed on the surfaces of the PE films using scanning electron microscopy (SEM) and atomic force microscopy (AFM). The formation of carbonyl groups was verified using X-ray photoelectron spectroscopy (XPS) and microattenuated total reflectance/Fourier transform infrared (micro-ATR/FTIR) imaging microscope. Suspension cultures of YT1 and YP1 (10(8) cells/mL) were able to degrade approximately 6.1 ± 0.3% and 10.7 ± 0.2% of the PE films (100 mg), respectively, over a 60-day incubation period. The molecular weights of the residual PE films were lower, and the release of 12 water-soluble daughter products was also detected. The results demonstrated the presence of PE-degrading bacteria in the guts of waxworms and provided promising evidence for the biodegradation of PE in the environment.

  16. Biodegradation of the metallic carcinogen hexavalent chromium Cr(VI) by an indigenously isolated bacterial strain

    PubMed Central

    Mishra, Susmita

    2010-01-01

    Background: Hexavalent chromium [Cr(VI)], a potential mutagen and carcinogen, is regularly introduced into the environment through diverse anthropogenic activities, including electroplating, leather tanning, and pigment manufacturing. Human exposure to this toxic metal ion not only causes potential human health hazards but also affects other life forms. The World Health Organization, the International Agency for Research on Cancer, and the Environmental Protection Agency have determined that Cr(VI) compounds are known human carcinogens. The Sukinda valley in Jajpur District, Orissa, is known for its deposit of chromite ore, producing nearly 98% of the chromite ore in India and one of the prime open cast chromite ore mines in the world (CES, Orissa Newsletter). Materials and Methods: Our investigation involved microbial remediation of Cr(VI) without producing any byproduct. Bacterial cultures tolerating high concentrations of Cr were isolated from the soil sample collected from the chromite-contaminated sites of Sukinda, and their bioaccumulation properties were investigated. Strains capable of growing at 250 mg/L Cr(VI) were considered as Cr resistant. Results: The experimental investigation showed the maximum specific Cr uptake at pH 7 and temperature 30°C. At about 50 mg/L initial Cr(VI) concentrations, uptake of the selected potential strain exceeded 98% within 12 h of incubation. The bacterial isolate was identified by 16S rRNA sequencing as Brevebacterium casei. Conclusion: Results indicated promising approach for microbial remediation of effluents containing elevated levels of Cr(VI). PMID:20976016

  17. Amino Acid Proximities in Two Sup35 Prion Strains Revealed by Chemical Cross-linking*

    PubMed Central

    Wong, Shenq-Huey; King, Chih-Yen

    2015-01-01

    Strains of the yeast prion [PSI] are different folding patterns of the same Sup35 protein, which stacks up periodically to form a prion fiber. Chemical cross-linking is employed here to probe different fiber structures assembled with a mutant Sup35 fragment. The photo-reactive cross-linker, p-benzoyl-l-phenylalanine (pBpa), was biosynthetically incorporated into bacterially prepared recombinant Sup(1–61)-GFP, containing the first 61 residues of Sup35, followed by the green fluorescent protein. Four methionine substitutions and two alanine substitutions were introduced at fixed positions in Sup(1–61) to allow cyanogen bromide cleavage to facilitate subsequent mass spectrometry analysis. Amyloid fibers of pBpa and Met/Ala-substituted Sup(1–61)-GFP were nucleated from purified yeast prion particles of two different strains, namely VK and VL, and shown to faithfully transmit specific strain characteristics to yeast expressing the wild type Sup35 protein. Intra- and intermolecular cross-linking were distinguished by tandem mass spectrometry analysis on fibers seeded from solutions containing equal amounts of 14N- and 15N-labeled protein. Fibers propagating the VL strain type exhibited intra- and intermolecular cross-linking between amino acid residues 3 and 28, as well as intra- and intermolecular linking between 32 and 55. Inter- and intramolecular cross-linking between residues 32 and 55 were detected in fibers propagating the VK strain type. Adjacencies of amino acid residues in space revealed by cross-linking were used to constrain possible chain folds of different [PSI] strains. PMID:26265470

  18. Amino Acid Proximities in Two Sup35 Prion Strains Revealed by Chemical Cross-linking.

    PubMed

    Wong, Shenq-Huey; King, Chih-Yen

    2015-10-09

    Strains of the yeast prion [PSI] are different folding patterns of the same Sup35 protein, which stacks up periodically to form a prion fiber. Chemical cross-linking is employed here to probe different fiber structures assembled with a mutant Sup35 fragment. The photo-reactive cross-linker, p-benzoyl-l-phenylalanine (pBpa), was biosynthetically incorporated into bacterially prepared recombinant Sup(1-61)-GFP, containing the first 61 residues of Sup35, followed by the green fluorescent protein. Four methionine substitutions and two alanine substitutions were introduced at fixed positions in Sup(1-61) to allow cyanogen bromide cleavage to facilitate subsequent mass spectrometry analysis. Amyloid fibers of pBpa and Met/Ala-substituted Sup(1-61)-GFP were nucleated from purified yeast prion particles of two different strains, namely VK and VL, and shown to faithfully transmit specific strain characteristics to yeast expressing the wild type Sup35 protein. Intra- and intermolecular cross-linking were distinguished by tandem mass spectrometry analysis on fibers seeded from solutions containing equal amounts of (14)N- and (15)N-labeled protein. Fibers propagating the VL strain type exhibited intra- and intermolecular cross-linking between amino acid residues 3 and 28, as well as intra- and intermolecular linking between 32 and 55. Inter- and intramolecular cross-linking between residues 32 and 55 were detected in fibers propagating the VK strain type. Adjacencies of amino acid residues in space revealed by cross-linking were used to constrain possible chain folds of different [PSI] strains.

  19. Bacterial Species- and Strain-Dependent Induction of Tissue Factor in Human Vascular Endothelial Cells

    PubMed Central

    Veltrop, M. H. A. M.; Beekhuizen, H.; Thompson, J.

    1999-01-01

    A cardinal process in bacterial endocarditis (BE) is the activation of the clotting system and the formation of a fibrin clot on the inner surface of the heart, the so-called endocardial vegetation. The processes that lead to the activation of the clotting system on endothelial surfaces upon exposure to bacteria are largely unknown. In the present study, we investigated in an in vitro model whether infection of human endothelial cells (EC) with bacteria that are relevant to BE, such as Staphylococcus aureus, Streptococcus sanguis, and Staphylococcus epidermidis, leads to induction of tissue factor (TF)-dependent procoagulant activity (TFA) and whether this process is influenced by host factors, such as interleukin-1 (IL-1), that are produced in response to the bacteremia in vivo. The results show that S. aureus binds to and is internalized by EC, resulting in expression of TF mRNA and TF surface protein as well as generation of TFA within 4 to 8 h after infection. No TFA was found when EC were exposed to UV-irradiated S. aureus or bacterial cell wall fragments. S. sanguis and S. epidermidis, although also binding to EC, did not induce endothelial TFA. This indicates a species and strain dependency. EC also expressed TFA after exposure to IL-1. The enhanced TFA of EC after exposure to S. aureus was not prevented by IL-1 receptor antagonist, arguing against an auto- or paracrine contribution of endogenous IL-1. When IL-1 was applied together with bacteria, this had a synergistic effect on the induction of EC TFA. This was found in particular with S. aureus but also, although to a lesser degree, with S. sanguis and S. epidermidis. This influence of IL-1 on the species- and strain-dependent induction of EC TFA suggests that bacterial factors as well as host factors orchestrate the induction of coagulation in an early stage in the pathogenesis of endovascular disease, such as BE. PMID:10531276

  20. Appraising bacterial strains for rapid BOD sensing--an empirical test to identify bacterial strains capable of reliably predicting real effluent BODs.

    PubMed

    Webber, Judith B; Noonan, Mike; Pasco, Neil F; Hay, Joanne M

    2011-01-01

    The measured response of rapid biochemical oxygen demand (BOD) biosensors is often not identical to those measured using the conventional 5-day BOD assay. This paper highlights the efficacy of using both glucose-glutamic acid (GGA) and Organisation for Economic Cooperation and Development (OECD) BOD standards as a rapid screen for microorganisms most likely to reliably predict real effluent BODs when used in rapid BOD devices. Using these two synthetic BOD standards, a microorganism was identified that produced comparable BOD response profiles for two assays, the MICREDOX® assay and the conventional 5-day BOD(5) test. A factorial experimental design systematically evaluated the impact of four factors (microbial strain, growth media composition, media strength, and microbial growth phase) on the BOD response profiles using GGA and OECD synthetic standard substrates. An outlier was identified that showed an improved correlation between the MICREDOX® BOD (BOD(sens)) and BOD(5) assays for both the synthetic standards and for real wastewater samples. Microbial strain was the dominant factor influencing BOD(sens) values, with Arthrobacter globiformis single cultures clearly demonstrating superior rapid BOD(sens) response profiles for both synthetic and real waste samples. It was the only microorganism to approach the BOD(5) response for the OECD substrate (171 mg O(2)L(-1)), and also reported BOD values for real waste samples that were comparable to those produced by the BOD(5) test, including discriminating between filtered and unfiltered samples.

  1. Single bacterial strain capable of significant contribution to carbon cycling in the surface ocean

    PubMed Central

    Pedler, Byron E.; Aluwihare, Lihini I.; Azam, Farooq

    2014-01-01

    Marine dissolved organic carbon (DOC) encompasses one of the largest reservoirs of carbon on Earth. Heterotrophic bacteria are the primary biotic force regulating the fate of this material, yet the capacity of individual strains to significantly contribute to carbon cycling is unknown. Here we quantified the ability of a single Alteromonas strain [Alteromonas sp. strain Scripps Institution of Oceanography (AltSIO)] to drawdown ambient DOC in a coastal ecosystem. In three experiments, AltSIO alone consumed the entire pool of labile DOC, defined here as the quantity consumed by the submicron size fraction of ambient microbial assemblages within 5 d. These findings demonstrate that complete removal of the labile DOC pool in coastal surface seawater can be achieved by a single taxon. During long-term incubations (>1 y) testing semilabile DOC consumption, AltSIO entered dormancy but remained viable, while the diverse assemblages continued to consume carbon. Given that AltSIO is a large bacterium and thus subject to increased grazing pressure, we sought to determine the ecological relevance of this phenotype. Growth dynamics in natural seawater revealed that AltSIO rapidly outgrew the native bacteria, and despite intense grazing pressure, was never eliminated from the population. A survey in the California Current Ecosystem revealed that large bacteria (≥40 fg C⋅cell−1) were persistent, accounting for up to 12% of total bacterial abundance and 24% of total bacterial biomass. We conclude that large, rapidly growing bacteria have the potential to disproportionately alter the fate of carbon in the mesotrophic ocean and play an important role in ecosystem function. PMID:24733921

  2. Single bacterial strain capable of significant contribution to carbon cycling in the surface ocean.

    PubMed

    Pedler, Byron E; Aluwihare, Lihini I; Azam, Farooq

    2014-05-20

    Marine dissolved organic carbon (DOC) encompasses one of the largest reservoirs of carbon on Earth. Heterotrophic bacteria are the primary biotic force regulating the fate of this material, yet the capacity of individual strains to significantly contribute to carbon cycling is unknown. Here we quantified the ability of a single Alteromonas strain [Alteromonas sp. strain Scripps Institution of Oceanography (AltSIO)] to drawdown ambient DOC in a coastal ecosystem. In three experiments, AltSIO alone consumed the entire pool of labile DOC, defined here as the quantity consumed by the submicron size fraction of ambient microbial assemblages within 5 d. These findings demonstrate that complete removal of the labile DOC pool in coastal surface seawater can be achieved by a single taxon. During long-term incubations (>1 y) testing semilabile DOC consumption, AltSIO entered dormancy but remained viable, while the diverse assemblages continued to consume carbon. Given that AltSIO is a large bacterium and thus subject to increased grazing pressure, we sought to determine the ecological relevance of this phenotype. Growth dynamics in natural seawater revealed that AltSIO rapidly outgrew the native bacteria, and despite intense grazing pressure, was never eliminated from the population. A survey in the California Current Ecosystem revealed that large bacteria (≥40 fg C⋅cell(-1)) were persistent, accounting for up to 12% of total bacterial abundance and 24% of total bacterial biomass. We conclude that large, rapidly growing bacteria have the potential to disproportionately alter the fate of carbon in the mesotrophic ocean and play an important role in ecosystem function.

  3. A Locked Nucleic Acid (LNA)-Based Real-Time PCR Assay for the Rapid Detection of Multiple Bacterial Antibiotic Resistance Genes Directly from Positive Blood Culture

    PubMed Central

    Zhu, Lingxiang; Shen, Dingxia; Zhou, Qiming; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2015-01-01

    Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA)-based quantitative real-time PCR (LNA-qPCR) method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1–10 colony forming units (CFU) per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4%) were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates. PMID:25775001

  4. A locked nucleic acid (LNA)-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

    PubMed

    Zhu, Lingxiang; Shen, Dingxia; Zhou, Qiming; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2015-01-01

    Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA)-based quantitative real-time PCR (LNA-qPCR) method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU) per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4%) were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

  5. Biodegradation of endosulfan isomers and its metabolite endosulfate by two biosurfactant producing bacterial strains of Bordetella petrii.

    PubMed

    Odukkathil, Greeshma; Vasudevan, Namasivayam

    2015-01-01

    The main objective of the investigation was to study the biodegradation of endosulfan isomers and its major metabolite endosulfate by two biosurfactant producing bacterial strains of Bordetella petrii. The significance of the study is to evaluate the capability of biosurfactant producing bacterial strains in enhancing the bioavailability of endosulfan. Sixty bacterial strains were isolated from the endosulfan degrading bacterial consortium and were screened for endosulfan degradation and biosurfactant production. Among those, two strains Bordetella petrii I GV 34 (Gene bank Accession No KJ02262) and Bordetella petrii II GV 36 (Gene bank Accession No KJ022625) were capable of degrading endosulfan with simultaneous biosurfactant production. Bordetella petrii I degraded 89% of α and 84% of β isomers of endosulfan whereas Bordetella petrii II degraded 82% of both the isomers. Both the strains were able to reduce the surface tension up to 19.6% and 21.4% with a minimum observed surface tension of 45 Dynes/cm and 44 Dynes/cm, respectively. The study revealed that the strains have the potential to enhance the degradation endosulfan residues in contaminated sites and water by biosurfactant production.

  6. Purification and characterization of three parathion hydrolases from gram-negative bacterial strains.

    PubMed

    Mulbry, W W; Karns, J S

    1989-02-01

    Three unique parathion hydrolases were purified from gram-negative bacterial isolates and characterized. All three purified enzymes had roughly comparable affinities for ethyl parathion and had broad temperature optima at ca. 40 degrees C. The membrane-bound hydrolase of Flavobacterium sp. strain ATCC 27551 was composed of a single subunit of approximately 35,000 daltons (Da) and was inhibited by sulfhydryl reagents such as dithiothreitol (DTT) and by metal salts such as CuCl2. The cytosolic hydrolase of strain B-1 was composed of a single subunit of approximately 43,000 Da and was stimulated by DTT and inhibited by CuCl2. The membrane-bound hydrolase of strain SC was composed of four identical subunits of 67,000 Da and was inhibited by DTT and stimulated by CuCl2. The substrate ranges of the three enzymes also differed, as evidenced by their relative affinities for parathion and the related organophosphate insecticide O-ethyl-O-4-nitrophenyl phenylphosphonothioate (EPN). The B-1 hydrolase displayed equal affinity for both compounds, the Flavobacterium enzyme showed twofold-lower affinity for EPN than for parathion, and the SC hydrolase displayed no activity toward EPN. The range in characteristics of these three enzymes can be exploited in different waste disposal strategies.

  7. Purification and characterization of three parathion hydrolases from gram-negative bacterial strains.

    PubMed Central

    Mulbry, W W; Karns, J S

    1989-01-01

    Three unique parathion hydrolases were purified from gram-negative bacterial isolates and characterized. All three purified enzymes had roughly comparable affinities for ethyl parathion and had broad temperature optima at ca. 40 degrees C. The membrane-bound hydrolase of Flavobacterium sp. strain ATCC 27551 was composed of a single subunit of approximately 35,000 daltons (Da) and was inhibited by sulfhydryl reagents such as dithiothreitol (DTT) and by metal salts such as CuCl2. The cytosolic hydrolase of strain B-1 was composed of a single subunit of approximately 43,000 Da and was stimulated by DTT and inhibited by CuCl2. The membrane-bound hydrolase of strain SC was composed of four identical subunits of 67,000 Da and was inhibited by DTT and stimulated by CuCl2. The substrate ranges of the three enzymes also differed, as evidenced by their relative affinities for parathion and the related organophosphate insecticide O-ethyl-O-4-nitrophenyl phenylphosphonothioate (EPN). The B-1 hydrolase displayed equal affinity for both compounds, the Flavobacterium enzyme showed twofold-lower affinity for EPN than for parathion, and the SC hydrolase displayed no activity toward EPN. The range in characteristics of these three enzymes can be exploited in different waste disposal strategies. Images PMID:2541658

  8. Isolation and characterization of marine bacterial strain degrading fucoidan from Korean Undaria pinnatifida Sporophylls.

    PubMed

    Kim, Woo-Jung; Kim, Sung-Min; Lee, Yoon-Hee; Kim, Hyun Guell; Kim, Hyung-Kwon; Moon, Seong Hoon; Suh, Hyun-Hyo; Jang, Ki-Hyo; Park, Yong-Il

    2008-04-01

    In spite of an increasing interest in fucoidans as biologically active compounds, no convenient commercial sources with fucoidanase activity are yet available. A marine bacterial strain that showed confluent growth on a minimal medium containing fucoidan, prepared from Korean Undaria pinnatifida sporophylls, as the sole carbon source was isolated and identified based on a 16S rDNA sequence analysis as a strain of Sphingomonas paucimobilis, and named Sphingomonas paucimobilis PF-1. The strain depolymerized fucoidan into more than 7 distinct lowmolecular- mass fucose-containing oligosaccharides, ranging from 305 to 3,749 Da. The enzyme activity was shown to be associated with the whole cell, suggesting the possibility of a surface display of the enzyme. However, a whole-cell enzyme preparation neither released the monomer Lfucose from the fucoidan nor hydrolyzed the chromogenic substrate p-nitrophenyl-alpha-L-fucoside, indicating that the enzyme may be an endo-acting fucoidanase rather than an alpha-L-fucosidase. Therefore, this would appear to be the first report on fucoidanolytic activity by a Sphingomonas species and also the first report on the enzymatic degradation of the Korean Undaria pinnatifida sporophyll fucoidan. Moreover, this enzyme activity may be very useful for structural analyses of fucose-containing polysaccharides and the production of bioactive fucooligosaccharides.

  9. Assessing the bioremediation potential of arsenic tolerant bacterial strains in rice rhizosphere interface.

    PubMed

    Singh, Namrata; Srivastava, Shubhi; Rathaur, Sushma; Singh, Nandita

    2016-10-01

    The arsenic tolerant bacterial strains Staphylococcus arlettae (NBRIEAG-6), Staphylococcus sp. (NBRIEAG-8) and Brevibacillus sp. (NBRIEAG-9) were tested for their roles in enhancing plant growth and induction of stress-related enzymes in rice (Oryza sativa L. cv. NDR-359) plants at two different concentrations, 30 and 15mg/kg of As(V) and As(III), respectively. An experiment was conducted to test the effect of these strains on plant growth promotion and arsenic uptake. We found 30%-40% reduction in total As uptake in bacteria-inoculated plants, with increased plant growth parameters compared to non-inoculated plants. Moreover, the bacteria-inoculated plants showed reduced activity of total glutathione (GSH) and glutathione reductase (GR) compared to their respective controls, which suggests the bacteria-mediated reduction of oxidative stress in plants. Thus, these strains were found to be beneficial in terms of the biochemical and physiological status of the plants under arsenic stress conditions. Furthermore, one-way ANOVA and principal component analysis (PCA) on enzymatic and non-enzymatic assays also revealed clear variations. The results support the distinction between control and treatments in both shoots and roots. Therefore, this study demonstrates the potential of rhizobacteria in alleviating arsenic stress in rice plants.

  10. Epidemiological analysis of bacterial strains involved in hospital infection in a university hospital from Brazil.

    PubMed

    Moraes, B A; Cravo, C A; Loureiro, M M; Solari, C A; Asensi, M D

    2000-01-01

    Hospital infections cause an increase in morbidity and mortality of hospitalized patients with significant rise in hospital costs. The aim of this work was an epidemiological analysis of hospital infection cases occurred in a public University Hospital in Rio de Janeiro. Hence, 238 strains were isolated from 14 different clinical materials of 166 patients hospitalized in the period between August 1995 and July 1997. The average age of the patients was 33.4 years, 72.9% used antimicrobials before having a positive culture. The most common risk conditions were surgery (19.3%), positive HIV or AIDS (18.1%) and lung disease (16.9%). 24 different bacterial species were identified, S. aureus (21%) and P. aeruginosa (18.5%) were predominant. Among 50 S. aureus isolated strains 36% were classified as MRSA (Methicillin Resistant S. aureus). The Gram negative bacteria presented high resistance to aminoglycosides and cephalosporins. A diarrhea outbreak, detected in high-risk neonatology ward, was caused by Salmonella serovar Infantis strain, with high antimicrobial resistance and a plasmid of high molecular weight (98Mda) containing virulence genes and positive for R factor.

  11. Differing Daphnia magna assimilation efficiencies for terrestrial, bacterial, and algal carbon and fatty acids.

    PubMed

    Taipale, Sami J; Brett, Michael T; Hahn, Martin W; Martin-Creuzburg, Dominik; Yeung, Sean; Hiltunen, Minna; Strandberg, Ursula; Kankaala, Paula

    2014-02-01

    There is considerable interest in the pathways by which carbon and growth-limiting elemental and biochemical nutrients are supplied to upper trophic levels. Fatty acids and sterols are among the most important molecules transferred across the plant-animal interface of food webs. In lake ecosystems, in addition to phytoplankton, bacteria and terrestrial organic matter are potential trophic resources for zooplankton, especially in those receiving high terrestrial organic matter inputs. We therefore tested carbon, nitrogen, and fatty acid assimilation by the crustacean Daphnia magna when consuming these resources. We fed Daphnia with monospecific diets of high-quality (Cryptomonas marssonii) and intermediate-quality (Chlamydomonas sp. and Scenedesmus gracilis) phytoplankton species, two heterotrophic bacterial strains, and particles from the globally dispersed riparian grass, Phragmites australis, representing terrestrial particulate organic carbon (t-POC). We also fed Daphnia with various mixed diets, and compared Daphnia fatty acid, carbon, and nitrogen assimilation across treatments. Our results suggest that bacteria were nutritionally inadequate diets because they lacked sterols and polyunsaturated omega-3 and omega-6 (omega-3 and omega-6) fatty acids (PUFAs). However, Daphnia were able to effectively use carbon and nitrogen from Actinobacteria, if their basal needs for essential fatty acids and sterols were met by phytoplankton. In contrast to bacteria, t-POC contained sterols and omega-6 and omega-3 fatty acids, but only at 22%, 1.4%, and 0.2% of phytoplankton levels, respectively, which indicated that t-POC food quality was especially restricted with regard to omega-3 PUFAs. Our results also showed higher assimilation of carbon than fatty acids from t-POC and bacteria into Daphnia, based on stable-isotope and fatty acids analysis, respectively. A relatively high (>20%) assimilation of carbon and fatty acids from t-POC was observed only when the proportion of t

  12. Cell wall teichoic acids of two Brevibacterium strains.

    PubMed

    Shashkov, A S; Potekhina, N V; Evtushenko, L I; Naumova, I B

    2004-06-01

    Structurally identical teichoic acids were detected in cell walls of two soil isolates assigned to Brevibacterium linens based on phylogenetic data. Both cell walls contain unsubstituted 1,3-poly(glycerol phosphate) and poly(glycosylglycerol phosphate). Repeating units of the latter--alpha-D-GlcpNAc-(1-->4)-beta-D-Galp-(1-->1)-Gro--are bound by phosphodiester bonds including OH-3 of galactose and OH-3 of glycerol. Some of the N-acetylglucosamine residues have 4,6-pyruvic acid acetal, amounts of the latter in the two strains being unequal. Species-specificity of the structures of teichoic acids in the genus Brevibacterium is discussed.

  13. An organic acid-tolerant HAA1-overexpression mutant of an industrial bioethanol strain of Saccharomyces cerevisiae and its application to the production of bioethanol from sugarcane molasses.

    PubMed

    Inaba, Takuya; Watanabe, Daisuke; Yoshiyama, Yoko; Tanaka, Koichi; Ogawa, Jun; Takagi, Hiroshi; Shimoi, Hitoshi; Shima, Jun

    2013-12-30

    Bacterial contamination is known as a major cause of the reduction in ethanol yield during bioethanol production by Saccharomyces cerevisiae. Acetate is an effective agent for the prevention of bacterial contamination, but it negatively affects the fermentation ability of S. cerevisiae. We have proposed that the combined use of organic acids including acetate and lactate and yeast strains tolerant to organic acids may be effective for the elimination of principally lactic acid bacterial (LAB) contamination. In a previous study employing laboratory S. cerevisiae strains, we showed that overexpression of the HAA1 gene, which encodes a transcriptional activator, could be a useful molecular breeding method for acetate-tolerant yeast strains. In the present study, we constructed a HAA1-overexpressing diploid strain (MATa/α, named ER HAA1-OP) derived from the industrial bioethanol strain Ethanol Red (ER). ER HAA1-OP showed tolerance not only to acetate but also to lactate, and this tolerance was dependent on the increased expression of HAA1 gene. The ethanol production ability of ER HAA1-OP was almost equivalent to that of the parent strain during the bioethanol production process from sugarcane molasses in the absence of acetate. The addition of acetate at 0.5% (w/v, pH 4.5) inhibited the fermentation ability of the parent strain, but such an inhibition was not observed in the ethanol production process using ER HAA1-OP.

  14. An organic acid-tolerant HAA1-overexpression mutant of an industrial bioethanol strain of Saccharomyces cerevisiae and its application to the production of bioethanol from sugarcane molasses

    PubMed Central

    2013-01-01

    Bacterial contamination is known as a major cause of the reduction in ethanol yield during bioethanol production by Saccharomyces cerevisiae. Acetate is an effective agent for the prevention of bacterial contamination, but it negatively affects the fermentation ability of S. cerevisiae. We have proposed that the combined use of organic acids including acetate and lactate and yeast strains tolerant to organic acids may be effective for the elimination of principally lactic acid bacterial (LAB) contamination. In a previous study employing laboratory S. cerevisiae strains, we showed that overexpression of the HAA1 gene, which encodes a transcriptional activator, could be a useful molecular breeding method for acetate-tolerant yeast strains. In the present study, we constructed a HAA1-overexpressing diploid strain (MATa/α, named ER HAA1-OP) derived from the industrial bioethanol strain Ethanol Red (ER). ER HAA1-OP showed tolerance not only to acetate but also to lactate, and this tolerance was dependent on the increased expression of HAA1 gene. The ethanol production ability of ER HAA1-OP was almost equivalent to that of the parent strain during the bioethanol production process from sugarcane molasses in the absence of acetate. The addition of acetate at 0.5% (w/v, pH 4.5) inhibited the fermentation ability of the parent strain, but such an inhibition was not observed in the ethanol production process using ER HAA1-OP. PMID:24373204

  15. Risk of spontaneous bacterial peritonitis associated with gastric Acid suppression.

    PubMed

    Chang, Shy-Shin; Lai, Chih-Cheng; Lee, Meng-tse Gabriel; Lee, Yu-Chien; Tsai, Yi-Wen; Hsu, Wan-Ting; Lee, Chien-Chang

    2015-06-01

    The primary objective of this study was to determine the association between the use of gastric acid suppressants (GAS) and the risk of developing spontaneous bacterial peritonitis (SBP) in patients with advanced liver cirrhosis (LC). A case-control study nested within a cohort of 480,000 representatives of Taiwan National Health Insurance beneficiaries was carried out. A case was matched with 100 controls on age, gender, and index date of SBP diagnosis. GAS use was identified from the 1-year period before the index date. Conditional logistic regression analysis was used to adjust for various unbalanced covariates between users and nonusers of GAS. A total of 947 cases of SBP were identified among the 86,418 patients with advanced LC. A significant increased risk of developing SBP was found to be associated with current (within 30 days), and recent (within 30-90 day) use of 2 different classes of GAS: proton pump inhibitors (PPIs) and histamine 2 receptor antagonists (H2RAs). The confounder adjusted rate ratio (aRR) for the current use of PPIs was 2.77 (95% CI: 1.90-4.04) and H2RAs was 2.62 (95% CI: 2.00-3.42). The risk of SBP attenuated for the recent use of PPIs (aRR: 2.20, 95%CI: 1.60-3.02) or H2RAs (aRR: 1.72, 95% CI: 1.25-2.37). In addition, sensitivity analysis using hospitalized SBP as the primary outcome showed a similar risk for the current use of PPIs (aRR, 3.24; 95% CI: 2.08-5.05) and H2RAs (aRR 2.43; 95% CI 1.71-3.46). Furthermore, higher cumulative days of gastric acid suppression were associated with a higher risk of SBP (trend P < 0.0001). To conclude, exposure to GAS was associated with an increased risk of SBP in patients with advanced LC. The association was more pronounced in current PPI users compared with nonusers.

  16. Fatty Acid Composition of Unicellular Strains of Blue-Green Algae1

    PubMed Central

    Kenyon, C. N.

    1972-01-01

    The fatty acids of 34 strains of unicellular blue-green algae provisionally assigned to the genera Synechococcus, Aphanocapsa, Gloeocapsa, Microcystis, and Chlorogloea by Stanier et al. have been chemically characterized. The strains analyzed can be divided into a series of compositional groups based upon the highest degree of unsaturation of the major cellular fatty acids. Twenty strains fall into the group characterized by one trienoic fatty acid isomer (α-linolenic acid), and seven strains fall into a group characterized by another trienoic acid isomer (γ-linolenic acid). These groups in many cases correlate well with groupings based upon other phenotypic characters of the strains, e.g., deoxyribonucleic acid base composition. The assignment of a strain to a compositional group is not altered when the strain is grown under a variety of different culture conditions. All strains contain glycolipids with the properties of mono- and digalactosyldiglycerides. PMID:4621688

  17. Marked intra-strain variation in response of Listeria monocytogenes dairy isolates to acid or salt stress and the effect of acid or salt adaptation on adherence to abiotic surfaces.

    PubMed

    Adrião, A; Vieira, M; Fernandes, I; Barbosa, M; Sol, M; Tenreiro, R P; Chambel, L; Barata, B; Zilhao, I; Shama, G; Perni, S; Jordan, S J; Andrew, P W; Faleiro, M L

    2008-03-31

    During food processing, and particularly in cheese manufacturing processes, Listeria monocytogenes may be exposed routinely to environments of low pH or high salt concentration. It has been suggested that these environmental conditions may contribute to bacterial adherence to abiotic surfaces and increased resistance to disinfection. In this study strains isolated from the environment of artisanal cheese-making dairies were used to investigate the behaviour of L. monocytogenes in response to acid and salt stress and clear differences between strains was observed. In planktonic culture, strains varied in resistance to low pH or high NaCl concentration and in the occurrence of an adaptive response to moderate acid or NaCl. There was dislocation in responses to salt and acid. Strains resistant, or adaptive, to acid were not resistant or adaptive to NaCl. The reverse also was observed. Exposure to moderate acid did not promote adherence to polystyrene but survival, at low pH or high NaCl concentration, of cells adherent to stainless steel was increased, even for strains that had no adaptive response planktonically, but the detail of these observations varied between strains. In contrast to acid adaptation, with some strains salt adaptation enhanced adherence of L. monocytogenes to polystyrene but this was not true for all strains. For some strains salt- or acid adaptation may enhance the survival of sessile cells exposed to hypochlorite disinfection.

  18. Evolution of the Lactic Acid Bacterial Community during Malt Whisky Fermentation: a Polyphasic Study

    PubMed Central

    van Beek, Sylvie; Priest, Fergus G.

    2002-01-01

    The development of the lactic acid bacterial community in a commercial malt whisky fermentation occurred in three broad phases. Initially, bacteria were inhibited by strong yeast growth. Fluorescence microscopy and environmental scanning electron microscopy revealed, in this early stage, both cocci and rods that were at least partly derived from the wort and yeast but also stemmed from the distillery plant. Denaturing gradient gel electrophoresis (DGGE) of partial 16S rRNA genes and sequence analysis revealed cocci related to Streptococcus thermophilus or Saccharococcus thermophilus, Lactobacillus brevis, and Lactobacillus fermentum. The middle phase began 35 to 40 h after yeast inoculation and was characterized by exponential growth of lactobacilli and residual yeast metabolism. Lactobacillus casei or Lactobacillus paracasei, L. fermentum, and Lactobacillus ferintoshensis were detected in samples of fermenting wort examined by DGGE during this stage. Bacterial growth was accompanied by the accumulation of acetic and lactic acids and the metabolism of residual maltooligosaccharides. By 70 h, two new PCR bands were detected on DGGE gels, and the associated bacteria were largely responsible for the final phase of the fermentation. The bacteria were phylogenetically related to Lactobacillus acidophilus and Lactobacillus delbrueckii, and strains similar to the former had previously been recovered from malt whisky fermentations in Japan. These were probably obligately homofermentative bacteria, required malt wort for growth, and could not be cultured on normal laboratory media, such as MRS. Their metabolism during the last 20 to 30 h of fermentation was associated with yeast death and autolysis and further accumulation of lactate but no additional acetate. PMID:11772639

  19. Aerobic digestion of tannery wastewater in a sequential batch reactor by salt-tolerant bacterial strains

    NASA Astrophysics Data System (ADS)

    Durai, G.; Rajasimman, M.; Rajamohan, N.

    2011-09-01

    Among the industries generating hyper saline effluents, tanneries are prominent in India. Hyper saline wastewater is difficult to treat by conventional biological treatment methods. Salt-tolerant microbes can adapt to these conditions and degrade the organics in hyper saline wastewater. In this study, the performance of a bench scale aerobic sequencing batch reactor (SBR) was investigated to treat the tannery wastewater by the salt-tolerant bacterial strains namely Pseudomonas aeruginosa, Bacillus flexus, Exiguobacterium homiense and Styphylococcus aureus. The study was carried out under different operating conditions by changing the hydraulic retention time, organic loading rate and initial substrate concentration. From the results it was found that a maximum COD reduction of 90.4% and colour removal of 78.6% was attained. From this study it was found that the salt-tolerant microorganisms could improve the reduction efficiency of COD and colour of the tannery wastewater.

  20. Bacterial phagocytosis by macrophages from lipopolysaccharide responder and nonresponder mouse strains.

    PubMed Central

    Cuffini, A; Carlone, N A; Forni, G

    1980-01-01

    The phagocytic capacity of macrophages from C3H/H3J mice was assessed against lipopolysaccharide-producing (Escherichia coli) and -nonproducing (Staphylococcus aureus) bacteria. Despite their gene-coded unresponsiveness to lipopolysaccharide endotoxin and lymphokines and their defective tumoricidal activity, proteose peptone-induced C3H/HeJ macrophages did not display a defective phagocytic capacity, but rather displayed an enhanced phagocytosis of both bacterial strains compared with macrophages from closely related C3H/HeN mice. Unstimulated peritoneal resident C3H/HeJ macrophages, on the other hand, displayed a normal phagocytic activity toward E. coli and enhanced phagocytosis toward S. aureus. PMID:6995321

  1. Selected bacterial strains protect Artemia spp. from the pathogenic effects of Vibrio proteolyticus CW8T2.

    PubMed

    Verschuere, L; Heang, H; Criel, G; Sorgeloos, P; Verstraete, W

    2000-03-01

    In this study Vibrio proteolyticus CW8T2 has been identified as a virulent pathogen for Artemia spp. Its infection route has been visualized with transmission electron microscopy. The pathogen affected microvilli and gut epithelial cells, disrupted epithelial cell junctions, and reached the body cavity, where it devastated cells and tissues. In vivo antagonism tests showed that preemptive colonization of the culture water with nine selected bacterial strains protected Artemia juveniles against the pathogenic effects. Two categories of the selected strains could be distinguished: (i) strains providing total protection, as no mortality occurred 2 days after the experimental infection with V. proteolyticus CW8T2, with strain LVS8 as a representative, and (ii) strains providing partial protection, as significant but not total mortality was observed, with strain LVS2 as a representative. The growth of V. proteolyticus CW8T2 in the culture medium was slowed down in the presence of strains LVS2 and LVS8, but growth suppression was distinctly higher with LVS8 than with LVS2. It was striking that the strains that gave only partial protection against the pathogen in the in vivo antagonism test showed also a restricted capability to colonize the Artemia compared to the strains providing total protection. The in vivo antagonism tests and the filtrate experiments showed that probably no extracellular bacterial compounds were involved in the protective action but that the living cells were required to protect Artemia against V. proteolyticus CW8T2.

  2. Influence of the acid type in the production of chitosan films reinforced with bacterial nanocellulose.

    PubMed

    Velásquez-Cock, J; Ramírez, E; Betancourt, S; Putaux, J-L; Osorio, M; Castro, C; Gañán, P; Zuluaga, R

    2014-08-01

    Chitosan films reinforced with bacterial cellulose (BC) nanoribbons were studied to understand the influence of acid (acetic and lactic acids) on the reinforcing effect. For both acids, the maximum concentration of the reinforcing constituent was 5wt% with respect to the dry weight of chitosan. The infrared spectra, mechanical properties, morphology and antimicrobial activity of the films were analyzed. The results showed a difference between the acids in their behavior and effect on the reinforcement, with a tensile strength of 12.3MPa for the acetic acid films and 3.3MPa for the lactic acid films. Additionally, the bacterial inhibition tests were shown to be positive for the lactic acid films and negative for the acetic acid films. Therefore, exchanging the acid used in these films may be desirable for certain applications.

  3. A nonluminescent and highly virulent Vibrio harveyi strain is associated with "bacterial white tail disease" of Litopenaeus vannamei shrimp.

    PubMed

    Zhou, Junfang; Fang, Wenhong; Yang, Xianle; Zhou, Shuai; Hu, Linlin; Li, Xincang; Qi, Xinyong; Su, Hang; Xie, Layue

    2012-01-01

    Recurrent outbreaks of a disease in pond-cultured juvenile and subadult Litopenaeus vannamei shrimp in several districts in China remain an important problem in recent years. The disease was characterized by "white tail" and generally accompanied by mass mortalities. Based on data from the microscopical analyses, PCR detection and 16S rRNA sequencing, a new Vibrio harveyi strain (designated as strain HLB0905) was identified as the etiologic pathogen. The bacterial isolation and challenge tests demonstrated that the HLB0905 strain was nonluminescent but highly virulent. It could cause mass mortality in affected shrimp during a short time period with a low dose of infection. Meanwhile, the histopathological and electron microscopical analysis both showed that the HLB0905 strain could cause severe fiber cell damages and striated muscle necrosis by accumulating in the tail muscle of L. vannamei shrimp, which led the affected shrimp to exhibit white or opaque lesions in the tail. The typical sign was closely similar to that caused by infectious myonecrosis (IMN), white tail disease (WTD) or penaeid white tail disease (PWTD). To differentiate from such diseases as with a sign of "white tail" but of non-bacterial origin, the present disease was named as "bacterial white tail disease (BWTD)". Present study revealed that, just like IMN and WTD, BWTD could also cause mass mortalities in pond-cultured shrimp. These results suggested that some bacterial strains are changing themselves from secondary to primary pathogens by enhancing their virulence in current shrimp aquaculture system.

  4. Biodegradation of hexazinone by two isolated bacterial strains (WFX-1 and WFX-2).

    PubMed

    Wang, Xuedong; Zhou, Sumei; Wang, Huili; Yang, Shao

    2006-08-01

    Two hexazinone-degrading bacterial strains were isolated from soil by enrichment culture technique, and identified as Pseudomonas sp. and Enterobacter cloacap, respectively. The two purified isolates, designated as WFX-1 and WFX-2, could rapidly degrade hexazinone with half-lives of 3.08 and 2.95 days in mineral salts medium (hereafter referred to as MSM). In contrast, their mixed bacterial culture (herein abbreviated as MBC) was found to degrade hexazinone, at an initial concentration of 50 mg l(-1), by enhancing 2.3-fold over that when the isolates were used alone. The degradation of hexazinone by MBC in MSM clearly decreased concomitant with the increase of initial concentration, and the level of hexazinone that was toxic enough to totally inhibit degradation was in the range of 150-200 mg l(-1). The appropriately combined conditions for hexazinone degradation by MBC in MSM were studied, and found to be pH 5.5, 30 degrees C and at agitation of 120 rpm. The addition of MBC to soil had a greater impact on disappearance of hexazinone, which nearly increased fivefold over that of the control set. As a result, findings in the present investigation provide useful information for soil and water decontamination of hexazinone.

  5. Degradation and metabolism of hexazinone by two isolated bacterial strains from soil.

    PubMed

    Wang, Xuedong; Wang, Huili; Tan, Chengxia

    2005-12-01

    Two hexazinone-degrading bacterial strains were isolated from soil by enrichment culture technique, and identified as Pseudomonas sp. and Enterobacter cloacap. The two purified isolates, designated as WFX-1 and WFX-2, could rapidly degrade hexazinone with a half-life of 3.08 days and 2.95 days in mineral salt medium (MSM), while their mixed bacterial culture was found to degrade hexazinone, at an initial concentration of 50 microg/ml, by enhancing 2.3-fold over that when the isolates were used alone. Two microbial metabolites (A and D) were obtained by preparative TLC and identified on the basis of the spectral data of IR, 1H NMR and HPLC-ESI-MS, but both of them were known products as they had been reported in soil and vegetation metabolites of hexazinone. However, metabolites B and C were new degradates, whose molecular weights (MW) were 157 and 156, respectively, being reported from microbial metabolism for the first time.

  6. Effectiveness of 5-Pyrrolidone-2-carboxylic Acid and Copper Sulfate Pentahydrate Association against Drug Resistant Staphylococcus Strains.

    PubMed

    Governa, Paolo; Miraldi, Elisabetta; De Fina, Gianna; Biagi, Marco

    2016-04-01

    Bacterial resistance is an ongoing challenge for pharmacotherapy and pharmaceutical chemistry. Staphylococcus aureus is the bacterial species which makes it most difficult to treat skin and soft tissue infections and it is seen in thousands of hospitalization cases each year. Severe but often underrated infectious diseases, such as complicated nasal infections, are primarily caused by MRSA and S. epidermidis too. With the aim of studying new drugs with antimicrobial activity and effectiveness on drug resistant Staphylococcus strains, our attention in this study was drawn on the activity of a new association between two natural products: 5-pyrrolidone-2-carboxylic acid (PCA), naturally produced by certain Lactobacillus species, and copper sulfate pentahydrate (CS). The antimicrobial susceptibility test was conducted taking into account 12 different Staphylococcus strains, comprising 6 clinical isolates and 6 resistant strains. PCA 4%, w/w, and CS 0.002%, w/w, association in distilled water solution was found to have bactericidal activity against all tested strains. Antimicrobial kinetics highlighted that PCA 4%, w/w, and CS 0.002% association could reduce by 5 log10 viable bacterial counts of MRSA and oxacillin resistant S. epidennidis in less than 5 and 3 minutes respectively. Microscopic investigations suggest a cell wall targeting mechanism of action. Being very safe and highly tolerated, the natural product PCA and CS association proved to be a promising antimicrobial agent to treat Staphylococcus related infections.

  7. The effect of rhamnolipid biosurfactant produced by Pseudomonas fluorescens on model bacterial strains and isolates from industrial wastewater.

    PubMed

    Vasileva-Tonkova, Evgenia; Sotirova, Anna; Galabova, Danka

    2011-02-01

    In this study, the effect of rhamnolipid biosurfactant produced by Pseudomonas fluorescens on bacterial strains, laboratory strains, and isolates from industrial wastewater was investigated. It was shown that biosurfactant, depending on the concentration, has a neutral or detrimental effect on the growth and protein release of model Gram (+) strain Bacillus subtilis 168. The growth and protein release of model Gram (-) strain Pseudomonas aeruginosa 1390 was not influenced by the presence of biosurfactant in the medium. Rhamnolipid biosurfactant at the used concentrations supported the growth of some slow growing on hexadecane bacterial isolates, members of the microbial community. Changes in cell surface hydrophobicity and permeability of some Gram (+) and Gram (-) isolates in the presence of rhamnolipid biosurfactant were followed in experiments in vitro. It was found that bacterial cells treated with biosurfactant became more or less hydrophobic than untreated cells depending on individual characteristics and abilities of the strains. For all treated strains, an increase in the amount of released protein was observed with increasing the amount of biosurfactant, probably due to increased cell permeability as a result of changes in the organization of cell surface structures. The results obtained could contribute to clarify the relationships between members of the microbial community as well as suggest the efficiency of surface properties of rhamnolipid biosurfactant from Pseudomonas fluorescens making it potentially applicable in bioremediation of hydrocarbon-polluted environments.

  8. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants

    PubMed Central

    Berni Canani, Roberto; Sangwan, Naseer; Stefka, Andrew T; Nocerino, Rita; Paparo, Lorella; Aitoro, Rosita; Calignano, Antonio; Khan, Aly A; Gilbert, Jack A; Nagler, Cathryn R

    2016-01-01

    Dietary intervention with extensively hydrolyzed casein formula supplemented with Lactobacillus rhamnosus GG (EHCF+LGG) accelerates tolerance acquisition in infants with cow's milk allergy (CMA). We examined whether this effect is attributable, at least in part, to an influence on the gut microbiota. Fecal samples from healthy controls (n=20) and from CMA infants (n=19) before and after treatment with EHCF with (n=12) and without (n=7) supplementation with LGG were compared by 16S rRNA-based operational taxonomic unit clustering and oligotyping. Differential feature selection and generalized linear model fitting revealed that the CMA infants have a diverse gut microbial community structure dominated by Lachnospiraceae (20.5±9.7%) and Ruminococcaceae (16.2±9.1%). Blautia, Roseburia and Coprococcus were significantly enriched following treatment with EHCF and LGG, but only one genus, Oscillospira, was significantly different between infants that became tolerant and those that remained allergic. However, most tolerant infants showed a significant increase in fecal butyrate levels, and those taxa that were significantly enriched in these samples, Blautia and Roseburia, exhibited specific strain-level demarcations between tolerant and allergic infants. Our data suggest that EHCF+LGG promotes tolerance in infants with CMA, in part, by influencing the strain-level bacterial community structure of the infant gut. PMID:26394008

  9. Detection of low-abundance bacterial strains in metagenomic datasets by eigengenome partitioning.

    PubMed

    Cleary, Brian; Brito, Ilana Lauren; Huang, Katherine; Gevers, Dirk; Shea, Terrance; Young, Sarah; Alm, Eric J

    2015-10-01

    Analyses of metagenomic datasets that are sequenced to a depth of billions or trillions of bases can uncover hundreds of microbial genomes, but naive assembly of these data is computationally intensive, requiring hundreds of gigabytes to terabytes of RAM. We present latent strain analysis (LSA), a scalable, de novo pre-assembly method that separates reads into biologically informed partitions and thereby enables assembly of individual genomes. LSA is implemented with a streaming calculation of unobserved variables that we call eigengenomes. Eigengenomes reflect covariance in the abundance of short, fixed-length sequences, or k-mers. As the abundance of each genome in a sample is reflected in the abundance of each k-mer in that genome, eigengenome analysis can be used to partition reads from different genomes. This partitioning can be done in fixed memory using tens of gigabytes of RAM, which makes assembly and downstream analyses of terabytes of data feasible on commodity hardware. Using LSA, we assemble partial and near-complete genomes of bacterial taxa present at relative abundances as low as 0.00001%. We also show that LSA is sensitive enough to separate reads from several strains of the same species.

  10. Antimicrobial potential of Ricinus communis leaf extracts in different solvents against pathogenic bacterial and fungal strains

    PubMed Central

    Naz, Rabia; Bano, Asghari

    2012-01-01

    Objective To investigate the in vitro antimicrobial activities of the leaf extract in different solvents viz., methanol, ethanol and water extracts of the selected plant Ricinus communis. Methods Agar well diffusion method and agar tube dilution method were carried out to perform the antibacterial and antifungal activity of methanol, ethanol and aqueous extracts. Results Methanol leaf extracts were found to be more active against Gram positive bacteria (Bacillus subtilis: ATCC 6059 and Staphylococcus aureus: ATCC 6538) as well as Gram negative bacteria (Pseudomonas aeruginosa: ATCC 7221 and Klebsiella pneumoniae) than ethanol and aqueous leaf extracts. Antifungal activity of methanol and aqueous leaf extracts were also carried out against selected fungal strains as Aspergillus fumigatus and Aspergillus flavus. Methanolic as well as aqueous leaf extracts of Ricinus communis were effective in inhibiting the fungal growth. Conclusions The efficient antibacterial and antifungal activity of Ricinus communis from the present investigation revealed that the methanol leaf extracts of the selected plant have significant potential to inhibit the growth of pathogenic bacterial and fungal strains than ethanol and aqueous leaf extracts. PMID:23593573

  11. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants

    DOE PAGES

    Berni Canani, Roberto; Sangwan, Naseer; Stefka, Andrew T.; ...

    2015-09-22

    Dietary intervention with extensively hydrolyzed casein formula supplemented with Lactobacillus rhamnosus GG (EHCF+LGG) accelerates tolerance acquisition in infants with cow’s milk allergy (CMA). We examined whether this effect is attributable, at least in part, to an influence on the gut microbiota. Fecal samples from healthy controls (n=20) and from CMA infants (n=19) before and after treatment with EHCF with (n=12) and without (n=7) supplementation with LGG were compared by 16S rRNA-based operational taxonomic unit clustering and oligotyping. Differential feature selection and generalized linear model fitting revealed that the CMA infants have a diverse gut microbial community structure dominated by Lachnospiraceaemore » (20.5±9.7%) and Ruminococcaceae (16.2±9.1%). Blautia, Roseburia and Coprococcus were significantly enriched following treatment with EHCF and LGG, but only one genus, Oscillospira, was significantly different between infants that became tolerant and those that remained allergic. However, most tolerant infants showed a significant increase in fecal butyrate levels, and those taxa that were significantly enriched in these samples, Blautia and Roseburia, exhibited specific strain-level demarcations between tolerant and allergic infants. As a result, our data suggest that EHCF+LGG promotes tolerance in infants with CMA, in part, by influencing the strain-level bacterial community structure of the infant gut.« less

  12. Host Immune Response to Bacterial Cyclic Diguanylic Acid (c-di-GMP)

    DTIC Science & Technology

    2009-07-01

    biofilm formation of Staphylococcus aureus, including human methicillin- resistant S. aureus strains and animal clinical isolates (6,19). We have also...Malouin. 2005. 3’,5’- cyclic diguanylic acid reduces the virulence of biofilm -forming Staphylococcus aureus strains in a mouse model of mastitis...8217- cyclic diguanylic acid reduces the virulence of biofilm -forming Staphylococcus aureus strains in a mouse model of mastitis infection 2. Antimicrob

  13. Size-dependent antimicrobial properties of CuO nanoparticles against Gram-positive and -negative bacterial strains

    PubMed Central

    Azam, Ameer; Ahmed, Arham S; Oves, M; Khan, MS; Memic, Adnan

    2012-01-01

    Background CuO is one of the most important transition metal oxides due to its captivating properties. It is used in various technological applications such as high critical temperature superconductors, gas sensors, in photoconductive applications, and so on. Recently, it has been used as an antimicrobial agent against various bacterial species. Here we synthesized different sized CuO nanoparticles and explored the size-dependent antibacterial activity of each CuO nanoparticles preparation. Methods CuO nanoparticles were synthesized using a gel combustion method. In this approach, cupric nitrate trihydrate and citric acid were dissolved in distilled water with a molar ratio of 1:1. The resulting solution was stirred at 100°C, until gel was formed. The gel was allowed to burn at 200°C to obtain amorphous powder, which was further annealed at different temperatures to obtain different size CuO nanoparticles. We then tested the antibacterial properties using well diffusion, minimum inhibitory concentration, and minimum bactericidal concentration methods. Results XRD spectra confirmed the formation of single phase CuO nanoparticles. Crystallite size was found to increase with an increase in annealing temperature due to atomic diffusion. A minimum crystallite size of 20 nm was observed in the case of CuO nanoparticles annealed at 400°C. Transmission electron microscopy results corroborate well with XRD results. All CuO nanoparticles exhibited inhibitory effects against both Gram-positive and -negative bacteria. The size of the particles was correlated with its antibacterial activity. Conclusion The antibacterial activity of CuO nanoparticles was found to be size-dependent. In addition, the highly stable minimum-sized monodispersed copper oxide nanoparticles synthesized during this study demonstrated a significant increase in antibacterial activities against both Gram-positive and -negative bacterial strains. PMID:22848176

  14. Rapid identification of ESKAPE bacterial strains using an autonomous microfluidic device.

    PubMed

    Ho, Jack Y; Cira, Nate J; Crooks, John A; Baeza, Josue; Weibel, Douglas B

    2012-01-01

    This article describes Bacteria ID Chips ('BacChips'): an inexpensive, portable, and autonomous microfluidic platform for identifying pathogenic strains of bacteria. BacChips consist of a set of microchambers and channels molded in the elastomeric polymer, poly(dimethylsiloxane) (PDMS). Each microchamber is preloaded with mono-, di-, or trisaccharides and dried. Pressing the layer of PDMS into contact with a glass coverslip forms the device; the footprint of the device in this article is ∼6 cm(2). After assembly, BacChips are degased under large negative pressure and are stored in vacuum-sealed plastic bags. To use the device, the bag is opened, a sample containing bacteria is introduced at the inlet of the device, and the degased PDMS draws the sample into the central channel and chambers. After the liquid at the inlet is consumed, air is drawn into the BacChip via the inlet and provides a physical barrier that separates the liquid samples in adjacent microchambers. A pH indicator is admixed with the samples prior to their loading, enabling the metabolism of the dissolved saccharides in the microchambers to be visualized. Importantly, BacChips operate without external equipment or instruments. By visually detecting the growth of bacteria using ambient light after ∼4 h, we demonstrate that BacChips with ten microchambers containing different saccharides can reproducibly detect the ESKAPE panel of pathogens, including strains of: Enterococcus faecalis, Enteroccocus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter aerogenes, and Enterobacter cloacae. This article describes a BacChip for point-of-care detection of ESKAPE pathogens and a starting point for designing multiplexed assays that identify bacterial strains from clinical samples and simultaneously determine their susceptibility to antibiotics.

  15. Biotransformation of arsenic by bacterial strains mediated by oxido-reductase enzyme system.

    PubMed

    Vishnoi, N; Singh, D P

    2014-12-24

    The present study deals with the enzyme mediated biotransformation of arsenic in five arsenic tolerant strains (Bacillus subtilis, Bacillus megaterium, Bacillus pumilus, Paenibacillus macerans and Escherichia coli). Biotransformation ability of these isolates was evaluated by monitoring arsenite oxidase and arsenate reductase activity. Results showed that arsenic oxidase activity was exclusively present in P. macerans and B. pumilus while B. subtilis, B. megaterium and E. coli strains showed presence of Arsenic oxido-reductase enzyme. The reversible nature of arsenic oxido- reductase suggested that same enzyme can carry out oxidation and reduction of arsenic depending upon the relative concentration of arsenic species. Lineweaver-Burk plot of the arsenite oxidase activity in P. macerans showed highest Km value (Km- 200 μM) and lower Vmax (0.012 μmol mg-1 protein min-1) indicating lowest affinity of the enzyme for arsenite. On the contrary, E. coli showed the lower Km value ( Km- 38.46 μM) and higher Vmax (0.044 μmol mg-1 protein min-1) suggesting for higher affinity for the arsenite. Lineweaver-Burk plot of arsenate reductase activity showed the presence of this enzyme in B. subtilis, B. megaterium and E. coli which were in the range of 200-360 μM Km and Vmax value between 0.256- 0.129 mmol mg-1 protein min-1. These results suggested that affinity of the as reductase enzyme is lowest for arsenate than that for the arsenite. Thus, arsenite oxidase system appears to be a predominant mechanism of cellular defense in these bacterial strains.

  16. Use of plant growth promoting bacterial strains to improve Cytisus striatus and Lupinus luteus development for potential application in phytoremediation.

    PubMed

    Balseiro-Romero, María; Gkorezis, Panagiotis; Kidd, Petra S; Van Hamme, Jonathan; Weyens, Nele; Monterroso, Carmen; Vangronsveld, Jaco

    2017-03-01

    Plant growth promoting (PGP) bacterial strains possess different mechanisms to improve plant development under common environmental stresses, and are therefore often used as inoculants in soil phytoremediation processes. The aims of the present work were to study the effects of a collection of plant growth promoting bacterial strains on plant development, antioxidant enzyme activities and nutritional status of Cytisus striatus and/or Lupinus luteus plants a) growing in perlite under non-stress conditions and b) growing in diesel-contaminated soil. For this, two greenhouse experiments were designed. Firstly, C. striatus and L. luteus plants were grown from seeds in perlite, and periodically inoculated with 6 PGP strains, either individually or in pairs. Secondly, L. luteus seedlings were grown in soil samples of the A and B horizons of a Cambisol contaminated with 1.25% (w/w) of diesel and inoculated with best PGP inoculant selected from the first experiment. The results indicated that the PGP strains tested in perlite significantly improved plant growth. Combination treatments provoked better growth of L. luteus than the respective individual strains, while individual inoculation treatments were more effective for C. striatus. L. luteus growth in diesel-contaminated soil was significantly improved in the presence of PGP strains, presenting a 2-fold or higher increase in plant biomass. Inoculants did not provoke significant changes in plant nutritional status, with the exception of a subset of siderophore-producing and P-solubilising bacterial strains that resulted in significantly modification of Fe or P concentrations in leaf tissues. Inoculants did not cause significant changes in enzyme activities in perlite experiments, however they significantly reduced oxidative stress in contaminated soils suggesting an improvement in plant tolerance to diesel. Some strains were applied to non-host plants, indicating a non-specific performance of their plant growth promotion

  17. Degradation of 3-Phenoxybenzoic Acid in Soil by Pseudomonas pseudoalcaligenes POB310(pPOB) and Two Modified Pseudomonas Strains

    PubMed Central

    Halden, Rolf U.; Tepp, Sandra M.; Halden, Barbara G.; Dwyer, Daryl F.

    1999-01-01

    Pseudomonas pseudoalcaligenes POB310(pPOB) and Pseudomonas sp. strains B13-D5(pD30.9) and B13-ST1(pPOB) were introduced into soil microcosms containing 3-phenoxybenzoic acid (3-POB) in order to evaluate and compare bacterial survival, degradation of 3-POB, and transfer of plasmids to a recipient bacterium. Strain POB310 was isolated for its ability to use 3-POB as a growth substrate; degradation is initiated by POB-dioxygenase, an enzyme encoded on pPOB. Strain B13-D5 contains pD30.9, a cloning vector harboring the genes encoding POB-dioxygenase; strain B13-ST1 contains pPOB. Degradation of 3-POB in soil by strain POB310 was incomplete, and bacterial densities decreased even under the most favorable conditions (100 ppm of 3-POB, supplementation with P and N, and soil water-holding capacity of 90%). Strains B13-D5 and B13-ST1 degraded 3-POB (10 to 100 ppm) to concentrations of <50 ppb with concomitant increases in density from 106 to 108 CFU/g (dry weight) of soil. Thus, in contrast to strain POB310, the modified strains had the following two features that are important for in situ bioremediation: survival in soil and growth concurrent with removal of an environmental contaminant. Strains B13-D5 and B13-ST1 also completely degraded 3-POB when the inoculum was only 30 CFU/g (dry weight) of soil. This suggests that in situ bioremediation may be effected, in some cases, with low densities of introduced bacteria. In pure culture, transfer of pPOB from strains POB310 and B13-ST1 to Pseudomonas sp. strain B13 occurred at frequencies of 5 × 10−7 and 10−1 transconjugant per donor, respectively. Transfer of pPOB from strain B13-ST1 to strain B13 was observed in autoclaved soil but not in nonautoclaved soil; formation of transconjugant bacteria was more rapid in soil containing clay and organic matter than in sandy soil. Transfer of pPOB from strain POB310 to strain B13 in soil was never observed. PMID:10427019

  18. Effects of different fermentation methods on bacterial cellulose and acid production by Gluconacetobacter xylinus in Cantonese-style rice vinegar.

    PubMed

    Fu, Liang; Chen, Siqian; Yi, Jiulong; Hou, Zongxia

    2014-07-01

    A strain of acidogenic bacterium was isolated from the fermentation liquid of Cantonese-style rice vinegar produced by traditional surface fermentation. 16S rDNA identification confirmed the bacterium as Gluconacetobacter xylinus, which synthesizes bacterial cellulose, and the acid productivity of the strain was investigated. In the study, the effects of the membrane integrity and the comparison of the air-liquid interface membrane with immerged membrane on total acidity, cellulose production, alcohol dehydrogenase (ADH) activity and number of bacteria were investigated. The cellulose membrane and the bacteria were observed under SEM for discussing their relationship. The correlations between oxygen consumption and total acid production rate were compared in surface and shake flask fermentation. The results showed the average acid productivity of the strain was 0.02g/(100mL/h), and the integrity of cellulose membrane in surface fermentation had an important effect on total acidity and cellulose production. With a higher membrane integrity, the total acidity after 144 h of fermentation was 3.75 g/100 mL, and the cellulose production was 1.71 g/100 mL after 360 h of fermentation. However, when the membrane was crushed by mechanical force, the total acidity and the cellulose production were as low as 0.36 g/100 mL and 0.14 g/100 mL, respectively. When the cellulose membrane was forced under the surface of fermentation liquid, the total acid production rate was extremely low, but the activity of ADH in the cellulose membrane was basically the same with the one above the liquid surface. The bacteria were mainly distributed in the cellulose membrane during the fermentation. The bacterial counts in surface fermentation were more than in the shake flask fermentation and G. xylinus consumed the substrate faster, in surface fermentation than in shake flask fermentation. The oxygen consumption rate and total acid production rate of surface fermentation were respectively 26

  19. A pseudaminic acid or a legionaminic acid derivative transferase is strain-specifically implicated in the general protein O-glycosylation system of the periodontal pathogen Tannerella forsythia.

    PubMed

    Tomek, Markus B; Janesch, Bettina; Maresch, Daniel; Windwarder, Markus; Altmann, Friedrich; Messner, Paul; Schäffer, Christina

    2017-03-16

    The occurrence of nonulosonic acids in bacteria is wide-spread and linked to pathogenicity. However, the knowledge of cognate nonulosonic acid transferases is scarce. In the periodontopathogen Tannerella forsythia, several proposed virulence factors carry strain-specifically either a pseudaminic or a legionaminic acid derivative as terminal sugar on an otherwise structurally identical, protein-bound oligosaccharide. This study aims to shed light on the transfer of either nonulosonic acid derivative on a proximal N-acetylmannosaminuronic acid residue within the O-glycan structure, exemplified with the bacterium's abundant S-layer glycoproteins. Bioinformatic analyses provided the candidate genes Tanf_01245 (strain ATCC 43037) and TFUB4_00887 (strain UB4), encoding a putative pseudaminic and a legionaminic acid derivative transferase, respectively. These transferases have identical C-termini and contain motifs typical of glycosyltransferases (DXD) and bacterial sialyltransferases (D/E-D/E-G and HP). They share homology to type B glycosyltransferases and TagB, an enzyme catalyzing glycerol transfer to an N-acetylmannosamine residue in teichoic acid biosynthesis. Analysis of a cellular pool of nucleotide-activated sugars confirmed the presence of the CMP-activated nonulosonic acid derivatives, which are most likely serving as substrates for the corresponding transferase. Single gene knock-out mutants targeted at either transferase were analyzed for S-layer O-glycan composition by ESI-MS, confirming the loss of the nonulosonic acid derivative. Cross-complementation of the mutants with the nonnative nonulosonic acid transferase was not successful indicating high stringency of the enzymes. This study identified plausible candidates for a pseudaminic and a legionaminic acid derivative transferase; these may serve as valuable tools for engineering of novel sialoglycoconjugates.

  20. Klebsiella sp. strain C2A isolated from olive oil mill waste is able to tolerate and degrade tannic acid in very high concentrations.

    PubMed

    Pepi, Milva; Cappelli, Serena; Hachicho, Nancy; Perra, Guido; Renzi, Monia; Tarabelli, Alessandro; Altieri, Roberto; Esposito, Alessandro; Focardi, Silvano E; Heipieper, Hermann J

    2013-06-01

    Four bacterial strains capable of growing in the presence of tannic acid as sole carbon and energy source were isolated from olive mill waste mixtures. 16S rRNA gene sequencing assigned them to the genus Klebsiella. The most efficient strain, Klebsiella sp. strain C2A, was able to degrade 3.5 g L(-1) tannic acid within 35 h with synthesizing gallic acid as main product. The capability of Klebsiella sp. strain C2A to produce tannase was evidenced at high concentrations of tannic acid up to 50 g L(-1) . The bacteria adapted to the toxicity of tannic acids by an increase in the membrane lipid fatty acids degree of saturation, especially in the presence of concentrations higher than 20 g L(-1) . The highly tolerant and adaptable bacterial strain characterized in this study could be used in bioremediation processes of wastes rich in polyphenols such as those derived from olive mills, winery or tanneries.

  1. Decolourisation of Acid Orange 7 recalcitrant auto-oxidation coloured by-products using an acclimatised mixed bacterial culture.

    PubMed

    Bay, Hui Han; Lim, Chi Kim; Kee, Thuan Chien; Ware, Ismail; Chan, Giek Far; Shahir, Shafinaz; Ibrahim, Zaharah

    2014-03-01

    This study focuses on the biodegradation of recalcitrant, coloured compounds resulting from auto-oxidation of Acid Orange 7 (AO7) in a sequential facultative anaerobic-aerobic treatment system. A novel mixed bacterial culture, BAC-ZS, consisting of Brevibacillus panacihumi strain ZB1, Lysinibacillus fusiformis strain ZB2, and Enterococcus faecalis strain ZL bacteria were isolated from environmental samples. The acclimatisation of the mixed culture was carried out in an AO7 decolourised solution. The acclimatised mixed culture showed 98 % decolourisation within 2 h of facultative anaerobic treatment using yeast extract and glucose as co-substrate. Subsequent aerobic post treatment caused auto-oxidation reaction forming dark coloured compounds that reduced the percentage decolourisation to 73 %. Interestingly, further agitations of the mixed culture in the solution over a period of 48 h significantly decolourise the coloured compounds and increased the decolourisation percentage to 90 %. Analyses of the degradation compounds using UV-visible spectrophotometer, Fourier transform infrared spectroscopy (FTIR) and high performance liquid chromatography (HPLC) showed complete degradation of recalcitrant AO7 by the novel BAC-ZS. Phytotoxicity tests using Cucumis sativus confirmed the dye solution after post aerobic treatment were less toxic compared to the parent dye. The quantitative real-time PCR revealed that E. faecalis strain ZL was the dominant strain in the acclimatised mix culture.

  2. Efficient production of L-lactic acid from xylose by a recombinant Candida utilis strain.

    PubMed

    Tamakawa, Hideyuki; Ikushima, Shigehito; Yoshida, Satoshi

    2012-01-01

    Efficient L-lactic acid production from xylose was achieved using a pyruvate decarboxylase-deficient Candida utilis strain expressing an L-lactate dehydrogenase, an NADH-preferring mutated xylose reductase (XR), a xylitol dehydrogenase and a xylulokinase. The recombinant strain showed 53% increased L-lactic acid production compared with the reference strain expressing native XR (NADPH-preferring).

  3. Bacterial treatment of alkaline cement kiln dust using Bacillus halodurans strain KG1

    PubMed Central

    Kunal; Rajor, Anita; Siddique, Rafat

    2016-01-01

    This study was conducted to isolate an acid-producing, alkaliphilic bacterium to reduce the alkalinity of cement industry waste (cement kiln dust). Gram-positive isolate KG1 grew well at pH values of 6–12, temperatures of 28–50 °C, and NaCl concentrations of 0–16% and thus was further screened for its potential to reduce the pH of an alkaline medium. Phenotypic characteristics of the KG1 isolate were consistent with those of the genus Bacillus, and the highest level of 16S rRNA gene sequence similarity was found with Bacillus halodurans strain DSM 497 (94.7%). On the basis of its phenotypic characteristics and genotypic distinctiveness from other phylogenetic neighbors belonging to alkaliphilic Bacillus species, the isolated strain was designated B. halodurans strain KG1, with GenBank accession number JQ307184 (= NCIM 5439). Isolate KG1 reduced the alkalinity (by 83.64%) and the chloride content (by 86.96%) of cement kiln dust and showed a potential to be used in the cement industry for a variety of applications. PMID:26887220

  4. Bacterial treatment of alkaline cement kiln dust using Bacillus halodurans strain KG1.

    PubMed

    Kunal; Rajor, Anita; Siddique, Rafat

    2016-01-01

    This study was conducted to isolate an acid-producing, alkaliphilic bacterium to reduce the alkalinity of cement industry waste (cement kiln dust). Gram-positive isolate KG1 grew well at pH values of 6-12, temperatures of 28-50°C, and NaCl concentrations of 0-16% and thus was further screened for its potential to reduce the pH of an alkaline medium. Phenotypic characteristics of the KG1 isolate were consistent with those of the genus Bacillus, and the highest level of 16S rRNA gene sequence similarity was found with Bacillus halodurans strain DSM 497 (94.7%). On the basis of its phenotypic characteristics and genotypic distinctiveness from other phylogenetic neighbors belonging to alkaliphilic Bacillus species, the isolated strain was designated B. halodurans strain KG1, with GenBank accession number JQ307184 (= NCIM 5439). Isolate KG1 reduced the alkalinity (by 83.64%) and the chloride content (by 86.96%) of cement kiln dust and showed a potential to be used in the cement industry for a variety of applications.

  5. Genome sequences of the high-acetic acid-resistant bacteria Gluconacetobacter europaeus LMG 18890T and G. europaeus LMG 18494 (reference strains), G. europaeus 5P3, and Gluconacetobacter oboediens 174Bp2 (isolated from vinegar).

    PubMed

    Andrés-Barrao, Cristina; Falquet, Laurent; Calderon-Copete, Sandra P; Descombes, Patrick; Ortega Pérez, Ruben; Barja, François

    2011-05-01

    Bacteria of the genus Gluconacetobacter are usually involved in the industrial production of vinegars with high acetic acid concentrations. We describe here the genome sequence of three Gluconacetobacter europaeus strains, a very common bacterial species from industrial fermentors, as well as of a Gluconacetobacter oboediens strain.

  6. Ciliates rapidly enhance the frequency of conjugation between Escherichia coli strains through bacterial accumulation in vesicles.

    PubMed

    Matsuo, Junji; Oguri, Satoshi; Nakamura, Shinji; Hanawa, Tomoko; Fukumoto, Tatsuya; Hayashi, Yasuhiro; Kawaguchi, Kouhei; Mizutani, Yoshihiko; Yao, Takashi; Akizawa, Kouzi; Suzuki, Haruki; Simizu, Chikara; Matsuno, Kazuhiko; Kamiya, Shigeru; Yamaguchi, Hiroyuki

    2010-10-01

    The mechanism underlying bacterial conjugation through protozoa was investigated. Kanamycin-resistant Escherichia coli SM10λ+ carrying pRT733 with TnphoA was used as donor bacteria and introduced by conjugation into ciprofloxacin-resistant E. coli clinical isolate recipient bacteria. Equal amounts of donor and recipient bacteria were mixed together in the presence or absence of protozoa (ciliates, free-living amoebae, myxamoebae) in Page's amoeba saline for 24 h. Transconjugants were selected with Luria broth agar containing kanamycin and ciprofloxacin. The frequency of conjugation was estimated as the number of transconjugants for each recipient. Conjugation frequency in the presence of ciliates was estimated to be approximately 10⁻⁶, but in the absence of ciliates, or in the presence of other protozoa, it was approximately 10⁻⁸. Conjugation also occurred in culture of ciliates at least 2 h after incubation. Successful conjugation was confirmed by the polymerase chain reaction. Addition of cycloheximide or latrunculin B resulted in suppression of conjugation. Heat killing the ciliates or bacteria had no effect on conjugation frequency. Co-localization of green fluorescent protein-expressing E. coli and PKH-67-vital-stained E. coli was observed in the same ciliate vesicles, suggesting that both donor and recipient bacteria had accumulated in the same vesicle. In this study, the conjugation frequency of bacteria was found to be significantly higher in vesicles purified from ciliates than those in culture suspension. We conclude that ciliates rapidly enhance the conjugation of E. coli strains through bacterial accumulation in vesicles.

  7. Isolation and characterization of different bacterial strains for bioremediation of n-alkanes and polycyclic aromatic hydrocarbons.

    PubMed

    Guermouche M'rassi, A; Bensalah, F; Gury, J; Duran, R

    2015-10-01

    Crude oil is a common environmental pollutant composed of a large number of both aromatic and aliphatic hydrocarbons. Biodegradation is carried out by microbial communities that are important in determining the fate of pollutants in the environment. The intrinsic biodegradability of the hydrocarbons and the distribution in the environment of competent degrading microorganisms are crucial information for the implementation of bioremediation processes. In the present study, the biodegradation capacities of various bacteria toward aliphatic and aromatic hydrocarbons were determined. The purpose of the study was to isolate and characterize hydrocarbon-degrading bacteria from contaminated soil of a refinery in Arzew, Algeria. A collection of 150 bacterial strains was obtained; the bacterial isolates were identified by 16S rRNA gene sequencing and their ability to degrade hydrocarbon compounds characterized. The isolated strains were mainly affiliated to the Gamma-Proteobacteria class. Among them, Pseudomonas spp. had the ability to metabolize high molecular weight hydrocarbon compounds such as pristane (C19) at 35.11 % by strain LGM22 and benzo[a] pyrene (C20) at 33.93 % by strain LGM11. Some strains were able to grow on all the hydrocarbons tested including octadecane, squalene, phenanthrene, and pyrene. Some strains were specialized degrading only few substrates. In contrast, the strain LGM2 designated as Pseudomonas sp. was found able to degrade both linear and branched alkanes as well as low and high poly-aromatic hydrocarbons (PAHs). The alkB gene involved in alkane degradation was detected in LGM2 and other Pseudomonas-related isolates. The capabilities of the isolated bacterial strains to degrade alkanes and PAHs should be of great practical significance in bioremediation of oil-contaminated environments.

  8. Effect of Indoleacetic Acid and Related Indoles on Lactobacillus sp. Strain 11201 Growth, Indoleacetic Acid Catabolism, and 3-Methylindole Formation †

    PubMed Central

    Honeyfield, D. C.; Carlson, J. R.

    1990-01-01

    A study was conducted to determine the activity of the 3-methylindole (3MI)-forming enzyme in Lactobacillus sp. strain 11201. Cells were incubated anaerobically with 17 different indolic and aromatic compounds. Indoleacetic acid (IAA), 5-hydroxyindoleacetic acid, 5-methoxy-3-indoleacetic acid, indole-3-pyruvate, or indole-3-propionic acid induced 3MI-forming activity. The highest total enzyme activity induced by IAA was observed in cells incubated with an initial concentration of 1.14 mM IAA. Peak activity of the 3MI-forming enzyme occurred 4 h after bacteria were incubated with either 0.114 or 1.14 mM IAA. Enzyme activity peaked earlier (2 h) and disappeared more rapidly at 5.7 mM IAA than at other concentrations of IAA. The effects of IAA and 3MI on the growth of Lactobacillus sp. strain 11201 and formation of 3MI from IAA also were determined. Bacterial growth and 3MI formation from IAA were reduced in medium containing exogenous 3MI. The growth depression observed in medium containing 5.7 mM IAA appears to be due to the toxicity of 3MI rather than IAA. The formation of 3MI in this ruminal Lactobacillus sp. is mediated by an inducible enzyme, and as 3MI accumulates, bacterial growth and rates of 3MI formation from IAA are reduced. PMID:16348189

  9. Fractionation of carbon isotopes in biosynthesis of fatty acids by a piezophilic bacterium Moritella japonica strain DSK1

    NASA Astrophysics Data System (ADS)

    Fang, Jiasong; Uhle, Maria; Billmark, Kaycie; Bartlett, Douglas H.; Kato, Chaki

    2006-04-01

    We examined stable carbon isotope fractionation in biosynthesis of fatty acids of a piezophilic bacterium Moritella japonica strain DSK1. The bacterium was grown to stationary phase at pressures of 0.1, 10, 20, and 50 MPa in media prepared using sterile-filtered natural seawater supplied with glucose as the sole carbon source. Strain DSK1 synthesized typical bacterial fatty acids (C 14-19 saturated, monounsaturated, and cyclopropane fatty acids) as well as long-chain polyunsaturated fatty acids (PUFA) (20:6 ω3). Bacterial cell biomass and individual fatty acids exhibited consistent pressure-dependent carbon isotope fractionations relative to glucose. The observed Δδ FA-glucose (-1.0‰ to -11.9‰) at 0.1 MPa was comparable to or slightly higher than fractionations reported in surface bacteria. However, bulk biomass and fatty acids became more depleted in 13C with pressure. Average carbon isotope fractionation (Δδ FA-glucose) at high pressures was much higher than that for surface bacteria: -15.7‰, -15.3‰, and -18.3‰ at 10, 20, and 50 MPa, respectively. PUFA were more 13C depleted than saturated and monounsaturated fatty acids at all pressures. The observed isotope effects may be ascribed to the kinetics of enzymatic reactions that are affected by hydrostatic pressure and to biosynthetic pathways that are different for short-chain and long-chain fatty acids. A simple quantitative calculation suggests that in situ piezophilic bacterial contribution of polyunsaturated fatty acids to marine sediments is nearly two orders of magnitude higher than that of marine phytoplankton and that the carbon isotope imprint of piezophilic bacteria can override that of surface phytoplankton. Our results have important implications for marine biogeochemistry. Depleted fatty acids reported in marine sediments and the water column may be derived simply from piezophilic bacteria resynthesis of organic matter, not from bacterial utilization of a 13C-depleted carbon source (i

  10. Bacterial production and transformation of dissolved neutral sugars and amino acids in seawater

    NASA Astrophysics Data System (ADS)

    Jørgensen, L.; Lechtenfeld, O.; Benner, R.; Middelboe, M.; Stedmon, C. A.

    2014-04-01

    Dissolved organic matter (DOM) in the ocean consists of a heterogeneous mixture of molecules, most of which are of unknown origin. Neutral sugars and amino acids are among the few recognizable biomolecules in DOM, and the molecular composition of these biomolecules is shaped primarily by biological production and degradation processes. This study provides insight into the bioavailability of biomolecules as well as the chemical composition of DOM produced by bacteria. The molecular compositions of neutral sugars and amino acids were investigated in DOM produced by bacteria and in DOM remaining after long-term bacterial degradation. Results from bioassay incubations (32 days) with natural and artificial seawater, indicate that the molecular compositions following bacterial degradation are not strongly influenced by the initial substrate or bacterial community. The molecular composition of neutral sugars released by bacteria was characterized by a high glucose content (47 mol%) and heterogeneous contributions from other neutral sugars (3-14 mol%). DOM remaining after bacterial degradation was characterized by a high galactose content (33 mol%), followed by glucose (22 mol%) and the remaining neutral sugars (7-11 mol%). The ratio of D-amino acids to L-amino acids increased during the experiments as a response to bacterial degradation, and after 32 days the D/L ratios of aspartic acid, glutamic acid, serine and alanine reached around 0.79, 0.32, 0.30 and 0.51 in all treatments, respectively. The striking similarity in neutral sugar and amino acid compositions between natural and artificial seawater samples, suggests that the microbial carbon pump also applies for neutral sugars and amino acids and that bacterially-produced biomolecules persist for long periods in the ocean.

  11. Extracellular acidic polysaccharide production by a two-membered bacterial coculture.

    PubMed

    Kurata, Shinya; Yamada, Kazutaka; Takatsu, Kyoko; Hanada, Satoshi; Koyama, Osamu; Yokomaku, Toyokazu; Kamagata, Yoichi; Kanagawa, Takahiro; Kurane, Ryuichiro

    2003-01-01

    A two-membered coculture of strains KYM-7 and KYM-8, identified as Cellulomonas cellulans and Agrobacterium tumefaciens, respectively, produced a large amount of an extracellular polysaccharide, designated APK-78, from starch. Each strain in pure culture produced only very little amount of polysaccharide from starch; the coexistence of the two strains from the early stage of cultivation was indispensable for a large amount of polysaccharide to be produced. The polysaccharide APK-78 was acidic and composed of glucose, galactose, succinic acid, and pyruvic acid with a molar ratio of 8.1:1.0:1.7:1.0, indicating that it is a succinoglycan type of polysaccharide.

  12. Differentiation of different mixed Listeria strains and also acid-injured, heat-injured, and repaired cells of Listeria monocytogenes using fourier transform infrared spectroscopy.

    PubMed

    Nyarko, Esmond; Donnelly, Catherine

    2015-03-01

    Fourier transform infrared (FT-IR) spectroscopy was used to differentiate mixed strains of Listeria monocytogenes and mixed strains of L. monocytogenes and Listeria innocua. FT-IR spectroscopy was also applied to investigate the hypothesis that heat-injured and acid-injured cells would return to their original physiological integrity following repair. Thin smears of cells on infrared slides were prepared from cultures for mixed strains of L. monocytogenes, mixed strains of L. monocytogenes and L. innocua, and each individual strain. Heat-injured and acid-injured cells were prepared by exposing harvested cells of L. monocytogenes strain R2-764 to a temperature of 56 ± 0.2°C for 10 min or lactic acid at pH 3 for 60 min, respectively. Cellular repair involved incubating aliquots of acid-injured and heat-injured cells separately in Trypticase soy broth supplemented with 0.6% yeast extract for 22 to 24 h; bacterial thin smears on infrared slides were prepared for each treatment. Spectral collection was done using 250 scans at a resolution of 4 cm(-1) in the mid-infrared wavelength region. Application of multivariate discriminant analysis to the wavelength region from 1,800 to 900 cm(-1) separated the individual L. monocytogenes strains. Mixed strains of L. monocytogenes and L. monocytogenes cocultured with L. innocua were successfully differentiated from the individual strains when the discriminant analysis was applied. Different mixed strains of L. monocytogenes were also successfully separated when the discriminant analysis was applied. A data set for injury and repair analysis resulted in the separation of acid-injured, heat-injured, and intact cells; repaired cells clustered closer to intact cells when the discriminant analysis (1,800 to 600 cm(-1)) was applied. FT-IR spectroscopy can be used for the rapid source tracking of L. monocytogenes strains because it can differentiate between different mixed strains and individual strains of the pathogen.

  13. Production of Oxygenated Fatty Acids from Vegetable Oils by Flavobacterium sp. Strain DS5

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavobacterium sp. strain DS5 (NRRL B-14859) was used to convert two vegetable oils, olive oil and soybean oil, directly to oxygenated fatty acids such as 10-ketostearic acid (10-KSA) and 10-hydroxystearic acid (10-HSA). Lipase addition to the culture was required because strain DS5 did not induce ...

  14. Association of Actinobacillus actinomycetemcomitans leukotoxin with nucleic acids on the bacterial cell surface.

    PubMed Central

    Ohta, H; Hara, H; Fukui, K; Kurihara, H; Murayama, Y; Kato, K

    1993-01-01

    Actinobacillus actinomycetemcomitans, a periodontopathic gram-negative bacterium, produces a leukotoxin that is a member of the RTX cytotoxin family. Although genes may function in toxin secretion, the leukotoxin is not secreted extracellularly but remains associated with the bacterial cell surface. We report here that this toxin-cell surface association is mediated by nucleic acids and directly demonstrate that the extracellular secretion of toxin occurs in growing cultures with increased ionic strength of medium. All examinations were performed with freshly harvested A. actinomycetemcomitans 301-b from anaerobic fructose-limited chemostat cultures. The occurrence of cell surface-localized DNA was shown by directly digesting whole cells with the restriction endonuclease EcoRI or HindIII, which yielded many DNA fragments. The cell surface DNA constituted about 20% of the total cellular DNA. The leukotoxin was released from the whole cells by digestion with DNase I as well as restriction endonucleases. Because the leukotoxin binds ionically to DNA, it is dependent on the ionic strength of buffers or media. Accordingly, the toxin was released from cells suspended in saline at pH 7.5 in the presence of increasing amounts of MgCl2 (0 to 10 mM) or NaCl (0 to 50 mM). Moreover, a considerable quantity of leukotoxin was detected in the culture supernatant of fructose-limited chemostat cultures when sodium succinate solution was pumped into the steady state as an additional salt (30 and then 50 mM). This toxin-DNA association was also found in well-characterized strains including not only the leukotoxin-producing ATCC 29522 but also the toxin production-variable ATCC 29523 and the non-leukotoxin-producing ATCC 33384 when these strains were grown in the chemostat culture. Images PMID:8406888

  15. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, an d analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: (1) to assess the potential terrorist threat to U.S. agricultural crops, (2) to determine whether suitable assays exist to monitor that threat, and (3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  16. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  17. Resistance and Inactivation Kinetics of Bacterial Strains Isolated from the Non-Chlorinated and Chlorinated Effluents of a WWTP

    PubMed Central

    Martínez-Hernández, Sylvia; Vázquez-Rodríguez, Gabriela A.; Beltrán-Hernández, Rosa I.; Prieto-García, Francisco; Miranda-López, José M.; Franco-Abuín, Carlos M.; Álvarez-Hernández, Alejandro; Iturbe, Ulises; Coronel-Olivares, Claudia

    2013-01-01

    The microbiological quality of water from a wastewater treatment plant that uses sodium hypochlorite as a disinfectant was assessed. Mesophilic aerobic bacteria were not removed efficiently. This fact allowed for the isolation of several bacterial strains from the effluents. Molecular identification indicated that the strains were related to Aeromonas hydrophila, Escherichia coli (three strains), Enterobacter cloacae, Kluyvera cryocrescens (three strains), Kluyvera intermedia, Citrobacter freundii (two strains), Bacillus sp. and Enterobacter sp. The first five strains, which were isolated from the non-chlorinated effluent, were used to test resistance to chlorine disinfection using three sets of variables: disinfectant concentration (8, 20 and 30 mg·L−1), contact time (0, 15 and 30 min) and water temperature (20, 25 and 30 °C). The results demonstrated that the strains have independent responses to experimental conditions and that the most efficient treatment was an 8 mg·L−1 dose of disinfectant at a temperature of 20 °C for 30 min. The other eight strains, which were isolated from the chlorinated effluent, were used to analyze inactivation kinetics using the disinfectant at a dose of 15 mg·L−1 with various retention times (0, 10, 20, 30, 60 and 90 min). The results indicated that during the inactivation process, there was no relationship between removal percentage and retention time and that the strains have no common response to the treatments. PMID:23924881

  18. [Effect of the inoculant strain Sphingomonas paucimobilis 20006FA on the bacterial composition of a phenanthrene-degrading consortium].

    PubMed

    Madueño, L; Coppotelli, B M; Morelli, I S

    2009-01-01

    The effect of the inoculant strain Sphingomonas paucimobilis 20006FA on the bacterial composition of a phenanthrene-degrading consortium obtained from a pristine soil in sequencing batch cultures was studied. Inoculated (F200+1) and non-inoculated (F200) phenanthrene-degrading consortia, were obtained. Bacterial diversity of consortia was studied at cultivable (phenotype and genotype characterization) and non-cultivable (PCR-DGGE) levels. During the successive cultures, a loss in the phenanthrene-degrading capacity and a decrease in the bacterial diversity were observed in both consortia. Although inoculation did not produce any significant changes in the consortia phenanthrene-degrading capacity (29.9% F200 and 27.6% F200+1), it did produce changes in the bacterial composition, showing a differential structural dynamics in the DGGE profiles of the inoculated consortium. In both consortia, a dominant band placed at the same position as that of the DNA of the inoculant strain in the DGGE gel could be observed. However, isolated cultures from the consortia which had an identical band position to that of S. paucimobilis 20006FA in the PCR-DGGE profile showed low similarity with respect to the inoculant strain (RAPD).

  19. Plant domestication and the assembly of bacterial and fungal communities associated with strains of the common sunflower, Helianthus annuus.

    PubMed

    Leff, Jonathan W; Lynch, Ryan C; Kane, Nolan C; Fierer, Noah

    2017-04-01

    Root and rhizosphere microbial communities can affect plant health, but it remains undetermined how plant domestication may influence these bacterial and fungal communities. We grew 33 sunflower (Helianthus annuus) strains (n = 5) that varied in their extent of domestication and assessed rhizosphere and root endosphere bacterial and fungal communities. We also assessed fungal communities in the sunflower seeds to investigate the degree to which root and rhizosphere communities were influenced by vertical transmission of the microbiome through seeds. Neither root nor rhizosphere bacterial communities were affected by the extent of sunflower domestication, but domestication did affect the composition of rhizosphere fungal communities. In particular, more modern sunflower strains had lower relative abundances of putative fungal pathogens. Seed-associated fungal communities strongly differed across strains, but several lines of evidence suggest that there is minimal vertical transmission of fungi from seeds to the adult plants. Our results indicate that plant-associated fungal communities are more strongly influenced by host genetic factors and plant breeding than bacterial communities, a finding that could influence strategies for optimizing microbial communities to improve crop yields.

  20. Metabolism of Cyclohexane Carboxylic Acid by Alcaligenes Strain W1

    PubMed Central

    Taylor, David G.; Trudgill, Peter W.

    1978-01-01

    Thirty-three microorganisms capable of growth with cyclohexane carboxylate as the sole source of carbon were isolated from mud, water, and soil samples from the Aberystwyth area. Preliminary screening and whole-cell oxidation studies suggested that, with one exception, all of the strains metabolized the growth substrate by beta-oxidation of the coenzyme A ester. This single distinctive strain, able to oxidize rapidly trans-4-hydroxycyclohexane carboxylate, 4-ketocyclohexane carboxylate, p-hydroxybenzoate, and protocatechuate when grown with cyclohexane carboxylate, was classified as a strain of Alcaligenes and given the number W1. Enzymes capable of converting cyclohexane carboxylate to p-hydroxybenzoate were induced by growth with the alicyclic acid and included the first unambiguous specimen of a cyclohexane carboxylate hydroxylase. Because it is a very fragile protein, attempts to stabilize the cyclohexane carboxylate hydroxylase so that a purification procedure could be developed have consistently failed. In limited studies with crude cell extracts, we found that hydroxylation occurred at the 4 position, probably yielding the trans isomer of 4-hydroxycyclohexane carboxylate. Simultaneous measurement of oxygen consumption and reduced nicotinamide adenine dinucleotide oxidation, coupled with an assessment of reactant stoichiometry, showed the enzyme to be a mixed-function oxygenase. Mass spectral analysis enabled the conversion of cyclohexane carboxylate to p-hydroxybenzoate by cell extracts to be established unequivocally, and all of our data were consistent with the pathway: cyclohexane carboxylate → trans-4-hydroxycyclohexane carboxylate → 4-ketocyclohexane carboxylate → p-hydroxybenzoate. The further metabolism of p-hydroxybenzoate proceeded by meta fission and by the oxidative branch of the 2-hydroxy-4-carboxymuconic semialde-hyde-cleaving pathway. PMID:207665

  1. Bacterial effects and interfacial inactivation mechanism of nZVI/Pd on Pseudomonas putida strain.

    PubMed

    Lv, Yuancai; Niu, Zhuyu; Chen, Yuancai; Hu, Yongyou

    2017-05-15

    With the introduction of nano zero valent iron (nZVI) technology into our environment, its potential environmental risk to environmental microorganisms has attracted considerable attention. In this study, Pseudomonas putida was chosen as a typical strain to study the bacterial toxicity of nZVI/Pd. The CFU assay results indicated that nZVI/Pd was toxic to P. putida cells but the toxicity decreased with an increase in DO. The experiments isolated by dialysis bag and flow cytometry analysis suggested that both membrane disruption caused by direct contact and oxidative stress were the main bactericidal mechanisms under the aerobic condition, while membrane disruption resulting from direct contact was the primary bactericidal mechanism in the anaerobic system. Furthermore, according to TEM, SEM, EDS, XRD, FTIR and XPS, it was indicated that in the aerobic system, the reactive oxygen species (ROS) generated by nZVI/Pd could oxidize the amide and hydroxyl groups into carboxyl groups, resulting in a decline in peptides and increase in polysaccharides. In addition, the ROS also accumulated inside the cell and caused cell inactivation via oxidative stress. In the anaerobic system, the adhered nZVI/Pd particles would attack the functional groups such as carboxyl, ester and amide, leading to the decline in proteins and polysaccharides and subsequent damage of the membrane. The findings provide a significant guide for the application of nano-bio combined technology.

  2. Application of two bacterial strains for wastewater bioremediation and assessment of phenolics biodegradation.

    PubMed

    Paisio, Cintia E; Quevedo, María R; Talano, Melina A; González, Paola S; Agostini, Elizabeth

    2014-08-01

    The use of native bacteria is a useful strategy to decontaminate industrial effluents. In this work, two bacterial strains isolated from polluted environments constitutes a promising alternative since they were able to remove several phenolic compounds not only from synthetic solutions but also from effluents derived from a chemical industry and a tannery which are complex matrices. Acinetobacter sp. RTE 1.4 showed ability to completely remove 2-methoxyphenol (1000 mg/L) while Rhodococcus sp. CS 1 not only degrade the same concentration of this compound but also removed 4- chlorophenol, 2,4-dichlorophenol and pentachlorophenol with high efficiency. Moreover, both bacteria degraded phenols naturally present or even exogenously added at high concentrations in effluents from the chemical industry and a tannery in short time (up to 5 d). In addition, a significant reduction of biological oxygen demand and chemical oxygen demand values was achieved after 7 d of treatment for both effluents using Acinetobacter sp. RTE 1.4 and Rhodococcus sp. CS1, respectively. These results showed that Acinetobacter sp. RTE1.4 and Rhodococcus sp. CS 1 might be considered as useful biotechnological tools for an efficient treatment of different effluents, since they showed wide versatility to detoxify these complex matrices, even supplemented with high phenol concentrations.

  3. Degradation of metal-EDTA complexes by resting cells of the bacterial strain DSM 9103

    SciTech Connect

    Satroutdinov, A.D.; Dedyukhina, E.G.; Chistyakova, T.I.; Witschel, M.; Minkevich, I.G.; Eroshin, V.K.; Egli, T.

    2000-05-01

    Ethylenediaminetetraacetate (EDTA), an industrially important chelating agent, forms very stable complexes with di- and trivalent metal ions, and in both wastewater and natural waters it is normally present in the metal-associated form. Therefore, the influence of EDTA speciation on its utilization by the EDTA-degrading bacterial strain DSM 9103 was investigated. EDTA-grown cells harvested from the exponential phase of a batch culture were incubated with 1 mM of various EDTA species and the EDTA concentration in the assay was monitored as a function of time. Uncomplexed EDTA as well as complexes with low stability constants were found to be readily degraded to completion at a constant rate. For more stable EDTA chelates (i.e., chelates of Co{sup 2+}, Cu{sup 2+}, Zn{sup 2+}, and Pb{sup 2+}) the data suggest that these complexes were not used directly by the cells but that they had to dissociate prior to degradation. The rate of this dissociation step possibly determined the microbial degradation of these complexes. CdEDTA{sup 2{minus}} and Fe(III)EDTA{sup {minus}} were not degraded within 48 h. In case of CdEDTA{sup 2{minus}} the toxicity of freed Cd{sup 2+} ions most likely prevented a significant degradation of the complex, whereas in case of Fe(III)EDTA{sup {minus}} a combination of metal or complex toxicity and the very slow dissociation of the complex might explain the absence of degradation.

  4. Evaluation of the angiogenic potency of a novel exopolysaccharide produced by the MK1 bacterial strain.

    PubMed

    Park, Ji-Yun; Kim, Beom Su; Lee, Jun

    2016-09-01

    Angiogenesis is an essential physiological step in wound healing and other regenerative processes. Here, we evaluated the angiogenic properties of an exopolysaccharide (EPS) secreted by MK1 (MK1-EPS), a novel bacterial strain isolated from Neungee mushrooms. MK1-EPS significantly increased human umbilical vein endothelial cell (HUVEC) proliferation, migration, and vascular tube formation. MK1-EPS enhanced the phosphorylation of extracellular signal-related kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, which are mitogen-activated protein kinases. In addition, the expression of p21 and intercellular adhesion molecule 1 (ICAM1), and phosphorylation of signal transducer and activator of transcription 3 (STAT3), but not of protein kinase B (AKT), were increased. Specific inhibitors of p38 (SB203580), ERK (PD98059), and JNK (SP600125) inhibited MK1-EPS-induced HUVEC proliferation, tube formation, and cell migration, and partially attenuated MKI-EPS-induced expression of p21 and ICAM1, and STAT3 phosphorylation. After surgical implantation into rabbit calvarial bone defects, new blood vessel formation was significantly higher with MK1-EPS composite bone granules than with granules alone, and new bone formation increased significantly. Therefore, MK1-EPS induces angiogenesis and may have potential for use as a bone regeneration agent in bone tissue engineering applications.

  5. Biostimulation of the autochthonous bacterial community and bioaugmentation of selected bacterial strains for the depletion of Polycyclic Aromatic Hydrocarbons in a historically contaminated soil

    NASA Astrophysics Data System (ADS)

    DiGregorio, Simona; Ruffini Castglione, Monica; Gentini, Alessandro; Lorenzi, Roberto

    2015-04-01

    Polycyclic aromatic hydrocarbons (PAHs) are a large group of organic contaminants causing hazards to organisms including humans. The objective of the study was (1) to validate the biostimulation of the autochthonous bacterial population by the amendment of lignocellulosic matrices inoculated with white rot fungi, to be exploited for the depletion of PAHs (5687 ppm) in a historical contaminated soil. (2) to validate the isolation of autochthonous bacterial strains capable to use PAHs as sole carbon source and their massive bioaugmentation for PAH depletion in a historical contaminated soil. The validation has been performed at mesocosm and pilot scale (7 tons of soil in a biopile). The two approaches end up with the complete depletion of the PAHs. A genotoxicological assessment of the process and of the soil at the end of the process of decontamination has been performed. The process of soil decontamination showed an increase in the genotoxicity of either the soil and the deriving elutriates. The bioaugmetation of selected bacterial strains determined the complete detoxification of the decontaminated soil after 21 weeks. The microbial ecology of the system during the process of decontamination has been monitored.

  6. Hydroxytyrosol from tyrosol using hydroxyphenylacetic acid-induced bacterial cultures and evidence of the role of 4-HPA 3-hydroxylase.

    PubMed

    Liebgott, Pierre-Pol; Amouric, Agnès; Comte, Alexia; Tholozan, Jean-Luc; Lorquin, Jean

    2009-12-01

    Hydroxytyrosol (HTyr) is a potent natural antioxidant found in olive mill wastewaters. Bacterial conversion of 4-tyrosol (2-(4-hydroxyphenyl)-ethanol) to HTyr was reported in a limited number of bacterial species including Pseudomonas aeruginosa. In this work, we studied this conversion, taking as a model the newly isolated Halomonas sp. strain HTB24. It was first hypothesized that the enzyme responsible for 4-tyrosol hydroxylation in HTyr was a 4-hydroxyphenylacetic acid 3-hydroxylase (HPAH, EC 1.14.13.3), previously known to convert 4-hydroxyphenylacetic acid (4-HPA) into 3,4-dihydroxyphenylacetic acid (3,4-DHPA) in P. aeruginosa. Cloning and expression of hpaB (oxygenase component) and hpaC (reductase component) genes from P. aeruginosa confirmed this hypothesis. Furthermore, using cultures of HTB24 containing 4-tyrosol, it was shown that 4-HPA accumulation preceded 4-tyrosol hydroxylation. We further demonstrated that the synthesis of HPAH activity was induced by 4-HPA, with the latter compound being formed from 4-tyrosol oxidation by aryl-dehydrogenases. Interestingly, similar results were obtained with other 4-HPA-induced bacteria, including P. aeruginosa, Serratia marcescens, Escherichia coli, Micrococcus luteus and other Halomonas, thus demonstrating general hydroxylating activity of 4-tyrosol by the HPAH enzyme. E. coli W did not have aryl-dehydrogenase activity and hence were unable to oxidize 4-tyrosol to 4-HPA and HTyr to 3,4-DHPA, making this bacterium a good candidate for achieving better HTyr production.

  7. Variability in the adaptive acid tolerance response phenotype of Salmonella enterica strains.

    PubMed

    Lianou, Alexandra; Nychas, George-John E; Koutsoumanis, Konstantinos P

    2017-04-01

    The objective of this study was the assessment of the stationary-phase, low-pH-inducible acid tolerance response (ATR) of different Salmonella enterica strains. For this purpose, 30 strains of the pathogen were grown in tryptone soy broth in the absence (non-adapted cultures) and presence (1% w/v; acid-adapted cultures) of glucose, and then subjected to 4-h acid challenge trials at pH 3.0. Surviving populations of each strain were determined at 1-h intervals, and the Weibull model was fitted to the derived microbiological data. Extensive variability in the acid stress responses of the tested S. enterica strains was observed, with the total population reductions (log CFU/ml) attained in 4 h of acid challenge ranging from 0.9 to 5.5 and from 0.6 to 7.0 for the non-adapted and acid-adapted cultures, respectively. As demonstrated by the model scale parameter δ and shape parameter p, the effect of acid adaptation on the inactivation curves was strain-specific. Although acid adaptation resulted in enhanced acid survival for the majority of the tested strains, there were strains exhibiting similar or decreased acid resistance compared to their non-adapted counterparts. Moreover, acid adaptation appeared to decrease the strain variability of δ whereas increasing the strain variability of p: the coefficient of variation of δ among the tested strains was 97.2 and 54.9% for the non-adapted and acid-adapted cultures, respectively, while the corresponding values for p were 12.7 and 48.1%. The data of the present study, which is the first one to systematically evaluate the adaptive ATR of multiple S. enterica strains, clearly demonstrate that this phenotype (attempted to be induced by growing the pathogen in the presence of glucose) is strain-dependent.

  8. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  9. Biodegradation of the Herbicide 2,4-Dichlorophenoxyacetic Acid by a New Isolated Strain of Achromobacter sp. LZ35.

    PubMed

    Xia, Zhen-Yuan; Zhang, Long; Zhao, Yan; Yan, Xin; Li, Shun-Peng; Gu, Tao; Jiang, Jian-Dong

    2017-02-01

    In this study, a bacterial strain of Achromobacter sp. LZ35, which was capable of utilizing 2,4-dichlorophenoxyacetic acid (2,4-D) and 2-methyl-4-chlorophenoxy acetic acid (MCPA) as the sole sources of carbon and energy for growth, was isolated from the soil in a disused pesticide factory in Suzhou, China. The optimal 2,4-D degradation by strain LZ35 occurred at 30 °C and pH 8.0 when the initial 2,4-D concentration was 200 mg L(-1). Strain LZ35 harbored the conserved 2,4-D/alpha-ketoglutarate dioxygenase (96%) and 2,4-dichlorophenol hydroxylase (99%), and catabolized 2,4-D via the intermediate 2,4-dichlorophenol. The inoculation of 7.8 × 10(6) CFU g(-1) soil of strain LZ35 cells to 2,4-D-contaminated soil could efficiently remove over 75 and 90% of 100 and 50 mg L(-1) 2,4-D in 12 days and significantly released the phytotoxicity of maize caused by the 2,4-D residue. This is the first report of an Achromobacter sp. strain that was capable of mineralizing both 2,4-D and MCPA. This study provides us a promising candidate for its application in the bioremediation of 2,4-D- or MCPA-contaminated sites.

  10. Seasonal variations in bacterial communities and antibiotic-resistant strains associated with green bottle flies (Diptera: Calliphoridae).

    PubMed

    Wei, Ting; Ishida, Ryuichi; Miyanaga, Kazuhiko; Tanji, Yasunori

    2014-05-01

    Green bottle flies occur frequently around human environments in Japan. Many species of green bottle flies have been studied with regard to their importance in forensic examinations or clinical therapies, but the bacterial communities associated with this group of flies have not been comprehensively investigated. In this research, 454 pyrosequencing was used to reveal the bacterial communities in green bottle flies collected in different seasons. Meanwhile, the bacteria were screened with selective media and tested for antibiotic susceptibility. Samples collected in three different seasons harbored distinctive bacterial communities. The predominant genera associated with green bottles flies were Staphylococcus in spring, Ignatzschineria in summer, and Vagococcus, Dysgonomonas, and an unclassified Acetobacteraceae in autumn. An upward trend in bacterial community diversity was observed from spring to autumn. Changes in climatic conditions could be the cause of these seasonal variations in fly-associated bacterial communities. The species of isolated antibiotic-resistant bacteria also differed across seasons, but it was difficult to correlate seasonal changes in antibiotic-resistant bacteria with changes in whole communities. A number of multiple-antibiotic-resistant bacteria were isolated, and some of these strains were closely affiliated with pathogens such as Enterococcus faecalis and Enterococcus faecium, which could cause serious threats to public health. Overall, this research provided us with information about the composition and seasonality of bacterial communities in green bottle flies, and highlighted the risks of fly-mediated dissemination of antibiotic-resistant pathogens.

  11. Selection of indigenous lactic acid bacteria to reinforce the intestinal microbiota of newly hatched chicken: relevance of in vitro and ex vivo methods for strains characterization.

    PubMed

    Babot, Jaime D; Argañaraz-Martínez, Eloy; Saavedra, Lucila; Apella, María C; Perez Chaia, Adriana

    2014-08-01

    Based on the natural benefits of the indigenous microbiota, lactic acid bacteria (LAB) from poultry origin were isolated from hens and broilers intestine, and their probiotic potential was further studied. The tolerance to digestion, adhesion, capture of a mannose-binding lectin, absence of virulent factors and antibiotic resistances were studied. Different in vitro and ex vivo assays were performed to select tolerant and adherent strains because standardized protocols have not been defined. Fourteen strains highly tolerant to gastrointestinal digestion were genetically identified. Hydrophobic surfaces were not required for the bacterial adhesion and only nine strains adhered ex vivo to the intestinal mucosa. Three strains captured a lectin of the same specificity of Type-1 fimbriae. Virulence factors were absent but some strains evidenced multiple antibiotic resistances. These results provide bases for a future standardization of methods for the selection of probiotic strains intended to reinforce the microbiota of newly hatched chickens.

  12. Genomic Encyclopedia of Bacterial and Archaeal Type Strains, Phase III: the genomes of soil and plant-associated and newly described type strains.

    PubMed

    Whitman, William B; Woyke, Tanja; Klenk, Hans-Peter; Zhou, Yuguang; Lilburn, Timothy G; Beck, Brian J; De Vos, Paul; Vandamme, Peter; Eisen, Jonathan A; Garrity, George; Hugenholtz, Philip; Kyrpides, Nikos C

    2015-01-01

    The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project was launched by the JGI in 2007 as a pilot project to sequence about 250 bacterial and archaeal genomes of elevated phylogenetic diversity. Herein, we propose to extend this approach to type strains of prokaryotes associated with soil or plants and their close relatives as well as type strains from newly described species. Understanding the microbiology of soil and plants is critical to many DOE mission areas, such as biofuel production from biomass, biogeochemistry, and carbon cycling. We are also targeting type strains of novel species while they are being described. Since 2006, about 630 new species have been described per year, many of which are closely aligned to DOE areas of interest in soil, agriculture, degradation of pollutants, biofuel production, biogeochemical transformation, and biodiversity.

  13. RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids

    PubMed Central

    Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A

    2012-01-01

    Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150

  14. Protease and lipase activities of fungal and bacterial strains derived from an artisanal raw ewe's milk cheese.

    PubMed

    Ozturkoglu-Budak, Sebnem; Wiebenga, Ad; Bron, Peter A; de Vries, Ronald P

    2016-11-21

    We previously identified the microbiota present during cheese ripening and observed high protease and lipase activity in Divle Cave cheese. To determine the contribution of individual isolates to enzyme activities, we investigated a range of species representing this microbiota for their proteolytic and lipolytic ability. In total, 17 fungal, 5 yeast and 18 bacterial strains, previously isolated from Divle Cave cheese, were assessed. Qualitative protease and lipase activities were performed on skim-milk agar and spirit-blue lipase agar, respectively, and resulted in a selection of strains for quantitative assays. For the quantitative assays, the strains were grown on minimal medium containing irradiated Divle Cave cheese, obtained from the first day of ripening. Out of 16 selected filamentous fungi, Penicillium brevicompactum, Penicillium cavernicola and Penicillium olsonii showed the highest protease activity, while Mucor racemosus was the best lipase producer. Yarrowia lipolytica was the best performing yeast with respect to protease and lipase activity. From the 18 bacterial strains, 14 and 11 strains, respectively showed protease and lipase activity in agar plates. Micrococcus luteus, Bacillus stratosphericus, Brevibacterium antiquum, Psychrobacter glacincola and Pseudomonas proteolytica displayed the highest protease and lipase activity. The proteases of yeast and filamentous fungi were identified as mainly aspartic protease by specific inhibition with Pepstatin A, whereas inhibition by PMSF (phenylmethylsulfonyl fluoride) indicated that most bacterial enzymes belong to serine type protease. Our results demonstrate that aspartic proteases, which usually have high milk clotting activity, are predominantly derived from fungal strains, and therefore fungal enzymes appear to be more suitable for use in the cheese industry. Microbial enzymes studied in this research might be alternatives for rennin (chymosin) from animal source because of their low cost and stable

  15. Characteristics of the high malic acid production mechanism in Saccharomyces cerevisiae sake yeast strain No. 28.

    PubMed

    Nakayama, Shunichi; Tabata, Ken; Oba, Takahiro; Kusumoto, Kenichi; Mitsuiki, Shinji; Kadokura, Toshimori; Nakazato, Atsumi

    2012-09-01

    We characterized a high malic acid production mechanism in sake yeast strain No. 28. No considerable differences in the activity of the enzymes that were involved in malic acid synthesis were observed between strain No. 28 and its parent strain, K1001. However, compared with strain K1001, which actively took up rhodamine 123 during staining, the cells of strain No. 28 were only lightly stained, even when cultured in high glucose concentrations. In addition, malic acid production by the respiratory-deficient strain of K1001 was 2.5-fold higher than that of the wild-type K1001 and wild-type No. 28. The findings of this study demonstrated that the high malic acid production by strain No. 28 is attributed to the suppression of mitochondrial activity.

  16. Draft Genome Sequence of Criibacterium bergeronii gen. nov., sp. nov., Strain CCRI-22567T, Isolated from a Vaginal Sample from a Woman with Bacterial Vaginosis

    PubMed Central

    Maheux, Andrée F.; Bérubé, Ève; Boudreau, Dominique K.; Raymond, Frédéric; Corbeil, Jacques; Roy, Paul H.

    2016-01-01

    Criibacterium bergeronii gen. nov., sp. nov., CCRI-22567 is the type strain of the new genus Criibacterium. The strain was isolated from a woman with bacterial vaginosis. The genome assembly comprised 2,384,460 bp, with 34.4% G+C content. This is the first genome announcement of a strain belonging to the genus Criibacterium. PMID:27587833

  17. Draft Genome Sequence of Criibacterium bergeronii gen. nov., sp. nov., Strain CCRI-22567T, Isolated from a Vaginal Sample from a Woman with Bacterial Vaginosis.

    PubMed

    Maheux, Andrée F; Bérubé, Ève; Boudreau, Dominique K; Raymond, Frédéric; Corbeil, Jacques; Roy, Paul H; Boissinot, Maurice; Omar, Rabeea F

    2016-09-01

    Criibacterium bergeronii gen. nov., sp. nov., CCRI-22567 is the type strain of the new genus Criibacterium The strain was isolated from a woman with bacterial vaginosis. The genome assembly comprised 2,384,460 bp, with 34.4% G+C content. This is the first genome announcement of a strain belonging to the genus Criibacterium.

  18. A genome-wide association study identifies a horizontally transferred bacterial surface adhesin gene associated with antimicrobial resistant strains

    PubMed Central

    Suzuki, Masato; Shibayama, Keigo; Yahara, Koji

    2016-01-01

    Carbapenems are a class of last-resort antibiotics; thus, the increase in bacterial carbapenem-resistance is a serious public health threat. Acinetobacter baumannii is one of the microorganisms that can acquire carbapenem-resistance; it causes severe nosocomial infection, and is notoriously difficult to control in hospitals. Recently, a machine-learning approach was first used to analyze the genome sequences of hundreds of susceptible and resistant A. baumannii strains, including those carrying commonly acquired resistant mechanisms, to build a classifier that can predict strain resistance. A complementary approach is to explore novel genetic elements that could be associated with the antimicrobial resistance of strains, independent of known mechanisms. Therefore, we carefully selected A. baumannii strains, spanning various genotypes, from public genome databases, and conducted the first genome-wide association study (GWAS) of carbapenem resistance. We employed a recently developed method, capable of identifying any kind of genetic variation and accounting for bacterial population structure, and evaluated its effectiveness. Our study identified a surface adhesin gene that had been horizontally transferred to an ancestral branch of A. baumannii, as well as a specific region of that gene that appeared to accumulate multiple individual variations across the different branches of carbapenem-resistant A. baumannii strains. PMID:27892531

  19. Pan-proteomics, a concept for unifying quantitative proteome measurements when comparing closely-related bacterial strains.

    PubMed

    Broadbent, James A; Broszczak, Daniel A; Tennakoon, Imalka U K; Huygens, Flavia

    2016-01-01

    The comparison of proteomes between genetically heterogeneous bacterial strains may offer valuable insights into physiological diversity and function, particularly where such variation aids in the survival and virulence of clinically-relevant strains. However, reports of such comparisons frequently fail to account for underlying genetic variance. As a consequence, the current knowledge regarding bacterial physiological diversity at the protein level may be incomplete or inaccurate. To address this, greater consideration must be given to the impact of genetic heterogeneity on proteome comparisons. This may be possible through the use of pan-proteomics, an analytical concept that permits the ability to qualitatively and quantitatively compare the proteomes of genetically heterogeneous organisms. Limited examples of this emerging technology highlight currently unmet analytical challenges. In this article we define pan-proteomics, where its value lies in microbiology, and discuss the technical considerations critical to its successful execution and potential future application.

  20. High-throughput genomic sequencing of cassava bacterial blight strains identifies conserved effectors to target for durable resistance.

    PubMed

    Bart, Rebecca; Cohn, Megan; Kassen, Andrew; McCallum, Emily J; Shybut, Mikel; Petriello, Annalise; Krasileva, Ksenia; Dahlbeck, Douglas; Medina, Cesar; Alicai, Titus; Kumar, Lava; Moreira, Leandro M; Rodrigues Neto, Júlio; Verdier, Valerie; Santana, María Angélica; Kositcharoenkul, Nuttima; Vanderschuren, Hervé; Gruissem, Wilhelm; Bernal, Adriana; Staskawicz, Brian J

    2012-07-10

    Cassava bacterial blight (CBB), incited by Xanthomonas axonopodis pv. manihotis (Xam), is the most important bacterial disease of cassava, a staple food source for millions of people in developing countries. Here we present a widely applicable strategy for elucidating the virulence components of a pathogen population. We report Illumina-based draft genomes for 65 Xam strains and deduce the phylogenetic relatedness of Xam across the areas where cassava is grown. Using an extensive database of effector proteins from animal and plant pathogens, we identify the effector repertoire for each sequenced strain and use a comparative sequence analysis to deduce the least polymorphic of the conserved effectors. These highly conserved effectors have been maintained over 11 countries, three continents, and 70 y of evolution and as such represent ideal targets for developing resistance strategies.

  1. High cell density propionic acid fermentation with an acid tolerant strain of Propionibacterium acidipropionici.

    PubMed

    Wang, Zhongqiang; Jin, Ying; Yang, Shang-Tian

    2015-03-01

    Propionic acid is an important chemical with wide applications and its production via fermentation is of great interest. However, economic production of bio-based propionic acid requires high product titer, yield, and productivity in the fermentation. A highly efficient and stable high cell density (HCD) fermentation process with cell recycle by centrifugation was developed for propionic acid production from glucose using an acid-tolerant strain of Propionibacterium acidipropionici, which had a higher specific growth rate, productivity, and acid tolerance compared to the wild type ATCC 4875. The sequential batch HCD fermentation at pH 6.5 produced propionic acid at a high titer of ∼40 g/L and productivity of 2.98 g/L h, with a yield of ∼0.44 g/g. The product yield increased to 0.53-0.62 g/g at a lower pH of 5.0-5.5, which, however, decreased the productivity to 1.28 g/L h. A higher final propionic acid titer of >55 g/L with a productivity of 2.23 g/L h was obtained in fed-batch HCD fermentation at pH 6.5. A 3-stage simulated fed-batch process in serum bottles produced 49.2 g/L propionic acid with a yield of 0.53 g/g and productivity of 0.66 g/L h. These productivities, yields and propionic acid titers were among the highest ever obtained in free-cell propionic acid fermentation.

  2. Colour removal from aqueous solutions of metal-complex azo dyes using bacterial cells of Shewanella strain J18 143.

    PubMed

    Li, Tie; Guthrie, James Thomas

    2010-06-01

    The decoloration treatment of textile dye effluents through biodegradation, using bacterial cells, has been studied as a possible means of solving some of the problems that are associated with the pollution of water sources by colorants. In this paper, the use of whole bacterial cells of Shewanella J18 143 for the reduction of aqueous solutions of selected mono-azo, metal-complex dyes, namely Irgalan Grey GLN, Irgalan Black RBLN and Irgalan Blue 3GL, was investigated. The effects of temperature, pH and dye concentration on colour removal were also investigated and shown to be important. The operative conditions for the removal of colour were 30 degrees C, at pH 6.8, with a final dye concentration of 0.12 g/L in the colour reduction system. This study provides an extension to the application of Shewanella strain J18 143 bacterial cells in the decoloration of textile wastewaters.

  3. Genome Sequence of a Copper-Resistant Strain of Acidovorax citrulli Causing Bacterial Fruit Blotch of Melons.

    PubMed

    Wang, Tielin; Yang, Yuwen; Zhao, Tingchang

    2015-04-23

    Bacterial fruit blotch (BFB) of melons is a seed-borne disease caused by Acidovorax citrulli. We determined the draft genome of A. citrulli Tw6. The strain was isolated from a watermelon collected from Beijing, China. The A. citrulli Tw6 genome contains 5,080,614 bp and has a G+C content of 68.7 mol%.

  4. Endozoicomonas genomes reveal functional adaptation and plasticity in bacterial strains symbiotically associated with diverse marine hosts

    PubMed Central

    Neave, Matthew J.; Michell, Craig T.; Apprill, Amy; Voolstra, Christian R.

    2017-01-01

    Endozoicomonas bacteria are globally distributed and often abundantly associated with diverse marine hosts including reef-building corals, yet their function remains unknown. In this study we generated novel Endozoicomonas genomes from single cells and metagenomes obtained directly from the corals Stylophora pistillata, Pocillopora verrucosa, and Acropora humilis. We then compared these culture-independent genomes to existing genomes of bacterial isolates acquired from a sponge, sea slug, and coral to examine the functional landscape of this enigmatic genus. Sequencing and analysis of single cells and metagenomes resulted in four novel genomes with 60–76% and 81–90% genome completeness, respectively. These data also confirmed that Endozoicomonas genomes are large and are not streamlined for an obligate endosymbiotic lifestyle, implying that they have free-living stages. All genomes show an enrichment of genes associated with carbon sugar transport and utilization and protein secretion, potentially indicating that Endozoicomonas contribute to the cycling of carbohydrates and the provision of proteins to their respective hosts. Importantly, besides these commonalities, the genomes showed evidence for differential functional specificity and diversification, including genes for the production of amino acids. Given this metabolic diversity of Endozoicomonas we propose that different genotypes play disparate roles and have diversified in concert with their hosts. PMID:28094347

  5. Addition of transcription activator-like effector binding sites to a pathogen strain-specific rice bacterial blight resistance gene makes it effective against additional strains and against bacterial leaf streak.

    PubMed

    Hummel, Aaron W; Doyle, Erin L; Bogdanove, Adam J

    2012-09-01

    Xanthomonas transcription activator-like (TAL) effectors promote disease in plants by binding to and activating host susceptibility genes. Plants counter with TAL effector-activated executor resistance genes, which cause host cell death and block disease progression. We asked whether the functional specificity of an executor gene could be broadened by adding different TAL effector binding elements (EBEs) to it. We added six EBEs to the rice Xa27 gene, which confers resistance to strains of the bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) that deliver the TAL effector AvrXa27. The EBEs correspond to three other effectors from Xoo strain PXO99(A) and three from strain BLS256 of the bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola (Xoc). Stable integration into rice produced healthy lines exhibiting gene activation by each TAL effector, and resistance to PXO99(A) , a PXO99(A) derivative lacking AvrXa27, and BLS256, as well as two other Xoo and 10 Xoc strains virulent toward wildtype Xa27 plants. Transcripts initiated primarily at a common site. Sequences in the EBEs were found to occur nonrandomly in rice promoters, suggesting an overlap with endogenous regulatory sequences. Thus, executor gene specificity can be broadened by adding EBEs, but caution is warranted because of the possible coincident introduction of endogenous regulatory elements.

  6. The strains recommended for use in the bacterial reverse mutation test (OECD guideline 471) can be certified as non-genetically modified organisms.

    PubMed

    Sugiyama, Kei-Ichi; Yamada, Masami; Awogi, Takumi; Hakura, Atsushi

    2016-01-01

    The bacterial reverse mutation test, commonly called Ames test, is used worldwide. In Japan, the genetically modified organisms (GMOs) are regulated under the Cartagena Domestic Law, and organisms obtained by self-cloning and/or natural occurrence would be exempted from the law case by case. The strains of Salmonella typhimurium and Escherichia coli recommended for use in the bacterial reverse mutation test (OECD guideline 471), have been considered as non-GMOs because they can be constructed by self-cloning or naturally occurring bacterial strains, or do not disturb the biological diversity. The present article explains the reasons why these tester strains should be classified as non-GMOs.

  7. Frequent major errors in antimicrobial susceptibility testing of bacterial strains distributed under the Deutsches Krebsforschungszentrum Quality Assurance Program.

    PubMed

    Boot, R

    2012-07-01

    The Quality Assurance Program (QAP) of the Deutsches Krebsforschungszentrum (DKFZ) was a proficiency testing system developed to service the laboratory animal discipline. The QAP comprised the distribution of bacterial strains from various species of animals for identification to species level and antibiotic susceptibility testing (AST). Identification capabilities were below acceptable standards. This study evaluated AST results using the DKFZ compilations of test results for all bacterial strains showing the number of participants reporting the strain as resistant (R), sensitive (S) or intermediate susceptible (I) to each antibiotic substance used. Due to lack of information about methods used, it was assumed that what the majority of the participants reported (R or S) was the correct test result and that an opposite result was a major error (ME). MEs occurred in 1375 of 14,258 (9.7%) of test results and ME% ranged from 0% to 23.2% per bacterial group-agent group combination. Considerable variation in MEs was found within groups of bacteria and within groups of agents. In addition to poor performance in proper species classification, the quality of AST in laboratory animal diagnostic laboratories seems far below standards considered acceptable in human diagnostic microbiology.

  8. Evaluation of insecticidal activity of a bacterial strain, Serratia sp. EML-SE1 against diamondback moth.

    PubMed

    Jeong, Hyung Uk; Mun, Hye Yeon; Oh, Hyung Keun; Kim, Seung Bum; Yang, Kwang Yeol; Kim, Iksoo; Lee, Hyang Burm

    2010-08-01

    To identify novel bioinsecticidal agents, a bacterial strain, Serratia sp. EML-SE1, was isolated from a dead larva of the lepidopteran diamondback moth (Plutella xylostella) collected from a cabbage field in Korea. In this study, the insecticidal activity of liquid cultures in Luria-Bertani broth (LBB) and nutrient broth (NB) of a bacterial strain, Serratia sp. EML-SE1 against thirty 3rd and 4th instar larvae of the diamondback moth was investigated on a Chinese cabbage leaf housed in a round plastic cage (Ø 10 x 6 cm). 72 h after spraying the cabbage leaf with LBB and NB cultures containing the bacterial strain, the mortalities of the larvae were determined to be 91.7% and 88.3%, respectively. In addition, the insecticidal activity on potted cabbage containing 14 leaves in a growth cage (165 x 83 x 124 cm) was found to be similar to that of the plastic cage experiment. The results of this study provided valuable information on the insecticidal activity of the liquid culture of a Serratia species against the diamondback moth.

  9. Biotransformation of p-coumaric acid and 2,4-dichlorophenoxy acetic acid by Azotobacter sp. strain SSB81.

    PubMed

    Gauri, Samiran S; Mandal, Santi M; Dey, Satyahari; Pati, Bikas R

    2012-12-01

    A comprehensive study was made on biotransformation of p-coumaric acid and 2,4-dichlorophenoxyacetic acid by an Azotobacter sp. strain SSB81. The strain was able to tolerate a high amount of both the phenolic acids and p-coumaric acid degraded maximum (50%) than 2,4-D (29%) after five days of incubation. The intermediate products during transformation have been identified and quantified using UV-Vis and LC-MS/MS analysis. Para-coumaric acid was degraded via p-hydroxybenzoic acid and protocatechuic acid, a non-oxidative pathway whereas 2,4-D via 4-chlorophenoxyacetic acid, 4-chlorophenol and 4-chlorocatechol, an oxidative pathway. The results suggest that SSB81 developed both the oxidative and non-oxidative pathway to degrade the soil accumulated phenolic acids. Thus, Azotobacter provides an advantage to reduce the toxic level of soil accumulated phenolic acids in addition to increase the soil fertility.

  10. Simultaneous Transport of Two Bacterial Strains in Intact Cores from Oyster, Virginia: Biological Effects and Numerical Modeling

    PubMed Central

    Dong, Hailiang; Rothmel, Randi; Onstott, Tullis C.; Fuller, Mark E.; DeFlaun, Mary F.; Streger, Sheryl H.; Dunlap, Robb; Fletcher, Madilyn

    2002-01-01

    The transport characteristics of two adhesion-deficient, indigenous groundwater strains, Comamonas sp. strain DA001 and Erwinia herbicola OYS2-A, were studied by using intact sediment cores (7 by 50 cm) from Oyster, Va. Both strains are gram-negative rods (1.10 by 0.56 and 1.56 by 0.46 μm, respectively) with strongly hydrophilic membranes and a slightly negative surface charge. The two strains exhibited markedly different behaviors when they were transported through granular porous sediment. To eliminate any effects of physical and chemical heterogeneity on bacterial transport and thus isolate the biological effect, the two strains were simultaneously injected into the same core. DA001 cells were metabolically labeled with 35S and tagged with a vital fluorescent stain, while OYS2-A cells were metabolically labeled with 14C. The fast decay of 35S allowed deconvolution of the two isotopes (and therefore the two strains). Dramatic differences in the transport behaviors were observed. The breakthrough of DA001 and the breakthrough of OYS2-A both occurred before the breakthrough of a conservative tracer (termed differential advection), with effluent recoveries of 55 and 30%, respectively. The retained bacterial concentration of OYS2-A in the sediment was twofold higher than that of DA001. Among the cell properties analyzed, the statistically significant differences between the two strains were cell length and diameter. The shorter, larger-diameter DA001 cells displayed a higher effluent recovery than the longer, smaller-diameter OYS2-A cells. CXTFIT modeling results indicated that compared to the DA001 cells, the OYS2-A cells experienced lower pore velocity, higher porosity, a higher attachment rate, and a lower detachment rate. All these factors may contribute to the observed differences in transport. PMID:11976080

  11. Implications of Genome-Based Discrimination between Clostridium botulinum Group I and Clostridium sporogenes Strains for Bacterial Taxonomy

    PubMed Central

    Weigand, Michael R.; Pena-Gonzalez, Angela; Shirey, Timothy B.; Broeker, Robin G.; Ishaq, Maliha K.; Konstantinidis, Konstantinos T.

    2015-01-01

    Taxonomic classification of Clostridium botulinum is based on the production of botulinum neurotoxin (BoNT), while closely related, nontoxic organisms are classified as Clostridium sporogenes. However, this taxonomic organization does not accurately mirror phylogenetic relationships between these species. A phylogenetic reconstruction using 2,016 orthologous genes shared among strains of C. botulinum group I and C. sporogenes clearly separated these two species into discrete clades which showed ∼93% average nucleotide identity (ANI) between them. Clustering of strains based on the presence of variable orthologs revealed 143 C. sporogenes clade-specific genetic signatures, a subset of which were further evaluated for their ability to correctly classify a panel of presumptive C. sporogenes strains by PCR. Genome sequencing of several C. sporogenes strains lacking these signatures confirmed that they clustered with C. botulinum strains in a core genome phylogenetic tree. Our analysis also identified C. botulinum strains that contained C. sporogenes clade-specific signatures and phylogenetically clustered with C. sporogenes strains. The genome sequences of two bont/B2-containing strains belonging to the C. sporogenes clade contained regions with similarity to a bont-bearing plasmid (pCLD), while two different strains belonging to the C. botulinum clade carried bont/B2 on the chromosome. These results indicate that bont/B2 was likely acquired by C. sporogenes strains through horizontal gene transfer. The genome-based classification of these species used to identify candidate genes for the development of rapid assays for molecular identification may be applicable to additional bacterial species that are challenging with respect to their classification. PMID:26048939

  12. Implications of Genome-Based Discrimination between Clostridium botulinum Group I and Clostridium sporogenes Strains for Bacterial Taxonomy.

    PubMed

    Weigand, Michael R; Pena-Gonzalez, Angela; Shirey, Timothy B; Broeker, Robin G; Ishaq, Maliha K; Konstantinidis, Konstantinos T; Raphael, Brian H

    2015-08-15

    Taxonomic classification of Clostridium botulinum is based on the production of botulinum neurotoxin (BoNT), while closely related, nontoxic organisms are classified as Clostridium sporogenes. However, this taxonomic organization does not accurately mirror phylogenetic relationships between these species. A phylogenetic reconstruction using 2,016 orthologous genes shared among strains of C. botulinum group I and C. sporogenes clearly separated these two species into discrete clades which showed ∼93% average nucleotide identity (ANI) between them. Clustering of strains based on the presence of variable orthologs revealed 143 C. sporogenes clade-specific genetic signatures, a subset of which were further evaluated for their ability to correctly classify a panel of presumptive C. sporogenes strains by PCR. Genome sequencing of several C. sporogenes strains lacking these signatures confirmed that they clustered with C. botulinum strains in a core genome phylogenetic tree. Our analysis also identified C. botulinum strains that contained C. sporogenes clade-specific signatures and phylogenetically clustered with C. sporogenes strains. The genome sequences of two bont/B2-containing strains belonging to the C. sporogenes clade contained regions with similarity to a bont-bearing plasmid (pCLD), while two different strains belonging to the C. botulinum clade carried bont/B2 on the chromosome. These results indicate that bont/B2 was likely acquired by C. sporogenes strains through horizontal gene transfer. The genome-based classification of these species used to identify candidate genes for the development of rapid assays for molecular identification may be applicable to additional bacterial species that are challenging with respect to their classification.

  13. Effects of remediation on the bacterial community of an acid mine drainage impacted stream.

    PubMed

    Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G

    2012-11-01

    Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage.

  14. Analysis of Known Bacterial Protein Vaccine Antigens Reveals Biased Physical Properties and Amino Acid Composition

    PubMed Central

    Mayers, Carl; Rowe, Sonya; Miller, Julie; Lingard, Bryan; Hayward, Sarah; Titball, Richard W.

    2003-01-01

    Many vaccines have been developed from live attenuated forms of bacterial pathogens or from killed bacterial cells. However, an increased awareness of the potential for transient side-effects following vaccination has prompted an increased emphasis on the use of sub-unit vaccines, rather than those based on whole bacterial cells. The identification of vaccine sub-units is often a lengthy process and bioinformatics approaches have recently been used to identify candidate protein vaccine antigens. Such methods ultimately offer the promise of a more rapid advance towards preclinical studies with vaccines. We have compared the properties of known bacterial vaccine antigens against randomly selected proteins and identified differences in the make-up of these two groups. A computer algorithm that exploits these differences allows the identification of potential vaccine antigen candidates from pathogenic bacteria on the basis of their amino acid composition, a property inherently associated with sub-cellular location. PMID:18629010

  15. Cellular fatty acid analysis as a potential tool for predicting mosquitocidal activity of Bacillus sphaericus strains.

    PubMed Central

    Frachon, E; Hamon, S; Nicolas, L; de Barjac, H

    1991-01-01

    Gas-liquid chromatography of fatty acid methyl esters and numerical analysis were carried out with 114 Bacillus sphaericus strains. Since only two clusters harbored mosquitocidal strains, this technique could be developed in screening programs to limit bioassays on mosquito larvae. It also allows differentiation of highly homologous strains. PMID:1781697

  16. Butyric acid from anaerobic fermentation of lignocellulosic biomass hydrolysates by Clostridium sp. strain RPT-4213

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel Clostridium sp. strain RPT-4213 was found producing butyrate under strict anaerobic conditions. This strain produced 9.47 g L-1 butyric acid from MRS media (0.48 g/g glucose). RPT-4213 was also used to ferment dilute acid pretreated hydrolysates including wheat straw (WSH), corn fiber (CFH...

  17. Isolation and characterization of a novel 2-methyl-4-chlorophenoxyacetic acid-degrading Enterobacter sp. strain SE08.

    PubMed

    Tan, Lin; Hu, Qiulong; Xiong, Xingyao; Su, Xiaojun; Huang, Yanning; Jiang, Ziwei; Zhou, Qingming; Zhao, Songyi; Zeng, Wei-ai

    2013-10-01

    A bacterial strain (SE08) capable of utilizing 2-methyl-4-chlorophenoxy acetic acid (MCPA) as the sole carbon and energy source for growth was isolated by continuous enrichment culturing in minimal salt medium (MSM) from a long term MCPA exposed soil. This bacterial strain was identified as Enterobacter sp. based on morphological, physiological and biochemical tests, as well as 16S rRNA sequence analysis. Its ability to degrade MCPA was determined using high performance liquid chromatography. The strain SE08 can tolerate unusually high MCPA concentrations (125-2000mg/L). The influences of culturing factors (initial concentration, pH, and temperature) on the bacterial growth and substrate degradation were studied. The results showed that the optimal MCPA degradation occurred at an MCPA concentration of 500mg/L, 30°C and pH 6.0. Under these conditions, 68.5 percent of MCPA in MSM was degraded by SE08, and the OD600nm reached 0.64 after culturing for 72h. The degradation of MCPA could be enhanced by addition of both carbon and nitrogen sources. At an initial MCPA concentration of 500mg/L, when 5g/L glucose and 2.5g/L yeast extract were added into the MSM media, the MCPA degradation was significantly increased to 83.8 percent, and OD600nm was increased to 1.09 after incubation at 30°C and pH 6.0 for 72h. This is the first study showing that an Enterobacter sp. strain is capable of degrading MCPA, which might provide a new approach for the remediation of MCPA contaminated soil and contribute to the limited knowledge about the function of Enterobacter species.

  18. Opsonic Antibodies to Enterococcus faecalis Strain 12030 Are Directed against Lipoteichoic Acid

    PubMed Central

    Theilacker, Christian; Kaczynski, Zbigniew; Kropec, Andrea; Fabretti, Francesca; Sange, Tatjana; Holst, Otto; Huebner, Johannes

    2006-01-01

    A teichoic acid (TA)-like polysaccharide in Enterococcus faecalis has previously been shown to induce opsonic antibodies that protect against bacteremia after active and passive immunization. Here we present new data providing a corrected structure of the antigen and the epitope against which the opsonic antibodies are directed. Capsular polysaccharide isolated from E. faecalis strain 12030 by enzymatic digestion of peptidoglycan and chromatography (enzyme-TA) was compared with lipoteichoic acid (LTA) extracted using butanol and purified by hydrophobic-interaction chromatography (BuOH-LTA). Structural determinations were carried out by chemical analysis and nuclear magnetic resonance spectroscopy. Antibody specificity was assessed by enzyme-linked immunosorbent assay and the opsonophagocytosis assay. After alanine ester hydrolysis, there was structural identity between enzyme-TA and BuOH-LTA of the TA-parts of the two molecules. The basic enterococcal LTA structure was confirmed: 1,3-poly(glycerol phosphate) nonstoichiometrically substituted at position C-2 of the glycerol residues with d-Ala and kojibiose. We also detected a novel substituent at position C-2, [d-Ala→6]-α-d-Glcp-(1→2-[d-Ala→6]-α-d-Glcp-1→). Antiserum raised against enzyme-TA bound equally well to BuOH-LTA and dealanylated BuOH-LTA as to the originally described enzyme-TA antigen. BuOH-LTA was a potent inhibitor of opsonophagocytic killing by the antiserum to enzyme-TA. Immunization with antibiotic-killed whole bacterial cells did not induce a significant proportion of antibodies directed against alanylated epitopes on the TA, and opsonic activity was inhibited completely by both alanylated and dealanylated BuOH-LTA. In summary, the E. faecalis strain 12030 enzyme-TA is structurally and immunologically identical to dealanylated LTA. Opsonic antibodies to E. faecalis 12030 are directed predominantly to nonalanylated epitopes on the LTA molecule. PMID:16988246

  19. Differential neutrophil responses to bacterial stimuli: Streptococcal strains are potent inducers of heparin-binding protein and resistin-release.

    PubMed

    Snäll, Johanna; Linnér, Anna; Uhlmann, Julia; Siemens, Nikolai; Ibold, Heike; Janos, Marton; Linder, Adam; Kreikemeyer, Bernd; Herwald, Heiko; Johansson, Linda; Norrby-Teglund, Anna

    2016-02-18

    Neutrophils are critical for the control of bacterial infections, but they may also contribute to disease pathology. Here we explore neutrophil responses, in particular the release of sepsis-associated factors heparin-binding protein (HBP) and resistin in relation to specific bacterial stimuli and sepsis of varying aetiology. Analyses of HBP and resistin in plasma of septic patients revealed elevated levels as compared to non-infected critically ill patients. HBP and resistin correlated significantly in septic patients, with the strongest association seen in group A streptococcal (GAS) cases. In vitro stimulation of human neutrophils revealed that fixed streptococcal strains induced significantly higher release of HBP and resistin, as compared to Staphylococcus aureus or Escherichia coli. Similarly, neutrophils stimulated with the streptococcal M1-protein showed a significant increase in co-localization of HBP and resistin positive granules as well as exocytosis of these factors, as compared to LPS. Using a GAS strain deficient in M1-protein expression had negligible effect on neutrophil activation, while a strain deficient in the stand-alone regulator MsmR was significantly less stimulatory as compared to its wild type strain. Taken together, the findings suggest that the streptococcal activation of neutrophils is multifactorial and involves, but is not limited to, proteins encoded by the FCT-locus.

  20. Introduction of a bacterial acetyl-CoA synthesis pathway improves lactic acid production in Saccharomyces cerevisiae.

    PubMed

    Song, Ji-Yoon; Park, Joon-Song; Kang, Chang Duk; Cho, Hwa-Young; Yang, Dongsik; Lee, Seunghyun; Cho, Kwang Myung

    2016-05-01

    Acid-tolerant Saccharomyces cerevisiae was engineered to produce lactic acid by expressing heterologous lactate dehydrogenase (LDH) genes, while attenuating several key pathway genes, including glycerol-3-phosphate dehydrogenase1 (GPD1) and cytochrome-c oxidoreductase2 (CYB2). In order to increase the yield of lactic acid further, the ethanol production pathway was attenuated by disrupting the pyruvate decarboxylase1 (PDC1) and alcohol dehydrogenase1 (ADH1) genes. Despite an increase in lactic acid yield, severe reduction of the growth rate and glucose consumption rate owing to the absence of ADH1 caused a considerable decrease in the overall productivity. In Δadh1 cells, the levels of acetyl-CoA, a key precursor for biologically applicable components, could be insufficient for normal cell growth. To increase the cellular supply of acetyl-CoA, we introduced bacterial acetylating acetaldehyde dehydrogenase (A-ALD) enzyme (EC 1.2.1.10) genes into the lactic acid-producing S. cerevisiae. Escherichia coli-derived A-ALD genes, mhpF and eutE, were expressed and effectively complemented the attenuated acetaldehyde dehydrogenase (ALD)/acetyl-CoA synthetase (ACS) pathway in the yeast. The engineered strain, possessing a heterologous acetyl-CoA synthetic pathway, showed an increased glucose consumption rate and higher productivity of lactic acid fermentation. The production of lactic acid was reached at 142g/L with production yield of 0.89g/g and productivity of 3.55gL(-1)h(-1) under fed-batch fermentation in bioreactor. This study demonstrates a novel approach that improves productivity of lactic acid by metabolic engineering of the acetyl-CoA biosynthetic pathway in yeast.

  1. Role of lauric acid-potassium hydroxide concentration on bacterial contamination of spray washed broiler carcasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A series of experiments were conducted to examine reductions in bacterial contamination of broiler carcasses washed in a spray cabinet with various concentrations of lauric acid (LA)-potassium hydroxide (KOH) solutions. Fifty eviscerated carcasses and 5 ceca were obtained from the processing line of...

  2. Conversion of lesquerolic acid to 14-oxo-11(Z)-eicosenoic acid by genetically variable Sphingobacterium multivorum strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We investigated new microbial systems for their ability to convert lesquerolic acid (LQA; 14-hydroxy-11(Z)-eicosenoic acid) to value-added products. A strain of Sphingobacterium multivorum (NRRL B-23212) was found previously to convert LQA to 14-oxo-11(Z)-eicosenoic acid (14-OEA), as determined by ...

  3. Protein Expression Profile of an Environmentally Important Bacterial Strain: the Chromate Response of Arthrobacter Species Strain FB24

    SciTech Connect

    Henne, Kristene L.; Turse, Joshua E.; Nakatsu, C. H.; Konopka, Allan

    2011-05-03

    The global proteomic response of Arthrobacter sp. strain FB24 to different levels of chromate stress was evaluated with both two-dimensional gel electrophoresis (2-DGE) and liquid chromatography coupled to tandem mass spectrometry (LC/LC-MS/MS) [Henne et al. 2009b]. Proteome coverage of 22% and 71% was obtained with 2-DGE and LC/LC-MS/MS, respectively. The strong response of strain FB24 to chromate suggests a condition of sulfur limitation, which could be driven by competition for the sulfate transporter by the structurally similar chromate ion. Additionally, the involvement of genes hypothesized to be directly involved in chromate resistance in strain FB24 was supported at the protein level.

  4. Rhodococcus sp. Strain CR-53 LipR, the First Member of a New Bacterial Lipase Family (Family X) Displaying an Unusual Y-Type Oxyanion Hole, Similar to the Candida antarctica Lipase Clan

    PubMed Central

    Bassegoda, Arnau; Pastor, F. I. Javier

    2012-01-01

    Bacterial lipases constitute the most important group of biocatalysts for synthetic organic chemistry. Accordingly, there is substantial interest in developing new valuable lipases. Considering the lack of information concerning the lipases of the genus Rhodococcus and taking into account the interest raised by the enzymes produced by actinomycetes, a search for putative lipase-encoding genes from Rhodococcus sp. strain CR-53 was performed. We isolated, cloned, purified, and characterized LipR, the first lipase described from the genus Rhodococcus. LipR is a mesophilic enzyme showing preference for medium-chain-length acyl groups without showing interfacial activation. It displays good long-term stability and high tolerance for the presence of ions and chemical agents in the reaction mixture. Amino acid sequence analysis of LipR revealed that it displays four unique amino acid sequence motifs that clearly separate it from any other previously described family of bacterial lipases. Using bioinformatics tools, LipR could be related only to several uncharacterized putative lipases from different bacterial origins, all of which display the four blocks of consensus amino acid sequence motifs that contribute to define a new family of bacterial lipases, namely, family X. Therefore, LipR is the first characterized member of the new bacterial lipase family X. Further confirmation of this new family of lipases was performed after cloning Burkholderia cenocepacia putative lipase, bearing the same conserved motifs and clustering in family X. Interestingly, all lipases grouping in the new bacterial lipase family X display a Y-type oxyanion hole, a motif conserved in the Candida antarctica lipase clan but never found among bacterial lipases. This observation contributes to confirm that LipR and its homologs belong to a new family of bacterial lipases. PMID:22226953

  5. Flexible bacterial strains that oxidize arsenite in anoxic or aerobic conditions and utilize hydrogen or acetate as alternative electron donors.

    PubMed

    Rodríguez-Freire, Lucía; Sun, Wenjie; Sierra-Alvarez, Reyes; Field, Jim A

    2012-02-01

    Arsenic is a carcinogenic compound widely distributed in the groundwater around the world. The fate of arsenic in groundwater depends on the activity of microorganisms either by oxidizing arsenite (As(III)), or by reducing arsenate (As(V)). Because of the higher toxicity and mobility of As(III) compared to As(V), microbial-catalyzed oxidation of As(III) to As(V) can lower the environmental impact of arsenic. Although aerobic As(III)-oxidizing bacteria are well known, anoxic oxidation of As(III) with nitrate as electron acceptor has also been shown to occur. In this study, three As(III)-oxidizing bacterial strains, Azoarcus sp. strain EC1-pb1, Azoarcus sp. strain EC3-pb1 and Diaphorobacter sp. strain MC-pb1, have been characterized. Each strain was tested for its ability to oxidize As(III) with four different electron acceptors, nitrate, nitrite, chlorate and oxygen. Complete As(III) oxidation was achieved with both nitrate and oxygen, demonstrating the novel ability of these bacterial strains to oxidize As(III) in either anoxic or aerobic conditions. Nitrate was only reduced to nitrite. Different electron donors were used to study their suitability in supporting nitrate reduction. Hydrogen and acetate were readily utilized by all the cultures. The flexibility of these As(III)-oxidizing bacteria to use oxygen and nitrate to oxidize As(III) as well as organic and inorganic substrates as alternative electron donors explains their presence in non-arsenic-contaminated environments. The findings suggest that at least some As(III)-oxidizing bacteria are flexible with respect to electron-acceptors and electron-donors and that they are potentially widespread in low arsenic concentration environments.

  6. Engineering Escherichia coli for biodiesel production utilizing a bacterial fatty acid methyltransferase.

    PubMed

    Nawabi, Parwez; Bauer, Stefan; Kyrpides, Nikos; Lykidis, Athanasios

    2011-11-01

    The production of low-cost biofuels in engineered microorganisms is of great interest due to the continual increase in the world's energy demands. Biodiesel is a renewable fuel that can potentially be produced in microbes cost-effectively. Fatty acid methyl esters (FAMEs) are a common component of biodiesel and can be synthesized from either triacylglycerol or free fatty acids (FFAs). Here we report the identification of a novel bacterial fatty acid methyltransferase (FAMT) that catalyzes the formation of FAMEs and 3-hydroxyl fatty acid methyl esters (3-OH-FAMEs) from the respective free acids and S-adenosylmethionine (AdoMet). FAMT exhibits a higher specificity toward 3-hydroxy free fatty acids (3-OH-FFAs) than FFAs, synthesizing 3-hydroxy fatty acid methyl esters (3-OH-FAMEs) in vivo. We have also identified bacterial members of the fatty acyl-acyl carrier protein (ACP) thioesterase (FAT) enzyme family with distinct acyl chain specificities. These bacterial FATs exhibit increased specificity toward 3-hydroxyacyl-ACP, generating 3-OH-FFAs, which can subsequently be utilized by FAMTs to produce 3-OH-FAMEs. PhaG (3-hydroxyacyl ACP:coenzyme A [CoA] transacylase) constitutes an alternative route to 3-OH-FFA synthesis; the coexpression of PhaG with FAMT led to the highest level of accumulation of 3-OH-FAMEs and FAMEs. The availability of AdoMet, the second substrate for FAMT, is an important factor regulating the amount of methyl esters produced by bacterial cells. Our results indicate that the deletion of the global methionine regulator metJ and the overexpression of methionine adenosyltransferase result in increased methyl ester synthesis.

  7. Developmental pathway for biofilm formation in curli-producing Escherichia coli strains: role of flagella, curli and colanic acid.

    PubMed

    Prigent-Combaret, C; Prensier, G; Le Thi, T T; Vidal, O; Lejeune, P; Dorel, C

    2000-08-01

    This work was performed to establish a model describing bacterial surface structures involved in biofilm development, in curli-overproducing Escherichia coli K-12 strains, at 30 degrees C, and in minimal growth medium. Using a genetic approach, in association with observations of sessile communities by light and electron microscopic techniques, the role of protein surface structures, such as flagella and curli, and saccharidic surface components, such as the E. coli exopolysaccharide, colanic acid, was determined. We show that, in the context of adherent ompR234 strains, (i) flagellar motility is not required for initial adhesion and biofilm development; (ii) both primary adhesion to inert surfaces and development of multilayered cell clusters require curli synthesis; (iii) curli display direct interactions with the substratum and form interbacterial bundles, allowing a cohesive and stable association of cells; and (iv) colanic acid does not appear critical for bacterial adhesion and further biofilm development but contributes to the biofilm architecture and allows for the formation of voluminous biofilms.

  8. Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo

    PubMed Central

    McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda

    2016-01-01

    ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099

  9. Endophytic Colonization of Potato (Solanum tuberosum L.) by a Novel Competent Bacterial Endophyte, Pseudomonas putida Strain P9, and Its Effect on Associated Bacterial Communities▿

    PubMed Central

    Andreote, Fernando Dini; de Araújo, Welington L.; de Azevedo, João L.; van Elsas, Jan Dirk; da Rocha, Ulisses Nunes; van Overbeek, Leonard S.

    2009-01-01

    Pseudomonas putida strain P9 is a novel competent endophyte from potato. P9 causes cultivar-dependent suppression of Phytophthora infestans. Colonization of the rhizoplane and endosphere of potato plants by P9 and its rifampin-resistant derivative P9R was studied. The purposes of this work were to follow the fate of P9 inside growing potato plants and to establish its effect on associated microbial communities. The effects of P9 and P9R inoculation were studied in two separate experiments. The roots of transplants of three different cultivars of potato were dipped in suspensions of P9 or P9R cells, and the plants were planted in soil. The fate of both strains was followed by examining colony growth and by performing PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Colonies of both strains were recovered from rhizoplane and endosphere samples of all three cultivars at two growth stages. A conspicuous band, representing P9 and P9R, was found in all Pseudomonas PCR-DGGE fingerprints for treated plants. The numbers of P9R CFU and the P9R-specific band intensities for the different replicate samples were positively correlated, as determined by linear regression analysis. The effects of plant growth stage, genotype, and the presence of P9R on associated microbial communities were examined by multivariate and unweighted-pair group method with arithmetic mean cluster analyses of PCR-DGGE fingerprints. The presence of strain P9R had an effect on bacterial groups identified as Pseudomonas azotoformans, Pseudomonas veronii, and Pseudomonas syringae. In conclusion, strain P9 is an avid colonizer of potato plants, competing with microbial populations indigenous to the potato phytosphere. Bacterization with a biocontrol agent has an important and previously unexplored effect on plant-associated communities. PMID:19329656

  10. NorB, an efflux pump in Staphylococcus aureus strain MW2, contributes to bacterial fitness in abscesses.

    PubMed

    Ding, Yanpeng; Onodera, Yoshikuni; Lee, Jean C; Hooper, David C

    2008-11-01

    While remaining a major problem in hospitals, Staphylococcus aureus is now spreading in communities. Strain MW2 (USA400 lineage) and other community methicillin-resistant S. aureus strains most commonly cause skin infections with abscess formation. Multidrug resistance (MDR) efflux pumps contribute to antimicrobial resistance but may also contribute to bacterial survival by removal of environmental toxins. In S. aureus, NorA, NorB, NorC, and Tet38 are chromosomally encoded efflux pumps whose overexpression can confer MDR to quinolones and other compounds (Nor pumps) or tetracyclines alone (Tet38), but the natural substrates of these pumps are not known. To determine the role of these efflux pumps in a natural environment in the absence of antibiotics, we used strain MW2 in a mouse subcutaneous abscess model and compared pump gene expression as determined by reverse transcription-PCR in the abscesses and in vitro. norB and tet38 were selectively upregulated in vivo more than 171- and 24-fold, respectively, whereas norA and norC were downregulated. These changes were associated with an increase in expression of mgrA, which encodes a transcriptional regulator known to affect pump gene expression. In competition experiments using equal inocula of a norB or tet38 mutant and parent strain MW2, each mutant exhibited growth defects of about two- to threefold in vivo. In complementation experiments, a single-copy insertion of norB (but not a single-copy insertion of tet38) in the attB site within geh restored the growth fitness of the norB mutant in vivo. Our findings indicate that some MDR pumps, like NorB, can facilitate bacterial survival when they are overexpressed in a staphylococcal abscess and may contribute to the relative resistance of abscesses to antimicrobial therapy, thus linking bacterial fitness and resistance in vivo.

  11. Inhibitory effects on bacterial growth and beta-ketoacyl-ACP reductase by different species of maple leaf extracts and tannic acid.

    PubMed

    Wu, Dan; Wu, Xiao-Dong; You, Xue-Fu; Ma, Xiao-Feng; Tian, Wei-Xi

    2010-01-01

    It is important to develop new antibiotics aimed at novel targets. The investigation found that the leaf extracts from five maples (Acer platanoides, Acer campestre, Acer rubrum, Acer saccharum and Acer truncatum Bunge collected in Denmark, Canada and China) and their component tannic acid displayed antibacterial ability against 24 standard bacteria strains with the minimum inhibitory concentration of 0.3-8.0 mg/mL. Unlike the standard antibiotic levofloxacin (LFX), these samples inhibited Gram-positive bacteria more effectively than they inhibited Gram-negative bacteria. These samples effectively inhibited two antidrug bacterial strains. The results show that these samples inhibit bacteria by a different mechanism from LFX. These samples potently inhibited b-ketoacyl-ACP reductase (FabG), which is an important enzyme in bacterial fatty acid synthesis. Tannic acid showed the strongest inhibition on FabG with a half inhibition concentration of 0.78 microM (0.81 microg/mL). Furthermore, tannic acid and two maple leaf extracts showed time-dependent irreversible inhibition of FabG. These three samples also exhibited better inhibition on bacteria. It is suggested that FabG is the antibacteria target of maple leaf extracts and tannic acid, and both reversible and irreversible inhibitions of FabG are important for the antibacterial effect.

  12. Analysis of Bacterial Diversity During Acetic Acid Fermentation of Tianjin Duliu Aged Vinegar by 454 Pyrosequencing.

    PubMed

    Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye

    2015-08-01

    The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process.

  13. Muramic Acid Measurements for Bacterial Investigations in Marine Environments by High-Pressure Liquid Chromatography

    PubMed Central

    Mimura, Toru; Romano, Jean-Claude

    1985-01-01

    Muramic acid, a constituent of procaryotic cell walls, was assayed by high-pressure liquid chromatography in samples from several marine environments (water column, surface microlayer, and sediment) and a bacterial culture. It is used as a microbial biomass indicator. The method gave a good separation of muramic acid from interfering compounds with satisfactory reproducibility. A pseudomonad culture had a muramic acid content of 4.7 × 10−10 to 5.3 × 10−10 μg per cell during growth. In natural water samples, highly significant relationships were found between muramic acid concentrations and bacterial numbers for populations of 108 to 1011 cells per liter. The muramic acid content in natural marine water decreased from 5.3 × 10−10 to 1.6 × 10−10 μg per cell with increasing depth. In coastal sediments exposed to sewage pollution, concentrations of muramic acid, ATP, organic carbon, and total amino acids displayed a parallel decrease with increasing distance from the sewage outlet. Advantages of muramic acid measurement by high-pressure liquid chromatography are its high sensitivity and reduction of preparation steps, allowing a short time analysis. PMID:16346848

  14. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  15. The Biofilm Lifestyle Involves an Increase in Bacterial Membrane Saturated Fatty Acids

    PubMed Central

    Dubois-Brissonnet, Florence; Trotier, Elsa; Briandet, Romain

    2016-01-01

    Biofilm formation on contact surfaces contributes to persistence of foodborne pathogens all along the food and feed chain. The specific physiological features of bacterial cells embedded in biofilms contribute to their high tolerance to environmental stresses, including the action of antimicrobial compounds. As membrane lipid adaptation is a vital facet of bacterial response when cells are submitted to harsh or unstable conditions, we focused here on membrane fatty acid composition of biofilm cells as compared to their free-growing counterparts. Pathogenic bacteria (Staphylococcus aureus, Listeria monocytogenes, Pseudomonas aeruginosa, Salmonella Typhimurium) were cultivated in planktonic or biofilm states and membrane fatty acid analyses were performed on whole cells in both conditions. The percentage of saturated fatty acids increases in biofilm cells in all cases, with a concomitant decrease of branched-chain fatty acids for Gram-positive bacteria, or with a decrease in the sum of other fatty acids for Gram-negative bacteria. We propose that increased membrane saturation in biofilm cells is an adaptive stress response that allows bacteria to limit exchanges, save energy, and survive. Reprogramming of membrane fluidity in biofilm cells might explain specific biofilm behavior including bacterial recalcitrance to biocide action. PMID:27840623

  16. d-Amino Acid Probes for Penicillin Binding Protein-based Bacterial Surface Labeling*

    PubMed Central

    Fura, Jonathan M.; Kearns, Daniel; Pires, Marcos M.

    2015-01-01

    Peptidoglycan is an essential and highly conserved mesh structure that surrounds bacterial cells. It plays a critical role in retaining a defined cell shape, and, in the case of pathogenic Gram-positive bacteria, it lies at the interface between bacterial cells and the host organism. Intriguingly, bacteria can metabolically incorporate unnatural d-amino acids into the peptidoglycan stem peptide directly from the surrounding medium, a process mediated by penicillin binding proteins (PBPs). Metabolic peptidoglycan remodeling via unnatural d-amino acids has provided unique insights into peptidoglycan biosynthesis of live bacteria and has also served as the basis of a synthetic immunology strategy with potential therapeutic implications. A striking feature of this process is the vast promiscuity displayed by PBPs in tolerating entirely unnatural side chains. However, the chemical space and physical features of this side chain promiscuity have not been determined systematically. In this report, we designed and synthesized a library of variants displaying diverse side chains to comprehensively establish the tolerability of unnatural d-amino acids by PBPs in both Gram-positive and Gram-negative organisms. In addition, nine Bacillus subtilis PBP-null mutants were evaluated with the goal of identifying a potential primary PBP responsible for unnatural d-amino acid incorporation and gaining insights into the temporal control of PBP activity. We empirically established the scope of physical parameters that govern the metabolic incorporation of unnatural d-amino acids into bacterial peptidoglycan. PMID:26499795

  17. The Biofilm Lifestyle Involves an Increase in Bacterial Membrane Saturated Fatty Acids.

    PubMed

    Dubois-Brissonnet, Florence; Trotier, Elsa; Briandet, Romain

    2016-01-01

    Biofilm formation on contact surfaces contributes to persistence of foodborne pathogens all along the food and feed chain. The specific physiological features of bacterial cells embedded in biofilms contribute to their high tolerance to environmental stresses, including the action of antimicrobial compounds. As membrane lipid adaptation is a vital facet of bacterial response when cells are submitted to harsh or unstable conditions, we focused here on membrane fatty acid composition of biofilm cells as compared to their free-growing counterparts. Pathogenic bacteria (Staphylococcus aureus, Listeria monocytogenes, Pseudomonas aeruginosa, Salmonella Typhimurium) were cultivated in planktonic or biofilm states and membrane fatty acid analyses were performed on whole cells in both conditions. The percentage of saturated fatty acids increases in biofilm cells in all cases, with a concomitant decrease of branched-chain fatty acids for Gram-positive bacteria, or with a decrease in the sum of other fatty acids for Gram-negative bacteria. We propose that increased membrane saturation in biofilm cells is an adaptive stress response that allows bacteria to limit exchanges, save energy, and survive. Reprogramming of membrane fluidity in biofilm cells might explain specific biofilm behavior including bacterial recalcitrance to biocide action.

  18. Biofilm bacterial community structure in streams affected by acid mine drainage.

    PubMed

    Lear, Gavin; Niyogi, Dev; Harding, Jon; Dong, Yimin; Lewis, Gillian

    2009-06-01

    We examined the bacterial communities of epilithic biofilms in 17 streams which represented a gradient ranging from relatively pristine streams to streams highly impacted by acid mine drainage (AMD). A combination of automated ribosomal intergenic spacer analysis with multivariate analysis and ordination provided a sensitive, high-throughput method to monitor the impact of AMD on stream bacterial communities. Significant differences in community structure were detected among neutral to alkaline (pH 6.7 to 8.3), acidic (pH 3.9 to 5.7), and very acidic (pH 2.8 to 3.5) streams. DNA sequence analysis revealed that the acidic streams were generally dominated by bacteria related to the iron-oxidizing genus Gallionella, while the organisms in very acidic streams were less diverse and included a high proportion of acidophilic eukaryotes, including taxa related to the algal genera Navicula and Klebsormidium. Despite the presence of high concentrations of dissolved metals (e.g., Al and Zn) and deposits of iron hydroxide in some of the streams studied, pH was the most important determinant of the observed differences in bacterial community variability. These findings confirm that any restoration activities in such systems must focus on dealing with pH as the first priority.

  19. Biomimetic synthesis of selenium nanospheres by bacterial strain JS-11 and its role as a biosensor for nanotoxicity assessment: a novel se-bioassay.

    PubMed

    Dwivedi, Sourabh; Alkhedhairy, Abdulaziz A; Ahamed, Maqusood; Musarrat, Javed

    2013-01-01

    Selenium nanoparticles (Se-NPs) were synthesized by green technology using the bacterial isolate Pseudomonas aeruginosa strain JS-11. The bacteria exhibited significant tolerance to selenite (SeO3(2-)) up to 100 mM concentration with an EC50 value of 140 mM. The spent medium (culture supernatant) contains the potential of reducing soluble and colorless SeO3(2-) to insoluble red elemental selenium (Se(0)) at 37°C. Characterization of red Se° product by use of UV-Vis spectroscopy, X-ray diffraction (XRD), atomic force microscopy (AFM) and transmission electron microscopy (TEM) with energy dispersive X-ray spectrum (EDX) analysis revealed the presence of stable, predominantly monodispersed and spherical selenium nanoparticles (Se-NPs) of an average size of 21 nm. Most likely, the metabolite phenazine-1-carboxylic acid (PCA) released by strain JS-11 in culture supernatant along with the known redox agents like NADH and NADH dependent reductases are responsible for biomimetic reduction of SeO3(2-) to Se° nanospheres. Based on the bioreduction of a colorless solution of SeO3(2-) to elemental red Se(0), a high throughput colorimetric bioassay (Se-Assay) was developed for parallel detection and quantification of nanoparticles (NPs) cytotoxicity in a 96 well format. Thus, it has been concluded that the reducing power of the culture supernatant of strain JS-11 could be effectively exploited for developing a simple and environmental friendly method of Se-NPs synthesis. The results elucidated that the red colored Se° nanospheres may serve as a biosensor for nanotoxicity assessment, contemplating the inhibition of SeO3(2-) bioreduction process in NPs treated bacterial cell culture supernatant, as a toxicity end point.

  20. Biomimetic Synthesis of Selenium Nanospheres by Bacterial Strain JS-11 and Its Role as a Biosensor for Nanotoxicity Assessment: A Novel Se-Bioassay

    PubMed Central

    Dwivedi, Sourabh; AlKhedhairy, Abdulaziz A.; Ahamed, Maqusood; Musarrat, Javed

    2013-01-01

    Selenium nanoparticles (Se-NPs) were synthesized by green technology using the bacterial isolate Pseudomonas aeruginosa strain JS-11. The bacteria exhibited significant tolerance to selenite (SeO32−) up to 100 mM concentration with an EC50 value of 140 mM. The spent medium (culture supernatant) contains the potential of reducing soluble and colorless SeO32− to insoluble red elemental selenium (Se0) at 37°C. Characterization of red Se° product by use of UV-Vis spectroscopy, X-ray diffraction (XRD), atomic force microscopy (AFM) and transmission electron microscopy (TEM) with energy dispersive X-ray spectrum (EDX) analysis revealed the presence of stable, predominantly monodispersed and spherical selenium nanoparticles (Se-NPs) of an average size of 21 nm. Most likely, the metabolite phenazine-1-carboxylic acid (PCA) released by strain JS-11 in culture supernatant along with the known redox agents like NADH and NADH dependent reductases are responsible for biomimetic reduction of SeO32− to Se° nanospheres. Based on the bioreduction of a colorless solution of SeO32− to elemental red Se0, a high throughput colorimetric bioassay (Se-Assay) was developed for parallel detection and quantification of nanoparticles (NPs) cytotoxicity in a 96 well format. Thus, it has been concluded that the reducing power of the culture supernatant of strain JS-11 could be effectively exploited for developing a simple and environmental friendly method of Se-NPs synthesis. The results elucidated that the red colored Se° nanospheres may serve as a biosensor for nanotoxicity assessment, contemplating the inhibition of SeO32− bioreduction process in NPs treated bacterial cell culture supernatant, as a toxicity end point. PMID:23483909

  1. Innovative use of a bacterial enzyme involved in sialic acid degradation to initiate sialic acid biosynthesis in glycoengineered insect cells

    PubMed Central

    Geisler, Christoph; Jarvis, Donald L.

    2012-01-01

    The baculovirus/insect cell system is widely used for recombinant protein production, but it is suboptimal for recombinant glycoprotein production because it does not provide sialylation, which is an essential feature of many glycoprotein biologics. This problem has been addressed by metabolic engineering, which has extended endogenous insect cell N-glycosylation pathways and enabled glycoprotein sialylation by baculovirus/insect cell systems. However, further improvement is needed because even the most extensively engineered baculovirus/insect cell systems require media supplementation with N-acetylmannosamine, an expensive sialic acid precursor, for efficient recombinant glycoprotein sialylation. Our solution to this problem focused on E. coli N-acetylglucosamine-6-phosphate 2′-epimerase (GNPE), which normally functions in bacterial sialic acid degradation. Considering that insect cells have the product, but not the substrate for this enzyme, we hypothesized that GNPE might drive the reverse reaction in these cells, thereby initiating sialic acid biosynthesis in the absence of media supplementation. We tested this hypothesis by isolating transgenic insect cells expressing E. coli GNPE together with a suite of mammalian genes needed for N-glycoprotein sialylation. Various assays showed that these cells efficiently produced sialic acid, CMP-sialic acid, and sialylated recombinant N-glycoproteins even in growth media without N-acetylmannosamine. Thus, this study demonstrated that a eukaryotic recombinant protein production platform can be glycoengineered with a bacterial gene, that a bacterial enzyme which normally functions in sialic acid degradation can be used to initiate sialic acid biosynthesis, and that insect cells expressing this enzyme can produce sialylated N-glycoproteins without N-acetylmannosamine supplementation, which will reduce production costs in glycoengineered baculovirus/insect cell systems. PMID:23022569

  2. Dietary Fatty Acids and Immune Response to Food-Borne Bacterial Infections

    PubMed Central

    Harrison, Lisa M.; Balan, Kannan V.; Babu, Uma S.

    2013-01-01

    Functional innate and acquired immune responses are required to protect the host from pathogenic bacterial infections. Modulation of host immune functions may have beneficial or deleterious effects on disease outcome. Different types of dietary fatty acids have been shown to have variable effects on bacterial clearance and disease outcome through suppression or activation of immune responses. Therefore, we have chosen to review research across experimental models and food sources on the effects of commonly consumed fatty acids on the most common food-borne pathogens, including Salmonella sp., Campylobacter sp., Shiga toxin-producing Escherichia coli, Shigella sp., Listeria monocytogenes, and Staphylococcus aureus. Altogether, the compilation of literature suggests that no single fatty acid is an answer for protection from all food-borne pathogens, and further research is necessary to determine the best approach to improve disease outcomes. PMID:23698167

  3. Isotope composition of sulphate in acid mine drainage as measure of bacterial oxidation

    USGS Publications Warehouse

    Taylor, B.E.; Wheeler, M.C.; Nordstrom, D.K.

    1984-01-01

    The formation of acid waters by oxidation of pyrite-bearing ore deposits, mine tailing piles, and coal measures is a complex biogeochemical process and is a serious environmental problem. We have studied the oxygen and sulphur isotope geochemistry of sulphides, sulphur, sulphate and water in the field and in experiments to identify sources of oxygen and reaction mechanisms of sulphate formation. Here we report that the oxygen isotope composition of sulphate in acid mine drainage shows a large variation due to differing proportions of atmospheric- and water-derived oxygen from both chemical and bacterially-mediated oxidation. 18O-enrichment of sulphate results from pyrite oxidation facilitated by Thiobacillus ferrooxidans in aerated environments. Oxygen isotope analysis may therefore be useful in monitoring the effectiveness of abatement programmes designed to inhibit bacterial oxidation. Sulphur isotopes show no significant fractionation between pyrite and sulphate, indicating the quantitative insignificance of intermediate oxidation states of sulphur under acid conditions. ?? 1984 Nature Publishing Group.

  4. Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications.

    PubMed

    Friedrich, Valentin; Janesch, Bettina; Windwarder, Markus; Maresch, Daniel; Braun, Matthias L; Megson, Zoë A; Vinogradov, Evgeny; Goneau, Marie-France; Sharma, Ashu; Altmann, Friedrich; Messner, Paul; Schoenhofen, Ian C; Schäffer, Christina

    2016-12-16

    Tannerella forsythia is an anaerobic, Gram-negative periodontal pathogen. A unique O-linked oligosaccharide decorates the bacterium's cell surface proteins and was shown to modulate the host immune response. In our study, we investigated the biosynthesis of the nonulosonic acid (NulO) present at the terminal position of this glycan. A bioinformatic analysis of T. forsythia genomes revealed a gene locus for the synthesis of pseudaminic acid (Pse) in the type strain ATCC 43037 while strains FDC 92A2 and UB4 possess a locus for the synthesis of legionaminic acid (Leg) instead. In contrast to the NulO in ATCC 43037, which has been previously identified as a Pse derivative (5-N-acetimidoyl-7-N-glyceroyl-3,5,7,9-tetradeoxy-l-glycero-l-manno-NulO), glycan analysis of strain UB4 performed in this study indicated a 350-Da, possibly N-glycolyl Leg (3,5,7,9-tetradeoxy-d-glycero-d-galacto-NulO) derivative with unknown C5,7 N-acyl moieties. We have expressed, purified and characterized enzymes of both NulO pathways to confirm these genes' functions. Using capillary electrophoresis (CE), CE-mass spectrometry and NMR spectroscopy, our studies revealed that Pse biosynthesis in ATCC 43037 essentially follows the UDP-sugar route described in Helicobacter pylori, while the pathway in strain FDC 92A2 corresponds to Leg biosynthesis in Campylobacter jejuni involving GDP-sugar intermediates. To demonstrate that the NulO biosynthesis enzymes are functional in vivo, we created knockout mutants resulting in glycans lacking the respective NulO. Compared to the wild-type strains, the mutants exhibited significantly reduced biofilm formation on mucin-coated surfaces, suggestive of their involvement in host-pathogen interactions or host survival. This study contributes to understanding possible biological roles of bacterial NulOs.

  5. Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications

    PubMed Central

    Windwarder, Markus; Maresch, Daniel; Braun, Matthias L.; Megson, Zoë A.; Vinogradov, Evgeny; Goneau, Marie-France; Sharma, Ashu; Altmann, Friedrich; Messner, Paul; Schoenhofen, Ian C.; Schäffer, Christina

    2017-01-01

    Tannerella forsythia is an anaerobic, Gram-negative periodontal pathogen. A unique O-linked oligosaccharide decorates the bacterium’s cell surface proteins and was shown to modulate the host immune response. In our study, we investigated the biosynthesis of the nonulosonic acid (NulO) present at the terminal position of this glycan. A bioinformatic analysis of T. forsythia genomes revealed a gene locus for the synthesis of pseudaminic acid (Pse) in the type strain ATCC 43037 while strains FDC 92A2 and UB4 possess a locus for the synthesis of legionaminic acid (Leg) instead. In contrast to the NulO in ATCC 43037, which has been previously identified as a Pse derivative (5-N-acetimidoyl-7-N-glyceroyl-3,5,7,9-tetradeoxy-l-glycero-l-manno-NulO), glycan analysis of strain UB4 performed in this study indicated a 350-Da, possibly N-glycolyl Leg (3,5,7,9-tetradeoxy-d-glycero-d-galacto-NulO) derivative with unknown C5,7 N-acyl moieties. We have expressed, purified and characterized enzymes of both NulO pathways to confirm these genes’ functions. Using capillary electrophoresis (CE), CE–mass spectrometry and NMR spectroscopy, our studies revealed that Pse biosynthesis in ATCC 43037 essentially follows the UDP-sugar route described in Helicobacter pylori, while the pathway in strain FDC 92A2 corresponds to Leg biosynthesis in Campylobacter jejuni involving GDP-sugar intermediates. To demonstrate that the NulO biosynthesis enzymes are functional in vivo, we created knockout mutants resulting in glycans lacking the respective NulO. Compared to the wild-type strains, the mutants exhibited significantly reduced biofilm formation on mucin-coated surfaces, suggestive of their involvement in host-pathogen interactions or host survival. This study contributes to understanding possible biological roles of bacterial NulOs. PMID:27986835

  6. Bacterial dehalogenation of halogenated alkanes and fatty acids.

    PubMed Central

    Omori, T; Alexander, M

    1978-01-01

    Sewage samples dehalogenated 1,9-dichloronane, 1-chloroheptane, and 6-bromohexanoate, but an organism able to use 1,9-dichlorononane as the sole carbon source could not be isolated from these samples. Resting cells of Pseudomonas sp. grown on n-undecane, but not cells grown on glycerol, dehalogenated 1,9-dichlorononane in the presence of chloramphenicol. Resting cells of five other n-undecane-utilizing bacteria cleaved the halogen from dichlorononane and 6-bromohexanoate, and four dehalogenated 1-chloroheptane; however, none of these organisms used 1,9-dichlorononane for growth. By contrast, four benzoate-utilizing bacteria removed bromine from 6-bromohexanoate but had little or no activity on the chlorinated hydrocarbons. Incubation of sewage with 1,9-dichlorononane increased its subsequent capacity to dehalogenate 1,9-dichlorononane and 6-bromohexanoate but not 1-chloroheptane. A soil isolate could dehalogenate several dichloralkanes, three halogenated heptanes, and halogen-containing fatty acids. An enzyme preparation from this bacterium released chloride from 1,9-dichlorononane. PMID:655703

  7. Biomineralization of calcium carbonate polymorphs by the bacterial strains isolated from calcareous sites.

    PubMed

    Dhami, Navdeep Kaur; Reddy, M Sudhakara; Mukherjee, Abhijit

    2013-05-01

    Microbially induced calcium carbonate precipitation (MICCP) is a naturally occurring biological process that has various applications in remediation and restoration of a range of building materials. In the present investigation, five ureolytic bacterial isolates capable of inducing calcium carbonate precipitation were isolated from calcareous soils on the basis of production of urease, carbonic anhydrase, extrapolymeric substances, and biofilm. Bacterial isolates were identified as Bacillus megaterium, B. cereus, B. thuringiensis, B. subtilis, and Lysinibacillus fusiformis based on 16S rRNA analysis. The calcium carbonate polymorphs produced by various bacterial isolates were analyzed by scanning electron microscopy, confocal laser scanning microscopy, X ray diffraction, and Fourier transmission infra red spectroscopy. A strainspecific precipitation of calcium carbonate forms was observed from different bacterial isolates. Based on the type of polymorph precipitated, the technology of MICCP can be applied for remediation of various building materials.

  8. Production and characterization of bacterial cellulose membranes with hyaluronic acid from chicken comb.

    PubMed

    de Oliveira, Sabrina Alves; da Silva, Bruno Campos; Riegel-Vidotti, Izabel Cristina; Urbano, Alexandre; de Sousa Faria-Tischer, Paula Cristina; Tischer, Cesar Augusto

    2017-04-01

    The bacterial cellulose (BC), from Gluconacetobacter hansenii, is a biofilm with a high degree of crystallinity that can be used for therapeutic purposes and as a candidate for healing wounds. Hyaluronic acid (HA) is a constitutive polysaccharide found in the extracellular matrix and is a material used in tissue engineering and scaffolding for tissue regeneration. In this study, polymeric composites were produced in presence of hyaluronic acid isolated from chicken comb on different days of fermentation, specifically on the first (BCHA-SABT0) and third day (BCHA-SABT3) of fermentation. The structural characteristics, thermal stability and molar mass of hyaluronic acid from chicken comb were evaluated. Native membrane and polymeric composites were characterized with respect to their morphology and crystallinity. The optimized process of extraction and purification of hyaluronic acid resulted in low molar mass hyaluronic acid with structural characteristics similar to the standard commercial hyaluronic acid. The results demonstrate that the polymeric composites (BC/HA-SAB) can be produced in situ. The membranes produced on the third day presented better incorporation of HA-SAB between cellulose microfiber, resulting in membranes with higher thermal stability, higher roughness and lower crystallinity. The biocompatiblily of bacterial cellulose and the importance of hyaluronic acid as a component of extracellular matrix qualify the polymeric composites as promising biomaterials for tissue engineering.

  9. Evaluation of toxic effects of several carboxylic acids on bacterial growth by toxicodynamic modelling

    PubMed Central

    2011-01-01

    Background Effects of organic acids on microbial fermentation are commonly tested in investigations about metabolic behaviour of bacteria. However, they typically provide only descriptive information without modelling the influence of acid concentrations on bacterial kinetics. Results We developed and applied a mathematical model (secondary model) to capture the toxicological effects of those chemicals on kinetic parameters that define the growth of bacteria in batch cultures. Thus, dose-response kinetics were performed with different bacteria (Leuconostoc mesenteroides, Carnobacterium pisicola, Escherichia coli, Bacillus subtilis and Listonella anguillarum) exposed at increasing concentrations of individual carboxylic acids (formic, acetic, propionic, butyric and lactic). In all bioassays the acids affected the maximum bacterial load (Xm) and the maximum growth rate (vm) but only in specific cases the lag phase (λ) was modified. Significance of the parameters was always high and in all fermentations the toxicodynamic equation was statistically consistent and had good predictability. The differences between D and L-lactic acid effects were significant for the growth of E. coli, L. mesenteroides and C. piscicola. In addition, a global parameter (EC50,τ) was used to compare toxic effects and provided a realistic characterization of antimicrobial agents using a single value. Conclusions The effect of several organic acids on the growth of different bacteria was accurately studied and perfectly characterized by a bivariate equation which combines the basis of dose-response theory with microbial growth kinetics (secondary model). The toxicity of carboxylic acids was lower with the increase of the molecular weight of these chemicals. PMID:22118421

  10. Identification of a New Marine Bacterial Strain SD8 and Optimization of Its Culture Conditions for Producing Alkaline Protease.

    PubMed

    Cui, Hongxia; Yang, Muyang; Wang, Liping; Xian, Cory J

    2015-01-01

    While much attention has been given to marine microorganisms for production of enzymes, which in general are relatively more stable and active compared to those from plants and animals, studies on alkaline protease production from marine microorganisms have been very limited. In the present study, the alkaline protease producing marine bacterial strain SD8 isolated from sea muds in the Geziwo Qinhuangdao sea area of China was characterized and its optimal culture conditions were investigated. Strain SD8 was initially classified to belong to genus Pseudomonas by morphological, physiological and biochemical characterizations, and then through 16S rDNA sequence it was identified to be likely Pseudomonas hibiscicola. In addition, the culture mediums, carbon sources and culture conditions of strain SD8 were optimized for maximum production of alkaline protease. Optimum enzyme production (236U/mL when cultured bacteria being at 0.75 mg dry weight/mL fermentation broth) was obtained when the isolate at a 3% inoculum size was grown in LB medium at 20 mL medium/100mL Erlenmeyer flask for 48h culture at 30°C with an initial of pH 7.5. This was the first report of strain Pseudomonas hibiscicola secreting alkaline protease, and the data for its optimal cultural conditions for alkaline protease production has laid a foundation for future exploration for the potential use of SD8 strain for alkaline protease production.

  11. Identification of a New Marine Bacterial Strain SD8 and Optimization of Its Culture Conditions for Producing Alkaline Protease

    PubMed Central

    Cui, Hongxia; Yang, Muyang; Wang, Liping; Xian, Cory J.

    2015-01-01

    While much attention has been given to marine microorganisms for production of enzymes, which in general are relatively more stable and active compared to those from plants and animals, studies on alkaline protease production from marine microorganisms have been very limited. In the present study, the alkaline protease producing marine bacterial strain SD8 isolated from sea muds in the Geziwo Qinhuangdao sea area of China was characterized and its optimal culture conditions were investigated. Strain SD8 was initially classified to belong to genus Pseudomonas by morphological, physiological and biochemical characterizations, and then through 16S rDNA sequence it was identified to be likely Pseudomonas hibiscicola. In addition, the culture mediums, carbon sources and culture conditions of strain SD8 were optimized for maximum production of alkaline protease. Optimum enzyme production (236U/mL when cultured bacteria being at 0.75 mg dry weight/mL fermentation broth) was obtained when the isolate at a 3% inoculum size was grown in LB medium at 20 mL medium/100mL Erlenmeyer flask for 48h culture at 30°C with an initial of pH 7.5. This was the first report of strain Pseudomonas hibiscicola secreting alkaline protease, and the data for its optimal cultural conditions for alkaline protease production has laid a foundation for future exploration for the potential use of SD8 strain for alkaline protease production. PMID:26716833

  12. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain.

    PubMed

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Abbott, James; Micklem, Chris N; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-06-14

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology.

  13. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain

    PubMed Central

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Micklem, Chris N.; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S.; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-01-01

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae. Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology. PMID:27247386

  14. Biodegradation and detoxification of melanoidin from distillery effluent using an aerobic bacterial strain SAG5 of Alcaligenes faecalis.

    PubMed

    Santal, Anita Rani; Singh, N P; Saharan, Baljeet Singh

    2011-10-15

    Distillery effluent retains very dark brown color even after anaerobic treatment due to presence of various water soluble, recalcitrant and coloring compounds mainly melanoidins. In laboratory conditions, melanoidin decolorizing bacteria was isolated and optimized the cultural conditions at various incubation temperatures, pH, carbon sources, nitrogen sources and combined effect of both carbon and nitrogen sources. The optimum decolorization (72.6 ± 0.56%) of melanoidins was achieved at pH 7.5 and temperature 37 °C on 5th day of cultivation. The toxicity evaluation with mung bean (Vigna radiata) revealed that the raw distillery effluent was environmentally highly toxic as compared to biologically treated distillery effluent, which indicated that the effluent after bacterial treatment is environmentally safe. This proves to be novel biological treatment technique for biodegradation and detoxification of melanoidin from distillery effluent using the bacterial strain SAG(5).

  15. Standoff laser-induced fluorescence of suspensions from different bacterial strains

    NASA Astrophysics Data System (ADS)

    Duschek, Frank; Walter, Arne; Fellner, Lea; Grünewald, Karin; Pargmann, Carsten; Handke, Jürgen; Tomaso, Herbert

    2016-10-01

    Biological hazardous substances like certain fungi and bacteria represent a high risk for the broad public if fallen into wrong hands. Incidents based on bio agents are commonly considered to have incalculable and complex consequences for first responders and people. The impact of such an event can be minimized by a combination of different sensor technologies that have been developed to detect bio-threats and to gather information after an incident. Sensors for bio-agents can be grouped into two categories. Sampling devices collect material from locations supposed to be contaminated, and they are able to identify biological material with high sensitivity and selectivity. However, these point sensors need to be positioned correctly in advance of an attack, and moving sources of biological material cannot be tracked. A different approach is based on optical standoff detection. For biological samples laser induced florescence (LIF) has been proven to get real time data on location and type of hazards without being in contact with the suspicious substance. This work is based on a bio-detector developed at the DLR Lampoldshausen. The LIF detection has been designed for outdoor operation at standoff distances from 20 m up to more than 100 m. The detector acquires LIF spectral data for two different excitation wavelengths (280 and 355 nm) as well as time resolved information for the fluorescence decay which can be used to classify suspicious samples. While the classification device had been trained on uncritical samples (like amino acids, NADH, yeast, chemicals, oils), this work presents the progress to more relevant, living bacteria of different strains. The low risk and non-pathogenic bacteria Bacillus thuringensis, Bacillus atrophaeus, Bacillus subtilis, Brevibacillus brevis, Micrococcus luteus, Oligella urethralis, Paenibacillus polymyxa and Escherichia coli (K12) have been investigated with the above set-up at both excitation wavelengths

  16. Differential malic acid degradation by selected strains of Saccharomyces during alcoholic fermentation.

    PubMed

    Redzepovic, S; Orlic, S; Majdak, A; Kozina, B; Volschenk, H; Viljoen-Bloom, M

    2003-05-25

    To produce a high-quality wine, it is important to obtain a fine balance between the various chemical constituents, especially between the sugar and acid content. The latter is more difficult to achieve in wines that have high acidity due to excess malic acid, since wine yeast in general cannot effectively degrade malic acid during alcoholic fermentation. An indigenous Saccharomyces paradoxus strain RO88 was able to degrade 38% of the malic acid in Chardonnay must and produced a wine of good quality. In comparison, Schizosaccharomyces pombe strain F effectively removed 90% of the malic acid, but did not produce a good-quality wine. Although commercially promoted as a malic-acid-degrading wine yeast strain, only 18% of the malic acid was degraded by Saccharomyces cerevisiae Lalvin strain 71B. Preliminary studies on the transcriptional regulation of the malic enzyme gene from three Saccharomyces strains, i.e. S. paradoxus RO88, S. cerevisiae 71B and Saccharomyces bayanus EC1118, were undertaken to elucidate the differences in their ability to degrade malic acid. Expression of the malic enzyme gene from S. paradoxus RO88 and S. cerevisiae 71B increased towards the end of fermentation once glucose was depleted, whereas no increase in transcription was observed for S. bayanus EC1118 which was also unable to effectively degrade malic acid.

  17. Similar bacterial community composition in acidic mining lakes with different pH and lake chemistry.

    PubMed

    Kampe, Heike; Dziallas, Claudia; Grossart, Hans-Peter; Kamjunke, Norbert

    2010-10-01

    As extreme environmental conditions strongly affect bacterial community composition (BCC), we examined whether differences in pH-even at low pH-and in iron and sulfate concentrations lead to changes in BCC of acidic mining lakes. Thereby, we tested the following hypotheses: (1) diversity of the bacterial community in acidic lakes decreases with reducing pH, (2) BCC differs between epilimnion and hypolimnion, and (3) BCC in extremely acidic environments does not vary much over time. Therefore, we investigated the BCC of three acidic lakes with different pH values (2.3, 2.7, and 3.2) by denaturing gradient gel electrophoresis (DGGE) and subsequent sequencing of DGGE bands as well as catalyzed reporter deposition-FISH (CARD-FISH). BCC did not significantly vary among the studied lakes nor differ much between water layers. In contrast, BCC significantly changed over time, which is contradictory to our hypotheses. Bacterial communities were dominated by Alpha-, Beta-, and Gammaproteobacteria, whereas Actino- and Acidobacteria rarely occurred. Cell numbers of both free and attached bacteria were positively related to DOC concentration. Overall, low pH and extreme chemical conditions of the studied lakes led to similar assemblages of bacteria with pronounced temporal differences. This notion indicates that temporal changes in environmental conditions including food web structure also affect unique communities of bacteria thriving at low pH.

  18. TolC is important for bacterial survival and oxidative stress response in Salmonella enterica serovar Choleraesuis in an acidic environment.

    PubMed

    Lee, Jen-Jie; Wu, Ying-Chen; Kuo, Chih-Jung; Hsuan, Shih-Ling; Chen, Ter-Hsin

    2016-09-25

    The outer membrane protein TolC, which is one of the key components of several multidrug efflux pumps, is thought to be involved in various independent systems in Enterobacteriaceae. Since the acidic environment of the stomach is an important protection barrier against foodborne pathogen infections in hosts, we evaluated whether TolC played a role in the acid tolerance of Salmonella enterica serovar Choleraesuis. Comparison of the acid tolerance of the tolC mutant and the parental wild-type strain showed that the absence of TolC limits the ability of Salmonella to sustain life under extreme acidic conditions. Additionally, the mutant exhibited morphological changes during growth in an acidic medium, leading to the conflicting results of cell viability measured by spectrophotometry and colony-forming unit counting. Reverse-transcriptional-PCR analysis indicated that acid-related molecules, apparatus, or enzymes and oxidation-induced factors were significantly affected by the acidic environment in the null-tolC mutant. The elongated cellular morphology was restored by adding antioxidants to the culture medium. Furthermore, we found that increased cellular antioxidative activity provides an overlapping protection against acid killing, demonstrating the complexity of the bacterial acid stress response. Our findings reinforce the multifunctional characteristics of TolC in acid tolerance or oxidative stress resistance and support the correlative protection mechanism between oxygen- and acid-mediated stress responses in Salmonella enterica serovar Choleraesuis.

  19. Biotechnological potential of a rhizosphere Pseudomonas aeruginosa strain producing phenazine-1-carboxylic acid and phenazine-1-carboxamide.

    PubMed

    Zhou, Lian; Jiang, Hai-Xia; Sun, Shuang; Yang, Dan-Dan; Jin, Kai-Ming; Zhang, Wei; He, Ya-Wen

    2016-03-01

    Bacterial phenazine metabolites belong to a group of nitrogen-containing heterocyclic compounds with antimicrobial activities. In this study, a rhizosphere Pseudomonas aeruginosa strain PA1201 was isolated and identified through 16S rDNA sequence analysis and fatty acid profiling. PA1201 inhibited the growth of various pathogenic microorganisms, including Rhizotonia solani, Magnaporthe grisea, Fusarium graminearum, Xanthomonas oryzae pv. oryzae, Xanthomonas oryzae pv. oryzicola, and Staphylococcus aureus. High Performance Liquid Chromatography showed that PA1201 produced high levels of phenazine-1-carboxylic acid (PCA), a registered green fungicide 'Shenqinmycin' with the fermentation titers of 81.7 mg/L in pigment producing medium (PPM) and 926.9 mg/L in SCG medium containing soybean meal, corn steep liquor and glucose. In addition, PA1201 produced another antifungal metabolite, phenazine-1-carboxaminde (PCN), a derivative of PCA, with the fermentation titers of 18.1 and 489.5 mg/L in PPM and SCG medium respectively. To the best of our knowledge, PA1201 is a rhizosphere originating P. aeruginosa strain that congenitally produces the highest levels of PCA and PCN among currently reported P. aeruginosa isolates, which endows it great biotechnological potential to be transformed to a biopesticide-producing engineering strain.

  20. Effect of ammonium and amino acids on the growth of selected strains of Gluconobacter and Acetobacter.

    PubMed

    Sainz, F; Mas, A; Torija, M J

    2017-02-02

    Acetic acid bacteria (AAB) are a group of microorganisms highly used in the food industry. However, its use can be limited by the insufficient information known about the nutritional requirements of AAB for optimal growth. The aim of this work was to study the effects of different concentrations and sources of nitrogen on the growth of selected AAB strains and to establish which nitrogen source best encouraged their growth. Two strains of three species of AAB, Gluconobacter japonicus, Gluconobacter oxydans and Acetobacter malorum, were grown in three different media with diverse nitrogen concentrations (25, 50, 100, and 300mgN/L and 1gN/L) as a complete solution of amino acids and ammonium. With this experiment, the most favourable medium and the lowest nitrogen concentration beneficial for the growth of each strain was selected. Subsequently, under these conditions, single amino acids or ammonium were added to media individually to determine the best nitrogen sources for each AAB strain. The results showed that nitrogen requirements are highly dependent on the nitrogen source, the medium and the AAB strain. Gluconobacter strains were able to grow in the lowest nitrogen concentration tested (25mgN/L); however, one of the G. oxydans strains and both A. malorum strains required a higher concentration of nitrogen (100-300mgN/L) for optimal growth. In general, single nitrogen sources were not able to support the growth of these AAB strains as well as the complete solution of amino acids and ammonium.

  1. Isolation and Characterization of Rhamnolipid-Producing Bacterial Strains from a Biodiesel Facility

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel strains of rhamnolipid-producing bacteria were isolated from soils at a biodiesel facility on the basis of their ability to grow on glycerol as a sole carbon source. Strains were identified as Acinetobacter calcoaceticus, Enterobacter asburiae, E. hormaecheii, Pantoea stewartii and Pseudomona...

  2. Bacterial sphingophospholipids containing non-hydroxy fatty acid activate murine macrophages via Toll-like receptor 4 and stimulate bacterial clearance.

    PubMed

    Fujiwara, Nagatoshi; Porcelli, Steven A; Naka, Takashi; Yano, Ikuya; Maeda, Shinji; Kuwata, Hirotaka; Akira, Shizuo; Uematsu, Satoshi; Takii, Takemasa; Ogura, Hisashi; Kobayashi, Kazuo

    2013-06-01

    Sphingobacterium spiritivorum has five unusual sphingophospholipids (SPLs). Our previous study determined the complete chemical structures of these SPLs. The compositions of the long-chain bases/fatty acids in the ceramide portion, isoheptadecasphingosine/isopentadecanoate or isoheptadecasphingosine/2-hydroxy isopentadecanoate, are characteristic. The immune response against bacterial lipid components is considered to play important roles in microbial infections. It is reported that several bacterial sphingolipids composed of ceramide are recognized by CD1-restricted T and NKT cells and that a non-peptide antigen is recognized by γδ T cells. In this study, we demonstrated that these bacterial SPLs activated murine bone marrow macrophages (BMMs) via Toll-like receptor (TLR) 4 but not TLR2, although they slightly activated CD1d-restricted NKT and γδT cells. Interestingly, this TLR 4-recognition pathway of bacterial SPLs involves the fatty acid composition of ceramide in addition to the sugar moiety. A non-hydroxy fatty acid composed of ceramide was necessary to activate murine BMMs. The bacterial survival was significantly higher in TLR4-KO mice than in TLR2-KO and wild-type mice. The results indicate that activation of the TLR4-dependent pathway of BMMs by SPLs induced an innate immune response and contributed to bacterial clearance.

  3. Selective modification of the 3''-amino group of kanamycin prevents significant loss of activity in resistant bacterial strains.

    PubMed

    Santana, Andrés G; Zárate, Sandra G; Asensio, Juan Luis; Revuelta, Julia; Bastida, Agatha

    2016-01-14

    Aminoglycosides are highly potent, wide-spectrum bactericidals. N-1 modification of aminoglycosides has thus far been the best approach to regain bactericidal efficiency of this class of antibiotics against resistant bacterial strains. In the present study we have evaluated the effect that both, the number of modifications and their distribution on the aminoglycoside amino groups (N-1, N-3, N-6' and N-3''), have on the antibiotic activity. The modification of N-3'' in the antibiotic kanamycin A is the key towards the design of new aminoglycoside antibiotics. This derivative maintains the antibiotic activity against aminoglycoside acetyl-transferase- and nucleotidyl-transferase-expressing strains, which are two of the most prevalent modifying enzymes found in aminoglycoside resistant bacteria.

  4. Pseudomonas reactans, a bacterial strain isolated from the intestinal flora of Blattella germanica with anti-Beauveria bassiana activity.

    PubMed

    Zhang, Fan; Huang, Yan Hong; Liu, Shu Zhen; Zhang, Lei; Li, Bo Tai; Zhao, Xiao Xu; Fu, Ying; Liu, Jian Jun; Zhang, Xue Xia

    2013-06-01

    Anti-Beauveria bassiana activity of aqueous fecal extracts from conventional German cockroaches [Blattella germanica (L.)] was detected, but was not detected in samples from germ-free German cockroaches. Subsequently, bacterial strain BGI-14 was isolated from the gut of conventional German cockroaches and was identified as Pseudomonas reactans based on 16S rDNA sequence. The strain BGI-14 not only inhibited the germination of conidia, but also inhibited the growth of B. bassiana hyphae. Further studies demonstrated that B. bassiana infections in German cockroaches orally treated with the extracts of BGI-14 fermentation were significantly weakened. Compared with the control group, the cumulative mortality rate of treatment group was reduced by 10.3% at 20 d postinoculation. These studies imply that intestinal flora with anti-B. bassiana activity might contribute to resistance of infection by entomopathogenic fungi.

  5. Characterisation and optimisation of three potential aerobic bacterial strains for kraft lignin degradation from pulp paper waste.

    PubMed

    Chandra, R; Raj, A; Purohit, H J; Kapley, A

    2007-03-01

    Eight aerobic bacterial strains were isolated from pulp paper mill effluent sludge. Out of eight through nutrient enrichment technique three potential aerobic bacterial strains ITRC S(6), ITRC S(7) and ITRC S(8) were found capable to effectively degrade the kraft lignin (KL), a major byproduct of the chemical pulping process and main contributor to the colour and toxicity of effluent. Further, these potential strains (ITRC S(6), ITRC S(7) and ITRC S(8)) were biochemically characterised as Gram variable small rod, Gram negative rod and Gram positive rod respectively. Subsequently, 16S rRNA sequencing showed 95% base sequence homology and it was identified as Paenibacillus sp. (AY952466), Aneurinibacillus aneurinilyticus (AY856831), Bacillus sp. (AY952465) for ITRC S(6), IITRC S(7) and ITRC S(8), respectively. In batch decolourization experiments Bacillus sp. ITRC S(8) reduced the colour of lignin amended mineral salt medium, pH 7.6 by 65% after 6th d, at 30 degrees C, A. aneurinilyticus ITRC S(7) by 56% and Paenibacillus ITRC S(6) 43%. Under these conditions the three strains degraded the KL by 37%, 33% and 30%, respectively while the mixed culture of these three bacteria reduced colour by 69%, lignin by 40% and total substrate by 50% under same conditions. Biodegradation of the KL was not affected by low (<0.2 mg l(-1)) dissolved oxygen content; thus oxygen inhibition is more likely to be a metabolism-dependent event. Initially with 48 h incubation the decolourization was slow with decreased pH. Further incubation there was rapid decolourization with slight increase in pH at 6d compared with initial pH by increasing culture optical density. The lignin analysis from medium with HPLC indicated complete degradation rather than biotransformation with complete loss of absorbance peak at 280 nm.

  6. Use of Response Surface Methodology to Optimize Culture Conditions for Hydrogen Production by an Anaerobic Bacterial Strain from Soluble Starch

    NASA Astrophysics Data System (ADS)

    Kieu, Hoa Thi Quynh; Nguyen, Yen Thi; Dang, Yen Thi; Nguyen, Binh Thanh

    2016-05-01

    Biohydrogen is a clean source of energy that produces no harmful byproducts during combustion, being a potential sustainable energy carrier for the future. Therefore, biohydrogen produced by anaerobic bacteria via dark fermentation has attracted attention worldwide as a renewable energy source. However, the hydrogen production capability of these bacteria depends on major factors such as substrate, iron-containing hydrogenase, reduction agent, pH, and temperature. In this study, the response surface methodology (RSM) with central composite design (CCD) was employed to improve the hydrogen production by an anaerobic bacterial strain isolated from animal waste in Phu Linh, Soc Son, Vietnam (PL strain). The hydrogen production process was investigated as a function of three critical factors: soluble starch concentration (8 g L-1 to 12 g L-1), ferrous iron concentration (100 mg L-1 to 200 mg L-1), and l-cysteine concentration (300 mg L-1 to 500 mg L-1). RSM analysis showed that all three factors significantly influenced hydrogen production. Among them, the ferrous iron concentration presented the greatest influence. The optimum hydrogen concentration of 1030 mL L-1 medium was obtained with 10 g L-1 soluble starch, 150 mg L-1 ferrous iron, and 400 mg L-1 l-cysteine after 48 h of anaerobic fermentation. The hydrogen concentration produced by the PL strain was doubled after using RSM. The obtained results indicate that RSM with CCD can be used as a technique to optimize culture conditions for enhancement of hydrogen production by the selected anaerobic bacterial strain. Hydrogen production from low-cost organic substrates such as soluble starch using anaerobic fermentation methods may be one of the most promising approaches.

  7. Physiological and genetic characteristics of two bacterial strains utilizing phenoxypropionate and phenoxyacetate herbicides.

    PubMed

    Müller, R H; Kleinsteuber, S; Babel, W

    2001-01-01

    Two strains, Rhodoferax sp. P230 and Delftia (Comamonas) acidovorans MCI, have previously been shown to carry activities for the degradation of the two enantiomers of (RS)-2-(2,4-dichlorophenoxy-)propionate (dichlorprop) and (RS)-2-(4-chloro-2-methylphenoxy-)propionate (mecoprop) and, in addition, are capable of degrading phenoxyacetate derivatives 2.4-dichlorophenoxyacetate (2,4-D) and 4-chloro-2-methylphenoxyacetate (MCPA). Metabolism of the herbicides is initiated by alpha-ketoglutarate-dependent dioxygenases for both enantiomers of the phenoxypropionate herbicides and for 2,4-D. These activities were constitutively expressed for both enantiomers of dichlorprop in strain MC1 and for the Renantiomer in strain P230. Enzyme activities for the complete degradation of phenoxyacetate and phenoxypropionate herbicides were induced during incubation on either of these herbicides. Strain MC1 has about threefold higher activities for the degradation of dichlorprop and for growth on this substrate (mumax = 0.15 h(-1)) than strain P230; the maximum growth rate on 2,4-D amounts to 0.045 h(-1) with strain MC1. Dichlorprop is utilized faster than mecoprop and the R-enantiomers are cleaved with higher rates than the S-enantiomers. The degradation of the chlorophenolic intermediates seems to proceed via the modified ortho cleavage pathway as indicated by activities of the respective enzymes. The enzymatic results were supported by genetic investigations by which the presence of the genes tfdB (encoding a dichlorophenol hydroxylase), tfdC (encoding a chlorocatechol 1,2-dioxygenase) and tfdD (encoding a chloromuconate cycloisomerase) could be demonstrated in both strains by PCR after application of respective primers. The presence of the tfdA gene (encoding a 2,4-D/alpha-ketoglutarate dioxygenase) was only shown for strain P230 but was lacking in strain MC1. Sequence analysis of the tfd gene fragments revealed high homology to the degradative genes of other proteobacterial strains

  8. Screening of Non- Saccharomyces cerevisiae Strains for Tolerance to Formic Acid in Bioethanol Fermentation.

    PubMed

    Oshoma, Cyprian E; Greetham, Darren; Louis, Edward J; Smart, Katherine A; Phister, Trevor G; Powell, Chris; Du, Chenyu

    2015-01-01

    Formic acid is one of the major inhibitory compounds present in hydrolysates derived from lignocellulosic materials, the presence of which can significantly hamper the efficiency of converting available sugars into bioethanol. This study investigated the potential for screening formic acid tolerance in non-Saccharomyces cerevisiae yeast strains, which could be used for the development of advanced generation bioethanol processes. Spot plate and phenotypic microarray methods were used to screen the formic acid tolerance of 7 non-Saccharomyces cerevisiae yeasts. S. kudriavzeii IFO1802 and S. arboricolus 2.3319 displayed a higher formic acid tolerance when compared to other strains in the study. Strain S. arboricolus 2.3319 was selected for further investigation due to its genetic variability among the Saccharomyces species as related to Saccharomyces cerevisiae and availability of two sibling strains: S. arboricolus 2.3317 and 2.3318 in the lab. The tolerance of S. arboricolus strains (2.3317, 2.3318 and 2.3319) to formic acid was further investigated by lab-scale fermentation analysis, and compared with S. cerevisiae NCYC2592. S. arboricolus 2.3319 demonstrated improved formic acid tolerance and a similar bioethanol synthesis capacity to S. cerevisiae NCYC2592, while S. arboricolus 2.3317 and 2.3318 exhibited an overall inferior performance. Metabolite analysis indicated that S. arboricolus strain 2.3319 accumulated comparatively high concentrations of glycerol and glycogen, which may have contributed to its ability to tolerate high levels of formic acid.

  9. A mixture of bacterial mechanical lysates is more efficient than single strain lysate and of bacterial-derived soluble products for the induction of an activating phenotype in human dendritic cells.

    PubMed

    Morandi, Barbara; Agazzi, Alessia; D'Agostino, Antonella; Antonini, Francesca; Costa, Gregorio; Sabatini, Federica; Ferlazzo, Guido; Melioli, Giovanni

    2011-07-01

    Dendritic cells (DCs), following an optimal maturation, are able to drive an efficient immune-response. For this, both co-stimulatory molecules (CD80 and CD86), activation molecules (CD83) and peptide presenting molecules (HLA) are over-expressed. The in vitro treatment of immature DC with fragments of bacterial strains, obtained by using a mechanical lysis as well as with bacterial-derived molecules (such as lipopolysaccharide and protido-glycan), induced the maturation of DCs and the secretion of a panel of cytokines and chemokines. Of note, ex vivo treated circulating DCs and plasmacytoid DCs were also activated by these bacterial bodies. However, while the particulate fraction of single bacterial strains or soluble bacterial-derived molecules induced a sub-optimal maturation (as evaluated by the expression of an activating phenotype on DCs and the amount of cytokine secretion), the addition of the mixture of the particulate fractions of the different bacterial strains was able to mediate an optimal maturation. These results were also confirmed by using the secretion of both cytokines and chemokines as markers of DC activation. All these findings suggest that the particulate fraction of bacterial lysate mixtures, because of their ability to interact with different surface structures, might be exploited not only as an immunogen, but also as an adjuvant treatment to boost an immune-response to poorly "antigenic" proteins, such as cancer antigens or allergens.

  10. Isolation of a high malic and low acetic acid-producing sake yeast Saccharomyces cerevisiae strain screened from respiratory inhibitor 2,4-dinitrophenol (DNP)-resistant strains.

    PubMed

    Kosugi, Shingo; Kiyoshi, Keiji; Oba, Takahiro; Kusumoto, Kenichi; Kadokura, Toshimori; Nakazato, Atsumi; Nakayama, Shunichi

    2014-01-01

    We isolated 2,4-dinitrophenol (DNP)-resistant sake yeast strains by UV mutagenesis. Among the DNP-resistant mutants, we focused on strains exhibiting high malic acid and low acetic acid production. The improved organic acid composition is unlikely to be under the control of enzyme activities related to malic and acetic acid synthesis pathways. Instead, low mitochondrial activity was observed in DNP-resistant mutants, indicating that the excess pyruvic acid generated during glycolysis is not metabolized in the mitochondria but converted to malic acid in the cytosol. In addition, the NADH/NAD(+) ratio of the DNP-resistant strains was higher than that of the parental strain K901. These results suggest that the increased NADH/NAD(+) ratio together with the low mitochondrial activity alter the organic acid composition because malic acid synthesis requires NADH, while acetic acid uses NAD(+).

  11. Newly isolated bacterial strains belonging to Bacillaceae (Bacillus sp.) and Micrococcaceae accelerate death of the honey bee mite, Varroa destructor (V. jacobsoni), in laboratory assays.

    PubMed

    Tsagou, Vasiliki; Lianou, Alexandra; Lazarakis, Dimitrios; Emmanouel, Nikolaos; Aggelis, George

    2004-03-01

    Newly isolated bacterial strains belonging to Bacillaceae (Bacillus sp.), Micrococcaceae and three unidentified strains were tested for their pathogenicity against the mite, Varroa destructor. The Bacillus sp. strain and two of the strains belonging to the Micrococcaceae family significantly decreased the time for 50% mortality of the mite population (up to 57%) and hence may be potential control agents. In in vitro bioassay whole cells, extracellular broth and cellular extract of the Bacillus sp. strain effectively killed the mites, suggesting that both endotoxins and exotoxins contributed to the killing.

  12. Aggregate formation in a freshwater bacterial strain induced by growth state and conspecific chemical cues.

    PubMed

    Blom, Judith F; Horňák, Karel; Simek, Karel; Pernthaler, Jakob

    2010-09-01

    We investigated the induction of aggregate formation in the freshwater bacterium Sphingobium sp. strain Z007 by growth state and protistan grazing. Dialysis bag batch culture experiments were conducted in which these bacteria were grown spatially separated from bacteria or from co-cultures of bacteria and predators. In pure cultures of Sphingobium sp. strain Z007, the concentrations of single cells and aggregates inside and outside the dialysis membranes developed in a similar manner over 3 days of incubation, and the proportions of aggregates were highest during the exponential growth phase. Cell production of Sphingobium sp. strain Z007 was enhanced in the presence of another isolate, Limnohabitans planktonicus, from an abundant freshwater lineage (R-BT065) outside the bags, and even more so if that strain was additionally grazed upon by the bacterivorous flagellate Poterioochromonas sp. However, the ratios of single cells to aggregates of Sphingobium sp. strain Z007 were not affected in either case. By contrast, the feeding of flagellates on Sphingobium sp. strain Z007 outside the dialysis bags led to significantly higher proportions of aggregates inside the bags. This was not paralleled by an increase in growth rates, and all cultures were in a comparable growth state at the end of the experiment. We conclude that two mechanisms, growth state and the possible release of infochemicals by the predator, may induce aggregate formation of Sphingobium sp. strain Z007. Moreover, these infochemicals only appeared to be generated by predation on cells from the same species.

  13. Soil type affects plant colonization, activity and catabolic gene expression of inoculated bacterial strains during phytoremediation of diesel.

    PubMed

    Afzal, Muhammad; Yousaf, Sohail; Reichenauer, Thomas G; Kuffner, Melanie; Sessitsch, Angela

    2011-02-28

    The combined use of plants and associated microorganisms has great potential for cleaning up soils contaminated with petroleum hydrocarbons. Apart from environmental conditions the physicochemical properties of the soil are the main factors influencing the survival and activity of an inoculated strain as well as the growth of plants. This study examined the effect of different soil types (sandy, loamy sand and loam) on the survival, gene abundance and catabolic gene expression of two inoculated strains (Pseudomonas sp. strain ITRI53 and Pantoea sp. strain BTRH79) in the rhizosphere and shoot interior of Italian ryegrass vegetated in diesel contaminated soils. High colonization, gene abundance and expression in loamy soils were observed. By contrast, low colonization, gene abundance and absence of gene expression in sandy soil were found. The highest levels of genes expression and hydrocarbon degradation were seen in loamy soil that had been inoculated with BTRH79 and were significantly higher compared to those in other soils. A positive correlation was observed between gene expression and hydrocarbon degradation indicating that catabolic gene expression is necessary for contaminant degradation. These results suggest that soil type influences the bacterial colonization and microbial activities and subsequently the efficiency of contaminant degradation.

  14. Natural history of the infant gut microbiome and impact of antibiotic treatment on bacterial strain diversity and stability.

    PubMed

    Yassour, Moran; Vatanen, Tommi; Siljander, Heli; Hämäläinen, Anu-Maaria; Härkönen, Taina; Ryhänen, Samppa J; Franzosa, Eric A; Vlamakis, Hera; Huttenhower, Curtis; Gevers, Dirk; Lander, Eric S; Knip, Mikael; Xavier, Ramnik J

    2016-06-15

    The gut microbial community is dynamic during the first 3 years of life, before stabilizing to an adult-like state. However, little is known about the impact of environmental factors on the developing human gut microbiome. We report a longitudinal study of the gut microbiome based on DNA sequence analysis of monthly stool samples and clinical information from 39 children, about half of whom received multiple courses of antibiotics during the first 3 years of life. Whereas the gut microbiome of most children born by vaginal delivery was dominated by Bacteroides species, the four children born by cesarean section and about 20% of vaginally born children lacked Bacteroides in the first 6 to 18 months of life. Longitudinal sampling, coupled with whole-genome shotgun sequencing, allowed detection of strain-level variation as well as the abundance of antibiotic resistance genes. The microbiota of antibiotic-treated children was less diverse in terms of both bacterial species and strains, with some species often dominated by single strains. In addition, we observed short-term composition changes between consecutive samples from children treated with antibiotics. Antibiotic resistance genes carried on microbial chromosomes showed a peak in abundance after antibiotic treatment followed by a sharp decline, whereas some genes carried on mobile elements persisted longer after antibiotic therapy ended. Our results highlight the value of high-density longitudinal sampling studies with high-resolution strain profiling for studying the establishment and response to perturbation of the infant gut microbiome.

  15. Bacterial viability and antibiotic susceptibility testing with SYTOX green nucleic acid stain.

    PubMed Central

    Roth, B L; Poot, M; Yue, S T; Millard, P J

    1997-01-01

    A fluorescent nucleic acid stain that does not penetrate living cells was used to assess the integrity of the plasma membranes of bacteria. SYTOX Green nucleic acid stain is an unsymmetrical cyanine dye with three positive charges that is completely excluded from live eukaryotic and prokaryotic cells. Binding of SYTOX Green stain to nucleic acids resulted in a > 500-fold enhancement in fluorescence emission (absorption and emission maxima at 502 and 523 nm, respectively), rendering bacteria with compromised plasma membranes brightly green fluorescent. SYTOX Green stain is readily excited by the 488-nm line of the argon ion laser. The fluorescence signal from membrane-compromised bacteria labeled with SYTOX Green stain was typically > 10-fold brighter than that from intact organisms. Bacterial suspensions labeled with SYTOX Green stain emitted green fluorescence in proportion to the fraction of permeabilized cells in the population, which was quantified by microscopy, fluorometry, or flow cytometry. Flow cytometric and fluorometric approaches were used to quantify the effect of beta-lactam antibiotics on the cell membrane integrity of Escherichia coli. Detection and discrimination of live and permeabilized cells labeled with SYTOX Green stain by flow cytometry were markedly improved over those by propidium iodide-based tests. These studies showed that bacterial labeling with SYTOX Green stain is an effective alternative to conventional methods for measuring bacterial viability and antibiotic susceptibility. PMID:9172364

  16. Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar.

    PubMed

    Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng

    2016-05-01

    Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites.

  17. Strain Dependent Genetic Networks for Antibiotic-Sensitivity in a Bacterial Pathogen with a Large Pan-Genome

    PubMed Central

    van Opijnen, Tim; Bento, José

    2016-01-01

    The interaction between an antibiotic and bacterium is not merely restricted to the drug and its direct target, rather antibiotic induced stress seems to resonate through the bacterium, creating selective pressures that drive the emergence of adaptive mutations not only in the direct target, but in genes involved in many different fundamental processes as well. Surprisingly, it has been shown that adaptive mutations do not necessarily have the same effect in all species, indicating that the genetic background influences how phenotypes are manifested. However, to what extent the genetic background affects the manner in which a bacterium experiences antibiotic stress, and how this stress is processed is unclear. Here we employ the genome-wide tool Tn-Seq to construct daptomycin-sensitivity profiles for two strains of the bacterial pathogen Streptococcus pneumoniae. Remarkably, over half of the genes that are important for dealing with antibiotic-induced stress in one strain are dispensable in another. By confirming over 100 genotype-phenotype relationships, probing potassium-loss, employing genetic interaction mapping as well as temporal gene-expression experiments we reveal genome-wide conditionally important/essential genes, we discover roles for genes with unknown function, and uncover parts of the antibiotic’s mode-of-action. Moreover, by mapping the underlying genomic network for two query genes we encounter little conservation in network connectivity between strains as well as profound differences in regulatory relationships. Our approach uniquely enables genome-wide fitness comparisons across strains, facilitating the discovery that antibiotic responses are complex events that can vary widely between strains, which suggests that in some cases the emergence of resistance could be strain specific and at least for species with a large pan-genome less predictable. PMID:27607357

  18. Characterization of CRISPR-Cas system in clinical Staphylococcus epidermidis strains revealed its potential association with bacterial infection sites.

    PubMed

    Li, Qiuchun; Xie, Xiaolei; Yin, Kequan; Tang, Yueyuan; Zhou, Xiaohui; Chen, Yun; Xia, Jie; Hu, Yachen; Ingmer, Hanne; Li, Yang; Jiao, Xinan

    2016-12-01

    Staphylococcus epidermidis is considered as a major cause of nosocomial infections, bringing an immense burden to healthcare systems. Virulent phages have been confirmed to be efficient in combating the pathogen, but the prensence of CRISPR-Cas system, which is a bacterial immune system eliminating phages was reported in few S. epidermidis strains. In this study, the CRISPR-Cas system was detected in 12 from almost 300 published genomes in GenBank and by PCR of cas6 gene in 18 strains out of 130 clinical isolates obtained in Copenhagen. Four strains isolated in 1965-1966 harboured CRISPR elements confirming that this immunity system was not recently acquired by S. epidermidis. In these CRISPR-positive strains, 44 and 12 spacers were found to belong to CRISPR1 and CRISPR2 elements, respectively. However, only 15 spacers displayed homology to reported phages and plasmids DNA. Interestingly, 5 different spacers located in the CRISPR1 locus with homolgy to virulent phage 6ec DNA sequences, and 19 strains each carrying 2 or 3 different spacers recognizing this phage, implied that the CRISPR-Cas immunity could be abrogated by nucleotide mismatch between the spacer and its target phage sequence, while new spacers obtained from the evolved phage could recover the CRISPR interference. In addition, phylogenetic analysis of the 29 CRISPR-positive isolates divided them into four lineages, with 81% human blood isolates as a distinct sub-lineage, suggesting that the CRISPR difference is closely related to diverse habitats. Knowledge of CRISPR and its prevalence may ultimately be applied in the understanding of origin and evolution of CRISPR-positive S. epidermidis strains.

  19. Strain Dependent Genetic Networks for Antibiotic-Sensitivity in a Bacterial Pathogen with a Large Pan-Genome.

    PubMed

    van Opijnen, Tim; Dedrick, Sandra; Bento, José

    2016-09-01

    The interaction between an antibiotic and bacterium is not merely restricted to the drug and its direct target, rather antibiotic induced stress seems to resonate through the bacterium, creating selective pressures that drive the emergence of adaptive mutations not only in the direct target, but in genes involved in many different fundamental processes as well. Surprisingly, it has been shown that adaptive mutations do not necessarily have the same effect in all species, indicating that the genetic background influences how phenotypes are manifested. However, to what extent the genetic background affects the manner in which a bacterium experiences antibiotic stress, and how this stress is processed is unclear. Here we employ the genome-wide tool Tn-Seq to construct daptomycin-sensitivity profiles for two strains of the bacterial pathogen Streptococcus pneumoniae. Remarkably, over half of the genes that are important for dealing with antibiotic-induced stress in one strain are dispensable in another. By confirming over 100 genotype-phenotype relationships, probing potassium-loss, employing genetic interaction mapping as well as temporal gene-expression experiments we reveal genome-wide conditionally important/essential genes, we discover roles for genes with unknown function, and uncover parts of the antibiotic's mode-of-action. Moreover, by mapping the underlying genomic network for two query genes we encounter little conservation in network connectivity between strains as well as profound differences in regulatory relationships. Our approach uniquely enables genome-wide fitness comparisons across strains, facilitating the discovery that antibiotic responses are complex events that can vary widely between strains, which suggests that in some cases the emergence of resistance could be strain specific and at least for species with a large pan-genome less predictable.

  20. Bile acids are new products of a marine bacterium, Myroides sp. strain SM1.

    PubMed

    Maneerat, Suppasil; Nitoda, Teruhiko; Kanzaki, Hiroshi; Kawai, Fusako

    2005-06-01

    Strain SM1 was isolated as a biosurfactant-producing microorganism from seawater and presumptively identified as Myroides sp., based on morphology, biochemical characteristics and 16S rDNA sequence. The strain produced surface-active compounds in marine broth, which were purified, using emulsification activity for n-hexadecane as an indicator. The purified compounds were identified by thin-layer chromatography, (1)H- and (13)C-NMR spectra and fast atom bombardment mass spectrometry as cholic acid, deoxycholic acid and their glycine conjugates. Type strains of the genus Myroides, M. odoratus JCM7458 and M. odoramitimus JCM7460, also produced these compounds. Myroides sp. strain SM1 possessed a biosynthetic route to cholic acid from cholesterol. Thus, bile acids were found as new products of prokaryotic cells, genus Myroides.

  1. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    PubMed Central

    Lui, Clarissa; Cady, Nathaniel C.; Batt, Carl A.

    2009-01-01

    The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform. PMID:22412335

  2. [Inhibitory effect of essential oils, food additives, peracetic acid and detergents on bacterial histidine decarboxylase].

    PubMed

    Kamii, Eri; Terada, Gaku; Akiyama, Jyunki; Isshiki, Kenji

    2011-01-01

    The aim of this study is to examine whether various essential oils, food additives, peracetic acid and detergents inhibit bacterial histidine decarboxylase. Crude extract of Morganella morganii NBRC3848 was prepared and incubated with various agents. Histidine decarboxylase activity was significantly inhibited (p<0.05) by 26 of 45 compounds tested. Among the 26 agents, sodium hypochlorite completely decomposed both histidine and histamine, while peracetic acid caused slight decomposition. Histidine and histamine were stable in the presence of the other 24 agents. These results indicated that 25 of the agents examined were inhibitors of histidine decarboxylase.

  3. Isolating and evaluating lactic acid bacteria strains for effectiveness of Leymus chinensis silage fermentation.

    PubMed

    Zhang, Q; Li, X J; Zhao, M M; Yu, Z

    2014-10-01

    Five LAB strains were evaluated using the acid production ability test, morphological observation, Gram staining, physiological, biochemical and acid tolerance tests. All five strains (LP1, LP2, LP3, LC1 and LC2) grew at pH 4·0, and LP1 grew at 15°C. Strains LP1, LP2 and LP3 were identified as Lactobacillus plantarum, whereas LC1 and LC2 were classified as Lactobacillus casei by sequencing 16S rDNA. The five isolated strains and two commercial inoculants (PS and CL) were added to native grass and Leymus chinensis (Trin.) Tzvel. for ensiling. All five isolated strains decreased the pH and ammonia nitrogen content, increased the lactic acid content and LP1, LP2 and LP3 increased the acetic content and lactic/acetic acid ratio of L. chinensis silage significantly. The five isolated strains and two commercial inoculants decreased the butyric acid content of the native grass silage. LP2 treatment had lower butyric acid content and ammonia nitrogen content than the other treatments. The five isolated strains improved the quality of L. chinensis silage. The five isolated strains and the two commercial inoculants were not effective in improving the fermentation quality of the native grass silage, but LP2 performed better comparatively. Significance and impact of the study: Leymus chinensis is an important grass in China and Russia, being the primary grass of the short grassland 'steppe' regions of central Asia. However, it has been difficult to make high-quality silage of this species because of low concentration of water-soluble carbohydrates (WSC). Isolating and evaluating lactic acid bacteria strains will be helpful for improving the silage quality of this extensively grown species.

  4. Molecular characterization of Xanthomonas strains responsible for bacterial leaf spot of tomato in Ethiopia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial spot of tomato (BST) is a major constraint to tomato production in Ethiopia and many other countries leading to significant crop losses. In the present study, using pathogenicity tests, sensitivity to copper and streptomycin, and multilocus sequence analysis, a diverse group of Xanthomonas...

  5. Use of carvacrol, thymol, and eugenol for biofilm eradication and resistance modifying susceptibility of Salmonella enterica serovar Typhimurium strains to nalidixic acid.

    PubMed

    Miladi, Hanene; Zmantar, Tarek; Kouidhi, Bochra; Chaabouni, Yassine; Mahdouani, Kacem; Bakhrouf, Amina; Chaieb, Kamel

    2017-03-01

    The Aims of the study was to evaluate the antibacterial susceptibility and the biofilm eradication of three natural compounds carvacrol (CAR), thymol (TH) and eugenol (EUG), alone or in combination with nalidixic acid (NA) against twelve Salmonella Typhimurium strains. The minimum inhibitory concentration (MIC) and the minimum biofilm eradication concentration (BEC50) of the tested compounds (CAR, TH and EUG) and their combinations with NA were evaluated. In order to assess whether these bacteria had active efflux pumps, ethidium bromide (EtBr) accumulation assays was achieved using spectrophotometric accumulation assays. Moreover, scanning electron microscopy was used to visualize the bacterial biofilm formation on stainless steel surfaces after exposed to NA, CAR, TH and EUG alone and in combination. TH was the most effective essential oil, with the lowest MICs values ranging from 32 to 128 μg/mL followed by EUG and CAR. In addition, the combination of NA with the different compounds enhances antibiotic susceptibility of the tested bacterial strains. These results were confirmed by EtBr accumulation assays. A pronounced effect in decreasing biofilm mass was also noticed. Moreover, SEM revealed that bacterial membrane was disrupted and a complete loss of membrane integrity was also evident. The combination of natural compounds with antibiotic enhances bacterial susceptibility to NA. This combination ameliorates eradication of biofilm formed by S. Typhimurium on polystyrene microtitre plates. Additionally, this synergy induces an alteration of the bacterial cell surface visualized by SEM.

  6. Butyric acid from anaerobic fermentation of lignocellulosic biomass hydrolysates by Clostridium tyrobutyricum strain RPT-4213

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A newly isolated Clostridium sp. strain RPT-4213 was found to produce butyrate under anaerobic conditions. Fermentations using Lactobacilli MRS Broth produced 9.47 g L-1 butyric acid from glucose (0.48 g/g glucose). However, the strain was not capable of utilizing five carbon sugars. To assess the a...

  7. Genome sequence of the acid-tolerant strain Rhizobium sp. LPU83.

    PubMed

    Wibberg, Daniel; Tejerizo, Gonzalo Torres; Del Papa, María Florencia; Martini, Carla; Pühler, Alfred; Lagares, Antonio; Schlüter, Andreas; Pistorio, Mariano

    2014-04-20

    Rhizobia are important members of the soil microbiome since they enter into nitrogen-fixing symbiosis with different legume host plants. Rhizobium sp. LPU83 is an acid-tolerant Rhizobium strain featuring a broad-host-range. However, it is ineffective in nitrogen fixation. Here, the improved draft genome sequence of this strain is reported. Genome sequence information provides the basis for analysis of its acid tolerance, symbiotic properties and taxonomic classification.

  8. A novel, sensitive method to evaluate potato germplasm for bacterial wilt resistance using a luminescent Ralstonia solanacearum reporter strain.

    PubMed

    Cruz, Andrea Paola Zuluaga; Ferreira, Virginia; Pianzzola, María Julia; Siri, María Inés; Coll, Núria S; Valls, Marc

    2014-03-01

    Several breeding programs are under way to introduce resistance to bacterial wilt caused by Ralstonia solanacearum in solanaceous crops. The lack of screening methods allowing easy measurement of pathogen colonization and the inability to detect latent (i.e., symptomless) infections are major limitations when evaluating resistance to this disease in plant germplasm. We describe a new method to study the interaction between R. solanacearum and potato germplasm that overcomes these restrictions. The R. solanacearum UY031 was genetically modified to constitutively generate light from a synthetic luxCDABE operon stably inserted in its chromosome. Colonization of this reporter strain on different potato accessions was followed using life imaging. Bacterial detection in planta by this nondisruptive system correlated with the development of wilting symptoms. In addition, we demonstrated that quantitative detection of the recombinant strain using a luminometer can identify latent infections on symptomless potato plants. We have developed a novel, unsophisticated, and accurate method for high-throughput evaluation of pathogen colonization in plant populations. We applied this method to compare the behavior of potato accessions with contrasting resistance to R. solanacearum. This new system will be especially useful to detect latency in symptomless parental lines before their inclusion in long-term breeding programs for disease resistance.

  9. Genome Sequence of Acidovorax citrulli Group 1 Strain pslb65 Causing Bacterial Fruit Blotch of Melons.

    PubMed

    Wang, Tielin; Sun, Baixin; Yang, Yuwen; Zhao, Tingchang

    2015-04-23

    Acidovorax citrulli is typed into two groups, mainly based on the host. We determined the draft genome of A. citrulli group 1 strain pslb65. The strain was isolated from melon collected from Xinjiang province, China. The A. citrulli pslb65 genome contains 4,903,443 bp and has a G+C content of 68.8 mol%.

  10. Genome Sequence of Acidovorax citrulli Group 1 Strain pslb65 Causing Bacterial Fruit Blotch of Melons

    PubMed Central

    Wang, Tielin; Sun, Baixin; Yang, Yuwen

    2015-01-01

    Acidovorax citrulli is typed into two groups, mainly based on the host. We determined the draft genome of A. citrulli group 1 strain pslb65. The strain was isolated from melon collected from Xinjiang province, China. The A. citrulli pslb65 genome contains 4,903,443 bp and has a G+C content of 68.8 mol%. PMID:25908136

  11. Comparative studies of genes encoding thermostable L-2-halo acid dehalogenase from Pseudomonas sp. strain YL, other dehalogenases, and two related hypothetical proteins from Escherichia coli.

    PubMed Central

    Nardi-Dei, V; Kurihara, T; Okamura, T; Liu, J Q; Koshikawa, H; Ozaki, H; Terashima, Y; Esaki, N; Soda, K

    1994-01-01

    We have determined the nucleotide sequence of the gene encoding thermostable L-2-halo acid dehalogenase (L-DEX) from the 2-chloroacrylate-utilizable bacterium Pseudomonas sp. strain YL. The open reading frame consists of 696 nucleotides corresponding to 232 amino acid residues. The protein molecular weight was estimated to be 26,179, which was in good agreement with the subunit molecular weight of the enzyme. The gene was efficiently expressed in the recombinant Escherichia coli cells: the amount of L-DEX corresponds to about 49% of the total soluble proteins. The predicted amino acid sequence showed a high level of similarity to those of L-DEXs from other bacterial strains and haloacetate dehalogenase H-2 from Moraxella sp. strain B (38 to 57% identity) but a very low level of similarity to those of haloacetate dehalogenase H-1 from Moraxella sp. strain B (10%) and haloalkane dehalogenase from Xanthobacter autotrophicus GJ10 (12%). By searching the protein amino acid sequence database, we found two E. coli hypothetical proteins similar to the Pseudomonas sp. strain YL L-DEX (21 to 22%). PMID:7944368

  12. Production of putrescine-capped stable silver nanoparticle: its characterization and antibacterial activity against multidrug-resistant bacterial strains

    NASA Astrophysics Data System (ADS)

    Saha, Saswati; Gupta, Bhaskar; Gupta, Kamala; Chaudhuri, Mahua Ghosh

    2016-11-01

    Integration of biology with nanotechnology is now becoming attention-grabbing area of research. The antimicrobial potency of silver has been eminent from antiquity. Due to the recent desire for the enhancement of antibacterial efficacy of silver, various synthesis methods of silver in their nano dimensions are being practiced using a range of capping material. The present work highlights a facile biomimetic approach for production of silver nanoparticle being capped and stabilized by putrescine, possessing a diameter of 10-25 ± 1.5 nm. The synthesized nanoparticles have been analyzed spectrally and analytically. Morphological studies are carried out by high-resolution transmission electron microscopy and crystallinity by selected area electron diffraction patterns. Moreover, the elemental composition of the capped nanoparticles was confirmed by energy-dispersive X-ray spectroscopy analysis. A comparative study (zone of inhibition and minimum inhibitory concentration) regarding the interactions and antibacterial potentiality of the capped silver nanoparticles with respect to the bare ones reveal the efficiency of the capped one over the bare one. The bacterial kinetic study was executed to monitor the interference of nanoparticles with bacterial growth rate. The results also highlight the efficacy of putrescine-capped silver nanoparticles as effective growth inhibitors against multi-drug resistant human pathogenic bacterial strains, which may, thus, potentially be applicable as an effective antibacterial control system to fight diseases.

  13. Comparative Genomics between Two Xenorhabdus bovienii Strains Highlights Differential Evolutionary Scenarios within an Entomopathogenic Bacterial Species

    PubMed Central

    Bisch, Gaëlle; Ogier, Jean-Claude; Médigue, Claudine; Rouy, Zoé; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2016-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Within Xenorhabdus bovienii species, the X. bovienii CS03 strain (Xb CS03) is nonvirulent when directly injected into lepidopteran insects, and displays a low virulence when associated with its Steinernema symbiont. The genome of Xb CS03 was sequenced and compared with the genome of a virulent strain, X. bovienii SS-2004 (Xb SS-2004). The genome size and content widely differed between the two strains. Indeed, Xb CS03 had a large genome containing several specific loci involved in the inhibition of competitors, including a few NRPS-PKS loci (nonribosomal peptide synthetases and polyketide synthases) producing antimicrobial molecules. Consistently, Xb CS03 had a greater antimicrobial activity than Xb SS-2004. The Xb CS03 strain contained more pseudogenes than Xb SS-2004. Decay of genes involved in the host invasion and exploitation (toxins, invasins, or extracellular enzymes) was particularly important in Xb CS03. This may provide an explanation for the nonvirulence of the strain when injected into an insect host. We suggest that Xb CS03 and Xb SS-2004 followed divergent evolutionary scenarios to cope with their peculiar life cycle. The fitness strategy of Xb CS03 would involve competitor inhibition, whereas Xb SS-2004 would quickly and efficiently kill the insect host. Hence, Xenorhabdus strains would have widely divergent host exploitation strategies, which impact their genome structure. PMID:26769959

  14. Omega-3 fatty acid production from enzyme saccharified hemp hydrolysate using a novel marine thraustochytrid strain.

    PubMed

    Gupta, Adarsha; Abraham, Reinu E; Barrow, Colin J; Puri, Munish

    2015-05-01

    In this work, a newly isolated marine thraustochytrid strain, Schizochytrium sp. DT3, was used for omega-3 fatty acid production by growing on lignocellulose biomass obtained from local hemp hurd (Cannabis sativa) biomass. Prior to enzymatic hydrolysis, hemp was pretreated with sodium hydroxide to open the biomass structure for the production of sugar hydrolysate. The thraustochytrid strain was able to grow on the sugar hydrolysate and accumulated polyunsaturated fatty acids (PUFAs). At the lowest carbon concentration of 2%, the PUFAs productivity was 71% in glucose and 59% in the sugars hydrolysate, as a percentage of total fatty acids. Saturated fatty acids (SFAs) levels were highest at about 49% of TFA using 6% glucose as the carbon source. SFAs of 41% were produced using 2% of SH. This study demonstrates that SH produced from lignocellulose biomass is a potentially useful carbon source for the production of omega-3 fatty acids in thraustochytrids, as demonstrated using the new strain, Schizochytrium sp. DT3.

  15. Beneficial Effect of Acetic Acid on the Xylose Utilization and Bacterial Cellulose Production by Gluconacetobacter xylinus.

    PubMed

    Yang, Xiao-Yan; Huang, Chao; Guo, Hai-Jun; Xiong, Lian; Luo, Jun; Wang, Bo; Chen, Xue-Fang; Lin, Xiao-Qing; Chen, Xin-De

    2014-09-01

    In this work, acetic acid was found as one promising substrate to improve xylose utilization by Gluconacetobacter xylinus CH001. Also, with the help of adding acetic acid into medium, the bacterial cellulose (BC) production by G. xylinus was increased significantly. In the medium containing 3 g l(-1) acetic acid, the optimal xylose concentration for BC production was 20 g l(-1). In the medium containing 20 g l(-1) xylose, the xylose utilization and BC production by G. xylinus were stimulated by acetic acid within certain concentration. The highest BC yield (1.35 ± 0.06 g l(-1)) was obtained in the medium containing 20 g l(-1) xylose and 3 g l(-1) acetic acid after 14 days. This value was 6.17-fold higher than the yield (0.21 ± 0.01 g l(-1)) in the medium only containing 20 g l(-1) xylose. The results analyzed by FE-SEM, FTIR, and XRD showed that acetic acid affected little on the microscopic morphology and physicochemical characteristics of BC. Base on the phenomenon observed, lignocellulosic acid hydrolysates (xylose and acetic acid are main carbon sources present in it) could be considered as one potential substrate for BC production.

  16. The effect of the bacterial product, succinic acid, on neutrophil bactericidal activity.

    PubMed

    Abdul-Majid, K B; Kenny, P A; Finlay-Jones, J J

    1997-02-01

    We investigated the effect of succinic acid on neutrophil bactericidal activity in a model of intra-abdominal abscess induced in mice by the peritoneal inoculation of 5 x 10(6) cfu ml-1 E. coli and 5 x 10(8) cfu ml-1 B. fragilis plus 1 mg of bran as faecal fibre analogue. The mean pH of the induced abscesses at week 1 was 6.7, higher than the pH associated with succinic acid inhibitory activity. We therefore determined the effect of succinic acid (0-100 mM) at pH 6.7 on the bactericidal activity of mouse bone marrow-derived neutrophils. Phagocytic killing of Proteus mirabilis by neutrophils was significantly inhibited by 30-100 mM succinic acid at pH 6.7 but there was no significant effect of succinic acid on engulfment of bacteria at this pH. However, significant inhibition of intracellular killing (assayed by adding succinic acid to suspensions of neutrophils which had engulfed bacteria in low serum concentrations but in the absence of succinic acid) was noted at 70 and 100 mM. These results indicate that succinic acid inhibits neutrophil bactericidal activity at a physiological pH, principally through inhibition of intracellular killing mechanisms and therefore contributing to bacterial persistence in this model of abscess formation.

  17. Microbial production of amino acids and derived chemicals: synthetic biology approaches to strain development.

    PubMed

    Wendisch, Volker F

    2014-12-01

    Amino acids are produced at the multi-million-ton-scale with fermentative production of l-glutamate and l-lysine alone being estimated to amount to more than five million tons in the year 2013. Metabolic engineering constantly improves productivities of amino acid producing strains, mainly Corynebacterium glutamicum and Escherichia coli strains. Classical mutagenesis and screening have been accelerated by combination with intracellular metabolite sensing. Synthetic biology approaches have allowed access to new carbon sources to realize a flexible feedstock concept. Moreover, new pathways for amino acid production as well as fermentative production of non-native compounds derived from amino acids or their metabolic precursors were developed. These include dipeptides, α,ω-diamines, α,ω-diacids, keto acids, acetylated amino acids and ω-amino acids.

  18. Acid production by oral strains of Candida albicans and lactobacilli.

    PubMed

    Klinke, T; Kneist, S; de Soet, J J; Kuhlisch, E; Mauersberger, S; Forster, A; Klimm, W

    2009-01-01

    Both Candida albicans and lactobacilli are common colonizers of carious lesions in children and adolescents. The purpose of this study is to compare the velocity of acid production between C. albicans and several Lactobacillus species at different pH levels and concentrations of glucose. Washed, pure resting-cell suspensions were obtained by culturing a total of 28 oral isolates comprising the species C. albicans, Lactobacillus rhamnosus, Lactobacillus paracasei paracasei, Lactobacillus paracasei tolerans and Lactobacillus delbrueckii lactis. Acid production from glucose was determined at a constant pH of 7.0, 5.5, 5.0 and 4.0 by repeated titrations with NaOH in an automated pH-stat system. Acid formation rates of yeast and lactobacilli proved to be similar at both neutral and low pH, while in a moderately acidic environment C. albicans produced less acid than the lactobacilli. Ion chromatographic analysis of the cell-free medium after titration revealed pyruvate to be the predominant organic acid anion secreted by C. albicans. The proportion of organic acids to overall acid production by the yeast was below 10% at neutral conditions, in contrast to 42-66% at pH 4.0. Compared to lactobacilli, yeast required a concentration of glucose that was about 50 times higher to allow acid production at half the maximum speed. Considering the clinical data in the literature about the frequency and proportions of microorganisms present in early childhood caries lesions, the contribution of oral lactobacilli as well as C. albicans to overall microbial acid formation appears to be important.

  19. Electrically conductive bacterial nanowires produced by Shewanella oneidensis strain MR-1 and other microorganisms.

    PubMed

    Gorby, Yuri A; Yanina, Svetlana; McLean, Jeffrey S; Rosso, Kevin M; Moyles, Dianne; Dohnalkova, Alice; Beveridge, Terry J; Chang, In Seop; Kim, Byung Hong; Kim, Kyung Shik; Culley, David E; Reed, Samantha B; Romine, Margaret F; Saffarini, Daad A; Hill, Eric A; Shi, Liang; Elias, Dwayne A; Kennedy, David W; Pinchuk, Grigoriy; Watanabe, Kazuya; Ishii, Shun'ichi; Logan, Bruce; Nealson, Kenneth H; Fredrickson, Jim K

    2006-07-25

    Shewanella oneidensis MR-1 produced electrically conductive pilus-like appendages called bacterial nanowires in direct response to electron-acceptor limitation. Mutants deficient in genes for c-type decaheme cytochromes MtrC and OmcA, and those that lacked a functional Type II secretion pathway displayed nanowires that were poorly conductive. These mutants were also deficient in their ability to reduce hydrous ferric oxide and in their ability to generate current in a microbial fuel cell. Nanowires produced by the oxygenic phototrophic cyanobacterium Synechocystis PCC6803 and the thermophilic, fermentative bacterium Pelotomaculum thermopropionicum reveal that electrically conductive appendages are not exclusive to dissimilatory metal-reducing bacteria and may, in fact, represent a common bacterial strategy for efficient electron transfer and energy distribution.

  20. Electrically conductive bacterial nanowires produced by Shewanella oneidensis strain MR-1 and other microorganisms

    PubMed Central

    Gorby, Yuri A.; Yanina, Svetlana; McLean, Jeffrey S.; Rosso, Kevin M.; Moyles, Dianne; Dohnalkova, Alice; Beveridge, Terry J.; Chang, In Seop; Kim, Byung Hong; Kim, Kyung Shik; Culley, David E.; Reed, Samantha B.; Romine, Margaret F.; Saffarini, Daad A.; Hill, Eric A.; Shi, Liang; Elias, Dwayne A.; Kennedy, David W.; Pinchuk, Grigoriy; Watanabe, Kazuya; Ishii, Shun’ichi; Logan, Bruce; Nealson, Kenneth H.; Fredrickson, Jim K.

    2006-01-01

    Shewanella oneidensis MR-1 produced electrically conductive pilus-like appendages called bacterial nanowires in direct response to electron-acceptor limitation. Mutants deficient in genes for c-type decaheme cytochromes MtrC and OmcA, and those that lacked a functional Type II secretion pathway displayed nanowires that were poorly conductive. These mutants were also deficient in their ability to reduce hydrous ferric oxide and in their ability to generate current in a microbial fuel cell. Nanowires produced by the oxygenic phototrophic cyanobacterium Synechocystis PCC6803 and the thermophilic, fermentative bacterium Pelotomaculum thermopropionicum reveal that electrically conductive appendages are not exclusive to dissimilatory metal-reducing bacteria and may, in fact, represent a common bacterial strategy for efficient electron transfer and energy distribution. PMID:16849424

  1. Enhanced production of bacterial cellulose by using Gluconacetobacter hansenii NCIM 2529 strain under shaking conditions.

    PubMed

    Mohite, Bhavna V; Salunke, Bipinchandra K; Patil, Satish V

    2013-03-01

    Bacterial cellulose (BC), a biopolymer, due to its unique properties is valuable for production of vital products in food, textile, medicine, and agriculture. In the present study, the optimal fermentation conditions for enhanced BC production by Gluconacetobacter hansenii NCIM 2529 were investigated under shaking conditions. The investigation on media components and culture parameters revealed that 2 % (w/v) sucrose as carbon source, 0.5 % (w/v) potassium nitrate as nitrogen source, 0.4 % (w/v) disodium phosphate as phosphate source, 0.04 % (w/v) magnesium sulfate, and 0.8 % (w/v) calcium chloride as trace elements, pH5.0, temperature 25 °C, and agitation speed 170 rpm with 6 days of fermentation period are optimal for maximum BC production. Production of BC using optimized media components and culture parameters was 1.66 times higher (5.0 g/l) than initial non optimized media (3.0 g/l). Fourier transform infrared spectroscopy spectrum and comparison with the available literature suggests that the produced component by G. hansenii in the present study is pure bacterial cellulose. The specific action of cellulase out of the investigated hydrolytic enzymes (cellulase, amylase, and protease) further confirmed purity of the produced BC. These findings give insight into conditions necessary for enhanced production of bacterial cellulose, which can be used for a variety of applications.

  2. Serum sialic acid in malignant tumors, bacterial infections, and chronic liver diseases.

    PubMed

    Stefenelli, N; Klotz, H; Engel, A; Bauer, P

    1985-01-01

    The total serum sialic acid concentration was determined in 2,264 persons with various malignant tumors, bacterial infections, rheumatic diseases, and chronic liver diseases, and in a control group. The thiobarbiturate method according to Warren was used. The upper limit (95% percentile) in the control group was 2.23 mumol/ml. Higher values were found in the groups with neoplasms (mean: 3.04 mumol/ml), inflammatory diseases (e.g., pneumonia: 3.02 mumol/ml), and active rheumatoid arthritis (3.05 mumol/ml). In the group with malignant diseases, the sialic acid concentration at the time of diagnosis was highest for bronchial carcinoma (3.29 mumol/ml) and lowest for breast cancer (2.58 mumol/ml). In chronic liver diseases the mean sialic acid level was lower than in a heterogeneous group of noninflammatory and nonneoplastic diseases. The estimation of the serum sialic acid concentration could be useful in the detection of tumor burden and metastases, and in the evaluation of the later course and prognosis of malignant neoplasms if bacterial/inflammatory and active rheumatoid processes can be excluded.

  3. Synthesis of a novel acrylated abietic acid-g-bacterial cellulose hydrogel by gamma irradiation.

    PubMed

    Abeer, Muhammad Mustafa; Amin, Mohd Cairul Iqbal Mohd; Lazim, Azwan Mat; Pandey, Manisha; Martin, Claire

    2014-09-22

    Acrylated abietic acid (acrylated AbA) and acrylated abietic acid-grafted bacterial cellulose pH sensitive hydrogel (acrylated AbA-g-BC) were prepared by a one-pot synthesis. The successful dimerization of acrylic acid (AA) and abietic acid (AbA) and grafting of the dimer onto bacterial cellulose (BC) was confirmed by 13C solid state NMR as well as FT-IR. X-ray diffraction analysis showed characteristic peaks for AbA and BC; further, there was no effect of increasing amorphous AA content on the overall crystallinity of the hydrogel. Differential scanning calorimetry revealed a glass transition temperature of 80°C. Gel fraction and swelling studies gave insight into the features of the hydrogel, suggesting that it was suitable for future applications such as drug delivery. Scanning electron microscopy observations showed an interesting interpenetrating network within the walls of hydrogel samples with the lowest levels of AA and gamma radiation doses. Cell viability test revealed that the synthesized hydrogel is safe for future use in biomedical applications.

  4. MetaMLST: multi-locus strain-level bacterial typing from metagenomic samples

    PubMed Central

    Zolfo, Moreno; Tett, Adrian; Jousson, Olivier; Donati, Claudio; Segata, Nicola

    2017-01-01

    Metagenomic characterization of microbial communities has the potential to become a tool to identify pathogens in human samples. However, software tools able to extract strain-level typing information from metagenomic data are needed. Low-throughput molecular typing schema such as Multilocus Sequence Typing (MLST) are still widely used and provide a wealth of strain-level information that is currently not exploited by metagenomic methods. We introduce MetaMLST, a software tool that reconstructs the MLST loci of microorganisms present in microbial communities from metagenomic data. Tested on synthetic and spiked-in real metagenomes, the pipeline was able to reconstruct the MLST sequences with >98.5% accuracy at coverages as low as 1×. On real samples, the pipeline showed higher sensitivity than assembly-based approaches and it proved successful in identifying strains in epidemic outbreaks as well as in intestinal, skin and gastrointestinal microbiome samples. PMID:27651451

  5. [Construction and evaluation of an engineered bacterial strain for producing lipopeptide under anoxic conditions].

    PubMed

    Liang, Xiao-long; Zhao, Feng; Shi, Rong-jiu; Ban, Yun-he; Zhou, Ji-dong; Han, Si-qin; Zhang, Ying

    2015-08-01

    Biosurfactant-facilitated oil recovery is one of the most important aspects of microbial enhanced oil recovery (MEOR). However, the biosurfactant production by biosurfactant-producing microorganisms, most of which are aerobes, is severely suppressed due to the in-situ anoxic conditions within oil reservoirs. In this research, we successfully engineered a strain JD-3, which could grow rapidly and produce lipopeptide under anoxic conditions, by protoplast confusion using a Bacillus amyloliquefaciens strain BQ-2 which produces biosurfactant aerobically, and a facultative anaerobic Pseudomonas stutzeri strain DQ-1 as parent strains. The alignment of 16S rDNA sequence (99% similarity) and comparisons of cell colony morphology showed that fusant JD-3 was closer to the parental strain B. amyloliquefaciens BQ-2. The surface tension of culture broth of fusant JD-3, after 36-hour cultivation under anaerobic conditions, decreased from initially 63.0 to 32.5 mN · m(-1). The results of thin layer chromatography and infrared spectrum analysis demonstrated that the biosurfactant produced by JD-3 was lipopeptide. The surface-active lipopeptide had a low critical micelle concentration (CMC) of 90 mg · L(-1) and presented a good ability to emulsify various hydrocarbons such as crude oil, liquid paraffin, and kerosene. Strain JD-3 could utilize peptone as nitrogen source and sucrose, glucose, glycerin or other common organics as carbon sources for anaerobic lipopeptide synthesis. The subculture of fusant JD-3 showed a stable lipopeptide-producing ability even after ten serial passages. All these results indicated that fusant JD-3 holds a great potential to microbially enhance oil recovery under anoxic conditions.

  6. Bacillus rubiinfantis sp. nov. strain mt2T, a new bacterial species isolated from human gut

    PubMed Central

    Tidjiani Alou, M.; Rathored, J.; Khelaifia, S.; Michelle, C.; Brah, S.; Diallo, B.A.; Raoult, D.; Lagier, J.-C.

    2015-01-01

    Bacillus rubiinfantis sp. nov. strain mt2T is the type strain of B. rubiinfantis sp. nov., isolated from the fecal flora of a child with kwashiorkor in Niger. It is Gram-positive facultative anaerobic rod belonging to the Bacillaceae family. We describe the features of this organism alongside the complete genome sequence and annotation. The 4 311 083 bp long genome (one chromosome but no plasmid) contains 4028 protein-coding gene and 121 RNA genes including nine rRNA genes. PMID:27076912

  7. Identification of Bacillus strains isolated from milk and cream with classical and nucleic acid hybridization methods.

    PubMed

    Tatzel, R; Ludwig, W; Schleifer, K H; Wallnöfer, P R

    1994-11-01

    A total of 529 bacterial strains have been isolated from milk and cream sampled at different sites in a dairy production plant under conditions selective for aerobic sporeforming bacteria. Identification with classical methods based on morphological, physiological and biochemical criteria showed Bacillus licheniformis to be the most frequently occurring Bacillus sp. The investigation also revealed 62 unidentified strains. Classical identification methods were time consuming (3-7 d), lacked specificity and--because of their dependence on phenotypic gene expression--sometimes produced ambiguous results. Consequently, a colony hybridization method developed for the identification of B. licheniformis strains and using nonradioactive labelled 23S rRNA targeted oligonucleotide probes was also used. Identification of B. licheniformis with both classical and hybridization methods revealed diverging identification results for 70 strains.

  8. The Genomic Sequence of the Oral Pathobiont Strain NI1060 Reveals Unique Strategies for Bacterial Competition and Pathogenicity

    PubMed Central

    Jiao, Yizu; Hasegawa, Mizuho; Moon, Henry; Núñez, Gabriel; Inohara, Naohiro; Raes, Jeroen

    2016-01-01

    Strain NI1060 is an oral bacterium responsible for periodontitis in a murine ligature-induced disease model. To better understand its pathogenicity, we have determined the complete sequence of its 2,553,982 bp genome. Although closely related to Pasteurella pneumotropica, a pneumonia-associated rodent commensal based on its 16S rRNA, the NI1060 genomic content suggests that they are different species thriving on different energy sources via alternative metabolic pathways. Genomic and phylogenetic analyses showed that strain NI1060 is distinct from the genera currently described in the family Pasteurellaceae, and is likely to represent a novel species. In addition, we found putative virulence genes involved in lipooligosaccharide synthesis, adhesins and bacteriotoxic proteins. These genes are potentially important for host adaption and for the induction of dysbiosis through bacterial competition and pathogenicity. Importantly, strain NI1060 strongly stimulates Nod1, an innate immune receptor, but is defective in two peptidoglycan recycling genes due to a frameshift mutation. The in-depth analysis of its genome thus provides critical insights for the development of NI1060 as a prime model system for infectious disease. PMID:27409077

  9. Control efficacy of an endophytic Bacillus amyloliquefaciens strain BZ6-1 against peanut bacterial Wilt, Ralstonia solanacearum.

    PubMed

    Wang, Xiaobing; Liang, Guobin

    2014-01-01

    We aimed to isolate and identify endophytic bacteria that might have efficacy against peanut bacterial wilt (BW) caused by Ralstonia solanacearum. Thirty-seven endophytic strains were isolated from healthy peanut plants in R. solanacearum-infested fields and eight showed antagonistic effects against R. solanacearum. Strain BZ6-1 with the highest antimicrobial activity was identified as Bacillus amyloliquefaciens based on morphology, biochemistry, and 16S rRNA analysis. Culture conditions of BZ6-1 were optimized using orthogonal test method and inhibitory zone diameter in dual culture plate assay reached 34.2 mm. Furthermore, main antimicrobial substances of surfactin and fengycin A homologues produced by BZ6-1 were analyzed by high performance liquid chromatography electrospray ionization tandem mass spectrometry. Finally, pot experiments were adopted to test the control efficiency of BZ6-1 against peanut BW. Disease incidence decreased significantly from 84.5% in the control to 12.1% with addition of 15 mL (10(8) cfu mL(-1)) culture broth for each seedling, suggesting the feasibility of strain BZ6-1 in the biological control of peanut plants BW.

  10. Overexpression of a phosphatidic acid phosphatase type 2 leads to an increase in triacylglycerol production in oleaginous Rhodococcus strains.

    PubMed

    Hernández, Martín A; Comba, Santiago; Arabolaza, Ana; Gramajo, Hugo; Alvarez, Héctor M

    2015-03-01

    Oleaginous Rhodococcus strains are able to accumulate large amounts of triacylglycerol (TAG). Phosphatidic acid phosphatase (PAP) enzyme catalyzes the dephosphorylation of phosphatidic acid (PA) to yield diacylglycerol (DAG), a key precursor for TAG biosynthesis. Studies to establish its role in lipid metabolism have been mainly focused in eukaryotes but not in bacteria. In this work, we identified and characterized a putative PAP type 2 (PAP2) encoded by the ro00075 gene in Rhodococcus jostii RHA1. Heterologous expression of ro00075 in Escherichia coli resulted in a fourfold increase in PAP activity and twofold in DAG content. The conditional deletion of ro00075 in RHA1 led to a decrease in the content of DAG and TAG, whereas its overexpression in both RHA1 and Rhodococcus opacus PD630 promoted an increase up to 10 to 15 % by cellular dry weight in TAG content. On the other hand, expression of ro00075 in the non-oleaginous strain Rhodococcus fascians F7 promoted an increase in total fatty acid content up to 7 % at the expense of free fatty acid (FFA), DAG, and TAG fractions. Moreover, co-expression of ro00075/atf2 genes resulted in a fourfold increase in total fatty acid content by a further increase of the FFA and TAG fractions. The results of this study suggest that ro00075 encodes for a PAP2 enzyme actively involved in TAG biosynthesis. Overexpression of this gene, as single one or with an atf gene, provides an alternative approach to increase the biosynthesis and accumulation of bacterial oils as a potential source of raw material for biofuel production.

  11. Selection and identification of bacterial strains with methyl-tert-butyl ether, ethyl-tert-butyl ether, and tert-amyl methyl ether degrading capacities.

    PubMed

    Purswani, Jessica; Pozo, Clementina; Rodríguez-Díaz, Marina; González-López, Jesús

    2008-11-01

    Nine bacterial strains isolated from two hydrocarbon-contaminated soils were selected because of their capacity for growth in culture media amended with 200 mg/L of one of the following gasoline oxygenates: Methyl-tert-butyl ether (MTBE), ethyl-tert-butyl ether (ETBE), and tert-amyl methyl ether (TAME). These strains were identified by amplification of their 16S rRNA gene, using fDl and rD1 primers, and were tested for their capacity to grow and biotransform these oxygenates in both mineral and cometabolic media. The isolates were classified as Bacillus simplex, Bacillus drentensis, Arthrobacter sp., Acinetobacter calcoaceticus, Acinetobacter sp., Gordonia amicalis (two strains), Nocardioides sp., and Rhodococcus ruber. Arthrobacter sp. (strain MG) and A. calcoaceticus (strain M10) consumed 100 (cometabolic medium) and 82 mg/L (mineral medium) of oxygenate TAME in 21 d, respectively, under aerobic conditions. Rhodococcus ruber (strain E10) was observed to use MTBE and ETBE as the sole carbon and energy source, whereas G. amicalis (strain T3) used TAME as the sole carbon and energy source for growth. All the bacterial strains transformed oxygenates better in the presence of an alternative carbon source (ethanol) with the exception of A. calcoaceticus (strain M10). The capacity of the selected strains to remove MTBE, ETBE, and TAME looks promising for application in bioremediation technologies.

  12. Structure and regulation of the omega-3 polyunsaturated fatty acid synthase genes from the deep-sea bacterium Photobacterium profundum strain SS9.

    PubMed

    Allen, Eric E; Bartlett, Douglas H

    2002-06-01

    Omega-3 polyunsaturated fatty acids (PUFAs) such as eicosapentaenoic acid (20:5n-3; EPA) and docosahexaenoic acid (22:6n-3; DHA) have been shown to be of major importance in the promotion of cardiovascular health, proper human development and the prevention of some cancers. A high proportion of bacterial isolates from low-temperature and high-pressure marine environments produce EPA or DHA. This paper presents the sequence of a 33 kbp locus from the deep-sea bacterium Photobacterium profundum strain SS9 which includes four of the five genes required for EPA biosynthesis. As with other bacterial pfa (polyunsaturated fatty acid) genes, the deduced amino acid sequences encoded by the SS9 genes reveal large multidomain proteins that are likely to catalyse EPA biosynthesis by a novel polyketide synthesis mechanism. RNase protection experiments separated the SS9 pfa genes into two transcriptional units, pfaA-C and pfaD. The pfaA transcriptional start site was identified. Cultivation at elevated hydrostatic pressure or reduced temperature did not increase pfa gene expression despite the resulting increase in percentage composition of EPA under these conditions. However, a regulatory mutant was characterized which showed both increased expression of pfaA-D and elevated EPA percentage composition. This result suggests that a regulatory factor exists which coordinates pfaA-D transcription. Additional consideration regarding the activities required for PUFA synthesis is provided together with comparative analyses of bacterial pfa genes and gene products.

  13. Draft Genome Sequence of Cyanobacterium sp. Strain IPPAS B-1200 with a Unique Fatty Acid Composition

    PubMed Central

    Starikov, Alexander Y.; Usserbaeva, Aizhan A.; Sinetova, Maria A.; Sarsekeyeva, Fariza K.; Zayadan, Bolatkhan K.; Ustinova, Vera V.; Kupriyanova, Elena V.; Los, Dmitry A.

    2016-01-01

    Here, we report the draft genome of Cyanobacterium sp. IPPAS strain B-1200, isolated from Lake Balkhash, Kazakhstan, and characterized by the unique fatty acid composition of its membrane lipids, which are enriched with myristic and myristoleic acids. The approximate genome size is 3.4 Mb, and the predicted number of coding sequences is 3,119. PMID:27856596

  14. In vaginal fluid, bacteria associated with bacterial vaginosis can be suppressed with lactic acid but not hydrogen peroxide

    PubMed Central

    2011-01-01

    Background Hydrogen peroxide (H2O2) produced by vaginal lactobacilli is generally believed to protect against bacteria associated with bacterial vaginosis (BV), and strains of lactobacilli that can produce H2O2 are being developed as vaginal probiotics. However, evidence that led to this belief was based in part on non-physiological conditions, antioxidant-free aerobic conditions selected to maximize both production and microbicidal activity of H2O2. Here we used conditions more like those in vivo to compare the effects of physiologically plausible concentrations of H2O2 and lactic acid on a broad range of BV-associated bacteria and vaginal lactobacilli. Methods Anaerobic cultures of seventeen species of BV-associated bacteria and four species of vaginal lactobacilli were exposed to H2O2, lactic acid, or acetic acid at pH 7.0 and pH 4.5. After two hours, the remaining viable bacteria were enumerated by growth on agar media plates. The effect of vaginal fluid (VF) on the microbicidal activities of H2O2 and lactic acid was also measured. Results Physiological concentrations of H2O2 (< 100 μM) failed to inactivate any of the BV-associated bacteria tested, even in the presence of human myeloperoxidase (MPO) that increases the microbicidal activity of H2O2. At 10 mM, H2O2 inactivated all four species of vaginal lactobacilli but only one of seventeen species of BV-associated bacteria. Moreover, the addition of just 1% vaginal fluid (VF) blocked the microbicidal activity of 1 M H2O2. In contrast, lactic acid at physiological concentrations (55-111 mM) and pH (4.5) inactivated all the BV-associated bacteria tested, and had no detectable effect on the vaginal lactobacilli. Also, the addition of 10% VF did not block the microbicidal activity of lactic acid. Conclusions Under optimal, anaerobic growth conditions, physiological concentrations of lactic acid inactivated BV-associated bacteria without affecting vaginal lactobacilli, whereas physiological concentrations of H2O2

  15. Time series community genomics analysis reveals rapid shifts in bacterial species, strains, and phage during infant gut colonization

    PubMed Central

    Sharon, Itai; Morowitz, Michael J.; Thomas, Brian C.; Costello, Elizabeth K.; Relman, David A.; Banfield, Jillian F.

    2013-01-01

    The gastrointestinal microbiome undergoes shifts in species and strain abundances, yet dynamics involving closely related microorganisms remain largely unknown because most methods cannot resolve them. We developed new metagenomic methods and utilized them to track species and strain level variations in microbial communities in 11 fecal samples collected from a premature infant during the first month of life. Ninety six percent of the sequencing reads were assembled into scaffolds of >500 bp in length that could be assigned to organisms at the strain level. Six essentially complete (∼99%) and two near-complete genomes were assembled for bacteria that comprised as little as 1% of the community, as well as nine partial genomes of bacteria representing as little as 0.05%. In addition, three viral genomes were assembled and assigned to their hosts. The relative abundance of three Staphylococcus epidermidis strains, as well as three phages that infect them, changed dramatically over time. Genes possibly related to these shifts include those for resistance to antibiotics, heavy metals, and phage. At the species level, we observed the decline of an early-colonizing Propionibacterium acnes strain similar to SK137 and the proliferation of novel Propionibacterium and Peptoniphilus species late in colonization. The Propionibacterium species differed in their ability to metabolize carbon compounds such as inositol and sialic acid, indicating that shifts in species composition likely impact the metabolic potential of the community. These results highlight the benefit of reconstructing complete genomes from metagenomic data and demonstrate methods for achieving this goal. PMID:22936250

  16. Identification of the Atlantic cod L-amino acid oxidase and its alterations following bacterial exposure.

    PubMed

    Kitani, Yoichiro; Fernandes, Jorge M O; Kiron, Viswanath

    2015-06-01

    Antibacterial factors that are present in epidermal mucus of fish have a potential role in the first line of host defence to bacterial pathogens. This study reports the identification of L-amino acid oxidase (LAO) in Atlantic cod (GmLao) and the changes in the molecule following bacterial exposure. The gmlao transcripts and LAO activity were present on both the body surface and in the internal organs of the fish. Relative mRNA level of gmlao increased significantly in the gills, the spleen and the head kidney (up to 8-fold) of fish that were challenged with the pathogen Vibrio anguillarum. The gmlao expression in skin was 4-fold higher in challenged fish. Our data indicate that LAO may be an important effector of antibacterial defence in Atlantic cod.

  17. Butyric acid fermentation from pretreated and hydrolysed wheat straw by an adapted Clostridium tyrobutyricum strain

    PubMed Central

    Baroi, G N; Baumann, I; Westermann, P; Gavala, H N

    2015-01-01

    Butyric acid is a valuable building-block for the production of chemicals and materials and nowadays it is produced exclusively from petroleum. The aim of this study was to develop a suitable and robust strain of Clostridium tyrobutyricum that produces butyric acid at a high yield and selectivity from lignocellulosic biomasses. Pretreated (by wet explosion) and enzymatically hydrolysed wheat straw (PHWS), rich in C6 and C5 sugars (71.6 and 55.4 g l−1 of glucose and xylose respectively), was used as substrate. After one year of serial selections, an adapted strain of C. tyrobutyricum was developed. The adapted strain was able to grow in 80% (v v−1) PHWS without addition of yeast extract compared with an initial tolerance to less than 10% PHWS and was able to ferment both glucose and xylose. It is noticeable that the adapted C. tyrobutyricum strain was characterized by a high yield and selectivity to butyric acid. Specifically, the butyric acid yield at 60–80% PHWS lie between 0.37 and 0.46 g g−1 of sugar, while the selectivity for butyric acid was as high as 0.9–1.0 g g−1 of acid. Moreover, the strain exhibited a robust response in regards to growth and product profile at pH 6 and 7. PMID:26230610

  18. Listeria monocytogenes varies among strains to maintain intracellular pH homeostasis under stresses by different acids as analyzed by a high-throughput microplate-based fluorometry.

    PubMed

    Cheng, Changyong; Yang, Yongchun; Dong, Zhimei; Wang, Xiaowen; Fang, Chun; Yang, Menghua; Sun, Jing; Xiao, Liya; Fang, Weihuan; Song, Houhui

    2015-01-01

    Listeria monocytogenes, a food-borne pathogen, has the capacity to maintain intracellular pH (pHi) homeostasis in acidic environments, but the underlying mechanisms remain elusive. Here, we report a simple microplate-based fluorescent method to determine pHi of listerial cells that were prelabeled with the fluorescent dye carboxyfluorescein diacetate N-succinimidyl ester and subjected to acid stress. We found that L. monocytogenes responds differently among strains toward organic and inorganic acids to maintain pHi homeostasis. The capacity of L. monocytogenes to maintain pHi at extracellular pH 4.5 (pHex) was compromised in the presence of acetic acid and lactic acid, but not by hydrochloric acid and citric acid. Organic acids exhibited more inhibitory effects than hydrochloric acid at certain pH conditions. Furthermore, the virulent stains L. monocytogenes EGDe, 850658 and 10403S was more resistant to acidic stress than the avirulent M7 which showed a defect in maintaining pHi homeostasis. Deletion of sigB, a stress-responsive alternative sigma factor from 10403S, markedly altered intracellular pHi homeostasis, and showed a significant growth and survival defect under acidic conditions. Thus, this work provides new insights into bacterial survival mechanism to acidic stresses.

  19. Listeria monocytogenes varies among strains to maintain intracellular pH homeostasis under stresses by different acids as analyzed by a high-throughput microplate-based fluorometry

    PubMed Central

    Cheng, Changyong; Yang, Yongchun; Dong, Zhimei; Wang, Xiaowen; Fang, Chun; Yang, Menghua; Sun, Jing; Xiao, Liya; Fang, Weihuan; Song, Houhui

    2015-01-01

    Listeria monocytogenes, a food-borne pathogen, has the capacity to maintain intracellular pH (pHi) homeostasis in acidic environments, but the underlying mechanisms remain elusive. Here, we report a simple microplate-based fluorescent method to determine pHi of listerial cells that were prelabeled with the fluorescent dye carboxyfluorescein diacetate N-succinimidyl ester and subjected to acid stress. We found that L. monocytogenes responds differently among strains toward organic and inorganic acids to maintain pHi homeostasis. The capacity of L. monocytogenes to maintain pHi at extracellular pH 4.5 (pHex) was compromised in the presence of acetic acid and lactic acid, but not by hydrochloric acid and citric acid. Organic acids exhibited more inhibitory effects than hydrochloric acid at certain pH conditions. Furthermore, the virulent stains L. monocytogenes EGDe, 850658 and 10403S was more resistant to acidic stress than the avirulent M7 which showed a defect in maintaining pHi homeostasis. Deletion of sigB, a stress-responsive alternative sigma factor from 10403S, markedly altered intracellular pHi homeostasis, and showed a significant growth and survival defect under acidic conditions. Thus, this work provides new insights into bacterial survival mechanism to acidic stresses. PMID:25667585

  20. Accuracy, reproducibility, and interpretation of fatty acid methyl ester profiles of model bacterial communities

    USGS Publications Warehouse

    Kidd, Haack S.; Garchow, H.; Odelson, D.A.; Forney, L.J.; Klug, M.J.

    1994-01-01

    We determined the accuracy and reproducibility of whole-community fatty acid methyl ester (FAME) analysis with two model bacterial communities differing in composition by using the Microbial ID, Inc. (MIDI), system. The biomass, taxonomic structure, and expected MIDI-FAME profiles under a variety of environmental conditions were known for these model communities a priori. Not all members of each community could be detected in the composite profile because of lack of fatty acid 'signatures' in some isolates or because of variations (approximately fivefold) in fatty acid yield across taxa. MIDI- FAME profiles of replicate subsamples of a given community were similar in terms of fatty acid yield per unit of community dry weight and relative proportions of specific fatty acids. Principal-components analysis (PCA) of MIDI-FAME profiles resulted in a clear separation of the two different communities and a clustering of replicates of each community from two separate experiments on the first PCA axis. The first PCA axis accounted for 57.1% of the variance in the data and was correlated with fatty acids that varied significantly between communities and reflected the underlying community taxonomic structure. On the basis of our data, community fatty acid profiles can be used to assess the relative similarities and differences of microbial communities that differ in taxonomic composition. However, detailed interpretation of community fatty acid profiles in terms of biomass or community taxonomic composition must be viewed with caution until our knowledge of the quantitative and qualitative distribution of fatty acids over a wide variety of taxa and the effects of growth conditions on fatty acid profiles is more extensive.

  1. Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar.

    PubMed

    Štornik, Aleksandra; Skok, Barbara; Trček, Janja

    2016-03-01

    Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S-23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S-23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1-5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial production of

  2. Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar

    PubMed Central

    Štornik, Aleksandra; Skok, Barbara

    2016-01-01

    Summary Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S−23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S−23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1−5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial

  3. Quantitative analysis of the lactic acid and acetaldehyde produced by Streptococcus thermophilus and Lactobacillus bulgaricus strains isolated from traditional Turkish yogurts using HPLC.

    PubMed

    Gezginc, Y; Topcal, F; Comertpay, S; Akyol, I

    2015-03-01

    The present study was conducted to evaluate the lactic acid- and acetaldehyde-producing abilities of lactic acid bacterial species isolated from traditionally manufactured Turkish yogurts using HPLC. The lactic acid bacterial species purified from the yogurts were the 2 most widely used species in industrial yogurt production: Streptococcus thermophilus and Lactobacillus bulgaricus. These bacteria have the ability to ferment hexose sugars homofermentatively to generate lactic acid and some carbonyl compounds, such as acetaldehyde through pyruvate metabolism. The levels of the compounds produced during fermentation influence the texture and the flavor of the yogurt and are themselves influenced by the chemical composition of the milk, processing conditions, and the metabolic activity of the starter culture. In the study, morphological, biochemical, and molecular characteristics were employed to identify the bacteria obtained from homemade yogurts produced in different regions of Turkey. A collection of 91 Strep. thermophilus and 35 L. bulgaricus strains were investigated for their lactic acid- and acetaldehyde-formation capabilities in various media such as cow milk, LM17 agar, and aerobic-anaerobic SM17 agar or de Man, Rogosa, and Sharpe agar. The amounts of the metabolites generated by each strain in all conditions were quantified by HPLC. The levels were found to vary depending on the species, the strain, and the growth conditions used. Whereas lactic acid production ranged between 0 and 77.9 mg/kg for Strep. thermophilus strains, it ranged from 0 to 103.5 mg/kg for L. bulgaricus. Correspondingly, the ability to generate acetaldehyde ranged from 0 to 105.9 mg/kg in Strep. thermophilus and from 0 to 126.9 mg/kg in L. bulgaricus. Our study constitutes the first attempt to determine characteristics of the wild strains isolated from traditional Turkish yogurts, and the approach presented here, which reveals the differences in metabolite production abilities of the

  4. Airborne bacterial reduction by spraying slightly acidic electrolyzed water in a laying-hen house.

    PubMed

    Zheng, Weichao; Kang, Runmin; Wang, Hongning; Li, Baoming; Xu, Changwen; Wang, Shuang

    2013-10-01

    Spraying slightly acidic electrolyzed water (SAEW) has been considered as a potential approach to reduce airborne bacteria in laying-hen houses. In this study, the effects of spraying SAEW on airborne bacterial reduction were investigated in a laying-hen house as compared with using diluted didecyl dimethyl ammonium bromide (DDAB). Averaged air temperature reduced by approximate 1 degrees C and average relative humidity increased by 3% at a stable ventilation rate (about 2.5 m3 hr(-1) per bird) in the laying-hen house 30 min after spraying (120 mL m(-2)). Compared with the control without spraying, the airborne bacterial concentration was reduced by about 0.70 and 0.37 log10 colony-forming units (CFU) m(-3) in the 4 hr after spraying 120 mL m(-2) SAEW (available chlorine concentration [ACC] of 156 mg L(-1)) and diluted DDAB (active compound concentration of 167 mg L(-1)), respectively. Compared with spraying diluted DDAB, spraying SAEW was determined to be more effective for reducing airborne bacterial in laying-hen houses. The effects of spraying SAEW and diluted DDAB on airborne bacterial reduction in the laying-hen house increased with the increasing available chlorine concentrations for SAEW (156, 206, 262 mg L(-1)) and increasing active compound concentrations for diluted DDAB (167, 333, 500 mg L(-1)), respectively. Spraying SAEW and diluted DDAB with two levels of spraying volumes (120 and 90 mL m(-2)) both showed significant differences on airborne bacterial reduction in the laying-hen house (P < 0.05).

  5. Effects of acetic acid, ethanol, and SO(2) on the removal of volatile acidity from acidic wines by two Saccharomyces cerevisiae commercial strains.

    PubMed

    Vilela-Moura, Alice; Schuller, Dorit; Mendes-Faia, Arlete; Côrte-Real, Manuela

    2010-07-01

    Herein, we report the influence of different combinations of initial concentration of acetic acid and ethanol on the removal of acetic acid from acidic wines by two commercial Saccharomyces cerevisiae strains S26 and S29. Both strains reduced the volatile acidity of an acidic wine (1.0 gl(-1) acetic acid and 11% (v/v) ethanol) by 78% and 48%, respectively. Acetic acid removal by strains S26 and S29 was associated with a decrease in ethanol concentration of 0.7 and 1.2% (v/v), respectively. Strain S26 revealed better removal efficiency due to its higher tolerance to stress factors imposed by acidic wines. Sulfur dioxide (SO(2)) in the concentration range 95-170 mg l(-1)inhibits the ability of both strains to reduce the volatile acidity of the acidic wine used under our experimental conditions. Therefore, deacidification should be carried out either in wines stabilized by filtration or in wines with SO(2)concentrations up to 70 mg l(-1). Deacidification of wines with the better performing strain S26 was associated with changes in the concentration of volatile compounds. The most pronounced increase was observed for isoamyl acetate (banana) and ethyl hexanoate (apple, pineapple), with an 18- and 25-fold increment, respectively, to values above the detection threshold. The acetaldehyde concentration of the deacidified wine was 2.3 times higher, and may have a detrimental effect on the wine aroma. Moreover, deacidification led to increased fatty acids concentration, but still within the range of values described for spontaneous fermentations, and with apparently no negative impact on the organoleptical properties.

  6. A novel immunity system for bacterial nucleic acid degrading toxins and its recruitment in various eukaryotic and DNA viral systems

    PubMed Central

    Zhang, Dapeng; Iyer, Lakshminarayan M.; Aravind, L.

    2011-01-01

    The use of nucleases as toxins for defense, offense or addiction of selfish elements is widely encountered across all life forms. Using sensitive sequence profile analysis methods, we characterize a novel superfamily (the SUKH superfamily) that unites a diverse group of proteins including Smi1/Knr4, PGs2, FBXO3, SKIP16, Syd, herpesviral US22, IRS1 and TRS1, and their bacterial homologs. Using contextual analysis we present evidence that the bacterial members of this superfamily are potential immunity proteins for a variety of toxin systems that also include the recently characterized contact-dependent inhibition (CDI) systems of proteobacteria. By analyzing the toxin proteins encoded in the neighborhood of the SUKH superfamily we predict that they possess domains belonging to diverse nuclease and nucleic acid deaminase families. These include at least eight distinct types of DNases belonging to HNH/EndoVII- and restriction endonuclease-fold, and RNases of the EndoU-like and colicin E3-like cytotoxic RNases-folds. The N-terminal domains of these toxins indicate that they are extruded by several distinct secretory mechanisms such as the two-partner system (shared with the CDI systems) in proteobacteria, ESAT-6/WXG-like ATP-dependent secretory systems in Gram-positive bacteria and the conventional Sec-dependent system in several bacterial lineages. The hedgehog-intein domain might also release a subset of toxic nuclease domains through auto-proteolytic action. Unlike classical colicin-like nuclease toxins, the overwhelming majority of toxin systems with the SUKH superfamily is chromosomally encoded and appears to have diversified through a recombination process combining different C-terminal nuclease domains to N-terminal secretion-related domains. Across the bacterial superkingdom these systems might participate in discriminating `self’ or kin from `non-self’ or non-kin strains. Using structural analysis we demonstrate that the SUKH domain possesses a versatile

  7. Effect of acidic electrolyzed water-induced bacterial inhibition and injury in live clam (Venerupis philippinarum) and mussel (Mytilus edulis).

    PubMed

    Al-Qadiri, Hamzah M; Al-Holy, Murad A; Shiroodi, Setareh Ghorban; Ovissipour, Mahmoudreza; Govindan, Byju N; Al-Alami, Nivin; Sablani, Shyam S; Rasco, Barbara

    2016-08-16

    The effect of acidic electrolyzed water (AEW) on inactivating Escherichia coli O104:H4, Listeria monocytogenes, Aeromonas hydrophila, Vibrio parahaemolyticus and Campylobacter jejuni in laboratory contaminated live clam (Venerupis philippinarum) and mussel (Mytilus edulis) was investigated. The initial levels of bacterial contamination were: in clam 4.9 to 5.7log10CFU/g, and in mussel 5.1 to 5.5log10CFU/g. Two types of AEW were used for treatment time intervals of 1 and 2h: strong (SAEW) with an available chlorine concentration (ACC) of 20mg/L, pH=3.1, and an oxidation-reduction potential (ORP) of 1150mV, and weak (WAEW) at ACC of 10mg/L, pH=3.55 and ORP of 950mV. SAEW and WAEW exhibited significant inhibitory activity against inoculated bacteria in both shellfish species with significant differences compared to saline solutions treatments (1-2% NaCl) and untreated controls (0h). SAEW showed the largest inhibitory activity, the extent of reduction (log10CFU/g) ranged from 1.4-1.7 for E. coli O104:H4; 1.0-1.6 for L. monocytogenes; 1.3-1.6 for A. hydrophila; 1.0-1.5 for V. parahaemolyticus; and 1.5-2.2 for C. jejuni in both types of shellfish. In comparison, significantly (P<0.05) lower inhibitory effect of WAEW was achieved compared to SAEW, where the extent of reduction (log10CFU/g) ranged from 0.7-1.1 for E. coli O104:H4; 0.6-0.9 for L. monocytogenes; 0.6-1.3 for A. hydrophila; 0.7-1.3 for V. parahaemolyticus; and 0.8-1.9 for C. jejuni in both types of shellfish. Among all bacterial strains examined in this study, AEW induced less bacterial injury (~0.1-1.0log10CFU/g) and more inactivation effect. This study revealed that AEW (10-20mg/L ACC) could be used to reduce bacterial contamination in live clam and mussel, which may help control possible unhygienic practices during production and processing of shellfish without apparent changes in the quality of the shellfish.

  8. Translation quality control is critical for bacterial responses to amino acid stress

    PubMed Central

    Bullwinkle, Tammy J.; Ibba, Michael

    2016-01-01

    Gene expression relies on quality control for accurate transmission of genetic information. One mechanism that prevents amino acid misincorporation errors during translation is editing of misacylated tRNAs by aminoacyl-tRNA synthetases. In the absence of editing, growth is limited upon exposure to excess noncognate amino acid substrates and other stresses, but whether these physiological effects result solely from mistranslation remains unclear. To explore if translation quality control influences cellular processes other than protein synthesis, an Escherichia coli strain defective in Tyr-tRNAPhe editing was used. In the absence of editing, cellular levels of aminoacylated tRNAPhe were elevated during amino acid stress, whereas in the wild-type strain these levels declined under the same growth conditions. In the editing-defective strain, increased levels of aminoacylated tRNAPhe led to continued synthesis of the PheL leader peptide and attenuation of pheA transcription under amino acid stress. Consequently, in the absence of editing, activation of the phenylalanine biosynthetic operon becomes less responsive to phenylalanine limitation. In addition to raising aminoacylated tRNA levels, the absence of editing lowered the amount of deacylated tRNAPhe in the cell. This reduction in deacylated tRNA was accompanied by decreased synthesis of the second messenger guanosine tetraphosphate and limited induction of stringent response-dependent gene expression in editing-defective cells during amino acid stress. These data show that a single quality-control mechanism, the editing of misacylated aminoacyl-tRNAs, provides a critical checkpoint both for maintaining the accuracy of translation and for determining the sensitivity of transcriptional responses to amino acid stress. PMID:26858451

  9. Translation quality control is critical for bacterial responses to amino acid stress.

    PubMed

    Bullwinkle, Tammy J; Ibba, Michael

    2016-02-23

    Gene expression relies on quality control for accurate transmission of genetic information. One mechanism that prevents amino acid misincorporation errors during translation is editing of misacylated tRNAs by aminoacyl-tRNA synthetases. In the absence of editing, growth is limited upon exposure to excess noncognate amino acid substrates and other stresses, but whether these physiological effects result solely from mistranslation remains unclear. To explore if translation quality control influences cellular processes other than protein synthesis, an Escherichia coli strain defective in Tyr-tRNA(Phe) editing was used. In the absence of editing, cellular levels of aminoacylated tRNA(Phe) were elevated during amino acid stress, whereas in the wild-type strain these levels declined under the same growth conditions. In the editing-defective strain, increased levels of aminoacylated tRNA(Phe) led to continued synthesis of the PheL leader peptide and attenuation of pheA transcription under amino acid stress. Consequently, in the absence of editing, activation of the phenylalanine biosynthetic operon becomes less responsive to phenylalanine limitation. In addition to raising aminoacylated tRNA levels, the absence of editing lowered the amount of deacylated tRNA(Phe) in the cell. This reduction in deacylated tRNA was accompanied by decreased synthesis of the second messenger guanosine tetraphosphate and limited induction of stringent response-dependent gene expression in editing-defective cells during amino acid stress. These data show that a single quality-control mechanism, the editing of misacylated aminoacyl-tRNAs, provides a critical checkpoint both for maintaining the accuracy of translation and for determining the sensitivity of transcriptional responses to amino acid stress.

  10. Metabolic evolution of Escherichia coli strains that produce organic acids

    DOEpatents

    Grabar, Tammy; Gong, Wei; Yocum, R Rogers

    2014-10-28

    This invention relates to the metabolic evolution of a microbial organism previously optimized for producing an organic acid in commercially significant quantities under fermentative conditions using a hexose sugar as sole source of carbon in a minimal mineral medium. As a result of this metabolic evolution, the microbial organism acquires the ability to use pentose sugars derived from cellulosic materials for its growth while retaining the original growth kinetics, the rate of organic acid production and the ability to use hexose sugars as a source of carbon. This invention also discloses the genetic change in the microorganism that confers the ability to use both the hexose and pentose sugars simultaneously in the production of commercially significant quantities of organic acids.

  11. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

    2001-09-25

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which has been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

  12. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, M.; Millard, C.S.; Stols, L.

    1998-06-23

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which as been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria. 2 figs.

  13. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

    2002-01-01

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which has been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

  14. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

    1998-01-01

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which as been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

  15. Genomic Survey of Pathogenicity Determinants and VNTR Markers in the Cassava Bacterial Pathogen Xanthomonas axonopodis pv. Manihotis Strain CIO151

    PubMed Central

    Arrieta-Ortiz, Mario L.; Rodríguez-R, Luis M.; Pérez-Quintero, Álvaro L.; Poulin, Lucie; Díaz, Ana C.; Arias Rojas, Nathalia; Trujillo, Cesar; Restrepo Benavides, Mariana; Bart, Rebecca; Boch, Jens; Boureau, Tristan; Darrasse, Armelle; David, Perrine; Dugé de Bernonville, Thomas; Fontanilla, Paula; Gagnevin, Lionel; Guérin, Fabien; Jacques, Marie-Agnès; Lauber, Emmanuelle; Lefeuvre, Pierre; Medina, Cesar; Medina, Edgar; Montenegro, Nathaly; Muñoz Bodnar, Alejandra; Noël, Laurent D.; Ortiz Quiñones, Juan F.; Osorio, Daniela; Pardo, Carolina; Patil, Prabhu B.; Poussier, Stéphane; Pruvost, Olivier; Robène-Soustrade, Isabelle; Ryan, Robert P.; Tabima, Javier; Urrego Morales, Oscar G.; Vernière, Christian; Carrere, Sébastien; Verdier, Valérie; Szurek, Boris; Restrepo, Silvia; López, Camilo

    2013-01-01

    Xanthomonas axonopodis pv. manihotis (Xam) is the causal agent of bacterial blight of cassava, which is among the main components of human diet in Africa and South America. Current information about the molecular pathogenicity factors involved in the infection process of this organism is limited. Previous studies in other bacteria in this genus suggest that advanced draft genome sequences are valuable resources for molecular studies on their interaction with plants and could provide valuable tools for diagnostics and detection. Here we have generated the first manually annotated high-quality draft genome sequence of Xam strain CIO151. Its genomic structure is similar to that of other xanthomonads, especially Xanthomonas euvesicatoria and Xanthomonas citri pv. citri species. Several putative pathogenicity factors were identified, including type III effectors, cell wall-degrading enzymes and clusters encoding protein secretion systems. Specific characteristics in this genome include changes in the xanthomonadin cluster that could explain the lack of typical yellow color in all strains of this pathovar and the presence of 50 regions in the genome with atypical nucleotide composition. The genome sequence was used to predict and evaluate 22 variable number of tandem repeat (VNTR) loci that were subsequently demonstrated as polymorphic in representative Xam strains. Our results demonstrate that Xanthomonas axonopodis pv. manihotis strain CIO151 possesses ten clusters of pathogenicity factors conserved within the genus Xanthomonas. We report 126 genes that are potentially unique to Xam, as well as potential horizontal transfer events in the history of the genome. The relation of these regions with virulence and pathogenicity could explain several aspects of the biology of this pathogen, including its ability to colonize both vascular and non-vascular tissues of cassava plants. A set of 16 robust, polymorphic VNTR loci will be useful to develop a multi-locus VNTR analysis

  16. Genomic survey of pathogenicity determinants and VNTR markers in the cassava bacterial pathogen Xanthomonas axonopodis pv. Manihotis strain CIO151.

    PubMed

    Arrieta-Ortiz, Mario L; Rodríguez-R, Luis M; Pérez-Quintero, Álvaro L; Poulin, Lucie; Díaz, Ana C; Arias Rojas, Nathalia; Trujillo, Cesar; Restrepo Benavides, Mariana; Bart, Rebecca; Boch, Jens; Boureau, Tristan; Darrasse, Armelle; David, Perrine; Dugé de Bernonville, Thomas; Fontanilla, Paula; Gagnevin, Lionel; Guérin, Fabien; Jacques, Marie-Agnès; Lauber, Emmanuelle; Lefeuvre, Pierre; Medina, Cesar; Medina, Edgar; Montenegro, Nathaly; Muñoz Bodnar, Alejandra; Noël, Laurent D; Ortiz Quiñones, Juan F; Osorio, Daniela; Pardo, Carolina; Patil, Prabhu B; Poussier, Stéphane; Pruvost, Olivier; Robène-Soustrade, Isabelle; Ryan, Robert P; Tabima, Javier; Urrego Morales, Oscar G; Vernière, Christian; Carrere, Sébastien; Verdier, Valérie; Szurek, Boris; Restrepo, Silvia; López, Camilo; Koebnik, Ralf; Bernal, Adriana

    2013-01-01

    Xanthomonas axonopodis pv. manihotis (Xam) is the causal agent of bacterial blight of cassava, which is among the main components of human diet in Africa and South America. Current information about the molecular pathogenicity factors involved in the infection process of this organism is limited. Previous studies in other bacteria in this genus suggest that advanced draft genome sequences are valuable resources for molecular studies on their interaction with plants and could provide valuable tools for diagnostics and detection. Here we have generated the first manually annotated high-quality draft genome sequence of Xam strain CIO151. Its genomic structure is similar to that of other xanthomonads, especially Xanthomonas euvesicatoria and Xanthomonas citri pv. citri species. Several putative pathogenicity factors were identified, including type III effectors, cell wall-degrading enzymes and clusters encoding protein secretion systems. Specific characteristics in this genome include changes in the xanthomonadin cluster that could explain the lack of typical yellow color in all strains of this pathovar and the presence of 50 regions in the genome with atypical nucleotide composition. The genome sequence was used to predict and evaluate 22 variable number of tandem repeat (VNTR) loci that were subsequently demonstrated as polymorphic in representative Xam strains. Our results demonstrate that Xanthomonas axonopodis pv. manihotis strain CIO151 possesses ten clusters of pathogenicity factors conserved within the genus Xanthomonas. We report 126 genes that are potentially unique to Xam, as well as potential horizontal transfer events in the history of the genome. The relation of these regions with virulence and pathogenicity could explain several aspects of the biology of this pathogen, including its ability to colonize both vascular and non-vascular tissues of cassava plants. A set of 16 robust, polymorphic VNTR loci will be useful to develop a multi-locus VNTR analysis

  17. High Frequency and Diversity of Antimicrobial Activities Produced by Nasal Staphylococcus Strains against Bacterial Competitors

    PubMed Central

    Janek, Daniela; Zipperer, Alexander; Kulik, Andreas; Krismer, Bernhard; Peschel, Andreas

    2016-01-01

    The human nasal microbiota is highly variable and dynamic often enclosing major pathogens such as Staphylococcus aureus. The potential roles of bacteriocins or other mechanisms allowing certain bacterial clones to prevail in this nutrient-poor habitat have hardly been studied. Of 89 nasal Staphylococcus isolates, unexpectedly, the vast majority (84%) was found to produce antimicrobial substances in particular under habitat-specific stress conditions, such as iron limitation or exposure to hydrogen peroxide. Activity spectra were generally narrow but highly variable with activities against certain nasal members of the Actinobacteria, Proteobacteria, Firmicutes, or several groups of bacteria. Staphylococcus species and many other Firmicutes were insusceptible to most of the compounds. A representative bacteriocin was identified as a nukacin-related peptide whose inactivation reduced the capacity of the producer Staphylococcus epidermidis IVK45 to limit growth of other nasal bacteria. Of note, the bacteriocin genes were found on mobile genetic elements exhibiting signs of extensive horizontal gene transfer and rearrangements. Thus, continuously evolving bacteriocins appear to govern bacterial competition in the human nose and specific bacteriocins may become important agents for eradication of notorious opportunistic pathogens from human microbiota. PMID:27490492

  18. [Recombinant Escherichia coli strains deficient in mixed acid fermentation pathways and capable of rapid aerobic growth on glucose with a reduced Crabtree effect].

    PubMed

    Morzhakova, A A; Skorokhodova, A Iu; Gulevich, A Iu; Debabov, V G

    2013-01-01

    In this study, we constructed and characterized Escherichia coli strains deficient for mixed acid fermentation pathways, which are capable of rapid aerobic growth on glucose without pronounced bacterial Crabtree effect. The main pathways of production of acetic and lactic acids and ethanol in these strains were inactivated by a deletion of the ackA, pta, poxB, IdhA, and adhEgenes. The phosphoenolpyruvate-dependent phosphotransferase system of glucose transport and phosphorylation was inactivated in the strains by a deletion of the ptsG gene. The possibility of alternative transport and phosphorylation of the carbohydrate substrate was ensured in recombinants by constitutive expression of the galP and glk genes, which encode the low-affinity H+-symporter of D-galactose and glucokinase, respectively. SGMI.0DeltaptsG PtacgalP and SG M1.0DeltaptsG PIglk PtacgalP strains were capable of rapid aerobic growth in a minimal medium containing 2.0 and 10.0 g/l of glucose and secreted only small amounts of acetic acid and trace amounts of pyruvic acid.

  19. Synergistic and Additive Effect of Oregano Essential Oil and Biological Silver Nanoparticles against Multidrug-Resistant Bacterial Strains

    PubMed Central

    Scandorieiro, Sara; de Camargo, Larissa C.; Lancheros, Cesar A. C.; Yamada-Ogatta, Sueli F.; Nakamura, Celso V.; de Oliveira, Admilton G.; Andrade, Célia G. T. J.; Duran, Nelson; Nakazato, Gerson; Kobayashi, Renata K. T.

    2016-01-01

    Bacterial resistance to conventional antibiotics has become a clinical and public health problem, making therapeutic decisions more challenging. Plant compounds and nanodrugs have been proposed as potential antimicrobial alternatives. Studies have shown that oregano (Origanum vulgare) essential oil (OEO) and silver nanoparticles have potent antibacterial activity, also against multidrug-resistant strains; however, the strong organoleptic characteristics of OEO and the development of resistance to these metal nanoparticles can limit their use. This study evaluated the antibacterial effect of a two-drug combination of biologically synthesized silver nanoparticles (bio-AgNP), produced by Fusarium oxysporum, and OEO against Gram-positive and Gram-negative bacteria, including multidrug-resistant strains. OEO and bio-AgNP showed bactericidal effects against all 17 strains tested, with minimal inhibitory concentrations (MIC) ranging from 0.298 to 1.193 mg/mL and 62.5 to 250 μM, respectively. Time-kill curves indicated that OEO acted rapidly (within 10 min), while the metallic nanoparticles took 4 h to kill Gram-negative bacteria and 24 h to kill Gram-positive bacteria. The combination of the two compounds resulted in a synergistic or additive effect, reducing their MIC values and reducing the time of action compared to bio-AgNP used alone, i.e., 20 min for Gram-negative bacteria and 7 h for Gram-positive bacteria. Scanning electron microscopy (SEM) revealed similar morphological alterations in Staphylococcus aureus (non-methicillin-resistant S. aureus, non-MRSA) cells exposed to three different treatments (OEO, bio-AgNP and combination of the two), which appeared cell surface blebbing. Individual and combined treatments showed reduction in cell density and decrease in exopolysaccharide matrix compared to untreated bacterial cells. It indicated that this composition have an antimicrobial activity against S. aureus by disrupting cells. Both compounds showed very low

  20. Cooperative Mn(II) oxidation between two bacterial strains in an aquatic environment.

    PubMed

    Liang, Jinsong; Bai, Yaohui; Hu, Chengzhi; Qu, Jiuhui

    2016-02-01

    In natural or engineered environments, diverse interspecific interactions among two or more microbial taxa may profoundly affect the transformation of organic compounds in the media. Little is known, however, about how these organisms and interactions affect the transformation of heavy metals. Recently, we found an interaction between two non-Mn(II)-oxidizing (when in monoculture) strains, Arthrobacter sp. QXT-31 and Sphingopyxis sp. QXT-31, which, when cultured in combination, resulted in Mn(II)-oxidizing activity in synthetic media. In order to study the occurrence likelihood of cooperative Mn(II) oxidation in natural water and discharged effluent, we initially identified an optimal ratio of the two strains in a combined culture, as well as the impacts of external factors on the cooperative oxidation. Once preferred initial conditions were established, we assessed the degree and rate of Mn(II) oxidation mediated by the combined QXT-31 strains (henceforth referred to as simply 'QXT-31') in three different water types: groundwater, domestic sewage and coking wastewater. Results showed that Mn(II) oxidation only occurred when the two strains were within a specific ratios range. When introduced to the test waters at the preferred ratio, QXT-31 demonstrated high Mn(II)-oxidizing activities, even when relative abundance of QXT-31 was very low (roughly 1.6%, calculated by 454 pyrosequencing events on 16S rcDNA). Interestingly, even under low relative abundance of QXT-31, removal of total organic carbon and total nitrogen in the test waters was significantly higher than the control treatments that were not inoculated with QXT-31. Data from our study indicate that cooperative Mn(II) oxidation is most likely to occur in natural aquatic ecosystems, and also suggests an alternative method to treat wastewater containing high concentrations of Mn(II).

  1. Phospholipid-Derived Fatty Acids and Quinones as Markers for Bacterial Biomass and Community Structure in Marine Sediments

    PubMed Central

    Kunihiro, Tadao; Veuger, Bart; Vasquez-Cardenas, Diana; Pozzato, Lara; Le Guitton, Marie; Moriya, Kazuyoshi; Kuwae, Michinobu; Omori, Koji; Boschker, Henricus T. S.; van Oevelen, Dick

    2014-01-01

    Phospholipid-derived fatty acids (PLFA) and respiratory quinones (RQ) are microbial compounds that have been utilized as biomarkers to quantify bacterial biomass and to characterize microbial community structure in sediments, waters, and soils. While PLFAs have been widely used as quantitative bacterial biomarkers in marine sediments, applications of quinone analysis in marine sediments are very limited. In this study, we investigated the relation between both groups of bacterial biomarkers in a broad range of marine sediments from the intertidal zone to the deep sea. We found a good log-log correlation between concentrations of bacterial PLFA and RQ over several orders of magnitude. This relationship is probably due to metabolic variation in quinone concentrations in bacterial cells in different environments, whereas PLFA concentrations are relatively stable under different conditions. We also found a good agreement in the community structure classifications based on the bacterial PLFAs and RQs. These results strengthen the application of both compounds as quantitative bacterial biomarkers. Moreover, the bacterial PLFA- and RQ profiles revealed a comparable dissimilarity pattern of the sampled sediments, but with a higher level of dissimilarity for the RQs. This means that the quinone method has a higher resolution for resolving differences in bacterial community composition. Combining PLFA and quinone analysis as a complementary method is a good strategy to yield higher resolving power in bacterial community structure. PMID:24769853

  2. Isolation of bacterial cellulose nanocrystalline from pineapple peel waste: Optimization of acid concentration in the hydrolysis method

    NASA Astrophysics Data System (ADS)

    Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik

    2016-02-01

    Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.

  3. Degradation of nicosulfuron by a novel isolated bacterial strain Klebsiella sp. Y1: condition optimization, kinetics and degradation pathway.

    PubMed

    Wang, Lin; Zhang, Xiaolin; Li, Yongmei

    2016-01-01

    A novel bacterial strain Klebsiella sp. Y1 was isolated from the soil of a constructed wetland, and it was identified based on the 16S rDNA sequence analysis. The co-metabolic degradation of nicosulfuron with glucose by Klebsiella sp. Y1 was investigated. The response surface methodology analysis indicated that the optimal pH and temperature were 7.0 and 35 °C, respectively, for the degradation of nicosulfuron. Under the optimal conditions, the degradation of nicosulfuron fitted Haldane kinetics model well. The removal of nicosulfuron was triggered by the acidification of glucose, which accelerated the hydrolysis of nicosulfuron. Then, the C-N bond of the sulfonylurea bridge was attacked and cleaved. Finally, the detected intermediate 2-amino-4,6-dimethoxypyrimidine was further biodegraded.

  4. Antibacterial efficacy of the seed extracts of Melia azedarach against some hospital isolated human pathogenic bacterial strains

    PubMed Central

    Khan, Abdul Viqar; Ahmed, Qamar Uddin; Mir, M Ramzan; Shukla, Indu; Khan, Athar Ali

    2011-01-01

    Objective To investigate the antibacterial potential of the polar and non-polar extracts of the seeds of Melia azedarach (M. azedarach) L. (Meliaceae) against eighteen hospital isolated human pathogenic bacterial strains. Methods Petrol, benzene, ethyl acetate, methanol, and aqueous extracts at five different concentrations (1, 2, 5, 10 and 15 mg/mL) were evaluated. Disk diffusion method was followed to evaluate the antibacterial efficacy. Results All extracts of the seeds demonstrated significant antibacterial activity against tested pathogens. Among all extracts, ethyl acetate extract revealed the highest inhibition comparatively. The present study also favored the traditional uses reported earlier. Conclusions Results of this study strongly confirm that the seed extracts of M. azedarach could be effective antibiotics, both in controlling gram-positive and gram-negative human pathogenic infections. PMID:23569812

  5. Towards a tolerance toolkit: Gene expression signatures enabling the emergence of resistant bacterial strains

    NASA Astrophysics Data System (ADS)

    Erickson, Keesha; Chatterjee, Anushree

    2014-03-01

    Microbial pathogens are able to rapidly acquire tolerance to chemical toxins. Developing next-generation antibiotics that impede the emergence of resistance will help avoid a world-wide health crisis. Conversely, the ability to induce rapid tolerance gains could lead to high-yielding strains for sustainable production of biofuels and commodity chemicals. Achieving these goals requires an understanding of the general mechanisms allowing microbes to become resistant to diverse toxins. We apply top-down and bottom-up methodologies to identify biological network changes leading to adaptation and tolerance. Using a top-down approach, we perform evolution experiments to isolate resistant strains, collect samples for transcriptomic and proteomic analysis, and use the omics data to inform mathematical gene regulatory models. Using a bottom-up approach, we build and test synthetic genetic devices that enable increased or decreased expression of selected genes. Unique patterns in gene expression are identified in cultures actively gaining resistance, especially in pathways known to be involved with stress response, efflux, and mutagenesis. Genes correlated with tolerance could potentially allow the design of resistance-free antibiotics or robust chemical production strains.

  6. Tet38 Efflux Pump Affects Staphylococcus aureus Internalization by Epithelial Cells through Interaction with CD36 and Contributes to Bacterial Escape from Acidic and Nonacidic Phagolysosomes.

    PubMed

    Truong-Bolduc, Q C; Khan, N S; Vyas, J M; Hooper, D C

    2017-02-01

    We previously reported that the Tet38 efflux pump is involved in internalization of Staphylococcus aureus by A549 lung epithelial cells. A lack of tet38 reduced bacterial uptake by A549 cells to 36% of that of the parental strain RN6390. Using invasion assays coupled with confocal microscopy imaging, we studied the host cell receptor(s) responsible for bacterial uptake via interaction with Tet38. We also assessed the ability of S. aureus to survive following alkalinization of the phagolysosomes by chloroquine. Antibody to the scavenger receptor CD36 reduced the internalization of S. aureus RN6390 by A549 cells, but the dependence on CD36 was reduced in QT7 tet38, suggesting that an interaction between Tet38 and CD36 contributed to S. aureus internalization. Following fusion of the S. aureus-associated endosomes with lysosomes, alkalinization of the acidic environment with chloroquine led to a rapid increase in the number of S. aureus RN6390 bacteria in the cytosol, followed by a decrease shortly thereafter. This effect of chloroquine was not seen in the absence of intact Tet38 in mutant QT7. These data taken together suggest that Tet38 plays a role both in bacterial internalization via interaction with CD36 and in bacterial escape from the phagolysosomes.

  7. Extracellular polymeric substances (EPS) producing bacterial strains of municipal wastewater sludge: isolation, molecular identification, EPS characterization and performance for sludge settling and dewatering.

    PubMed

    Bala Subramanian, S; Yan, S; Tyagi, R D; Surampalli, R Y

    2010-04-01

    Wastewater treatment plants often face the problems of sludge settling mainly due to sludge bulking. Generally, synthetic organic polymer and/or inorganic coagulants (ferric chloride, alum and quick lime) are used for sludge settling. These chemicals are very expensive and further pollute the environment. Whereas, the bioflocculants are environment friendly and may be used to flocculate the sludge. Extracellular polymeric substances (EPS) produced by sludge microorganisms play a definite role in sludge flocculation. In this study, 25 EPS producing strains were isolated from municipal wastewater treatment plant. Microorganisms were selected based on EPS production properties on solid agar medium. Three types of EPS (slime, capsular and bacterial broth mixture of both slime and capsular) were harvested and their characteristics were studied. EPS concentration (dry weight), viscosity and their charge (using a Zetaphoremeter) were also measured. Bioflocculability of obtained EPS was evaluated by measuring the kaolin clay flocculation activity. Six bacterial strains (BS2, BS8, BS9, BS11, BS15 and BS25) were selected based on the kaolin clay flocculation. The slime EPS was better for bioflocculation than capsular EPS and bacterial broth. Therefore, extracted slime EPS (partially purified) from six bacterial strains was studied in terms of sludge settling [sludge volume index (SVI)] and dewatering [capillary suction time (CST)]. Biopolymers produced by individual strains substantially improved dewaterability. The extracted slime EPS from six different strains were partially characterized.

  8. Survival of model bacterial strains and helminth eggs in the course of mesophilic anaerobic digestion of pig slurry.

    PubMed

    Juris, P; Tóth, F; Lauková, A; Plachý, P; Dubinský, P; Sokol, J

    1996-05-01

    The effect of methanogenesis on the survival of model bacterial strains (Escherichia coli EC 5, Staphylococcus aureus SA 11, Enterococcus faecium CCM 4231) and non-embryonated helminth eggs (Ascaris suum) was investigated in pig slurry. Two pilot-plant experiments were carried out in two anaerobic digesters (800 and 1,000 litre) in a mesophilic thermal range (35-37 degrees C). The mean hydraulic retention time of the digesters was 20 days. The methanogenesis process was monitored by determining the following chemical parameters: pH, N-NH3, total dry matter (kg/day), organic matter (kg/day) production of methane by supplied and degraded organic matter (m3/kg). The results obtained allow us to state that the anaerobic stabilization of pig slurry in the mesophilic temperature range resulted in total devitalization of model bacterial strains E. coli EC 5 and Ent. faecium CCM 4231. St. aureus SA 11 cells, exposed to the above mentioned conditions, were also reduced in their number from 10.04 to 3.27 and from 8.69 to 2.77 log cfu/ml. It is assumed that the longer retention time of excrements in the digester could also result in total devitalization of St. aureus SA 11 cells. From the microbiological point of view, the above mentioned facts indicate a sufficient hygienization effect of the anaerobic fermentation on the contaminated pig excrements. The survival of A. suum eggs was little affected by the 20-day anaerobic mesophilic digestion of pig slurry. Only 17 or 18% (F1, F2) of the non-embryonated A. suum eggs were damaged after the 20-day exposure.

  9. Analysis of Vaginal Acetic Acid in Patients Undergoing Treatment for Bacterial Vaginosis

    PubMed Central

    Chaudry, Amjad N.; Travers, Paul J.; Yuenger, Jeffrey; Colletta, Lorraine; Evans, Phillip; Zenilman, Jonathan M.; Tummon, Andrew

    2004-01-01

    A “gold standard” method for the diagnosis of bacterial vaginosis (BV) is lacking. The clinical criteria described by the Amsel technique are subjective and difficult to quantify. Alternatively, the reading of Gram-stained vaginal smears by scoring techniques such as those that use the Nugent or Hay-Ison scoring systems is again subjective, requires expert personnel to perform the reading, and is infrequently used clinically. Recently, a new diagnostic device, the Osmetech Microbial Analyzer—Bacterial Vaginosis (OMA-BV), which determines a patient's BV status on the basis of measurement of the amount of acetic acid present in a vaginal swab specimen, was approved by the Food and Drug Administration. The present study uses the conducting polymer gas-sensing technology of OMA-BV to measure the concentration of acetic acid in the headspace above vaginal swab specimens from patients undergoing treatment for BV with metronidazole. In 97.8% of the cases the level of acetic acid detected fell sharply during the treatment period, crossing from above to below the diagnostic threshold of 900 ppm. The diagnosis obtained on the basis of the level of vaginal acetic acid was compared with the diagnoses obtained by use of the Amsel criteria and the Nugent scoring system both at the time of initial entry into the study and at the repeat samplings on days 7 and 14. The results obtained with OMA-BV showed overall agreements compared with the results of the Amsel and Nugent tests of 98 and 94%, respectively, for the 34 patients monitored through the treatment process. This provides further evidence that the measurement of vaginal acetic acid by headspace analysis with conducting polymer sensors is a valid alternative to present tests for the diagnosis of BV. PMID:15528711

  10. Investigation of the biotransformation of pentachlorophenol and pulp paper mill effluent decolorisation by the bacterial strains in a mixed culture.

    PubMed

    Singh, Shail; Chandra, R; Patel, D K; Reddy, M M K; Rai, Vibhuti

    2008-09-01

    Mixed culture of two bacterial strains Bacillus sp. and Serratia marcescens showed potential pentachlorophenol (PCP) degradation and decolorisation of pulp paper mill effluent. The physico-chemical quality of pulp paper mill effluent has been analyzed after 168 h incubation period degraded by mixed culture. The study revealed that it has decreased high load of BOD, COD, TS, TDS, TSS, sulphate, phosphate, total nitrogen, total phenols, metals and different salts (i.e. chloride, sodium, nitrate, potassium) at 168 h incubation period. PCP degradation in pulp paper mill effluent was confirmed by HPLC analysis. Mixed culture was found to degrade PCP up to (94%) present in pulp paper mill effluent with 1% glucose and 0.5% peptone (w/v) at 30+/-1 degrees C, pH 8.0+/-0.2 at 120 rpm in 168 h incubation period. The simultaneous release of chloride ion up to 1,200 mg/l at 168 h emphasized the bacterial dechlorination in the medium. The pulp paper mill effluent degradation was also supported by decline in pH, AOX (absorbable organic halides), color, D.O., BOD, COD and PCP. The analysis of pulp paper mill effluent degradation products by GC-MS analysis revealed the formation of low molecular weight compound like 2-chlorophenol (RT=3.8 min) and tetrachlorohydroquinone (RT=11.86 min) from PCP extracted degraded sample. Further, mixed culture may be used for bioremediation of PCP containing pulp paper mill waste in the environment.

  11. Trace Amounts of Furan-2-Carboxylic Acids Determine the Quality of Solid Agar Plates for Bacterial Culture

    PubMed Central

    Hara, Shintaro; Isoda, Reika; Tahvanainen, Teemu; Hashidoko, Yasuyuki

    2012-01-01

    Background Many investigators have recognised that a significant proportion of environmental bacteria exist in a viable but non-culturable state on agar plates, and some researchers have also noticed that some of such bacteria clearly recover their growth on matrices other than agar. However, the reason why agar is unsuitable for the growth of some bacteria has not been addressed. Methodology/Principal Findings According to the guide of a bioassay for swarming inhibition, we identified 5-hydroxymethylfuran-2-carboxylic acid (5-HMFA) and furan-2-carboxylic acid (FA) as factors that inhibit bacterial swarming and likely inhibit extracellular polysaccharide production on agar. The furan-2-carboxylic acids 5-HMFA and FA effectively inhibited the swarming and swimming of several environmental bacteria at concentrations of 1.8 and 2.3 µg L−1 (13 and 21 nmol L−1), respectively, which are equivalent to the concentrations of these compounds in 0.3% agar. On Luria-Bertani (LB) plates containing 1.0% agar that had been previously washed with MeOH, a mixture of 5-HMFA and FA in amounts equivalent to their original concentrations in the unwashed agar repressed the swarming of Escherichia coli K12 strain W3110, a representative swarming bacterium. Conclusions/Significance Agar that contains trace amounts of 5-HMFA and FA inhibits the proliferation of some slow-growing or difficult-to-culture bacteria on the plates, but it is useful for single colony isolation due to the ease of identification of swarmable bacteria as the non-swarmed colonies. PMID:22848437

  12. [The research progress of succinic acid fermentation strains].

    PubMed

    Wang, Qing-Zhao; Zhao, Xue-Ming

    2007-07-01

    The potential of succinic acid as an important chemical intermediates had been realized and fermentation is one of the best ways to make it possible in economical aspect. Fermentation organism is the key part of the fermentation method. The updated research developments of fermentation organisms and the fermentation characteristics and problems of them were reviewed and analyzed in this paper. Finally,the development future of fermenation organism was forecasted.

  13. Bioleaching of copper from waste printed circuit boards by bacterial consortium enriched from acid mine drainage.

    PubMed

    Xiang, Yun; Wu, Pingxiao; Zhu, Nengwu; Zhang, Ting; Liu, Wen; Wu, Jinhua; Li, Ping

    2010-12-15

    The objectives of this study were to evaluate the solubility of copper in waste printed circuit boards (PCBs) by bacterial consortium enriched from natural acid mine drainage, and to determine optimum conditions of bioleaching copper from PCBs. The results indicated that the extraction of copper was mainly accomplished indirectly through oxidation by ferric ions generated from ferrous ion oxidation bacteria. The initial pH and Fe(2+) concentration played an important role in copper extraction and precipitate formation. The leaching rate of copper was generally higher at lower PCB powder dosage. Moreover, a two-step process was extremely necessary for bacterial growth and obtaining an appropriate Fe(2+) oxidation rate; a suitable time when 6.25 g/L of Fe(2+) remained in the solution was suggested for adding PCB powder. The maximum leaching rate of copper was achieved 95% after 5 days under the conditions of initial pH 1.5, 9 g/L of initial Fe(2+), and 20 g/L of PCB powder. All findings demonstrated that copper could be efficiently solubilized from waste PCBs by using bacterial consortium, and the leaching period was shortened remarkably from about 12 days to 5 days.

  14. Enhanced biodegradation of alkane hydrocarbons and crude oil by mixed strains and bacterial community analysis.

    PubMed

    Chen, Yu; Li, Chen; Zhou, Zhengxi; Wen, Jianping; You, Xueyi; Mao, Youzhi; Lu, Chunzhe; Huo, Guangxin; Jia, Xiaoqiang

    2014-04-01

    In this study, two strains, Acinetobacter sp. XM-02 and Pseudomonas sp. XM-01, were isolated from soil samples polluted by crude oil at Bohai offshore. The former one could degrade alkane hydrocarbons (crude oil and diesel, 1:4 (v/v)) and crude oil efficiently; the latter one failed to grow on alkane hydrocarbons but could produce rhamnolipid (a biosurfactant) with glycerol as sole carbon source. Compared with pure culture, mixed culture of the two strains showed higher capability in degrading alkane hydrocarbons and crude oil of which degradation rate were increased from 89.35 and 74.32 ± 4.09 to 97.41 and 87.29 ± 2.41 %, respectively. In the mixed culture, Acinetobacter sp. XM-02 grew fast with sufficient carbon source and produced intermediates which were subsequently utilized for the growth of Pseudomonas sp. XM-01 and then, rhamnolipid was produced by Pseudomonas sp. XM-01. Till the end of the process, Acinetobacter sp. XM-02 was inhibited by the rapid growth of Pseudomonas sp. XM-01. In addition, alkane hydrocarbon degradation rate of the mixed culture increased by 8.06 to 97.41 % compared with 87.29 % of the pure culture. The surface tension of medium dropping from 73.2 × 10(-3) to 28.6 × 10(-3) N/m. Based on newly found cooperation between the degrader and the coworking strain, rational investigations and optimal strategies to alkane hydrocarbons biodegradation were utilized for enhancing crude oil biodegradation.

  15. Selection of a Bifidobacterium animalis subsp. lactis Strain with a Decreased Ability To Produce Acetic Acid

    PubMed Central

    Margolles, Abelardo

    2012-01-01

    We have characterized a new strain, Bifidobacterium animalis subsp. lactis CECT 7953, obtained by random UV mutagenesis, which produces less acetic acid than the wild type (CECT 7954) in three different experimental settings: De Man-Rogosa-Sharpe broth without sodium acetate, resting cells, and skim milk. Genome sequencing revealed a single Phe-Ser substitution in the acetate kinase gene product that seems to be responsible for the strain's reduced acid production. Accordingly, acetate kinase specific activity was lower in the low acetate producer. Strain CECT 7953 produced less acetate, less ethanol, and more yoghourt-related volatile compounds in skim milk than the wild type did. Thus, CECT 7953 shows promising potential for the development of dairy products fermented exclusively by a bifidobacterial strain. PMID:22389372

  16. Selection of a Bifidobacterium animalis subsp. lactis strain with a decreased ability to produce acetic acid.

    PubMed

    Margolles, Abelardo; Sánchez, Borja

    2012-05-01

    We have characterized a new strain, Bifidobacterium animalis subsp. lactis CECT 7953, obtained by random UV mutagenesis, which produces less acetic acid than the wild type (CECT 7954) in three different experimental settings: De Man-Rogosa-Sharpe broth without sodium acetate, resting cells, and skim milk. Genome sequencing revealed a single Phe-Ser substitution in the acetate kinase gene product that seems to be responsible for the strain's reduced acid production. Accordingly, acetate kinase specific activity was lower in the low acetate producer. Strain CECT 7953 produced less acetate, less ethanol, and more yoghourt-related volatile compounds in skim milk than the wild type did. Thus, CECT 7953 shows promising potential for the development of dairy products fermented exclusively by a bifidobacterial strain.

  17. Endospore abundance and D:L-amino acid modeling of bacterial turnover in holocene marine sediment (Aarhus Bay)

    NASA Astrophysics Data System (ADS)

    Langerhuus, Alice T.; Røy, Hans; Lever, Mark A.; Morono, Yuki; Inagaki, Fumio; Jørgensen, Bo B.; Lomstein, Bente Aa.

    2012-12-01

    In order to study bacterial activity, and turnover times of bacterial necromass and biomass in marine sediment, two stations from the Aarhus Bay, Denmark were analyzed. Sediment cores were up to 11 m deep and covered a timescale from the present to ˜11,000 years ago. Sediment was analyzed for total hydrolysable amino acids (THAA), total hydrolysable amino sugars, the bacterial endospore marker dipicolinic acid (DPA), and amino acid enantiomers (L- and D-form) of aspartic acid. Turnover times of bacterial necromass and vegetative cells, as well as carbon oxidation rates were estimated by use of the D:L-amino acid racemization model. Diagenetic indicators were applied to evaluate the diagenetic state of the sedimentary organic matter. The contribution of amino acids to total organic carbon, and the ratio between the amino acids aspartic acid and glutamic acid, and their respective non protein degradation products, β-alanine and γ-amino butyric acid, all indicated increasing degradation state of the organic matter with sediment depth and age. Quantification of DPA showed that endospores were abundant, and increased with depth relative to vegetative cells. Most of the amino acids (97%) could be ascribed to microbial necromass, i.e. the remains of dead bacterial cells. Model estimates showed that the turnover times of microbial necromass were in the range of 0.5-1 × 105 years, while turnover times of vegetative cells were in the range of tens to hundreds of years. The turnover time of the TOC pool increased with depth in the sediment, indicating that the TOC pool became progressively more refractory and unavailable to microorganisms with depth and age of the organic matter.

  18. Ultralong C100 mycolic acids support the assignment of Segniliparus as a new bacterial genus.

    PubMed

    Hong, Sunhee; Cheng, Tan-Yun; Layre, Emilie; Sweet, Lindsay; Young, David C; Posey, James E; Butler, W Ray; Moody, D Branch

    2012-01-01

    Mycolic acid-producing bacteria isolated from the respiratory tract of human and non-human mammals were recently assigned as a distinct genus, Segniliparus, because they diverge from rhodococci and mycobacteria in genetic and chemical features. Using high accuracy mass spectrometry, we determined the chemical composition of 65 homologous mycolic acids in two Segniliparus species and separately analyzed the three subclasses to measure relative chain length, number and stereochemistry of unsaturations and cyclopropyl groups within each class. Whereas mycobacterial mycolate subclasses are distinguished from one another by R groups on the meromycolate chain, Segniliparus species synthesize solely non-oxygenated α-mycolates with high levels of cis unsaturation. Unexpectedly Segniliparus α-mycolates diverge into three subclasses based on large differences in carbon chain length with one bacterial culture producing mycolates that range from C58 to C100. Both the overall chain length (C100) and the chain length diversity (C42) are larger than previously seen for mycolic acid-producing organisms and provide direct chemical evidence for assignment of Segniliparus as a distinct genus. Yet, electron microscopy shows that the long and diverse mycolates pack into a typical appearing membrane. Therefore, these new and unexpected extremes of mycolic acid chemical structure raise questions about the modes of mycolic acid packing and folding into a membrane.

  19. Bioconversion of Styrene to Poly(hydroxyalkanoate) (PHA) by the New Bacterial Strain Pseudomonas putida NBUS12

    PubMed Central

    Tan, Giin-Yu Amy; Chen, Chia-Lung; Ge, Liya; Li, Ling; Tan, Swee Ngin; Wang, Jing-Yuan

    2015-01-01

    Styrene is a toxic pollutant commonly found in waste effluents from plastic processing industries. We herein identified and characterized microorganisms for bioconversion of the organic eco-pollutant styrene into a valuable biopolymer medium-chain-length poly(hydroxyalkanoate) (mcl-PHA). Twelve newly-isolated styrene-degrading Pseudomonads were obtained and partial phaC genes were detected by PCR in these isolates. These isolates assimilated styrene to produce mcl-PHA, forming PHA contents between 0.05±0.00 and 23.10±3.25% cell dry mass (% CDM). The best-performing isolate was identified as Pseudomonas putida NBUS12. A genetic analysis of 16S rDNA and phaZ genes revealed P. putida NBUS12 as a genetically-distinct strain from existing phenotypically-similar bacterial strains. This bacterium achieved a final biomass of 1.28±0.10 g L−1 and PHA content of 32.49±2.40% CDM. The extracted polymer was mainly comprised of 3-hydroxyhexanoate (C6 ), 3-hydroxyoctanoate (C8 ), 3-hydroxydecanoate (C10 ), 3-hydroxydodecanoate (C12 ), and 3-hydroxytetradecanoate (C14 ) monomers at a ratio of 2:42:1257:17:1. These results collectively suggested that P. putida NBUS12 is a promising candidate for the biotechnological conversion of styrene into mcl-PHA. PMID:25740622

  20. Activation of Macrophages by Exopolysaccharide Produced by MK1 Bacterial Strain Isolated from Neungee Mushroom, Sarcodon aspratus

    PubMed Central

    Im, Sun-A; Wang, Wenxia; Lee, Chong-Kil

    2010-01-01

    Background The MK1 strain, a novel bacterial isolate from soft-rotten tissue of the Neungee mushroom, produces copious amounts of exopolysaccharide (EPS) in a dextrose minimal medium. This study examined the molecular characteristics and immunomodulatory activity of MK1 EPS. Methods The EPS in the culture supernatant was purified by cold ethanol precipitation, and characterized by SDS-PAGE/silver staining and Bio-HPLC. The immunomodulatory activities of the EPS were examined using the mouse monocytic cell line, RAW 264.7 cells. Results The molecular weights of the purified EPS were rather heterogeneous, ranging from 10.6 to 55 kDa. The EPS was composed of glucose, rhamnose, mannose, galactose, and glucosamine at an approximate molar ratio of 1.00:0.8:0.71:0.29:0.21. EPS activated the RAW cells to produce cytokines, such as TNF-α and IL-1β, and nitric oxide (NO). EPS also induced the expression of co-stimulatory molecules, such as B7-1, B7-2 and ICAM-1, and increased the phagocytic activity. The macrophage-activating activity of EPS was not due to endotoxin contamination because the treatment of EPS with polymyin B did not reduce the macrophage-activating activity. Conclusion The EPS produced from the MK1 strain exerts macrophage-activating activity. PMID:21286384

  1. Bis(aminomethyl)phosphinic Acid, a Highly Promising Scaffold for the Development of Bacterial Urease Inhibitors

    PubMed Central

    2014-01-01

    Inhibitors of bacterial ureases are considered to be promising compounds in the treatment of infections caused by Helicobacter pylori in the gastric tract and/or by urealytic bacteria (e.g., Proteus species) in the urinary tract. A new, extended transition state scaffold, bis(aminomethyl)phosphinic acid, was successfully explored for the construction of effective enzyme inhibitors. A reliable methodology for the synthesis of phosphinate analogues in a three-component Mannich-type reaction was elaborated. The obtained molecules were assayed against ureases purified from Sporosarcina pasteurii and Proteus mirabilis, and aminomethyl(N-n-hexylaminomethyl)phosphinic acid was found to be the most potent inhibitor, with a Ki = 108 nM against the S. pasteurii enzyme. PMID:25699141

  2. [Advancement in the research of early detection of bacterial nucleic acid in molecular diagnosis of sepsis].

    PubMed

    Liu, Xiao; Ren, Hui; Peng, Dai-zhi

    2013-04-01

    Early diagnosis of sepsis helps make effective clinical decisions and improve the survival rate of patients with severe infection. However, the timely and accurate diagnosis of sepsis is still a great challenge in clinic. In order to settle the very problem, the scientists in the world have made a lot of exploration and research in the field of rapid molecular identification of pathogens. Nowadays, the nucleic acid detection of sepsis is mainly composed of 3 types of methodological strategies, either based on positive blood culture, single colonies, or directly on blood specimens. This paper presents a comprehensive overview of advances in the research of early detection of bacterial nucleic acid as molecular diagnosis of sepsis.

  3. Growth kinetics of a diesel-degrading bacterial strain from petroleum-contaminated soil.

    PubMed

    Dahalan, S F A; Yunus, I; Johari, W L W; Shukor, M Y; Halmi, M I E; Shamaan, N A; Syed, M A

    2014-03-01

    A diesel-degrading bacterium was isolated from a diesel-contaminated site in Selangor, Malaysia. The isolate was tentatively identified as Acinetobacter sp. strain DRY12 based on partial 16S rDNA molecular phylogeny and Biolog GN microplate panels and Microlog database. Optimum growth occurred from 3 to 5% diesel and the strain was able to tolerate as high as 8% diesel. The optimal pH that supported growth of the bacterium was between pH 7.5 to 8.0. The isolate exhibited optimal growth in between 30 and 35 degrees C. The best nitrogen source was potassium nitrate (between 0.6 and 0.9% (w/v)) followed by ammonium chloride, sodium nitrite and ammonium sulphate in descending order. An almost complete removal of diesel components was seen from the reduction in hydrocarbon peaks observed using Solid Phase Microextraction Gas Chromatography analysis after 10 days of incubation. The best growth kinetic model to fit experimental data was the Haldane model of substrate inhibiting growth with a correlation coefficient value of 0.97. The maximum growth rate- micromax was 0.039 hr(-1) while the saturation constant or half velocity constant Ks and inhibition constant Ki, were 0.387% and 4.46%, respectively. MATH assays showed that 75% of the bacterium was found in the hexadecane phase indicating that the bacterium was hydrophobic. The characteristics of this bacterium make it useful for bioremediation works in the Tropics.

  4. D-Amino acids inhibit biofilm formation in Staphylococcus epidermidis strains from ocular infections.

    PubMed

    Ramón-Peréz, Miriam L; Diaz-Cedillo, Francisco; Ibarra, J Antonio; Torales-Cardeña, Azael; Rodríguez-Martínez, Sandra; Jan-Roblero, Janet; Cancino-Diaz, Mario E; Cancino-Diaz, Juan C

    2014-10-01

    Biofilm formation on medical and surgical devices is a major virulence determinant for Staphylococcus epidermidis. The bacterium S. epidermidis is able to produce biofilms on biotic and abiotic surfaces and is the cause of ocular infection (OI). Recent studies have shown that d-amino acids inhibit and disrupt biofilm formation in the prototype strains Bacillus subtilis NCBI3610 and Staphylococcus aureus SCO1. The effect of d-amino acids on S. epidermidis biofilm formation has yet to be tested for clinical or commensal isolates. S. epidermidis strains isolated from healthy skin (n = 3), conjunctiva (n = 9) and OI (n = 19) were treated with d-Leu, d-Tyr, d-Pro, d-Phe, d-Met or d-Ala and tested for biofilm formation. The presence of d-amino acids during biofilm formation resulted in a variety of patterns. Some strains were sensitive to all amino acids tested, while others were sensitive to one or more, and one strain was resistant to all of them when added individually; in this way d-Met inhibited most of the strains (26/31), followed by d-Phe (21/31). Additionally, the use of d-Met inhibited biofilm formation on a contact lens. The use of l-isomers caused no defect in biofilm formation in all strains tested. In contrast, when biofilms were already formed d-Met, d-Phe and d-Pro were able to disrupt it. In summary, here we demonstrated the inhibitory effect of d-amino acids on biofilm formation in S. epidermidis. Moreover, we showed, for the first time, that S. epidermidis clinical strains have a different sensitivity to these compounds during biofilm formation.

  5. Anaerobic and aerobic degradation of cyanophycin by the denitrifying bacterium Pseudomonas alcaligenes strain DIP1 and role of three other coisolates in a mixed bacterial consortium.

    PubMed

    Sallam, Ahmed; Steinbüchel, Alexander

    2008-06-01

    Four bacterial strains were isolated from a cyanophycin granule polypeptide (CGP)-degrading anaerobic consortium, identified by 16S rRNA gene sequencing, and assigned to species of the genera Pseudomonas, Enterococcus, Clostridium, and Paenibacillus. The consortium member responsible for CGP degradation was assigned as Pseudomonas alcaligenes strain DIP1. The growth of and CGP degradation by strain DIP1 under anaerobic conditions were enhanced but not dependent on the presence of nitrate as an electron acceptor. CGP was hydrolyzed to its constituting beta-Asp-Arg dipeptides, which were then completely utilized within 25 and 4 days under anaerobic and aerobic conditions, respectively. The end products of CGP degradation by strain DIP1 were alanine, succinate, and ornithine as determined by high-performance liquid chromatography analysis. The facultative anaerobic Enterococcus casseliflavus strain ELS3 and the strictly anaerobic Clostridium sulfidogenes strain SGB2 were coisolates and utilized the beta-linked isodipeptides from the common pool available to the mixed consortium, while the fourth isolate, Paenibacillus odorifer strain PNF4, did not play a direct role in the biodegradation of CGP. Several syntrophic interactions affecting CGP degradation, such as substrate utilization, the reduction of electron acceptors, and aeration, were elucidated. This study demonstrates the first investigation of CGP degradation under both anaerobic and aerobic conditions by one bacterial strain, with regard to the physiological role of other bacteria in a mixed consortium.

  6. [Mitigating the repress of cinnamic acid to cucumber growth by microbial strain].

    PubMed

    Yu, Guo-hui; Xie, Yin-hua; Chen, Yan-hong; Chen, Yuan-feng; Cheng, Ping

    2006-12-01

    Cucumber is one of the most important vegetable species. Its continuous planting has become a common practice demand in many areas of China, but an obstacle from continuous planting made sustainable production of this crop to be prohibited. The self-toxic effect was considered as an important negative factor to continuous cropping cucumber. And cinnamic acid was found to be the main substance to cause self-toxic. Strain Ha8, which isolated from waste water estuary in Zhuhai city and has been authenticated as Cellulosimicrobium cellulans, was found to be able to degrade cinnamic acid, benzoic acid, paraaminobenzoic acid and phenol. Its biologic degrading rate to cinnamic acid was 64.1% and its total degrading rate to cinnamic acid was 79.32% . Therefore, strain Ha8 was used to mitigate the growth stress of cucumber caused by cinnamic acid in the research. In the experiment by hydroponic culturing method, it was found that the stem length, root length, stem weight, leaf weight, root weight, numbers of flower and harvest weight of cucumbers were lower than those untreated ones when added 2micromol/L or 10micromol/L cinnamic acid in culturing solution. But when added 10(7)cfu/L of strain Ha8 and 2micromol/L or 10micromol/L cinnamic acid in same culturing solution, these parameters were higher than those treated only by 2mircomol/L or 10micromol/L cinnamic acid. The result shown that strain Ha8 could mitigate the self-toxic effect caused by cinnamic acid. In edaphic culturing experiments, it was found that organic fertilizer mixed with strain Ha8 could mitigate the growth stress of cucumber caused by 100mg/kg cinnamic acid. When added 3mg/kg sterilized organic fertilizer with strain Ha8 (> or = 10(6)cfu/g dry organic fertilizer) in the culturing soil, the result was satisfied. This treatment could not only improve the growth of cucumber, enhance their root dehydrogenase activity and output, promote their nutrition absorption rate, but also adjust the microbial groups in

  7. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities.

    PubMed

    Huete-Stauffer, Tamara M; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures.

  8. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities

    PubMed Central

    Huete-Stauffer, Tamara M.; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G.

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  9. Production of conjugated linoleic acids by Lactobacillus plantarum strains isolated from naturally fermented Chinese pickles*

    PubMed Central

    Liu, Pei; Shen, Sheng-rong; Ruan, Hui; Zhou, Qian; Ma, Liu-liu; He, Guo-qing

    2011-01-01

    Naturally fermented pickles harbour many lactic acid bacteria (LAB). Forty-three LAB strains with conjugated linoleic acid (CLA)-producing ability were isolated from three naturally fermented pickle brines. Of these isolates, lp15 identified as Lactobacillus plantarum by API 50 CHL system and full-length 16S rDNA sequence analysis exhibited the highest CLA-producing ability (26.1% conversion) at 48 h in de Man Rogosa Sharpe (MRS) broth in the presence of 100 µg/ml of linoleic acid (LA). Compared to other strains, L. plantarum strain lp15 showed the highest tolerance upon increased levels of LA in the medium, i.e., up to 600 µg/ml. This strain converted about 25% of LA into CLA isomers [predominantly cis-9, trans-11 CLA (9-CLA) and trans-10, cis-12 CLA (10-CLA)], of which 75% was 9-CLA. Interestingly, though the conversion rate of LA into CLA by lp15 remained stable between 100 to 600 µg/ml LA levels in the medium, it dropped sharply at 1000 µg/ml. Taken together, the lp15 strain displayed relatively high LA tolerance with higher conversion rate, which implies that this strain is a valuable candidate for enhancing the CLA content in food-sources like pickles. PMID:22042657

  10. Different response to acetic acid stress in Saccharomyces cerevisiae wild-type and l-ascorbic acid-producing strains.

    PubMed

    Martani, Francesca; Fossati, Tiziana; Posteri, Riccardo; Signori, Lorenzo; Porro, Danilo; Branduardi, Paola

    2013-09-01

    Biotechnological processes are of increasing significance for industrial production of fine and bulk chemicals, including biofuels. Unfortunately, under operative conditions microorganisms meet multiple stresses, such as non-optimal pH, temperature, oxygenation and osmotic stress. Moreover, they have to face inhibitory compounds released during the pretreatment of lignocellulosic biomasses, which constitute the preferential substrate for second-generation processes. Inhibitors include furan derivatives, phenolic compounds and weak organic acids, among which acetic acid is one of the most abundant and detrimental for cells. They impair cellular metabolism and growth, reducing the productivity of the process: therefore, the development of robust cell factories with improved production rates and resistance is of crucial importance. Here we show that a yeast strain engineered to endogenously produce vitamin C exhibits an increased tolerance compared to the parental strain when exposed to acetic acid at moderately toxic concentrations, measured as viability on plates. Starting from this evidence, we investigated more deeply: (a) the nature and levels of reactive oxygen species (ROS); (b) the activation of enzymes that act directly as detoxifiers of reactive oxygen species, such as superoxide dismutase (SOD) and catalase, in parental and engineered strains during acetic acid stress. The data indicate that the engineered strain can better recover from stress by limiting ROS accumulation, independently from SOD activation. The engineered yeast can be proposed as a model for further investigating direct and indirect mechanism(s) by which an antioxidant can rescue cells from organic acid damage; moreover, these studies will possibly provide additional targets for further strain improvements.

  11. Solid- and vapor-phase antimicrobial activities of six essential oils: susceptibility of selected foodborne bacterial and fungal strains.

    PubMed

    López, P; Sánchez, C; Batlle, R; Nerín, C

    2005-08-24

    The antimicrobial activity of essential oils (EOs) of cinnamon (Cinnamon zeylanicum), clove (Syzygium aromaticum), basil (Ocimum basillicum), rosemary (Rosmarinus officinalis), dill (Anethum graveolens), and ginger (Zingiber officinalis) was evaluated over a range of concentrations in two types of contact tests (solid and vapor diffusion). The EOs were tested against an array of four Gram-positive bacteria (Staphylococcus aureus, Bacillus cereus, Enterococcus faecalis, and Listeria monocytogenes), four Gram-negative bacteria (Escherichia coli, Yersinia enterocolitica, Salmonella choleraesuis, and Pseudomonas aeruginosa), and three fungi (a yeast, Candida albicans, and two molds, Penicillium islandicum and Aspergillus flavus). The rationale for this work was to test the possibility of creating a protective atmosphere by using natural compounds that could extend the shelf life of packaged foodstuffs while minimizing organoleptic alterations. In the solid diffusion tests, cinnamon and clove gave the strongest (and very similar) inhibition, followed by basil and rosemary, with dill and ginger giving the weakest inhibition. The fungi were the most sensitive microorganisms, followed by the Gram-positive bacterial strains. The Gram-negative strain P. aeruginosa was the least inhibited. The composition of the atmosphere generated by the EOs, and their minimum inhibitory concentrations (MICs), were determined using a disk volatilization method, in which no inhibition from rosemary or basil was observed. Cinnamon and clove, once again, gave similar results for every microorganism. As a general rule, MIC (fungi) < MIC (bacteria) with no clear differences between Gram-positive or -negative strains except for P. aeruginosa, which was not inhibited by any of the EOs in the vapor phase. The atmosphere generated from the EOs was analyzed by means of solid-phase microextraction combined with gas chromatography-ion trap mass spectrometry. Differences among the volatiles in the EOs

  12. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

    PubMed Central

    Alonzo, Francis

    2016-01-01

    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

  13. Algal and bacterial activities in acidic (pH 3) strip mine lakes

    SciTech Connect

    Gyure, R.A.; Konopka, A.; Brooks, A.; Doemel, W.

    1987-09-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H/sub 2/S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H/sub 2/S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by (/sup 14/C)glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake.

  14. Algal and Bacterial Activities in Acidic (pH 3) Strip Mine Lakes

    PubMed Central

    Gyure, Ruth A.; Konopka, Allan; Brooks, Austin; Doemel, William

    1987-01-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H2S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H2S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by [14C]glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake. PMID:16347430

  15. Assessment of Heat Resistance of Bacterial Spores from Food Product Isolates by Fluorescence Monitoring of Dipicolinic Acid Release

    PubMed Central

    Kort, Remco; O'Brien, Andrea C.; van Stokkum, Ivo H. M.; Oomes, Suus J. C. M.; Crielaard, Wim; Hellingwerf, Klaas J.; Brul, Stanley

    2005-01-01

    This study is aimed at the development and application of a convenient and rapid optical assay to monitor the wet-heat resistance of bacterial endospores occurring in food samples. We tested the feasibility of measuring the release of the abundant spore component dipicolinic acid (DPA) as a probe for heat inactivation. Spores were isolated from the laboratory type strain Bacillus subtilis 168 and from two food product isolates, Bacillus subtilis A163 and Bacillus sporothermodurans IC4. Spores from the lab strain appeared much less heat resistant than those from the two food product isolates. The decimal reduction times (D values) for spores from strains 168, A163, and IC4 recovered on Trypticase soy agar were 1.4, 0.7, and 0.3 min at 105°C, 120°C, and 131°C, respectively. The estimated Z values were 6.3°C, 6.1°C, and 9.7°C, respectively. The extent of DPA release from the three spore crops was monitored as a function of incubation time and temperature. DPA concentrations were determined by measuring the emission at 545 nm of the fluorescent terbium-DPA complex in a microtiter plate fluorometer. We defined spore heat resistance as the critical DPA release temperature (Tc), the temperature at which half the DPA content has been released within a fixed incubation time. We found Tc values for spores from Bacillus strains 168, A163, and IC4 of 108°C, 121°C, and 131°C, respectively. On the basis of these observations, we developed a quantitative model that describes the time and temperature dependence of the experimentally determined extent of DPA release and spore inactivation. The model predicts a DPA release rate profile for each inactivated spore. In addition, it uncovers remarkable differences in the values for the temperature dependence parameters for the rate of spore inactivation, DPA release duration, and DPA release delay. PMID:16000762

  16. Application of Routine Diagnostic Procedure, VITEK 2 Compact, MALDI-TOF MS, and PCR Assays in Identification Procedure of Bacterial Strain with Ambiguous Phenotype.

    PubMed

    Książczyk, Marta; Kuczkowski, Maciej; Dudek, Bartłomiej; Korzekwa, Kamila; Tobiasz, Anna; Korzeniowska-Kowal, Agnieszka; Paluch, Emil; Wieliczko, Alina; Bugla-Płoskońska, Gabriela

    2016-05-01

    In diagnostic microbiology as well as in microbiological research, the identification of a microorganism is a crucial and decisive stage. A broad choice of methods is available, based on both phenotypic and molecular properties of microbes. The aim of this study was to compare the application of phenotypic and molecular tools in bacterial identification on the example of Gram-negative intestine rod with an ambiguous phenotype. Different methods of identification procedure, which based on various properties of bacteria, were applied, e.g., microscopic observation of single-bacterial cells, macroscopic observation of bacterial colonies morphology, the automated system of microorganism identification (biochemical tests), the mass spectrometry method (analysis of bacterial proteome), and genetic analysis with PCR reactions. The obtained results revealed discrepancies in the identification of the tested bacterial strain with an atypical phenotype: mucous morphology of colonies, not characteristic for either E. coli and Citrobacter spp., mass spectrometry analysis of proteome initially assigned the tested strain to Citrobacter genus (C. freundii) and biochemical profiles pointed to Escherichia coli. A decisive method in the current study was genetic analysis with PCR reactions which identified conserved genetic sequences highly specific to E. coli species in the genome of the tested strain.

  17. Analysis of Growth Inhibition and Metabolism of Hydroxycinnamic Acids by Brewing and Spoilage Strains of Brettanomyces Yeast.

    PubMed

    Lentz, Michael; Harris, Chad

    2015-10-15

    Brettanomyces yeasts are well-known as spoilage organisms in both the wine and beer industries, but also contribute important desirable characters to certain beer styles. These properties are mediated in large part by Brettanomyces' metabolism of hydroxycinnamic acids (HCAs) present in beverage raw materials. Here we compare growth inhibition by, and metabolism of, HCAs among commercial brewing strains and spoilage strains of B. bruxellensis and B. anomalus. These properties vary widely among the different strains tested and between the HCAs analyzed. Brewing strains showed more efficient metabolism of ferulic acid over p-coumaric acid, a trait not shared among the spoilage strains.

  18. Analysis of Growth Inhibition and Metabolism of Hydroxycinnamic Acids by Brewing and Spoilage Strains of Brettanomyces Yeast

    PubMed Central

    Lentz, Michael; Harris, Chad

    2015-01-01

    Brettanomyces yeasts are well-known as spoilage organisms in both the wine and beer industries, but also contribute important desirable characters to certain beer styles. These properties are mediated in large part by Brettanomyces’ metabolism of hydroxycinnamic acids (HCAs) present in beverage raw materials. Here we compare growth inhibition by, and metabolism of, HCAs among commercial brewing strains and spoilage strains of B. bruxellensis and B. anomalus. These properties vary widely among the different strains tested and between the HCAs analyzed. Brewing strains showed more efficient metabolism of ferulic acid over p-coumaric acid, a trait not shared among the spoilage strains. PMID:28231223

  19. Key volatile aroma compounds of lactic acid fermented malt based beverages - impact of lactic acid bacteria strains.

    PubMed

    Nsogning Dongmo, Sorelle; Sacher, Bertram; Kollmannsberger, Hubert; Becker, Thomas

    2017-08-15

    This study aims to define the aroma composition and key aroma compounds of barley malt wort beverages produced from fermentation using six lactic acid bacteria (LAB) strains. Gas chromatography mass spectrometry-olfactometry and flame ionization detection was employed; key aroma compounds were determined by means of aroma extract dilution analysis. Fifty-six detected volatile compounds were similar among beverages. However, significant differences were observed in the concentration of individual compounds. Key aroma compounds (flavor dilution (FD) factors ≥16) were β-damascenone, furaneol, phenylacetic acid, 2-phenylethanol, 4-vinylguaiacol, sotolon, methional, vanillin, acetic acid, nor-furaneol, guaiacol and ethyl 2-methylbutanoate. Furthermore, acetaldehyde had the greatest odor activity value of up to 4266. Sensory analyses revealed large differences in the flavor profile. Beverage from L. plantarum Lp. 758 showed the highest FD factors in key aroma compounds and was correlated to fruity flavors. Therefore, we suggest that suitable LAB strain selection may improve the flavor of malt based beverages.

  20. Diversity and distribution of culturable lactic acid bacterial species in Indonesian Sayur Asin

    PubMed Central

    Mangunwardoyo, Wibowo; Abinawanto; Salamah, Andi; Sukara, Endang; Sulistiani; Dinoto, Achmad

    2016-01-01

    Background and Objectives: Lactic acid bacteria (LAB) play important roles in processing of Sayur Asin (spontaneously fermented mustard). Unfortunately, information about LAB in Indonesian Sayur Asin, prepared by traditional manufactures which is important as baseline data for maintenance of food quality and safety, is unclear. The aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in Sayur Asin of Indonesia. Materials and Methods: Four Sayur Asin samples (fermentation liquor and fermented mustard) were collected at harvesting times (3–7 days after fermentation) from two traditional manufactures in Tulung Agung (TA) and Kediri (KDR), East Java provinces, Indonesia. LAB strains were isolated by using MRS agar method supplemented with 1% CaCO 3 and characterized morphologically. Identification of the strains was performed basedon 16S rDNA analysis and the phylogenetic tree was drawn to understand the phylogenetic relationship of the collected strains. Results: Different profiles were detected in total count of the plates, salinity and pH of fermenting liquor of Sayur Asin in TA and KDR provinces. A total of 172 LAB isolates were successfully isolated and identified based on their 16S rDNA sequences. Phylogenetic analysis of 27 representative LAB strains from Sayur Asin showed that these strains belonged to 5 distinct species namely Lactobacilus farciminis (N=32), L. fermentum (N=4), L. namurensis (N=15), L. plantarum (N=118) and L. parafarraginis (N=1). Strains D5-S-2013 and B4-S-2013 showed a close phylogenetic relationship with L. composti and L. paralimentarius, respectively where as the sequence had slightly lower similarity of lower than 99%, suggesting that they may be classified into novel species and need further investigation due to exhibition of significant differences in their nucleotide sequences. Lactobacillus plantarum was found being dominant in all sayur asin samples. Conclusion: Lactobacilli were

  1. Lactic Acid Production from Pretreated Hydrolysates of Corn Stover by a Newly Developed Bacillus coagulans Strain

    PubMed Central

    Jiang, Ting; Qiao, Hui; Zheng, Zhaojuan; Chu, Qiulu; Li, Xin; Yong, Qiang; Ouyang, Jia

    2016-01-01

    An inhibitor-tolerance strain, Bacillus coagulans GKN316, was developed through atmospheric and room temperature plasma (ARTP) mutation and evolution experiment in condensed dilute-acid hydrolysate (CDH) of corn stover. The fermentabilities of other hydrolysates with B. coagulans GKN316 and the parental strain B. coagulans NL01 were assessed. When using condensed acid-catalyzed steam-exploded hydrolysate (CASEH), condensed acid-catalyzed liquid hot water hydrolysate (CALH) and condensed acid-catalyzed sulfite hydrolysate (CASH) as substrates, the concentration of lactic acid reached 45.39, 16.83, and 18.71 g/L by B. coagulans GKN316, respectively. But for B. coagulans NL01, only CASEH could be directly fermented to produce 15.47 g/L lactic acid. The individual inhibitory effect of furfural, 5-hydroxymethylfurfural (HMF), vanillin, syringaldehyde and p-hydroxybenzaldehyde (pHBal) on xylose utilization by B. coagulans GKN316 was also studied. The strain B. coagulans GKN316 could effectively convert these toxic inhibitors to the less toxic corresponding alcohols in situ. These results suggested that B. coagulans GKN316 was well suited to production of lactic acid from undetoxified lignocellulosic hydrolysates. PMID:26863012

  2. Design of homo-organic acid producing strains using multi-objective optimization.

    PubMed

    Kim, Tae Yong; Park, Jong Myoung; Kim, Hyun Uk; Cho, Kwang Myung; Lee, Sang Yup

    2015-03-01

    Production of homo-organic acids without byproducts is an important challenge in bioprocess engineering to minimize operation cost for separation processes. In this study, we used multi-objective optimization to design Escherichia coli strains with the goals of maximally producing target organic acids, while maintaining sufficiently high growth rate and minimizing the secretion of undesired byproducts. Homo-productions of acetic, lactic and succinic acids were targeted as examples. Engineered E. coli strains capable of producing homo-acetic and homo-lactic acids could be developed by taking this systems approach for the minimal identification of gene knockout targets. Also, failure to predict effective gene knockout targets for the homo-succinic acid production suggests that the multi-objective optimization is useful in assessing the suitability of a microorganism as a host strain for the production of a homo-organic acid. The systems metabolic engineering-based approach reported here should be applicable to the production of other industrially important organic acids.

  3. Lactic Acid Production from Pretreated Hydrolysates of Corn Stover by a Newly Developed Bacillus coagulans Strain.

    PubMed

    Jiang, Ting; Qiao, Hui; Zheng, Zhaojuan; Chu, Qiulu; Li, Xin; Yong, Qiang; Ouyang, Jia

    2016-01-01

    An inhibitor-tolerance strain, Bacillus coagulans GKN316, was developed through atmospheric and room temperature plasma (ARTP) mutation and evolution experiment in condensed dilute-acid hydrolysate (CDH) of corn stover. The fermentabilities of other hydrolysates with B. coagulans GKN316 and the parental strain B. coagulans NL01 were assessed. When using condensed acid-catalyzed steam-exploded hydrolysate (CASEH), condensed acid-catalyzed liquid hot water hydrolysate (CALH) and condensed acid-catalyzed sulfite hydrolysate (CASH) as substrates, the concentration of lactic acid reached 45.39, 16.83, and 18.71 g/L by B. coagulans GKN316, respectively. But for B. coagulans NL01, only CASEH could be directly fermented to produce 15.47 g/L lactic acid. The individual inhibitory effect of furfural, 5-hydroxymethylfurfural (HMF), vanillin, syringaldehyde and p-hydroxybenzaldehyde (pHBal) on xylose utilization by B. coagulans GKN316 was also studied. The strain B. coagulans GKN316 could effectively convert these toxic inhibitors to the less toxic corresponding alcohols in situ. These results suggested that B. coagulans GKN316 was well suited to production of lactic acid from undetoxified lignocellulosic hydrolysates.

  4. Complete Genome Sequence of Lactobacillus jensenii Strain SNUV360, a Probiotic for Treatment of Bacterial Vaginosis Isolated from the Vagina of a Healthy Korean Woman

    PubMed Central

    Lee, Sunghee; You, Hyun Ju; Kwon, Bomi

    2017-01-01

    ABSTRACT Lactobacillus jensenii SNUV360 is a potential probiotic strain that shows antimicrobial activity for the treatment of bacterial vaginosis. Here, we present the complete genomic sequence of L. jensenii SNUV360, isolated from a vaginal sample from a healthy Korean woman. Analysis of the sequence may provide insight into its functional activity. PMID:28280032

  5. Efficient free fatty acid production in engineered Escherichia coli strains using soybean oligosaccharides as feedstock.

    PubMed

    Wang, Dan; Wu, Hui; Thakker, Chandresh; Beyersdorf, Jared; Bennett, George N; San, Ka-Yiu

    2015-01-01

    To be competitive with current petrochemicals, microbial synthesis of free fatty acids can be made to rely on a variety of renewable resources rather than on food carbon sources, which increase its attraction for governments and companies. Industrial waste soybean meal is an inexpensive feedstock, which contains soluble sugars such as stachyose, raffinose, sucrose, glucose, galactose, and fructose. Free fatty acids were produced in this report by introducing an acyl-ACP carrier protein thioesterase and (3R)-hydroxyacyl-ACP dehydratase into E. coli. Plasmid pRU600 bearing genes involved in raffinose and sucrose metabolism was also transformed into engineered E. coli strains, which allowed more efficient utilization of these two kinds of specific oligosaccharide present in the soybean meal extract. Strain ML103 (pRU600, pXZ18Z) produced ~1.60 and 2.66 g/L of free fatty acids on sucrose and raffinose, respectively. A higher level of 2.92 g/L fatty acids was obtained on sugar mixture. The fatty acid production using hydrolysate obtained from acid or enzyme based hydrolysis was evaluated. Engineered strains just produced ~0.21 g/L of free fatty acids with soybean meal acid hydrolysate. However, a fatty acid production of 2.61 g/L with a high yield of 0.19 g/g total sugar was observed on an enzymatic hydrolysate. The results suggest that complex mixtures of oligosaccharides derived from soybean meal can serve as viable feedstock to produce free fatty acids. Enzymatic hydrolysis acts as a much more efficient treatment than acid hydrolysis to facilitate the transformation of industrial waste from soybean processing to high value added chemicals.

  6. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120

    PubMed Central

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-01-01

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion. PMID:25915115

  7. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120.

    PubMed

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-04-23

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion.

  8. Growth inhibition of Cronobacter spp. strains in reconstituted powdered infant formula acidified with organic acids supported by natural stomach acidity.

    PubMed

    Zhu, S; Schnell, S; Fischer, M

    2013-09-01

    Cronobacter is associated with outbreaks of rare, but life-threatening cases of meningitis, necrotizing enterocolitis, and sepsis in newborns. This study was conducted to determine the effect of organic acids on growth of Cronobacter in laboratory medium and reconstituted powdered infant formula (PIF) as well as the bacteriostatic effect of slightly acidified infant formula when combined with neonatal gastric acidity. Inhibitory effect of seven organic acids on four acid sensitive Cronobacter strains was determined in laboratory medium with broth dilution method at pH 5.0, 5.5 and 6.0. Acetic, butyric and propionic acids were most inhibitive against Cronobacter in the laboratory medium. The killing effect of these three acids was partially buffered in reconstituted PIF. Under neonatal gastric acid condition of pH 5.0, the slightly acidified formula which did not exert inhibition effect solely reduced significantly the Cronobacter populations. A synergistic effect of formula moderately acidified with organic acid combined with the physiological infant gastric acid was visible in preventing the rapid growth of Cronobacter in neonatal stomach. The study contributed to a better understanding of the inhibitory effect of organic acids on Cronobacter growth in different matrixes and provided new ideas in terms of controlling bacteria colonization and translocation by acidified formula.

  9. Clostridium strain which produces acetic acid from waste gases

    DOEpatents

    Gaddy, J.L.

    1997-01-14

    A method and apparatus are disclosed for converting waste gases from industrial processes such as oil refining, carbon black, coke, ammonia, and methanol production, into useful products. The method includes introducing the waste gases into a bioreactor where they are fermented to various organic acids or alcohols by anaerobic bacteria within the bioreactor. These valuable end products are then recovered, separated and purified. In an exemplary recovery process, the bioreactor raffinate is passed through an extraction chamber into which one or more non-inhibitory solvents are simultaneously introduced to extract the product. Then, the product is separated from the solvent by distillation. Gas conversion rates can be maximized by use of centrifuges, hollow fiber membranes, or other means of ultrafiltration to return entrained anaerobic bacteria from the bioreactor raffinate to the bioreactor itself, thus insuring the highest possible cell concentration. 4 figs.

  10. Discovery of Bacterial Fatty Acid Synthase Type II Inhibitors Using a Novel Cellular Bioluminescent Reporter Assay

    PubMed Central

    Wallace, Joselynn; Bowlin, Nicholas O.; Mills, Debra M.; Saenkham, Panatda; Kwasny, Steven M.; Opperman, Timothy J.; Williams, John D.; Rock, Charles O.; Bowlin, Terry L.

    2015-01-01

    Novel, cellular, gain-of-signal, bioluminescent reporter assays for fatty acid synthesis type II (FASII) inhibitors were constructed in an efflux-deficient strain of Pseudomonas aeruginosa and based on the discovery that FASII genes in P. aeruginosa are coordinately upregulated in response to pathway disruption. A screen of 115,000 compounds identified a series of sulfonamidobenzamide (SABA) analogs, which generated strong luminescent signals in two FASII reporter strains but not in four control reporter strains designed to respond to inhibitors of pathways other than FASII. The SABA analogs selectively inhibited lipid biosynthesis in P. aeruginosa and exhibited minimal cytotoxicity to mammalian cells (50% cytotoxic concentration [CC50] ≥ 80 μM). The most potent SABA analogs had MICs of 0.5 to 7.0 μM (0.2 to 3.0 μg/ml) against an efflux-deficient Escherichia coli (ΔtolC) strain but had no detectable MIC against efflux-proficient E. coli or against P. aeruginosa (efflux deficient or proficient). Genetic, molecular genetic, and biochemical studies revealed that SABA analogs target the enzyme (AccC) catalyzing the biotin carboxylase half-reaction of the acetyl coenzyme A (acetyl-CoA) carboxylase step in the initiation phase of FASII in E. coli and P. aeruginosa. These results validate the capability and the sensitivity of this novel bioluminescent reporter screen to identify inhibitors of E. coli and P. aeruginosa FASII. PMID:26169404

  11. Divalent cations enhance fluoride binding to Streptococcus mutans and Streptococcus sanguinis cells and subsequently inhibit bacterial acid production.

    PubMed

    Domon-Tawaraya, H; Nakajo, K; Washio, J; Ashizawa, T; Ichino, T; Sugawara, H; Fukumoto, S; Takahashi, N

    2013-01-01

    One preventive effect of topical fluoride application is derived from the fact that fluoride can inhibit bacterial acid production. Furthermore, divalent cations such as Ca(2+) and Mg(2+) increase the binding of fluoride to bacterial cells. These findings suggest that exposure of oral bacteria to fluoride in the presence of divalent cations increases fluoride binding to bacterial cells and subsequently enhances fluoride-induced inhibition of bacterial acid production. This study investigated the effects of fluoride exposure (0-20,000 ppm F) in the presence of Ca(2+) or Mg(2+) prior to glucose challenge on pH fall ability by bacterial sugar fermentation, as well as fluoride binding to bacterial cells by exposure to fluoride, and fluoride release from bacterial cells during bacterial sugar fermentation, using caries-related bacteria, Streptococcus mutans and Streptococcus sanguinis. The pH fall by both streptococci was inhibited by exposure to over 250 ppm F in the presence of Ca(2+) (p < 0.01), whereas in the presence of Mg(2+), the pH fall by S. mutans and S. sanguinis was inhibited after exposure to over 250 and 950 ppm F, respectively (p < 0.05). The amounts of fluoride binding to and released from streptococcal cells increased with the concentration of fluoride the cells were exposed to in the presence of Mg(2+), but were high enough even after 250 ppm F exposure in the presence of Ca(2+). The enhanced inhibition of acid production in the presence of divalent cations is probably due to the improved efficiency of fluoride binding to bacterial cells being improved via these divalent cations.

  12. Acetic Acid Bacterial Biota of the Pink Sugar Cane Mealybug, Saccharococcus sacchari, and Its Environs

    PubMed Central

    Ashbolt, Nicholas J.; Inkerman, Peter A.

    1990-01-01

    Saccharococcus sacchari is the primary colonizer of the developing “sterile” tissue between the leaf sheath and stem of sugar cane. The honeydew secreted by the mealybugs is acidic (about pH 3) and supports an atypical epiphytic microbiota dominated by acetobacter-like bacteria and acidophilic yeast species. However, Erwinia and Leuconostoc species predominate within the leaf sheath pocket region when the mealybugs die out. The unidentified acetobacters were readily isolated from S. sacchari throughout its life cycle and from other genera of mealybugs on sugar cane and various other plants, both above and below ground. No other insect present on sugar cane was a significant vector of acetic acid bacteria. The major factors restricting microbial diversity within the environs of mealybugs were considered to be yeast activity along with bacterial production of acetic acid, ketogluconic acids, and gamma-pyrones, in association with their lowering of pH. The microbial products may aid in suppressing the attack by the parasitic mold Aspergillus parasiticus on mealybugs but could act as attractants for the predatory fruit fly Cacoxenus perspicax. PMID:16348144

  13. Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.

    PubMed

    Kaul, Tiffany K; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V; Kapahi, Pankaj; Gill, Matthew S

    2014-01-01

    The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit.

  14. Development of a bacterial bioassay for atrazine and cyanuric acid detection

    PubMed Central

    Hua, Anna; Gueuné, Hervé; Cregut, Mickaël; Thouand, Gérald; Durand, Marie-José

    2015-01-01

    The s-triazine herbicides are compounds which can disseminate into soils and water. Due to their toxic effects on living organisms, their concentrations in drinking water are legislated by WHO recommendations. Here we have developed for the first time, to the best of our knowledge, an alternative method for physicochemical quantification using two bioluminescent bacterial biosensors: E. coli SM003 for cyanuric acid detection and E. coli SM004 for both atrazine and cyanuric acid detection. The concentration of cyanuric acid detection for E. coli SM003 ranges from 7.83 μM to 2.89 mM, and for E. coli SM004 ranges from 0.22 to 15 μM. Moreover, atrazine detection by E. coli SM004 ranges from 1.08 to 15 μM. According to WHO recommendations, the cyanuric acid detection range is sensitive enough to discriminate between polluted and drinking water. Nevertheless, the detection of atrazine by E. coli SM004 is only applicable for high concentrations of contaminants. PMID:25852669

  15. Bacterial Fatty Acids Enhance Recovery from the Dauer Larva in Caenorhabditis elegans

    PubMed Central

    Kaul, Tiffany K.; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V.; Kapahi, Pankaj; Gill, Matthew S.

    2014-01-01

    The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit. PMID:24475206

  16. Adaptive laboratory evolution of ethanologenic Zymomonas mobilis strain tolerant to furfural and acetic acid inhibitors.

    PubMed

    Shui, Zong-Xia; Qin, Han; Wu, Bo; Ruan, Zhi-yong; Wang, Lu-shang; Tan, Fu-Rong; Wang, Jing-Li; Tang, Xiao-Yu; Dai, Li-Chun; Hu, Guo-Quan; He, Ming-Xiong

    2015-07-01

    Furfural and acetic acid from lignocellulosic hydrolysates are the prevalent inhibitors to Zymomonas mobilis during cellulosic ethanol production. Developing a strain tolerant to furfural or acetic acid inhibitors is difficul by using rational engineering strategies due to poor understanding of their underlying molecular mechanisms. In this study, strategy of adaptive laboratory evolution (ALE) was used for development of a furfural and acetic acid-tolerant strain. After three round evolution, four evolved mutants (ZMA7-2, ZMA7-3, ZMF3-2, and ZMF3-3) that showed higher growth capacity were successfully obtained via ALE method. Based on the results of profiling of cell growth, glucose utilization, ethanol yield, and activity of key enzymes, two desired strains, ZMA7-2 and ZMF3-3, were achieved, which showed higher tolerance under 7 g/l acetic acid and 3 g/l furfural stress condition. Especially, it is the first report of Z. mobilis strain that could tolerate higher furfural. The best strain, Z. mobilis ZMF3-3, has showed 94.84% theoretical ethanol yield under 3-g/l furfural stress condition, and the theoretical ethanol yield of ZM4 is only 9.89%. Our study also demonstrated that ALE method might also be used as a powerful metabolic engineering tool for metabolic engineering in Z. mobilis. Furthermore, the two best strains could be used as novel host for further metabolic engineering in cellulosic ethanol or future biorefinery. Importantly, the two strains may also be used as novel-tolerant model organisms for the genetic mechanism on the "omics" level, which will provide some useful information for inverse metabolic engineering.

  17. Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.

    2012-07-01

    Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.

  18. Amino acids improve acid tolerance and internal pH maintenance in Bacillus cereus ATCC14579 strain.

    PubMed

    Senouci-Rezkallah, Khadidja; Schmitt, Philippe; Jobin, Michel P

    2011-05-01

    This study investigated the involvement of glutamate-, arginine- and lysine-dependent systems in the Acid Tolerance Response (ATR) of Bacillus cereus ATCC14579 strain. Cells were grown in a chemostat at external pH (pH(e)) 7.0 and 5.5. Population reduction after acid shock at pH 4.0 was strongly limited in cells grown at pH 5.5 (acid-adapted) compared with cells grown at pH 7.0 (unadapted), indicating that B. cereus cells grown at low pH(e) were able to induce a marked ATR. Glutamate, arginine and lysine enhanced the resistance of unadapted cells to pH 4.0 acid shock of 1-log or 2-log populations, respectively. Amino acids had no detectable effect on acid resistance in acid-adapted cells. An acid shock at pH 4.0 resulted in a marked drop in internal pH (pH(i)) in unadapted cells compared with acid-adapted cells. When acid shock was achieved in the presence of glutamate, arginine or lysine, pH(i) was maintained at higher values (6.31, 6.69 or 6.99, respectively) compared with pH(i) in the absence of amino acids (4.88). Acid-adapted cells maintained their pH(i) at around 6.4 whatever the condition. Agmatine (a competitive inhibitor of arginine decarboxylase) had a negative effect on the ability of B. cereus cells to survive and maintain their pH(i) during acid shock. Our data demonstrate that B. cereus is able to induce an ATR during growth at low pH. This adaptation depends on pH(i) homeostasis and is enhanced in the presence of glutamate, arginine and lysine. Hence evaluations of the pathogenicity of B. cereus must take into account its ability to adapt to acid stress.

  19. Improvement of Phosphate Solubilization and Medicago Plant Yield by an Indole-3-Acetic Acid-Overproducing Strain of Sinorhizobium meliloti▿ †

    PubMed Central

    Bianco, Carmen; Defez, Roberto

    2010-01-01

    Nitrogen (N) and phosphorus (P) are the most limiting factors for plant growth. Some microorganisms improve the uptake and availability of N and P, minimizing chemical fertilizer dependence. It has been published that the RD64 strain, a Sinorhizobium meliloti 1021 strain engineered to overproduce indole-3-acetic acid (IAA), showed improved nitrogen fixation ability compared to the wild-type 1021 strain. Here, we present data showing that RD64 is also highly effective in mobilizing P from insoluble sources, such as phosphate rock (PR). Under P-limiting conditions, the higher level of P-mobilizing activity of RD64 than of the 1021 wild-type strain is connected with the upregulation of genes coding for the high-affinity P transport system, the induction of acid phosphatase activity, and the increased secretion into the growth medium of malic, succinic, and fumaric acids. Medicago truncatula plants nodulated by RD64 (Mt-RD64), when grown under P-deficient conditions, released larger amounts of another P-solubilizing organic acid, 2-hydroxyglutaric acid, than plants nodulated by the wild-type strain (Mt-1021). It has already been shown that Mt-RD64 plants exhibited higher levels of dry-weight production than Mt-1021 plants. Here, we also report that P-starved Mt-RD64 plants show significant increases in both shoot and root fresh weights when compared to P-starved Mt-1021 plants. We discuss how, in a Rhizobium-legume model system, a balanced interplay of different factors linked to bacterial IAA overproduction rather than IAA production per se stimulates plant growth under stressful environmental conditions and, in particular, under P starvation. PMID:20511434

  20. Metschnikowia Strains Isolated from Botrytized Grapes Antagonize Fungal and Bacterial Growth by Iron Depletion▿

    PubMed Central

    Sipiczki, Matthias

    2006-01-01

    Noble-rotted grapes are colonized by complex microbial populations. I isolated pigment-producing Metschnikowia strains from noble-rotted grapes that had antagonistic activity against filamentous fungi, yeasts, and bacteria. A red-maroon pigment was formed from a diffusible colorless precursor released by the cells into the medium. The conversion of the precursor required iron and could occur both in the cells (red colonies) and in the medium (red halos around colonies). The intensity of pigmentation was correlated with the intensity of the antimicrobial activity. Mutants that did not form pigment also lacked antifungal activity. Within the pigmented halos, conidia of the sensitive fungi did not germinate, and their hyphae did not grow and frequently lysed at the tips. Supplementation of the medium with iron reduced the size of the halos and the inhibition zones, while it increased the pigment accumulation by the colonies. The iron-binding agent tropolone had a similar effect, so I hypothesize that pigmented Metschnikowia isolates inhibit the growth of the sensitive microorganisms by pigment formation, which depletes the free iron in the medium. As the pigment is a large nondiffusible complex produced in the presence of both low and high concentrations of ferric ions, the proposed mechanism is different from the mechanisms operating in microbes that release siderophores into the environment for iron acquisition. PMID:17021223

  1. Synthesis of hydroxytyrosol, 2-hydroxyphenylacetic acid, and 3-hydroxyphenylacetic acid by differential conversion of tyrosol isomers using Serratia marcescens strain.

    PubMed

    Allouche, Noureddine; Sayadi, Sami

    2005-08-10

    We investigated to develop an effective procedure to produce the potentially high-added-value phenolic compounds through bioconversion of tyrosol isomers. A soil bacterium, designated Serratia marcescens strain, was isolated on the basis of its ability to grow on p-tyrosol (4-hydroxyphenylethanol) as a sole source of carbon and energy. During growth on p-tyrosol, Ser. marcescens strain was capable of promoting the formation of hydroxytyrosol. To achieve maximal hydroxytyrosol yield, the growth state of the culture utilized for p-tyrosol conversion as well as the amount of p-tyrosol that was treated were optimized. The optimal yield of hydroxytyrosol (80%) was obtained by Ser. marcescens growing cells after a 7-h incubation using 2 g/L of p-tyrosol added at the end of the exponential phase to a culture pregrown on 1 g/L of p-tyrosol. Furthermore, the substrate specificity of the developed biosynthesis was investigated using m-tyrosol (3-hydroxyphenylethanol) and o-tyrosol (2-hydroxyphenylethanol) as substrates. Ser. marcescens strain transformed completely m-tyrosol and o-tyrosol into 3-hydroxyphenylacetic acid and 2-hydroxyphenylacetic acid, respectively, via the oxidation of the side chain carbon of the treated substrates. This proposed procedure is an alternative approach to obtain hydroxytyrosol, 2-hydroxyphenylacetic acid, and 3-hydroxyphenylacetic acid in an environmentally friendly way which could encourage their use as alternatives in the search for replacement of synthetic food additives.

  2. Biodegradation of fenvalerate and 3-phenoxybenzoic acid by a novel Stenotrophomonas sp. strain ZS-S-01 and its use in bioremediation of contaminated soils.

    PubMed

    Chen, Shaohua; Yang, Liu; Hu, Meiying; Liu, Jingjing

    2011-04-01

    A bacterial strain ZS-S-01, newly isolated from activated sludge, could effectively degrade fenvalerate and its hydrolysis product 3-phenoxybenzoic acid (3-PBA). Based on the morphology, physiological biochemical characteristics, and 16 S rDNA sequence, strain ZS-S-01 was identified as Stenotrophomonas sp. Strain ZS-S-01 could also degrade and utilize deltamethrin, beta-cypermethrin, beta-cyfluthrin, and cyhalothrin as substrates for growth. Strain ZS-S-01 was capable of degrading fenvalerate rapidly without a lag phase over a wide range of pH and temperature, even in the presence of other carbon sources, and metabolized it to yield 3-PBA, then completely degraded it. No persistent accumulative product was detected by HPLC and GC/MS analysis. Studies on biodegradation in various soils showed that strain ZS-S-01 demonstrated efficient degradation of fenvalerate and 3-PBA (both 50 mg·kg(-1)) with a rate constant of 0.1418-0.3073 d(-1), and half-lives ranged from 2.3 to 4.9 days. Compared with the controls, the half-lives for fenvalerate and 3-PBA reduced by 16.9-156.3 days. These results highlight strain ZS-S-01 may have potential for use in bioremediation of pyrethroid-contaminated environment.

  3. Enhanced Acid Tolerance in Bifidobacterium longum by Adaptive Evolution: Comparison of the Genes between the Acid-Resistant Variant and Wild-Type Strain.

    PubMed

    Jiang, Yunyun; Ren, Fazheng; Liu, Songling; Zhao, Liang; Guo, Huiyuan; Hou, Caiyun

    2016-03-01

    Acid stress can affect the viability of probiotics, especially Bifidobacterium. This study aimed to improve the acid tolerance of Bifidobacterium longum BBMN68 using adaptive evolution. The stress response, and genomic differences of the parental strain and the variant strain were compared by acid stress. The highest acid-resistant mutant strain (BBMN68m) was isolated from more than 100 asexual lines, which were adaptive to the acid stress for 10(th), 20(th), 30(th), 40(th), and 50(th) repeats, respectively. The variant strain showed a significant increase in acid tolerance under conditions of pH 2.5 for 2 h (from 7.92 to 4.44 log CFU/ml) compared with the wildtype strain (WT, from 7.87 to 0 log CFU/ml). The surface of the variant strain was also smoother. Comparative whole-genome analysis showed that the galactosyl transferase D gene (cpsD, bbmn68_1012), a key gene involved in exopolysaccharide (EPS) synthesis, was altered by two nucleotides in the mutant, causing alteration in amino acids, pI (from 8.94 to 9.19), and predicted protein structure. Meanwhile, cpsD expression and EPS production were also reduced in the variant strain (p < 0.05) compared with WT, and the exogenous WT-EPS in the variant strain reduced its acid-resistant ability. These results suggested EPS was related to acid responses of BBMN68.

  4. Conjugated Linoleic Acid Stimulates Apoptosis in RH and Tehran Strains of Toxoplasma gondii, in Vitro

    PubMed Central

    SHAMSEDDIN, Jebreil; AKHLAGHI, Lame; RAZMJOU, Elham; SHOJAEE, Saeedeh; MONAVARI, Seyed Hamid Reza; TAJIK, Nader; EBRAHIMI, Soltan Ahmed; MEAMAR, Ahmad Reza

    2015-01-01</