Science.gov

Sample records for acid bacterial strains

  1. Method for construction of bacterial strains with increased succinic acid production

    DOEpatents

    Donnelly, Mark I.; Sanville-Millard, Cynthia; Chatterjee, Ranjini

    2000-01-01

    A fermentation process for producing succinic acid is provided comprising selecting a bacterial strain that does not produce succinic acid in high yield, disrupting the normal regulation of sugar metabolism of said bacterial strain, and combining the mutant bacterial strain and selected sugar in anaerobic conditions to facilitate production of succinic acid. Also provided is a method for changing low yield succinic acid producing bacteria to high yield succinic acid producing bacteria comprising selecting a bacterial strain having a phosphotransferase system and altering the phosphotransferase system so as to allow the bacterial strain to simultaneously metabolize different sugars.

  2. A bacterial strain with a unique quadruplet codon specifying non-native amino acids.

    PubMed

    Chatterjee, Abhishek; Lajoie, Marc J; Xiao, Han; Church, George M; Schultz, Peter G

    2014-08-18

    The addition of noncanonical amino acids to the genetic code requires unique codons not assigned to the 20 canonical amino acids. Among the 64 triplet codons, only the three nonsense "stop" codons have been used to encode non-native amino acids. Use of quadruplet "frame-shift" suppressor codons provides an abundant alternative but suffers from low suppression efficiency as a result of competing recognition of their first three bases by endogenous host tRNAs or release factors. Deletion of release factor 1 in a genomically recoded strain of E. coli (E. coli C321), in which all endogenous amber stop codons (UAG) are replaced with UAA, abolished UAG mediated translation termination. Here we show that a Methanocaldococcus jannaschii-derived frame-shift suppressor tRNA/aminoacyl-tRNA synthetase pair enhanced UAGN suppression efficiency in this recoded bacterial strain. These results demonstrate that efficient quadruplet codons for encoding non-native amino acids can be generated by eliminating competing triplet codon recognition at the ribosome.

  3. Bacterial cellulose produced by a new acid-resistant strain of Gluconacetobacter genus.

    PubMed

    Castro, Cristina; Zuluaga, Robin; Álvarez, Catalina; Putaux, Jean-Luc; Caro, Gloria; Rojas, Orlando J; Mondragon, Iñaki; Gañán, Piedad

    2012-08-01

    A bacterial strain isolated from the fermentation of Colombian homemade vinegar, Gluconacetobacter medellensis, was investigated as a new source of bacterial cellulose (BC). The BC produced from substrate media consisting of various carbon sources at different pH and incubation times was quantified. Hestrin-Schramm (HS) medium modified with glucose led to the highest BC yields followed by sucrose and fructose. Interestingly, the microorganisms are highly tolerant to low pH: an optimum yield of 4.5 g/L was achieved at pH 3.5, which is generally too low for other bacterial species to function. The cellulose microfibrils produced by the new strain were characterized by scanning and transmission electron microscopy, infrared spectroscopy X-ray diffraction and elemental analysis. The morphological, structural and chemical characteristics of the cellulose produced are similar to those expected for BC.

  4. High performance degradation of azo dye Acid Orange 7 and sulfanilic acid in a laboratory scale reactor after seeding with cultured bacterial strains.

    PubMed

    Coughlin, Michael F; Kinkle, Brian K; Bishop, Paul L

    2003-06-01

    Bacterial strains 1CX and SAD4i--previously isolated from the mixed liquor of a municipal sewage treatment plant--are capable of degrading the azo dye Acid Orange 7 (AO7) and sulfanilic acid, respectively. A rotating drum bioreactor (RDBR), operating under continuous flow and nutrient conditions designed to simulate the effluent from a dye manufacturing plant, was seeded with strains 1CX and SAD4i, forming a biofilm capable of degrading AO7 and sulfanilic acid. In addition, an RDBR containing a pre-existing biofilm capable of degrading AO7, but not sulfanilic acid, was seeded with strain SAD4i alone. Strain SAD4i was incorporated into the existing biofilm and degraded the sulfanilic acid resulting from the degradation of AO7 by indigenous members of the biofilm. The ability to seed a bioreactor with bacterial strains capable of degrading azo dyes, and resulting by-products, in a mixed microbial community suggests that this process could have commercial applications.

  5. New lactic acid bacterial strains from traditional Mongolian fermented milk products have altered adhesion to porcine gastric mucin depending on the carbon source.

    PubMed

    Kimoto-Nira, Hiromi; Yamasaki, Seishi; Sasaki, Keisuke; Moriya, Naoko; Takenaka, Akio; Suzuki, Chise

    2015-03-01

    Attachment of lactic acid bacteria to the mucosal surface of the gastrointestinal tract is a major property of probiotics. Here, we examined the ability of 21 lactic acid bacterial strains isolated from traditional fermented milk products in Mongolia to adhere to porcine gastric mucin in vitro. Higher attachment was observed with Lactobacillus delbrueckii subsp. bulgaricus strains 6-8 and 8-1 than with Lactobacillus rhamnosus GG (positive control). Lactococcus lactis subsp. cremoris strain 7-1 adhered to mucin as effectively as did strain GG. Heat inactivation decreased the adhesive ability of strains 6-8 and 8-1 but did not affect strain 7-1. The adhesion of strains 6-8, 7-1 and 8-1 was significantly inhibited when the cells were pretreated with periodate and trypsin, indicating that proteinaceous and carbohydrate-like cell surface compounds are involved in the adhesion of these strains. The adhesion of strain 7-1 was affected by the type of carbohydrate present in the growth medium, being higher with fructose than with lactose, galactose or xylose as the carbon source. The sugar content of 7-1 cells grown on various carbohydrates was negatively correlated with its adhesive ability. We provide new probiotic candidate strains and new information regarding carbohydrate preference that influences lactic acid bacterial adhesion to mucin.

  6. Bacterial Strain Diversity Within Wounds

    PubMed Central

    Kirkup, Benjamin C.

    2015-01-01

    Significance: Rare bacterial taxa (taxa of low relative frequency) are numerous and ubiquitous in virtually any sample—including wound samples. In addition, even the high-frequency genera and species contain multiple strains. These strains, individually, are each only a small fraction of the total bacterial population. Against the view that wounds contain relatively few kinds of bacteria, this newly recognized diversity implies a relatively high rate of migration into the wound and the potential for diversification during infection. Understanding the biological and medical importance of these numerous taxa is an important new element of wound microbiology. Recent Advances: Only recently have these numerous strains been discovered; the technology to detect, identify, and characterize them is still in its infancy. Multiple strains of both gram-negative and gram-positive bacteria have been found in a single wound. In the few cases studied, the distribution of the bacteria suggests microhabitats and biological interactions. Critical Issues: The distribution of the strains, their phenotypic diversity, and their interactions are still largely uncharacterized. The technologies to investigate this level of genomic detail are still developing and have not been largely deployed to investigate wounds. Future Directions: As advanced metagenomics, single-cell genomics, and advanced microscopy develop, the study of wound microbiology will better address the complex interplay of numerous individually rare strains with both the host and each other. PMID:25566411

  7. Bacteriocins and novel bacterial strains.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poultry is thought to be a significant source of Campylobacter in human disease. We evaluated anti-Campylobacter activity among 365 Bacillus and Paenibacillus isolates from poultry. One novel antagonistic Bacillus circulans and three Paenibacillus polymyxa strains were identified and further studi...

  8. BACTERIAL OXIDATION OF DIPICOLINIC ACID I.

    PubMed Central

    Arima, Kei; Kobayashi, Yasuo

    1962-01-01

    Arima, Kei (University of Tokyo, Tokyo, Japan) and Yasuo Kobayashi. Bacterial oxidation of dipicolinic acid. I. Isolation of microorganisms, their culture conditions, and end products. J. Bacteriol. 84:759–764. 1962.—In a study of the metabolic pathway(s) of dipicolinic acid (DPA) in microorganisms, 436 strains of soil microorganisms were isolated by use of an enrichment culture technique. Most of them were bacteria, and one of them, Achromobacter, which had the strongest DPA-oxidizing activity, was used for the following experiments. In DPA-free medium, the enzymes which oxidize DPA were not produced. The best culture condition for enzyme production and cell growth was: Nutrient Broth supplemented with 0.1% DPA, 30 C, and 20 hr of shake culture. End products were oxalic acid, NH3, and CO2. Oxalic acid was not oxidized further by this bacterium. The over-all reaction equation of DPA oxidation was determined. PMID:16561964

  9. Lactic acid bacterial cell factories for gamma-aminobutyric acid.

    PubMed

    Li, Haixing; Cao, Yusheng

    2010-11-01

    Gamma-aminobutyric acid is a non-protein amino acid that is widely present in organisms. Several important physiological functions of gamma-aminobutyric acid have been characterized, such as neurotransmission, induction of hypotension, diuretic effects, and tranquilizer effects. Many microorganisms can produce gamma-aminobutyric acid including bacteria, fungi and yeasts. Among them, gamma-aminobutyric acid-producing lactic acid bacteria have been a focus of research in recent years, because lactic acid bacteria possess special physiological activities and are generally regarded as safe. They have been extensively used in food industry. The production of lactic acid bacterial gamma-aminobutyric acid is safe and eco-friendly, and this provides the possibility of production of new naturally fermented health-oriented products enriched in gamma-aminobutyric acid. The gamma-aminobutyric acid-producing species of lactic acid bacteria and their isolation sources, the methods for screening of the strains and increasing their production, the enzymatic properties of glutamate decarboxylases and the relative fundamental research are reviewed in this article. And the potential applications of gamma-aminobutyric acid-producing lactic acid bacteria were also referred to.

  10. Bacterial Cyanuric Acid Hydrolase for Water Treatment

    PubMed Central

    Yeom, Sujin; Mutlu, Baris R.; Aksan, Alptekin

    2015-01-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  11. Bacterial Cyanuric Acid Hydrolase for Water Treatment.

    PubMed

    Yeom, Sujin; Mutlu, Baris R; Aksan, Alptekin; Wackett, Lawrence P

    2015-10-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation. PMID:26187963

  12. Bacterial Cyanuric Acid Hydrolase for Water Treatment.

    PubMed

    Yeom, Sujin; Mutlu, Baris R; Aksan, Alptekin; Wackett, Lawrence P

    2015-10-01

    Di- and trichloroisocyanuric acids are widely used as water disinfection agents, but cyanuric acid accumulates with repeated additions and must be removed to maintain free hypochlorite for disinfection. This study describes the development of methods for using a cyanuric acid-degrading enzyme contained within nonliving cells that were encapsulated within a porous silica matrix. Initially, three different bacterial cyanuric acid hydrolases were compared: TrzD from Acidovorax citrulli strain 12227, AtzD from Pseudomonas sp. strain ADP, and CAH from Moorella thermoacetica ATCC 39073. Each enzyme was expressed recombinantly in Escherichia coli and tested for cyanuric acid hydrolase activity using freely suspended or encapsulated cell formats. Cyanuric acid hydrolase activities differed by only a 2-fold range when comparing across the different enzymes with a given format. A practical water filtration system is most likely to be used with nonviable cells, and all cells were rendered nonviable by heat treatment at 70°C for 1 h. Only the CAH enzyme from the thermophile M. thermoacetica retained significant activity under those conditions, and so it was tested in a flowthrough system simulating a bioreactive pool filter. Starting with a cyanuric acid concentration of 10,000 μM, more than 70% of the cyanuric acid was degraded in 24 h, it was completely removed in 72 h, and a respike of 10,000 μM cyanuric acid a week later showed identical biodegradation kinetics. An experiment conducted with water obtained from municipal swimming pools showed the efficacy of the process, although cyanuric acid degradation rates decreased by 50% in the presence of 4.5 ppm hypochlorite. In total, these experiments demonstrated significant robustness of cyanuric acid hydrolase and the silica bead materials in remediation.

  13. Cryoprotection from bacterial teichoic acid

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Harrison, William; Kirkpatrick, Karl; Brown, Eric D.

    2009-08-01

    Recent studies from our lab demonstrated that teichoic acid is surrounded by liquid water at -40 °C. The size and shape of the liquid water pockets has been visualized with fluorescence microscopy images of aqueous Rhodamine- B solutions. The long, thin channels surround ice crystals with a size of 5-20 microns. Subsequent studies show that B. subtilis Gram-positive bacteria are sequestered into large pockets without added teichoic acid. Here, the ice crystals are orders of manitude larger. When bacteria are mixed with teichoic acid solutions, the distribution of bacteria changes dramatically. The smaller ice crystals allow the bacteria to align in the thin channels of liquid water seen with teichoic acid only. The role of teichoic acid in the freeze tolerance was examined with live/dead fluorescence assays of bacteria mixed with teichoic acid. These quantitative assays were used to determine if teichoic acid acts in a synergetic fashion to enhance the survivability of E. coli, a gram-negative species which lacks teichoic acid. Additionally, we have obtained B. subtilis mutants lacking wall-associated teichoic acids to evaluate cryoprotection compared to the wild-type strain.

  14. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03

    PubMed Central

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-01-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l-1. The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters. PMID:25253925

  15. Bacterial Decolorization of Textile Azo Dye Acid Orange by Staphylococcus hominis RMLRT03.

    PubMed

    Singh, Rajat Pratap; Singh, Pradeep Kumar; Singh, Ram Lakhan

    2014-05-01

    A bacterial strain RMLRT03 with ability to decolorize textile dye Acid Orange dye was isolated from textile effluent contaminated soil of Tanda, Ambedkar Nagar, Uttar Pradesh (India). The decolorization studies were performed in Bushnell and Haas medium (BHM) amended with Acid Orange dye. The bacterial strain was identified as Staphylococcus hominis on the basis of 16S rDNA sequence. The bacterial strain exhibited good decolorization ability with glucose and yeast extract supplementation as cosubstrate in static conditions. The optimal condition for the decolorization of Acid Orange dye by Staphylococcus hominis RMLRT03 strain were at pH 7.0 and 35°C in 60 h of incubation. The bacterial strain could tolerate high concentrations of Acid Orange dye up to 600 mg l(-1). The high decolorizing activity under natural environmental conditions indicates that the bacterial strain has practical application in the treatment of dye containing wastewaters.

  16. Decolorization of the textile dyes by newly isolated bacterial strains.

    PubMed

    Chen, Kuo-Cheng; Wu, Jane-Yii; Liou, Dar-Jen; Hwang, Sz-Chwun John

    2003-02-27

    Six bacterial strains with the capability of degrading textile dyes were isolated from sludge samples and mud lakes. Aeromonas hydrophila was selected and identified because it exhibited the greatest color removal from various dyes. Although A. hydrophila displayed good growth in aerobic or agitation culture (AGI culture), color removal was the best in anoxic or anaerobic culture (ANA culture). For color removal, the most suitable pH and temperature were pH 5.5-10.0 and 20-35 degrees C under anoxic culture (ANO culture). More than 90% of RED RBN was reduced in color within 8 days at a dye concentration of 3,000 mg l(-1). This strain could also decolorize the media containing a mixture of dyes within 2 days of incubation. Nitrogen sources such as yeast extract or peptone could enhance strongly the decolorization efficiency. In contrast to a nitrogen source, glucose inhibited decolorization activity because the consumed glucose was converted to organic acids that might decrease the pH of the culture medium, thus inhibiting the cell growth and decolorization activity. Decolorization appeared to proceed primarily by biological degradation.

  17. Purification of bacterial genomic DNA in less than 20 min using chelex-100 microwave: examples from strains of lactic acid bacteria isolated from soil samples.

    PubMed

    Reyes-Escogido, Lourdes; Balam-Chi, Mario; Rodríguez-Buenfil, Ingrid; Valdés, Jesús; Kameyama, Luis; Martínez-Pérez, Francisco

    2010-11-01

    We established a Chelex 100-Microwave method for the purification of bacterial genomic DNA (gDNA) in less than 20 min with high yield and good quality, useful for multiple purposes. It combines Chelex 100, proteinase K, RNase A and heating in a microwave oven. The resulting gDNA was used directly to identify bacterial species of the Order Lactobacillales by means of PCR amplification of their 16S rDNA gene, isolated from sediments on the Yucatan Peninsula, Mexico. This method produced gDNA free of phenolic and protein residual contaminants from 100 of these isolated bacteria. 16S rDNA amplification and sequencing showed Pediococcus acidilactici to prevail in inland lagoons, and Pediococcus pentosaceus, Lactobacillus plantarum, Lactobacillus sp., and Lactobacillus fermentum to be most abundant in the soils of livestock farms. The combination of Chelex 100, enzymes and microwave heating used in the Chelex 100-Microwave method produced large amounts of highly pure gDNA from Gram-positive and Gram-negative bacteria, in less than 20 min.

  18. Bacterial Lipoteichoic Acid Enhances Cryosurvival

    PubMed Central

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Scull, Erin; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2015-01-01

    Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. We show that lipoteichoic acid (LTA), a biopolymer in the cell wall of Gram-positive bacteria, can be added to B. subtilis cultures and increase freeze tolerance. At 1% w/v, LTA enables a 50% survival rate, similar to the results obtained with 1% w/v glycerol as measured with the resazurin cell viability assay. In the absence of added LTA or glycerol, a very small number of B. subtilis cells survive freezing. This suggests that an innate freeze tolerance mechanism exists. While cryoprotection can be provided by extracellular polymeric substances (EPS), our data demonstrate a role for LTA in cryoprotection. Currently, the exact mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. However, low temperature microscopy data show small ice crystals aligned along channels of liquid water. Our observations suggest that teichoic acids could protect liquid water within biofilms and planktonic bacteria, augmenting the role of brine while also raising the possibility for survival without brine present. PMID:25477208

  19. Genome engineering and gene expression control for bacterial strain development.

    PubMed

    Song, Chan Woo; Lee, Joungmin; Lee, Sang Yup

    2015-01-01

    In recent years, a number of techniques and tools have been developed for genome engineering and gene expression control to achieve desired phenotypes of various bacteria. Here we review and discuss the recent advances in bacterial genome manipulation and gene expression control techniques, and their actual uses with accompanying examples. Genome engineering has been commonly performed based on homologous recombination. During such genome manipulation, the counterselection systems employing SacB or nucleases have mainly been used for the efficient selection of desired engineered strains. The recombineering technology enables simple and more rapid manipulation of the bacterial genome. The group II intron-mediated genome engineering technology is another option for some bacteria that are difficult to be engineered by homologous recombination. Due to the increasing demands on high-throughput screening of bacterial strains having the desired phenotypes, several multiplex genome engineering techniques have recently been developed and validated in some bacteria. Another approach to achieve desired bacterial phenotypes is the repression of target gene expression without the modification of genome sequences. This can be performed by expressing antisense RNA, small regulatory RNA, or CRISPR RNA to repress target gene expression at the transcriptional or translational level. All of these techniques allow efficient and rapid development and screening of bacterial strains having desired phenotypes, and more advanced techniques are expected to be seen.

  20. Antimicrobial effect against different bacterial strains and bacterial adaptation to essential oils used as feed additives.

    PubMed

    Melo, Antonio Diego Brandão; Amaral, Amanda Figueiredo; Schaefer, Gustavo; Luciano, Fernando Bittencourt; de Andrade, Carla; Costa, Leandro Batista; Rostagno, Marcos Horácio

    2015-10-01

    The aim of this study was to evaluate the antimicrobial activity and determine the minimum bactericidal concentration (MBC) of the essential oils derived from Origanum vulgare (oregano), Melaleuca alternifolia (tea tree), Cinnamomum cassia (cassia), and Thymus vulgaris (white thyme) against Salmonella Typhimurium, Salmonella Enteritidis, Escherichia coli, Staphylococcus aureus and Enterococcus faecalis. The study also investigated the ability of these different bacterial strains to develop adaptation after repetitive exposure to sub-lethal concentrations of these essential oils. The MBC of the essential oils studied was determined by disc diffusion and broth dilution methods. All essential oils showed antimicrobial effect against all bacterial strains. In general, the development of adaptation varied according to the bacterial strain and the essential oil (tea tree > white thyme > oregano). Therefore, it is important to use essential oils at efficient bactericidal doses in animal feed, food, and sanitizers, since bacteria can rapidly develop adaptation when exposed to sub-lethal concentrations of these oils. PMID:26424908

  1. Antimicrobial effect against different bacterial strains and bacterial adaptation to essential oils used as feed additives.

    PubMed

    Melo, Antonio Diego Brandão; Amaral, Amanda Figueiredo; Schaefer, Gustavo; Luciano, Fernando Bittencourt; de Andrade, Carla; Costa, Leandro Batista; Rostagno, Marcos Horácio

    2015-10-01

    The aim of this study was to evaluate the antimicrobial activity and determine the minimum bactericidal concentration (MBC) of the essential oils derived from Origanum vulgare (oregano), Melaleuca alternifolia (tea tree), Cinnamomum cassia (cassia), and Thymus vulgaris (white thyme) against Salmonella Typhimurium, Salmonella Enteritidis, Escherichia coli, Staphylococcus aureus and Enterococcus faecalis. The study also investigated the ability of these different bacterial strains to develop adaptation after repetitive exposure to sub-lethal concentrations of these essential oils. The MBC of the essential oils studied was determined by disc diffusion and broth dilution methods. All essential oils showed antimicrobial effect against all bacterial strains. In general, the development of adaptation varied according to the bacterial strain and the essential oil (tea tree > white thyme > oregano). Therefore, it is important to use essential oils at efficient bactericidal doses in animal feed, food, and sanitizers, since bacteria can rapidly develop adaptation when exposed to sub-lethal concentrations of these oils.

  2. Antimicrobial effect against different bacterial strains and bacterial adaptation to essential oils used as feed additives

    PubMed Central

    Melo, Antonio Diego Brandão; Amaral, Amanda Figueiredo; Schaefer, Gustavo; Luciano, Fernando Bittencourt; de Andrade, Carla; Costa, Leandro Batista; Rostagno, Marcos Horácio

    2015-01-01

    The aim of this study was to evaluate the antimicrobial activity and determine the minimum bactericidal concentration (MBC) of the essential oils derived from Origanum vulgare (oregano), Melaleuca alternifolia (tea tree), Cinnamomum cassia (cassia), and Thymus vulgaris (white thyme) against Salmonella Typhimurium, Salmonella Enteritidis, Escherichia coli, Staphylococcus aureus and Enterococcus faecalis. The study also investigated the ability of these different bacterial strains to develop adaptation after repetitive exposure to sub-lethal concentrations of these essential oils. The MBC of the essential oils studied was determined by disc diffusion and broth dilution methods. All essential oils showed antimicrobial effect against all bacterial strains. In general, the development of adaptation varied according to the bacterial strain and the essential oil (tea tree > white thyme > oregano). Therefore, it is important to use essential oils at efficient bactericidal doses in animal feed, food, and sanitizers, since bacteria can rapidly develop adaptation when exposed to sub-lethal concentrations of these oils. PMID:26424908

  3. Identification and characterisation of potential biofertilizer bacterial strains

    NASA Astrophysics Data System (ADS)

    Karagöz, Kenan; Kotan, Recep; Dadaşoǧlu, Fatih; Dadaşoǧlu, Esin

    2016-04-01

    In this study we aimed that isolation, identification and characterizations of PGPR strains from rhizosphere of legume plants. 188 bacterial strains isolated from different legume plants like clover, sainfoin and vetch in Erzurum province of Turkey. These three plants are cultivated commonly in the Erzurum province. It was screen that 50 out of 188 strains can fix nitrogen and solubilize phosphate. These strains were identified via MIS (Microbial identification system). According to MIS identification results, 40 out of 50 strains were identified as Bacillus, 5 as Pseudomonas, 3 as Paenibacillus, 1 as Acinetobacter, 1 as Brevibacterium. According to classical test results, while the catalase test result of all isolates are positive, oxidase, KOH and starch hydrolysis rest results are variable.

  4. Effects of oral intake of plasmacytoid dendritic cells-stimulative lactic acid bacterial strain on pathogenesis of influenza-like illness and immunological response to influenza virus.

    PubMed

    Sugimura, Tetsu; Takahashi, Hitoshi; Jounai, Kenta; Ohshio, Konomi; Kanayama, Masaya; Tazumi, Kyoko; Tanihata, Yoko; Miura, Yutaka; Fujiwara, Daisuke; Yamamoto, Norio

    2015-09-14

    Lactococcus lactis ssp. lactis JCM5805 has been shown to be a rare lactic acid bacterium that can activate plasmacytoid dendritic cells in both murine and human species. In this study, we carried out a randomised placebo-controlled double-blind experiment to evaluate its effect on the pathogenesis of influenza-like illness during the winter season. A total of 213 volunteers were divided into two groups, which received either yogurt made with L. lactis JCM5805 or a placebo beverage daily for 10 weeks. In the JCM5805 group, the cumulative incidence days of 'cough' and 'feverishness', which are defined as major symptoms of an influenza-like illness, were significantly decreased compared with the placebo group. In addition, peripheral blood mononuclear cells prepared from volunteers were cultured in the presence of inactivated human influenza virus A/H1N1 (A/PR/8/34). IFN-α elicited by A/H1N1 tended to be higher in the JCM5805 group compared with the placebo group, and an IFN-α-inducible antiviral factor, interferon-stimulated gene 15 (ISG15), elicited by A/H1N1 was significantly higher in the JCM5805 group compared with the placebo group after the intake period. These results suggest that intake of JCM5805 is able to prevent the pathogenesis of an influenza-like illness via enhancement of an IFN-α-mediated response to the influenza virus.

  5. Detoxification of mercury pollutant leached from spent fluorescent lamps using bacterial strains.

    PubMed

    Al-Ghouti, Mohammad A; Abuqaoud, Reem H; Abu-Dieyeh, Mohammed H

    2016-03-01

    The spent fluorescent lamps (SFLs) are being classified as a hazardous waste due to having mercury as one of its main components. Mercury is considered the second most toxic heavy metal (arsenic is the first) with harmful effects on animal nervous system as it causes different neurological disorders. In this research, the mercury from phosphor powder was leached, then bioremediated using bacterial strains isolated from Qatari environment. Leaching of mercury was carried out with nitric and hydrochloric acid solutions using two approaches: leaching at ambient conditions and microwave-assisted leaching. The results obtained from this research showed that microwave-assisted leaching method was significantly better in leaching mercury than the acid leaching where the mercury leaching efficiency reached 76.4%. For mercury bio-uptake, twenty bacterial strains (previously isolated and purified from petroleum oil contaminated soils) were sub-cultured on Luria Bertani (LB) plates with mercury chloride to check the bacterial tolerance to mercury. Seven of these twenty strains showed a degree of tolerance to mercury. The bio-uptake capacities of the promising strains were investigated using the mercury leached from the fluorescent lamps. Three of the strains (Enterobacter helveticus, Citrobacter amalonaticus, and Cronobacter muytjensii) showed bio-uptake efficiency ranged from 28.8% to 63.6%.

  6. Detoxification of mercury pollutant leached from spent fluorescent lamps using bacterial strains.

    PubMed

    Al-Ghouti, Mohammad A; Abuqaoud, Reem H; Abu-Dieyeh, Mohammed H

    2016-03-01

    The spent fluorescent lamps (SFLs) are being classified as a hazardous waste due to having mercury as one of its main components. Mercury is considered the second most toxic heavy metal (arsenic is the first) with harmful effects on animal nervous system as it causes different neurological disorders. In this research, the mercury from phosphor powder was leached, then bioremediated using bacterial strains isolated from Qatari environment. Leaching of mercury was carried out with nitric and hydrochloric acid solutions using two approaches: leaching at ambient conditions and microwave-assisted leaching. The results obtained from this research showed that microwave-assisted leaching method was significantly better in leaching mercury than the acid leaching where the mercury leaching efficiency reached 76.4%. For mercury bio-uptake, twenty bacterial strains (previously isolated and purified from petroleum oil contaminated soils) were sub-cultured on Luria Bertani (LB) plates with mercury chloride to check the bacterial tolerance to mercury. Seven of these twenty strains showed a degree of tolerance to mercury. The bio-uptake capacities of the promising strains were investigated using the mercury leached from the fluorescent lamps. Three of the strains (Enterobacter helveticus, Citrobacter amalonaticus, and Cronobacter muytjensii) showed bio-uptake efficiency ranged from 28.8% to 63.6%. PMID:26725036

  7. Tannic acid degradation by Klebsiella strains isolated from goat feces

    PubMed Central

    Tahmourespour, Arezoo; Tabatabaee, Nooroldin; Khalkhali, Hossein; Amini, Imane

    2016-01-01

    Background and Objectives: Tannins are toxic polyphenols that either bind and precipitate or condense proteins. The high tannin content of some plants is the preliminary limitation of using them as a ruminant feed. So, the aim of this study was the isolation and characterization of tannic acid degrading bacterial strains from goat feces before and after feeding on Pistachio-Soft Hulls as tannin rich diet (TRD). Materials and Methods: Bacterial strains capable of utilizing tannic acid as sole carbon and energy source were isolated and characterized from goat feces before and after feeding on TRD. Tannase activity, maximum tolerable concentration and biodegradation potential were assessed. Results: Four tannase positive isolates were identified as Klebsiella pneumoniae. Isolated strains showed the maximum tolerable concentration of 64g/L of tannin. The tannic acid degradation percentage at a concentration of 15.0 g/L reached a maximum of 68% after 24 h incubation, and more than 98% after 72 h incubation. The pH of the medium also decreased along with tannic acid utilization. Conclusions: It is obvious that TRD induced adaptive responses. Thus, while the bacteria were able to degrade and detoxify the tannic acids, they had to adapt in the presence of high concentrations of tannic acid. So, these isolates have an amazing potential for application in bioremediation, waste water treatment, also reduction of tannins antinutritional effects in animal feeds. PMID:27092220

  8. Diversity of Heteropolysaccharide-Producing Lactic Acid Bacterium Strains and Their Biopolymers

    PubMed Central

    Mozzi, Fernanda; Vaningelgem, Frederik; Hébert, Elvira María; Van der Meulen, Roel; Foulquié Moreno, María Remedios; Font de Valdez, Graciela; De Vuyst, Luc

    2006-01-01

    Thirty-one lactic acid bacterial strains from different species were evaluated for exopolysaccharide (EPS) production in milk. Thermophilic strains produced more EPS than mesophilic ones, but EPS yields were generally low. Ropiness or capsular polysaccharide formation was strain dependent. Six strains produced high-molecular-mass EPS. Polymers were classified into nine groups on the basis of their monomer composition. EPS from Enterococcus strains were isolated and characterized. PMID:16751563

  9. Carbazole degradation in the soil microcosm by tropical bacterial strains

    PubMed Central

    Salam, Lateef B.; Ilori, Matthew O.; Amund, Olukayode O.

    2015-01-01

    In a previous study, three bacterial strains isolated from tropical hydrocarbon-contaminated soils and phylogenetically identified as Achromobacter sp. strain SL1, Pseudomonas sp. strain SL4 and Microbacterium esteraromaticum strain SL6 displayed angular dioxygenation and mineralization of carbazole in batch cultures. In this study, the ability of these isolates to survive and enhance carbazole degradation in soil were tested in field-moist microcosms. Strain SL4 had the highest survival rate (1.8 x 107 cfu/g) after 30 days of incubation in sterilized soil, while there was a decrease in population density in native (unsterilized) soil when compared with the initial population. Gas chromatographic analysis after 30 days of incubation showed that in sterilized soil amended with carbazole (100 mg/kg), 66.96, 82.15 and 68.54% were degraded by strains SL1, SL4 and SL6, respectively, with rates of degradation of 0.093, 0.114 and 0.095 mg kg−1 h−1. The combination of the three isolates as inoculum in sterilized soil degraded 87.13% carbazole at a rate of 0.121 mg kg−1 h−1. In native soil amended with carbazole (100 mg/kg), 91.64, 87.29 and 89.13% were degraded by strains SL1, SL4 and SL6 after 30 days of incubation, with rates of degradation of 0.127, 0.121 and 0.124 mg kg−1 h−1, respectively. This study successfully established the survivability (> 106 cfu/g detected after 30 days) and carbazole-degrading ability of these bacterial strains in soil, and highlights the potential of these isolates as seed for the bioremediation of carbazole-impacted environments. PMID:26691461

  10. Carbazole degradation in the soil microcosm by tropical bacterial strains.

    PubMed

    Salam, Lateef B; Ilori, Matthew O; Amund, Olukayode O

    2015-01-01

    In a previous study, three bacterial strains isolated from tropical hydrocarbon-contaminated soils and phylogenetically identified as Achromobacter sp. strain SL1, Pseudomonas sp. strain SL4 and Microbacterium esteraromaticum strain SL6 displayed angular dioxygenation and mineralization of carbazole in batch cultures. In this study, the ability of these isolates to survive and enhance carbazole degradation in soil were tested in field-moist microcosms. Strain SL4 had the highest survival rate (1.8 x 107 cfu/g) after 30 days of incubation in sterilized soil, while there was a decrease in population density in native (unsterilized) soil when compared with the initial population. Gas chromatographic analysis after 30 days of incubation showed that in sterilized soil amended with carbazole (100 mg/kg), 66.96, 82.15 and 68.54% were degraded by strains SL1, SL4 and SL6, respectively, with rates of degradation of 0.093, 0.114 and 0.095 mg kg-1 h-1. The combination of the three isolates as inoculum in sterilized soil degraded 87.13% carbazole at a rate of 0.121 mg kg-1 h-1. In native soil amended with carbazole (100 mg/kg), 91.64, 87.29 and 89.13% were degraded by strains SL1, SL4 and SL6 after 30 days of incubation, with rates of degradation of 0.127, 0.121 and 0.124 mg kg-1 h-1, respectively. This study successfully established the survivability (> 106 cfu/g detected after 30 days) and carbazole-degrading ability of these bacterial strains in soil, and highlights the potential of these isolates as seed for the bioremediation of carbazole-impacted environments.

  11. Lactic acid bacterial extract as a biogenic mineral growth modifier

    NASA Astrophysics Data System (ADS)

    Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal

    2009-04-01

    The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.

  12. Screening of Bacterial Strains for Polygalacturonase Activity: Its Production by Bacillus sphaericus (MTCC 7542).

    PubMed

    Jayani, Ranveer Singh; Shukla, Surendra Kumar; Gupta, Reena

    2010-10-31

    At present almost all the pectinolytic enzymes used for industrial applications are produced by fungi. There are a few reports of pectinase production by bacterial strains. Therefore, in the present study, seventy-four bacterial strains, isolated from soil and rotten vegetable samples, were screened for polygalacturonase production. The strain PG-31, which gave maximum activity, was identified as Bacillus sphaericus (MTCC 7542). Maximal quantities of polygalacturonase were produced when a 16-hours-old inoculum was used at 7.5% (v/v) in production medium and incubated in shaking conditions (160 rpm) for 72 hours. The optimal temperature and pH for bacterial growth and polygalacturonase production were found to be 30°C and 6.8, respectively. Maximum enzyme production resulted when citrus pectin was used as the carbon source at a concentration of 1.25% (w/v), whereas other carbon sources led to a decrease (30%-70%) in enzyme production. Casein hydrolysate and yeast extract used together as organic nitrogen source gave best results, and ammonium chloride was found to be the most suitable inorganic nitrogen source. The supplementation of media with 0.9% (w/v) D-galacturonic acid led to a 23% increase in activity. Bacillus sphaericus, a bacterium isolated from soil, produced good amount of polygalacturonase activity at neutral pH; hence, it would be potentially useful to increase the yield of banana, grape, or apple juice.

  13. Comparing biocompatibility of gingival fibroblasts and bacterial strains on a different modified titanium discs.

    PubMed

    Franková, Jana; Pivodová, Veronika; Růžička, Filip; Tománková, Kateřina; Šafářová, Klára; Vrbková, Jana; Ulrichová, Jitka

    2013-10-01

    The modification of implant surface situated in the area of peri-implant sulcus has important role in bacterial and cell adhesion. Six different chemically and physically modified titanium discs were prepared: glazed (Tis-MALP), unglazed (Tis-O), unglazed and alkali-etched (Tis-OA), unglazed and coated with ZrN (Tis-OZ), unglazed, sand blasted, and acid etched (Tis-OPAE), and unglazed, sand blasted, acid, and alkali etched (Tis-OPAAE). Analysis of surface topography was determined using scanning electron microscopy and atomic force microscopy (AFM). Biocompatibility of gingival fibroblasts was characterized by the production of tumor necrosis factor alpha, collagen I, matrix metalloproteinase 2 (MMP-2) after 24 and 72 h and expression of α3 β1 integrin and vinculin using enzyme-linked immunosorbent assay (ELISA) or modified ELISA after 6 and 24 h. Microorganism adhesion (five bacterial strains) and biofilm formation was also evaluated. The adhesion of bacteria and gingival fibroblasts was significantly higher on titanium disc Tis-OPAAE and biofilm formation on the same surface for Streptococcus mutans, Streptococcus gordonii, and Streptococcus intermedius. The gingival fibroblasts on Tis-OPAAE disc had also significantly lower production of MMP-2. The collagen production was significantly lower on all surfaces with roughness higher than 0.2 μm. This study confirmed that the titanium disc with the surface roughness 3.39 μm (Tis-OPAAE) supported the adhesion of bacterial strains as well as gingival fibroblasts.

  14. Biodegradation of crude oil by individual bacterial strains and a mixed bacterial consortium

    PubMed Central

    Santisi, Santina; Cappello, Simone; Catalfamo, Maurizio; Mancini, Giuseppe; Hassanshahian, Mehdi; Genovese, Lucrezia; Giuliano, Laura; Yakimov, Michail M.

    2015-01-01

    Three bacterial isolates identified as Alcanivorax borkumensis SK2, Rhodococcus erythropolis HS4 and Pseudomonas stutzeri SDM, based on 16S rRNA gene sequences, were isolated from crude oil enrichments of natural seawater. Single strains and four bacterial consortia designed by mixing the single bacterial cultures respectively in the following ratios: (Alcanivorax: Pseudomonas, 1:1), (Alcanivorax: Rhodococcus, 1:1), (Pseudomonas: Rhodococcus, 1:1), and (Alcanivorax: Pseudomonas: Rhodococcus, 1:1:1), were analyzed in order to evaluate their oil degrading capability. All experiments were carried out in microcosms systems containing seawater (with and without addition of inorganic nutrients) and crude oil (unique carbon source). Measures of total and live bacterial abundance, Card-FISH and quali-, quantitative analysis of hydrocarbons (GC-FID) were carried out in order to elucidate the co-operative action of mixed microbial populations in the process of biodegradation of crude oil. All data obtained confirmed the fundamental role of bacteria belonging to Alcanivorax genus in the degradation of linear hydrocarbons in oil polluted environments. PMID:26273252

  15. Spray washing carcasses with alkaline solutions of lauric acid to reduce bacterial contamination

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ability of lauric acid (LA)-potassium hydroxide (KOH) solutions to reduce carcass bacterial contamination was examined. Skin of carcasses was inoculated with a cecal paste containing antibiotic resistant strains of Escherichia coli, Salmonella Typhimirum, and Campylobacter coli. In one trial, in...

  16. Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

    PubMed Central

    Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo

    1988-01-01

    A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

  17. Interesting starter culture strains for controlled cocoa bean fermentation revealed by simulated cocoa pulp fermentations of cocoa-specific lactic acid bacteria.

    PubMed

    Lefeber, Timothy; Janssens, Maarten; Moens, Frédéric; Gobert, William; De Vuyst, Luc

    2011-09-01

    Among various lactic acid bacterial strains tested, cocoa-specific strains of Lactobacillus fermentum were best adapted to the cocoa pulp ecosystem. They fermented glucose to lactic acid and acetic acid, reduced fructose to mannitol, and converted citric acid into lactic acid and 2,3-butanediol.

  18. Total Biosynthesis of Legionaminic Acid, a Bacterial Sialic Acid Analogue.

    PubMed

    Hassan, Mohamed I; Lundgren, Benjamin R; Chaumun, Michael; Whitfield, Dennis M; Clark, Brady; Schoenhofen, Ian C; Boddy, Christopher N

    2016-09-19

    Legionaminic acid, Leg5,7Ac2 , a nonulosonic acid like 5-acetamido neuraminic acid (Neu5Ac, sialic acid), is found in cell surface glycoconjugates of bacteria including the pathogens Campylobacter jejuni, Acinetobacter baumanii and Legionella pneumophila. The presence of Leg5,7Ac2 has been correlated with virulence in humans by mechanisms that likely involve subversion of the host's immune system or interactions with host cell surfaces due to its similarity to Neu5Ac. Investigation into its role in bacterial physiology and pathogenicity is limited as there are no effective sources of it. Herein, we construct a de novo Leg5,7Ac2 biosynthetic pathway by combining multiple metabolic modules from three different microbial sources (Saccharomyces cerevisiae, C. jejuni, and L. pneumophila). Over-expression of this de novo pathway in Escherichia coli that has been engineered to lack two native catabolic pathways, enables significant quantities of Leg5,7Ac2 (≈120 mg L(-1) of culture broth) to be produced. Pure Leg5,7Ac2 could be isolated and converted into CMP-activated sugar for biochemical applications and a phenyl thioglycoside for chemical synthesis applications. This first total biosynthesis provides an essential source of Leg5,7Ac2 enabling study of its role in prokaryotic and eukaryotic glycobiology. PMID:27538580

  19. Bacterial synthesis of polysialic acid lactosides in recombinant Escherichia coli K-12.

    PubMed

    Richard, Emeline; Buon, Laurine; Drouillard, Sophie; Fort, Sébastien; Priem, Bernard

    2016-07-01

    Bacterial polysialyltransferases (PSTs) are processive enzymes involved in the synthesis of polysialic capsular polysaccharides. They can also synthesize polysialic acid in vitro from disialylated and trisialylated lactoside acceptors, which are the carbohydrate moieties of GD3 and GT3 gangliosides, respectively. Here, we engineered a non-pathogenic Escherichia coli strain that overexpresses recombinant sialyltransferases and sialic acid synthesis genes and can convert an exogenous lactoside into polysialyl lactosides. Several PSTs were assayed for their ability to synthesize polysialyl lactosides in the recombinant strains. Fed-batch cultures produced α-2,8 polysialic acid or alternate α-2,8-2,9 polysialic acid in quantities reaching several grams per liter. Bacterial culture in the presence of propargyl-β-lactoside as the exogenous acceptor led to the production of conjugatable polysaccharides by means of copper-assisted click chemistry. PMID:26927318

  20. Bacterial cell wall-induced arthritis: chemical composition and tissue distribution of four Lactobacillus strains.

    PubMed

    Simelyte, E; Rimpiläinen, M; Lehtonen, L; Zhang, X; Toivanen, P

    2000-06-01

    To study what determines the arthritogenicity of bacterial cell walls, cell wall-induced arthritis in the rat was applied, using four strains of Lactobacillus. Three of the strains used proved to induce chronic arthritis in the rat; all were Lactobacillus casei. The cell wall of Lactobacillus fermentum did not induce chronic arthritis. All arthritogenic bacterial cell walls had the same peptidoglycan structure, whereas that of L. fermentum was different. Likewise, all arthritogenic cell walls were resistant to lysozyme degradation, whereas the L. fermentum cell wall was lysozyme sensitive. Muramic acid was observed in the liver, spleen, and lymph nodes in considerably larger amounts after injection of an arthritogenic L. casei cell wall than following injection of a nonarthritogenic L. fermentum cell wall. The L. casei cell wall also persisted in the tissues longer than the L. fermentum cell wall. The present results, taken together with those published previously, underline the possibility that the chemical structure of peptidoglycan is important in determining the arthritogenicity of the bacterial cell wall. PMID:10816508

  1. New bacterial strain of the genus Ochrobactrum with glyphosate-degrading activity.

    PubMed

    Hadi, Faranak; Mousavi, Amir; Noghabi, Kambiz Akbari; Tabar, Hadi Ghaderi; Salmanian, Ali Hatef

    2013-01-01

    Thirty bacterial strains with various abilities to utilize glyphosate as the sole phosphorus source were isolated from farm soils using the glyphosate enrichment cultivation technique. Among them, a strain showing a remarkable glyphosate-degrading activity was identified by biochemical features and 16S rRNA sequence analysis as Ochrobactrum sp. (GDOS). Herbicide (3 mM) degradation was induced by phosphate starvation, and was completed within 60 h. Aminomethylphosphonic acid was detected in the exhausted medium, suggesting glyphosate oxidoreductase as the enzyme responsible for herbicide breakdown. As it grew even in the presence of glyphosate concentrations as high as 200 mM, Ochrobactrum sp. could be used for bioremediation purposes and treatment of heavily contaminated soils.

  2. A Catalytic DNA Activated by a Specific Strain of Bacterial Pathogen

    PubMed Central

    Shen, Zhifa; Wu, Zaisheng; Chang, Dingran; Zhang, Wenqing; Tram, Kha; Lee, Christine; Kim, Peter; Salena, Bruno J.

    2015-01-01

    Abstract Pathogenic strains of bacteria are known to cause various infectious diseases and there is a growing demand for molecular probes that can selectively recognize them. Here we report a special DNAzyme (catalytic DNA), RFD‐CD1, that shows exquisite specificity for a pathogenic strain of Clostridium difficile (C. difficile). RFD‐CD1 was derived by an in vitro selection approach where a random‐sequence DNA library was allowed to react with an unpurified molecular mixture derived from this strain of C. difficle, coupled with a subtractive selection strategy to eliminate cross‐reactivities to unintended C. difficile strains and other bacteria species. RFD‐CD1 is activated by a truncated version of TcdC, a transcription factor, that is unique to the targeted strain of C. difficle. Our study demonstrates for the first time that in vitro selection offers an effective approach for deriving functional nucleic acid probes that are capable of achieving strain‐specific recognition of bacterial pathogens. PMID:26676768

  3. Accelerated decolorization of structurally different azo dyes by newly isolated bacterial strains.

    PubMed

    Khalid, Azeem; Arshad, Muhammad; Crowley, David E

    2008-02-01

    Wastewater effluents from the textile and other dye-stuff industries contain significant amounts of synthetic dyes that require treatment to prevent groundwater contamination. In research aimed at biotechnology for treatment of azo dyes, this study examined 288 strains of azo-dye degrading bacteria to identify efficient strains and determine incubation times required for decolorization. Initial enrichment cultures were carried out using a mixture of four structurally different dyes (Acid Red 88, Reactive Black 5, Direct Red 81, and Disperse Orange 3) as the sole source of C and N to isolate the bacteria from soil, activated sludge, and natural asphalt. Six strains were selected for further study based on their prolific growth and ability to rapidly decolorize the dyes individually or in mixtures. Treatment times required by the most efficient strain, AS96 (Shewanella putrefaciens) were as short as 4 h for complete decolorization of 100 mg l(-1) of AR-88 and DR-81 dyes under static conditions, and 6 and 8 h, respectively, for complete decolorization of RB-5 and DO-3. To our knowledge, these bacterial strains are the most efficient azo-dye degrading bacteria that have been described and may have practical application for biological treatment of dye-polluted wastewater streams.

  4. Phenotypic and phylogenetic characterization of an abamectin-degrading bacterial strain isolated from a citrus orchard.

    PubMed

    Ali, Shinawar Waseem; Yu, Fang-Bo; Haider, Muhammad Saleem; Yan, Xin; Li, Shun-Peng

    2013-01-01

    Bacterial strain GB-01 was isolated from abamectin-contaminated soils by continuous enrichment culture. The preliminary identification of strain GB-01 as a Burkholderia species was based mainly on simple biochemical and substrate utilization tests; however, these tests alone cannot accurately differentiate all the species within the genus Burkholderia. The strain GB-01 was subjected to taxonomic analysis through a polyphasic approach, in which phenotypic, genotypic, and phylogenetic information was gathered to conclude the classification of this microbe. Phenotypic information comes from basic bacteriological tests and substrate utilization patterns using the Biolog GN2 MicroPlating system and automated miniature biochemical test kits, i.e. API 20 NE, ID 32 GN and API 50 CH, as well as analyzing the whole cell fatty acid profile. Genotypic information was gathered from whole genome DNA base composition (G+C mol%), and DNA-DNA hybridization with its closest species, while phylogenetic information was collected from the comparative analysis of 16S rRNA and recA gene sequences. The results of polyphasic analysis concluded that strain GB-01 is an atypical strain of the Burkholderia diffusa species. PMID:23863292

  5. A novel protein tightly bound to bacterial magnetic particles in Magnetospirillum magneticum strain AMB-1.

    PubMed

    Arakaki, Atsushi; Webb, John; Matsunaga, Tadashi

    2003-03-01

    Magnetic bacteria synthesize magnetite crystals with species-dependent morphologies. The molecular mechanisms that control nano-sized magnetite crystal formation and the generation of diverse morphologies are not well understood. From the analysis of magnetite crystal-associated proteins, several low molecular mass proteins tightly bound to bacterial magnetite were obtained from Magnetospirillum magneticum strain AMB-1. These proteins showed common features in their amino acid sequences, which contain hydrophobic N-terminal and hydrophilic C-terminal regions. The C-terminal regions in Mms5, Mms6, Mms7, and Mms13 contain dense carboxyl and hydroxyl groups that bind iron ions. Nano-sized magnetic particles similar to those in magnetic bacteria were prepared by chemical synthesis of magnetite in the presence of the acidic protein Mms6. These proteins may be directly involved in biological magnetite crystal formation in magnetic bacteria.

  6. Impacts of hydrophilic colanic acid on bacterial attachment to microfiltration membranes and subsequent membrane biofouling.

    PubMed

    Yoshida, Keitaro; Tashiro, Yosuke; May, Thithiwat; Okabe, Satoshi

    2015-06-01

    In order to examine the interactions between physicochemical properties of specific extracellular polymeric substances (EPS) and membrane biofouling, we investigated the impacts of hydrophilic colanic acid, as a model extracellular polysaccharide component, on initial bacterial attachment to different microfiltration (MF) membranes and membrane biofouling by using Escherichia coli strains producing different amounts of colanic acid. In a newly designed microtiter plate assay, the bacterial attachment by an E. coli strain RcsF(+), which produces massive amounts of colanic acid, decreased only to a hydrophobic membrane because the colanic acid made cell surfaces more hydrophilic, resulting in low cell attachment to hydrophobic membranes. The bench-scale cross-flow filtration tests followed by filtration resistance measurement revealed that RcsF(+) caused severe irreversible membrane fouling (i.e., pore-clogging), whereas less extracellular polysaccharide-producing strains caused moderate but reversible fouling to all membranes used in this study. Further cross-flow filtration tests indicated that colanic acid liberated in the bulk phase could rapidly penetrate pre-accumulated biomass layers (i.e., biofilms) and then directly clogged membrane pores. These results indicate that colanic acid, a hydrophilic extracellular polysaccharide, and possible polysaccharides with similar characteristics with colanic acid are considered as a major cause of severe irreversible membrane fouling (i.e., pore-clogging) regardless of biofilm formation (dynamic membrane).

  7. Strain typing of acetic acid bacteria responsible for vinegar production by the submerged elaboration method.

    PubMed

    Fernández-Pérez, Rocío; Torres, Carmen; Sanz, Susana; Ruiz-Larrea, Fernanda

    2010-12-01

    Strain typing of 103 acetic acid bacteria isolates from vinegars elaborated by the submerged method from ciders, wines and spirit ethanol, was carried on in this study. Two different molecular methods were utilised: pulsed field gel electrophoresis (PFGE) of total DNA digests with a number of restriction enzymes, and enterobacterial repetitive intergenic consensus (ERIC) - PCR analysis. The comparative study of both methods showed that restriction fragment PFGE of SpeI digests of total DNA was a suitable method for strain typing and for determining which strains were present in vinegar fermentations. Results showed that strains of the species Gluconacetobacter europaeus were the most frequent leader strains of fermentations by the submerged method in the studied vinegars, and among them strain R1 was the predominant one. Results showed as well that mixed populations (at least two different strains) occurred in vinegars from cider and wine, whereas unique strains were found in spirit vinegars, which offered the most stressing conditions for bacterial growth.

  8. CMA manufacture II: Improved bacterial strain for acetate production: Final report

    SciTech Connect

    Ljungdahl, L.G.; Carreira, L.H.; Garrison, R.J.; Rabek, N.E.; Gunter, L.F.; Wiegel, J.

    1986-06-01

    Three homoacetogenic anaerobic thermophilic bacteria, Clostridium thermoaceticum, Clostridium thermoautotrophicum, and Acetogenium kivui, were evaluated for possible use in an industrial fermentative process to manufacture calcium, magnesium acetate (CMA) from hydrolyzed corn starch and dolime. The hydrolyzed corn starch is fermented by the bacteria with a theoretical yield of about 90%. Improved bacterial strains were obtained from the clostridial bacteria but not from A. kivui. In fermentations with improved bacterial strains using dolime to neutralize the produced acetic acid, up to 150 g/liter of CMA was produced, however, the production rate was only about 12 g/liter per 24 hours. Batch fermentation, continuous fermentation with and without cell-recycling and continuous fermentation with a new type of rotating fermentor were tested. Economic evaluation of the results indicate that CMA can be produced for $0.24/lb. The rotating fermentor device was developed at the end of the contract period. With it a production rate of almost 10 g/liter an hour was obtained, however, the concentration of acetate in the harvested fermentation broth was only 1 percent. Further research should lead to the development of an economic fermentation process for CMA. 38 refs., 10 figs., 34 tabs.

  9. Comparison of Rapid Methods for Analysis of Bacterial Fatty Acids

    PubMed Central

    Moss, C. Wayne; Lambert, M. A.; Merwin, W. H.

    1974-01-01

    When rapid gas-liquid chromatography methods for determination of bacterial fatty acids were compared, results showed that saponification was required for total fatty acid analysis. Transesterification with boron-trihalide reagents (BF3-CH3OH, BCl3-CH3OH) caused extensive degradation of cyclopropane acids and was less effective than saponification in releasing cellular hydroxy fatty acids. Digestion of cells with tetramethylammonium hydroxide was unsatisfactory because of extraneous gas-liquid chromatography peaks and because of lower recovery of branched-chain and hydroxy fatty acids. A simple, rapid saponification procedure which can be used for total cellular fatty acid analysis of freshly grown cells is described. PMID:4844271

  10. Rapid identification and discrimination of bacterial strains by laser induced breakdown spectroscopy and neural networks.

    PubMed

    Manzoor, S; Moncayo, S; Navarro-Villoslada, F; Ayala, J A; Izquierdo-Hornillos, R; de Villena, F J Manuel; Caceres, J O

    2014-04-01

    Identification and discrimination of bacterial strains of same species exhibiting resistance to antibiotics using laser induced breakdown spectroscopy (LIBS) and neural networks (NN) algorithm is reported. The method has been applied to identify 40 bacterial strains causing hospital acquired infections (HAI), i.e. Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumoniae, Salmonella typhimurium, Salmonella pullurum and Salmonella salamae. The strains analyzed included both isolated from clinical samples and constructed in laboratory that differ in mutations as a result of their resistance to one or more antibiotics. Small changes in the atomic composition of the bacterial strains, as a result of their mutations and genetic variations, were detected by the LIBS-NN methodology and led to their identification and classification. This is of utmost importance because solely identification of bacterial species is not sufficient for disease diagnosis and identification of the actual strain is also required. The proposed method was successfully able to discriminate strains of the same bacterial species. The optimized NN models provided reliable bacterial strain identification with an index of spectral correlation higher than 95% for the samples analyzed, showing the potential and effectiveness of the method to address the safety and social-cost HAI-related issue.

  11. Typing of Histoplasma capsulatum strains by fatty acid profile analysis.

    PubMed

    Zarnowski, Robert; Miyazaki, Makoto; Dobrzyn, Agnieszka; Ntambi, James M; Woods, Jon P

    2007-06-01

    The performance of fatty acid profiling for strain differentiation of Histoplasma capsulatum was assessed. Total fatty acids were isolated from the yeast-phase cells of seven stock and two previously unreported clinical strains of H. capsulatum var. capsulatum, as well as from one unreported clinical strain and one stock strain of H. capsulatum var. duboisii, and one strain of each of three other dimorphic zoopathogenic fungal species, Blastomyces dermatitidis, Paracoccidioides brasiliensis and Sporothrix schenckii. Different colony morphology and pigmentation types of the H. capsulatum strains were also included. The most frequently occurring fatty acids were oleic, palmitic, stearic and linoleic acids. There were variations in the relative percentage fatty acid contents of H. capsulatum strains that could be used for strain identification and discrimination. Differentiation between H. capsulatum strains was achieved by the comparison of detected fatty acids accompanied by principal component analysis using calculated Varimax-rotated principal component loadings. Statistical analysis yielded three major principal components that explained over 94 % of total variance in the data. All the strains of H. capsulatum var. capsulatum RFLP classes II and III were grouped into two distinct clusters: the heterogenic RFLP class I formed a large, but also well-defined group, whereas the outgroup strains of H. capsulatum var. duboisii, B. dermatitidis, P. brasiliensis and S. schenckii were shifted away. These data suggest that fatty acid profiling can be used in H. capsulatum strain classification and epidemiological studies that require strain differentiation at the intraspecies level. PMID:17510264

  12. Bioremediation potential of a highly mercury resistant bacterial strain Sphingobium SA2 isolated from contaminated soil.

    PubMed

    Mahbub, Khandaker Rayhan; Krishnan, Kannan; Megharaj, Mallavarapu; Naidu, Ravi

    2016-02-01

    A mercury resistant bacterial strain, SA2, was isolated from soil contaminated with mercury. The 16S rRNA gene sequence of this isolate showed 99% sequence similarity to the genera Sphingobium and Sphingomonas of α-proteobacteria group. However, the isolate formed a distinct phyletic line with the genus Sphingobium suggesting the strain belongs to Sphingobium sp. Toxicity studies indicated resistance to high levels of mercury with estimated EC50 values 4.5 mg L(-1) and 44.15 mg L(-1) and MIC values 5.1 mg L(-1) and 48.48 mg L(-1) in minimal and rich media, respectively. The strain SA2 was able to volatilize mercury by producing mercuric reductase enzyme which makes it potential candidate for remediating mercury. ICP-QQQ-MS analysis of Hg supplemented culture solutions confirmed that almost 79% mercury in the culture suspension was volatilized in 6 h. A very small amount of mercury was observed to accumulate in cell pellets which was also evident according to ESEM-EDX analysis. The mercuric reductase gene merA was amplified and sequenced. The deduced amino acid sequence demonstrated sequence homology with α-proteobacteria and Ascomycota group.

  13. Bioremediation potential of a highly mercury resistant bacterial strain Sphingobium SA2 isolated from contaminated soil.

    PubMed

    Mahbub, Khandaker Rayhan; Krishnan, Kannan; Megharaj, Mallavarapu; Naidu, Ravi

    2016-02-01

    A mercury resistant bacterial strain, SA2, was isolated from soil contaminated with mercury. The 16S rRNA gene sequence of this isolate showed 99% sequence similarity to the genera Sphingobium and Sphingomonas of α-proteobacteria group. However, the isolate formed a distinct phyletic line with the genus Sphingobium suggesting the strain belongs to Sphingobium sp. Toxicity studies indicated resistance to high levels of mercury with estimated EC50 values 4.5 mg L(-1) and 44.15 mg L(-1) and MIC values 5.1 mg L(-1) and 48.48 mg L(-1) in minimal and rich media, respectively. The strain SA2 was able to volatilize mercury by producing mercuric reductase enzyme which makes it potential candidate for remediating mercury. ICP-QQQ-MS analysis of Hg supplemented culture solutions confirmed that almost 79% mercury in the culture suspension was volatilized in 6 h. A very small amount of mercury was observed to accumulate in cell pellets which was also evident according to ESEM-EDX analysis. The mercuric reductase gene merA was amplified and sequenced. The deduced amino acid sequence demonstrated sequence homology with α-proteobacteria and Ascomycota group. PMID:26378869

  14. Fatty acid profiling to characterize California strains of Xylella fastidiosa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Different strains of Xylella fastidiosa cause diseases such as Pierce’s disease of grapevine, citrus variegated chlorosis, and bacterial leaf scorch of hardwoods. However, more research is needed to better define subspecies and strains of X. fastidiosa to improve both regulations concerning this bac...

  15. Complete genome sequence of Japanese erwinia strain ejp617, a bacterial shoot blight pathogen of pear.

    PubMed

    Park, Duck Hwan; Thapa, Shree Prasad; Choi, Beom-Soon; Kim, Won-Sik; Hur, Jang Hyun; Cho, Jun Mo; Lim, Jong-Sung; Choi, Ik-Young; Lim, Chun Keun

    2011-01-01

    The Japanese Erwinia strain Ejp617 is a plant pathogen that causes bacterial shoot blight of pear in Japan. Here, we report the complete genome sequence of strain Ejp617 isolated from Nashi pears in Japan to provide further valuable insight among related Erwinia species.

  16. Lysozyme-coated silver nanoparticles for differentiating bacterial strains on the basis of antibacterial activity

    NASA Astrophysics Data System (ADS)

    Ashraf, Sumaira; Chatha, Mariyam Asghar; Ejaz, Wardah; Janjua, Hussnain Ahmed; Hussain, Irshad

    2014-10-01

    Lysozyme, an antibacterial enzyme, was used as a stabilizing ligand for the synthesis of fairly uniform silver nanoparticles adopting various strategies. The synthesized particles were characterized using UV-visible spectroscopy, FTIR, dynamic light scattering (DLS), and TEM to observe their morphology and surface chemistry. The silver nanoparticles were evaluated for their antimicrobial activity against several bacterial species and various bacterial strains within the same species. The cationic silver nanoparticles were found to be more effective against Pseudomonas aeruginosa 3 compared to other bacterial species/strains investigated. Some of the bacterial strains of the same species showed variable antibacterial activity. The difference in antimicrobial activity of these particles has led to the conclusion that antimicrobial products formed from silver nanoparticles may not be equally effective against all the bacteria. This difference in the antibacterial activity of silver nanoparticles for different bacterial strains from the same species may be due to the genome islands that are acquired through horizontal gene transfer (HGT). These genome islands are expected to possess some genes that may encode enzymes to resist the antimicrobial activity of silver nanoparticles. These silver nanoparticles may thus also be used to differentiate some bacterial strains within the same species due to variable silver resistance of these variants, which may not possible by simple biochemical tests.

  17. Closely related protist strains have different grazing impacts on natural bacterial communities.

    PubMed

    Glücksman, Edvard; Bell, Thomas; Griffiths, Robert I; Bass, David

    2010-12-01

    Heterotrophic protists are abundant in most environments and exert a strong top-down control on bacterial communities. However, little is known about how selective most protists are with respect to their bacterial prey. We conducted feeding trials using cercomonad and glissomonad Cercozoa by assaying them on a standardized, diverse bacterial community washed from beech leaf litter. For each of the nine protist strains assayed here, we measured several phenotypic traits (cell volume, speed, plasticity and protist cell density) that we anticipated would be important for their feeding ecology. We also estimated the genetic relatedness of the strains based on the 18S rRNA gene. We found that the nine protist strains had significantly different impacts on both the abundance and the composition of the bacterial communities. Both the phylogenetic distance between protist strains and differences in protist strain traits were important in explaining variation in the bacterial communities. Of the morphological traits that we investigated, protist cell volume and morphological plasticity (the extent to which cells showed amoeboid cell shape flexibility) were most important in determining bacterial community composition. The results demonstrate that closely related and morphologically similar protist species can have different impacts on their prey base.

  18. Lysozyme-coated silver nanoparticles for differentiating bacterial strains on the basis of antibacterial activity

    PubMed Central

    2014-01-01

    Lysozyme, an antibacterial enzyme, was used as a stabilizing ligand for the synthesis of fairly uniform silver nanoparticles adopting various strategies. The synthesized particles were characterized using UV-visible spectroscopy, FTIR, dynamic light scattering (DLS), and TEM to observe their morphology and surface chemistry. The silver nanoparticles were evaluated for their antimicrobial activity against several bacterial species and various bacterial strains within the same species. The cationic silver nanoparticles were found to be more effective against Pseudomonas aeruginosa 3 compared to other bacterial species/strains investigated. Some of the bacterial strains of the same species showed variable antibacterial activity. The difference in antimicrobial activity of these particles has led to the conclusion that antimicrobial products formed from silver nanoparticles may not be equally effective against all the bacteria. This difference in the antibacterial activity of silver nanoparticles for different bacterial strains from the same species may be due to the genome islands that are acquired through horizontal gene transfer (HGT). These genome islands are expected to possess some genes that may encode enzymes to resist the antimicrobial activity of silver nanoparticles. These silver nanoparticles may thus also be used to differentiate some bacterial strains within the same species due to variable silver resistance of these variants, which may not possible by simple biochemical tests. PMID:25435831

  19. Lysozyme-coated silver nanoparticles for differentiating bacterial strains on the basis of antibacterial activity.

    PubMed

    Ashraf, Sumaira; Chatha, Mariyam Asghar; Ejaz, Wardah; Janjua, Hussnain Ahmed; Hussain, Irshad

    2014-01-01

    Lysozyme, an antibacterial enzyme, was used as a stabilizing ligand for the synthesis of fairly uniform silver nanoparticles adopting various strategies. The synthesized particles were characterized using UV-visible spectroscopy, FTIR, dynamic light scattering (DLS), and TEM to observe their morphology and surface chemistry. The silver nanoparticles were evaluated for their antimicrobial activity against several bacterial species and various bacterial strains within the same species. The cationic silver nanoparticles were found to be more effective against Pseudomonas aeruginosa 3 compared to other bacterial species/strains investigated. Some of the bacterial strains of the same species showed variable antibacterial activity. The difference in antimicrobial activity of these particles has led to the conclusion that antimicrobial products formed from silver nanoparticles may not be equally effective against all the bacteria. This difference in the antibacterial activity of silver nanoparticles for different bacterial strains from the same species may be due to the genome islands that are acquired through horizontal gene transfer (HGT). These genome islands are expected to possess some genes that may encode enzymes to resist the antimicrobial activity of silver nanoparticles. These silver nanoparticles may thus also be used to differentiate some bacterial strains within the same species due to variable silver resistance of these variants, which may not possible by simple biochemical tests. PMID:25435831

  20. Indole-3-acetic acid biosynthetic pathway and aromatic amino acid aminotransferase activities in Pantoea dispersa strain GPK.

    PubMed

    Kulkarni, G B; Nayak, A S; Sajjan, S S; Oblesha, A; Karegoudar, T B

    2013-05-01

    This investigation deals with the production of IAA by a bacterial isolate Pantoea dispersa strain GPK (PDG) identified by 16S rRNA gene sequence analysis. HPLC and Mass spectral analysis of metabolites from bacterial spent medium revealed that, IAA production by PDG is Trp-dependent and follows indole-3-pyruvic acid (IPyA) pathway. Substrate specificity study of aromatic amino acid aminotransferase (AAT) showed high activities, only when tryptophan (Trp) and α-ketoglutarate (α-kg) were used as substrates. AAT is highly specific for Trp and α-kg as amino group donor and acceptor, respectively. The effect of exogenous IAA on bacterial growth was established. Low concentration of exogenous IAA induced the growth, whereas high concentration decreased the growth of bacterium. PDG treatment significantly increased the root length, shoot length and dry mass of the chickpea and pigeon pea plants. PMID:23448265

  1. Recovery of succinic acid produced by fermentation of a metabolically engineered Mannheimia succiniciproducens strain.

    PubMed

    Song, Hyohak; Huh, Yun Suk; Lee, Sang Yup; Hong, Won Hi; Hong, Yeon Ki

    2007-12-01

    There have recently been much advances in the production of succinic acid, an important four-carbon dicarboxylic acid for many industrial applications, by fermentation of several natural and engineered bacterial strains. Mannheimia succiniciproducens MBEL55E isolated from bovine rumen is able to produce succinic acid with high efficiency, but also produces acetic, formic and lactic acids just like other anaerobic succinic acid producers. We recently reported the development of an engineered M. succiniciproducens LPK7 strain which produces succinic acid as a major fermentation product while producing much reduced by-products. Having an improved succinic acid producer developed, it is equally important to develop a cost-effective downstream process for the recovery of succinic acid. In this paper, we report the development of a simpler and more efficient method for the recovery of succinic acid. For the recovery of succinic acid from the fermentation broth of LPK7 strain, a simple process composed of a single reactive extraction, vacuum distillation, and crystallization yielded highly purified succinic acid (greater than 99.5% purity, wt%) with a high yield of 67.05wt%. When the same recovery process or even multiple reactive extraction steps were applied to the fermentation broth of MBEL55E, lower purity and yield of succinic acid were obtained. These results suggest that succinic acid can be purified in a cost-effective manner by using the fermentation broth of engineered LPK7 strain, showing the importance of integrating the strain development, fermentation and downstream process for optimizing the whole processes for succinic acid production. PMID:17765349

  2. Bacterial defluorination of 4-fluoroglutamic acid.

    PubMed

    Donnelly, Clár; Murphy, Cormac D

    2007-12-01

    Fluorinated amino acids are used as enzyme inhibitors, mechanistic probes and in the production of pharmacologically active peptides. Because enantiomerically pure 4-fluoroglutamate is difficult to prepare, the selective degradation of the L-isomer is a potentially convenient method of obtaining D-4-fluoroglutamate from the racemate. In this paper, we describe our investigations on the degradation of 4-fluoroglutamate by bacteria. Fluoride ion was detected in resting-cell cultures of a number of bacteria that were incubated with racemic 4-fluoroglutamate. Analysis of the culture supernatants by chiral gas chromatography-mass spectrometry revealed that only the L-isomer was degraded. The degradation of 4-fluoroglutamate was also examined in cell-free extracts of Streptomyces cattleya and Proteus mirabilis, and it was observed that equimolar concentrations of fluoride ion and ammonia were generated. The activity was located in the soluble fraction of cell extracts, thus is not related to the L-2-amino-4-chloro-4-pentenoic acid dehydrochlorinase previously identified in membrane fractions of P. mirabilis.

  3. Progress in lactic acid bacterial phage research

    PubMed Central

    2014-01-01

    Research on lactic acid bacteria (LAB) has advanced significantly over the past number of decades and these developments have been driven by the parallel advances in technologies such as genomics, bioinformatics, protein expression systems and structural biology, combined with the ever increasing commercial relevance of this group of microorganisms. Some of the more significant and impressive outputs have been in the domain of bacteriophage-host interactions which provides a prime example of the cutting-edge model systems represented by LAB research. Here, we present a retrospective overview of the key advances in LAB phage research including phage-host interactions and co-evolution. We describe how in many instances this knowledge can be pivotal in creating real improvements in the application of LAB cultures in commercial practice. PMID:25185514

  4. Nucleic acid detection technologies and marker molecules in bacterial diagnostics.

    PubMed

    Scheler, Ott; Glynn, Barry; Kurg, Ants

    2014-05-01

    There is a growing need for quick and reliable methods for microorganism detection and identification worldwide. Although traditional culture-based technologies are trustworthy and accurate at a relatively low cost, they are also time- and labor-consuming and are limited to culturable bacteria. Those weaknesses have created a necessity for alternative technologies that are capable for faster and more precise bacterial identification from medical, food or environmental samples. The most common current approach is to analyze the nucleic acid component of analyte solution and determine the bacterial composition according to the specific nucleic acid profiles that are present. This review aims to give an up-to-date overview of different nucleic acid target sequences and respective analytical technologies.

  5. Bacterial CS2 hydrolases from Acidithiobacillus thiooxidans strains are homologous to the archaeal catenane CS2 hydrolase.

    PubMed

    Smeulders, Marjan J; Pol, Arjan; Venselaar, Hanka; Barends, Thomas R M; Hermans, John; Jetten, Mike S M; Op den Camp, Huub J M

    2013-09-01

    Carbon disulfide (CS(2)) and carbonyl sulfide (COS) are important in the global sulfur cycle, and CS(2) is used as a solvent in the viscose industry. These compounds can be converted by sulfur-oxidizing bacteria, such as Acidithiobacillus thiooxidans species, to carbon dioxide (CO(2)) and hydrogen sulfide (H2S), a property used in industrial biofiltration of CS(2)-polluted airstreams. We report on the mechanism of bacterial CS(2) conversion in the extremely acidophilic A. thiooxidans strains S1p and G8. The bacterial CS(2) hydrolases were highly abundant. They were purified and found to be homologous to the only other described (archaeal) CS(2) hydrolase from Acidianus strain A1-3, which forms a catenane of two interlocked rings. The enzymes cluster in a group of β-carbonic anhydrase (β-CA) homologues that may comprise a subclass of CS(2) hydrolases within the β-CA family. Unlike CAs, the CS(2) hydrolases did not hydrate CO(2) but converted CS(2) and COS with H(2)O to H(2)S and CO(2). The CS(2) hydrolases of A. thiooxidans strains G8, 2Bp, Sts 4-3, and BBW1, like the CS(2) hydrolase of Acidianus strain A1-3, exist as both octamers and hexadecamers in solution. The CS(2) hydrolase of A. thiooxidans strain S1p forms only octamers. Structure models of the A. thiooxidans CS(2) hydrolases based on the structure of Acidianus strain A1-3 CS(2) hydrolase suggest that the A. thiooxidans strain G8 CS(2) hydrolase may also form a catenane. In the A. thiooxidans strain S1p enzyme, two insertions (positions 26 and 27 [PD] and positions 56 to 61 [TPAGGG]) and a nine-amino-acid-longer C-terminal tail may prevent catenane formation.

  6. Volatile Emissions from Mycobacterium avium subsp. paratuberculosis Mirror Bacterial Growth and Enable Distinction of Different Strains

    PubMed Central

    Trefz, Phillip; Koehler, Heike; Klepik, Klaus; Moebius, Petra; Reinhold, Petra; Schubert, Jochen K.; Miekisch, Wolfram

    2013-01-01

    Control of paratuberculosis in livestock is hampered by the low sensitivity of established direct and indirect diagnostic methods. Like other bacteria, Mycobacterium avium subsp. paratuberculosis (MAP) emits volatile organic compounds (VOCs). Differences of VOC patterns in breath and feces of infected and not infected animals were described in first pilot experiments but detailed information on potential marker substances is missing. This study was intended to look for characteristic volatile substances in the headspace of cultures of different MAP strains and to find out how the emission of VOCs was affected by density of bacterial growth. One laboratory adapted and four field strains, three of MAP C-type and one MAP S-type were cultivated on Herrold’s egg yolk medium in dilutions of 10-0, 10-2, 10-4 and 10-6. Volatile substances were pre-concentrated from the headspace over the MAP cultures by means of Solid Phase Micro Extraction (SPME), thermally desorbed from the SPME fibers and separated and identified by means of GC-MS. Out of the large number of compounds found in the headspace over MAP cultures, 34 volatile marker substances could be identified as potential biomarkers for growth and metabolic activity. All five MAP strains could clearly be distinguished from blank culture media by means of emission patterns based on these 34 substances. In addition, patterns of volatiles emitted by the reference strain were significantly different from the field strains. Headspace concentrations of 2-ethylfuran, 2-methylfuran, 3-methylfuran, 2-pentylfuran, ethyl acetate, 1-methyl-1-H-pyrrole and dimethyldisulfide varied with density of bacterial growth. Analysis of VOCs emitted from mycobacterial cultures can be used to identify bacterial growth and, in addition, to differentiate between different bacterial strains. VOC emission patterns may be used to approximate bacterial growth density. In a perspective volatile marker substances could be used to diagnose MAP

  7. Antibiotic susceptibility of bacterial strains isolated from patients with community-acquired urinary tract infections in France. Multicentre Study Group.

    PubMed

    Goldstein, F W

    2000-02-01

    The aim of this study was to determine the distribution and antibiotic susceptibility patterns of bacterial strains isolated from adults with community-acquired urinary tract infections (UTI) in France. From December 1996 to March 1997, each of 15 private laboratories in France consecutively collected about 80 non-duplicate strains isolated from adult outpatients with UTI, including patients receiving care at home, and tested their susceptibility by the disk diffusion test. A total of 1160 strains were collected: 1031 gram-negative bacilli, including Escherichia coli (n = 865), Proteus mirabilis (n = 68) and Klebsiella spp. (n = 40), and 129 gram-positive cocci, including Staphylococcus aureus (n = 16), other staphylococci (n = 25), group B streptococci (n = 25) and enterococci (n = 63). In the case of 430 bacterial isolates, the patients had either been hospitalised in the last 6 months or received antibiotic treatment in the last 3 months. The antibiotic susceptibility rates for Escherichia coli were: amoxicillin (58.7%), amoxicillin-clavulanic acid (63.3%), ticarcillin (61.4%), cephalothin (66.8%) cefuroxime (77.6%), cefixime (83.6%), cefotaxime (99.8%), ceftazidime (99%), nalidixic acid (91.9%), norfloxacin (96.6%), ofloxacin (96.3%), ciprofloxacin (98.3%), cotrimoxazole (78.2%), fosfomycin (99.1%) and gentamicin (98.4%). Of the Enterobacteriaceae, five strains produced an extended-spectrum beta-lactamase. Methicillin resistance was detected in nine Staphylococcus aureus isolates. The most important findings were two extended-spectrum, beta-lactamase-producing and three methicillin-resistant Staphylococcus aureus strains isolated from patients who had not been hospitalised in the last 6 months or taken antibiotics in the last 3 months. The findings indicate that these strains can spread within the community; therefore, monitoring antibiotic susceptibility of bacteria isolated in the community appears to be mandatory.

  8. Superhydrophobic poly(L-lactic acid) surface as potential bacterial colonization substrate

    PubMed Central

    2011-01-01

    Hydrophobicity is a very important surface property and there is a growing interest in the production and characterization of superhydrophobic surfaces. Accordingly, it was recently shown how to obtain a superhydrophobic surface using a simple and cost-effective method on a polymer named poly(L-lactic acid) (PLLA). To evaluate the ability of such material as a substrate for bacterial colonization, this work assessed the capability of different bacteria to colonize a biomimetic rough superhydrophobic (SH) PLLA surface and also a smooth hydrophobic (H) one. The interaction between these surfaces and bacteria with different morphologies and cell walls was studied using one strain of Staphylococcus aureus and one of Pseudomonas aeruginosa. Results showed that both bacterial strains colonized the surfaces tested, although significantly higher numbers of S. aureus cells were found on SH surfaces comparing to H ones. Moreover, scanning electron microscopy images showed an extracellular matrix produced by P. aeruginosa on SH PLLA surfaces, indicating that this bacterium is able to form a biofilm on such substratum. Bacterial removal through lotus leaf effect was also tested, being more efficient on H coupons than on SH PLLA ones. Overall, the results showed that SH PLLA surfaces can be used as a substrate for bacterial colonization and, thus, have an exceptional potential for biotechnology applications. PMID:22018163

  9. Lactic Acid Bacterial Starter Culture with Antioxidant and γ-Aminobutyric Acid Biosynthetic Activities Isolated from Flatfish-Sikhae Fermentation.

    PubMed

    Won, Yeong Geol; Yu, Hyun-Hee; Chang, Young-Hyo; Hwang, Han-Joon

    2015-12-01

    The aim of this study is to select a lactic acid bacterial strain as a starter culture for flatfish-Sikhae fermentation and to evaluate its suitability for application in a food system. Four strains of lactic acid bacteria isolated from commercial flatfish-Sikhae were identified and selected as starter culture candidates through investigation of growth rates, salt tolerance, food safety, and functional properties such as antioxidative and antimicrobial activities. The fermentation properties of the starter candidates were also examined in food systems prepared with these strains (candidate batch) in comparison with a spontaneous fermentation process without starter culture (control batch) at 15°C. The results showed that the candidate YG331 batch had better fermentation properties such as viable cell count, pH, and acidity than the other experimental batches, including the control batch. The results are expressed according to selection criteria based on a preliminary sensory evaluation and physiochemical investigation. Also, only a small amount of histamine was detected with the candidate YG331 batch. The radical scavenging activity of the candidate batches was better compared with the control batch, and especially candidate YG331 batch showed the best radical scavenging activity. Also, we isolated another starter candidate (identified as Lactobacillus brevis PM03) with γ-aminobutyric acid (GABA)-producing activity from commercial flatfish-Sikhae products. The sensory scores of the candidate YG331 batch were better than those of the other experimental batches in terms of flavor, color, and overall acceptance. In this study, we established selection criteria for the lactic acid bacterial starter for the flatfish-Sikhae production and finally selected candidate YG331 as the most suitable starter.

  10. Biomass and organic acids in sandstone of a weathering building: Production by bacterial and fungal isolates.

    PubMed

    Palmer, R J; Siebert, J; Hirsch, P

    1991-12-01

    Ten fungal and nine bacterial strains were isolated from a weathering sandstone building. Their growth, organic acid production, and acidification capacity were assessed in culture under nutritional conditions similar to those in situ. Biomass (10-50 nmol phospholipid-PO4g(-1)) within the rock was small compared to soils. The isolated organisms were able to produce high amounts of those acids found in the sandstone, but acid production did not cause a drastic reduction in culture pH. It is suggested that the importance of acidification in microbial degradation of sandstone has been overestimated and that, under in situ pH and nutritional conditions, cation chelation by microbially produced organic acid anions may be more relevant to the weathering process.

  11. Screening of Lactobacillus strains of domestic goose origin against bacterial poultry pathogens for use as probiotics.

    PubMed

    Dec, Marta; Puchalski, Andrzej; Urban-Chmiel, Renata; Wernicki, Andrzej

    2014-10-01

    Lactobacilli are natural inhabitants of human and animal mucous membranes, including the avian gastrointestinal tract. Recently, increasing attention has been given to their probiotic, health-promoting capacities, among which their antagonistic potential against pathogens plays a key role. A study was conducted to evaluate probiotic properties of Lactobacillus strains isolated from feces or cloacae of domestic geese. Among the 104 examined isolates, previously identified to the species level by whole-cell matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and analysis of 16S-23S regions of rDNA, dominated Lactobacillus salivarius (35%), followed by Lactobacillus johnsonii (18%) and Lactobacillus ingluviei (11%). All lactobacilli were screened for antimicrobial activity toward Salmonella Enteritidis, Escherichia coli, Clostridium perfringens, Staphylococcus aureus, Pasteurella multocida, and Riemerella anatipestifer using the agar slab method and the well diffusion method. Lactobacillus salivarius and Lactobacillus plantarum exhibited particularly strong antagonism toward all of the indicator strains. In the agar slab method, the highest sensitivity to Lactobacillus was observed in R. anatipestifer and P. multocida, and the lowest in E. coli and S. aureus. The ability to produce H₂O₂was exhibited by 92% of isolates, but there was no correlation between the rate of production of this reactive oxygen species and the antimicrobial activity of Lactobacillus sp. All lactobacilli showed resistance to pH 3.0 and 3.5 and to 2% bile. The data demonstrate that Lactobacillus isolates from geese may have probiotic potential in reducing bacterial infections. The antibacterial activity of the selected lactobacilli is mainly due to lactic acid production by these bacteria. The selected Lactobacillus strains that strongly inhibited the growth of pathogenic bacteria, and were also resistant to low pH and bile salts, can potentially restore the balance

  12. Screening of Lactobacillus strains of domestic goose origin against bacterial poultry pathogens for use as probiotics.

    PubMed

    Dec, Marta; Puchalski, Andrzej; Urban-Chmiel, Renata; Wernicki, Andrzej

    2014-10-01

    Lactobacilli are natural inhabitants of human and animal mucous membranes, including the avian gastrointestinal tract. Recently, increasing attention has been given to their probiotic, health-promoting capacities, among which their antagonistic potential against pathogens plays a key role. A study was conducted to evaluate probiotic properties of Lactobacillus strains isolated from feces or cloacae of domestic geese. Among the 104 examined isolates, previously identified to the species level by whole-cell matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and analysis of 16S-23S regions of rDNA, dominated Lactobacillus salivarius (35%), followed by Lactobacillus johnsonii (18%) and Lactobacillus ingluviei (11%). All lactobacilli were screened for antimicrobial activity toward Salmonella Enteritidis, Escherichia coli, Clostridium perfringens, Staphylococcus aureus, Pasteurella multocida, and Riemerella anatipestifer using the agar slab method and the well diffusion method. Lactobacillus salivarius and Lactobacillus plantarum exhibited particularly strong antagonism toward all of the indicator strains. In the agar slab method, the highest sensitivity to Lactobacillus was observed in R. anatipestifer and P. multocida, and the lowest in E. coli and S. aureus. The ability to produce H₂O₂was exhibited by 92% of isolates, but there was no correlation between the rate of production of this reactive oxygen species and the antimicrobial activity of Lactobacillus sp. All lactobacilli showed resistance to pH 3.0 and 3.5 and to 2% bile. The data demonstrate that Lactobacillus isolates from geese may have probiotic potential in reducing bacterial infections. The antibacterial activity of the selected lactobacilli is mainly due to lactic acid production by these bacteria. The selected Lactobacillus strains that strongly inhibited the growth of pathogenic bacteria, and were also resistant to low pH and bile salts, can potentially restore the balance

  13. Specificity of monoclonal antibodies to strains of Dickeya sp. that cause bacterial heart rot of pineapple.

    PubMed

    Peckham, Gabriel D; Kaneshiro, Wendy S; Luu, Van; Berestecky, John M; Alvarez, Anne M

    2010-10-01

    During a severe outbreak of bacterial heart rot that occurred in pineapple plantations on Oahu, Hawaii, in 2003 and years following, 43 bacterial strains were isolated from diseased plants or irrigation water and identified as Erwinia chrysanthemi (now Dickeya sp.) by phenotypic, molecular, and pathogenicity assays. Rep-PCR fingerprint patterns grouped strains from pineapple plants and irrigation water into five genotypes (A-E) that differed from representatives of other Dickeya species, Pectobacterium carotovorum and other enteric saprophytes isolated from pineapple. Monoclonal antibodies produced following immunization of mice with virulent type C Dickeya sp. showed only two specificities. MAb Pine-1 (2D11G1, IgG1 with kappa light chain) reacted to all 43 pineapple/water strains and some reference strains (D. dianthicola, D. chrysanthemi, D. paradisiaca, some D. dadantii, and uncharacterized Dickeya sp.) but did not react to reference strains of D. dieffenbachiae, D. zeae, or one of the two Malaysian pineapple strains. MAb Pine-2 (2A7F2, IgG3 with kappa light chain) reacted to all type B, C, and D strains but not to any A or E strains or any reference strains except Dickeya sp. isolated from Malaysian pineapple. Pathogenicity tests showed that type C strains were more aggressive than type A strains when inoculated during cool months. Therefore, MAb Pine-2 distinguishes the more virulent type C strains from less virulent type A pineapple strains and type E water strains. MAbs with these two specificities enable development of rapid diagnostic tests that will distinguish the systemic heart rot pathogen from opportunistic bacteria associated with rotted tissues. Use of the two MAbs in field assays also permits the monitoring of a known subpopulation and provides additional decision tools for disease containment and management practices.

  14. The Mechanism for Type I Interferon Induction by Mycobacterium tuberculosis is Bacterial Strain-Dependent

    PubMed Central

    Wiens, Kirsten E.; Ernst, Joel D.

    2016-01-01

    Type I interferons (including IFNαβ) are innate cytokines that may contribute to pathogenesis during Mycobacterium tuberculosis (Mtb) infection. To induce IFNβ, Mtb must gain access to the host cytosol and trigger stimulator of interferon genes (STING) signaling. A recently proposed model suggests that Mtb triggers STING signaling through bacterial DNA binding cyclic GMP-AMP synthase (cGAS) in the cytosol. The aim of this study was to test the generalizability of this model using phylogenetically distinct strains of the Mtb complex (MTBC). We infected bone marrow derived macrophages with strains from MTBC Lineages 2, 4 and 6. We found that the Lineage 6 strain induced less IFNβ, and that the Lineage 2 strain induced more IFNβ, than the Lineage 4 strain. The strains did not differ in their access to the host cytosol and IFNβ induction by each strain required both STING and cGAS. We also found that the three strains shed similar amounts of bacterial DNA. Interestingly, we found that the Lineage 6 strain was associated with less mitochondrial stress and less mitochondrial DNA (mtDNA) in the cytosol compared with the Lineage 4 strain. Treating macrophages with a mitochondria-specific antioxidant reduced cytosolic mtDNA and inhibited IFNβ induction by the Lineage 2 and 4 strains. We also found that the Lineage 2 strain did not induce more mitochondrial stress than the Lineage 4 strain, suggesting that additional pathways contribute to higher IFNβ induction. These results indicate that the mechanism for IFNβ by Mtb is more complex than the established model suggests. We show that mitochondrial dynamics and mtDNA contribute to IFNβ induction by Mtb. Moreover, we show that the contribution of mtDNA to the IFNβ response varies by MTBC strain and that additional mechanisms exist for Mtb to induce IFNβ. PMID:27500737

  15. The Mechanism for Type I Interferon Induction by Mycobacterium tuberculosis is Bacterial Strain-Dependent.

    PubMed

    Wiens, Kirsten E; Ernst, Joel D

    2016-08-01

    Type I interferons (including IFNαβ) are innate cytokines that may contribute to pathogenesis during Mycobacterium tuberculosis (Mtb) infection. To induce IFNβ, Mtb must gain access to the host cytosol and trigger stimulator of interferon genes (STING) signaling. A recently proposed model suggests that Mtb triggers STING signaling through bacterial DNA binding cyclic GMP-AMP synthase (cGAS) in the cytosol. The aim of this study was to test the generalizability of this model using phylogenetically distinct strains of the Mtb complex (MTBC). We infected bone marrow derived macrophages with strains from MTBC Lineages 2, 4 and 6. We found that the Lineage 6 strain induced less IFNβ, and that the Lineage 2 strain induced more IFNβ, than the Lineage 4 strain. The strains did not differ in their access to the host cytosol and IFNβ induction by each strain required both STING and cGAS. We also found that the three strains shed similar amounts of bacterial DNA. Interestingly, we found that the Lineage 6 strain was associated with less mitochondrial stress and less mitochondrial DNA (mtDNA) in the cytosol compared with the Lineage 4 strain. Treating macrophages with a mitochondria-specific antioxidant reduced cytosolic mtDNA and inhibited IFNβ induction by the Lineage 2 and 4 strains. We also found that the Lineage 2 strain did not induce more mitochondrial stress than the Lineage 4 strain, suggesting that additional pathways contribute to higher IFNβ induction. These results indicate that the mechanism for IFNβ by Mtb is more complex than the established model suggests. We show that mitochondrial dynamics and mtDNA contribute to IFNβ induction by Mtb. Moreover, we show that the contribution of mtDNA to the IFNβ response varies by MTBC strain and that additional mechanisms exist for Mtb to induce IFNβ. PMID:27500737

  16. Increasing viscosity and yields of bacterial exopolysaccharides by repeatedly exposing strains to ampicillin.

    PubMed

    Li, Ou; Liu, Ao; Lu, Cui; Zheng, Dao-qiong; Qian, Chao-dong; Wang, Pin-Mei; Jiang, Xin-Hang; Wu, Xue-Chang

    2014-09-22

    A universal method to enhance productivity and viscosity of bacterial exopolysaccharides was developed. The technique was based on the principle that ampicillin can inhibit the biosynthesis of peptidoglycan, which shares a common synthetic pathway with that of bacterial exopolysaccharides. Serial passages of three typical representatives of bacterial EPS-producing strains, namely Sphingomonas elodea, Xanthomonas campestris, and Paenibacillus elgii, were subjected to ampicillin, which was used as a stressor and a mutagen. These mutant strains are advantageous over other strains because of two major factors. First, all of the resulting strains were almost mutants with increase in EPS productivity and viscosity. Second, isolated serial strains showed different levels of increase in EPS production and viscosity to satisfy the different requirements of practical applications. No differences were observed in the monosaccharide composition produced by the mutant and parent strains; however, high-viscosity mutant strains exhibited higher molecular weights. The results confirmed that the developed method is a controlled universal one that can improve exopolysaccharides productivity and viscosity.

  17. Influence of temperature, oxygen and bacterial strain identity on the association of Campylobacter jejuni with Acanthamoeba castellanii.

    PubMed

    Baré, Julie; Sabbe, Koen; Huws, Sharon; Vercauteren, Dries; Braeckmans, Kevin; van Gremberghe, Ineke; Favoreel, Herman; Houf, Kurt

    2010-11-01

    Campylobacteriosis is the most frequently reported foodborne disease in the industrialized world, mainly through consumption of contaminated chicken meat. To date, no information is available on the primary infection sources of poultry. In this study, the ability of five Campylobacter jejuni strains with different invasion potential towards Caco-2 cells to survive and replicate in the protozoan Acanthamoeba castellanii was tested under simulated in situ conditions (i.e. chicken broiler houses). Results indicate that environmental conditions play a crucial role in C. jejuni-A. castellanii interactions. Co-culture in general did not result in an increase of either bacteria or amoebae. However, co-culture with Acanthamoeba did result in a delayed decline and an increased long-term survival of Campylobacter. Bacterial strain-specific effects were observed, with higher survival rates for low-invasive strains. The presence of C. jejuni in general did not affect A. castellanii viability, except at 37 °C under microaerobic conditions, where the presence of the reference and low-invasive Campylobacter strains resulted in a significant decline in amoebal viability. Confocal laser scanning microscopy revealed that intra-amoebal campylobacters were not always colocated with acidic organelles, suggesting potential bacterial interference with digestive processes. As Acanthamoeba enhances the persistence of C. jejuni, the presence of the amoeba in broiler house environments may have important implications for the ecology and epidemiology of this food pathogen. PMID:20722733

  18. Pilot Screening to Determine Antimicrobial Synergies in a Multidrug-Resistant Bacterial Strain Library

    PubMed Central

    Kim, Si-Hyun; Park, Chulmin; Chun, Hye-Sun; Choi, Jae-Ki; Lee, Hyo-Jin; Cho, Sung-Yeon; Park, Sun Hee; Choi, Su-Mi; Choi, Jung-Hyun; Yoo, Jin-Hong

    2016-01-01

    With the rise in multidrug-resistant (MDR) bacterial infections, there has been increasing interest in combinations of ≥2 antimicrobial agents with synergistic effects. We established an MDR bacterial strain library to screen for in vitro antimicrobial synergy by using a broth microdilution checkerboard method and high-throughput luciferase-based bacterial cell viability assay. In total, 39 MDR bacterial strains, including 23 carbapenem-resistant gram-negative bacteria, 9 vancomycin-intermediate Staphylococcus aureus, and 7 vancomycin-resistant Enterococcus faecalis, were used to screen for potential antimicrobial synergies. Synergies were more frequently identified with combinations of imipenem plus trimethoprim–sulfamethoxazole for carbapenem-resistant Acinetobacter baumannii in the library. To verify this finding, we tested 34 A. baumannii clinical isolates resistant to both imipenem and trimethoprim–sulfamethoxazole by the checkerboard method. The imipenem plus trimethoprim–sulfamethoxazole combination showed synergy in the treatment of 21 (62%) of the clinical isolates. The results indicate that pilot screening for antimicrobial synergy in the MDR bacterial strain library could be valuable in the selection of combination therapeutic regimens to treat MDR bacterial infections. Further studies are warranted to determine whether this screening system can be useful to screen for the combined effects of conventional antimicrobials and new-generation antimicrobials or nonantimicrobials. PMID:26974861

  19. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors

    PubMed Central

    Getino, María; Fernández-López, Raúl; Palencia-Gándara, Carolina; Campos-Gómez, Javier; Sánchez-López, Jose M.; Martínez, Marta; Fernández, Antonio; de la Cruz, Fernando

    2016-01-01

    Bacterial conjugation is the main mechanism for the dissemination of multiple antibiotic resistance in human pathogens. This dissemination could be controlled by molecules that interfere with the conjugation process. A search for conjugation inhibitors among a collection of 1,632 natural compounds, identified tanzawaic acids A and B as best hits. They specially inhibited IncW and IncFII conjugative systems, including plasmids mobilized by them. Plasmids belonging to IncFI, IncI, IncL/M, IncX and IncH incompatibility groups were targeted to a lesser extent, whereas IncN and IncP plasmids were unaffected. Tanzawaic acids showed reduced toxicity in bacterial, fungal or human cells, when compared to synthetic conjugation inhibitors, opening the possibility of their deployment in complex environments, including natural settings relevant for antibiotic resistance dissemination. PMID:26812051

  20. Recent advances in inhibitors of bacterial fatty acid synthesis type II (FASII) system enzymes as potential antibacterial agents.

    PubMed

    Wang, Yi; Ma, Shutao

    2013-10-01

    Bacterial infections are a constant and serious threat to human health. With the increase of multidrug resistance of clinically pathogenic bacteria, common antibiotic therapies have been less effective. Fatty acid synthesis type II (FASII) system enzymes are essential for bacterial membrane lipid biosynthesis and represent increasingly promising targets for the discovery of antibacterial agents with new mechanisms of action. This review highlights recent advances in inhibitors of bacterial FASII as potential antibacterial agents, paying special attention to the activities, mechanisms, and structure-activity relationships of those inhibitors that mainly target β-ketoacyl-ACP synthase, β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydratase, and enoyl-ACP reductase. Although inhibitors with low nanomolar and selective activity against various bacterial FASII have entered clinical trials, further research is needed to expand upon both available and yet unknown scaffolds to identify new FASII inhibitors that may have antibacterial potential, particularly against resistant bacterial strains.

  1. Simultaneous production of acetic and gluconic acids by a thermotolerant Acetobacter strain during acetous fermentation in a bioreactor.

    PubMed

    Mounir, Majid; Shafiei, Rasoul; Zarmehrkhorshid, Raziyeh; Hamouda, Allal; Ismaili Alaoui, Mustapha; Thonart, Philippe

    2016-02-01

    The activity of bacterial strains significantly influences the quality and the taste of vinegar. Previous studies of acetic acid bacteria have primarily focused on the ability of bacterial strains to produce high amounts of acetic acid. However, few studies have examined the production of gluconic acid during acetous fermentation at high temperatures. The production of vinegar at high temperatures by two strains of acetic acid bacteria isolated from apple and cactus fruits, namely AF01 and CV01, respectively, was evaluated in this study. The simultaneous production of gluconic and acetic acids was also examined in this study. Biochemical and molecular identification based on a 16s rDNA sequence analysis confirmed that these strains can be classified as Acetobacter pasteurianus. To assess the ability of the isolated strains to grow and produce acetic acid and gluconic acid at high temperatures, a semi-continuous fermentation was performed in a 20-L bioreactor. The two strains abundantly grew at a high temperature (41°C). At the end of the fermentation, the AF01 and CV01 strains yielded acetic acid concentrations of 7.64% (w/v) and 10.08% (w/v), respectively. Interestingly, CV01 was able to simultaneously produce acetic and gluconic acids during acetic fermentation, whereas AF01 mainly produced acetic acid. In addition, CV01 was less sensitive to ethanol depletion during semi-continuous fermentation. Finally, the enzymatic study showed that the two strains exhibited high ADH and ALDH enzyme activity at 38°C compared with the mesophilic reference strain LMG 1632, which was significantly susceptible to thermal inactivation. PMID:26253254

  2. Simultaneous production of acetic and gluconic acids by a thermotolerant Acetobacter strain during acetous fermentation in a bioreactor.

    PubMed

    Mounir, Majid; Shafiei, Rasoul; Zarmehrkhorshid, Raziyeh; Hamouda, Allal; Ismaili Alaoui, Mustapha; Thonart, Philippe

    2016-02-01

    The activity of bacterial strains significantly influences the quality and the taste of vinegar. Previous studies of acetic acid bacteria have primarily focused on the ability of bacterial strains to produce high amounts of acetic acid. However, few studies have examined the production of gluconic acid during acetous fermentation at high temperatures. The production of vinegar at high temperatures by two strains of acetic acid bacteria isolated from apple and cactus fruits, namely AF01 and CV01, respectively, was evaluated in this study. The simultaneous production of gluconic and acetic acids was also examined in this study. Biochemical and molecular identification based on a 16s rDNA sequence analysis confirmed that these strains can be classified as Acetobacter pasteurianus. To assess the ability of the isolated strains to grow and produce acetic acid and gluconic acid at high temperatures, a semi-continuous fermentation was performed in a 20-L bioreactor. The two strains abundantly grew at a high temperature (41°C). At the end of the fermentation, the AF01 and CV01 strains yielded acetic acid concentrations of 7.64% (w/v) and 10.08% (w/v), respectively. Interestingly, CV01 was able to simultaneously produce acetic and gluconic acids during acetic fermentation, whereas AF01 mainly produced acetic acid. In addition, CV01 was less sensitive to ethanol depletion during semi-continuous fermentation. Finally, the enzymatic study showed that the two strains exhibited high ADH and ALDH enzyme activity at 38°C compared with the mesophilic reference strain LMG 1632, which was significantly susceptible to thermal inactivation.

  3. Biochemical diversity of the bacterial strains and their biopolymer producing capabilities in wastewater sludge.

    PubMed

    More, T T; Yan, S; John, R P; Tyagi, R D; Surampalli, R Y

    2012-10-01

    The biochemical characterization of 13 extracellular polymeric substances (EPS) producing bacterial strains were carried out by BIOLOG. The bacterial strains were cultured in sterilized sludge for EPS production. Flocculation and dewatering capabilities of produced EPS (broth, crude slime and capsular) were examined using kaolin suspension combined with calcium (150 mg of Ca(2+)/L of kaolin suspension). BIOLOG revealed that there were 9 Bacillus, 2 Serratia and 2 Yersinia species. Most of these bacterial strains had the capability to utilize wide spectrum of carbon and nitrogen sources. EPS concentration of more than 1g/L was produced by most of the bacterial strains. Concentration of EPS produced by different Bacillus strains was higher than that of Serratia and Yersinia. Broth EPS revealed flocculation activity more than 75% for Bacillus sp.7, Bacillus sp.4 and Bacillus sp.6, respectively. Flocculation activity higher than 75% was attained using very low concentrations of broth EPS (1.12-2.70 mg EPS/g SS).

  4. Transport processes and mutual interactions of three bacterial strains in saturated porous media

    NASA Astrophysics Data System (ADS)

    Stumpp, Christine; Lawrence, John R.; Hendry, M. Jim; Maloszewski, Pitor

    2010-05-01

    Transport processes of the bacterial strains Klebsiella oxytoca, Burkholderia cepacia G4PR-1 and Pseudomonas sp #5 were investigated in saturated column experiments to study the differences in transport characteristics and the mutual interactions of these strains during transport. Soil column experiments (114 mm long x 33 mm in diameter) were conducted with constant water velocities (3.9-5.7 cm/h) through a medium to coarse grained silica sand. All experiments were performed in freshly packed columns in quadruplicate. Chloride was used as tracer to determine the mean transit time, dispersivity and flow rate. It was injected as a pulse into the columns together with the bacterial strains suspended in artificial groundwater medium. In the first setup, each strain was investigated alone. In the second setup, transport processes were performed injecting two strains simultaneously. Finally, the transport characteristics were studied in successive experiments when one bacterium was resident on the sand grains prior to the introduction of the second strain. In all experiments the peak C/Co bacterial concentrations were attenuated with respect to the conservative tracer chloride and a well defined tailing was observed. A one dimensional mathematical model for advective-dispersive transport that accounts for irreversible and reversible sorption was used to analyze the bacterial breakthrough curves and tailing patterns. It was shown that the sorption parameters were different for the three strains that can be explained by the properties of the bacteria. For the species Klebsiella oxytoca and Burkholderia cepacia G4PR-the transport parameters were mostly in the same range independent of the experimental setup. However, Pseudomonas sp #5, which is a motile bacterium, showed differences in the breakthrough curves and sorption parameters during the experiments. The simultaneous and successive experiments indicated an influence on the reversible sorption processes when another

  5. Biodegradation of organochlorine pesticide endosulfan by bacterial strain Alcaligenes faecalis JBW4.

    PubMed

    Kong, Lingfen; Zhu, Shaoyuan; Zhu, Lusheng; Xie, Hui; Su, Kunchang; Yan, Tongxiang; Wang, Jun; Wang, Jinhua; Wang, Fenghua; Sun, Fengxia

    2013-11-01

    The recently discovered endosulfan-degrading bacterial strain Alcaligenesfaecalis JBW4 was isolated from activated sludge. This strain is able to use endosulfan as a carbon and energy source. The optimal conditions for the growth of strain JBW4 and for biodegradation by this strain were identified, and the metabolic products of endosulfan degradation were studied in detail. The maximum level of endosulfan biodegradation by strain JBW4 was obtained using broth at an initial pH of 7.0, an incubation temperature of 40 degreeC and an endosulfan concentration of 100 mg/L. The concentration of endosulfan was determined by gas chromatography. Strain JBW4 was able to degrade 87.5% of alpha-endosulfan and 83.9% of beta-endosulfan within 5 days. These degradation rates are much higher than the previously reported bacterial strains. Endosulfan diol and endosulfan lactone were the major metabolites detected by gas chromatography-mass spectrometry; endosulfan sulfate, which is a persistent and toxic metabolite, was not detected. These results suggested that A. faecalis JBW4 degrades endosulfan via a non-oxidative pathway. The biodegradation of endosulfan by A. faecalis is reported for the first time. Additionally, the present study indicates that strain JBW4 may have potential for the biodegradation of endosulfan residues.

  6. Interactions between Closely Related Bacterial Strains Are Revealed by Deep Transcriptome Sequencing

    PubMed Central

    González-Torres, Pedro; Pryszcz, Leszek P.; Santos, Fernando; Martínez-García, Manuel

    2015-01-01

    Comparative genomics, metagenomics, and single-cell technologies have shown that populations of microbial species encompass assemblages of closely related strains. This raises the question of whether individual bacterial lineages respond to the presence of their close relatives by modifying their gene expression or, instead, whether assemblages simply act as the arithmetic addition of their individual components. Here, we took advantage of transcriptome sequencing to address this question. For this, we analyzed the transcriptomes of two closely related strains of the extremely halophilic bacterium Salinibacter ruber grown axenically and in coculture. These organisms dominate bacterial assemblages in hypersaline environments worldwide. The strains used here cooccurred in the natural environment and are 100% identical in their 16S rRNA genes, and each strain harbors an accessory genome representing 10% of its complete genome. Overall, transcriptomic patterns from pure cultures were very similar for both strains. Expression was detected along practically the whole genome albeit with some genes at low levels. A subset of genes was very highly expressed in both strains, including genes coding for the light-driven proton pump xanthorhodopsin, genes involved in the stress response, and genes coding for transcriptional regulators. Expression differences between pure cultures affected mainly genes involved in environmental sensing. When the strains were grown in coculture, there was a modest but significant change in their individual transcription patterns compared to those in pure culture. Each strain sensed the presence of the other and responded in a specific manner, which points to fine intraspecific transcriptomic modulation. PMID:26431969

  7. Bacterial delta-aminolevulinic acid synthase activity is not essential for leghemoglobin formation in the soybean/Bradyrhizobium japonicum symbiosis

    SciTech Connect

    Guerinot, M.L.; Chelm, B.K.

    1986-03-01

    Previous studies of legume nodules have indicated that formation of the heme moiety of leghemoglobin is a function of the bacterial symbiont. The authors now show that a hemA mutant of Bradyrhizobium japonicum that cannot carry out the first step in heme biosynthesis forms fully effective nodules on soybeans. The bacterial mutant strain was constructed by first isolated the wild-type hemA gene encoding delta-aminolevulinic acid synthase (EC 2.3.1.37) from a cosmid library, using a fragment of the Rhizobium meliloti hemA gene as a hybridization probe. A deletion of the hemA gene region, generated in vitro, then was used to construct the analogous chromosomal mutation by gene-directed mutagenesis. The mutant strain had no delta-aminolevulinic acid synthase activity and was unable to grow in minimal medium unless delta-aminolevulinic acid was added. Despite its auxotrophy, the mutant strain incited nodules that appeared normal, contained heme, and were capable of high levels of acetylene reduction. These results rule out bacterial delta-aminolevulinic acid synthase activity as the exclusive source of delta-aminolevulinic acid for heme formation in soybean nodules.

  8. Use of bacterial extracts to enhance amino acid breakdown in dry fermented sausages.

    PubMed

    Herranz, B; Fernández, M; de la Hoz, L; Ordóñez, J A

    2006-02-01

    The effect of the intracellular cell-free extracts (ICFEs) of two bacterial strains (Lactobacillus sakei GO and Bacillus pumilus) on the amino acid catabolism and the sensory properties of dry fermented sausages, was investigated. Extracts were added to sausages alone or in combination with a protease, papain. Amino acid breakdown was monitored by the changes in free amino acids, ammonia and amine content during the ripening process. A 15% decrease in the content of free amino acids was observed in sausages added with the ICFE from L. sakei GO. Furthermore, the extract of L. sakei GO significantly reduced (54-68%) the content of the amino acids considered as precursors of the typical ripened flavour, i.e., valine, leucine and isoleucine. Chemical changes were not reflected in a significant improvement of the sensory quality of sausages added with the ICFEs. The potential use of the bacterial ICFEs studied in the present work for the manufacture of dry fermented sausages, and its comparison with the use of fungal extracts, are discussed. PMID:22061560

  9. Draft genome sequence of XANTHOMONAS ARBORICOLA strain 3004, causal agent of bacterial disease on barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report here the annotated genome sequence of XANTHOMONAS ARBORICOLA str. 3004, a Gram-negative phytopathogenic bacteria that includes several pathovars characterized by virulence specificity. Strain 3004 was isolated from barley leaves with symptoms of streak (bacterial blight) and also can infec...

  10. Complete Genome Sequence of a Human Cytomegalovirus Strain AD169 Bacterial Artificial Chromosome Clone

    PubMed Central

    Ostermann, Eleonore; Spohn, Michael; Indenbirken, Daniela

    2016-01-01

    The complete sequence of the human cytomegalovirus strain AD169 (variant ATCC) cloned as a bacterial artificial chromosome (AD169-BAC, also known as HB15 or pHB15) was determined. The viral genome has a length of 230,290 bp and shows 52 nucleotide differences compared to a previously sequenced AD169varATCC clone. PMID:27034483

  11. 'Olegusella massiliensis' strain KHD7, a new bacterial genus isolated from the female genital tract.

    PubMed

    Diop, K; Diop, A; Raoult, D; Fournier, P-E; Fenollar, F

    2016-07-01

    We report the main characteristics of 'Olegusella massiliensis' gen. nov., sp. nov., strain KHD7 (= CSUR P2268 = DSM 101849), a new member of the Coriobacteriaceae family isolated from the vaginal flora of a patient with bacterial vaginosis. PMID:27330814

  12. 'Lascolabacter vaginalis' strain KHD1, a new bacterial species cultivated from human female genital tract.

    PubMed

    Diop, K; Mediannikov, O; Fournier, P-E; Raoult, D; Bretelle, F; Fenollar, F

    2016-09-01

    We present the major characteristics of 'Lascolabacter vaginalis' strain KHD1 (= CSUR P0109 = DSM 101752), a new member of the family Prevotellaceae that was cultivated from a vaginal sample of a 33-year-old woman with bacterial vaginosis. PMID:27358744

  13. Triacetic acid lactone production in industrial Saccharomyces yeast strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...

  14. Metabolomic characterization of halophilic bacterial isolates reveals strains synthesizing rare diaminoacids under salt stress.

    PubMed

    Joghee, Nidhya Nadarajan; Jayaraman, Gurunathan

    2014-07-01

    Metabolomics-based approaches to study stress responses in bacteria have received much attention in recent years. In the present study, a metabolomic analysis of the representative halophilic bacterial isolates (Halomonas hydrothermalis VITP9, Bacillus aquimaris VITP4, Planococcus maritimus VITP21 and Virgibacillus dokdonensis VITP14) from a saltern region in India was performed using nuclear magnetic resonance spectroscopy. Chemometric analysis of (1)H NMR spectra revealed salt-dependent increase in the levels of metabolites, mainly from the aspartate and glutamate family, that are directed from the glycolytic pathway, pentose phosphate pathway and citric acid cycle. The composition of the metabolites was found to be different with respect to the species and the type of growth medium. Analysis of the two dimensional NMR data revealed accumulation of two rare diaminoacids, Nε-acetyl-α-lysine and Nδ-acetylornithine (by VITP21 and VITP4 strains respectively) apart from other well known solutes such as ectoine, proline, glutamate and glycine betaine. Metabolite profiles of strains capable of synthesizing Nε-acetyl-α-lysine and Nδ-acetylornithine suggested their biosynthesis from lysine and ornithine using aspartate and glutamate as their precursors, respectively. Further, the cells in moderate salinity (5% w/v NaCl) showed an increase in growth rate along with increase in the levels of nucleotides, whereas at higher salinity (10% w/v NaCl), the levels of aromatic and hydrophobic metabolites dropped, accompanied with a decrease in growth rate, rightly suggesting that at any salt-stress condition provided, cellular homeostasis was favored over growth. PMID:24636996

  15. Biodegradation of Ochratoxin A by Bacterial Strains Isolated from Vineyard Soils

    PubMed Central

    De Bellis, Palmira; Tristezza, Mariana; Haidukowski, Miriam; Fanelli, Francesca; Sisto, Angelo; Mulè, Giuseppina; Grieco, Francesco

    2015-01-01

    Ochratoxin A (OTA) is a mycotoxin with a main nephrotoxic activity contaminating several foodstuffs. In the present report, five soil samples collected from OTA-contaminated vineyards were screened to isolate microorganisms able to biodegrade OTA. When cultivated in OTA-supplemented medium, OTA was converted in OTα by 225 bacterial isolates. To reveal clonal relationships between isolates, molecular typing by using an automated rep-PCR system was carried out, thus showing the presence of 27 different strains (rep-PCR profiles). The 16S-rRNA gene sequence analysis of an isolate representative of each rep-PCR profiles indicated that they belonged to five bacterial genera, namely Pseudomonas, Leclercia, Pantoea, Enterobacter, and Acinetobacter. However, further evaluation of OTA-degrading activity by the 27 strains revealed that only Acinetobacter calcoaceticus strain 396.1 and Acinetobacter sp. strain neg1, consistently conserved the above property; their further characterization showed that they were able to convert 82% and 91% OTA into OTα in six days at 24 °C, respectively. The presence of OTα, as the unique OTA-degradation product was confirmed by LC-HRMS. This is the first report on OTA biodegradation by bacterial strains isolated from agricultural soils and carried out under aerobic conditions and moderate temperatures. These microorganisms might be used to detoxify OTA-contaminated feed and could be a new source of gene(s) for the development of a novel enzymatic detoxification system. PMID:26633497

  16. Biodegradation of Ochratoxin A by Bacterial Strains Isolated from Vineyard Soils.

    PubMed

    De Bellis, Palmira; Tristezza, Mariana; Haidukowski, Miriam; Fanelli, Francesca; Sisto, Angelo; Mulè, Giuseppina; Grieco, Francesco

    2015-12-01

    Ochratoxin A (OTA) is a mycotoxin with a main nephrotoxic activity contaminating several foodstuffs. In the present report, five soil samples collected from OTA-contaminated vineyards were screened to isolate microorganisms able to biodegrade OTA. When cultivated in OTA-supplemented medium, OTA was converted in OTα by 225 bacterial isolates. To reveal clonal relationships between isolates, molecular typing by using an automated rep-PCR system was carried out, thus showing the presence of 27 different strains (rep-PCR profiles). The 16S-rRNA gene sequence analysis of an isolate representative of each rep-PCR profiles indicated that they belonged to five bacterial genera, namely Pseudomonas, Leclercia, Pantoea, Enterobacter, and Acinetobacter. However, further evaluation of OTA-degrading activity by the 27 strains revealed that only Acinetobacter calcoaceticus strain 396.1 and Acinetobacter sp. strain neg1, consistently conserved the above property; their further characterization showed that they were able to convert 82% and 91% OTA into OTα in six days at 24 °C, respectively. The presence of OTα, as the unique OTA-degradation product was confirmed by LC-HRMS. This is the first report on OTA biodegradation by bacterial strains isolated from agricultural soils and carried out under aerobic conditions and moderate temperatures. These microorganisms might be used to detoxify OTA-contaminated feed and could be a new source of gene(s) for the development of a novel enzymatic detoxification system. PMID:26633497

  17. Pyroprinting: a rapid and flexible genotypic fingerprinting method for typing bacterial strains.

    PubMed

    Black, Michael W; VanderKelen, Jennifer; Montana, Aldrin; Dekhtyar, Alexander; Neal, Emily; Goodman, Anya; Kitts, Christopher L

    2014-10-01

    Bacterial strain typing is commonly employed in studies involving epidemiology, population ecology, and microbial source tracking to identify sources of fecal contamination. Methods for differentiating strains generally use either a collection of phenotypic traits or rely on some interrogation of the bacterial genotype. This report introduces pyroprinting, a novel genotypic strain typing method that is rapid, inexpensive, and discriminating compared to the most sensitive methods already in use. Pyroprinting relies on the simultaneous pyrosequencing of polymorphic multicopy loci, such as the intergenic transcribed spacer regions of rRNA operons in bacterial genomes. Data generated by sequencing combinations of variable templates are reproducible and intrinsically digitized. The theory and development of pyroprinting in Escherichia coli, including the selection of similarity thresholds to define matches between isolates, are presented. The pyroprint-based strain differentiation limits and phylogenetic relevance compared to other typing methods are also explored. Pyroprinting is unique in its simplicity and, paradoxically, in its intrinsic complexity. This new approach serves as an excellent alternative to more cumbersome or less phylogenetically relevant strain typing methods.

  18. Detection of ureolytic activity of bacterial strains isolated from entomopathogenic nematodes using infrared spectroscopy.

    PubMed

    Lechowicz, Lukasz; Chrapek, Magdalena; Czerwonka, Grzegorz; Korzeniowska-Kowal, Agnieszka; Tobiasz, Anna; Urbaniak, Mariusz; Matuska-Lyzwa, Joanna; Kaca, Wieslaw

    2016-08-01

    The pathogenicity of entomopathogenic nematodes (EPNs) depends directly on the presence of bacteria in the nematode digestive tracts. Based on 16S rRNA and MALDI-TOF analyses 20 isolated bacteria were assigned to 10 species with 10 isolates classified as Pseudomonas ssp. Six strains (30%) show ureolytic activity on Christensen medium. Spectroscopic analysis of the strains showed that the ureolytic activity is strongly correlated with the following wavenumbers: 935 cm(-1) in window W4, which carries information about the bacterial cell wall construction and 1158 cm(-1) in window W3 which corresponds to proteins in bacterial cell. A logistic regression model designed on the basis of the selected wavenumbers differentiates ureolytic from non-ureolytic bacterial strains with an accuracy of 100%. Spectroscopic studies and mathematical analyses made it possible to differentiate EPN-associated Pseudomonas sp. strains from clinical Pseudomonas aeruginosa PAO1. These results suggest, that infrared spectra of EPN-associated Pseudomonas sp. strains may reflect its adaptation to the host. PMID:26972384

  19. Isolation and characterization of a novel bacterial strain Shewanella marinisediminis sp. nov. from deep-sea sediments.

    PubMed

    Kim, Young Sug; Park, Jin-Soo; Yang, Hyun Ok; Kwon, Hak Cheol

    2013-05-01

    A new bacterial strain designated DH39T was isolated from marine sediment collected from the East Sea, Korea. Phylogenetic analysis using the 16S rRNA gene sequence revealed that strain DH39(T) clustered with the genus Shewanella and is closely related to Shewanella canadensis HAW-EB2(T), S. woodyi MS32(T), and S. sediminis HAW-EB3(T) with 98.1, 97.8, and 97.6% sequence similarities, respectively. The isolated bacterium was Gram-negative, rod-shaped, and aerobic. Its temperature range for growth was 4-30 degrees C. The predominant fatty acids were 16:1omega7, 17:1omega8, 13:0-i, 16:0, and 15:0-i. The DNA G+C content was 45.0 mol%. DNA-DNA hybridization analysis showed that DNA-DNA relatedness values in the 165 rRNA phylogenetic tree of strain DH39(T) and its nearest neighbors S. hanedai and S. sediminis were 52.9 and 58.7%. Phylogenetic evidence and phenotypic characteristics suggest strain DH39(T) constitutes a novel Shewanella species. Therefore, we propose Shewanella marinisediminis sp. nov., with DH39(T) (KCCM 42936(T) = NCCB 100311(T)) as the type strain.

  20. [Isolation and characteristics of Panax ginseng autotoxin-degrading bacterial strains].

    PubMed

    Zhao, Dong-Yue; Li, Yong; Ding, Wan-Long

    2013-06-01

    In this study, traditional plate culturing method was used to isolate autotoxin-degrading microbial strains, and which were then identified by 16S rDNA homological analysis and morphological characteristics. Furthermore, the growth and autotoxin-degrading efficiency of them were analyzed by liquid culturing method and GC-MS to illustrate their autotoxin-degradation characteristics. As a result, five bacterial strains having autotoxin-degrading activity were isolated from 6-years ginseng nonrhizospheric soil successfully, and which can growth successfully by taking autotoxins added artificially as carbon source in liquid culturing condition. Results indicated that it was feasible to isolate autotoxin-degrading bacteria from ginseng nonrhizospheric soil, and the isolated bacterial strains can be used to degrade autotoxins in soils once planted Panax ginseng.

  1. Isolation of a Bacterial Strain Able To Degrade Branched Nonylphenol

    PubMed Central

    Tanghe, Tom; Dhooge, Willem; Verstraete, Willy

    1999-01-01

    Conventional enrichment of microorganisms on branched nonylphenol (NP) as only carbon and energy source yielded mixed cultures able to grow on the organic compound. However, plating yielded no single colonies capable, alone or in combination with other isolates, of degrading the NP in liquid culture. Therefore, a special approach was used, referred to as “serial dilution-plate resuspension,” to reduce culture complexity. In this way, one isolate, TTNP3, tentatively identified as a Sphingomonas sp., was found to be able to grow on NP in liquid culture. Remarkably, this isolate was able to be filtered through a 0.45-μm-pore-diameter filter. Moreover, isolate TTNP3 did not form visible colonies on mineral medium with NP, and it formed visible colonies on R2A agar only after a prolonged incubation of 1 week. High-performance liquid chromatography and gas chromatography-mass spectroscopy analysis of the culture media indicated that the strain starts the degradation of NP with a fission of the phenol ring and preferably uses the para isomer of NP and not the ortho isomer. No distinct accumulation of an intermediary product could be observed. PMID:9925611

  2. Isolation and characteristics analysis of a novel high bacterial cellulose producing strain Gluconacetobacter intermedius CIs26.

    PubMed

    Yang, Ying; Jia, Jingjing; Xing, Jianrong; Chen, Jianbing; Lu, Shengmin

    2013-02-15

    A strain producing bacterial cellulose (BC) screened from rotten mandarin fruit was identified as Gluconacetobacter intermedius CIs26 by the examination of general taxonomical characteristics and 16S rDNA sequence analysis. Furthermore, Fourier transform infrared (FT-IR) spectrum showed that pellicle produced by strain CIs26 was composed of glucan, and had the same functional group as a typical BC. X-ray diffractometry (XRD) analysis indicated that the BC was type I in structure with crystallinity index of 75%. BC yields of strain CIs26 in Hestrin-Schramn (HS), citrus waste modified HS (CMHS) and citrus waste solution (CWS) mediums were 2.1 g/L, 5.7 g/L, and 7.2 g/L, respectively. It was shown that citrus waste could stimulate BC production of strain CIs26 efficiently. Based on the ability of utilization of citrus waste, this strain appeared to have potential in BC manufacture on an industrial scale.

  3. Isolation of phenazine 1,6-di-carboxylic acid from Pseudomonas aeruginosa strain HRW.1-S3 and its role in biofilm-mediated crude oil degradation and cytotoxicity against bacterial and cancer cells.

    PubMed

    Dasgupta, Debdeep; Kumar, Abhinash; Mukhopadhyay, Balaram; Sengupta, Tapas K

    2015-10-01

    Pseudomonas sp. has long been known for production of a wide range of secondary metabolites during late exponential and stationary phases of growth. Phenazine derivatives constitute a large group of secondary metabolites produced by microorganisms including Pseudomonas sp. Phenazine 1,6-di-carboxylic acid (PDC) is one of such metabolites and has been debated for its origin from Pseudomonas sp. The present study describes purification and characterization of PDC isolated from culture of a natural isolate of Pseudomonas sp. HRW.1-S3 while grown in presence of crude oil as sole carbon source. The isolated PDC was tested for its effect on biofilm formation by another environmental isolate of Pseudomonas sp. DSW.1-S4 which lacks the ability to produce any phenazine compound. PDC showed profound effect on both planktonic as well as biofilm mode of growth of DSW.1-S4 at concentrations between 5 and 20 μM. Interestingly, PDC showed substantial cytotoxicity against three cancer cell lines and against both Gram-positive and Gram-negative bacteria. Thus, the present study not only opens an avenue to understand interspecific cooperation between Pseudomonas species which may lead its applicability in bioremediation, but also it signifies the scope of future investigation on PDC for its therapeutic applications.

  4. Characterization and evaluation of Bacillus amyloliquefaciens strain WF02 regarding its biocontrol activities and genetic responses against bacterial wilt in two different resistant tomato cultivars.

    PubMed

    Huang, Chu-Ning; Lin, Chan-Pin; Hsieh, Feng-Chia; Lee, Sook-Kuan; Cheng, Kuan-Chen; Liu, Chi-Te

    2016-11-01

    Bacillus amyloliquefaciens strain WF02, isolated from soil collected at Wufeng Mountain, Taiwan, has siderophore-producing ability and in vitro antagonistic activity against bacterial wilt pathogen. To determine the impact of plant genotype on biocontrol effectiveness, we treated soil with this strain before infecting susceptible (L390) and moderately resistant (Micro-Tom) tomato cultivars with Ralstonia solanacearum strain Pss4. We also compared the efficacy of this strain with that of commercial Bacillus subtilis strain Y1336. Strain WF02 provided longer lasting protection against R. solanacearum than did strain Y1336 and controlled the development of wilt in both cultivars. To elucidate the genetic responses in these plants under WF02 treatment, we analyzed the temporal expression of defense-related genes in leaves. The salicylic acid pathway-related genes phenylalanine ammonia-lyase and pathogenesis-related protein 1a were up-regulated in both cultivars, whereas expression of the jasmonic acid pathway-related gene lipoxygenase was only elevated in the susceptible tomato cultivar (L390). These results suggest that WF02 can provide protection against bacterial wilt in tomato cultivars with different levels of disease resistance via direct and indirect modes of action. PMID:27646210

  5. Bacterial control on the structure of As-Fe oxy-hydroxides in acid mine drainage.

    NASA Astrophysics Data System (ADS)

    Morin, G.; Lebrun, S.; Juillot, F.; Casiot, C.; Bruneel, O.; Belin, S.; Proux, O.; Brown, G. E.; Guyot, F.; Calas, G.

    2004-12-01

    Nano-crystalline or amorphous iron oxy-hydroxides are kinetically favored with respect to stable crystalline phases in low temperature environments. Therefore, they frequently occur as transient phases in Earth's surface environments. They exhibit very-high surface areas (few 100 cm2/g) and thus play a key role in the geochemical cycles of minor and trace elements, including toxic elements as arsenic. Natural low-temperature iron oxides also potentially host biological signatures since they can form through various biologically driven reactions. In the present communication, we compare the mineralogy and crystal chemistry of biogenic As-rich iron precipitates synthesized using various acidophilic bacterial strain isolated from an exceptionally arsenic-rich acid mine drainage [1]. XAS, XRD, SEM and TEM investigation of these highly reactive nano-minerals obtained in controlled conditions allows to better constrain their mechanisms of formation. Our data show that the enzymatic oxidation of Fe(II) and/or As(III) play a key role in controlling the nature of the mineral species precipitating in acid mine drainage. We show that the nature of mineral species forming from solutions can be directly determined by the metabolic activity of specific bacterial strains. This influence is thought to be primarily indirect, bacteria controlling the rate of Fe(II) and As(III) oxidation reactions, which in turn leads to various Fe(III) and As(V) super-saturation conditions. These latter parameters are crucial in controlling the structure of nano-crystalline As-Fe low temperature minerals. 1- Morin et al. (2003) Bacterial formation of tooeleite and mixed As(III)/(V)-Fe(III) gels in the Carnoulès acid mine drainage, France. A XANES, XRD and SEM study. Environ. Sci. and Technol. 37,1705-1712.

  6. Strain typing of acetic acid bacteria responsible for vinegar production by the submerged elaboration method.

    PubMed

    Fernández-Pérez, Rocío; Torres, Carmen; Sanz, Susana; Ruiz-Larrea, Fernanda

    2010-12-01

    Strain typing of 103 acetic acid bacteria isolates from vinegars elaborated by the submerged method from ciders, wines and spirit ethanol, was carried on in this study. Two different molecular methods were utilised: pulsed field gel electrophoresis (PFGE) of total DNA digests with a number of restriction enzymes, and enterobacterial repetitive intergenic consensus (ERIC) - PCR analysis. The comparative study of both methods showed that restriction fragment PFGE of SpeI digests of total DNA was a suitable method for strain typing and for determining which strains were present in vinegar fermentations. Results showed that strains of the species Gluconacetobacter europaeus were the most frequent leader strains of fermentations by the submerged method in the studied vinegars, and among them strain R1 was the predominant one. Results showed as well that mixed populations (at least two different strains) occurred in vinegars from cider and wine, whereas unique strains were found in spirit vinegars, which offered the most stressing conditions for bacterial growth. PMID:20832673

  7. Characterization of rumen bacterial strains isolated from enrichments of rumen content in the presence of propolis.

    PubMed

    de Aguiar, Sílvia Cristina; Zeoula, Lucia Maria; do Prado, Odimari Pricila Pires; Arcuri, Pedro Braga; Forano, Evelyne

    2014-11-01

    Propolis presents many biological properties, including antibacterial activities, and has been proposed as an additive in ruminant nutrition. Twenty bacterial strains, previously isolated from enrichments of Brazilian cow rumen contents in the presence of different propolis extracts (LLOS), were characterized using phenotyping and 16S rRNA identification. Seven strains were assigned to Streptococcus sp., most likely S. bovis, and were all degrading starch. One amylolytic lactate-utilizing strain of Selenomonas ruminantium was also found. Two strains of Clostridium bifermentans were identified and showed proteolytic activity. Two strains were assigned to Mitsuokella jalaludinii and were saccharolytic. One strain belonged to a Bacillus species and seven strains were affiliated with Escherichia coli. All of the 20 strains were able to use many sugars, but none of them were able to degrade the polysaccharides carboxymethylcellulose and xylans. The effect of three propolis extracts (LLOS B1, C1 and C3) was tested on the in vitro growth of four representative isolates of S. bovis, E. coli, M. jalaludinii and C. bifermentans. The growth of S. bovis, E. coli and M. jalaludinii was not affected by the three propolis extracts at 1 mg ml(-1). C. bifermentans growth was completely inhibited at this LLOS concentration, but this bacterium was partially resistant at lower concentrations. LLOS C3, with the lower concentration of phenolic compounds, was a little less inhibitory than B1 and C1 on this strain.

  8. Induced drought tolerance through wild and mutant bacterial strain Pseudomonas simiae in mung bean (Vigna radiata L.).

    PubMed

    Kumari, Sarita; Vaishnav, Anukool; Jain, Shekhar; Varma, Ajit; Choudhary, Devendra Kumar

    2016-01-01

    The present study focused on the overproducing mutant of a plant growth promoting rhizobacterium (PGPR) Pseudomonas simiae strain AU (MTCC-12057) for significant drought tolerance in mung bean plants. Five mutants namely AU-M1, AU-M2, AU-M3, AU-M4 and AU-M5 were made after treatment of wild type strain with N-methyl-N-nitro-N-nitrosoguanidine. Mutant strain AU-M4 was recorded for enhanced ACC deaminase (ACC-D) activity, indole acetic acid (IAA) production and inorganic phosphate (Pi) solubilization compared to wild strain and other four mutant strains under drought condition. AU-M4 showed higher phosphate solubilization index (8.17) together with higher ACC-D activity (98 nmol/mg/h) and IAA concentration (69.35 µg/ml) compared with the wild type P. simiae strain AU ACC-D activity (79 nmol/mg/h) and IAA concentration (38.98 µg/ml) respectively. In this report, we investigated the effect of both wild and mutant type bacterial strain on mung bean plants under drought stress. Results showed that mutant AU-M4 and wild type strain AU inoculated plants exhibited superior tolerance against drought stress, as shown by their enhanced plant biomass (fresh weight), higher water content, higher proline accumulation and lower osmotic stress injury. Mutant AU-M4 and wild strain AU inoculated plants reduced the ethylene level by 59 and 45% respectively, compared to the control under stress condition. Furthermore, bacterial inoculated plants showed enhanced induced systemic drought tolerance by reducing stomata size and net photosynthesis resulting higher water content in mung bean plants that may help in survival of plants during drought condition. To mitigate the effects of drought stress, use of PGPR will be needed to ensure sufficient production of food from crop plants. Taking current leads available, concerted future research is needed in this area, particularly on field evaluation with application of potential microorganisms.

  9. Induced drought tolerance through wild and mutant bacterial strain Pseudomonas simiae in mung bean (Vigna radiata L.).

    PubMed

    Kumari, Sarita; Vaishnav, Anukool; Jain, Shekhar; Varma, Ajit; Choudhary, Devendra Kumar

    2016-01-01

    The present study focused on the overproducing mutant of a plant growth promoting rhizobacterium (PGPR) Pseudomonas simiae strain AU (MTCC-12057) for significant drought tolerance in mung bean plants. Five mutants namely AU-M1, AU-M2, AU-M3, AU-M4 and AU-M5 were made after treatment of wild type strain with N-methyl-N-nitro-N-nitrosoguanidine. Mutant strain AU-M4 was recorded for enhanced ACC deaminase (ACC-D) activity, indole acetic acid (IAA) production and inorganic phosphate (Pi) solubilization compared to wild strain and other four mutant strains under drought condition. AU-M4 showed higher phosphate solubilization index (8.17) together with higher ACC-D activity (98 nmol/mg/h) and IAA concentration (69.35 µg/ml) compared with the wild type P. simiae strain AU ACC-D activity (79 nmol/mg/h) and IAA concentration (38.98 µg/ml) respectively. In this report, we investigated the effect of both wild and mutant type bacterial strain on mung bean plants under drought stress. Results showed that mutant AU-M4 and wild type strain AU inoculated plants exhibited superior tolerance against drought stress, as shown by their enhanced plant biomass (fresh weight), higher water content, higher proline accumulation and lower osmotic stress injury. Mutant AU-M4 and wild strain AU inoculated plants reduced the ethylene level by 59 and 45% respectively, compared to the control under stress condition. Furthermore, bacterial inoculated plants showed enhanced induced systemic drought tolerance by reducing stomata size and net photosynthesis resulting higher water content in mung bean plants that may help in survival of plants during drought condition. To mitigate the effects of drought stress, use of PGPR will be needed to ensure sufficient production of food from crop plants. Taking current leads available, concerted future research is needed in this area, particularly on field evaluation with application of potential microorganisms. PMID:26712619

  10. Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco.

    PubMed

    Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Juergen

    2013-11-01

    Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance.

  11. The impact of bacterial strain on the products of dissimilatory iron reduction

    NASA Astrophysics Data System (ADS)

    Salas, Everett C.; Berelson, William M.; Hammond, Douglas E.; Kampf, Anthony R.; Nealson, Kenneth H.

    2010-01-01

    Three bacterial strains from the genus Shewanella were used to examine the influence of specific bacteria on the products of dissimilatory iron reduction. Strains CN32, MR-4 and W3-18-1 were incubated with HFO (hydrous ferric oxide) as the terminal electron acceptor and lactate as the organic carbon and energy source. Mineral products of iron reduction were analyzed using X-ray powder diffraction, electron microscopy, coulometry and susceptometry. Under identical nutrient loadings, iron reduction rates for strains CN32 and W3-18-1 were similar, and about twice as fast as MR-4. Qualitative and quantitative assessment of mineralized end products (secondary minerals) indicated that different products were formed during experiments with similar reduction rates but different strains (CN32 and W3-18-1), and similar products were formed during experiments with different iron reduction rates and different strains (CN32 and MR-4). The major product of iron reduction by strains CN32 and MR-4 was magnetite, while for W3-18-1 it was a mixture of magnetite and iron carbonate hydroxide hydrate (green rust), a precursor to fougerite. Another notable difference was that strains CN32 and MR-4 converted all of the starting ferric iron material into magnetite, while W3-18-1 did not convert most of the Fe 3+ into a recognizable crystalline material. Biofilm formation is more robust in W3-18-1 than in the other two strains used in this study. The differences in mineralization may be an indicator that EPS (or another cellular product from W3-18-1) may interfere with the crystallization of magnetite or facilitate formation of green rust. These results suggest that the relative abundance of mineral end products and the relative distribution of these products are strongly dependent on the bacterial species or strain catalyzing iron reduction.

  12. The Impact of Bacterial Strain on the Products of Dissimilatory Iron Reduction

    PubMed Central

    Salas, Everett C.; Berelson, William M.; Hammond, Douglas E.; Kampf, Anthony R.; Nealson, Kenneth H.

    2009-01-01

    Three bacterial strains from the genus Shewanella were used to examine the influence of specific bacteria on the products of dissimilatory iron reduction. Strains CN32, MR-4 and W3-18-1 were incubated with HFO (hydrous ferric oxide) as the terminal electron acceptor and lactate as the organic carbon and energy source. Mineral products of iron reduction were analyzed using X-ray powder diffraction, electron microscopy, coulometry and susceptometry. Under identical nutrient loadings, iron reduction rates for strains CN32 and W3-18-1 were similar, and about twice as fast as MR-4. Qualitative and quantitative assessment of mineralized end products (secondary minerals) indicated that different products were formed during experiments with similar reduction rates but different strains (CN32 and W3-18-1), and similar products were formed during experiments with different iron reduction rates and different strains (CN32 and MR-4). The major product of iron reduction by strains CN32 and MR-4 was magnetite, while for W3-18-1 it was a mixture of magnetite and iron carbonate hydroxide hydrate (green rust), a precursor to fougerite. Another notable difference was that strains CN32 and MR-4 converted all of the starting ferric iron material into magnetite, while W3-18-1 did not convert most of the Fe3+ into a recognizable crystalline material. Biofilm formation is more robust in W3-18-1 than in the other two strains used in this study. The differences in mineralization may be an indicator that EPS (or another cellular product from W3-18-1) may interfere with the crystallization of magnetite or facilitate formation of green rust. These results suggest that the relative abundance of mineral end products and the relative distribution of these products are strongly dependent on the bacterial species or strain catalyzing iron reduction. PMID:20161499

  13. ANItools web: a web tool for fast genome comparison within multiple bacterial strains

    PubMed Central

    Han, Na; Qiang, Yujun; Zhang, Wen

    2016-01-01

    Background: Early classification of prokaryotes was based solely on phenotypic similarities, but modern prokaryote characterization has been strongly influenced by advances in genetic methods. With the fast development of the sequencing technology, the ever increasing number of genomic sequences per species offers the possibility for developing distance determinations based on whole-genome information. The average nucleotide identity (ANI), calculated from pair-wise comparisons of all sequences shared between two given strains, has been proposed as the new metrics for bacterial species definition and classification. Results: In this study, we developed the web version of ANItools (http://ani.mypathogen.cn/), which helps users directly get ANI values from online sources. A database covering ANI values of any two strains in a genus was also included (2773 strains, 1487 species and 668 genera). Importantly, ANItools web can automatically run genome comparison between the input genomic sequence and data sequences (Genus and Species levels), and generate a graphical report for ANI calculation results. Conclusion: ANItools web is useful for defining the relationship between bacterial strains, further contributing to the classification and identification of bacterial species using genome data. Database URL: http://ani.mypathogen.cn/ PMID:27270714

  14. [Characterization of thermophilic strain SY-14 with capability to lyse bacterial cells].

    PubMed

    Song, Yu-dong; Hu, Hong-ying; Xi, Jin-ying

    2007-09-01

    One spore-forming thermophilic bacterial strain SY-14, isolated from sewage sludge compost, showed significant capability to lyse bacterial cells. The strain was identified as Geobacillus sp. based on morphological characteristics and homology identification of 16S rDNA sequence. The optimal temperature and pH for growth were about 60 degrees C and pH 6.0-7.0 respectively. The culture supernatant of SY-14 showed lytic activity against both intact and thermal inactivated bacterial cells, and the cell lysis percentages at 6 hours were 70% and 85% respectively. The lytic activity of the culture supernatant decreased significantly after heat treatment, which inferred the lytic activity mainly derived from extracellular lytic enzymes of SY-14. The lytic activity of the culture supernatants of SY-14 increased significantly during the log phase in the batch culture process, and then decreased quickly after the maximum activity was reached. The culture supernatant of SY-14 showed lytic activity against all the five tested Gram-negative strains and some tested Gram-positive strains.

  15. Selection and characterization of Cheonggukjang (fast fermented soybean paste)-originated bacterial strains with a high level of S-adenosyl-L-methionine production and probiotics efficacy.

    PubMed

    Park, Sunhyun; Kim, Min-Jeong; Hong, Jiyoung; Kim, Hyo-Jin; Yi, Sung-Hun; Lee, Myung-Ki

    2014-11-01

    This study was executed to develop probiotics producing S-adenosyl-L-methionine (SAMe), a methyl group donor in the 5-methyltetrahydrofolate methylation reaction in animal cells. SAMe is an essential substance in the synthesis, activation, and metabolism of hormones, neurotransmitters, nucleic acids, phospholipids, and cell membranes of animals. SAMe is also known as a nutritional supplement for improving human brain function. In this study, SAMe-producing strains were identified in six kinds of Cheonggukjang, and strains with excellent SAMe production were identified, with one strain in the Enterococcus genus and six strains in the Bacillus genus. Strains with a large amount of SAMe production included lactic acid bacteria, such as Enterococcus faecium, Enterococcus durans, and Enterococcus sanguinicola, as well as various strains in the Bacillus genus. The SAMe-overproducing strains showed antibacterial activity against some harmful microbes, in addition to weak acid resistance and strong bile resistance, indicating characteristics of probiotics. Cheonggukjang-originated beneficial bacterial strains overproducing SAMe may be commercially useful for manufacturing SAMe-rich foods.

  16. Amino Acid and Vitamin Requirements of Several Bacteroides Strains

    PubMed Central

    Quinto, Grace

    1966-01-01

    Nutritional studies were performed on nine Bacteroides strains, by use of the methodology and media of anaerobic rumen microbiology. Ristella perfoetens CCI required l-arginine hydrochloride, l-tryptophan, l-leucine, l-histidine hydrochloride, l-cysteine hydrochloride, dl-valine, dl-tyrosine, and the vitamin calcium-d-pantothenate, since scant turbidity developed in media without these nutrients. R. perfoetens was stimulated by glycine, dl-lysine hydrochloride, dl-isoleucine, l-proline, l-glutamic acid, dl-alanine, dl-phenylalanine, dl-methionine, and the vitamins nicotinamide and p-aminobenzoic acid, since maximal turbidity developed more slowly in media without these nutrients than in complete medium. Medium A-23, which was devised for R. perfoetens, contained salts, 0.0002% nicotinamide and calcium d-pantothenate, 0.00001% p-aminobenzoic acid, 0.044% l-tryptophan, 0.09% l-glutamic acid, and 0.1% of the other 13 amino acids listed above. Zuberella clostridiformis and seven strains of R. pseudoinsolita did not require vitamins, and showed no absolute requirement for any one amino acid. Various strains produced maximal turbidity more slowly in media deficient in l-proline, glycine, l-glutamic acid, dl-serine, l-histidine hydrochloride, dl-alanine, or l-cysteine hydrochloride, than in complete medium. These eight strains grew optimally in medium A-23 plus 0.1% dl-serine but without vitamins. PMID:16349673

  17. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family.

    PubMed

    Broussard, Tyler C; Miller, Darcie J; Jackson, Pamela; Nourse, Amanda; White, Stephen W; Rock, Charles O

    2016-03-18

    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

  18. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family.

    PubMed

    Broussard, Tyler C; Miller, Darcie J; Jackson, Pamela; Nourse, Amanda; White, Stephen W; Rock, Charles O

    2016-03-18

    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins.

  19. Isolation of two Pseudomonas strains producing pseudomonic acid A.

    PubMed

    Fritz, Eva; Fekete, Agnes; Lintelmann, Jutta; Schmitt-Kopplin, Philipe; Meckenstock, Rainer U

    2009-02-01

    Two novel Pseudomonas strains were isolated from groundwater sediment samples. The strains showed resistance against the antibiotics tetracycline, cephalothin, nisin, vancomycin, nalidixic acid, erythromycin, lincomycin, and penicillin and grew at temperatures between 15 and 37 degrees C and pH values from 4 to 10 with a maximum at pH 7 to 10. The 16S ribosomal RNA gene sequences and the substrate spectrum of the isolates revealed that the two strains belonged to the Pseudomonas fluorescens group. The supernatants of both strains had an antibiotic effect against Gram-positive bacteria and one Gram-negative strain. The effective substance was produced under standard cultivation conditions without special inducer molecules or special medium composition. The antibiotically active compound was identified as pseudomonic acid A by off-line high performance liquid chromatography (HPLC) and Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS). The measurement on ultra performance liquid chromatography (UPLC, UV-vis detection) confirmed the determination of pseudomonic acid A which was produced by both strains at 1.7-3.5mg/l. Our findings indicate that the ability to produce the antibiotic pseudomonic acid A (Mupirocin) is more spread among the pseudomonads then anticipated from the only producer known so far. PMID:19070447

  20. Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt

    PubMed Central

    2012-01-01

    In the present study, two of the most toxic bacterial strains of Bacillus sphaericus against mosquito were identified with the most recent genetic techniques. The PCR product profiles indicated the presence of genes encoding Bin A, Bin B and Mtx1 in all analyzed strains; they are consistent with protein profiles. The preliminary bioinformatics analysis of the binary toxin genes sequence revealed that the open reading frames had high similarities when matched with nucleotides sequence in the database of other B. sphaericus strains. The biological activity of B. sphaericus strains varied according to growing medium, and cultivation time. The highest yield of viable counts, spores and larvicidal protein were attained after 5 days. Poly (P) medium achieved the highest yield of growth, sporulation, protein and larvicidal activity for all tested strains compared to the other tested media. The larvicidal protein produced by local strains (B. sphaericus EMCC 1931 and EMCC 1932) in P medium was more lethal against the 3rd instar larvae of Culex pipiens than that of reference strains (B. sphaericus 1593 and B. sphaericus 2297). The obtained results revealed that P medium was the most effective medium and will be used in future work in order to optimize large scale production of biocide by the locally isolated Bacillus sphaericus strains. PMID:22280528

  1. Make Histri: reconstructing the exchange history of bacterial and archaeal type strains.

    PubMed

    Verslyppe, Bert; De Smet, Wim; De Baets, Bernard; De Vos, Paul; Dawyndt, Peter

    2011-07-01

    Each transfer of a microbial strain between a Biological Resource Center (BRC) and an individual researcher or another BRC imposes a risk of contamination or human error. Such artifacts jeopardize the quality of scientific results. In order to trace back possible scientific discrepancies that can be linked to failure of authenticity of the biological material involved, we launched the 'Make Histri' project that aims at reconstructing the exchange history ('Histri') of all bacterial and archaeal type strains as can be deduced from the information contained in BRC online catalogs. A Histri, visualized as a rooted tree, contains all known strain numbers attributed to the various cultures of a given strain, annotated with additional information about each transfer of microbial material. PMID:21514082

  2. Differential proteome analysis of a selected bacterial strain isolated from a high background radiation area in response to radium stress.

    PubMed

    Zakeri, Farideh; Sadeghizadeh, Majid; Kardan, Mohammad Reza; Shahbani Zahiri, Hossein; Ahmadian, Gholamreza; Masoumi, Fatemeh; Sharafi, Hakimeh; Rigi, Garshasb; Vali, Hojatollah; Akbari Noghabi, Kambiz

    2012-08-01

    The present study describes the response of a bacterial strain, isolated from a hot spring in an area with the highest levels of natural radiation, under radium ((226)Ra) stress. The bacterium has been characterized as a novel and efficient radium biosorbent and identified as a variant of Serratia marcescens by biochemical tests and molecular recognition. In order to gain insights into key cellular events that allow this strain to survive and undergo (226)Ra adaptation and biosorption, the strain was tested under two experimental conditions of 1000 and 6000 Bq (226)Ra stress. A proteomic approach involving two-dimensional polyacrylamide gel electrophoresis and mass spectrometry was used to identify the differentially expressed proteins under (226)Ra stress. Functional assessment of identified proteins with significantly altered expression levels revealed several mechanisms thought to be involved in (226)Ra adaptation and conferring resistant phenotype to the isolate, including general stress adaptation, anti-oxidative stress, protein and nucleic acid synthesis, energy metabolism, efflux and transport proteins. It suggests that this strain through evolution is particularly well adapted to the high background radiation environment and could represent an alternative source to remove (226)Ra from such areas as well as industrial radionuclide polluted wastewaters.

  3. Isolation and properties of a pure bacterial strain capable of fluorobenzene degradation as sole carbon and energy source.

    PubMed

    Carvalho, M F; Ferreira Jorge, R; Pacheco, C C; De Marco, P; Castro, P M L

    2005-02-01

    A pure bacterial strain capable of aerobic biodegradation of fluorobenzene (FB) as the sole carbon and energy source was isolated by selective enrichment from sediments collected from a polluted site. 16S rRNA and fatty acid analyses support that strain F11 belongs to a novel genus within the alpha-2 subgroup of the Proteobacteria, possibly within a new clade related to the order Rhizobiales. In batch cultures, growth of strain F11 on FB led to stoichiometric release of fluoride ion. Maximum experimental growth rate of 0.04 h-1 was obtained at FB concentration of 0.4 mM. Growth kinetics were described by the Luong model. An inhibitory effect with increasing FB concentrations was observed, with no growth occurring at concentrations higher than 3.9 mM. Strain F11 was shown to be able to use a range of other organic compounds, including other fluorinated compounds such as 2-fluorobenzoate, 4-fluorobenzoate and 4-fluorophenol. To our knowledge, this is the first time biodegradation of FB, as the sole carbon and energy source, by a pure bacterium has been reported. PMID:15658996

  4. Comparison of two multimetal resistant bacterial strains: Enterobacter sp. YSU and Stenotrophomonas maltophilia ORO2.

    PubMed

    Holmes, Andrew; Vinayak, Anubhav; Benton, Cherise; Esbenshade, Aaron; Heinselman, Carlisle; Frankland, Daniel; Kulkarni, Samatha; Kurtanich, Adrienne; Caguiat, Jonathan

    2009-11-01

    The Y-12 plant in Oak Ridge, TN, which manufactured nuclear weapons during World War II and the Cold War, contaminated East Fork Poplar Creek with heavy metals. The multimetal resistant bacterial strain, Stenotrophomonas maltophilia Oak Ridge strain O2 (S. maltophilia O2), was isolated from East Fork Poplar Creek. Sequence analysis of 16s rDNA suggested that our working strain of S. maltophilia O2 was a strain of Enterobacter. Phylogenetic tree analysis and biochemical tests confirmed that it belonged to an Enterobacter species. This new strain was named Enterobacter sp. YSU. Using a modified R3A growth medium, R3A-Tris, the Hg(II), Cd(II), Zn(II), Cu(II), Au(III), Cr(VI), Ag(I), As(III), and Se(IV) MICs for a confirmed strain of S. maltophilia O2 were 0.24, 0.33, 5, 5, 0.25, 7, 0.03, 14, and 40 mM, respectively, compared to 0.07, 0.24, 0.8, 3, 0.05, 0.4, 0.08, 14, and 40 mM, respectively, for Enterobacter sp. YSU. Although S. maltophilia O2 was generally more metal resistant than Enterobacter sp. YSU, in comparison to Escherichia coli strain HB101, Enterobacter sp. YSU was resistant to Hg(II), Cd(II), Zn(II), Au(III), Ag(I), As(III), and Se(IV). By studying metal resistances in these two strains, it may be possible to understand what makes one microorganism more metal resistant than another microorganism. This work also provided benchmark MICs that can be used to evaluate the metal resistance properties of other bacterial isolates from East Fork Poplar Creek and other metal contaminated sites.

  5. Comparison of two multimetal resistant bacterial strains: Enterobacter sp. YSU and Stenotrophomonas maltophilia ORO2.

    PubMed

    Holmes, Andrew; Vinayak, Anubhav; Benton, Cherise; Esbenshade, Aaron; Heinselman, Carlisle; Frankland, Daniel; Kulkarni, Samatha; Kurtanich, Adrienne; Caguiat, Jonathan

    2009-11-01

    The Y-12 plant in Oak Ridge, TN, which manufactured nuclear weapons during World War II and the Cold War, contaminated East Fork Poplar Creek with heavy metals. The multimetal resistant bacterial strain, Stenotrophomonas maltophilia Oak Ridge strain O2 (S. maltophilia O2), was isolated from East Fork Poplar Creek. Sequence analysis of 16s rDNA suggested that our working strain of S. maltophilia O2 was a strain of Enterobacter. Phylogenetic tree analysis and biochemical tests confirmed that it belonged to an Enterobacter species. This new strain was named Enterobacter sp. YSU. Using a modified R3A growth medium, R3A-Tris, the Hg(II), Cd(II), Zn(II), Cu(II), Au(III), Cr(VI), Ag(I), As(III), and Se(IV) MICs for a confirmed strain of S. maltophilia O2 were 0.24, 0.33, 5, 5, 0.25, 7, 0.03, 14, and 40 mM, respectively, compared to 0.07, 0.24, 0.8, 3, 0.05, 0.4, 0.08, 14, and 40 mM, respectively, for Enterobacter sp. YSU. Although S. maltophilia O2 was generally more metal resistant than Enterobacter sp. YSU, in comparison to Escherichia coli strain HB101, Enterobacter sp. YSU was resistant to Hg(II), Cd(II), Zn(II), Au(III), Ag(I), As(III), and Se(IV). By studying metal resistances in these two strains, it may be possible to understand what makes one microorganism more metal resistant than another microorganism. This work also provided benchmark MICs that can be used to evaluate the metal resistance properties of other bacterial isolates from East Fork Poplar Creek and other metal contaminated sites. PMID:19688378

  6. Accumulation of Amino Acids in Rhizobium sp. Strain WR1001 in Response to Sodium Chloride Salinity

    PubMed Central

    Hua, Sui-Sheng T.; Tsai, Victor Y.; Lichens, Georgia M.; Noma, Amy T.

    1982-01-01

    Rhizobium sp. strain WR1001, isolated from the Sonoran Desert by Eskew and Ting, was found to be able to grow in defined medium containing NaCl up to 500 mM, a concentration approaching that of sea water. Therefore, it is a valuable strain for studying the biochemical basis of salt tolerance. Intracellular free glutamate was found to increase rapidly in response to osmotic stress by NaCl. It accounted for 88% of the amino acid pool when the bacterium was grown in 500 mM NaCl. The role of glutamate dehydrogenase in glutamate biosynthesis was examined in several Rhizobium strains. Both NADH- and NADPH-dependent glutamate dehydrogenase activities in various Rhizobium strains were observed. The range of activity differed considerably depending on the particular strain. KCl (500 mM) did not stimulate glutamate dehydrogenase activity, as reported in a number of bacterial strains by Measures. The low activity of glutamate dehydrogenase in Rhizobium sp. strain WR1001 apparently cannot fulfill a biosynthetic function of glutamate formation in response to medium NaCl concentrations. PMID:16346049

  7. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  8. Bacterial cellulose production by Acetobacter xylinum strains from agricultural waste products.

    PubMed

    Kongruang, Sasithorn

    2008-03-01

    Bacterial cellulose is a biopolysaccharide produced from the bacteria, Acetobacter xylinum. Static batch fermentations for bacterial cellulose production were studied in coconut and pineapple juices under 30 degrees C in 5-l fermenters by using three Acetobacter strains: A. xylinum TISTR 998, A. xylinum TISTR 975, and A. xylinum TISTR 893. Experiments were carried out to compare bacterial cellulose yields along with growth kinetic analysis. Results showed that A. xylinum TISTR 998 produced a bacterial cellulose yield of 553.33 g/l, while A. xylinum TISTR 893 produced 453.33 g/l and A. xylinum TISTR 975 produced 243.33 g/l. In pineapple juice, the yields for A. xylinum TISTR 893, 975, and 998 were 576.66, 546.66, and 520 g/l, respectively. The strain TISTR 998 showed the highest productivity when using coconut juice. Morphological properties of cellulose pellicles, in terms of texture and color, were also measured, and the textures were not significantly different among treatments.

  9. Bacterial Cellulose Production by Acetobacter xylinum Strains from Agricultural Waste Products

    NASA Astrophysics Data System (ADS)

    Kongruang, Sasithorn

    Bacterial cellulose is a biopolysaccharide produced from the bacteria, Acetobacter xylinum. Static batch fermentations for bacterial cellulose production were studied in coconut and pineapple juices under 30 °C in 5-1 fermenters by using three Acetobacter strains: A. xylinum TISTR 998, A. xylinum TISTR 975, and A. xylinum TISTR 893. Experiments were carried out to compare bacterial cellulose yields along with growth kinetic analysis. Results showed that A. xylinum TISTR 998 produced a bacterial cellulose yield of 553.33 g/l, while A. xylinum TISTR 893 produced 453.33 g/l and A. xylinum TISTR 975 produced 243.33 g/l. In pineapple juice, the yields for A. xylinum TISTR 893, 975, and 998 were 576.66, 546.66, and 520 g/l, respectively. The strain TISTR 998 showed the highest productivity when using coconut juice. Morphological properties of cellulose pellicles, in terms of texture and color, were also measured, and the textures were not significantly different among treatments.

  10. Application of whole-genome sequencing for bacterial strain typing in molecular epidemiology.

    PubMed

    Salipante, Stephen J; SenGupta, Dhruba J; Cummings, Lisa A; Land, Tyler A; Hoogestraat, Daniel R; Cookson, Brad T

    2015-04-01

    Nosocomial infections pose a significant threat to patient health; however, the gold standard laboratory method for determining bacterial relatedness (pulsed-field gel electrophoresis [PFGE]) remains essentially unchanged 20 years after its introduction. Here, we explored bacterial whole-genome sequencing (WGS) as an alternative approach for molecular strain typing. We compared WGS to PFGE for investigating presumptive outbreaks involving three important pathogens: vancomycin-resistant Enterococcus faecium (n=19), methicillin-resistant Staphylococcus aureus (n=17), and Acinetobacter baumannii (n=15). WGS was highly reproducible (average≤0.39 differences between technical replicates), which enabled a functional, quantitative definition for determining clonality. Strain relatedness data determined by PFGE and WGS roughly correlated, but the resolution of WGS was superior (P=5.6×10(-8) to 0.016). Several discordant results were noted between the methods. A total of 28.9% of isolates which were indistinguishable by PFGE were nonclonal by WGS. For A. baumannii, a species known to undergo rapid horizontal gene transfer, 16.2% of isolate pairs considered nonidentical by PFGE were clonal by WGS. Sequencing whole bacterial genomes with single-nucleotide resolution demonstrates that PFGE is prone to false-positive and false-negative results and suggests the need for a new gold standard approach for molecular epidemiological strain typing.

  11. Application of whole-genome sequencing for bacterial strain typing in molecular epidemiology.

    PubMed

    Salipante, Stephen J; SenGupta, Dhruba J; Cummings, Lisa A; Land, Tyler A; Hoogestraat, Daniel R; Cookson, Brad T

    2015-04-01

    Nosocomial infections pose a significant threat to patient health; however, the gold standard laboratory method for determining bacterial relatedness (pulsed-field gel electrophoresis [PFGE]) remains essentially unchanged 20 years after its introduction. Here, we explored bacterial whole-genome sequencing (WGS) as an alternative approach for molecular strain typing. We compared WGS to PFGE for investigating presumptive outbreaks involving three important pathogens: vancomycin-resistant Enterococcus faecium (n=19), methicillin-resistant Staphylococcus aureus (n=17), and Acinetobacter baumannii (n=15). WGS was highly reproducible (average≤0.39 differences between technical replicates), which enabled a functional, quantitative definition for determining clonality. Strain relatedness data determined by PFGE and WGS roughly correlated, but the resolution of WGS was superior (P=5.6×10(-8) to 0.016). Several discordant results were noted between the methods. A total of 28.9% of isolates which were indistinguishable by PFGE were nonclonal by WGS. For A. baumannii, a species known to undergo rapid horizontal gene transfer, 16.2% of isolate pairs considered nonidentical by PFGE were clonal by WGS. Sequencing whole bacterial genomes with single-nucleotide resolution demonstrates that PFGE is prone to false-positive and false-negative results and suggests the need for a new gold standard approach for molecular epidemiological strain typing. PMID:25631811

  12. In Vivo Selection To Identify Bacterial Strains with Enhanced Ecological Performance in Synbiotic Applications

    PubMed Central

    Krumbeck, Janina A.; Maldonado-Gomez, María X.; Martínez, Inés; Frese, Steven A.; Burkey, Thomas E.; Rasineni, Karuna; Ramer-Tait, Amanda E.; Harris, Edward N.; Hutkins, Robert W.

    2015-01-01

    One strategy for enhancing the establishment of probiotic bacteria in the human intestinal tract is via the parallel administration of a prebiotic, which is referred to as a synbiotic. Here we present a novel method that allows a rational selection of putative probiotic strains to be used in synbiotic applications: in vivo selection (IVS). This method consists of isolating candidate probiotic strains from fecal samples following enrichment with the respective prebiotic. To test the potential of IVS, we isolated bifidobacteria from human subjects who consumed increasing doses of galactooligosaccharides (GOS) for 9 weeks. A retrospective analysis of the fecal microbiota of one subject revealed an 8-fold enrichment in Bifidobacterium adolescentis strain IVS-1 during GOS administration. The functionality of GOS to support the establishment of IVS-1 in the gastrointestinal tract was then evaluated in rats administered the bacterial strain alone, the prebiotic alone, or the synbiotic combination. Strain-specific quantitative real-time PCR showed that the addition of GOS increased B. adolescentis IVS-1 abundance in the distal intestine by nearly 2 logs compared to rats receiving only the probiotic. Illumina 16S rRNA sequencing not only confirmed the increased establishment of IVS-1 in the intestine but also revealed that the strain was able to outcompete the resident Bifidobacterium population when provided with GOS. In conclusion, this study demonstrated that IVS can be used to successfully formulate a synergistic synbiotic that can substantially enhance the establishment and competitiveness of a putative probiotic strain in the gastrointestinal tract. PMID:25616794

  13. Draft Genome Sequence of Two Strains of Xanthomonas arboricola Isolated from Prunus persica Which Are Dissimilar to Strains That Cause Bacterial Spot Disease on Prunus spp.

    PubMed Central

    Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M.

    2016-01-01

    The draft genome sequences of two strains of Xanthomonas arboricola, isolated from asymptomatic peach trees in Spain, are reported here. These strains are avirulent and do not belong to the same phylogroup as X. arboricola pv. pruni, a causal agent of bacterial spot disease of stone fruits and almonds. PMID:27609931

  14. Draft Genome Sequence of Two Strains of Xanthomonas arboricola Isolated from Prunus persica Which Are Dissimilar to Strains That Cause Bacterial Spot Disease on Prunus spp.

    PubMed

    Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M; Cubero, Jaime

    2016-09-08

    The draft genome sequences of two strains of Xanthomonas arboricola, isolated from asymptomatic peach trees in Spain, are reported here. These strains are avirulent and do not belong to the same phylogroup as X. arboricola pv. pruni, a causal agent of bacterial spot disease of stone fruits and almonds.

  15. Exposure to bacterial endotoxin generates a distinct strain of α-synuclein fibril.

    PubMed

    Kim, Changyoun; Lv, Guohua; Lee, Jun Sung; Jung, Byung Chul; Masuda-Suzukake, Masami; Hong, Chul-Suk; Valera, Elvira; Lee, He-Jin; Paik, Seung R; Hasegawa, Masato; Masliah, Eliezer; Eliezer, David; Lee, Seung-Jae

    2016-01-01

    A single amyloidogenic protein is implicated in multiple neurological diseases and capable of generating a number of aggregate "strains" with distinct structures. Among the amyloidogenic proteins, α-synuclein generates multiple patterns of proteinopathies in a group of diseases, such as Parkinson disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA). However, the link between specific conformations and distinct pathologies, the key concept of the strain hypothesis, remains elusive. Here we show that in the presence of bacterial endotoxin, lipopolysaccharide (LPS), α-synuclein generated a self-renewable, structurally distinct fibril strain that consistently induced specific patterns of synucleinopathies in mice. These results suggest that amyloid fibrils with self-renewable structures cause distinct types of proteinopathies despite the identical primary structure and that exposure to exogenous pathogens may contribute to the diversity of synucleinopathies. PMID:27488222

  16. A computational exploration of bacterial metabolic diversity identifying metabolic interactions and growth-efficient strain communities

    PubMed Central

    2011-01-01

    Background Metabolic interactions involve the exchange of metabolic products among microbial species. Most microbes live in communities and usually rely on metabolic interactions to increase their supply for nutrients and better exploit a given environment. Constraint-based models have successfully analyzed cellular metabolism and described genotype-phenotype relations. However, there are only a few studies of genome-scale multi-species interactions. Based on genome-scale approaches, we present a graph-theoretic approach together with a metabolic model in order to explore the metabolic variability among bacterial strains and identify and describe metabolically interacting strain communities in a batch culture consisting of two or more strains. We demonstrate the applicability of our approach to the bacterium E. coli across different single-carbon-source conditions. Results A different diversity graph is constructed for each growth condition. The graph-theoretic properties of the constructed graphs reflect the inherent high metabolic redundancy of the cell to single-gene knockouts, reveal mutant-hubs of unique metabolic capabilities regarding by-production, demonstrate consistent metabolic behaviors across conditions and show an evolutionary difficulty towards the establishment of polymorphism, while suggesting that communities consisting of strains specifically adapted to a given condition are more likely to evolve. We reveal several strain communities of improved growth relative to corresponding monocultures, even though strain communities are not modeled to operate towards a collective goal, such as the community growth and we identify the range of metabolites that are exchanged in these batch co-cultures. Conclusions This study provides a genome-scale description of the metabolic variability regarding by-production among E. coli strains under different conditions and shows how metabolic differences can be used to identify metabolically interacting strain

  17. Production of lactic acid from sucrose: strain selection, fermentation, and kinetic modeling.

    PubMed

    Lunelli, Betânia H; Andrade, Rafael R; Atala, Daniel I P; Wolf Maciel, Maria Regina; Maugeri Filho, Francisco; Maciel Filho, Rubens

    2010-05-01

    Lactic acid is an important product arising from the anaerobic fermentation of sugars. It is used in the pharmaceutical, cosmetic, chemical, and food industries as well as for biodegradable polymer and green solvent production. In this work, several bacterial strains were isolated from industrial ethanol fermentation, and the most efficient strain for lactic acid production was selected. The fermentation was conducted in a batch system under anaerobic conditions for 50 h at a temperature of 34 degrees C, a pH value of 5.0, and an initial sucrose concentration of 12 g/L using diluted sugarcane molasses. Throughout the process, pulses of molasses were added in order to avoid the cell growth inhibition due to high sugar concentration as well as increased lactic acid concentrations. At the end of the fermentation, about 90% of sucrose was consumed to produce lactic acid and cells. A kinetic model has been developed to simulate the batch lactic acid fermentation results. The data obtained from the fermentation were used for determining the kinetic parameters of the model. The developed model for lactic acid production, growth cell, and sugar consumption simulates the experimental data well.

  18. Antimicrobial Resistance and Plasmid Profile of Bacterial Strains Isolated from the Urbanized Eltsovka-1 River (Russia).

    PubMed

    Lobova, Tatiana I; Yemelyanova, Elena; Andreeva, Irina S; Puchkova, Larisa I; Repin, Vladimir Ye

    2015-08-01

    Antimicrobial resistance and plasmid profile of Gram-positive and Gram-negative bacterial strains isolated from the urbanized Eltsovka-1 River (Russia) were investigated. Sequencing of the 16S rRNA of of G+ strains showed 99-100% identity to that of Bacillus aerophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, Bacillus anthrancis, Bacillus barbaricus, Bacillus cereus, Bacillus flexus, Bacillus indriensis, Bacillus stratosphericus, Bacillus subtilis subsp. subtilis, Bacillus thuringiensis, Streptomyces albidoflavus, Streptomyces albus, Streptomyces exfoliatus, Streptomyces odorifer, and Streptomyces sampsonii. Sequencing of the 16S rRNA of G-strains was similar in 99-100% to that of Aeromonas bestiarum, Aeromonas encheleia, Aeromonas hydrophila, A. hydrophila subsp. anaerogenes, A. hydrophila subsp. dhakensis, Aeromonas media, Aeromonas molluscorum, Aeromonas popoffii, Aeromonas salmonicida subsp. masoucida, A. salmonicida subsp. pectinolytica, A. salmonicida subsp. salmonicida, Aeromonas punctata, Aeromonas sobria, and Shewanella putrefaciens. The highest percentage (88.4%) of strains was resistant to polymyxin B followed by 69% to lincomycin, 61.5% to benzilpenicillin, 57.7% to ampicillin, and 50% to carbenicillin. A low level of resistance (4%) was found to kanamycin (8%), to streptomycin (11.5%), to neomycin and tetracycline, and (15%) to erythromycin. No resistance was found to gentamycin, monomycin, and chloroamphenicol. The majority (80.7%) of strains was multidrug-resistant. Ninety-two percent of all strains carried plasmid DNA of various sizes.

  19. Lactic acid bacteria colonization and clinical outcome after probiotic supplementation in conventionally treated bacterial vaginosis and vulvovaginal candidiasis.

    PubMed

    Ehrström, Sophia; Daroczy, Katalin; Rylander, Eva; Samuelsson, Carolina; Johannesson, Ulrika; Anzén, Bo; Påhlson, Carl

    2010-09-01

    This randomized double-blind placebo controlled study assessed the vaginal colonization of lactic acid bacteria and clinical outcome. Vaginal capsules containing L gasseri LN40, Lactobacillus fermentum LN99, L. casei subsp. rhamnosus LN113 and P. acidilactici LN23, or placebos were administered for five days to 95 women after conventional treatment of bacterial vaginosis and/or vulvovaginal candidiasis. Vulvovaginal examinations and vaginal samplings were performed before and after administration, after the first and second menstruation, and after six months. Presence of LN strains was assessed using RAPD analysis. LN strains were present 2-3 days after administration in 89% of the women receiving LN strains (placebo: 0%, p < 0.0001). After one menstruation 53% were colonized by at least one LN strain. Nine percent were still colonized six months after administration. Ninety-three percent of the women receiving LN strains were cured 2-3 days after administration (placebo: 83%), and 78% after one menstruation (placebo: 71%) (ns). The intervention group experienced less malodorous discharge 2-3 days after administration (p = 0.03) and after the second menstruation (p = 0.04), compared with placebo. In summary, five days of vaginal administration of LN strains after conventional treatment of bacterial vaginosis and/or vulvovaginal candidiasis lead to vaginal colonization, somewhat fewer recurrences and less malodorous discharge.

  20. Rhizospheric Bacterial Strain Brevibacterium casei MH8a Colonizes Plant Tissues and Enhances Cd, Zn, Cu Phytoextraction by White Mustard

    PubMed Central

    Płociniczak, Tomasz; Sinkkonen, Aki; Romantschuk, Martin; Sułowicz, Sławomir; Piotrowska-Seget, Zofia

    2016-01-01

    Environmental pollution by heavy metals has become a serious problem in the world. Phytoextraction, which is one of the plant-based technologies, has attracted the most attention for the bioremediation of soils polluted with these contaminants. The aim of this study was to determine whether the multiple-tolerant bacterium, Brevibacterium casei MH8a isolated from the heavy metal-contaminated rhizosphere soil of Sinapis alba L., is able to promote plant growth and enhance Cd, Zn, and Cu uptake by white mustard under laboratory conditions. Additionally, the ability of the rifampicin-resistant spontaneous mutant of MH8a to colonize plant tissues and its mechanisms of plant growth promotion were also examined. In order to assess the ecological consequences of bioaugmentation on autochthonous bacteria, the phospholipid fatty acid (PLFA) analysis was used. The MH8a strain exhibited the ability to produce ammonia, 1-amino-cyclopropane-1-carboxylic acid deaminase, indole 3-acetic acid and HCN but was not able to solubilize inorganic phosphate and produce siderophores. Introduction of MH8a into soil significantly increased S. alba biomass and the accumulation of Cd (208%), Zn (86%), and Cu (39%) in plant shoots in comparison with those grown in non-inoculated soil. Introduced into the soil, MH8a was able to enter the plant and was found in the roots and leaves of inoculated plants thus indicating its endophytic features. PLFA analysis revealed that the MH8a that was introduced into soil had a temporary influence on the structure of the autochthonous bacterial communities. The plant growth-promoting features of the MH8a strain and its ability to enhance the metal uptake by white mustard and its long-term survival in soil as well as its temporary impact on autochthonous microorganisms make the strain a suitable candidate for the promotion of plant growth and the efficiency of phytoextraction. PMID:26909087

  1. Competitive Ability and Survival in Soil of Pseudomonas Strain 679-2, a Dominant, Nonobligate Bacterial Predator of Bacteria

    PubMed Central

    Casida, L. E.

    1992-01-01

    A copper-resistant, nonobligate, bacterial predator of bacteria was isolated from soil. It was a Pseudomonas species, designated strain 679-2. It attacked most other nonobligate bacterial predators and hence could control their predatory and other activities in nature. It also inhibited various fungi. It attached to prey cells and produced a toxic, copper-related, growth initiation factor like that produced by Cupriavidus necator. In addition, it produced a second, novel compound that was both antibacterial and antifungal. Strain 679-2 appeared to have only a very limited natural occurrence. It was found only in the soil from one small area in one field. It was absent on the leaves of the plant species that were examined. Regardless of its rarity, however, it was highly competitive in soil. An inoculum consisting of only a few cells added to soil multiplied rapidly to become a major component of the soil microflora within 24 h. A small amount of glutamic acid could be added along with the cells to stimulate production of the toxic compounds noted above, but this was not necessary. After this multiplication, or when large numbers of cells were added to soil, the numbers decreased only slowly during the next several months. Cell survival also was good on plant leaves. The survival in soil and on plant leaves occurred in both laboratory and field experiments. Other than desiccation, the natural mechanism for controlling the numbers or activities of strain 679-2 in soil is not known. The various characteristics of this bacterium, as noted above, are of particular interest because they indicate a possible use of the cells or inhibitor compounds for controlling organisms in soil or on plant surfaces. PMID:16348631

  2. Competitive ability and survival in soil of Pseudomonas strain 679-2, a dominant, nonobligate bacterial predator of bacteria

    SciTech Connect

    Casida, L.E. )

    1992-01-01

    A copper-resistant, nonobligate, bacterial predator of bacteria was isolated from soil. It was a Pseudomonas species, designated strain 679-2. It attacked most other nonobligate bacterial predators and hence could control their predatory and other activities in nature. It also inhibited various fungi. It attached to prey cells and produced a toxic, copper-related, growth initiation factor like that produced by Cupriavidus necator. In addition, it produced a second, novel compound that was both antibacterial and antifungal. Strain 679-2 appeared to have only a very limited natural occurrence. It was found only in the soil from one small area in one field. It was absent on the leaves of the plant species that were examined. An inoculum consisting of only a few cells added to soil multiplied rapidly to become a major component of the soil microflora within 24 h. A small amount of glutamic acid could be added along with the cells to stimulate production of the toxic compounds noted above, but this was not necessary. After this multiplication, or when large numbers of cells were added to soil, the numbers decreased only slowly during the next several months. Cell survival also was good on plant leaves. The survival in soil and on plant leaves occurred in both laboratory and field experiments. Other than desiccation, the natural mechanism for controlling the numbers or activities of strain 679-2 in soil is not known. The various characteristics of this bacterium, as noted above, are of particular interest because they indicate a possible use of the cells or inhibitor compounds for controlling organisms in soil or on plant surfaces.

  3. Genome Sequences of 15 Gardnerella vaginalis Strains Isolated from the Vaginas of Women with and without Bacterial Vaginosis

    PubMed Central

    Robinson, Lloyd S.; Perry, Justin; Lek, Sai; Wollam, Aye; Sodergren, Erica; Weinstock, George

    2016-01-01

    Gardnerella vaginalis is a predominant species in bacterial vaginosis, a dysbiosis of the vagina that is associated with adverse health outcomes, including preterm birth. Here, we present the draft genome sequences of 15 Gardnerella vaginalis strains (now available through BEI Resources) isolated from women with and without bacterial vaginosis. PMID:27688326

  4. Genome Sequences of 15 Gardnerella vaginalis Strains Isolated from the Vaginas of Women with and without Bacterial Vaginosis.

    PubMed

    Robinson, Lloyd S; Perry, Justin; Lek, Sai; Wollam, Aye; Sodergren, Erica; Weinstock, George; Lewis, Warren G; Lewis, Amanda L

    2016-01-01

    Gardnerella vaginalis is a predominant species in bacterial vaginosis, a dysbiosis of the vagina that is associated with adverse health outcomes, including preterm birth. Here, we present the draft genome sequences of 15 Gardnerella vaginalis strains (now available through BEI Resources) isolated from women with and without bacterial vaginosis. PMID:27688326

  5. Cockroaches as a Source of High Bacterial Pathogens with Multidrug Resistant Strains in Gondar Town, Ethiopia.

    PubMed

    Moges, Feleke; Eshetie, Setegn; Endris, Mengistu; Huruy, Kahsay; Muluye, Dagnachew; Feleke, Tigist; G/Silassie, Fisha; Ayalew, Getenet; Nagappan, Raja

    2016-01-01

    Background. Cockroaches are source of bacterial infections and this study was aimed to assess bacterial isolates and their antimicrobial profiles from cockroaches in Gondar town, Ethiopia. Methods. A total of 60 cockroaches were collected from March 1 to May 30, 2014, in Gondar town. Bacterial species were isolated from external and internal parts of cockroaches. Disk diffusion method was used to determine antibiotic susceptibility patterns. Data were entered and analyzed by using SPSS version 20; P values <0.005 were considered as statistically significant. Results. Of 181 identified bacteria species, 110 (60.8%) and 71 (39.2%) were identified from external and internal parts of cockroaches, respectively. Klebsiella pneumoniae 32 (17.7%), Escherichia coli 29 (16%), and Citrobacter spp. 27 (15%) were the predominant isolates. High resistance rate was observed to cotrimoxazole, 60 (33.1%), and least resistance rate was noted to ciprofloxacin, 2 (1.1%). Additionally, 116 (64.1%) of the isolates were MDR strains; Salmonella spp. were the leading MDR isolates (100%) followed by Enterobacter (90.5%) and Shigella spp. (76.9%). Conclusion. Cockroaches are the potential source of bacteria pathogens with multidrug resistant strains and hence effective preventive and control measures are required to minimize cockroach related infections.

  6. Cockroaches as a Source of High Bacterial Pathogens with Multidrug Resistant Strains in Gondar Town, Ethiopia

    PubMed Central

    Huruy, Kahsay; Muluye, Dagnachew; Feleke, Tigist; G/Silassie, Fisha; Ayalew, Getenet; Nagappan, Raja

    2016-01-01

    Background. Cockroaches are source of bacterial infections and this study was aimed to assess bacterial isolates and their antimicrobial profiles from cockroaches in Gondar town, Ethiopia. Methods. A total of 60 cockroaches were collected from March 1 to May 30, 2014, in Gondar town. Bacterial species were isolated from external and internal parts of cockroaches. Disk diffusion method was used to determine antibiotic susceptibility patterns. Data were entered and analyzed by using SPSS version 20; P values <0.005 were considered as statistically significant. Results. Of 181 identified bacteria species, 110 (60.8%) and 71 (39.2%) were identified from external and internal parts of cockroaches, respectively. Klebsiella pneumoniae 32 (17.7%), Escherichia coli 29 (16%), and Citrobacter spp. 27 (15%) were the predominant isolates. High resistance rate was observed to cotrimoxazole, 60 (33.1%), and least resistance rate was noted to ciprofloxacin, 2 (1.1%). Additionally, 116 (64.1%) of the isolates were MDR strains; Salmonella spp. were the leading MDR isolates (100%) followed by Enterobacter (90.5%) and Shigella spp. (76.9%). Conclusion. Cockroaches are the potential source of bacteria pathogens with multidrug resistant strains and hence effective preventive and control measures are required to minimize cockroach related infections. PMID:27340653

  7. Cockroaches as a Source of High Bacterial Pathogens with Multidrug Resistant Strains in Gondar Town, Ethiopia.

    PubMed

    Moges, Feleke; Eshetie, Setegn; Endris, Mengistu; Huruy, Kahsay; Muluye, Dagnachew; Feleke, Tigist; G/Silassie, Fisha; Ayalew, Getenet; Nagappan, Raja

    2016-01-01

    Background. Cockroaches are source of bacterial infections and this study was aimed to assess bacterial isolates and their antimicrobial profiles from cockroaches in Gondar town, Ethiopia. Methods. A total of 60 cockroaches were collected from March 1 to May 30, 2014, in Gondar town. Bacterial species were isolated from external and internal parts of cockroaches. Disk diffusion method was used to determine antibiotic susceptibility patterns. Data were entered and analyzed by using SPSS version 20; P values <0.005 were considered as statistically significant. Results. Of 181 identified bacteria species, 110 (60.8%) and 71 (39.2%) were identified from external and internal parts of cockroaches, respectively. Klebsiella pneumoniae 32 (17.7%), Escherichia coli 29 (16%), and Citrobacter spp. 27 (15%) were the predominant isolates. High resistance rate was observed to cotrimoxazole, 60 (33.1%), and least resistance rate was noted to ciprofloxacin, 2 (1.1%). Additionally, 116 (64.1%) of the isolates were MDR strains; Salmonella spp. were the leading MDR isolates (100%) followed by Enterobacter (90.5%) and Shigella spp. (76.9%). Conclusion. Cockroaches are the potential source of bacteria pathogens with multidrug resistant strains and hence effective preventive and control measures are required to minimize cockroach related infections. PMID:27340653

  8. Bacterial Utilization of L-sugars and D-amino Acids

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-01-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084

  9. Bacterial utilization of L-sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

    2006-08-01

    The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of

  10. Salicylic acid is not a bacterial siderophore: a theoretical study.

    PubMed

    Chipperfield, J R; Ratledge, C

    2000-06-01

    Using a newly available program for calculating the concentrations and speciation of various ions (Pettit, LD & Powell KJ, 'SolEq' Academic Software, 1999), we have calculated that at pH 7 the amount of free Fe(III) present in an aqueous solution is 1.4 x 10(-9) M and not 10(-18) M as is usually quoted. In the presence of salicylic acid, included in the calculations at 10(-4) M, the solubility of Fe(III) is increased to only 9.8 x 10(-9) M suggesting that salicylate is unable to act as a siderophore although it is produced as an extracellular product by several bacterial genera when grown iron deficiently. In the presence of 40 mM phosphate, the soluble Fe(III) concentration is decreased by 10(4) at pH 7 and again this is hardly affected by the presence of salicylate. Thus, for microorganisms grown either in vitro or in vivo, salicylate is unlikely to function as a iron solubilizing agent. The same conclusions may also apply to 2,3-dihydroxybenzoic acid.

  11. Occurrence of copper-resistant strains and a shift in Xanthomonas spp. causing tomato bacterial spot in Ontario.

    PubMed

    Abbasi, Pervaiz A; Khabbaz, Salah Eddin; Weselowski, Brian; Zhang, Liang

    2015-10-01

    Field strains of tomato bacterial spot pathogen (Xanthomonas euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri) were characterized for sensitivity to copper and species composition. A total of 98 strains were isolated from symptomatic leaf and fruit samples collected from 18 tomato fields in Ontario. In greenhouse pathogenicity tests, most of the field strains caused severe (37 strains) to highly severe (23 strains) symptoms on 'Bonny Best' tomato plants, whereas 38 strains caused moderate symptoms. In MGY agar plates amended with various concentrations of copper sulfate, 11 strains were completely sensitive (no growth) and 87 strains were resistant (grew on 1.0 mmol/L or higher copper concentration). PCR analysis of the hrp gene cluster followed by restriction digestion with HaeIII and sequencing identified X. gardneri (35 strains) and X. perforans (26 strains) as predominant species and X. euvesicatoria and X. vesicatoria as less common species in Ontario tomato fields. Separation of field strains into various species was also confirmed with starch hydrolysis activity on agar medium. Moreover, 72 field strains produced shiny greenish-yellow colonies surrounded by a milky zone on xanthomonad differential (Xan-D) medium, and the colonies of 26 strains did not produce a milky zone. Thirty-four strains could not be clustered into any species and 25 of those strains were negative for the hrp gene PCR and also did not produce a milky zone around colonies on Xan-D medium. Our results suggest a widespread existence of copper-resistant strains and an increase in X. perforans strains of bacterial spot pathogen in Ontario. This information on copper resistance and species composition within bacterial spot pathogens in Ontario will be helpful for developing effective disease management strategies, making cultivar selection, and breeding new tomato cultivars. PMID:26308592

  12. Occurrence of copper-resistant strains and a shift in Xanthomonas spp. causing tomato bacterial spot in Ontario.

    PubMed

    Abbasi, Pervaiz A; Khabbaz, Salah Eddin; Weselowski, Brian; Zhang, Liang

    2015-10-01

    Field strains of tomato bacterial spot pathogen (Xanthomonas euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri) were characterized for sensitivity to copper and species composition. A total of 98 strains were isolated from symptomatic leaf and fruit samples collected from 18 tomato fields in Ontario. In greenhouse pathogenicity tests, most of the field strains caused severe (37 strains) to highly severe (23 strains) symptoms on 'Bonny Best' tomato plants, whereas 38 strains caused moderate symptoms. In MGY agar plates amended with various concentrations of copper sulfate, 11 strains were completely sensitive (no growth) and 87 strains were resistant (grew on 1.0 mmol/L or higher copper concentration). PCR analysis of the hrp gene cluster followed by restriction digestion with HaeIII and sequencing identified X. gardneri (35 strains) and X. perforans (26 strains) as predominant species and X. euvesicatoria and X. vesicatoria as less common species in Ontario tomato fields. Separation of field strains into various species was also confirmed with starch hydrolysis activity on agar medium. Moreover, 72 field strains produced shiny greenish-yellow colonies surrounded by a milky zone on xanthomonad differential (Xan-D) medium, and the colonies of 26 strains did not produce a milky zone. Thirty-four strains could not be clustered into any species and 25 of those strains were negative for the hrp gene PCR and also did not produce a milky zone around colonies on Xan-D medium. Our results suggest a widespread existence of copper-resistant strains and an increase in X. perforans strains of bacterial spot pathogen in Ontario. This information on copper resistance and species composition within bacterial spot pathogens in Ontario will be helpful for developing effective disease management strategies, making cultivar selection, and breeding new tomato cultivars.

  13. Use of Fatty Acid Methyl Ester Profiles to Compare Copper-Tolerant and Copper-Sensitive Strains of Pantoea ananatis.

    PubMed

    Nischwitz, C; Gitaitis, R; Sanders, H; Langston, D; Mullinix, B; Torrance, R; Boyhan, G; Zolobowska, L

    2007-10-01

    acid/14-methylpentadecenoic acid) also had an impact on the differences observed between copper-sensitive parents and copper-resistant mutants. Finding these changes in bacterial fatty acid composition could lead to the development of a laboratory assay to identify copper-tolerant strains using gas chromatography as well as providing clues to further elucidate the mode of action of copper tolerance. PMID:18943688

  14. Antimicrobial Activity of Monoramnholipids Produced by Bacterial Strains Isolated from the Ross Sea (Antarctica) †

    PubMed Central

    Tedesco, Pietro; Maida, Isabel; Palma Esposito, Fortunato; Tortorella, Emiliana; Subko, Karolina; Ezeofor, Chidinma Christiana; Zhang, Ying; Tabudravu, Jioji; Jaspars, Marcel; Fani, Renato; de Pascale, Donatella

    2016-01-01

    Microorganisms living in extreme environments represent a huge reservoir of novel antimicrobial compounds and possibly of novel chemical families. Antarctica is one of the most extraordinary places on Earth and exhibits many distinctive features. Antarctic microorganisms are well known producers of valuable secondary metabolites. Specifically, several Antarctic strains have been reported to inhibit opportunistic human pathogens strains belonging to Burkholderia cepacia complex (Bcc). Herein, we applied a biodiscovery pipeline for the identification of anti-Bcc compounds. Antarctic sub-sea sediments were collected from the Ross Sea, and used to isolate 25 microorganisms, which were phylogenetically affiliated to three bacterial genera (Psychrobacter, Arthrobacter, and Pseudomonas) via sequencing and analysis of 16S rRNA genes. They were then subjected to a primary cell-based screening to determine their bioactivity against Bcc strains. Positive isolates were used to produce crude extracts from microbial spent culture media, to perform the secondary screening. Strain Pseudomonas BNT1 was then selected for bioassay-guided purification employing SPE and HPLC. Finally, LC-MS and NMR structurally resolved the purified bioactive compounds. With this strategy, we achieved the isolation of three rhamnolipids, two of which were new, endowed with high (MIC < 1 μg/mL) and unreported antimicrobial activity against Bcc strains. PMID:27128927

  15. Isolation and characteristics analysis of a novel high bacterial cellulose producing strain Gluconacetobacter intermedius CIs26.

    PubMed

    Yang, Ying; Jia, Jingjing; Xing, Jianrong; Chen, Jianbing; Lu, Shengmin

    2013-02-15

    A strain producing bacterial cellulose (BC) screened from rotten mandarin fruit was identified as Gluconacetobacter intermedius CIs26 by the examination of general taxonomical characteristics and 16S rDNA sequence analysis. Furthermore, Fourier transform infrared (FT-IR) spectrum showed that pellicle produced by strain CIs26 was composed of glucan, and had the same functional group as a typical BC. X-ray diffractometry (XRD) analysis indicated that the BC was type I in structure with crystallinity index of 75%. BC yields of strain CIs26 in Hestrin-Schramn (HS), citrus waste modified HS (CMHS) and citrus waste solution (CWS) mediums were 2.1 g/L, 5.7 g/L, and 7.2 g/L, respectively. It was shown that citrus waste could stimulate BC production of strain CIs26 efficiently. Based on the ability of utilization of citrus waste, this strain appeared to have potential in BC manufacture on an industrial scale. PMID:23399252

  16. Electrochemistry of marmatite-carbon paste electrode in the presence of bacterial strains.

    PubMed

    Shi, Shao-yuan; Fang, Zhao-heng; Ni, Jin-ren

    2006-01-01

    The electrochemical behaviors of a marmatite-carbon paste electrode with the chemical leaching of Fe3+ ions, or the microbial leaching using Acidithiobacillus ferrooxidans, were compared. The cyclic voltammograms of the electrode in the presence and absence of bacterial strains showed that the leaching process of marmatite was carried out by the different reactions occurring in the interface of the marmatite electrode-leach liquid. The polarization currents of the electrode under the differently applied potentials suggested that the microbial leaching of marmatite could be accelerated by the applied potential. The SEM observations indicated that the corrosion pits formed in the electrode surface were similar to the attached bacterial cells in shape and size, other than that by the chemical leaching of Fe3+ ions. The contact leaching of the attached cells on the mineral substrate played an important role on the dissolution of marmatite in addition to the chemical leaching of Fe3+ ions.

  17. Efficacy of Aqueous and Methanolic Extracts of Rheum Spiciformis against Pathogenic Bacterial and Fungal Strains

    PubMed Central

    Dar, Khalid Bashir; Bhat, Aashiq Hussain; Amin, Shajrul; Anees, Suhail; Masood, Akbar; Zargar, Mohammed Iqbal

    2016-01-01

    Introduction Rheum spiciformis is a newly identified edible medicinal plant of genus Rheum. The plant is used to treat various diseases on traditional levels in Kashmir Valley, India. Aim To evaluate the phytochemical screening, antibacterial and antifungal potential of aqueous and methanolic extracts of Rheum spiciformis, a traditionally used edible medicinal plant. Materials and Methods Methanolic and aqueous extracts of Rheum spiciformis were tested for their antimicrobial activities against six bacterial strains namely Bacillus subtilis, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Proteus vulgaris and Escherichia coli and four fungal strains Penicillium chrysogenum, Aspergillus fumigatus, Candida albicans and Saccharomyces cerevisiae. The susceptibility of microbial strains to the two extracts was determined using agar well diffusion method. Phytochemical screening was carried out by using various standard procedures. Results Methanolic extract showed potent antimicrobial activity as compared to aqueous extract at the concentrations of 10, 30, 50, 80 and 100mg/ml. The most susceptible bacterial strains were Staphylococcus aureus with zone of inhibition (25±0.10mm), Klebsiella pneumonia (23±0.25mm), Proteus vulgaris (22±0.10mm) at the concentration of 100mg/ml. Aqueous extracts at the higher concentration were found effective against Proteus vulgaris and Bacillus subtilis with zone of inhibition (17±0.24mm) and (17±0.10mm), respectively. Among fungal strains the most susceptible were Aspergillus fumigatus (21±0.10mm), Saccharomyces cerevisiae (20±0.20mm) and Penicillium Chrysogenum (17±0.15mm) at the concentration of 100mg/ml methanol extract. The zone of inhibition for aqueous extract against fungal strains ranged between 14±0.13mm to 16±0.19mm at the highest concentration of plant extract. Phytochemical analysis revealed the presence of various secondary metabolites like flavonoids, saponins, volatile oils, phenols, steroids

  18. Development of Fatty Acid-Producing Corynebacterium glutamicum Strains

    PubMed Central

    Takeno, Seiki; Takasaki, Manami; Urabayashi, Akinobu; Mimura, Akinori; Muramatsu, Tetsuhiro; Mitsuhashi, Satoshi

    2013-01-01

    To date, no information has been made available on the genetic traits that lead to increased carbon flow into the fatty acid biosynthetic pathway of Corynebacterium glutamicum. To develop basic technologies for engineering, we employed an approach that begins by isolating a fatty acid-secreting mutant without depending on mutagenic treatment. This was followed by genome analysis to characterize its genetic background. The selection of spontaneous mutants resistant to the palmitic acid ester surfactant Tween 40 resulted in the isolation of a desired mutant that produced oleic acid, suggesting that a single mutation would cause increased carbon flow down the pathway and subsequent excretion of the oversupplied fatty acid into the medium. Two additional rounds of selection of spontaneous cerulenin-resistant mutants led to increased production of the fatty acid in a stepwise manner. Whole-genome sequencing of the resulting best strain identified three specific mutations (fasR20, fasA63up, and fasA2623). Allele-specific PCR analysis showed that the mutations arose in that order. Reconstitution experiments with these mutations revealed that only fasR20 gave rise to oleic acid production in the wild-type strain. The other two mutations contributed to an increase in oleic acid production. Deletion of fasR from the wild-type strain led to oleic acid production as well. Reverse transcription-quantitative PCR analysis revealed that the fasR20 mutation brought about upregulation of the fasA and fasB genes encoding fatty acid synthases IA and IB, respectively, by 1.31-fold ± 0.11-fold and 1.29-fold ± 0.12-fold, respectively, and of the accD1 gene encoding the β-subunit of acetyl-CoA carboxylase by 3.56-fold ± 0.97-fold. On the other hand, the fasA63up mutation upregulated the fasA gene by 2.67-fold ± 0.16-fold. In flask cultivation with 1% glucose, the fasR20 fasA63up fasA2623 triple mutant produced approximately 280 mg of fatty acids/liter, which consisted mainly of oleic

  19. Bacterial production of free fatty acids from freshwater macroalgal cellulose

    PubMed Central

    Hoovers, Spencer W.; Marner, Wesley D.; Brownson, Amy K.; Lennen, Rebecca M.; Wittkopp, Tyler M.; Yoshitani, Jun; Zulkifly, Shahrizim; Graham, Linda E.; Chaston, Sheena D.; McMahon, Katherine D.

    2013-01-01

    The predominant strategy for using algae to produce biofuels relies on the overproduction of lipids in microalgae with subsequent conversion to biodiesel (methyl-esters) or green diesel (alkanes). Conditions that both optimize algal growth and lipid accumulation rarely overlap, and differences in growth rates can lead to wild species outcompeting the desired lipid-rich strains. Here, we demonstrate an alternative strategy in which cellulose contained in the cell walls of multicellular algae is used as a feedstock for cultivating biofuel-producing micro-organisms. Cellulose was extracted from an environmental sample of Cladophora glomerata-dominated periphyton that was collected from Lake Mendota, WI, USA. The resulting cellulose cake was hydrolyzed by commercial enzymes to release fermentable glucose. The hydrolysis mixture was used to formulate an undefined medium that was able to support the growth, without supplementation, of a free fatty acid (FFA)-overproducing strain of Escherichia coli (Lennen et. al 2010). To maximize free fatty acid production from glucose, an isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible vector was constructed to express the Umbellularia californica acyl–acyl carrier protein (ACP) thioesterase. Thioesterase expression was optimized by inducing cultures with 50 μM IPTG. Cell density and FFA titers from cultures grown on algae-based media reached 50% of those (~90 μg/mL FFA) cultures grown on rich Luria–Bertani broth supplemented with 0.2% glucose. In comparison, cultures grown in two media based on AFEX-pretreated corn stover generated tenfold less FFA than cultures grown in algae-based media. This study demonstrates that macroalgal cellulose is a potential carbon source for the production of biofuels or other microbially synthesized compounds. PMID:21643704

  20. Complete Genome Sequence of Gluconacetobacter hansenii Strain NQ5 (ATCC 53582), an Efficient Producer of Bacterial Cellulose.

    PubMed

    Pfeffer, Sarah; Mehta, Kalpa; Brown, R Malcolm

    2016-01-01

    This study reports the release of the complete nucleotide sequence of Gluconacetobacter hansenii strain NQ5 (ATCC 53582). This strain was isolated by R. Malcolm Brown, Jr. in a sugar mill in North Queensland, Australia, and is an efficient producer of bacterial cellulose. The elucidation of the genome will contribute to the study of the molecular mechanisms necessary for cellulose biosynthesis. PMID:27516505

  1. Complete Genome Sequence of Gluconacetobacter hansenii Strain NQ5 (ATCC 53582), an Efficient Producer of Bacterial Cellulose.

    PubMed

    Pfeffer, Sarah; Mehta, Kalpa; Brown, R Malcolm

    2016-08-11

    This study reports the release of the complete nucleotide sequence of Gluconacetobacter hansenii strain NQ5 (ATCC 53582). This strain was isolated by R. Malcolm Brown, Jr. in a sugar mill in North Queensland, Australia, and is an efficient producer of bacterial cellulose. The elucidation of the genome will contribute to the study of the molecular mechanisms necessary for cellulose biosynthesis.

  2. Complete Genome Sequence of Gluconacetobacter hansenii Strain NQ5 (ATCC 53582), an Efficient Producer of Bacterial Cellulose

    PubMed Central

    Pfeffer, Sarah; Mehta, Kalpa

    2016-01-01

    This study reports the release of the complete nucleotide sequence of Gluconacetobacter hansenii strain NQ5 (ATCC 53582). This strain was isolated by R. Malcolm Brown, Jr. in a sugar mill in North Queensland, Australia, and is an efficient producer of bacterial cellulose. The elucidation of the genome will contribute to the study of the molecular mechanisms necessary for cellulose biosynthesis. PMID:27516505

  3. A novel production process for optically pure L-lactic acid from kitchen refuse using a bacterial consortium at high temperatures.

    PubMed

    Tashiro, Yukihiro; Matsumoto, Hiroko; Miyamoto, Hirokuni; Okugawa, Yuki; Pramod, Poudel; Miyamoto, Hisashi; Sakai, Kenji

    2013-10-01

    We investigated L-lactic acid production in static batch fermentation of kitchen refuse using a bacterial consortium from marine-animal-resource (MAR) composts at temperatures ranging from 30 to 65 °C. At relatively low temperatures butyric acid accumulated, whereas at higher temperatures L-lactic acid was produced. In particular, fermentation at 50 °C produced 34.5 g L(-1) L-lactic acid with 90% lactic acid selectivity and 100% optical purity. Denaturing gradient gel electrophoresis indicated that dominant bacteria present in the original MAR composts diminished rapidly and Bacillus coagulans strains became the dominant contributors to L-lactic acid production at 45, 50 and 55 °C. This is the first report of the achievement of 100% optical purity of L-lactic acid using a bacterial consortium.

  4. Production of lactic acid from paper sludge using acid-tolerant, thermophilic Bacillus coagulan strains.

    PubMed

    Budhavaram, Naresh K; Fan, Zhiliang

    2009-12-01

    Production of lactic acid from paper sludge was studied using thermophilic Bacillus coagulan strains 36D1 and P4-102B. More than 80% of lactic acid yield and more than 87% of cellulose conversion were achieved using both strains without any pH control due to the buffering effect of CaCO(3) in paper sludge. The addition of CaCO(3) as the buffering reagent in rich medium increased lactic acid yield but had little effect on cellulose conversion; when lean medium was utilized, the addition of CaCO(3) had little effect on either cellulose conversion or lactic acid yield. Lowering the fermentation temperature lowered lactic acid yield but increased cellulose conversion. Semi-continuous simultaneous saccharification and co-fermentation (SSCF) using medium containing 100 g/L cellulose equivalent paper sludge without pH control was carried out in serum bottles for up to 1000 h. When rich medium was utilized, the average lactic acid concentrations in steady state for strains 36D1 and P4-102B were 92 g/L and 91.7 g/L, respectively, and lactic acid yields were 77% and 78%. The average lactic acid concentrations produced using semi-continuous SSCF with lean medium were 77.5 g/L and 77.0 g/L for strains 36D1 and P4-102B, respectively, and lactic acid yields were 72% and 75%. The productivities at steady state were 0.96 g/L/h and 0.82 g/L/h for both strains in rich medium and lean medium, respectively. Our data support that B. coagulan strains 36D1 and P4-102B are promising for converting paper sludge to lactic acid via SSCF.

  5. Strain ŽP - the first bacterial conjugation-based "kill"-"anti-kill" antimicrobial system.

    PubMed

    Starčič Erjavec, Marjanca; Petkovšek, Živa; Kuznetsova, Marina V; Maslennikova, Irina L; Žgur-Bertok, Darja

    2015-11-01

    As multidrug resistant bacteria pose one of the greatest risks to human health new alternative antibacterial agents are urgently needed. One possible mechanism that can be used as an alternative to traditional antibiotic therapy is transfer of killing agents via conjugation. Our work was aimed at providing a proof of principle that conjugation-based antimicrobial systems are possible. We constructed a bacterial conjugation-based "kill"-"anti-kill" antimicrobial system employing the well known Escherichia coli probiotic strain Nissle 1917 genetically modified to harbor a conjugative plasmid carrying the "kill" gene (colicin ColE7 activity gene) and a chromosomally encoded "anti-kill" gene (ColE7 immunity gene). The constructed strain acts as a donor in conjugal transfer and its efficiency was tested in several types of conjugal assays. Our results clearly demonstrate that conjugation-based antimicrobial systems can be highly efficient. PMID:26436830

  6. Exposure to bacterial endotoxin generates a distinct strain of α-synuclein fibril

    PubMed Central

    Kim, Changyoun; Lv, Guohua; Lee, Jun Sung; Jung, Byung Chul; Masuda-Suzukake, Masami; Hong, Chul-Suk; Valera, Elvira; Lee, He-Jin; Paik, Seung R.; Hasegawa, Masato; Masliah, Eliezer; Eliezer, David; Lee, Seung-Jae

    2016-01-01

    A single amyloidogenic protein is implicated in multiple neurological diseases and capable of generating a number of aggregate “strains” with distinct structures. Among the amyloidogenic proteins, α-synuclein generates multiple patterns of proteinopathies in a group of diseases, such as Parkinson disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA). However, the link between specific conformations and distinct pathologies, the key concept of the strain hypothesis, remains elusive. Here we show that in the presence of bacterial endotoxin, lipopolysaccharide (LPS), α-synuclein generated a self-renewable, structurally distinct fibril strain that consistently induced specific patterns of synucleinopathies in mice. These results suggest that amyloid fibrils with self-renewable structures cause distinct types of proteinopathies despite the identical primary structure and that exposure to exogenous pathogens may contribute to the diversity of synucleinopathies. PMID:27488222

  7. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens.

    PubMed

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R; Barany, Francis; Soper, Steven A

    2012-09-21

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft(3)). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic

  8. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens.

    PubMed

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R; Barany, Francis; Soper, Steven A

    2012-09-21

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft(3)). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic

  9. Modular microfluidic system fabricated in thermoplastics for the strain-specific detection of bacterial pathogens†

    PubMed Central

    Chen, Yi-Wen; Wang, Hong; Hupert, Mateusz; Witek, Makgorzata; Dharmasiri, Udara; Pingle, Maneesh R.; Barany, Francis

    2015-01-01

    The recent outbreaks of a lethal E. coli strain in Germany have aroused renewed interest in developing rapid, specific and accurate systems for detecting and characterizing bacterial pathogens in suspected contaminated food and/or water supplies. To address this need, we have designed, fabricated and tested an integrated modular-based microfluidic system and the accompanying assay for the strain-specific identification of bacterial pathogens. The system can carry out the entire molecular processing pipeline in a single disposable fluidic cartridge and detect single nucleotide variations in selected genes to allow for the identification of the bacterial species, even its strain with high specificity. The unique aspect of this fluidic cartridge is its modular format with task-specific modules interconnected to a fluidic motherboard to permit the selection of the target material. In addition, to minimize the amount of finishing steps for assembling the fluidic cartridge, many of the functional components were produced during the polymer molding step used to create the fluidic network. The operation of the cartridge was provided by electronic, mechanical, optical and hydraulic controls located off-chip and packaged into a small footprint instrument (1 ft3). The fluidic cartridge was capable of performing cell enrichment, cell lysis, solid-phase extraction (SPE) of genomic DNA, continuous flow (CF) PCR, CF ligase detection reaction (LDR) and universal DNA array readout. The cartridge was comprised of modules situated on a fluidic motherboard; the motherboard was made from polycarbonate, PC, and used for cell lysis, SPE, CF PCR and CF LDR. The modules were task-specific units and performed universal zip-code array readout or affinity enrichment of the target cells with both made from poly(methylmethacrylate), PMMA. Two genes, uidA and sipB/C, were used to discriminate between E. coli and Salmonella, and evaluated as a model system. Results showed that the fluidic system

  10. [Colonization and disease control and fruit preservation functions of endophytic bacterial strains in lychee].

    PubMed

    Cai, Xue-qing; Chen, Wei; Lin, Na; Lin, Tong; Hu, Fang-ping

    2011-08-01

    By spraying the GFP-marked endophytic bacterial strains BS-2-gfp and TB2-gfp, this paper studied their colonization in lychee organs and the functions of the strains in disease control and fruit preservation. The BS-2-gfp and TB2-gfp could colonize and propagate in lychee leaves, flowers, un-matured fruits, and matured fruits, and transfer from the flowers to un-matured fruits. The colonization of BS-2-gfp and TB2-gfp in lychee leaves varied with season and growth stage, being larger in quantity and longer in duration in spring than in autumn. The colonization quantity and duration of the strains also differed in other organs. Both the BS-2-gfp and the TB2-gfp could be isolated and recovered from lychee leaves after 37 d inoculation, the BS-2-gfp could not be isolated from the flowers after inoculation for 10 d, and the BS-2-gfp and TB2-gfp had the largest colonization quantity in matured fruits. The colonization quantity of TB2-gfp in lychee pericarp reached to the maximum (1.90 x 10(6) CFU x g(-1) FM) when the disease index of litchi downy blight had a sharp increase, and, compared with BS-2-gfp, the TB2-gfp had better fruit preservation efficiency, and its colonization quantity in lychee pericarp was also higher. It was suggested that there was a positive correlation between the colonization quantity of test bacterial strains in lychee pericarp and the disease control and fruit preservation effect.

  11. Metabolism of 2-hydroxy-1-naphthoic acid and naphthalene via gentisic acid by distinctly different sets of enzymes in Burkholderia sp. strain BC1.

    PubMed

    Chowdhury, Piyali Pal; Sarkar, Jayita; Basu, Soumik; Dutta, Tapan K

    2014-05-01

    Burkholderia sp. strain BC1, a soil bacterium, isolated from a naphthalene balls manufacturing waste disposal site, is capable of utilizing 2-hydroxy-1-naphthoic acid (2H1NA) and naphthalene individually as the sole source of carbon and energy. To deduce the pathway for degradation of 2H1NA, metabolites isolated from resting cell culture were identified by a combination of chromatographic and spectrometric analyses. Characterization of metabolic intermediates, oxygen uptake studies and enzyme activities revealed that strain BC1 degrades 2H1NA via 2-naphthol, 1,2,6-trihydroxy-1,2-dihydronaphthalene and gentisic acid. In addition, naphthalene was found to be degraded via 1,2-dihydroxy-1,2-dihydronaphthalene, salicylic acid and gentisic acid, with the putative involvement of the classical nag pathway. Unlike most other Gram-negative bacteria, metabolism of salicylic acid in strain BC1 involves a dual pathway, via gentisic acid and catechol, with the latter being metabolized by catechol 1,2-dioxygenase. Involvement of a non-oxidative decarboxylase in the enzymic transformation of 2H1NA to 2-naphthol indicates an alternative catabolic pathway for the bacterial degradation of hydroxynaphthoic acid. Furthermore, the biochemical observations on the metabolism of structurally similar compounds, naphthalene and 2-naphthol, by similar but different sets of enzymes in strain BC1 were validated by real-time PCR analyses.

  12. [Advances in the progress of anti-bacterial biofilms properties of acetic acid].

    PubMed

    Gao, Xinxin; Jin, Zhenghua; Chen, Xinxin; Yu, Jia'ao

    2016-06-01

    Bacterial biofilms are considered to be the hindrance in the treatment of chronic wound, because of their tolerance toward antibiotics and other antimicrobial agents. They also have strong ability to escape from the host immune attack. Acetic acid, as a kind of organic weak acid, can disturb the biofilms by freely diffusing through the bacterial biofilms and bacterial cell membrane structure. Then the acid dissociates to release the hydrogen ions, leading to the disorder of the acid-base imbalance, change of protein conformation, and the degradation of the DNA within the membranes. This paper reviews the literature on the characteristics and treatment strategies of the bacterial biofilms and the acetic acid intervention on them, so as to demonstrate the roles acetic acid may play in the treatment of chronic wound, and thus provide a convincing treatment strategy for this kind of disease. PMID:27321493

  13. [Advances in the progress of anti-bacterial biofilms properties of acetic acid].

    PubMed

    Gao, Xinxin; Jin, Zhenghua; Chen, Xinxin; Yu, Jia'ao

    2016-06-01

    Bacterial biofilms are considered to be the hindrance in the treatment of chronic wound, because of their tolerance toward antibiotics and other antimicrobial agents. They also have strong ability to escape from the host immune attack. Acetic acid, as a kind of organic weak acid, can disturb the biofilms by freely diffusing through the bacterial biofilms and bacterial cell membrane structure. Then the acid dissociates to release the hydrogen ions, leading to the disorder of the acid-base imbalance, change of protein conformation, and the degradation of the DNA within the membranes. This paper reviews the literature on the characteristics and treatment strategies of the bacterial biofilms and the acetic acid intervention on them, so as to demonstrate the roles acetic acid may play in the treatment of chronic wound, and thus provide a convincing treatment strategy for this kind of disease.

  14. Antibiotic susceptibility of different lactic acid bacteria strains.

    PubMed

    Karapetkov, N; Georgieva, R; Rumyan, N; Karaivanova, E

    2011-12-01

    Five lactic acid bacteria (LAB) strains belonging to species Lactobacillus acidophilus, Lactobacillus helveticus, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus delbrueckii subsp. lactis and Streptococcus thermophilus were tested for their susceptibility to 27 antibiotics. The minimum inhibitory concentrations of each antimicrobial were determined using a microdilution test. Among the strains a high susceptibility was detected for most of the cell-wall synthesis inhibitors (penicillins, cefoxitin and vancomycin) and resistance toward inhibitors of DNA synthesis (trimethoprim/sulfonamides and fluoroquinolones). Generally, the Lactobacillus strains were inhibited by antibiotics such as chloramphenicol, erythromycin and tetracycline at breakpoint levels lower or equal to the levels defined by the European Food Safety Authority. Despite the very similar profile of S. thermophilus LC201 to lactobacilli, the detection of resistance toward erythromycin necessitates the performance of additional tests in order to prove the absence of transferable resistance genes.

  15. Cryptococcus neoformans can utilize the bacterial melanin precursor homogentisic acid for fungal melanogenesis.

    PubMed

    Frases, Susana; Salazar, Angela; Dadachova, Ekaterina; Casadevall, Arturo

    2007-01-01

    Cryptococcus neoformans melanizes in the environment and in mammalian tissues, but the process of melanization in either venue is mysterious given that this microbe produces melanin only from exogenous substrates. Understanding the process of melanization is important because melanization is believed to protect against various stresses in the environment, including UV radiation, and pigment production is associated with virulence. Melanization in C. neoformans requires the availability of diphenolic precursors. In contrast, many bacteria synthesize melanin from homogentisic acid (HGA). We report that C. neoformans strains representing all four serotypes can produce a brown pigment from HGA. The brown pigment was acid resistant and had the electron paramagnetic resonance spectrum of a stable free radical, qualities that identified it as a melanin. Melanin "ghost"-like particles obtained from pigmented C. neoformans cells were hydrophobic, fluorescent under a variety of irradiation wavelengths, negatively charged, insoluble in organic solvents and alcohols, resistant to degradation by strong acids, and vulnerable to bleaching. HGA melanization was laccase dependent and repressed by high concentrations of glucose. The ability of C. neoformans to utilize a bacterial melanin precursor compound suggests a new substrate source for melanization in the environment.

  16. Cryptococcus neoformans Can Utilize the Bacterial Melanin Precursor Homogentisic Acid for Fungal Melanogenesis▿

    PubMed Central

    Frases, Susana; Salazar, Angela; Dadachova, Ekaterina; Casadevall, Arturo

    2007-01-01

    Cryptococcus neoformans melanizes in the environment and in mammalian tissues, but the process of melanization in either venue is mysterious given that this microbe produces melanin only from exogenous substrates. Understanding the process of melanization is important because melanization is believed to protect against various stresses in the environment, including UV radiation, and pigment production is associated with virulence. Melanization in C. neoformans requires the availability of diphenolic precursors. In contrast, many bacteria synthesize melanin from homogentisic acid (HGA). We report that C. neoformans strains representing all four serotypes can produce a brown pigment from HGA. The brown pigment was acid resistant and had the electron paramagnetic resonance spectrum of a stable free radical, qualities that identified it as a melanin. Melanin “ghost”-like particles obtained from pigmented C. neoformans cells were hydrophobic, fluorescent under a variety of irradiation wavelengths, negatively charged, insoluble in organic solvents and alcohols, resistant to degradation by strong acids, and vulnerable to bleaching. HGA melanization was laccase dependent and repressed by high concentrations of glucose. The ability of C. neoformans to utilize a bacterial melanin precursor compound suggests a new substrate source for melanization in the environment. PMID:17098915

  17. Biodegradation of the metallic carcinogen hexavalent chromium Cr(VI) by an indigenously isolated bacterial strain

    PubMed Central

    Mishra, Susmita

    2010-01-01

    Background: Hexavalent chromium [Cr(VI)], a potential mutagen and carcinogen, is regularly introduced into the environment through diverse anthropogenic activities, including electroplating, leather tanning, and pigment manufacturing. Human exposure to this toxic metal ion not only causes potential human health hazards but also affects other life forms. The World Health Organization, the International Agency for Research on Cancer, and the Environmental Protection Agency have determined that Cr(VI) compounds are known human carcinogens. The Sukinda valley in Jajpur District, Orissa, is known for its deposit of chromite ore, producing nearly 98% of the chromite ore in India and one of the prime open cast chromite ore mines in the world (CES, Orissa Newsletter). Materials and Methods: Our investigation involved microbial remediation of Cr(VI) without producing any byproduct. Bacterial cultures tolerating high concentrations of Cr were isolated from the soil sample collected from the chromite-contaminated sites of Sukinda, and their bioaccumulation properties were investigated. Strains capable of growing at 250 mg/L Cr(VI) were considered as Cr resistant. Results: The experimental investigation showed the maximum specific Cr uptake at pH 7 and temperature 30°C. At about 50 mg/L initial Cr(VI) concentrations, uptake of the selected potential strain exceeded 98% within 12 h of incubation. The bacterial isolate was identified by 16S rRNA sequencing as Brevebacterium casei. Conclusion: Results indicated promising approach for microbial remediation of effluents containing elevated levels of Cr(VI). PMID:20976016

  18. An approach to identifying drug resistance associated mutations in bacterial strains

    PubMed Central

    2012-01-01

    Background Drug resistance in bacterial pathogens is an increasing problem, which stimulates research. However, our understanding of drug resistance mechanisms remains incomplete. Fortunately, the fast-growing number of fully sequenced bacterial strains now enables us to develop new methods to identify mutations associated with drug resistance. Results We present a new comparative approach to identify genes and mutations that are likely to be associated with drug resistance mechanisms. In order to test the approach, we collected genotype and phenotype data of 100 fully sequenced strains of S. aureus and 10 commonly used drugs. Then, applying the method, we re-discovered the most common genetic determinants of drug resistance and identified some novel putative associations. Conclusions Firstly, the collected data may help other researchers to develop and verify similar techniques. Secondly, the proposed method is successful in identifying drug resistance determinants. Thirdly, the in-silico identified genetic mutations, which are putatively involved in drug resistance mechanisms, may increase our understanding of the drug resistance mechanisms. PMID:23281931

  19. Evidence of polyethylene biodegradation by bacterial strains from the guts of plastic-eating waxworms.

    PubMed

    Yang, Jun; Yang, Yu; Wu, Wei-Min; Zhao, Jiao; Jiang, Lei

    2014-12-01

    Polyethylene (PE) has been considered nonbiodegradable for decades. Although the biodegradation of PE by bacterial cultures has been occasionally described, valid evidence of PE biodegradation has remained limited in the literature. We found that waxworms, or Indian mealmoths (the larvae of Plodia interpunctella), were capable of chewing and eating PE films. Two bacterial strains capable of degrading PE were isolated from this worm's gut, Enterobacter asburiae YT1 and Bacillus sp. YP1. Over a 28-day incubation period of the two strains on PE films, viable biofilms formed, and the PE films' hydrophobicity decreased. Obvious damage, including pits and cavities (0.3-0.4 μm in depth), was observed on the surfaces of the PE films using scanning electron microscopy (SEM) and atomic force microscopy (AFM). The formation of carbonyl groups was verified using X-ray photoelectron spectroscopy (XPS) and microattenuated total reflectance/Fourier transform infrared (micro-ATR/FTIR) imaging microscope. Suspension cultures of YT1 and YP1 (10(8) cells/mL) were able to degrade approximately 6.1 ± 0.3% and 10.7 ± 0.2% of the PE films (100 mg), respectively, over a 60-day incubation period. The molecular weights of the residual PE films were lower, and the release of 12 water-soluble daughter products was also detected. The results demonstrated the presence of PE-degrading bacteria in the guts of waxworms and provided promising evidence for the biodegradation of PE in the environment.

  20. Bacterial virulence, proinflammatory cytokines and host immunity: how to choose the appropriate Salmonella vaccine strain?

    PubMed

    Raupach, B; Kaufmann, S H

    2001-01-01

    Salmonella infection in its mammalian host can be dissected into two main components. The co-ordinate expression of bacterial virulence genes which are designed to evade, subvert or circumvent the host response on the one hand, and the host defence mechanisms which are designed to restrict bacterial survival and replication on the other hand. The outcome of infection is determined by the one which succeeds in disturbing this equilibrium more efficiently. This delicate balance between Salmonella virulence and host immunity/inflammation has important implications for vaccine development or therapeutic intervention. Novel Salmonella vaccine candidates and live carriers for heterologous antigens are attenuated strains with defined genetic modifications of metabolic or virulence functions. Although genetic defects of different gene loci can lead to similar degrees of attenuation, effects on the course of infection may vary, thereby altering the quality of the elicited immune response. Studies with gene-deficient animals indicate that Salmonella typhimurium strains with mutations in aroA, phoP/phoQ or ssrA/ssrB invoke different immune responses and that a differential repertoire of pro-inflammatory cytokines is required for clearance. Consequently, Salmonella mutants defective in distinct virulence functions offer the potential to specifically modulate the immune response for defined medical applications.

  1. Isolation and characterization of an efficient bacterial cellulose producer strain in agitated culture: Gluconacetobacter hansenii P2A.

    PubMed

    Aydın, Yasar Andelib; Aksoy, Nuran Deveci

    2014-02-01

    In this study, typical niches of acetic acid bacteria were screened for isolation of cellulose producer strains. Hestrin Schramm broth was used as enrichment and production media. Only nine out of 329 isolates formed thick biofilms on liquid surface and were identified as potential cellulose producers. Physiological and biochemical tests proved that all cellulose producers belonged to Gluconacetobacter genus. Most productive and mutation-resistant strain was subjected to 16S rRNA sequence analysis and identified as Gluconacetobacter hansenii P2A due to 99.8 % sequence similarity. X-ray diffraction analysis proved that the biofilm conformed to Cellulose I crystal structure, rich in Iα mass fraction. Static cultivation of G. hansenii P2A in HS medium resulted with 1.89 ± 0.08 g/l of bacterial cellulose production corresponding to 12.0 ± 0.3 % yield in terms of substrate consumption. Shaking and agitation at 120 rpm aided in enhancement of the amount and yield of produced cellulose. Productivity and yield reached up to 3.25 ± 0.11 g/l and 17.20 ± 0.14 % in agitated culture while a slight decrease from 78.7 % to 77.3 % was observed in the crystallinity index. PMID:24190494

  2. Isolation and characterization of an efficient bacterial cellulose producer strain in agitated culture: Gluconacetobacter hansenii P2A.

    PubMed

    Aydın, Yasar Andelib; Aksoy, Nuran Deveci

    2014-02-01

    In this study, typical niches of acetic acid bacteria were screened for isolation of cellulose producer strains. Hestrin Schramm broth was used as enrichment and production media. Only nine out of 329 isolates formed thick biofilms on liquid surface and were identified as potential cellulose producers. Physiological and biochemical tests proved that all cellulose producers belonged to Gluconacetobacter genus. Most productive and mutation-resistant strain was subjected to 16S rRNA sequence analysis and identified as Gluconacetobacter hansenii P2A due to 99.8 % sequence similarity. X-ray diffraction analysis proved that the biofilm conformed to Cellulose I crystal structure, rich in Iα mass fraction. Static cultivation of G. hansenii P2A in HS medium resulted with 1.89 ± 0.08 g/l of bacterial cellulose production corresponding to 12.0 ± 0.3 % yield in terms of substrate consumption. Shaking and agitation at 120 rpm aided in enhancement of the amount and yield of produced cellulose. Productivity and yield reached up to 3.25 ± 0.11 g/l and 17.20 ± 0.14 % in agitated culture while a slight decrease from 78.7 % to 77.3 % was observed in the crystallinity index.

  3. A locked nucleic acid (LNA)-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

    PubMed

    Zhu, Lingxiang; Shen, Dingxia; Zhou, Qiming; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2015-01-01

    Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA)-based quantitative real-time PCR (LNA-qPCR) method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU) per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4%) were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

  4. Regulation of the Pseudomonas sp. Strain ADP Cyanuric Acid Degradation Operon

    PubMed Central

    García-González, Vicente; Govantes, Fernando; Porrúa, Odil; Santero, Eduardo

    2005-01-01

    Pseudomonas sp. strain ADP is the model strain for studying bacterial degradation of the s-triazine herbicide atrazine. In this work, we focused on the expression of the atzDEF operon, involved in mineralization of the central intermediate of the pathway, cyanuric acid. Expression analysis of atzD-lacZ fusions in Pseudomonas sp. strain ADP and Pseudomonas putida showed that atzDEF is subjected to dual regulation in response to nitrogen limitation and cyanuric acid. The gene adjacent to atzD, orf99 (renamed here atzR), encoding a LysR-like regulator, was found to be required for both responses. Expression of atzR-lacZ was induced by nitrogen limitation and repressed by AtzR. Nitrogen regulation of atzD-lacZ and atzR-lacZ expression was dependent on the alternative σ factor σN and NtrC, suggesting that the cyanuric acid degradation operon may be subject to general nitrogen control. However, while atzR is transcribed from a σN-dependent promoter, atzDEF transcription appears to be driven from a σ70-type promoter. Expression of atzR from a heterologous promoter revealed that although NtrC regulation of atzD-lacZ requires the AtzR protein, it is not the indirect result of NtrC-activated AtzR synthesis. We propose that expression of the cyanuric acid degradation operon atzDEF is controlled by means of a complex regulatory circuit in which AtzR is the main activator. AtzR activity is in turn modulated by the presence of cyanuric acid and by a nitrogen limitation signal transduced by the Ntr system. PMID:15601699

  5. Degradation of 3-phenoxybenzoic acid in soil by Pseudomonas pseudoalcaligenes POB310(pPOB) and two modified Pseudomonas strains

    SciTech Connect

    Halden, R.U.; Tepp, S.M.; Halden, B.G.; Dwyer, D.F.

    1999-08-01

    Pseudomonas pseudoalcaligenes POB310(pPOB) and Pseudomonas sp. strains B13-D5(pD30.9) and B13-ST1 (pPOB) were introduced into soil microcosms containing 3-phenoxybenzoic acid (3-POB) in order to evaluate and compare bacterial survival, degradation of 3-POB, and transfer of plasmids to a recipient bacterium. Strain POB310 was isolated for its ability to use 3-POB as a growth substrate; degradation is initiated by POB-dioxygenase, an enzyme encoded on pPOB. Strain B13-D5 contains pD30.9, a cloning vector harboring the genes encoding POB-dioxygenase; strain B13-ST1 contains pPOB. Degradation of 3-POB in soil by strain POB310 was incomplete, and bacterial densities decreased even under the most favorable conditions. Strains B13-D5 and B13-ST1 degraded 3-POB to concentrations of < 50 ppb with concomitant increases in density from 10{sup 6} to 10{sup 8} CFU/g of soil. Thus, in contrast to strain POB310, the modified strains had the following two features that are important for in situ bioremediation: survival in soil and growth concurrent with removal of an environmental contaminant. Strains B13-D5 and B13-ST1 also completely degraded 3-POB when the inoculum was only 30 CFU/g of soil. This suggests that in situ bioremediation may be effected, in some cases, with low densities of introduced bacterial. In pure culture, transfer of pPOB from strains POB310 and B13-ST1 to Pseudomonas sp. strain B13 occurred at frequencies of 5 {times} 10{sup {minus}7} and 10{sup {minus}1} transconjugant per donor, respectively. Transfer of pPOB from strain B13-ST1 to strain B13 was observed in autoclaved soil but not in nonautoclaved soil; formation of transconjugant bacteria was more rapid in soil containing clay and organic matter than in sandy soil. Transfer of pPOB from strain POB310 to strain B13 in soil was never observed.

  6. Appraising bacterial strains for rapid BOD sensing--an empirical test to identify bacterial strains capable of reliably predicting real effluent BODs.

    PubMed

    Webber, Judith B; Noonan, Mike; Pasco, Neil F; Hay, Joanne M

    2011-01-01

    The measured response of rapid biochemical oxygen demand (BOD) biosensors is often not identical to those measured using the conventional 5-day BOD assay. This paper highlights the efficacy of using both glucose-glutamic acid (GGA) and Organisation for Economic Cooperation and Development (OECD) BOD standards as a rapid screen for microorganisms most likely to reliably predict real effluent BODs when used in rapid BOD devices. Using these two synthetic BOD standards, a microorganism was identified that produced comparable BOD response profiles for two assays, the MICREDOX® assay and the conventional 5-day BOD(5) test. A factorial experimental design systematically evaluated the impact of four factors (microbial strain, growth media composition, media strength, and microbial growth phase) on the BOD response profiles using GGA and OECD synthetic standard substrates. An outlier was identified that showed an improved correlation between the MICREDOX® BOD (BOD(sens)) and BOD(5) assays for both the synthetic standards and for real wastewater samples. Microbial strain was the dominant factor influencing BOD(sens) values, with Arthrobacter globiformis single cultures clearly demonstrating superior rapid BOD(sens) response profiles for both synthetic and real waste samples. It was the only microorganism to approach the BOD(5) response for the OECD substrate (171 mg O(2)L(-1)), and also reported BOD values for real waste samples that were comparable to those produced by the BOD(5) test, including discriminating between filtered and unfiltered samples.

  7. Aflatoxin B1 degradation by liquid cultures and lysates of three bacterial strains.

    PubMed

    Adebo, Oluwafemi Ayodeji; Njobeh, Patrick Berka; Sidu, Sibusiso; Tlou, Matsobane Godfrey; Mavumengwana, Vuyo

    2016-09-16

    Aflatoxin contamination remains a daunting issue to address in food safety. In spite of the efforts geared towards prevention and elimination of this toxin, it still persists in agricultural commodities. This has necessitated the search for other measures such as microbial degradation to combat this hazard. In this study, we investigated the biodegradation of aflatoxin B1 (AFB1), using lysates of three bacterial strains (Pseudomonas anguilliseptica VGF1, Pseudomonas fluorescens and Staphylococcus sp. VGF2) isolated from a gold mine aquifer. The bacterial cells were intermittently lysed in the presence and absence of protease inhibitors to obtain protease free lysates, subsequently incubated with AFB1 for 3, 6, 12, 24, and 48h to investigate whether any possible AFB1 degradation occurred using high performance liquid chromatography (HPLC) for detection. Results obtained revealed that after 6h of incubation, protease inhibited lysates of Staphylococcus sp. VGF2 demonstrated the highest degradation capacity of 100%, whereas P. anguilliseptica VGF1 and P. fluorescens lysates degraded AFB1 by 66.5 and 63%, respectively. After further incubation to 12h, no residual AFB1 was detected for all the lysates. Lower degrading ability was however observed for liquid cultures and uninhibited lysates. Data on cytotoxicity studies against human lymphocytes showed that the degraded products were less toxic than the parent AFB1. From this study, it can thus be deduced that the mechanism of degradation by these bacterial lysates is enzymatic. This study shows the efficacy of crude bacterial lysates for detoxifying AFB1 indicating potential for application in the food and feed industry. PMID:27294556

  8. Differing Daphnia magna assimilation efficiencies for terrestrial, bacterial, and algal carbon and fatty acids.

    PubMed

    Taipale, Sami J; Brett, Michael T; Hahn, Martin W; Martin-Creuzburg, Dominik; Yeung, Sean; Hiltunen, Minna; Strandberg, Ursula; Kankaala, Paula

    2014-02-01

    There is considerable interest in the pathways by which carbon and growth-limiting elemental and biochemical nutrients are supplied to upper trophic levels. Fatty acids and sterols are among the most important molecules transferred across the plant-animal interface of food webs. In lake ecosystems, in addition to phytoplankton, bacteria and terrestrial organic matter are potential trophic resources for zooplankton, especially in those receiving high terrestrial organic matter inputs. We therefore tested carbon, nitrogen, and fatty acid assimilation by the crustacean Daphnia magna when consuming these resources. We fed Daphnia with monospecific diets of high-quality (Cryptomonas marssonii) and intermediate-quality (Chlamydomonas sp. and Scenedesmus gracilis) phytoplankton species, two heterotrophic bacterial strains, and particles from the globally dispersed riparian grass, Phragmites australis, representing terrestrial particulate organic carbon (t-POC). We also fed Daphnia with various mixed diets, and compared Daphnia fatty acid, carbon, and nitrogen assimilation across treatments. Our results suggest that bacteria were nutritionally inadequate diets because they lacked sterols and polyunsaturated omega-3 and omega-6 (omega-3 and omega-6) fatty acids (PUFAs). However, Daphnia were able to effectively use carbon and nitrogen from Actinobacteria, if their basal needs for essential fatty acids and sterols were met by phytoplankton. In contrast to bacteria, t-POC contained sterols and omega-6 and omega-3 fatty acids, but only at 22%, 1.4%, and 0.2% of phytoplankton levels, respectively, which indicated that t-POC food quality was especially restricted with regard to omega-3 PUFAs. Our results also showed higher assimilation of carbon than fatty acids from t-POC and bacteria into Daphnia, based on stable-isotope and fatty acids analysis, respectively. A relatively high (>20%) assimilation of carbon and fatty acids from t-POC was observed only when the proportion of t

  9. Biodegradation of endosulfan isomers and its metabolite endosulfate by two biosurfactant producing bacterial strains of Bordetella petrii.

    PubMed

    Odukkathil, Greeshma; Vasudevan, Namasivayam

    2015-01-01

    The main objective of the investigation was to study the biodegradation of endosulfan isomers and its major metabolite endosulfate by two biosurfactant producing bacterial strains of Bordetella petrii. The significance of the study is to evaluate the capability of biosurfactant producing bacterial strains in enhancing the bioavailability of endosulfan. Sixty bacterial strains were isolated from the endosulfan degrading bacterial consortium and were screened for endosulfan degradation and biosurfactant production. Among those, two strains Bordetella petrii I GV 34 (Gene bank Accession No KJ02262) and Bordetella petrii II GV 36 (Gene bank Accession No KJ022625) were capable of degrading endosulfan with simultaneous biosurfactant production. Bordetella petrii I degraded 89% of α and 84% of β isomers of endosulfan whereas Bordetella petrii II degraded 82% of both the isomers. Both the strains were able to reduce the surface tension up to 19.6% and 21.4% with a minimum observed surface tension of 45 Dynes/cm and 44 Dynes/cm, respectively. The study revealed that the strains have the potential to enhance the degradation endosulfan residues in contaminated sites and water by biosurfactant production.

  10. Risk of Spontaneous Bacterial Peritonitis Associated With Gastric Acid Suppression

    PubMed Central

    Chang, Shy-Shin; Lai, Chih-Cheng; Lee, Meng-tse Gabriel; Lee, Yu-Chien; Tsai, Yi-Wen; Hsu, Wan-Ting; Lee, Chien-Chang

    2015-01-01

    Abstract The primary objective of this study was to determine the association between the use of gastric acid suppressants (GAS) and the risk of developing spontaneous bacterial peritonitis (SBP) in patients with advanced liver cirrhosis (LC). A case–control study nested within a cohort of 480,000 representatives of Taiwan National Health Insurance beneficiaries was carried out. A case was matched with 100 controls on age, gender, and index date of SBP diagnosis. GAS use was identified from the 1-year period before the index date. Conditional logistic regression analysis was used to adjust for various unbalanced covariates between users and nonusers of GAS. A total of 947 cases of SBP were identified among the 86,418 patients with advanced LC. A significant increased risk of developing SBP was found to be associated with current (within 30 days), and recent (within 30–90 day) use of 2 different classes of GAS: proton pump inhibitors (PPIs) and histamine 2 receptor antagonists (H2RAs). The confounder adjusted rate ratio (aRR) for the current use of PPIs was 2.77 (95%CI: 1.90–4.04) and H2RAs was 2.62 (95%CI: 2.00–3.42). The risk of SBP attenuated for the recent use of PPIs (aRR: 2.20, 95%CI: 1.60–3.02) or H2RAs (aRR: 1.72, 95%CI: 1.25–2.37). In addition, sensitivity analysis using hospitalized SBP as the primary outcome showed a similar risk for the current use of PPIs (aRR, 3.24; 95%CI: 2.08–5.05) and H2RAs (aRR 2.43; 95%CI 1.71–3.46). Furthermore, higher cumulative days of gastric acid suppression were associated with a higher risk of SBP (trend P < 0.0001). To conclude, exposure to GAS was associated with an increased risk of SBP in patients with advanced LC. The association was more pronounced in current PPI users compared with nonusers. PMID:26039135

  11. Comparison of D-gluconic acid production in selected strains of acetic acid bacteria.

    PubMed

    Sainz, F; Navarro, D; Mateo, E; Torija, M J; Mas, A

    2016-04-01

    The oxidative metabolism of acetic acid bacteria (AAB) can be exploited for the production of several compounds, including D-gluconic acid. The production of D-gluconic acid in fermented beverages could be useful for the development of new products without glucose. In the present study, we analyzed nineteen strains belonging to eight different species of AAB to select those that could produce D-gluconic acid from D-glucose without consuming D-fructose. We tested their performance in three different media and analyzed the changes in the levels of D-glucose, D-fructose, D-gluconic acid and the derived gluconates. D-Glucose and D-fructose consumption and D-gluconic acid production were heavily dependent on the strain and the media. The most suitable strains for our purpose were Gluconobacter japonicus CECT 8443 and Gluconobacter oxydans Po5. The strawberry isolate Acetobacter malorum (CECT 7749) also produced D-gluconic acid; however, it further oxidized D-gluconic acid to keto-D-gluconates.

  12. Genetic and biochemical diversity of Gardnerella vaginalis strains isolated from women with bacterial vaginosis.

    PubMed

    Pleckaityte, Milda; Janulaitiene, Migle; Lasickiene, Rita; Zvirbliene, Aurelija

    2012-06-01

    Gardnerella vaginalis is considered a substantial player in the progression of bacterial vaginosis (BV). We analysed 17 G. vaginalis strains isolated from the genital tract of women diagnosed with BV to establish a potential link between genotypes/biotypes and the expression of virulence factors, vaginolysin (VLY) and sialidase, which are assumed to play a substantial role in the pathogenesis of BV. Amplified ribosomal DNA restriction analysis revealed two G. vaginalis genotypes. Gardnerella vaginalis isolates of genotype 2 appeared more complex than genotype 1 and were subdivided into three subtypes. Biochemical typing allowed us to distinguish four different biotypes. A great diversity of the level of VLY production among the isolates of G. vaginalis may be related to a different cytotoxicity level of the strains. We did not find any correlation between VLY production level and G. vaginalis genotype/biotype. In contrast, a link between G. vaginalis genotype and sialidase production was established. Our findings on the diversity of VLY expression level in different clinical isolates and linking sialidase activity with the genotype of G. vaginalis could help to evaluate the pathogenic potential of different G. vaginalis strains.

  13. Stenotrophomonas maltophilia SeITE02, a New Bacterial Strain Suitable for Bioremediation of Selenite-Contaminated Environmental Matrices▿

    PubMed Central

    Antonioli, Paolo; Lampis, Silvia; Chesini, Irene; Vallini, Giovanni; Rinalducci, Sara; Zolla, Lello; Righetti, Pier Giorgio

    2007-01-01

    Biochemical and proteomic tools have been utilized for investigating the mechanism of action of a new Stenotrophomonas maltophilia strain (SeITE02), a gammaproteobacterium capable of resistance to high concentrations of selenite [SeO32−, Se(IV)], reducing it to nontoxic elemental selenium under aerobic conditions; this strain was previously isolated from a selenite-contaminated mining soil. Biochemical analysis demonstrated that (i) nitrite reductase does not seem to take part in the process of selenite reduction by the bacterial strain SeITE02, although its involvement in this process had been hypothesized in other cases; (ii) nitrite strongly interferes with selenite removal when the two oxyanions (NO2− and SeO32−) are simultaneously present, suggesting that the two reduction/detoxification pathways share a common enzymatic step, probably at the level of cellular transport; (iii) in vitro, selenite reduction does not take place in the membrane or periplasmic fractions but only in the cytoplasm, where maximum activity is exhibited at pH 6.0 in the presence of NADPH; and (iv) glutathione is involved in the selenite reduction mechanism, since inhibition of its synthesis leads to a considerable delay in the onset of reduction. As far as the proteomic findings are concerned, the evidence was reached that 0.2 mM selenite and 16 mM nitrite, when added to the culture medium, caused a significant modulation (ca. 10%, i.e., 96 and 85 protein zones, respectively) of the total proteins visualized in the respective two-dimensional maps. These spots were identified by mass spectrometry analysis and were found to belong to the following functional classes: nucleotide synthesis and metabolism, damaged-protein catabolism, protein and amino acid metabolism, and carbohydrate metabolism along with DNA-related proteins and proteins involved in cell division, oxidative stress, and cell wall synthesis. PMID:17827320

  14. Evolution of the Lactic Acid Bacterial Community during Malt Whisky Fermentation: a Polyphasic Study

    PubMed Central

    van Beek, Sylvie; Priest, Fergus G.

    2002-01-01

    The development of the lactic acid bacterial community in a commercial malt whisky fermentation occurred in three broad phases. Initially, bacteria were inhibited by strong yeast growth. Fluorescence microscopy and environmental scanning electron microscopy revealed, in this early stage, both cocci and rods that were at least partly derived from the wort and yeast but also stemmed from the distillery plant. Denaturing gradient gel electrophoresis (DGGE) of partial 16S rRNA genes and sequence analysis revealed cocci related to Streptococcus thermophilus or Saccharococcus thermophilus, Lactobacillus brevis, and Lactobacillus fermentum. The middle phase began 35 to 40 h after yeast inoculation and was characterized by exponential growth of lactobacilli and residual yeast metabolism. Lactobacillus casei or Lactobacillus paracasei, L. fermentum, and Lactobacillus ferintoshensis were detected in samples of fermenting wort examined by DGGE during this stage. Bacterial growth was accompanied by the accumulation of acetic and lactic acids and the metabolism of residual maltooligosaccharides. By 70 h, two new PCR bands were detected on DGGE gels, and the associated bacteria were largely responsible for the final phase of the fermentation. The bacteria were phylogenetically related to Lactobacillus acidophilus and Lactobacillus delbrueckii, and strains similar to the former had previously been recovered from malt whisky fermentations in Japan. These were probably obligately homofermentative bacteria, required malt wort for growth, and could not be cultured on normal laboratory media, such as MRS. Their metabolism during the last 20 to 30 h of fermentation was associated with yeast death and autolysis and further accumulation of lactate but no additional acetate. PMID:11772639

  15. Evolution of the lactic acid bacterial community during malt whisky fermentation: a polyphasic study.

    PubMed

    van Beek, Sylvie; Priest, Fergus G

    2002-01-01

    The development of the lactic acid bacterial community in a commercial malt whisky fermentation occurred in three broad phases. Initially, bacteria were inhibited by strong yeast growth. Fluorescence microscopy and environmental scanning electron microscopy revealed, in this early stage, both cocci and rods that were at least partly derived from the wort and yeast but also stemmed from the distillery plant. Denaturing gradient gel electrophoresis (DGGE) of partial 16S rRNA genes and sequence analysis revealed cocci related to Streptococcus thermophilus or Saccharococcus thermophilus, Lactobacillus brevis, and Lactobacillus fermentum. The middle phase began 35 to 40 h after yeast inoculation and was characterized by exponential growth of lactobacilli and residual yeast metabolism. Lactobacillus casei or Lactobacillus paracasei, L. fermentum, and Lactobacillus ferintoshensis were detected in samples of fermenting wort examined by DGGE during this stage. Bacterial growth was accompanied by the accumulation of acetic and lactic acids and the metabolism of residual maltooligosaccharides. By 70 h, two new PCR bands were detected on DGGE gels, and the associated bacteria were largely responsible for the final phase of the fermentation. The bacteria were phylogenetically related to Lactobacillus acidophilus and Lactobacillus delbrueckii, and strains similar to the former had previously been recovered from malt whisky fermentations in Japan. These were probably obligately homofermentative bacteria, required malt wort for growth, and could not be cultured on normal laboratory media, such as MRS. Their metabolism during the last 20 to 30 h of fermentation was associated with yeast death and autolysis and further accumulation of lactate but no additional acetate.

  16. Development and application of monoclonal antibodies for in situ detection of indigenous bacterial strains in aquatic ecosystems.

    PubMed Central

    Faude, U C; Höfle, M G

    1997-01-01

    Strain-specific monoclonal antibodies (MAbs) were developed for three different bacterial isolates obtained from a freshwater environment (Lake Plusssee) in the spring of 1990. The three isolates, which were identified by molecular methods, were as follows: Cytophaga johnsonae PX62, Comamonas acidovorans PX54, and Aeromonas hydrophila PU7718. These strains represented three species that were detected in high abundance during a set of mesocosm experiments in Lake Plusssee by the direct analysis of low-molecular-weight RNAs from bacterioplankton. We developed one MAb each for the bacterial isolates PX54 and PU7718 that did not show any cross-reactivity with other bacterial strains by immunofluorescence microscopy. Each MAb recognized the general lipopolysaccharide fraction of the homologous strain. These MAbs were tested successfully for their ability to be used for the in situ detection and counting of bacteria in lake water by immunofluorescence microscopy. During the spring of 1993, A. hydrophila PU7718 showed a depth distribution in Lake Plusssee with a pronounced maximum abundance at 6 m, whereas Comamonas acidovorans PX54 showed a depth distribution with a maximum abundance at the surface. The application of these MAbs to the freshwater samples enabled us to determine the cell morphologies and microhabitats of these strains within their natural environment. The presence of as many as 8,000 cells of these strains per ml in their original habitats 3 years after their initial isolation demonstrated the persistence of individual strains of heterotrophic bacteria over long time spans in pelagic habitats. PMID:9361440

  17. Development and application of monoclonal antibodies for in situ detection of indigenous bacterial strains in aquatic ecosystems.

    PubMed

    Faude, U C; Höfle, M G

    1997-11-01

    Strain-specific monoclonal antibodies (MAbs) were developed for three different bacterial isolates obtained from a freshwater environment (Lake Plusssee) in the spring of 1990. The three isolates, which were identified by molecular methods, were as follows: Cytophaga johnsonae PX62, Comamonas acidovorans PX54, and Aeromonas hydrophila PU7718. These strains represented three species that were detected in high abundance during a set of mesocosm experiments in Lake Plusssee by the direct analysis of low-molecular-weight RNAs from bacterioplankton. We developed one MAb each for the bacterial isolates PX54 and PU7718 that did not show any cross-reactivity with other bacterial strains by immunofluorescence microscopy. Each MAb recognized the general lipopolysaccharide fraction of the homologous strain. These MAbs were tested successfully for their ability to be used for the in situ detection and counting of bacteria in lake water by immunofluorescence microscopy. During the spring of 1993, A. hydrophila PU7718 showed a depth distribution in Lake Plusssee with a pronounced maximum abundance at 6 m, whereas Comamonas acidovorans PX54 showed a depth distribution with a maximum abundance at the surface. The application of these MAbs to the freshwater samples enabled us to determine the cell morphologies and microhabitats of these strains within their natural environment. The presence of as many as 8,000 cells of these strains per ml in their original habitats 3 years after their initial isolation demonstrated the persistence of individual strains of heterotrophic bacteria over long time spans in pelagic habitats. PMID:9361440

  18. Influence of the acid type in the production of chitosan films reinforced with bacterial nanocellulose.

    PubMed

    Velásquez-Cock, J; Ramírez, E; Betancourt, S; Putaux, J-L; Osorio, M; Castro, C; Gañán, P; Zuluaga, R

    2014-08-01

    Chitosan films reinforced with bacterial cellulose (BC) nanoribbons were studied to understand the influence of acid (acetic and lactic acids) on the reinforcing effect. For both acids, the maximum concentration of the reinforcing constituent was 5wt% with respect to the dry weight of chitosan. The infrared spectra, mechanical properties, morphology and antimicrobial activity of the films were analyzed. The results showed a difference between the acids in their behavior and effect on the reinforcement, with a tensile strength of 12.3MPa for the acetic acid films and 3.3MPa for the lactic acid films. Additionally, the bacterial inhibition tests were shown to be positive for the lactic acid films and negative for the acetic acid films. Therefore, exchanging the acid used in these films may be desirable for certain applications.

  19. Development of amplified fragment length polymorphism-derived functional strain-specific markers to assess the persistence of 10 bacterial strains in soil microcosms.

    PubMed

    Xiang, S-R; Cook, M; Saucier, S; Gillespie, P; Socha, R; Scroggins, R; Beaudette, L A

    2010-11-01

    To augment the information on commercial microbial products, we investigated the persistence patterns of high-priority bacterial strains from the Canadian Domestic Substance List (DSL). Specific DNA markers for each of the 10 DSL bacterial strains were developed using the amplified fragment length polymorphism (AFLP) technique, and the fates of DSL strains introduced in soil were assessed by real-time quantitative PCR (qPCR). The results indicated that all DNA markers had high specificity at the functional strain level and that detection of the target microorganisms was sensitive at a detection limitation range from 1.3 × 10² to 3.25 × 10⁵ CFU/g of dry soil. The results indicated that all introduced strains showed a trend toward a declining persistence in soil and could be categorized into three pattern types. The first type was long-term persistence exemplified by Pseudomonas stutzeri (ATCC 17587) and Pseudomonas denitrificans (ATCC 13867) strains. In the second pattern, represented by Bacillus subtilis (ATCC 6051) and Escherichia hermannii (ATCC 700368), the inoculated strain populations dropped dramatically below the detection threshold after 10 to 21 days, while in the third pattern there was a gradual decrease, with the population falling below the detectable level within the 180-day incubation period. These patterns indicate a selection effect of a microbial community related to the ecological function of microbial strains introduced in soil. As a key finding, the DSL strains can be quantitatively tracked in soil with high sensitivity and specificity at the functional strain level. This provides the basic evidence for further risk assessment of the priority DSL strains.

  20. A suite of recombinant luminescent bacterial strains for the quantification of bioavailable heavy metals and toxicity testing

    PubMed Central

    2009-01-01

    Background Recombinant whole-cell sensors have already proven useful in the assessment of the bioavailability of environmental pollutants like heavy metals and organic compounds. In this work 19 recombinant bacterial strains representing various Gram-positive (Staphylococcus aureus and Bacillus subtilis) and Gram-negative (Escherichia coli, Pseudomonas fluorescens) bacteria were constructed to express the luminescence encoding genes luxCDABE (from Photorhabdus luminescens) as a response to bioavailable heavy metals ("lights-on" metal sensors containing metal-response elements, 13 strains) or in a constitutive manner ("lights-off" constructs, 6 strains). Results The bioluminescence of all 13 "lights-on" metal sensor strains was expressed as a function of the sub-toxic metal concentrations enabling the quantitative determination of metals bioavailable for these strains. Five sensor strains, constructed for detecting copper and mercury, proved to be target metal specific, whereas eight other sensor strains were simultaneously induced by Cd2+, Hg2+, Zn2+and Pb2+. The lowest limits of determination of the "lights-on" sensor strains for the metals tested in this study were (μg l-1): 0.002 of CH3HgCl, 0.03 of HgCl2, 1.8 of CdCl2, 33 of Pb(NO3)2, 1626 of ZnSO4, 24 of CuSO4 and 340 of AgNO3. In general, the sensitivity of the "lights-on" sensor strains was mostly dependent on the metal-response element used while the selection of host bacterium played a relatively minor role. In contrast, toxicity of metals to the "lights-off" strains was only dependent on the bacterial host so that Gram-positive strains were remarkably more sensitive than Gram-negative ones. Conclusion The constructed battery of 19 recombinant luminescent bacterial strains exhibits several novel aspects as it contains i) metal sensor strains with similar metal-response elements in different host bacteria; ii) metal sensor strains with metal-response elements in different copies and iii) a "lights

  1. Data on true tRNA diversity among uncultured and bacterial strains

    PubMed Central

    Rekadwad, Bhagwan N.; Khobragade, Chandrahasya N.

    2016-01-01

    Complete genome sequences of two uncultured archaea (BX649197 and CR937008) and 10 uncultured bacteria (AC160099, FP245538-FP245540, FP312972, FP312974-75, FP312977, FP312985 and NZ_JPJG01000067) were used for creation of digital data of tRNA. tRNAscan-SE and ENDMEMO GC calculating tools were used for detection of tRNA, drawing their structures and calculation of GC percent. Seven archaeal and 48 bacterial tRNA were detected from above 12 sequences. Four archaeal and 30 bacterial tRNA showed cove score more than 20% are called as true tRNA. Three tRNA of uncultured bacteria (AC160099) has the presence of the variable loop. The tRNA of FP245540, FP245575, FP245577 and FP245585 has one variable loop each. The true tRNA of archaea were Alanine, Arginine and Cysteine-type tRNA, while the majority of bacteria true tRNA classified as Alanine, Glutamic acid, Isoleucine, Leucine, Methionine, Phenylalanine, Proline and Valine-type tRNA with cove score ranged from 70% to 97.15%. Archaeal and bacterial have GC content approximately 43% and 34.7–63.3% respectively. Archaeal tRNA has 60.4–64.2% GC content. Similarly, bacterial tRNA contributed 49.3–66.3% GC content to the total GC content. This generated data is useful for studies on diversity of tRNA among prokaryotes. PMID:27222849

  2. Selected Bacterial Strains Protect Artemia spp. from the Pathogenic Effects of Vibrio proteolyticus CW8T2

    PubMed Central

    Verschuere, Laurent; Heang, Hanglamong; Criel, Godelieve; Sorgeloos, Patrick; Verstraete, Willy

    2000-01-01

    In this study Vibrio proteolyticus CW8T2 has been identified as a virulent pathogen for Artemia spp. Its infection route has been visualized with transmission electron microscopy. The pathogen affected microvilli and gut epithelial cells, disrupted epithelial cell junctions, and reached the body cavity, where it devastated cells and tissues. In vivo antagonism tests showed that preemptive colonization of the culture water with nine selected bacterial strains protected Artemia juveniles against the pathogenic effects. Two categories of the selected strains could be distinguished: (i) strains providing total protection, as no mortality occurred 2 days after the experimental infection with V. proteolyticus CW8T2, with strain LVS8 as a representative, and (ii) strains providing partial protection, as significant but not total mortality was observed, with strain LVS2 as a representative. The growth of V. proteolyticus CW8T2 in the culture medium was slowed down in the presence of strains LVS2 and LVS8, but growth suppression was distinctly higher with LVS8 than with LVS2. It was striking that the strains that gave only partial protection against the pathogen in the in vivo antagonism test showed also a restricted capability to colonize the Artemia compared to the strains providing total protection. The in vivo antagonism tests and the filtrate experiments showed that probably no extracellular bacterial compounds were involved in the protective action but that the living cells were required to protect Artemia against V. proteolyticus CW8T2. PMID:10698783

  3. Effectiveness of 5-Pyrrolidone-2-carboxylic Acid and Copper Sulfate Pentahydrate Association against Drug Resistant Staphylococcus Strains.

    PubMed

    Governa, Paolo; Miraldi, Elisabetta; De Fina, Gianna; Biagi, Marco

    2016-04-01

    Bacterial resistance is an ongoing challenge for pharmacotherapy and pharmaceutical chemistry. Staphylococcus aureus is the bacterial species which makes it most difficult to treat skin and soft tissue infections and it is seen in thousands of hospitalization cases each year. Severe but often underrated infectious diseases, such as complicated nasal infections, are primarily caused by MRSA and S. epidermidis too. With the aim of studying new drugs with antimicrobial activity and effectiveness on drug resistant Staphylococcus strains, our attention in this study was drawn on the activity of a new association between two natural products: 5-pyrrolidone-2-carboxylic acid (PCA), naturally produced by certain Lactobacillus species, and copper sulfate pentahydrate (CS). The antimicrobial susceptibility test was conducted taking into account 12 different Staphylococcus strains, comprising 6 clinical isolates and 6 resistant strains. PCA 4%, w/w, and CS 0.002%, w/w, association in distilled water solution was found to have bactericidal activity against all tested strains. Antimicrobial kinetics highlighted that PCA 4%, w/w, and CS 0.002% association could reduce by 5 log10 viable bacterial counts of MRSA and oxacillin resistant S. epidennidis in less than 5 and 3 minutes respectively. Microscopic investigations suggest a cell wall targeting mechanism of action. Being very safe and highly tolerated, the natural product PCA and CS association proved to be a promising antimicrobial agent to treat Staphylococcus related infections. PMID:27396191

  4. Effectiveness of 5-Pyrrolidone-2-carboxylic Acid and Copper Sulfate Pentahydrate Association against Drug Resistant Staphylococcus Strains.

    PubMed

    Governa, Paolo; Miraldi, Elisabetta; De Fina, Gianna; Biagi, Marco

    2016-04-01

    Bacterial resistance is an ongoing challenge for pharmacotherapy and pharmaceutical chemistry. Staphylococcus aureus is the bacterial species which makes it most difficult to treat skin and soft tissue infections and it is seen in thousands of hospitalization cases each year. Severe but often underrated infectious diseases, such as complicated nasal infections, are primarily caused by MRSA and S. epidermidis too. With the aim of studying new drugs with antimicrobial activity and effectiveness on drug resistant Staphylococcus strains, our attention in this study was drawn on the activity of a new association between two natural products: 5-pyrrolidone-2-carboxylic acid (PCA), naturally produced by certain Lactobacillus species, and copper sulfate pentahydrate (CS). The antimicrobial susceptibility test was conducted taking into account 12 different Staphylococcus strains, comprising 6 clinical isolates and 6 resistant strains. PCA 4%, w/w, and CS 0.002%, w/w, association in distilled water solution was found to have bactericidal activity against all tested strains. Antimicrobial kinetics highlighted that PCA 4%, w/w, and CS 0.002% association could reduce by 5 log10 viable bacterial counts of MRSA and oxacillin resistant S. epidennidis in less than 5 and 3 minutes respectively. Microscopic investigations suggest a cell wall targeting mechanism of action. Being very safe and highly tolerated, the natural product PCA and CS association proved to be a promising antimicrobial agent to treat Staphylococcus related infections.

  5. A strain of the bacterial symbiont Regiella insecticola protects aphids against parasitoids.

    PubMed

    Vorburger, Christoph; Gehrer, Lukas; Rodriguez, Paula

    2010-02-23

    Aphids commonly harbour facultative bacterial endosymbionts and may benefit from their presence through increased resistance to parasitoids. This has been demonstrated for Hamiltonella defensa and Serratia symbiotica, while a third common endosymbiont, Regiella insecticola, did not provide such protection. However, this symbiont was recently detected in a highly resistant clone of the peach-potato aphid, Myzus persicae, from Australia. To test if resistance was indeed conferred by the endosymbiont, we eliminated it from this clone with antibiotics, and we transferred it to two other clones of the same and one clone of a different aphid species (Aphis fabae). Exposing these lines to the parasitoid Aphidius colemani showed clearly that unlike other strains of this bacterium, this specific isolate of R. insecticola provides strong protection against parasitic wasps, suggesting that the ability to protect their host against natural enemies may evolve readily in multiple species of endosymbiotic bacteria.

  6. Bacterial phagocytosis by macrophages from lipopolysaccharide responder and nonresponder mouse strains.

    PubMed Central

    Cuffini, A; Carlone, N A; Forni, G

    1980-01-01

    The phagocytic capacity of macrophages from C3H/H3J mice was assessed against lipopolysaccharide-producing (Escherichia coli) and -nonproducing (Staphylococcus aureus) bacteria. Despite their gene-coded unresponsiveness to lipopolysaccharide endotoxin and lymphokines and their defective tumoricidal activity, proteose peptone-induced C3H/HeJ macrophages did not display a defective phagocytic capacity, but rather displayed an enhanced phagocytosis of both bacterial strains compared with macrophages from closely related C3H/HeN mice. Unstimulated peritoneal resident C3H/HeJ macrophages, on the other hand, displayed a normal phagocytic activity toward E. coli and enhanced phagocytosis toward S. aureus. PMID:6995321

  7. In vitro antimicrobial activity of marbofloxacin and enrofloxacin against bacterial strains isolated from companion animals.

    PubMed

    Farca, A M; Cavana, P; Robino, P; Nebbia, P

    2007-06-01

    Fluoroquinolones were originally developed for the Gram-negative aerobic spectrum, but the newer generation agents are also highly effective against some Gram-positive pathogens and cause few adverse effects. Owing to these characteristics, fluoroquinolones are often used in first line therapy in small animal practice. However, their widespread use has raised concern over emerging bacterial resistance. In this study we evaluated the in vitro efficacy of two fluoroquinolones, marbofloxacin and enrofloxacin, on field strains isolated from clinical infections between 2002 and 2005. Our data show that most of the isolates are still sensitive to both antimicrobials and marbofloxacin was more effective than enrofloxacin, especially against P. aeruginosa and beta-Streptococci (P < 0.01). beta-Streptococci demonstrated the greatest resistance to the two study drugs.

  8. Aerobic digestion of tannery wastewater in a sequential batch reactor by salt-tolerant bacterial strains

    NASA Astrophysics Data System (ADS)

    Durai, G.; Rajasimman, M.; Rajamohan, N.

    2011-09-01

    Among the industries generating hyper saline effluents, tanneries are prominent in India. Hyper saline wastewater is difficult to treat by conventional biological treatment methods. Salt-tolerant microbes can adapt to these conditions and degrade the organics in hyper saline wastewater. In this study, the performance of a bench scale aerobic sequencing batch reactor (SBR) was investigated to treat the tannery wastewater by the salt-tolerant bacterial strains namely Pseudomonas aeruginosa, Bacillus flexus, Exiguobacterium homiense and Styphylococcus aureus. The study was carried out under different operating conditions by changing the hydraulic retention time, organic loading rate and initial substrate concentration. From the results it was found that a maximum COD reduction of 90.4% and colour removal of 78.6% was attained. From this study it was found that the salt-tolerant microorganisms could improve the reduction efficiency of COD and colour of the tannery wastewater.

  9. Inhibition of food-borne bacterial pathogens by bacteriocins from lactic acid bacteria isolated from meat.

    PubMed Central

    Lewus, C B; Kaiser, A; Montville, T J

    1991-01-01

    Ten strains of bacteriocin-producing lactic acid bacteria were isolated from retail cuts of meat. These 10 strains along with 11 other bacteriocin-producing lactic acid bacteria were tested for inhibitory activity against psychotrophic pathogens, including four strains of Listeria monocytogenes, two strains of Aeromonas hydrophila, and two strains of Staphylococcus aureus. Inhibition due to acid, hydrogen peroxide, and lytic bacteriophage were excluded. The proteinaceous nature of the inhibitory substance was confirmed by demonstration of its sensitivity to proteolytic enzymes. Eight of the meat isolates had inhibitory activity against all four L. monocytogenes strains. Bacteriocin activity against L. monocytogenes was found in all of the strains obtained from other sources. Activity against A. hydrophila and S. aureus was also common. Images PMID:1908209

  10. Evidence of polyethylene biodegradation by bacterial strains from the guts of plastic-eating waxworms.

    PubMed

    Yang, Jun; Yang, Yu; Wu, Wei-Min; Zhao, Jiao; Jiang, Lei

    2014-12-01

    Polyethylene (PE) has been considered nonbiodegradable for decades. Although the biodegradation of PE by bacterial cultures has been occasionally described, valid evidence of PE biodegradation has remained limited in the literature. We found that waxworms, or Indian mealmoths (the larvae of Plodia interpunctella), were capable of chewing and eating PE films. Two bacterial strains capable of degrading PE were isolated from this worm's gut, Enterobacter asburiae YT1 and Bacillus sp. YP1. Over a 28-day incubation period of the two strains on PE films, viable biofilms formed, and the PE films' hydrophobicity decreased. Obvious damage, including pits and cavities (0.3-0.4 μm in depth), was observed on the surfaces of the PE films using scanning electron microscopy (SEM) and atomic force microscopy (AFM). The formation of carbonyl groups was verified using X-ray photoelectron spectroscopy (XPS) and microattenuated total reflectance/Fourier transform infrared (micro-ATR/FTIR) imaging microscope. Suspension cultures of YT1 and YP1 (10(8) cells/mL) were able to degrade approximately 6.1 ± 0.3% and 10.7 ± 0.2% of the PE films (100 mg), respectively, over a 60-day incubation period. The molecular weights of the residual PE films were lower, and the release of 12 water-soluble daughter products was also detected. The results demonstrated the presence of PE-degrading bacteria in the guts of waxworms and provided promising evidence for the biodegradation of PE in the environment. PMID:25384056

  11. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants

    PubMed Central

    Berni Canani, Roberto; Sangwan, Naseer; Stefka, Andrew T; Nocerino, Rita; Paparo, Lorella; Aitoro, Rosita; Calignano, Antonio; Khan, Aly A; Gilbert, Jack A; Nagler, Cathryn R

    2016-01-01

    Dietary intervention with extensively hydrolyzed casein formula supplemented with Lactobacillus rhamnosus GG (EHCF+LGG) accelerates tolerance acquisition in infants with cow's milk allergy (CMA). We examined whether this effect is attributable, at least in part, to an influence on the gut microbiota. Fecal samples from healthy controls (n=20) and from CMA infants (n=19) before and after treatment with EHCF with (n=12) and without (n=7) supplementation with LGG were compared by 16S rRNA-based operational taxonomic unit clustering and oligotyping. Differential feature selection and generalized linear model fitting revealed that the CMA infants have a diverse gut microbial community structure dominated by Lachnospiraceae (20.5±9.7%) and Ruminococcaceae (16.2±9.1%). Blautia, Roseburia and Coprococcus were significantly enriched following treatment with EHCF and LGG, but only one genus, Oscillospira, was significantly different between infants that became tolerant and those that remained allergic. However, most tolerant infants showed a significant increase in fecal butyrate levels, and those taxa that were significantly enriched in these samples, Blautia and Roseburia, exhibited specific strain-level demarcations between tolerant and allergic infants. Our data suggest that EHCF+LGG promotes tolerance in infants with CMA, in part, by influencing the strain-level bacterial community structure of the infant gut. PMID:26394008

  12. Detection of low-abundance bacterial strains in metagenomic datasets by eigengenome partitioning.

    PubMed

    Cleary, Brian; Brito, Ilana Lauren; Huang, Katherine; Gevers, Dirk; Shea, Terrance; Young, Sarah; Alm, Eric J

    2015-10-01

    Analyses of metagenomic datasets that are sequenced to a depth of billions or trillions of bases can uncover hundreds of microbial genomes, but naive assembly of these data is computationally intensive, requiring hundreds of gigabytes to terabytes of RAM. We present latent strain analysis (LSA), a scalable, de novo pre-assembly method that separates reads into biologically informed partitions and thereby enables assembly of individual genomes. LSA is implemented with a streaming calculation of unobserved variables that we call eigengenomes. Eigengenomes reflect covariance in the abundance of short, fixed-length sequences, or k-mers. As the abundance of each genome in a sample is reflected in the abundance of each k-mer in that genome, eigengenome analysis can be used to partition reads from different genomes. This partitioning can be done in fixed memory using tens of gigabytes of RAM, which makes assembly and downstream analyses of terabytes of data feasible on commodity hardware. Using LSA, we assemble partial and near-complete genomes of bacterial taxa present at relative abundances as low as 0.00001%. We also show that LSA is sensitive enough to separate reads from several strains of the same species. PMID:26368049

  13. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants.

    PubMed

    Berni Canani, Roberto; Sangwan, Naseer; Stefka, Andrew T; Nocerino, Rita; Paparo, Lorella; Aitoro, Rosita; Calignano, Antonio; Khan, Aly A; Gilbert, Jack A; Nagler, Cathryn R

    2016-03-01

    Dietary intervention with extensively hydrolyzed casein formula supplemented with Lactobacillus rhamnosus GG (EHCF+LGG) accelerates tolerance acquisition in infants with cow's milk allergy (CMA). We examined whether this effect is attributable, at least in part, to an influence on the gut microbiota. Fecal samples from healthy controls (n=20) and from CMA infants (n=19) before and after treatment with EHCF with (n=12) and without (n=7) supplementation with LGG were compared by 16S rRNA-based operational taxonomic unit clustering and oligotyping. Differential feature selection and generalized linear model fitting revealed that the CMA infants have a diverse gut microbial community structure dominated by Lachnospiraceae (20.5±9.7%) and Ruminococcaceae (16.2±9.1%). Blautia, Roseburia and Coprococcus were significantly enriched following treatment with EHCF and LGG, but only one genus, Oscillospira, was significantly different between infants that became tolerant and those that remained allergic. However, most tolerant infants showed a significant increase in fecal butyrate levels, and those taxa that were significantly enriched in these samples, Blautia and Roseburia, exhibited specific strain-level demarcations between tolerant and allergic infants. Our data suggest that EHCF+LGG promotes tolerance in infants with CMA, in part, by influencing the strain-level bacterial community structure of the infant gut.

  14. Detection of low-abundance bacterial strains in metagenomic datasets by eigengenome partitioning.

    PubMed

    Cleary, Brian; Brito, Ilana Lauren; Huang, Katherine; Gevers, Dirk; Shea, Terrance; Young, Sarah; Alm, Eric J

    2015-10-01

    Analyses of metagenomic datasets that are sequenced to a depth of billions or trillions of bases can uncover hundreds of microbial genomes, but naive assembly of these data is computationally intensive, requiring hundreds of gigabytes to terabytes of RAM. We present latent strain analysis (LSA), a scalable, de novo pre-assembly method that separates reads into biologically informed partitions and thereby enables assembly of individual genomes. LSA is implemented with a streaming calculation of unobserved variables that we call eigengenomes. Eigengenomes reflect covariance in the abundance of short, fixed-length sequences, or k-mers. As the abundance of each genome in a sample is reflected in the abundance of each k-mer in that genome, eigengenome analysis can be used to partition reads from different genomes. This partitioning can be done in fixed memory using tens of gigabytes of RAM, which makes assembly and downstream analyses of terabytes of data feasible on commodity hardware. Using LSA, we assemble partial and near-complete genomes of bacterial taxa present at relative abundances as low as 0.00001%. We also show that LSA is sensitive enough to separate reads from several strains of the same species.

  15. Biotransformation of tetracycline by a novel bacterial strain Stenotrophomonas maltophilia DT1.

    PubMed

    Leng, Yifei; Bao, Jianguo; Chang, Gaofeng; Zheng, Han; Li, Xingxing; Du, Jiangkun; Snow, Daniel; Li, Xu

    2016-11-15

    Although several abiotic processes have been reported that can transform antibiotics, little is known about whether and how microbiological processes may degrade antibiotics in the environment. This work isolated one tetracycline degrading bacterial strain, Stenotrophomonas maltophilia strain DT1, and characterized the biotransformation of tetracycline by DT1 under various environmental conditions. The biotransformation rate was the highest when the initial pH was 9 and the reaction temperature was at 30°C, and can be described using the Michaelis-Menten model under different initial tetracycline concentrations. When additional substrate was present, the substrate that caused increased biomass resulted in a decreased biotransformation rate of tetracycline. According to disk diffusion tests, the biotransformation products of tetracycline had lower antibiotic potency than the parent compound. Six possible biotransformation products were identified, and a potential biotransformation pathway was proposed that included sequential removal of N-methyl, carbonyl, and amine function groups. Results from this study can lead to better estimation of the fate and transport of antibiotics in the environment and has the potential to be utilized in designing engineering processes to remove tetracycline from water and soil. PMID:27420384

  16. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants

    DOE PAGES

    Berni Canani, Roberto; Sangwan, Naseer; Stefka, Andrew T.; Nocerino, Rita; Paparo, Lorella; Aitoro, Rosita; Calignano, Antonio; Khan, Aly A.; Gilbert, Jack A.; Nagler, Cathryn R.

    2015-09-22

    Dietary intervention with extensively hydrolyzed casein formula supplemented with Lactobacillus rhamnosus GG (EHCF+LGG) accelerates tolerance acquisition in infants with cow’s milk allergy (CMA). We examined whether this effect is attributable, at least in part, to an influence on the gut microbiota. Fecal samples from healthy controls (n=20) and from CMA infants (n=19) before and after treatment with EHCF with (n=12) and without (n=7) supplementation with LGG were compared by 16S rRNA-based operational taxonomic unit clustering and oligotyping. Differential feature selection and generalized linear model fitting revealed that the CMA infants have a diverse gut microbial community structure dominated by Lachnospiraceaemore » (20.5±9.7%) and Ruminococcaceae (16.2±9.1%). Blautia, Roseburia and Coprococcus were significantly enriched following treatment with EHCF and LGG, but only one genus, Oscillospira, was significantly different between infants that became tolerant and those that remained allergic. However, most tolerant infants showed a significant increase in fecal butyrate levels, and those taxa that were significantly enriched in these samples, Blautia and Roseburia, exhibited specific strain-level demarcations between tolerant and allergic infants. As a result, our data suggest that EHCF+LGG promotes tolerance in infants with CMA, in part, by influencing the strain-level bacterial community structure of the infant gut.« less

  17. Increasing antibiotic resistance in preservative-tolerant bacterial strains isolated from cosmetic products.

    PubMed

    Orús, Pilar; Gomez-Perez, Laura; Leranoz, Sonia; Berlanga, Mercedes

    2015-03-01

    To ensure the microbiological quality, consumer safety and organoleptic properties of cosmetic products, manufacturers need to comply with defined standards using several preservatives and disinfectants. A drawback regarding the use of these preservatives is the possibility of generating cross-insusceptibility to other disinfectants or preservatives, as well as cross resistance to antibiotics. Therefore, the objective of this study was to understand the adaptive mechanisms of Enterobacter gergoviae, Pseudomonas putida and Burkholderia cepacia that are involved in recurrent contamination in cosmetic products containing preservatives. Diminished susceptibility to formaldehyde-donors was detected in isolates but not to other preservatives commonly used in the cosmetics industry, although increasing resistance to different antibiotics (β-lactams, quinolones, rifampicin, and tetracycline) was demonstrated in these strains when compared with the wild-type strain. The outer membrane protein modifications and efflux mechanism activities responsible for the resistance trait were evaluated. The development of antibiotic-resistant microorganisms due to the selective pressure from preservatives included in cosmetic products could be a risk for the emergence and spread of bacterial resistance in the environment. Nevertheless, the large contribution of disinfection and preservation cannot be denied in cosmetic products.

  18. Effects of different fermentation methods on bacterial cellulose and acid production by Gluconacetobacter xylinus in Cantonese-style rice vinegar.

    PubMed

    Fu, Liang; Chen, Siqian; Yi, Jiulong; Hou, Zongxia

    2014-07-01

    A strain of acidogenic bacterium was isolated from the fermentation liquid of Cantonese-style rice vinegar produced by traditional surface fermentation. 16S rDNA identification confirmed the bacterium as Gluconacetobacter xylinus, which synthesizes bacterial cellulose, and the acid productivity of the strain was investigated. In the study, the effects of the membrane integrity and the comparison of the air-liquid interface membrane with immerged membrane on total acidity, cellulose production, alcohol dehydrogenase (ADH) activity and number of bacteria were investigated. The cellulose membrane and the bacteria were observed under SEM for discussing their relationship. The correlations between oxygen consumption and total acid production rate were compared in surface and shake flask fermentation. The results showed the average acid productivity of the strain was 0.02g/(100mL/h), and the integrity of cellulose membrane in surface fermentation had an important effect on total acidity and cellulose production. With a higher membrane integrity, the total acidity after 144 h of fermentation was 3.75 g/100 mL, and the cellulose production was 1.71 g/100 mL after 360 h of fermentation. However, when the membrane was crushed by mechanical force, the total acidity and the cellulose production were as low as 0.36 g/100 mL and 0.14 g/100 mL, respectively. When the cellulose membrane was forced under the surface of fermentation liquid, the total acid production rate was extremely low, but the activity of ADH in the cellulose membrane was basically the same with the one above the liquid surface. The bacteria were mainly distributed in the cellulose membrane during the fermentation. The bacterial counts in surface fermentation were more than in the shake flask fermentation and G. xylinus consumed the substrate faster, in surface fermentation than in shake flask fermentation. The oxygen consumption rate and total acid production rate of surface fermentation were respectively 26

  19. Degradation of 3-Phenoxybenzoic Acid in Soil by Pseudomonas pseudoalcaligenes POB310(pPOB) and Two Modified Pseudomonas Strains

    PubMed Central

    Halden, Rolf U.; Tepp, Sandra M.; Halden, Barbara G.; Dwyer, Daryl F.

    1999-01-01

    Pseudomonas pseudoalcaligenes POB310(pPOB) and Pseudomonas sp. strains B13-D5(pD30.9) and B13-ST1(pPOB) were introduced into soil microcosms containing 3-phenoxybenzoic acid (3-POB) in order to evaluate and compare bacterial survival, degradation of 3-POB, and transfer of plasmids to a recipient bacterium. Strain POB310 was isolated for its ability to use 3-POB as a growth substrate; degradation is initiated by POB-dioxygenase, an enzyme encoded on pPOB. Strain B13-D5 contains pD30.9, a cloning vector harboring the genes encoding POB-dioxygenase; strain B13-ST1 contains pPOB. Degradation of 3-POB in soil by strain POB310 was incomplete, and bacterial densities decreased even under the most favorable conditions (100 ppm of 3-POB, supplementation with P and N, and soil water-holding capacity of 90%). Strains B13-D5 and B13-ST1 degraded 3-POB (10 to 100 ppm) to concentrations of <50 ppb with concomitant increases in density from 106 to 108 CFU/g (dry weight) of soil. Thus, in contrast to strain POB310, the modified strains had the following two features that are important for in situ bioremediation: survival in soil and growth concurrent with removal of an environmental contaminant. Strains B13-D5 and B13-ST1 also completely degraded 3-POB when the inoculum was only 30 CFU/g (dry weight) of soil. This suggests that in situ bioremediation may be effected, in some cases, with low densities of introduced bacteria. In pure culture, transfer of pPOB from strains POB310 and B13-ST1 to Pseudomonas sp. strain B13 occurred at frequencies of 5 × 10−7 and 10−1 transconjugant per donor, respectively. Transfer of pPOB from strain B13-ST1 to strain B13 was observed in autoclaved soil but not in nonautoclaved soil; formation of transconjugant bacteria was more rapid in soil containing clay and organic matter than in sandy soil. Transfer of pPOB from strain POB310 to strain B13 in soil was never observed. PMID:10427019

  20. Rapid Identification of ESKAPE Bacterial Strains Using an Autonomous Microfluidic Device

    PubMed Central

    Ho, Jack Y.; Cira, Nate J.; Crooks, John A.; Baeza, Josue; Weibel, Douglas B.

    2012-01-01

    This article describes Bacteria ID Chips (‘BacChips’): an inexpensive, portable, and autonomous microfluidic platform for identifying pathogenic strains of bacteria. BacChips consist of a set of microchambers and channels molded in the elastomeric polymer, poly(dimethylsiloxane) (PDMS). Each microchamber is preloaded with mono-, di-, or trisaccharides and dried. Pressing the layer of PDMS into contact with a glass coverslip forms the device; the footprint of the device in this article is ∼6 cm2. After assembly, BacChips are degased under large negative pressure and are stored in vacuum-sealed plastic bags. To use the device, the bag is opened, a sample containing bacteria is introduced at the inlet of the device, and the degased PDMS draws the sample into the central channel and chambers. After the liquid at the inlet is consumed, air is drawn into the BacChip via the inlet and provides a physical barrier that separates the liquid samples in adjacent microchambers. A pH indicator is admixed with the samples prior to their loading, enabling the metabolism of the dissolved saccharides in the microchambers to be visualized. Importantly, BacChips operate without external equipment or instruments. By visually detecting the growth of bacteria using ambient light after ∼4 h, we demonstrate that BacChips with ten microchambers containing different saccharides can reproducibly detect the ESKAPE panel of pathogens, including strains of: Enterococcus faecalis, Enteroccocus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter aerogenes, and Enterobacter cloacae. This article describes a BacChip for point-of-care detection of ESKAPE pathogens and a starting point for designing multiplexed assays that identify bacterial strains from clinical samples and simultaneously determine their susceptibility to antibiotics. PMID:22848451

  1. Klebsiella sp. strain C2A isolated from olive oil mill waste is able to tolerate and degrade tannic acid in very high concentrations.

    PubMed

    Pepi, Milva; Cappelli, Serena; Hachicho, Nancy; Perra, Guido; Renzi, Monia; Tarabelli, Alessandro; Altieri, Roberto; Esposito, Alessandro; Focardi, Silvano E; Heipieper, Hermann J

    2013-06-01

    Four bacterial strains capable of growing in the presence of tannic acid as sole carbon and energy source were isolated from olive mill waste mixtures. 16S rRNA gene sequencing assigned them to the genus Klebsiella. The most efficient strain, Klebsiella sp. strain C2A, was able to degrade 3.5 g L(-1) tannic acid within 35 h with synthesizing gallic acid as main product. The capability of Klebsiella sp. strain C2A to produce tannase was evidenced at high concentrations of tannic acid up to 50 g L(-1) . The bacteria adapted to the toxicity of tannic acids by an increase in the membrane lipid fatty acids degree of saturation, especially in the presence of concentrations higher than 20 g L(-1) . The highly tolerant and adaptable bacterial strain characterized in this study could be used in bioremediation processes of wastes rich in polyphenols such as those derived from olive mills, winery or tanneries.

  2. Enhanced treatment of tannery wastewater in an integrated multistage bioreactor (IMBR) by the predominant bacterial strains enriched from marine sediments.

    PubMed

    Huang, Guangdao; Fan, Guofeng; Liu, Guoguang

    2016-01-01

    An innovative integrated multistage bioreactor (IMBR) system, which was augmented with three predominant bacterial strains (Lactobacillus paracasei CL1107, Pichia jadinii CL1705, and Serratia marcescens CL1502) isolated from marine sediments, was developed to treat real tannery wastewater without performing physicochemical pretreatment, with the potential to reduce the generation of waste sludge and odors. The performance of the IMBR treatment system, with and without the inclusion of the predominant bacterial strains, was compared. The results indicated that the performance of the IMBR system without bioaugmentation by the predominant bacterial strains was poor. However, when in the presence of the predominant bacterial strains, the IMBR system exhibited high removal efficiencies of chemical oxygen demand (COD) (97%), NH4(+)-N (97.7%), and total nitrogen (TN) (90%). In addition, the system had the capacity for the simultaneous removal of organics and nitrogen, heterotrophic nitrification and denitrification being carried out concurrently, thereby avoiding the strong inhibition of high concentrations of COD on nitrification. The system possessed excellent adaptability and ability to resist influent loading fluctuations, and had a good alkalinity balance such that it could achieve a high NH4(+)-N, and TN removal efficiency without a supplement of external alkalinity. In addition, an empirical performance modeling of the IMBR system was analyzed. PMID:26901723

  3. Decolourisation of Acid Orange 7 recalcitrant auto-oxidation coloured by-products using an acclimatised mixed bacterial culture.

    PubMed

    Bay, Hui Han; Lim, Chi Kim; Kee, Thuan Chien; Ware, Ismail; Chan, Giek Far; Shahir, Shafinaz; Ibrahim, Zaharah

    2014-03-01

    This study focuses on the biodegradation of recalcitrant, coloured compounds resulting from auto-oxidation of Acid Orange 7 (AO7) in a sequential facultative anaerobic-aerobic treatment system. A novel mixed bacterial culture, BAC-ZS, consisting of Brevibacillus panacihumi strain ZB1, Lysinibacillus fusiformis strain ZB2, and Enterococcus faecalis strain ZL bacteria were isolated from environmental samples. The acclimatisation of the mixed culture was carried out in an AO7 decolourised solution. The acclimatised mixed culture showed 98 % decolourisation within 2 h of facultative anaerobic treatment using yeast extract and glucose as co-substrate. Subsequent aerobic post treatment caused auto-oxidation reaction forming dark coloured compounds that reduced the percentage decolourisation to 73 %. Interestingly, further agitations of the mixed culture in the solution over a period of 48 h significantly decolourise the coloured compounds and increased the decolourisation percentage to 90 %. Analyses of the degradation compounds using UV-visible spectrophotometer, Fourier transform infrared spectroscopy (FTIR) and high performance liquid chromatography (HPLC) showed complete degradation of recalcitrant AO7 by the novel BAC-ZS. Phytotoxicity tests using Cucumis sativus confirmed the dye solution after post aerobic treatment were less toxic compared to the parent dye. The quantitative real-time PCR revealed that E. faecalis strain ZL was the dominant strain in the acclimatised mix culture. PMID:24293297

  4. Decolourisation of Acid Orange 7 recalcitrant auto-oxidation coloured by-products using an acclimatised mixed bacterial culture.

    PubMed

    Bay, Hui Han; Lim, Chi Kim; Kee, Thuan Chien; Ware, Ismail; Chan, Giek Far; Shahir, Shafinaz; Ibrahim, Zaharah

    2014-03-01

    This study focuses on the biodegradation of recalcitrant, coloured compounds resulting from auto-oxidation of Acid Orange 7 (AO7) in a sequential facultative anaerobic-aerobic treatment system. A novel mixed bacterial culture, BAC-ZS, consisting of Brevibacillus panacihumi strain ZB1, Lysinibacillus fusiformis strain ZB2, and Enterococcus faecalis strain ZL bacteria were isolated from environmental samples. The acclimatisation of the mixed culture was carried out in an AO7 decolourised solution. The acclimatised mixed culture showed 98 % decolourisation within 2 h of facultative anaerobic treatment using yeast extract and glucose as co-substrate. Subsequent aerobic post treatment caused auto-oxidation reaction forming dark coloured compounds that reduced the percentage decolourisation to 73 %. Interestingly, further agitations of the mixed culture in the solution over a period of 48 h significantly decolourise the coloured compounds and increased the decolourisation percentage to 90 %. Analyses of the degradation compounds using UV-visible spectrophotometer, Fourier transform infrared spectroscopy (FTIR) and high performance liquid chromatography (HPLC) showed complete degradation of recalcitrant AO7 by the novel BAC-ZS. Phytotoxicity tests using Cucumis sativus confirmed the dye solution after post aerobic treatment were less toxic compared to the parent dye. The quantitative real-time PCR revealed that E. faecalis strain ZL was the dominant strain in the acclimatised mix culture.

  5. Genome sequences of the high-acetic acid-resistant bacteria Gluconacetobacter europaeus LMG 18890T and G. europaeus LMG 18494 (reference strains), G. europaeus 5P3, and Gluconacetobacter oboediens 174Bp2 (isolated from vinegar).

    PubMed

    Andrés-Barrao, Cristina; Falquet, Laurent; Calderon-Copete, Sandra P; Descombes, Patrick; Ortega Pérez, Ruben; Barja, François

    2011-05-01

    Bacteria of the genus Gluconacetobacter are usually involved in the industrial production of vinegars with high acetic acid concentrations. We describe here the genome sequence of three Gluconacetobacter europaeus strains, a very common bacterial species from industrial fermentors, as well as of a Gluconacetobacter oboediens strain.

  6. Characterization of bacterial strains capable of desulphurisation in soil and sediment samples from Antarctica.

    PubMed

    Boniek, Douglas; Figueiredo, Débora; Pylro, Victor Satler; Duarte, Gabriela Frois

    2010-09-01

    The presence of sulphur in fossil fuels and the natural environment justifies the study of sulphur-utilising bacterial species and genes involved in the biodesulphurisation process. Technology has been developed based on the natural ability of microorganisms to remove sulphur from polycyclic aromatic hydrocarbon chains. This biotechnology aims to minimise the emission of sulphur oxides into the atmosphere during combustion and prevent the formation of acid rain. In this study, the isolation and characterization of desulphurising microorganisms in rhizosphere and bulk soil samples from Antarctica that were either contaminated with oil or uncontaminated was described. The growth of selected isolates and their capacity to utilise sulphur based on the formation of the terminal product of desulphurisation via the 4S pathway, 2-hydroxybiphenyl, was analysed. DNA was extracted from the isolates and BOX-PCR and DNA sequencing were performed to obtain a genomic diversity profile of cultivable desulphurising bacterial species. Fifty isolates were obtained showing the ability of utilising dibenzothiophene as a substrate and sulphur source for maintenance and growth when plated on selective media. However, only seven genetically diverse isolates tested positive for sulphur removal using the Gibbs assay. DNA sequencing revealed that these isolates were related to the genera Acinetobacter and Pseudomonas.

  7. Adherence of gram-positive and gram-negative bacterial strains to human lung fibroblasts in vitro.

    PubMed

    Martin, D; Mathieu, L G; Lecomte, J; deRepentigny, J

    1986-01-01

    The adherence to eukaryotic cells of Escherichia coli, Neisseria gonorrhoeae, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis and the yeast Candida albicans was studied by light microscopy with an in vitro micromethod involving different cell lines. The method is inexpensive, consumes little time and material, and is reproducible. It was used to show that the gram-positive Cowan I strain of S. aureus, which naturally forms protein A on its surface, adheres in much larger numbers to human lung fibroblasts than the protein A-free Wood 46 strain, the strain of S. epidermidis, and the encapsulated Smith strain. The presence of a capsule on the latter strain apparently prevented its attachment to the fibroblasts. Among the gram-negative species studied, a piliated clinical isolate of N. gonorrhoeae, displaying the opaque colonial phenotype, adhered in larger numbers than another isolate lacking pili and displaying the transparent phenotype. E. coli K12 attached slightly to the cell line, whereas P. aeruginosa adhered to it moderately. One strain of C. albicans tested did not attach in any detectable numbers. No clear correlation between bacterial cell surface hydrophobicity, as evaluated by the hexadecane assay, and adherence to eukaryotic cells could be demonstrated for these microorganisms. With our method, bacterial attachment proceeded best at 37 degrees C and did not require more than 1 h of contact with the cell monolayer. The method described revealed differences in the adherence to eukaryotic cells, not only among species, but also between strains of the same species.

  8. Bacterial wilt resistance in tomato, pepper, and eggplant: genetic resources respond to diverse strains in the Ralstonia solanacearum species complex.

    PubMed

    Lebeau, A; Daunay, M-C; Frary, A; Palloix, A; Wang, J-F; Dintinger, J; Chiroleu, F; Wicker, E; Prior, P

    2011-01-01

    Bacterial wilt, caused by strains belonging to the Ralstonia solanacearum species complex, inflicts severe economic losses in many crops worldwide. Host resistance remains the most effective control strategy against this disease. However, wilt resistance is often overcome due to the considerable variation among pathogen strains. To help breeders circumvent this problem, we assembled a worldwide collection of 30 accessions of tomato, eggplant and pepper (Core-TEP), most of which are commonly used as sources of resistance to R. solanacearum or for mapping quantitative trait loci. The Core-TEP lines were challenged with a core collection of 12 pathogen strains (Core-Rs2) representing the phylogenetic diversity of R. solanacearum. We observed six interaction phenotypes, from highly susceptible to highly resistant. Intermediate phenotypes resulted from the plants' ability to tolerate latent infections (i.e., bacterial colonization of vascular elements with limited or no wilting). The Core-Rs2 strains partitioned into three pathotypes on pepper accessions, five on tomato, and six on eggplant. A "pathoprofile" concept was developed to characterize the strain clusters, which displayed six virulence patterns on the whole set of Core-TEP host accessions. Neither pathotypes nor pathoprofiles were phylotype specific. Pathoprofiles with high aggressiveness were mainly found in strains from phylotypes I, IIB, and III. One pathoprofile included a strain that overcame almost all resistance sources. PMID:20795852

  9. Bacterial treatment of alkaline cement kiln dust using Bacillus halodurans strain KG1

    PubMed Central

    Kunal; Rajor, Anita; Siddique, Rafat

    2016-01-01

    This study was conducted to isolate an acid-producing, alkaliphilic bacterium to reduce the alkalinity of cement industry waste (cement kiln dust). Gram-positive isolate KG1 grew well at pH values of 6–12, temperatures of 28–50 °C, and NaCl concentrations of 0–16% and thus was further screened for its potential to reduce the pH of an alkaline medium. Phenotypic characteristics of the KG1 isolate were consistent with those of the genus Bacillus, and the highest level of 16S rRNA gene sequence similarity was found with Bacillus halodurans strain DSM 497 (94.7%). On the basis of its phenotypic characteristics and genotypic distinctiveness from other phylogenetic neighbors belonging to alkaliphilic Bacillus species, the isolated strain was designated B. halodurans strain KG1, with GenBank accession number JQ307184 (= NCIM 5439). Isolate KG1 reduced the alkalinity (by 83.64%) and the chloride content (by 86.96%) of cement kiln dust and showed a potential to be used in the cement industry for a variety of applications. PMID:26887220

  10. Bacterial treatment of alkaline cement kiln dust using Bacillus halodurans strain KG1.

    PubMed

    Kunal; Rajor, Anita; Siddique, Rafat

    2016-01-01

    This study was conducted to isolate an acid-producing, alkaliphilic bacterium to reduce the alkalinity of cement industry waste (cement kiln dust). Gram-positive isolate KG1 grew well at pH values of 6-12, temperatures of 28-50°C, and NaCl concentrations of 0-16% and thus was further screened for its potential to reduce the pH of an alkaline medium. Phenotypic characteristics of the KG1 isolate were consistent with those of the genus Bacillus, and the highest level of 16S rRNA gene sequence similarity was found with Bacillus halodurans strain DSM 497 (94.7%). On the basis of its phenotypic characteristics and genotypic distinctiveness from other phylogenetic neighbors belonging to alkaliphilic Bacillus species, the isolated strain was designated B. halodurans strain KG1, with GenBank accession number JQ307184 (= NCIM 5439). Isolate KG1 reduced the alkalinity (by 83.64%) and the chloride content (by 86.96%) of cement kiln dust and showed a potential to be used in the cement industry for a variety of applications.

  11. Bacterial treatment of alkaline cement kiln dust using Bacillus halodurans strain KG1.

    PubMed

    Kunal; Rajor, Anita; Siddique, Rafat

    2016-01-01

    This study was conducted to isolate an acid-producing, alkaliphilic bacterium to reduce the alkalinity of cement industry waste (cement kiln dust). Gram-positive isolate KG1 grew well at pH values of 6-12, temperatures of 28-50°C, and NaCl concentrations of 0-16% and thus was further screened for its potential to reduce the pH of an alkaline medium. Phenotypic characteristics of the KG1 isolate were consistent with those of the genus Bacillus, and the highest level of 16S rRNA gene sequence similarity was found with Bacillus halodurans strain DSM 497 (94.7%). On the basis of its phenotypic characteristics and genotypic distinctiveness from other phylogenetic neighbors belonging to alkaliphilic Bacillus species, the isolated strain was designated B. halodurans strain KG1, with GenBank accession number JQ307184 (= NCIM 5439). Isolate KG1 reduced the alkalinity (by 83.64%) and the chloride content (by 86.96%) of cement kiln dust and showed a potential to be used in the cement industry for a variety of applications. PMID:26887220

  12. Isolation and characterization of different bacterial strains for bioremediation of n-alkanes and polycyclic aromatic hydrocarbons.

    PubMed

    Guermouche M'rassi, A; Bensalah, F; Gury, J; Duran, R

    2015-10-01

    Crude oil is a common environmental pollutant composed of a large number of both aromatic and aliphatic hydrocarbons. Biodegradation is carried out by microbial communities that are important in determining the fate of pollutants in the environment. The intrinsic biodegradability of the hydrocarbons and the distribution in the environment of competent degrading microorganisms are crucial information for the implementation of bioremediation processes. In the present study, the biodegradation capacities of various bacteria toward aliphatic and aromatic hydrocarbons were determined. The purpose of the study was to isolate and characterize hydrocarbon-degrading bacteria from contaminated soil of a refinery in Arzew, Algeria. A collection of 150 bacterial strains was obtained; the bacterial isolates were identified by 16S rRNA gene sequencing and their ability to degrade hydrocarbon compounds characterized. The isolated strains were mainly affiliated to the Gamma-Proteobacteria class. Among them, Pseudomonas spp. had the ability to metabolize high molecular weight hydrocarbon compounds such as pristane (C19) at 35.11 % by strain LGM22 and benzo[a] pyrene (C20) at 33.93 % by strain LGM11. Some strains were able to grow on all the hydrocarbons tested including octadecane, squalene, phenanthrene, and pyrene. Some strains were specialized degrading only few substrates. In contrast, the strain LGM2 designated as Pseudomonas sp. was found able to degrade both linear and branched alkanes as well as low and high poly-aromatic hydrocarbons (PAHs). The alkB gene involved in alkane degradation was detected in LGM2 and other Pseudomonas-related isolates. The capabilities of the isolated bacterial strains to degrade alkanes and PAHs should be of great practical significance in bioremediation of oil-contaminated environments.

  13. Synergistic degradation of linuron by a bacterial consortium and isolation of a single linuron-degrading variovorax strain.

    PubMed

    Dejonghe, Winnie; Berteloot, Ellen; Goris, Johan; Boon, Nico; Crul, Katrien; Maertens, Siska; Höfte, Monica; De Vos, Paul; Verstraete, Willy; Top, Eva M

    2003-03-01

    The bacterial community composition of a linuron-degrading enrichment culture and the role of the individual strains in linuron degradation have been determined by a combination of methods, such as denaturing gradient gel electrophoresis of the total 16S rRNA gene pool, isolation and identification of strains, and biodegradation assays. Three strains, Variovorax sp. strain WDL1, Delftia acidovorans WDL34, and Pseudomonas sp. strain WDL5, were isolated directly from the linuron-degrading culture. In addition, subculture of this enrichment culture on potential intermediates in the degradation pathway of linuron (i.e., N,O-dimethylhydroxylamine and 3-chloroaniline) resulted in the isolation of, respectively, Hyphomicrobium sulfonivorans WDL6 and Comamonas testosteroni WDL7. Of these five strains, only Variovorax sp. strain WDL1 was able to use linuron as the sole source of C, N, and energy. WDL1 first converted linuron to 3,4-dichloroaniline (3,4-DCA), which transiently accumulated in the medium but was subsequently degraded. To the best of our knowledge, this is the first report of a strain that degrades linuron further than the aromatic intermediates. Interestingly, the rate of linuron degradation by strain WDL1 was lower than that for the consortium, but was clearly increased when WDL1 was coinoculated with each of the other four strains. D. acidovorans WDL34 and C. testosteroni WDL7 were found to be responsible for degradation of the intermediate 3,4-DCA, and H. sulfonivorans WDL6 was the only strain able to degrade N,O-dimethylhydroxylamine. The role of Pseudomonas sp. strain WDL5 needs to be further elucidated. The degradation of linuron can thus be performed by a single isolate, Variovorax sp. strain WDL1, but is stimulated by a synergistic interaction with the other strains isolated from the same linuron-degrading culture.

  14. Synergistic Degradation of Linuron by a Bacterial Consortium and Isolation of a Single Linuron-Degrading Variovorax Strain

    PubMed Central

    Dejonghe, Winnie; Berteloot, Ellen; Goris, Johan; Boon, Nico; Crul, Katrien; Maertens, Siska; Höfte, Monica; De Vos, Paul; Verstraete, Willy; Top, Eva M.

    2003-01-01

    The bacterial community composition of a linuron-degrading enrichment culture and the role of the individual strains in linuron degradation have been determined by a combination of methods, such as denaturing gradient gel electrophoresis of the total 16S rRNA gene pool, isolation and identification of strains, and biodegradation assays. Three strains, Variovorax sp. strain WDL1, Delftia acidovorans WDL34, and Pseudomonas sp. strain WDL5, were isolated directly from the linuron-degrading culture. In addition, subculture of this enrichment culture on potential intermediates in the degradation pathway of linuron (i.e., N,O-dimethylhydroxylamine and 3-chloroaniline) resulted in the isolation of, respectively, Hyphomicrobium sulfonivorans WDL6 and Comamonas testosteroni WDL7. Of these five strains, only Variovorax sp. strain WDL1 was able to use linuron as the sole source of C, N, and energy. WDL1 first converted linuron to 3,4-dichloroaniline (3,4-DCA), which transiently accumulated in the medium but was subsequently degraded. To the best of our knowledge, this is the first report of a strain that degrades linuron further than the aromatic intermediates. Interestingly, the rate of linuron degradation by strain WDL1 was lower than that for the consortium, but was clearly increased when WDL1 was coinoculated with each of the other four strains. D. acidovorans WDL34 and C. testosteroni WDL7 were found to be responsible for degradation of the intermediate 3,4-DCA, and H. sulfonivorans WDL6 was the only strain able to degrade N,O-dimethylhydroxylamine. The role of Pseudomonas sp. strain WDL5 needs to be further elucidated. The degradation of linuron can thus be performed by a single isolate, Variovorax sp. strain WDL1, but is stimulated by a synergistic interaction with the other strains isolated from the same linuron-degrading culture. PMID:12620840

  15. Bacterial production and transformation of dissolved neutral sugars and amino acids in seawater

    NASA Astrophysics Data System (ADS)

    Jørgensen, L.; Lechtenfeld, O.; Benner, R.; Middelboe, M.; Stedmon, C. A.

    2014-04-01

    Dissolved organic matter (DOM) in the ocean consists of a heterogeneous mixture of molecules, most of which are of unknown origin. Neutral sugars and amino acids are among the few recognizable biomolecules in DOM, and the molecular composition of these biomolecules is shaped primarily by biological production and degradation processes. This study provides insight into the bioavailability of biomolecules as well as the chemical composition of DOM produced by bacteria. The molecular compositions of neutral sugars and amino acids were investigated in DOM produced by bacteria and in DOM remaining after long-term bacterial degradation. Results from bioassay incubations (32 days) with natural and artificial seawater, indicate that the molecular compositions following bacterial degradation are not strongly influenced by the initial substrate or bacterial community. The molecular composition of neutral sugars released by bacteria was characterized by a high glucose content (47 mol%) and heterogeneous contributions from other neutral sugars (3-14 mol%). DOM remaining after bacterial degradation was characterized by a high galactose content (33 mol%), followed by glucose (22 mol%) and the remaining neutral sugars (7-11 mol%). The ratio of D-amino acids to L-amino acids increased during the experiments as a response to bacterial degradation, and after 32 days the D/L ratios of aspartic acid, glutamic acid, serine and alanine reached around 0.79, 0.32, 0.30 and 0.51 in all treatments, respectively. The striking similarity in neutral sugar and amino acid compositions between natural and artificial seawater samples, suggests that the microbial carbon pump also applies for neutral sugars and amino acids and that bacterially-produced biomolecules persist for long periods in the ocean.

  16. Differentiation of different mixed Listeria strains and also acid-injured, heat-injured, and repaired cells of Listeria monocytogenes using fourier transform infrared spectroscopy.

    PubMed

    Nyarko, Esmond; Donnelly, Catherine

    2015-03-01

    Fourier transform infrared (FT-IR) spectroscopy was used to differentiate mixed strains of Listeria monocytogenes and mixed strains of L. monocytogenes and Listeria innocua. FT-IR spectroscopy was also applied to investigate the hypothesis that heat-injured and acid-injured cells would return to their original physiological integrity following repair. Thin smears of cells on infrared slides were prepared from cultures for mixed strains of L. monocytogenes, mixed strains of L. monocytogenes and L. innocua, and each individual strain. Heat-injured and acid-injured cells were prepared by exposing harvested cells of L. monocytogenes strain R2-764 to a temperature of 56 ± 0.2°C for 10 min or lactic acid at pH 3 for 60 min, respectively. Cellular repair involved incubating aliquots of acid-injured and heat-injured cells separately in Trypticase soy broth supplemented with 0.6% yeast extract for 22 to 24 h; bacterial thin smears on infrared slides were prepared for each treatment. Spectral collection was done using 250 scans at a resolution of 4 cm(-1) in the mid-infrared wavelength region. Application of multivariate discriminant analysis to the wavelength region from 1,800 to 900 cm(-1) separated the individual L. monocytogenes strains. Mixed strains of L. monocytogenes and L. monocytogenes cocultured with L. innocua were successfully differentiated from the individual strains when the discriminant analysis was applied. Different mixed strains of L. monocytogenes were also successfully separated when the discriminant analysis was applied. A data set for injury and repair analysis resulted in the separation of acid-injured, heat-injured, and intact cells; repaired cells clustered closer to intact cells when the discriminant analysis (1,800 to 600 cm(-1)) was applied. FT-IR spectroscopy can be used for the rapid source tracking of L. monocytogenes strains because it can differentiate between different mixed strains and individual strains of the pathogen.

  17. Efficacy of Poly-Lactic-Co-Glycolic Acid Micro- and Nanoparticles of Ciprofloxacin Against Bacterial Biofilms.

    PubMed

    Thomas, Nicky; Thorn, Chelsea; Richter, Katharina; Thierry, Benjamin; Prestidge, Clive

    2016-10-01

    Bacterial biofilms are associated with a number of recurring infectious diseases and are a major cause for antibiotic resistance. Despite the broad use of polymeric microparticles and nanoparticles in biomedical research, it is not clear which particle size is more effective against biofilms. The purpose of this study was to evaluate the efficacy of sustained release poly-lactic-co-glycolic acid (PLGA) micro- and nanoparticles containing ciprofloxacin against biofilms of Staphylococcus aureus and Pseudomonas aeruginosa. The PLGA particles were prepared by the double emulsion solvent evaporation method. The resulting microparticles (12 μm) and nanoparticles (300 nm) contained drug loads of 7.3% and 4.5% (wt/wt) ciprofloxacin, respectively. Drug release was complete within 1 week following comparable release profiles for both particle sizes. Micro- and nanoparticles demonstrated a similar in vitro antibiofilm performance against mature P aeruginosa and S aureus with marked differences between the 2 strains. The sustained release of ciprofloxacin from micro- and nanoparticles over 6 days was equally effective as the continuous treatment with ciprofloxacin solution over the same period resulting in the eradication of culturable S aureus suggesting that reformulation of ciprofloxacin as sustained release PLGA micro- and nanoparticles might be valuable formulation approaches for the treatment of biofilms. PMID:27519649

  18. Comparison of effects of compost amendment and of single-strain inoculation on root bacterial communities of young cucumber seedlings.

    PubMed

    Ofek, Maya; Hadar, Yitzhak; Minz, Dror

    2009-10-01

    Compost amendment and inoculations with specific microorganisms are fundamentally different soil treatment methods, commonly used in agriculture for the improvement of plant growth and health. Although distinct, both methods affect the rhizosphere and the plant roots. In the present study we used a 16S rRNA gene approach to achieve an overview of early consequences of these treatments on the assemblage of plant root bacterial communities. For this purpose, cucumber seedlings were grown, under controlled conditions, in perlite potting mix amended with biosolid compost or straw compost, or inoculated with Streptomyces spp. A uniform trend of response of root bacterial communities for all treatments was observed. Root bacterial density, measured as bacterial targets per plant tef gene by real-time PCR, was reduced in 31 to 67%. In addition, increased taxonomic diversity accompanied shifts in composition (alpha-diversity). The magnitude of change in these parameters relative to the perlite control varied between the different treatments but not in relation to the treatment method (compost amendments versus inoculations). Similarity between the compositions of root and of potting mix bacterial communities (beta-diversity) was relatively unchanged. The abundance of Oxalobacteraceae was >50% of the total root bacterial community in the untreated perlite. Root domination by this group subsided >10-fold (straw compost) to >600-fold (Streptomyces sp. strain S1) after treatment. Thus, loss of dominance appears to be the major phenomenon underlining the response trend of the root bacterial communities. PMID:19700550

  19. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  20. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    SciTech Connect

    Kingsley, Mark T

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, an d analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: (1) to assess the potential terrorist threat to U.S. agricultural crops, (2) to determine whether suitable assays exist to monitor that threat, and (3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  1. Auxotroph Accumulation in Deoxyribonucleic Acid Polymeraseless Strains of Escherichia coli K-121

    PubMed Central

    Berg, Claire M.

    1971-01-01

    Spontaneous auxotrophs are found with high frequency in several strains of Escherichia coli K-12 deficient in Kornberg deoxyribonucleic acid polymerase. These include amino acid-, vitamin-, purine-, and pyrimidine-requiring strains. Although this was suggestive evidence that these strains might be mutators, reconstruction experiments demonstrate that auxotrophs possess a selective advantage over prototrophs in the same culture. Thus, despite the high frequency of auxotrophs in polymerase-deficient strains, it is not yet clear whether they have elevated mutation rates. PMID:4934065

  2. Resistance and Inactivation Kinetics of Bacterial Strains Isolated from the Non-Chlorinated and Chlorinated Effluents of a WWTP

    PubMed Central

    Martínez-Hernández, Sylvia; Vázquez-Rodríguez, Gabriela A.; Beltrán-Hernández, Rosa I.; Prieto-García, Francisco; Miranda-López, José M.; Franco-Abuín, Carlos M.; Álvarez-Hernández, Alejandro; Iturbe, Ulises; Coronel-Olivares, Claudia

    2013-01-01

    The microbiological quality of water from a wastewater treatment plant that uses sodium hypochlorite as a disinfectant was assessed. Mesophilic aerobic bacteria were not removed efficiently. This fact allowed for the isolation of several bacterial strains from the effluents. Molecular identification indicated that the strains were related to Aeromonas hydrophila, Escherichia coli (three strains), Enterobacter cloacae, Kluyvera cryocrescens (three strains), Kluyvera intermedia, Citrobacter freundii (two strains), Bacillus sp. and Enterobacter sp. The first five strains, which were isolated from the non-chlorinated effluent, were used to test resistance to chlorine disinfection using three sets of variables: disinfectant concentration (8, 20 and 30 mg·L−1), contact time (0, 15 and 30 min) and water temperature (20, 25 and 30 °C). The results demonstrated that the strains have independent responses to experimental conditions and that the most efficient treatment was an 8 mg·L−1 dose of disinfectant at a temperature of 20 °C for 30 min. The other eight strains, which were isolated from the chlorinated effluent, were used to analyze inactivation kinetics using the disinfectant at a dose of 15 mg·L−1 with various retention times (0, 10, 20, 30, 60 and 90 min). The results indicated that during the inactivation process, there was no relationship between removal percentage and retention time and that the strains have no common response to the treatments. PMID:23924881

  3. [Effect of the inoculant strain Sphingomonas paucimobilis 20006FA on the bacterial composition of a phenanthrene-degrading consortium].

    PubMed

    Madueño, L; Coppotelli, B M; Morelli, I S

    2009-01-01

    The effect of the inoculant strain Sphingomonas paucimobilis 20006FA on the bacterial composition of a phenanthrene-degrading consortium obtained from a pristine soil in sequencing batch cultures was studied. Inoculated (F200+1) and non-inoculated (F200) phenanthrene-degrading consortia, were obtained. Bacterial diversity of consortia was studied at cultivable (phenotype and genotype characterization) and non-cultivable (PCR-DGGE) levels. During the successive cultures, a loss in the phenanthrene-degrading capacity and a decrease in the bacterial diversity were observed in both consortia. Although inoculation did not produce any significant changes in the consortia phenanthrene-degrading capacity (29.9% F200 and 27.6% F200+1), it did produce changes in the bacterial composition, showing a differential structural dynamics in the DGGE profiles of the inoculated consortium. In both consortia, a dominant band placed at the same position as that of the DNA of the inoculant strain in the DGGE gel could be observed. However, isolated cultures from the consortia which had an identical band position to that of S. paucimobilis 20006FA in the PCR-DGGE profile showed low similarity with respect to the inoculant strain (RAPD).

  4. Interaction of mouse splenocytes and macrophages with bacterial strains in vitro: the effect of age in the immune response.

    PubMed

    Van Beek, A A; Hoogerland, J A; Belzer, C; De Vos, P; De Vos, W M; Savelkoul, H F J; Leenen, P J M

    2016-01-01

    Probiotics influence the immune system, both at the local and systemic level. Recent findings suggest the relation between microbiota and the immune system alters with age. Our objective was to address direct effects of six bacterial strains on immune cells from young and aged mice: Lactobacillus plantarum WCFS1, Lactobacillus casei BL23, Lactococcus lactis MG1363, Bifidobacterium breve ATCC15700, Bifidobacterium infantis ATCC15697, and Akkermansia muciniphila ATCC BAA-835. We used splenocytes and naïve or interferon-γ-stimulated bone marrow-derived macrophages (BMDM) as responder populations. All tested bacterial strains induced phenotypic and cytokine responses in splenocytes and BMDM. Based on magnitude of the cellular inflammatory response and cytokine profiles, two subgroups of bacteria were identified, i.e. L. plantarum and L. casei versus B. breve, B. infantis, and A. muciniphila. The latter group of bacteria induced high levels of cytokines produced under inflammatory conditions, including tumour necrosis factor (TNF), interleukin (IL)-6 and IL-10. Responses to L. lactis showed features of both subgroups. In addition, we compared responses by splenocytes and BMDM derived from young mice to those of aged mice, and found that splenocytes and BMDM derived from aged mice had an increased IL-10 production and dysregulated IL-6 and TNF production compared to young immune cells. Overall, our study shows differential inflammatory responses to distinct bacterial strains, and profound age-dependent effects. These findings, moreover, support the view that immune environment importantly influences bacterial immune effects. PMID:26689225

  5. Biostimulation of the autochthonous bacterial community and bioaugmentation of selected bacterial strains for the depletion of Polycyclic Aromatic Hydrocarbons in a historically contaminated soil

    NASA Astrophysics Data System (ADS)

    DiGregorio, Simona; Ruffini Castglione, Monica; Gentini, Alessandro; Lorenzi, Roberto

    2015-04-01

    Polycyclic aromatic hydrocarbons (PAHs) are a large group of organic contaminants causing hazards to organisms including humans. The objective of the study was (1) to validate the biostimulation of the autochthonous bacterial population by the amendment of lignocellulosic matrices inoculated with white rot fungi, to be exploited for the depletion of PAHs (5687 ppm) in a historical contaminated soil. (2) to validate the isolation of autochthonous bacterial strains capable to use PAHs as sole carbon source and their massive bioaugmentation for PAH depletion in a historical contaminated soil. The validation has been performed at mesocosm and pilot scale (7 tons of soil in a biopile). The two approaches end up with the complete depletion of the PAHs. A genotoxicological assessment of the process and of the soil at the end of the process of decontamination has been performed. The process of soil decontamination showed an increase in the genotoxicity of either the soil and the deriving elutriates. The bioaugmetation of selected bacterial strains determined the complete detoxification of the decontaminated soil after 21 weeks. The microbial ecology of the system during the process of decontamination has been monitored.

  6. Evaluation of the angiogenic potency of a novel exopolysaccharide produced by the MK1 bacterial strain.

    PubMed

    Park, Ji-Yun; Kim, Beom Su; Lee, Jun

    2016-09-01

    Angiogenesis is an essential physiological step in wound healing and other regenerative processes. Here, we evaluated the angiogenic properties of an exopolysaccharide (EPS) secreted by MK1 (MK1-EPS), a novel bacterial strain isolated from Neungee mushrooms. MK1-EPS significantly increased human umbilical vein endothelial cell (HUVEC) proliferation, migration, and vascular tube formation. MK1-EPS enhanced the phosphorylation of extracellular signal-related kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, which are mitogen-activated protein kinases. In addition, the expression of p21 and intercellular adhesion molecule 1 (ICAM1), and phosphorylation of signal transducer and activator of transcription 3 (STAT3), but not of protein kinase B (AKT), were increased. Specific inhibitors of p38 (SB203580), ERK (PD98059), and JNK (SP600125) inhibited MK1-EPS-induced HUVEC proliferation, tube formation, and cell migration, and partially attenuated MKI-EPS-induced expression of p21 and ICAM1, and STAT3 phosphorylation. After surgical implantation into rabbit calvarial bone defects, new blood vessel formation was significantly higher with MK1-EPS composite bone granules than with granules alone, and new bone formation increased significantly. Therefore, MK1-EPS induces angiogenesis and may have potential for use as a bone regeneration agent in bone tissue engineering applications. PMID:27357535

  7. Biodegradation potentiality of psychrophilic bacterial strain Oleispira antarctica RB-8(T).

    PubMed

    Gentile, G; Bonsignore, M; Santisi, S; Catalfamo, M; Giuliano, L; Genovese, L; Yakimov, M M; Denaro, R; Genovese, M; Cappello, S

    2016-04-15

    The present study is focused on assessing the growth and hydrocarbon-degrading capability of the psychrophilic strain Oleispira antarctica RB-8(T). This study considered six hydrocarbon mixtures that were tested for 22days at two different cultivation temperatures (4 and 15°C). During the incubation period, six sub-aliquots of each culture at different times were processed for total bacterial abundance and GC-FID (gas chromatography-flame ionization detection) hydrocarbon analysis. Results from DNA extraction and DAPI (4',6-diamidino-2-phenylindole) staining showed a linear increase during the first 18days of the experiment in almost all the substrates used; both techniques showed a good match, but the difference in values obtained was approximately one order of magnitude. GC-FID results revealed a substantial hydrocarbon degradation rate in almost all hydrocarbon sources and in particular at 15°C rather than 4°C (for commercial oil engine, oily waste, fuel jet, and crude oil). A more efficient degradation was observed in cultures grown with diesel and bilge water at 4°C. PMID:26912198

  8. Degradation of metal-EDTA complexes by resting cells of the bacterial strain DSM 9103

    SciTech Connect

    Satroutdinov, A.D.; Dedyukhina, E.G.; Chistyakova, T.I.; Witschel, M.; Minkevich, I.G.; Eroshin, V.K.; Egli, T.

    2000-05-01

    Ethylenediaminetetraacetate (EDTA), an industrially important chelating agent, forms very stable complexes with di- and trivalent metal ions, and in both wastewater and natural waters it is normally present in the metal-associated form. Therefore, the influence of EDTA speciation on its utilization by the EDTA-degrading bacterial strain DSM 9103 was investigated. EDTA-grown cells harvested from the exponential phase of a batch culture were incubated with 1 mM of various EDTA species and the EDTA concentration in the assay was monitored as a function of time. Uncomplexed EDTA as well as complexes with low stability constants were found to be readily degraded to completion at a constant rate. For more stable EDTA chelates (i.e., chelates of Co{sup 2+}, Cu{sup 2+}, Zn{sup 2+}, and Pb{sup 2+}) the data suggest that these complexes were not used directly by the cells but that they had to dissociate prior to degradation. The rate of this dissociation step possibly determined the microbial degradation of these complexes. CdEDTA{sup 2{minus}} and Fe(III)EDTA{sup {minus}} were not degraded within 48 h. In case of CdEDTA{sup 2{minus}} the toxicity of freed Cd{sup 2+} ions most likely prevented a significant degradation of the complex, whereas in case of Fe(III)EDTA{sup {minus}} a combination of metal or complex toxicity and the very slow dissociation of the complex might explain the absence of degradation.

  9. Application of two bacterial strains for wastewater bioremediation and assessment of phenolics biodegradation.

    PubMed

    Paisio, Cintia E; Quevedo, María R; Talano, Melina A; González, Paola S; Agostini, Elizabeth

    2014-08-01

    The use of native bacteria is a useful strategy to decontaminate industrial effluents. In this work, two bacterial strains isolated from polluted environments constitutes a promising alternative since they were able to remove several phenolic compounds not only from synthetic solutions but also from effluents derived from a chemical industry and a tannery which are complex matrices. Acinetobacter sp. RTE 1.4 showed ability to completely remove 2-methoxyphenol (1000 mg/L) while Rhodococcus sp. CS 1 not only degrade the same concentration of this compound but also removed 4- chlorophenol, 2,4-dichlorophenol and pentachlorophenol with high efficiency. Moreover, both bacteria degraded phenols naturally present or even exogenously added at high concentrations in effluents from the chemical industry and a tannery in short time (up to 5 d). In addition, a significant reduction of biological oxygen demand and chemical oxygen demand values was achieved after 7 d of treatment for both effluents using Acinetobacter sp. RTE 1.4 and Rhodococcus sp. CS1, respectively. These results showed that Acinetobacter sp. RTE1.4 and Rhodococcus sp. CS 1 might be considered as useful biotechnological tools for an efficient treatment of different effluents, since they showed wide versatility to detoxify these complex matrices, even supplemented with high phenol concentrations.

  10. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  11. Bacterial Communities in Acidic and Circumneutral Streams †

    PubMed Central

    Palumbo, Anthony V.; Bogle, Mary Anna; Turner, Ralph R.; Elwood, Jerry W.; Mulholland, Patrick J.

    1987-01-01

    The relationship between pH and the abundance and activity of bacteria in streams was examined as part of a study of the effect of acidification on stream communities. Of the bacterial communities examined, the epilithic community appeared to be the most significantly affected by acidification. Microbial biomass, as quantified by measuring the ATP level, on rock surfaces was significantly correlated with pH. Also, bacterial production by the epilithic bacteria, indicated by incorporation of tritiated thymidine into DNA, was always higher at high-pH sites than at low-pH sites of the same stream order and elevation. Bacterioplankton concentrations varied between 0.53 × 105 and 9.42 × 105 cells · ml−1 in the first- to fourth-order streams examined. The bacterioplankton concentration in one sample from a spring was 0.17 × 105 cells · ml−1. Bacterioplankton concentrations were not correlated with pH but were significantly correlated with seston concentrations. The correlation with seston is a result of increases in particle-associated bacteria at high seston concentrations. The proportion of bacterioplankton attached to particles varied from 0 to 70%. Bacterial numbers and production in the sediments were significantly correlated with the organic content of the sediment rather than with the pH of the overlying water. Thus, reduced abundance and activity of bacteria as a result of acidification could be detected only for the relatively active community on rock surfaces; this community was exposed to the low pH because of the unbuffered nature of its environment. PMID:16347283

  12. Genetic strain and reproductive status affect endometrial fatty acid concentrations.

    PubMed

    Meier, S; Peterson, A J; Mitchell, M D; Littlejohn, M; Walker, C G; Roche, J R

    2009-08-01

    Poor reproductive performance limits cow longevity in seasonal, pasture-based dairy systems. Few differences in ovarian dynamics have been reported in different strains of Holstein-Friesian cows, implying that the uterine environment may be a key component determining reproductive success. To test the hypothesis that the uterine environment differs among genetic strains of the Holstein-Friesian cow, endometrial fatty acids (FA) were analyzed from New Zealand (NZ), and North American (NA) Holstein-Friesian cows. The effect of reproductive status was also investigated, with cows from both Holstein-Friesian strains slaughtered on either d 17 of the estrous cycle (termed cyclic) or d 17 of pregnancy (after embryo transfer; termed pregnant). Endometrial tissues were collected from 22 cows (NZ pregnant, n = 6; NZ cyclic, n = 4; NA pregnant, n = 6; NA cyclic, n = 6), and FA composition was analyzed. Daily plasma progesterone concentrations, milk production, milk FA composition, body weight, and body condition score were determined. Milk yield (4% fat-corrected milk) was similar for the NZ (28.5 kg/d) and NA (29.3 kg/d; SE 2.07 kg/d) cows, but NZ cows had a greater mean milk fat percentage. Mean plasma progesterone concentrations were significantly greater in NZ cows. Plasma progesterone concentrations were similar in the pregnant and cyclic groups. Mean length of the trophoblast recovered from the pregnant cows (NZ: 20.8 +/- 2.84 cm; NA: 27.9 +/- 10.23 cm) was not affected by genetic strain. Endometrial tissues from NZ cows contained greater concentrations of C17:0, C20:3n-3, and total polyunsaturated FA. The endometria from pregnant cows contained greater concentrations of C17:0, C20:2, and C20:3n-6, and less C20:1, C20:2, C20:5n-3. The observed changes in endometrial FA between Holstein-Friesian cows of different genetic origins or reproductive states may reflect differences in endometrial function and may affect reproductive function.

  13. In-vitro bacterial killing kinetics of ticarcillin/clavulanic acid.

    PubMed

    Gould, I M; Dent, J; Wise, R

    1987-03-01

    An in-vitro model was developed to study the rates of killing by ticarcillin/clavulanic acid combinations of various beta-lactamase producing, ticarcillin resistant, logarithmic phase clinical isolates. Killing, defined as a 3 log reduction, was dependent on the organism, the concentration of clavulanic acid and the duration of exposure. For most isolates studied an optimum period of exposure to and concentration of clavulanic acid could be defined. Certain test strains showed optimum response to readily attainable in-vivo concentrations of clavulanic acid while other strains, although sensitive by MIC data showed a poor response. The clinical implications of this are discussed.

  14. Unified Theory of Bacterial Sialometabolism: How and Why Bacteria Metabolize Host Sialic Acids

    PubMed Central

    Vimr, Eric R.

    2013-01-01

    Sialic acids are structurally diverse nine-carbon ketosugars found mostly in humans and other animals as the terminal units on carbohydrate chains linked to proteins or lipids. The sialic acids function in cell-cell and cell-molecule interactions necessary for organismic development and homeostasis. They not only pose a barrier to microorganisms inhabiting or invading an animal mucosal surface, but also present a source of potential carbon, nitrogen, and cell wall metabolites necessary for bacterial colonization, persistence, growth, and, occasionally, disease. The explosion of microbial genomic sequencing projects reveals remarkable diversity in bacterial sialic acid metabolic potential. How bacteria exploit host sialic acids includes a surprisingly complex array of metabolic and regulatory capabilities that is just now entering a mature research stage. This paper attempts to describe the variety of bacterial sialometabolic systems by focusing on recent advances at the molecular and host-microbe-interaction levels. The hope is that this focus will provide a framework for further research that holds promise for better understanding of the metabolic interplay between bacterial growth and the host environment. An ability to modify or block this interplay has already yielded important new insights into potentially new therapeutic approaches for modifying or blocking bacterial colonization or infection. PMID:23724337

  15. Improvement of phosphate solubilization and Medicago plant yield by an indole-3-acetic acid-overproducing strain of Sinorhizobium meliloti.

    PubMed

    Bianco, Carmen; Defez, Roberto

    2010-07-01

    Nitrogen (N) and phosphorus (P) are the most limiting factors for plant growth. Some microorganisms improve the uptake and availability of N and P, minimizing chemical fertilizer dependence. It has been published that the RD64 strain, a Sinorhizobium meliloti 1021 strain engineered to overproduce indole-3-acetic acid (IAA), showed improved nitrogen fixation ability compared to the wild-type 1021 strain. Here, we present data showing that RD64 is also highly effective in mobilizing P from insoluble sources, such as phosphate rock (PR). Under P-limiting conditions, the higher level of P-mobilizing activity of RD64 than of the 1021 wild-type strain is connected with the upregulation of genes coding for the high-affinity P transport system, the induction of acid phosphatase activity, and the increased secretion into the growth medium of malic, succinic, and fumaric acids. Medicago truncatula plants nodulated by RD64 (Mt-RD64), when grown under P-deficient conditions, released larger amounts of another P-solubilizing organic acid, 2-hydroxyglutaric acid, than plants nodulated by the wild-type strain (Mt-1021). It has already been shown that Mt-RD64 plants exhibited higher levels of dry-weight production than Mt-1021 plants. Here, we also report that P-starved Mt-RD64 plants show significant increases in both shoot and root fresh weights when compared to P-starved Mt-1021 plants. We discuss how, in a Rhizobium-legume model system, a balanced interplay of different factors linked to bacterial IAA overproduction rather than IAA production per se stimulates plant growth under stressful environmental conditions and, in particular, under P starvation. PMID:20511434

  16. Inhibition of bacterial activity in acid mine drainage

    NASA Astrophysics Data System (ADS)

    Singh, Gurdeep; Bhatnagar, Miss Mridula

    1988-12-01

    Acid mine drainage water give rise to rapid growth and activity of an iron- and sulphur- oxidizing bacterium Thiobacillus ferrooxidians which greatly accelerate acid producing reactions by oxidation of pyrite material associated with coal and adjoining strata. The role of this bacterium in production of acid mine drainage is described. This study presents the data which demonstrate the inhibitory effect of certain organic acids, sodium benzoate, sodium lauryl sulphate, quarternary ammonium compounds on the growth of the acidophilic aerobic autotroph Thiobacillus ferrooxidians. In each experiment, 10 milli-litres of laboratory developed culture of Thiobacillus ferrooxidians was added to 250 milli-litres Erlenmeyer flask containing 90 milli-litres of 9-k media supplemented with FeSO4 7H2O and organic compounds at various concentrations. Control experiments were also carried out. The treated and untreated (control) samples analysed at various time intervals for Ferrous Iron and pH levels. Results from this investigation showed that some organic acids, sodium benzoate, sodium lauryl sulphate and quarternary ammonium compounds at low concentration (10-2 M, 10-50 ppm concentration levels) are effective bactericides and able to inhibit and reduce the Ferrous Iron oxidation and acidity formation by inhibiting the growth of Thiobacillus ferrooxidians is also discussed and presented

  17. Characteristics of the high malic acid production mechanism in Saccharomyces cerevisiae sake yeast strain No. 28.

    PubMed

    Nakayama, Shunichi; Tabata, Ken; Oba, Takahiro; Kusumoto, Kenichi; Mitsuiki, Shinji; Kadokura, Toshimori; Nakazato, Atsumi

    2012-09-01

    We characterized a high malic acid production mechanism in sake yeast strain No. 28. No considerable differences in the activity of the enzymes that were involved in malic acid synthesis were observed between strain No. 28 and its parent strain, K1001. However, compared with strain K1001, which actively took up rhodamine 123 during staining, the cells of strain No. 28 were only lightly stained, even when cultured in high glucose concentrations. In addition, malic acid production by the respiratory-deficient strain of K1001 was 2.5-fold higher than that of the wild-type K1001 and wild-type No. 28. The findings of this study demonstrated that the high malic acid production by strain No. 28 is attributed to the suppression of mitochondrial activity.

  18. Activation of dormant bacterial genes by Nonomuraea sp. strain ATCC 39727 mutant-type RNA polymerase.

    PubMed

    Talà, Adelfia; Wang, Guojun; Zemanova, Martina; Okamoto, Susumu; Ochi, Kozo; Alifano, Pietro

    2009-02-01

    There is accumulating evidence that the ability of actinomycetes to produce antibiotics and other bioactive secondary metabolites has been underestimated due to the presence of cryptic gene clusters. The activation of dormant genes is therefore one of the most important areas of experimental research for the discovery of drugs in these organisms. The recent observation that several actinomycetes possess two RNA polymerase beta-chain genes (rpoB) has opened up the possibility, explored in this study, of developing a new strategy to activate dormant gene expression in bacteria. Two rpoB paralogs, rpoB(S) and rpoB(R), provide Nonomuraea sp. strain ATCC 39727 with two functionally distinct and developmentally regulated RNA polymerases. The product of rpoB(R), the expression of which increases after transition to stationary phase, is characterized by five amino acid substitutions located within or close to the so-called rifampin resistance clusters that play a key role in fundamental activities of RNA polymerase. Here, we report that rpoB(R) markedly activated antibiotic biosynthesis in the wild-type Streptomyces lividans strain 1326 and also in strain KO-421, a relaxed (rel) mutant unable to produce ppGpp. Site-directed mutagenesis demonstrated that the rpoB(R)-specific missense H426N mutation was essential for the activation of secondary metabolism. Our observations also indicated that mutant-type or duplicated, rpoB often exists in nature among rare actinomycetes and will thus provide a basis for further basic and applied research.

  19. Seasonal variations in bacterial communities and antibiotic-resistant strains associated with green bottle flies (Diptera: Calliphoridae).

    PubMed

    Wei, Ting; Ishida, Ryuichi; Miyanaga, Kazuhiko; Tanji, Yasunori

    2014-05-01

    Green bottle flies occur frequently around human environments in Japan. Many species of green bottle flies have been studied with regard to their importance in forensic examinations or clinical therapies, but the bacterial communities associated with this group of flies have not been comprehensively investigated. In this research, 454 pyrosequencing was used to reveal the bacterial communities in green bottle flies collected in different seasons. Meanwhile, the bacteria were screened with selective media and tested for antibiotic susceptibility. Samples collected in three different seasons harbored distinctive bacterial communities. The predominant genera associated with green bottles flies were Staphylococcus in spring, Ignatzschineria in summer, and Vagococcus, Dysgonomonas, and an unclassified Acetobacteraceae in autumn. An upward trend in bacterial community diversity was observed from spring to autumn. Changes in climatic conditions could be the cause of these seasonal variations in fly-associated bacterial communities. The species of isolated antibiotic-resistant bacteria also differed across seasons, but it was difficult to correlate seasonal changes in antibiotic-resistant bacteria with changes in whole communities. A number of multiple-antibiotic-resistant bacteria were isolated, and some of these strains were closely affiliated with pathogens such as Enterococcus faecalis and Enterococcus faecium, which could cause serious threats to public health. Overall, this research provided us with information about the composition and seasonality of bacterial communities in green bottle flies, and highlighted the risks of fly-mediated dissemination of antibiotic-resistant pathogens.

  20. Genomic Encyclopedia of Bacterial and Archaeal Type Strains, Phase III: the genomes of soil and plant-associated and newly described type strains.

    PubMed

    Whitman, William B; Woyke, Tanja; Klenk, Hans-Peter; Zhou, Yuguang; Lilburn, Timothy G; Beck, Brian J; De Vos, Paul; Vandamme, Peter; Eisen, Jonathan A; Garrity, George; Hugenholtz, Philip; Kyrpides, Nikos C

    2015-01-01

    The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project was launched by the JGI in 2007 as a pilot project to sequence about 250 bacterial and archaeal genomes of elevated phylogenetic diversity. Herein, we propose to extend this approach to type strains of prokaryotes associated with soil or plants and their close relatives as well as type strains from newly described species. Understanding the microbiology of soil and plants is critical to many DOE mission areas, such as biofuel production from biomass, biogeochemistry, and carbon cycling. We are also targeting type strains of novel species while they are being described. Since 2006, about 630 new species have been described per year, many of which are closely aligned to DOE areas of interest in soil, agriculture, degradation of pollutants, biofuel production, biogeochemical transformation, and biodiversity.

  1. Rumen bacterial communities shift across a lactation in Holstein, Jersey and Holstein × Jersey dairy cows and correlate to rumen function, bacterial fatty acid composition and production parameters.

    PubMed

    Bainbridge, Melissa L; Cersosimo, Laura M; Wright, André-Denis G; Kraft, Jana

    2016-05-01

    Rumen bacteria form a dynamic, complex, symbiotic relationship with their host, degrading forages to provide volatile fatty acids (VFA) and other substrates as energy to the animal. The objectives were to characterize rumen bacteria in three genetic lines of primiparous dairy cattle, Holstein (HO, n = 7), Jersey (JE, n = 8), and HO × JE crossbreeds (CB, n = 7) across a lactation [3, 93, 183 and 273 days in milk (DIM)] and correlate these factors with VFA, bacterial cell membrane fatty acids (FA), and animal production (i.e. milk yield). This study employed Illumina MiSeq (v. 3) to investigate rumen bacterial communities and gas-liquid chromatography/mass spectroscopy to identify bacterial membrane FA. Lactation stage had a prominent effect on rumen bacterial communities, whereas genetics had a lesser effect on rumen bacteria. The FA composition of bacterial cell membranes was affected by both lactation stage and genetics. Few correlations existed between VFA and bacterial communities; however, moderate correlations occurred between milk yield, protein percentage, fat yield and rumen bacterial communities. Positive correlations were found between branched-chain FA (BCFA) in bacterial cell membranes and bacterial genera. In conclusion, bacterial communities and their FA compositions are more affected by stage of lactation than by genetics of dairy cow. PMID:26985012

  2. Amino Acid-Based Zwitterionic Polymer Surfaces Highly Resist Long-Term Bacterial Adhesion.

    PubMed

    Liu, Qingsheng; Li, Wenchen; Wang, Hua; Newby, Bi-Min Zhang; Cheng, Fang; Liu, Lingyun

    2016-08-01

    The surfaces or coatings that can effectively suppress bacterial adhesion in the long term are of critical importance for biomedical applications. Herein, a group of amino acid-based zwitterionic polymers (pAAZ) were investigated for their long-term resistance to bacterial adhesion. The polymers were derived from natural amino acids including serine, ornithine, lysine, aspartic acid, and glutamic acid. The pAAZ brushes were grafted on gold via the surface-initiated photoiniferter-mediated polymerization (SI-PIMP). Results show that the pAAZ coatings highly suppressed adsorption from the undiluted human serum and plasma. Long-term bacterial adhesion on these surfaces was investigated, using two kinds of representative bacteria [Gram-positive Staphylococcus epidermidis and Gram-negative Pseudomonas aeruginosa] as the model species. Results demonstrate that the pAAZ surfaces were highly resistant to bacterial adhesion after culturing for 1, 5, 9, or even 14 days, representing at least 95% reduction at all time points compared to the control unmodified surfaces. The bacterial accumulation on the pAAZ surfaces after 9 or 14 days was even lower than on the surfaces grafted with poly[poly(ethyl glycol) methyl ether methacrylate] (pPEGMA), one of the most common antifouling materials known to date. The pAAZ brushes also exhibited excellent structural stability in phosphate-buffered saline after incubation for 4 weeks. The bacterial resistance and stability of pAAZ polymers suggest they have good potential to be used for those applications where long-term suppression to bacterial attachment is desired. PMID:27397718

  3. [Algicidal activity against red-tide algaes by marine bacterial strain N3 isolated from a HABs area, southern China].

    PubMed

    Shi, Rong-jun; Huang, Hong-hui; Qi, Zhan-hui; Hu, Wei-an; Tian, Zi-yang; Dai, Ming

    2013-05-01

    A marine algicidal bacterium N3 was isolated from a HABs area in Mirs Bay, a subtropical bay, in southern China. Algicidal activity and algicidal mode against Phaeodactylum tricornutum, Scrippsiella trochoidea, Prorocentrum micans and Skeletonema costatum were observed by the liquid infection method. The results showed that there were no algicidal activities against P. tricornutum and S. costatum. However, when the bacterial volume fractions were 2% and 10% , S. trochoidea and P. micans could be killed, respectively. S. trochoidea cells which were exposed to strain N3 became irregular in shape and the cellular components lost their integrity and were decomposed. While, the P. micans cells became inflated and the cellular components aggregated, followed by cell lysis. Strain N3 killed S. trochoidea and P. micans directly, and the algicidal activities of the bacterial strain N3 was concentration-dependent. To S. trochoidea, 2% (V/V) of bacteria in algae showed the strongest algicidal activity, all of the S. trochoidea cells were killed within 120 h. But the growth rates of cells, in the 1% and 0. 1% treatment groups, were only slightly lower than that in the control group. In all treatment groups, the densities of strain N3 were in declining trends. While, to P. micans, 10% and 5% of bacteria in algae showed strong algicidal activities, 78% and 70% of the S. trochoidea were killed within 120 h, respectively. However, the number of S. trochoidea after exposure to 1% of bacterial cultures still increased up to 5 incubation days. And in the three treatment groups, the densities of strain N3 experienced a decrease process. The isolated strain N3 was identified as Bacillus sp. by morphological observation, physiological and biochemical characterization, and homology comparisons based on 16S rRNA sequences. PMID:23914549

  4. [Algicidal activity against red-tide algaes by marine bacterial strain N3 isolated from a HABs area, southern China].

    PubMed

    Shi, Rong-jun; Huang, Hong-hui; Qi, Zhan-hui; Hu, Wei-an; Tian, Zi-yang; Dai, Ming

    2013-05-01

    A marine algicidal bacterium N3 was isolated from a HABs area in Mirs Bay, a subtropical bay, in southern China. Algicidal activity and algicidal mode against Phaeodactylum tricornutum, Scrippsiella trochoidea, Prorocentrum micans and Skeletonema costatum were observed by the liquid infection method. The results showed that there were no algicidal activities against P. tricornutum and S. costatum. However, when the bacterial volume fractions were 2% and 10% , S. trochoidea and P. micans could be killed, respectively. S. trochoidea cells which were exposed to strain N3 became irregular in shape and the cellular components lost their integrity and were decomposed. While, the P. micans cells became inflated and the cellular components aggregated, followed by cell lysis. Strain N3 killed S. trochoidea and P. micans directly, and the algicidal activities of the bacterial strain N3 was concentration-dependent. To S. trochoidea, 2% (V/V) of bacteria in algae showed the strongest algicidal activity, all of the S. trochoidea cells were killed within 120 h. But the growth rates of cells, in the 1% and 0. 1% treatment groups, were only slightly lower than that in the control group. In all treatment groups, the densities of strain N3 were in declining trends. While, to P. micans, 10% and 5% of bacteria in algae showed strong algicidal activities, 78% and 70% of the S. trochoidea were killed within 120 h, respectively. However, the number of S. trochoidea after exposure to 1% of bacterial cultures still increased up to 5 incubation days. And in the three treatment groups, the densities of strain N3 experienced a decrease process. The isolated strain N3 was identified as Bacillus sp. by morphological observation, physiological and biochemical characterization, and homology comparisons based on 16S rRNA sequences.

  5. High cell density propionic acid fermentation with an acid tolerant strain of Propionibacterium acidipropionici.

    PubMed

    Wang, Zhongqiang; Jin, Ying; Yang, Shang-Tian

    2015-03-01

    Propionic acid is an important chemical with wide applications and its production via fermentation is of great interest. However, economic production of bio-based propionic acid requires high product titer, yield, and productivity in the fermentation. A highly efficient and stable high cell density (HCD) fermentation process with cell recycle by centrifugation was developed for propionic acid production from glucose using an acid-tolerant strain of Propionibacterium acidipropionici, which had a higher specific growth rate, productivity, and acid tolerance compared to the wild type ATCC 4875. The sequential batch HCD fermentation at pH 6.5 produced propionic acid at a high titer of ∼40 g/L and productivity of 2.98 g/L h, with a yield of ∼0.44 g/g. The product yield increased to 0.53-0.62 g/g at a lower pH of 5.0-5.5, which, however, decreased the productivity to 1.28 g/L h. A higher final propionic acid titer of >55 g/L with a productivity of 2.23 g/L h was obtained in fed-batch HCD fermentation at pH 6.5. A 3-stage simulated fed-batch process in serum bottles produced 49.2 g/L propionic acid with a yield of 0.53 g/g and productivity of 0.66 g/L h. These productivities, yields and propionic acid titers were among the highest ever obtained in free-cell propionic acid fermentation.

  6. Draft Genome Sequence of Criibacterium bergeronii gen. nov., sp. nov., Strain CCRI-22567T, Isolated from a Vaginal Sample from a Woman with Bacterial Vaginosis.

    PubMed

    Maheux, Andrée F; Bérubé, Ève; Boudreau, Dominique K; Raymond, Frédéric; Corbeil, Jacques; Roy, Paul H; Boissinot, Maurice; Omar, Rabeea F

    2016-01-01

    Criibacterium bergeronii gen. nov., sp. nov., CCRI-22567 is the type strain of the new genus Criibacterium The strain was isolated from a woman with bacterial vaginosis. The genome assembly comprised 2,384,460 bp, with 34.4% G+C content. This is the first genome announcement of a strain belonging to the genus Criibacterium. PMID:27587833

  7. Draft Genome Sequence of Criibacterium bergeronii gen. nov., sp. nov., Strain CCRI-22567T, Isolated from a Vaginal Sample from a Woman with Bacterial Vaginosis

    PubMed Central

    Maheux, Andrée F.; Bérubé, Ève; Boudreau, Dominique K.; Raymond, Frédéric; Corbeil, Jacques; Roy, Paul H.

    2016-01-01

    Criibacterium bergeronii gen. nov., sp. nov., CCRI-22567 is the type strain of the new genus Criibacterium. The strain was isolated from a woman with bacterial vaginosis. The genome assembly comprised 2,384,460 bp, with 34.4% G+C content. This is the first genome announcement of a strain belonging to the genus Criibacterium. PMID:27587833

  8. Isolation and characterization of a potential paraffin-wax degrading thermophilic bacterial strain Geobacillus kaustophilus TERI NSM for application in oil wells with paraffin deposition problems.

    PubMed

    Sood, Nitu; Lal, Banwari

    2008-02-01

    Paraffin deposition problems, that have plagued the oil industry, are currently remediated by mechanical and chemical means. However, since these methods are problematic, a microbiological approach has been considered. The bacteria, required for the mitigation of paraffin deposition problems, should be able to survive the high temperatures of oil wells and degrade the paraffins under low oxygen and nutrient conditions while sparing the low carbon chain paraffins. In this study, a thermophilic paraffinic wax degrading bacterial strain was isolated from a soil sample contaminated with paraffinic crude oil. The selected strain, Geobacillus TERI NSM, could degrade 600mg of paraffinic wax as the sole carbon source in 1000ml minimal salts medium in 7d at 55 degrees C. This strain was identified as Geobacillus kaustophilus by fatty acid methyl esters analysis and 16S rRNA full gene sequencing. G. kaustophilus TERI NSM showed 97% degradation of eicosane, 85% degradation of pentacosane and 77% degradation of triacontane in 10d when used as the carbon source. The strain TERI NSM could also degrade the paraffins of crude oil collected from oil wells that had a history of paraffin deposition problems.

  9. Isolation and characterization of a potential paraffin-wax degrading thermophilic bacterial strain Geobacillus kaustophilus TERI NSM for application in oil wells with paraffin deposition problems.

    PubMed

    Sood, Nitu; Lal, Banwari

    2008-02-01

    Paraffin deposition problems, that have plagued the oil industry, are currently remediated by mechanical and chemical means. However, since these methods are problematic, a microbiological approach has been considered. The bacteria, required for the mitigation of paraffin deposition problems, should be able to survive the high temperatures of oil wells and degrade the paraffins under low oxygen and nutrient conditions while sparing the low carbon chain paraffins. In this study, a thermophilic paraffinic wax degrading bacterial strain was isolated from a soil sample contaminated with paraffinic crude oil. The selected strain, Geobacillus TERI NSM, could degrade 600mg of paraffinic wax as the sole carbon source in 1000ml minimal salts medium in 7d at 55 degrees C. This strain was identified as Geobacillus kaustophilus by fatty acid methyl esters analysis and 16S rRNA full gene sequencing. G. kaustophilus TERI NSM showed 97% degradation of eicosane, 85% degradation of pentacosane and 77% degradation of triacontane in 10d when used as the carbon source. The strain TERI NSM could also degrade the paraffins of crude oil collected from oil wells that had a history of paraffin deposition problems. PMID:17942139

  10. Reactivity of sera from sheep immunised with individual outer membrane proteins of Bacteroides nodosus against heterologous bacterial strains.

    PubMed

    Emery, D L

    1984-09-01

    In order to identify those bacterial antigens which might be involved in immunity against ovine footrot, antisera were raised in sheep to 6 proteins in the outer membrane complex (OMC) of one strain of Bacteroides nodosus. Examination of the specificity of these antisera by Western blotting, crossed immunoelectrophoresis (XIEP) and IEP, revealed that they recognized the homologous OMC protein, but did not precipitate either undenatured pili or OMC, nor could they agglutinate the homologous bacteria. In contrast, anti-OMC and anti-pili sera could precipitate OMC or pili respectively, and agglutinate whole bacteria. Subsequent analysis of these sera against 5 strains of B. nodosus from different serogroups revealed that Proteins 1, 3 and 4 had a similar antigenic structure in all strains examined. The reactivity of anti-pili sera was restricted to homologous bacteria whereas anti-pilin sera (raised against denatured pili) also reacted with pilin from 2 of 3 heterologous strains. However, none of the patterns of staining or absorption of any of these sera matched the spectrum of cross-protection afforded by vaccination of sheep with B. nodosus strain 198 cells. The results question the role of individual OMC proteins in cross-protective immunity and may imply that interactions between several bacterial components are involved in the phenomenon. PMID:6208674

  11. High-throughput genomic sequencing of cassava bacterial blight strains identifies conserved effectors to target for durable resistance.

    PubMed

    Bart, Rebecca; Cohn, Megan; Kassen, Andrew; McCallum, Emily J; Shybut, Mikel; Petriello, Annalise; Krasileva, Ksenia; Dahlbeck, Douglas; Medina, Cesar; Alicai, Titus; Kumar, Lava; Moreira, Leandro M; Rodrigues Neto, Júlio; Verdier, Valerie; Santana, María Angélica; Kositcharoenkul, Nuttima; Vanderschuren, Hervé; Gruissem, Wilhelm; Bernal, Adriana; Staskawicz, Brian J

    2012-07-10

    Cassava bacterial blight (CBB), incited by Xanthomonas axonopodis pv. manihotis (Xam), is the most important bacterial disease of cassava, a staple food source for millions of people in developing countries. Here we present a widely applicable strategy for elucidating the virulence components of a pathogen population. We report Illumina-based draft genomes for 65 Xam strains and deduce the phylogenetic relatedness of Xam across the areas where cassava is grown. Using an extensive database of effector proteins from animal and plant pathogens, we identify the effector repertoire for each sequenced strain and use a comparative sequence analysis to deduce the least polymorphic of the conserved effectors. These highly conserved effectors have been maintained over 11 countries, three continents, and 70 y of evolution and as such represent ideal targets for developing resistance strategies. PMID:22699502

  12. Tetrahydroindazole inhibitors of bacterial type II topoisomerases. Part 2: SAR development and potency against multidrug-resistant strains.

    PubMed

    Wiener, John J M; Gomez, Laurent; Venkatesan, Hariharan; Santillán, Alejandro; Allison, Brett D; Schwarz, Kimberly L; Shinde, Shirin; Tang, Liu; Hack, Michael D; Morrow, Brian J; Motley, S Timothy; Goldschmidt, Raul M; Shaw, Karen Joy; Jones, Todd K; Grice, Cheryl A

    2007-05-15

    We have previously reported a novel class of tetrahydroindazoles that display potency against a variety of Gram-positive and Gram-negative bacteria, potentially via interaction with type II bacterial topoisomerases. Herein are reported SAR investigations of this new series. Several compounds possessing broad-spectrum potency were prepared. Further, these compounds exhibit activity against multidrug-resistant Gram-positive microorganisms equivalent to that against susceptible strains.

  13. Genome Sequence of a Copper-Resistant Strain of Acidovorax citrulli Causing Bacterial Fruit Blotch of Melons.

    PubMed

    Wang, Tielin; Yang, Yuwen; Zhao, Tingchang

    2015-04-23

    Bacterial fruit blotch (BFB) of melons is a seed-borne disease caused by Acidovorax citrulli. We determined the draft genome of A. citrulli Tw6. The strain was isolated from a watermelon collected from Beijing, China. The A. citrulli Tw6 genome contains 5,080,614 bp and has a G+C content of 68.7 mol%.

  14. Genome Sequence of a Copper-Resistant Strain of Acidovorax citrulli Causing Bacterial Fruit Blotch of Melons

    PubMed Central

    Wang, Tielin; Yang, Yuwen

    2015-01-01

    Bacterial fruit blotch (BFB) of melons is a seed-borne disease caused by Acidovorax citrulli. We determined the draft genome of A. citrulli Tw6. The strain was isolated from a watermelon collected from Beijing, China. The A. citrulli Tw6 genome contains 5,080,614 bp and has a G+C content of 68.7 mol%. PMID:25908132

  15. Genome Sequence of a Copper-Resistant Strain of Acidovorax citrulli Causing Bacterial Fruit Blotch of Melons.

    PubMed

    Wang, Tielin; Yang, Yuwen; Zhao, Tingchang

    2015-01-01

    Bacterial fruit blotch (BFB) of melons is a seed-borne disease caused by Acidovorax citrulli. We determined the draft genome of A. citrulli Tw6. The strain was isolated from a watermelon collected from Beijing, China. The A. citrulli Tw6 genome contains 5,080,614 bp and has a G+C content of 68.7 mol%. PMID:25908132

  16. Amino acid oxidase of leukocytes in relation to H2O2-mediated bacterial killing

    PubMed Central

    Eckstein, Marlene R.; Baehner, Robert L.; Nathan, David G.

    1971-01-01

    D-Amino acid oxidase and L-amino acid oxidase have been measured in sucrose homogenates of polymorphonuclear leukocytes (PMN) obtained from guinea pigs and humans. Subcellular distribution patterns and studies on latency indicate that these oxidases are soluble enzymes. Their hydrogen peroxide-generating capacity was verified. Chronic granulomatous disease PMN, which lack a respiratory burst and fail to generate H2O2 during phagocytosis and do not kill catalase positive bacteria, had peroxide-generating amino acid oxidase activity equal to that found in PMN homogenates from patients with bacterial infections. The precise metabolic and bactericidal role of amino acid oxidases in PMN remains uncertain. PMID:4397948

  17. The strains recommended for use in the bacterial reverse mutation test (OECD guideline 471) can be certified as non-genetically modified organisms.

    PubMed

    Sugiyama, Kei-Ichi; Yamada, Masami; Awogi, Takumi; Hakura, Atsushi

    2016-01-01

    The bacterial reverse mutation test, commonly called Ames test, is used worldwide. In Japan, the genetically modified organisms (GMOs) are regulated under the Cartagena Domestic Law, and organisms obtained by self-cloning and/or natural occurrence would be exempted from the law case by case. The strains of Salmonella typhimurium and Escherichia coli recommended for use in the bacterial reverse mutation test (OECD guideline 471), have been considered as non-GMOs because they can be constructed by self-cloning or naturally occurring bacterial strains, or do not disturb the biological diversity. The present article explains the reasons why these tester strains should be classified as non-GMOs.

  18. Effects of remediation on the bacterial community of an acid mine drainage impacted stream.

    PubMed

    Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G

    2012-11-01

    Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage. PMID:23145829

  19. Effects of remediation on the bacterial community of an acid mine drainage impacted stream.

    PubMed

    Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G

    2012-11-01

    Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage.

  20. Analysis of Known Bacterial Protein Vaccine Antigens Reveals Biased Physical Properties and Amino Acid Composition

    PubMed Central

    Mayers, Carl; Rowe, Sonya; Miller, Julie; Lingard, Bryan; Hayward, Sarah; Titball, Richard W.

    2003-01-01

    Many vaccines have been developed from live attenuated forms of bacterial pathogens or from killed bacterial cells. However, an increased awareness of the potential for transient side-effects following vaccination has prompted an increased emphasis on the use of sub-unit vaccines, rather than those based on whole bacterial cells. The identification of vaccine sub-units is often a lengthy process and bioinformatics approaches have recently been used to identify candidate protein vaccine antigens. Such methods ultimately offer the promise of a more rapid advance towards preclinical studies with vaccines. We have compared the properties of known bacterial vaccine antigens against randomly selected proteins and identified differences in the make-up of these two groups. A computer algorithm that exploits these differences allows the identification of potential vaccine antigen candidates from pathogenic bacteria on the basis of their amino acid composition, a property inherently associated with sub-cellular location. PMID:18629010

  1. Biological decolorization of the reactive dyes Reactive Black 5 by a novel isolated bacterial strain Enterobacter sp. EC3.

    PubMed

    Wang, Hui; Zheng, Xiao-Wei; Su, Jian-Qiang; Tian, Yun; Xiong, Xiao-Jing; Zheng, Tian-Ling

    2009-11-15

    Studies were carried out on the decolorization of the reactive dye Reactive Black 5 by a newly isolated bacterium, EC3. Phenotypic characterization and phylogenetic analysis based on 16S rDNA sequence comparisons indicate that this strain belonged to the genus Enterobacter. The optimal conditions for the decolorizing activity of Enterobacter sp. EC3 were anaerobic conditions with glucose supplementation, at pH 7.0, and 37 degrees C. The maximum decolorization efficiency against Reactive Black 5 achieved in this study was 92.56%. Ultra-violet and visible (UV-vis) analyses before and after decolorization and the colorless bacterial biomass after decolorization suggested that decolorization was due to biodegradation, rather than inactive surface adsorption. The bacterial strain also showed a strong ability to decolorize various reactive textile dyes, including both azo and anthraquinone dyes. To our knowledge, it is the first time that a bacterial strain of Enterobacter sp. has been reported with decolorizing ability against both azo and anthraquinone dyes.

  2. Gluconacetobacter hansenii subsp. nov., a high-yield bacterial cellulose producing strain induced by high hydrostatic pressure.

    PubMed

    Ge, Han-Jing; Du, Shuang-Kui; Lin, De-Hui; Zhang, Jun-Na; Xiang, Jin-Le; Li, Zhi-Xi

    2011-12-01

    Strain M(438), deposited as CGMCC3917 and isolated from inoculums of bacterial cellulose (BC) producing strain screened in homemade vinegar and then induced by high hydrostatic pressure treatment (HHP), has strong ability to produce BC more than three times as that of its initial strain. It is the highest yield BC-producing strain ever reported. In this paper, M(438) was identidied as Gluconacetobacter hansenii subsp. nov. on the basis of the results obtained by examining it phylogenetically, phenotypically, and physiologically-biochemically. Furthermore, the genetic diversity of strain M(438) and its initial strain was examined by amplified fragment length polymorphism. The results indicated that strain M(438) was a deletion mutant induced by HHP, and the only deleted sequence showed 99% identity with 24,917-24,723 bp in the genome sequence of Ga. hansenii ATCC23769, and the complement gene sequence was at 24,699-25,019 bp with local tag GXY_15142, which codes small multidrug resistance (SMR) protein. It can be inferred that SMR might be related to inhibiting BC production to a certain extent.

  3. Butyric acid from anaerobic fermentation of lignocellulosic biomass hydrolysates by Clostridium sp. strain RPT-4213

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel Clostridium sp. strain RPT-4213 was found producing butyrate under strict anaerobic conditions. This strain produced 9.47 g L-1 butyric acid from MRS media (0.48 g/g glucose). RPT-4213 was also used to ferment dilute acid pretreated hydrolysates including wheat straw (WSH), corn fiber (CFH...

  4. Implications of Genome-Based Discrimination between Clostridium botulinum Group I and Clostridium sporogenes Strains for Bacterial Taxonomy

    PubMed Central

    Weigand, Michael R.; Pena-Gonzalez, Angela; Shirey, Timothy B.; Broeker, Robin G.; Ishaq, Maliha K.; Konstantinidis, Konstantinos T.

    2015-01-01

    Taxonomic classification of Clostridium botulinum is based on the production of botulinum neurotoxin (BoNT), while closely related, nontoxic organisms are classified as Clostridium sporogenes. However, this taxonomic organization does not accurately mirror phylogenetic relationships between these species. A phylogenetic reconstruction using 2,016 orthologous genes shared among strains of C. botulinum group I and C. sporogenes clearly separated these two species into discrete clades which showed ∼93% average nucleotide identity (ANI) between them. Clustering of strains based on the presence of variable orthologs revealed 143 C. sporogenes clade-specific genetic signatures, a subset of which were further evaluated for their ability to correctly classify a panel of presumptive C. sporogenes strains by PCR. Genome sequencing of several C. sporogenes strains lacking these signatures confirmed that they clustered with C. botulinum strains in a core genome phylogenetic tree. Our analysis also identified C. botulinum strains that contained C. sporogenes clade-specific signatures and phylogenetically clustered with C. sporogenes strains. The genome sequences of two bont/B2-containing strains belonging to the C. sporogenes clade contained regions with similarity to a bont-bearing plasmid (pCLD), while two different strains belonging to the C. botulinum clade carried bont/B2 on the chromosome. These results indicate that bont/B2 was likely acquired by C. sporogenes strains through horizontal gene transfer. The genome-based classification of these species used to identify candidate genes for the development of rapid assays for molecular identification may be applicable to additional bacterial species that are challenging with respect to their classification. PMID:26048939

  5. Role of lauric acid-potassium hydroxide concentration on bacterial contamination of spray washed broiler carcasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A series of experiments were conducted to examine reductions in bacterial contamination of broiler carcasses washed in a spray cabinet with various concentrations of lauric acid (LA)-potassium hydroxide (KOH) solutions. Fifty eviscerated carcasses and 5 ceca were obtained from the processing line of...

  6. Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo

    PubMed Central

    McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda

    2016-01-01

    ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099

  7. Protein Expression Profile of an Environmentally Important Bacterial Strain: the Chromate Response of Arthrobacter Species Strain FB24

    SciTech Connect

    Henne, Kristene L.; Turse, Joshua E.; Nakatsu, C. H.; Konopka, Allan

    2011-05-03

    The global proteomic response of Arthrobacter sp. strain FB24 to different levels of chromate stress was evaluated with both two-dimensional gel electrophoresis (2-DGE) and liquid chromatography coupled to tandem mass spectrometry (LC/LC-MS/MS) [Henne et al. 2009b]. Proteome coverage of 22% and 71% was obtained with 2-DGE and LC/LC-MS/MS, respectively. The strong response of strain FB24 to chromate suggests a condition of sulfur limitation, which could be driven by competition for the sulfate transporter by the structurally similar chromate ion. Additionally, the involvement of genes hypothesized to be directly involved in chromate resistance in strain FB24 was supported at the protein level.

  8. Inhibitory effects on bacterial growth and beta-ketoacyl-ACP reductase by different species of maple leaf extracts and tannic acid.

    PubMed

    Wu, Dan; Wu, Xiao-Dong; You, Xue-Fu; Ma, Xiao-Feng; Tian, Wei-Xi

    2010-01-01

    It is important to develop new antibiotics aimed at novel targets. The investigation found that the leaf extracts from five maples (Acer platanoides, Acer campestre, Acer rubrum, Acer saccharum and Acer truncatum Bunge collected in Denmark, Canada and China) and their component tannic acid displayed antibacterial ability against 24 standard bacteria strains with the minimum inhibitory concentration of 0.3-8.0 mg/mL. Unlike the standard antibiotic levofloxacin (LFX), these samples inhibited Gram-positive bacteria more effectively than they inhibited Gram-negative bacteria. These samples effectively inhibited two antidrug bacterial strains. The results show that these samples inhibit bacteria by a different mechanism from LFX. These samples potently inhibited b-ketoacyl-ACP reductase (FabG), which is an important enzyme in bacterial fatty acid synthesis. Tannic acid showed the strongest inhibition on FabG with a half inhibition concentration of 0.78 microM (0.81 microg/mL). Furthermore, tannic acid and two maple leaf extracts showed time-dependent irreversible inhibition of FabG. These three samples also exhibited better inhibition on bacteria. It is suggested that FabG is the antibacteria target of maple leaf extracts and tannic acid, and both reversible and irreversible inhibitions of FabG are important for the antibacterial effect.

  9. Bacterial adherence to titanium, poly-L-lactic acid, and composite hydroxyapatite and poly-L-lactic acid interference screws.

    PubMed

    Masini, Brendan D; Stinner, Daniel J; Waterman, Scott M; Wenke, Joseph C; Gerlinger, Tad L

    2012-01-01

    This study investigates a potential site of bacterial adherence, the implant surface, comparing titanium, poly-L-lactic acid (PLLA), and composite hydroxyapatite and poly-L-lactic acid (PLLA-HA) interference screws using a bioluminescent in vitro model. Interference screws of three materials, titanium (Arthrex, Naples, FL), bioabsorbable poly-L-lactic acid (BIORCI, Smith & Nephew, Andover, MA), and bioabsorbable composite hydroxyapatite and poly-L-lactic acid (BIORCI-HA, Smith & Nephew, Andover, MA) were immersed in a broth of bioluminescent Staphylococcus aureus. The screws were irrigated and then imaged with a photon-capturing camera system yielding a total photon count correlating with residual adherent bacteria. The titanium screws had the lowest mean total bacterial counts followed by the PLLA-HA screws and with the PLLA screws having the highest mean total counts. The difference in means between the titanium group and the PLLA group was statistically significant (p < .001). Titanium interference screws have less bacterial adherence than comparable bioabsorbable PLLA screws.

  10. Analysis of Bacterial Diversity During Acetic Acid Fermentation of Tianjin Duliu Aged Vinegar by 454 Pyrosequencing.

    PubMed

    Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye

    2015-08-01

    The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process.

  11. Muramic Acid Measurements for Bacterial Investigations in Marine Environments by High-Pressure Liquid Chromatography

    PubMed Central

    Mimura, Toru; Romano, Jean-Claude

    1985-01-01

    Muramic acid, a constituent of procaryotic cell walls, was assayed by high-pressure liquid chromatography in samples from several marine environments (water column, surface microlayer, and sediment) and a bacterial culture. It is used as a microbial biomass indicator. The method gave a good separation of muramic acid from interfering compounds with satisfactory reproducibility. A pseudomonad culture had a muramic acid content of 4.7 × 10−10 to 5.3 × 10−10 μg per cell during growth. In natural water samples, highly significant relationships were found between muramic acid concentrations and bacterial numbers for populations of 108 to 1011 cells per liter. The muramic acid content in natural marine water decreased from 5.3 × 10−10 to 1.6 × 10−10 μg per cell with increasing depth. In coastal sediments exposed to sewage pollution, concentrations of muramic acid, ATP, organic carbon, and total amino acids displayed a parallel decrease with increasing distance from the sewage outlet. Advantages of muramic acid measurement by high-pressure liquid chromatography are its high sensitivity and reduction of preparation steps, allowing a short time analysis. PMID:16346848

  12. The effect of linoleic acid on the Sauvignon blanc fermentation by different wine yeast strains.

    PubMed

    Casu, Francesca; Pinu, Farhana R; Fedrizzi, Bruno; Greenwood, David R; Villas-Boas, Silas G

    2016-08-01

    The level of linoleic acid in the Sauvignon blanc (SB) grape juice affects the development of different aroma compounds during fermentation by Saccharomyces cerevisiae EC1118, including key varietal thiols such as 3-mercaptohexanol (3MH) and 3-mercaptohexyl acetate (3MHA). However, it is still unknown if linoleic acid would affect in a similar way other commonly used S. cerevisiae wine strains. Here we investigated the effect of grape juice linoleic acid on the development of aroma compounds and other metabolites of SB wines using different wine yeast strains: EC1118, AWRI796 and VIN13. Linoleic acid clearly affected the levels of acetylated aroma compounds, several amino acids, and antioxidant molecules, independent of yeast strain, but the production of 3MH was affected by linoleic acid in a strain-specific manner. Moreover, the supplementation of deuterium-labelled 3MH also affected the production of varietal thiols in a strain-specific way. Linoleic acid reduced the acetylation process probably by inhibiting an acetyltransferase, an effect that was independent of the yeast strain. However, regulation of the 3MH biosynthesis is strain-specific, which suggests a mindful consideration not only towards the wine yeast but also to the linoleic acid concentration in the grape juice in order to obtain the desired wine aroma characteristics. PMID:27364827

  13. Dietary fatty acids and immune response to food-borne bacterial infections.

    PubMed

    Harrison, Lisa M; Balan, Kannan V; Babu, Uma S

    2013-05-01

    Functional innate and acquired immune responses are required to protect the host from pathogenic bacterial infections. Modulation of host immune functions may have beneficial or deleterious effects on disease outcome. Different types of dietary fatty acids have been shown to have variable effects on bacterial clearance and disease outcome through suppression or activation of immune responses. Therefore, we have chosen to review research across experimental models and food sources on the effects of commonly consumed fatty acids on the most common food-borne pathogens, including Salmonella sp., Campylobacter sp., Shiga toxin-producing Escherichia coli, Shigella sp., Listeria monocytogenes, and Staphylococcus aureus. Altogether, the compilation of literature suggests that no single fatty acid is an answer for protection from all food-borne pathogens, and further research is necessary to determine the best approach to improve disease outcomes. PMID:23698167

  14. Isotope composition of sulphate in acid mine drainage as measure of bacterial oxidation

    USGS Publications Warehouse

    Taylor, B.E.; Wheeler, M.C.; Nordstrom, D.K.

    1984-01-01

    The formation of acid waters by oxidation of pyrite-bearing ore deposits, mine tailing piles, and coal measures is a complex biogeochemical process and is a serious environmental problem. We have studied the oxygen and sulphur isotope geochemistry of sulphides, sulphur, sulphate and water in the field and in experiments to identify sources of oxygen and reaction mechanisms of sulphate formation. Here we report that the oxygen isotope composition of sulphate in acid mine drainage shows a large variation due to differing proportions of atmospheric- and water-derived oxygen from both chemical and bacterially-mediated oxidation. 18O-enrichment of sulphate results from pyrite oxidation facilitated by Thiobacillus ferrooxidans in aerated environments. Oxygen isotope analysis may therefore be useful in monitoring the effectiveness of abatement programmes designed to inhibit bacterial oxidation. Sulphur isotopes show no significant fractionation between pyrite and sulphate, indicating the quantitative insignificance of intermediate oxidation states of sulphur under acid conditions. ?? 1984 Nature Publishing Group.

  15. Endophytic Colonization of Potato (Solanum tuberosum L.) by a Novel Competent Bacterial Endophyte, Pseudomonas putida Strain P9, and Its Effect on Associated Bacterial Communities▿

    PubMed Central

    Andreote, Fernando Dini; de Araújo, Welington L.; de Azevedo, João L.; van Elsas, Jan Dirk; da Rocha, Ulisses Nunes; van Overbeek, Leonard S.

    2009-01-01

    Pseudomonas putida strain P9 is a novel competent endophyte from potato. P9 causes cultivar-dependent suppression of Phytophthora infestans. Colonization of the rhizoplane and endosphere of potato plants by P9 and its rifampin-resistant derivative P9R was studied. The purposes of this work were to follow the fate of P9 inside growing potato plants and to establish its effect on associated microbial communities. The effects of P9 and P9R inoculation were studied in two separate experiments. The roots of transplants of three different cultivars of potato were dipped in suspensions of P9 or P9R cells, and the plants were planted in soil. The fate of both strains was followed by examining colony growth and by performing PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Colonies of both strains were recovered from rhizoplane and endosphere samples of all three cultivars at two growth stages. A conspicuous band, representing P9 and P9R, was found in all Pseudomonas PCR-DGGE fingerprints for treated plants. The numbers of P9R CFU and the P9R-specific band intensities for the different replicate samples were positively correlated, as determined by linear regression analysis. The effects of plant growth stage, genotype, and the presence of P9R on associated microbial communities were examined by multivariate and unweighted-pair group method with arithmetic mean cluster analyses of PCR-DGGE fingerprints. The presence of strain P9R had an effect on bacterial groups identified as Pseudomonas azotoformans, Pseudomonas veronii, and Pseudomonas syringae. In conclusion, strain P9 is an avid colonizer of potato plants, competing with microbial populations indigenous to the potato phytosphere. Bacterization with a biocontrol agent has an important and previously unexplored effect on plant-associated communities. PMID:19329656

  16. Effects of elaidic acid, a predominant industrial trans fatty acid, on bacterial growth and cell surface hydrophobicity of lactobacilli.

    PubMed

    Wu, Qinglong; Shah, Nagendra P

    2014-12-01

    The consumption of trans fatty acids (TFAs) increases the risk of cardiovascular diseases and coronary heart disease in human, and there are no effective ways to remove TFAs after consumption. The aim of this study was to investigate the effects of elaidic acid on bacterial growth, cell surface hydrophobicity of lactobacilli, and metabolism of elaidic acid by lactobacilli. Lactobacilli were inoculated in MRS broth containing 0, 100, 200, and 500 mg/L of elaidic acid. Viable cell counts of lactobacilli were enumerated, concentrations of elaidic acid were determined, and cell surface hydrophobicity of lactobacilli was measured. The results showed that the growth of lactobacilli was significantly inhibited by 500 mg/L of elaidic acid, however, a cell count of 8.50 log10 CFU/mL was still reached for tested lactobacilli after 24-h incubation. In particular, a reduction of elaidic acid was found for tested lactobacilli after 24-h incubation as compared to its initial concentration of 200 mg/L. However, cell surface hydrophobicity showed no correlations with the metabolism of elaidic acid by lactobacilli. Moreover, elaidic acid was able to influence cell surface hydrophobicity, and the decrease in hydrophobicity was more obvious in Lactobacillus paracasei and Lactobacillus casei compared with that in other tested lactobacilli. This study suggests that elaidic acid could change physiochemical surface properties of lactobacilli and the lactobacilli have the potential to reduce TFAs.

  17. Simultaneous Extraction of Viral and Bacterial Nucleic Acids for Molecular Diagnostic Applications

    PubMed Central

    Kajiura, Lauren N.; Stewart, Scott D.; Dresios, John; Uyehara, Catherine F. T.

    2015-01-01

    Molecular detection of microbial pathogens in clinical samples requires the application of efficient sample lysis protocols and subsequent extraction and isolation of their nucleic acids. Here, we describe a simple and time-efficient method for simultaneous extraction of genomic DNA from gram-positive and -negative bacteria, as well as RNA from viral agents present in a sample. This method compared well with existing bacterial- and viral-specialized extraction protocols, worked reliably on clinical samples, and was not pathogen specific. This method may be used to extract DNA and RNA concurrently from viral and bacterial pathogens present in a sample and effectively detect coinfections in routine clinical diagnostics. PMID:26543438

  18. Biomimetic Synthesis of Selenium Nanospheres by Bacterial Strain JS-11 and Its Role as a Biosensor for Nanotoxicity Assessment: A Novel Se-Bioassay

    PubMed Central

    Dwivedi, Sourabh; AlKhedhairy, Abdulaziz A.; Ahamed, Maqusood; Musarrat, Javed

    2013-01-01

    Selenium nanoparticles (Se-NPs) were synthesized by green technology using the bacterial isolate Pseudomonas aeruginosa strain JS-11. The bacteria exhibited significant tolerance to selenite (SeO32−) up to 100 mM concentration with an EC50 value of 140 mM. The spent medium (culture supernatant) contains the potential of reducing soluble and colorless SeO32− to insoluble red elemental selenium (Se0) at 37°C. Characterization of red Se° product by use of UV-Vis spectroscopy, X-ray diffraction (XRD), atomic force microscopy (AFM) and transmission electron microscopy (TEM) with energy dispersive X-ray spectrum (EDX) analysis revealed the presence of stable, predominantly monodispersed and spherical selenium nanoparticles (Se-NPs) of an average size of 21 nm. Most likely, the metabolite phenazine-1-carboxylic acid (PCA) released by strain JS-11 in culture supernatant along with the known redox agents like NADH and NADH dependent reductases are responsible for biomimetic reduction of SeO32− to Se° nanospheres. Based on the bioreduction of a colorless solution of SeO32− to elemental red Se0, a high throughput colorimetric bioassay (Se-Assay) was developed for parallel detection and quantification of nanoparticles (NPs) cytotoxicity in a 96 well format. Thus, it has been concluded that the reducing power of the culture supernatant of strain JS-11 could be effectively exploited for developing a simple and environmental friendly method of Se-NPs synthesis. The results elucidated that the red colored Se° nanospheres may serve as a biosensor for nanotoxicity assessment, contemplating the inhibition of SeO32− bioreduction process in NPs treated bacterial cell culture supernatant, as a toxicity end point. PMID:23483909

  19. Evaluation of toxic effects of several carboxylic acids on bacterial growth by toxicodynamic modelling

    PubMed Central

    2011-01-01

    Background Effects of organic acids on microbial fermentation are commonly tested in investigations about metabolic behaviour of bacteria. However, they typically provide only descriptive information without modelling the influence of acid concentrations on bacterial kinetics. Results We developed and applied a mathematical model (secondary model) to capture the toxicological effects of those chemicals on kinetic parameters that define the growth of bacteria in batch cultures. Thus, dose-response kinetics were performed with different bacteria (Leuconostoc mesenteroides, Carnobacterium pisicola, Escherichia coli, Bacillus subtilis and Listonella anguillarum) exposed at increasing concentrations of individual carboxylic acids (formic, acetic, propionic, butyric and lactic). In all bioassays the acids affected the maximum bacterial load (Xm) and the maximum growth rate (vm) but only in specific cases the lag phase (λ) was modified. Significance of the parameters was always high and in all fermentations the toxicodynamic equation was statistically consistent and had good predictability. The differences between D and L-lactic acid effects were significant for the growth of E. coli, L. mesenteroides and C. piscicola. In addition, a global parameter (EC50,τ) was used to compare toxic effects and provided a realistic characterization of antimicrobial agents using a single value. Conclusions The effect of several organic acids on the growth of different bacteria was accurately studied and perfectly characterized by a bivariate equation which combines the basis of dose-response theory with microbial growth kinetics (secondary model). The toxicity of carboxylic acids was lower with the increase of the molecular weight of these chemicals. PMID:22118421

  20. Use of oleic acid to reduce the population of the bacterial flora of poultry skin.

    PubMed

    Hinton, A; Ingram, K D

    2000-09-01

    The effect of oleic acid on native bacterial flora of poultry skin was examined. Skin from commercial broiler carcasses was washed once or twice in solutions of 0, 2, 4, 6, 8, or 10% (wt/vol) oleic acid and rinsed in peptone water. Aerobic bacteria, Enterobacteriaceae, Campylobacter, and enterococci in the rinsates were enumerated. Significantly fewer aerobic bacteria, Enterobacteriaceae, Campylobacter, and enterococci were recovered from rinsates of skin washed in oleic acid than from control samples. Additionally, fewer bacteria were recovered from rinsates of skin washed in higher concentrations of oleic acid than from skin washed in lower concentrations of the fatty acid. In most cases, there was no significant difference in the number of bacteria recovered from rinsates of skin washed once or twice in solutions of oleic acid. Washing skin samples twice in 10% solutions of oleic acid significantly reduced the number of aerobic bacteria, Enterobacteriaceae, Campylobacter, and enterococci that remained attached to the skin. Campylobacter sp., Enterococcus faecalis, and Listeria monocytogenes isolates possessed the least resistance to the antibacterial activity of oleic acid in vitro, while Escherichia coli and Pseudomonas aeruginosa showed higher resistance. Enterobacter cloacae, Staphylococcus lentus, and Salmonella Typhimurium had the greatest resistance to the antibacterial activity of oleic acid. Findings indicate that oleic acid reduces the number of bacteria on the skin of processed broilers and that the fatty acid is bactericidal to several spoilage and pathogenic bacteria associated with poultry.

  1. Changes in ruminal bacterial community composition following feeding of alfalfa ensiled with a lactic acid bacterial inoculant.

    PubMed

    Mohammed, R; Stevenson, D M; Beauchemin, K A; Muck, R E; Weimer, P J

    2012-01-01

    Some silage inoculants help to improve silage quality and promote an increase in milk production, possibly through altering the rumen microflora. We hypothesized that rumen bacterial community composition (BCC) would be different in cows fed alfalfa ensiled with the inoculant Lactobacillus plantarum MTD/1 (LP) compared with those fed alfalfa ensiled without the inoculant (Ctrl). Eight ruminally cannulated Holstein cows were allotted to 2 diets (Ctrl or LP) in a double crossover design with four 28-d periods. Diets were formulated to contain (% dry matter basis) 28.0% neutral detergent fiber and 16.2% crude protein, and contained alfalfa silage, 50.9; corn silage, 20.6; high-moisture shelled corn, 21.4; soy hulls, 4.7; plus minerals and vitamins, 2.4. Ruminal digesta were collected just before feeding on 3 consecutive days near the end of each period, and were separated into solid and liquid phases. Microbial DNA was extracted from each phase, amplified by PCR using domain-level bacterial primers, and subjected to automated ribosomal intergenic spacer analysis. The pH was 4.56 and 4.86 and the lactate-to-acetate ratio 9.8 and 4.4, respectively, for the treated and untreated alfalfa silages. Dry matter intakes and milk production data were not influenced by diets but showed a cow effect. Total volatile fatty acids (mM) tended to be greater for LP compared with Ctrl. Individual volatile fatty acids were not influenced by diets but showed a significant cow effect. Ruminal acetate (mol/100 mol) and acetate-to-propionate ratio were lower and propionate (mol/100 mol) greater for the 2 milk fat-depressed (MFD; <3.2% fat content) cows compared with the other 6 cows. Correspondence analysis of the 265 peaks in the automated ribosomal intergenic spacer analysis profile across the 188 samples revealed that the first 2 components contributed 7.1 and 3.8% to the total variation in the profile. The ordination points representing the liquid and solid phases clustered separately

  2. Biomineralization of calcium carbonate polymorphs by the bacterial strains isolated from calcareous sites.

    PubMed

    Dhami, Navdeep Kaur; Reddy, M Sudhakara; Mukherjee, Abhijit

    2013-05-01

    Microbially induced calcium carbonate precipitation (MICCP) is a naturally occurring biological process that has various applications in remediation and restoration of a range of building materials. In the present investigation, five ureolytic bacterial isolates capable of inducing calcium carbonate precipitation were isolated from calcareous soils on the basis of production of urease, carbonic anhydrase, extrapolymeric substances, and biofilm. Bacterial isolates were identified as Bacillus megaterium, B. cereus, B. thuringiensis, B. subtilis, and Lysinibacillus fusiformis based on 16S rRNA analysis. The calcium carbonate polymorphs produced by various bacterial isolates were analyzed by scanning electron microscopy, confocal laser scanning microscopy, X ray diffraction, and Fourier transmission infra red spectroscopy. A strainspecific precipitation of calcium carbonate forms was observed from different bacterial isolates. Based on the type of polymorph precipitated, the technology of MICCP can be applied for remediation of various building materials.

  3. [Isolation and identification of a bacterial strain JS018 capable of degrading several kinds of organophosphate pesticides].

    PubMed

    Jiang, Yu-Ji; Deng, You-Jin; Liu, Xin-Rui; Xie, Bao-Gui; Hu, Fang-Ping

    2006-06-01

    Organophosphate pesticides are used widely all over the world and play an important role in plant pest control. However these pesticides are considered as pollutants and harmful to human health. To search for microorganisms that can degrade organophosphate pesticides with high efficiency, a bacterial strain, coded as JS018, was isolated and screened from the soil in the vicinity of Shanming Pesticides Factory, Shanming, Fujian. Laboratory tests showed that the bacterium could degrade several kinds of organophosphate pesticides, such as Parathion-methyl and phoxin. The strain's degrading rates on phoxin, Parathion-methyl, hostathion and dichlorvos in LB liquid fermentation medium for 36 h were 99%, 96%, 80.4% and 69.0% respectively. The bacterial colonies on LB plate appeared shiny and pale-pink in color. The bacteria were Gram-negative coccoids, 0.5 - 0.7 microm in diameter. They grew well at 30 - 38 degrees C and pH 7.0 - 9.0. The optimal temperature and pH for cell growth was 32 degrees C and pH 7.5 - 8.0, respectively. They did not grow in medium containing 6% or more NaCl. The antibiotic susceptibility tests showed that the strain was resistant to ampicillin, penicillin and lincomycin. It was sensitive to kanamycin, tetracycline and gentamicin. Laboratory tests also showed that the strain could ferment D-glucose, trehalose, melezitose and ethanol. It was negative in the production of indole and hydrogen sulfide. It could not liquefy gelatin, utilize citrate, nor ferment L-arabinose, sucrose, D-mannitol, D-xylose, fructose, D-galactose, maltose or lactose. The catalase, urease and nitrate reduction were positive. Based on its morphological, physiological and biochemical properties as well as the 16S rDNA sequence analysis result, the strain was tentatively identified as Roseomonas sp. PMID:16933622

  4. Comparative analysis of bacterial community and antibiotic-resistant strains in different developmental stages of the housefly (Musca domestica).

    PubMed

    Wei, Ting; Hu, Jun; Miyanaga, Kazuhiko; Tanji, Yasunori

    2013-02-01

    The housefly (Musca domestica) is an important host for a variety of bacteria, including some pathogenic and antibiotic-resistant strains. To further investigate the relationship between the housefly and the bacteria it harbors, it is necessary to understand the fate of microorganisms during the larval metamorphosis. The major bacterial communities in three developmental stages of the housefly (maggot, pupa, and adult fly) were investigated by a culture-independent method, polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis of 16S rRNA genes. The bacteria that were identified using DGGE analysis spanned phyla Proteobacteria, Firmicutes, and Bacteroidetes. Changes in the predominant genera were observed during the housefly development. Bacteroides, Koukoulia, and Schineria were detected in maggots, Neisseria in pupae, and Macrococcus, Lactococcus, and Kurthia in adult flies. Antibiotic-resistant bacteria were screened using a selective medium and tested for antibiotic susceptibility. Most resistant isolates from maggots and pupae were classified as Proteus spp., while those from adult flies were much more diverse and spanned 12 genera. Among 20 tested strains across the three stages, 18 were resistant to at least two antibiotics. Overall, we demonstrated that there are changes in the major bacterial communities and antibiotic-resistant strains as the housefly develops.

  5. TolC is important for bacterial survival and oxidative stress response in Salmonella enterica serovar Choleraesuis in an acidic environment.

    PubMed

    Lee, Jen-Jie; Wu, Ying-Chen; Kuo, Chih-Jung; Hsuan, Shih-Ling; Chen, Ter-Hsin

    2016-09-25

    The outer membrane protein TolC, which is one of the key components of several multidrug efflux pumps, is thought to be involved in various independent systems in Enterobacteriaceae. Since the acidic environment of the stomach is an important protection barrier against foodborne pathogen infections in hosts, we evaluated whether TolC played a role in the acid tolerance of Salmonella enterica serovar Choleraesuis. Comparison of the acid tolerance of the tolC mutant and the parental wild-type strain showed that the absence of TolC limits the ability of Salmonella to sustain life under extreme acidic conditions. Additionally, the mutant exhibited morphological changes during growth in an acidic medium, leading to the conflicting results of cell viability measured by spectrophotometry and colony-forming unit counting. Reverse-transcriptional-PCR analysis indicated that acid-related molecules, apparatus, or enzymes and oxidation-induced factors were significantly affected by the acidic environment in the null-tolC mutant. The elongated cellular morphology was restored by adding antioxidants to the culture medium. Furthermore, we found that increased cellular antioxidative activity provides an overlapping protection against acid killing, demonstrating the complexity of the bacterial acid stress response. Our findings reinforce the multifunctional characteristics of TolC in acid tolerance or oxidative stress resistance and support the correlative protection mechanism between oxygen- and acid-mediated stress responses in Salmonella enterica serovar Choleraesuis. PMID:27599929

  6. [Hydrocarbons and fatty acid methyl esters in bacterial biomass before and after physicochemical treatment].

    PubMed

    Botvinko, I V; Popova, O V; Stroeva, A R; Shuvalov, S A; Vinokurov, V A

    2014-01-01

    Hydrocarbons and fatty acid methyl esters were identified by chromatography-mass spectrometry in the extracts from the native biomass of bacteria: chemoorganoheterotrophic Arthrobacter sp. and Pseudomonas aeruginosa and chemolithoautotrophic Carboxydothermus sp. Ultrasound treatment of bacterial biomass and mild thermolysis were shown promote formation of a broad spectrum of hydrocarbons from bacterial biomass. The biomarker stigmastane belonging to the sterane group was found in P. aeruginosa biomass after thermolysis at 110 degrees C in an open vial. Alkane composition in P. aeruginosa biomass before and after thermolysis at 300 degrees C in a sealed container remained unchanged, indicating the possibility of preservation of hydrocarbons of bacterial origin in sealed layers under high temperature and elevated pressure.

  7. Similar bacterial community composition in acidic mining lakes with different pH and lake chemistry.

    PubMed

    Kampe, Heike; Dziallas, Claudia; Grossart, Hans-Peter; Kamjunke, Norbert

    2010-10-01

    As extreme environmental conditions strongly affect bacterial community composition (BCC), we examined whether differences in pH-even at low pH-and in iron and sulfate concentrations lead to changes in BCC of acidic mining lakes. Thereby, we tested the following hypotheses: (1) diversity of the bacterial community in acidic lakes decreases with reducing pH, (2) BCC differs between epilimnion and hypolimnion, and (3) BCC in extremely acidic environments does not vary much over time. Therefore, we investigated the BCC of three acidic lakes with different pH values (2.3, 2.7, and 3.2) by denaturing gradient gel electrophoresis (DGGE) and subsequent sequencing of DGGE bands as well as catalyzed reporter deposition-FISH (CARD-FISH). BCC did not significantly vary among the studied lakes nor differ much between water layers. In contrast, BCC significantly changed over time, which is contradictory to our hypotheses. Bacterial communities were dominated by Alpha-, Beta-, and Gammaproteobacteria, whereas Actino- and Acidobacteria rarely occurred. Cell numbers of both free and attached bacteria were positively related to DOC concentration. Overall, low pH and extreme chemical conditions of the studied lakes led to similar assemblages of bacteria with pronounced temporal differences. This notion indicates that temporal changes in environmental conditions including food web structure also affect unique communities of bacteria thriving at low pH.

  8. Identification of a New Marine Bacterial Strain SD8 and Optimization of Its Culture Conditions for Producing Alkaline Protease.

    PubMed

    Cui, Hongxia; Yang, Muyang; Wang, Liping; Xian, Cory J

    2015-01-01

    While much attention has been given to marine microorganisms for production of enzymes, which in general are relatively more stable and active compared to those from plants and animals, studies on alkaline protease production from marine microorganisms have been very limited. In the present study, the alkaline protease producing marine bacterial strain SD8 isolated from sea muds in the Geziwo Qinhuangdao sea area of China was characterized and its optimal culture conditions were investigated. Strain SD8 was initially classified to belong to genus Pseudomonas by morphological, physiological and biochemical characterizations, and then through 16S rDNA sequence it was identified to be likely Pseudomonas hibiscicola. In addition, the culture mediums, carbon sources and culture conditions of strain SD8 were optimized for maximum production of alkaline protease. Optimum enzyme production (236U/mL when cultured bacteria being at 0.75 mg dry weight/mL fermentation broth) was obtained when the isolate at a 3% inoculum size was grown in LB medium at 20 mL medium/100mL Erlenmeyer flask for 48h culture at 30°C with an initial of pH 7.5. This was the first report of strain Pseudomonas hibiscicola secreting alkaline protease, and the data for its optimal cultural conditions for alkaline protease production has laid a foundation for future exploration for the potential use of SD8 strain for alkaline protease production.

  9. Cloning of a very virulent plus, 686 strain of Marek's disease virus as a bacterial artificial chromosome.

    PubMed

    Reddy, Sanjay M; Sun, Aijun; Khan, Owais A; Lee, Lucy F; Lupiani, Blanca

    2013-06-01

    Bacterial artificial chromosome (BAC) vectors were first developed to facilitate propagation and manipulation of large DNA fragments. This technology was later used to clone full-length genomes of large DNA viruses to study viral gene function. Marek's disease virus (MDV) is a highly oncogenic herpesvirus that causes rapid induction of T-cell lymphomas in chickens. Based on the virus's ability to cause disease in vaccinated chickens, MDV strains are classified into pathotypes, with the most virulent strains belonging to the very virulent plus (vv+) pathotype. Here we report the construction of BAC clones of 686 (686-BAC), a vv+ strain of MDV. Transfection of DNA isolated from two independent clones into duck embryo fibroblasts resulted in recovery of infectious virus. Pathogenesis studies showed that the BAC-derived 686 viruses were more virulent than Md5, a vv strain of MDV. With the use of a two-step red-mediated mutagenesis process, both copies of viral interleukin 8 (vIL-8) were deleted from the MDV genome, showing that 686-BACs were amenable to mutagenesis techniques. The generation of BAC clones from a vv+ strain of MDV is a significant step toward understanding molecular basis of MDV pathogenesis.

  10. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain.

    PubMed

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Abbott, James; Micklem, Chris N; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-06-14

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology.

  11. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain

    PubMed Central

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Micklem, Chris N.; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S.; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-01-01

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae. Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology. PMID:27247386

  12. Biotechnological potential of a rhizosphere Pseudomonas aeruginosa strain producing phenazine-1-carboxylic acid and phenazine-1-carboxamide.

    PubMed

    Zhou, Lian; Jiang, Hai-Xia; Sun, Shuang; Yang, Dan-Dan; Jin, Kai-Ming; Zhang, Wei; He, Ya-Wen

    2016-03-01

    Bacterial phenazine metabolites belong to a group of nitrogen-containing heterocyclic compounds with antimicrobial activities. In this study, a rhizosphere Pseudomonas aeruginosa strain PA1201 was isolated and identified through 16S rDNA sequence analysis and fatty acid profiling. PA1201 inhibited the growth of various pathogenic microorganisms, including Rhizotonia solani, Magnaporthe grisea, Fusarium graminearum, Xanthomonas oryzae pv. oryzae, Xanthomonas oryzae pv. oryzicola, and Staphylococcus aureus. High Performance Liquid Chromatography showed that PA1201 produced high levels of phenazine-1-carboxylic acid (PCA), a registered green fungicide 'Shenqinmycin' with the fermentation titers of 81.7 mg/L in pigment producing medium (PPM) and 926.9 mg/L in SCG medium containing soybean meal, corn steep liquor and glucose. In addition, PA1201 produced another antifungal metabolite, phenazine-1-carboxaminde (PCN), a derivative of PCA, with the fermentation titers of 18.1 and 489.5 mg/L in PPM and SCG medium respectively. To the best of our knowledge, PA1201 is a rhizosphere originating P. aeruginosa strain that congenitally produces the highest levels of PCA and PCN among currently reported P. aeruginosa isolates, which endows it great biotechnological potential to be transformed to a biopesticide-producing engineering strain. PMID:26873561

  13. Inhibitory activity of Salvadora persica extracts against oral bacterial strains associated with periodontitis: An in-vitro study

    PubMed Central

    Amir Alireza, Rasouli Ghahroudi; Afsaneh, Rezaei; Seied Hosein, Mohseni Salehifard; Siamak, Yaghoobee; Afshin, Khorsand; Zeinab, Kadkhoda; Mahvash, Moosavi Jazi; Amir Reza, Rokn

    2014-01-01

    Aims The use of natural plant extracts in pharmacology, medicine and dental hygiene has found a growing interest in modern scientific research. Salvadora persica is a natural tree whose fibrous branches have been approved by the World Health Organization for oral hygiene. Periodontitis is a highly prevalent adult gingival disease that leads to bone destruction and connective tissue attachment loss. The aim of this research was assessment the antimicrobial activities of methanolic extract of Salvadora persica (miswak) on isolated strains from the oral fluid. Methods In practical section, 50 female university students (21.4 ± 1 year) participated in the study. Based on examination by a periodontist, they were grouped into (Group I, n = 21) and (Group II, n = 29) i.e. with and without periodontitis respectively. Their un-stimulated saliva samples were obtained in sterile tubes. While three bacterial genera, Staphylococcus, Streptococcus and Lactobacillus were identified in all subjects, Enterococcus and Escherichia were only detected in Group I. Results A statistically significant difference in colonization levels between the two groups was observed. The effect of methanolic extract of S. persica against oral bacterial strains isolated from saliva was investigated using agar disc diffusion and microdilution methods. Although methanolic extract of S. persica was effective on growth inhibition of all strains, it was significantly more effective on Gram positive bacteria than Gram negative ones. Conclusions Effective substances present in S. persica extracts, exhibit a broad range of antibacterial activity and affect almost all bacterial species regardless of the Gram-staining nature. PMID:25737914

  14. Comparative Study of Bacterial Communities in Nepenthes Pitchers and Their Correlation to Species and Fluid Acidity.

    PubMed

    Kanokratana, Pattanop; Mhuanthong, Wuttichai; Laothanachareon, Thanaporn; Tangphatsornruang, Sithichoke; Eurwilaichitr, Lily; Kruetreepradit, Trongtham; Mayes, Shawn; Champreda, Verawat

    2016-08-01

    Pitchers are specialized digestive organs of carnivorous plants which evolved for trapping prey and represent a unique environment harboring hidden diversity of unexplored microbes forming transient hydrolytic microcosms. In this study, the diversity of bacterial communities in the pitcher fluids of seven local Nepenthes found in Thailand was assessed by tagged 16S ribosomal RNA (rRNA) gene amplicon sequencing on an Ion PGM™ platform. A total of 1,101,000 filtered sequences were obtained which were taxonomically classified into 20 phyla, 48 classes, 72 orders, 153 families, and 442 genera while the remainder (1.43 %) could not be assigned to any existing taxa. Proteobacteria represented the predominant members in closed pitchers and more diversified bacterial taxa particularly Bacteriodetes and Actinobacteria, showed increasing abundance in open pitchers containing insect bodies. Principal coordinate analysis revealed that distribution of bacterial taxa was not significantly related to the Nepenthes species but strongly correlated to the pH of the pitcher fluids (pH 1.7-6.7). Acidicella was a highly dominant bacterial genus in acidic pitcher fluids while Dyella and Mycobacterium were also common genera in most pitchers. A unique microbial community structure was found in Nepenthes ampullaria which could reflect their adaptation to digest leaf litter, in addition to insect prey. The work revealed the highly unexplored nature of bacterial microcosms in Nepenthes pitcher fluids and provides insights into their community structure in this unique ecological system. PMID:27287538

  15. Comparisons of internal behavior after exposure to Flavobacterium psychrophilum between two ayu (Plecoglossus altivelis altivelis) strains showing different cumulative mortality to bacterial cold water disease.

    PubMed

    Kageyama, Tetsushi; Kuwada, Tomonori; Ohara, Kenichi; Nouno, Aya; Umino, Tetsuya; Furusawa, Shuichi

    2013-12-30

    Bacterial cold water disease (BCWD) in ayu (Plecoglossus altivelis altivelis) has a serious impact on aquaculture and fisheries. There is known to be a significant difference among ayu strains with regard to mortality caused by BCWD. In this study, the immune response of different ayu strains against Flavobacterium psychrophilum infection was observed. One strain was resistant to infection by F. psychrophilum, and the other was susceptible to infection by the same bacteria. The number of bacteria in the body was observed in each ayu strain, and the change in bacterial counts was similar. However, there was a significant difference in bacterial count in the spleen between the two strains on days 6, 9, 12 and 15 after exposure. To observe the immune response against F. psychrophilum, agglutination assay using serum was performed. An agglutination reaction in the resistant ayu strain was observed in 4 out of 6 ayu on day 6 after exposure, while no reactions in the susceptible ayu strain were observed in any sampled fish until day 12. However, some reactions in the susceptible ayu strain were observed in surviving ayu. These results indicate that there is a correlation between the presence of bacterial multiplication and agglutination reaction against F. psychrophilum.

  16. PLANT MICROBIOME. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa.

    PubMed

    Lebeis, Sarah L; Paredes, Sur Herrera; Lundberg, Derek S; Breakfield, Natalie; Gehring, Jase; McDonald, Meredith; Malfatti, Stephanie; Glavina del Rio, Tijana; Jones, Corbin D; Tringe, Susannah G; Dangl, Jeffery L

    2015-08-21

    Immune systems distinguish "self" from "nonself" to maintain homeostasis and must differentially gate access to allow colonization by potentially beneficial, nonpathogenic microbes. Plant roots grow within extremely diverse soil microbial communities but assemble a taxonomically limited root-associated microbiome. We grew isogenic Arabidopsis thaliana mutants with altered immune systems in a wild soil and also in recolonization experiments with a synthetic bacterial community. We established that biosynthesis of, and signaling dependent on, the foliar defense phytohormone salicylic acid is required to assemble a normal root microbiome. Salicylic acid modulates colonization of the root by specific bacterial families. Thus, plant immune signaling drives selection from the available microbial communities to sculpt the root microbiome.

  17. Screening of Non- Saccharomyces cerevisiae Strains for Tolerance to Formic Acid in Bioethanol Fermentation.

    PubMed

    Oshoma, Cyprian E; Greetham, Darren; Louis, Edward J; Smart, Katherine A; Phister, Trevor G; Powell, Chris; Du, Chenyu

    2015-01-01

    Formic acid is one of the major inhibitory compounds present in hydrolysates derived from lignocellulosic materials, the presence of which can significantly hamper the efficiency of converting available sugars into bioethanol. This study investigated the potential for screening formic acid tolerance in non-Saccharomyces cerevisiae yeast strains, which could be used for the development of advanced generation bioethanol processes. Spot plate and phenotypic microarray methods were used to screen the formic acid tolerance of 7 non-Saccharomyces cerevisiae yeasts. S. kudriavzeii IFO1802 and S. arboricolus 2.3319 displayed a higher formic acid tolerance when compared to other strains in the study. Strain S. arboricolus 2.3319 was selected for further investigation due to its genetic variability among the Saccharomyces species as related to Saccharomyces cerevisiae and availability of two sibling strains: S. arboricolus 2.3317 and 2.3318 in the lab. The tolerance of S. arboricolus strains (2.3317, 2.3318 and 2.3319) to formic acid was further investigated by lab-scale fermentation analysis, and compared with S. cerevisiae NCYC2592. S. arboricolus 2.3319 demonstrated improved formic acid tolerance and a similar bioethanol synthesis capacity to S. cerevisiae NCYC2592, while S. arboricolus 2.3317 and 2.3318 exhibited an overall inferior performance. Metabolite analysis indicated that S. arboricolus strain 2.3319 accumulated comparatively high concentrations of glycerol and glycogen, which may have contributed to its ability to tolerate high levels of formic acid.

  18. Screening of Non- Saccharomyces cerevisiae Strains for Tolerance to Formic Acid in Bioethanol Fermentation

    PubMed Central

    Oshoma, Cyprian E.; Greetham, Darren; Louis, Edward J.; Smart, Katherine A.; Phister, Trevor G.; Powell, Chris; Du, Chenyu

    2015-01-01

    Formic acid is one of the major inhibitory compounds present in hydrolysates derived from lignocellulosic materials, the presence of which can significantly hamper the efficiency of converting available sugars into bioethanol. This study investigated the potential for screening formic acid tolerance in non-Saccharomyces cerevisiae yeast strains, which could be used for the development of advanced generation bioethanol processes. Spot plate and phenotypic microarray methods were used to screen the formic acid tolerance of 7 non-Saccharomyces cerevisiae yeasts. S. kudriavzeii IFO1802 and S. arboricolus 2.3319 displayed a higher formic acid tolerance when compared to other strains in the study. Strain S. arboricolus 2.3319 was selected for further investigation due to its genetic variability among the Saccharomyces species as related to Saccharomyces cerevisiae and availability of two sibling strains: S. arboricolus 2.3317 and 2.3318 in the lab. The tolerance of S. arboricolus strains (2.3317, 2.3318 and 2.3319) to formic acid was further investigated by lab-scale fermentation analysis, and compared with S. cerevisiae NCYC2592. S. arboricolus 2.3319 demonstrated improved formic acid tolerance and a similar bioethanol synthesis capacity to S. cerevisiae NCYC2592, while S. arboricolus 2.3317 and 2.3318 exhibited an overall inferior performance. Metabolite analysis indicated that S. arboricolus strain 2.3319 accumulated comparatively high concentrations of glycerol and glycogen, which may have contributed to its ability to tolerate high levels of formic acid. PMID:26284784

  19. Isolation and Characterization of Rhamnolipid-Producing Bacterial Strains from a Biodiesel Facility

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel strains of rhamnolipid-producing bacteria were isolated from soils at a biodiesel facility on the basis of their ability to grow on glycerol as a sole carbon source. Strains were identified as Acinetobacter calcoaceticus, Enterobacter asburiae, E. hormaecheii, Pantoea stewartii and Pseudomona...

  20. Polysaccharide capsule and sialic acid-mediated regulation promote biofilm-like intracellular bacterial communities during cystitis.

    PubMed

    Anderson, Gregory G; Goller, Carlos C; Justice, Sheryl; Hultgren, Scott J; Seed, Patrick C

    2010-03-01

    Uropathogenic Escherichia coli (UPEC) is the leading cause of urinary tract infections (UTIs). A murine UTI model has revealed an infection cascade whereby UPEC undergoes cycles of invasion of the bladder epithelium, intracellular proliferation in polysaccharide-containing biofilm-like masses called intracellular bacterial communities (IBC), and then dispersal into the bladder lumen to initiate further rounds of epithelial colonization and invasion. We predicted that the UPEC K1 polysaccharide capsule is a key constituent of the IBC matrix. Compared to prototypic E. coli K1 strain UTI89, a capsule assembly mutant had a fitness defect in functionally TLR4(+) and TLR4(-) mice, suggesting a protective role of capsule in inflamed and noninflamed hosts. K1 capsule assembly and synthesis mutants had dramatically reduced IBC formation, demonstrating the common requirement for K1 polysaccharide in IBC development. The capsule assembly mutant appeared dispersed in the cytoplasm of the bladder epithelial cells and failed to undergo high-density intracellular replication during later stages of infection, when the wild-type strain continued to form serial generations of IBC. Deletion of the sialic acid regulator gene nanR partially restored IBC formation in the capsule assembly mutant. These data suggest that capsule is necessary for efficient IBC formation and that aberrant sialic acid accumulation, resulting from disruption of K1 capsule assembly, produces a NanR-mediated defect in intracellular proliferation and IBC development. Together, these data demonstrate the complex but important roles of UPEC polysaccharide encapsulation and sialic acid signaling in multiple stages of UTI pathogenesis.

  1. Isolation of a high malic and low acetic acid-producing sake yeast Saccharomyces cerevisiae strain screened from respiratory inhibitor 2,4-dinitrophenol (DNP)-resistant strains.

    PubMed

    Kosugi, Shingo; Kiyoshi, Keiji; Oba, Takahiro; Kusumoto, Kenichi; Kadokura, Toshimori; Nakazato, Atsumi; Nakayama, Shunichi

    2014-01-01

    We isolated 2,4-dinitrophenol (DNP)-resistant sake yeast strains by UV mutagenesis. Among the DNP-resistant mutants, we focused on strains exhibiting high malic acid and low acetic acid production. The improved organic acid composition is unlikely to be under the control of enzyme activities related to malic and acetic acid synthesis pathways. Instead, low mitochondrial activity was observed in DNP-resistant mutants, indicating that the excess pyruvic acid generated during glycolysis is not metabolized in the mitochondria but converted to malic acid in the cytosol. In addition, the NADH/NAD(+) ratio of the DNP-resistant strains was higher than that of the parental strain K901. These results suggest that the increased NADH/NAD(+) ratio together with the low mitochondrial activity alter the organic acid composition because malic acid synthesis requires NADH, while acetic acid uses NAD(+).

  2. Bacterially synthesized folate and supplemental folic acid are absorbed across the large intestine of piglets.

    PubMed

    Asrar, Farhan M; O'Connor, Deborah L

    2005-10-01

    A large pool of folate exists in the large intestine of humans. Preliminary evidence, primarily in vitro, suggests that this folate may be bioavailable. The purpose of this study was to test the hypothesis that supplemental folic acid and bacterially synthesized folate are absorbed across the large intestine of piglets. The pig was used as an animal model because it resembles the human in terms of folate absorption, at least in the small intestine. A tracer of [3H]-folic acid or [3H]-para-aminobenzoic acid ([3H]-PABA), a precursor of bacterially synthesized folate, was injected into the cecum of 11-day-old piglets. Feces and urine were collected for 3 days. Thereafter, piglets were killed, and livers and kidneys harvested. [3H]-Folate was isolated from biological samples by affinity chromatography using immobilized milk folate binding proteins and counted using a scintillation counter. In piglets injected with [3H]-folic acid, the feces, liver, urine and kidneys accounted for 82.1%, 12.3%, 3.9% and 1.7% of recovered [3H]-folate, respectively. In piglets injected with [3H]-PABA, the amount of recovered bacterially synthesized folate in the feces, liver and urine was 85.1%, 0.4% and 14.6%, respectively. Twenty-three percent and 13% of tritium were recovered in samples examined (liver, kidney, fecal and urine) from piglets injected with [3H]-folic acid and [3H]-PABA, respectively. Using our estimates of [3H]-folic acid absorption and the total and percent monoglutamyl folate content of piglet feces, we predict that at least 18% of the dietary folate requirement for the piglet could be met by folate absorption across the large intestine.

  3. [Cephalosporin-Acid Synthetase of Escherichia coli Strain VKPM B-10182: Genomic Context, Gene Identification, Producer Strain Production].

    PubMed

    Eldarov M, A; Sklyarenko, A V; Mardanov, A V; Beletsky, A V; Zhgun, A A; Dumina, M V; Medvedeva, N V; Satarova, D E; Ravin, N V; Yarockii, S V

    2015-01-01

    An enzyme of cephalosporin-acid synthetase produced by the E. coli strain VKPM B-10182 has specificity for the synthesis of β-lactam antibiotics of the cephalosporin acids class (cefazolin, cefalotin, cefezole etc.). A comparison of the previously determined genomic sequence of E. coli VKPM B-10182 with a genome of the parent E. coli strain ATCC 9637 was performed. Multiple mutations indicating the long selection history of the strain were detected, including mutations in the genes of RNase and β-lactamases that could enhance the level of enzyme synthesis and reduce the degree of degradation of the synthesized cephalosporin acids. The CASA gene--a direct homolog of the penicillin G-acylase gene--was identified by bioinformatics methods. The homology of the gene was confirmed by gene cloning and the expression and determination of its enzymatic activity in the reaction of cefazolin synthesis. The CASA gene was isolated and cloned into the original expression vector, resulting in an effective E. coli BL2l(DE3) pMD0107 strain producing CASA. PMID:26596082

  4. Spray washing carcasses with alkaline solutions of lauric acid to reduce bacterial contamination.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The effect of spray washing carcasses with lauric acid (LA)-potassium hydroxide (KOH) on bacteria recovered from whole-carcass-rinsates (WCR) was examined. Skin of carcasses was inoculated with a cecal paste containing antibiotic resistant strains of Escherichia coli, Salmonella Typhimirum, and Camp...

  5. Gene-related strain variation of Staphylococcus aureus for homologous resistance response to acid stress.

    PubMed

    Lee, Soomin; Ahn, Sooyeon; Lee, Heeyoung; Kim, Won-Il; Kim, Hwang-Yong; Ryu, Jae-Gee; Kim, Se-Ri; Choi, Kyoung-Hee; Yoon, Yohan

    2014-10-01

    This study investigated the effect of adaptation of Staphylococcus aureus strains to the acidic condition of tomato in response to environmental stresses, such as heat and acid. S. aureus ATCC 13565, ATCC 14458, ATCC 23235, ATCC 27664, and NCCP10826 habituated in tomato extract at 35°C for 24 h were inoculated in tryptic soy broth. The culture suspensions were then subjected to heat challenge or acid challenge at 60°C and pH 3.0, respectively, for 60 min. In addition, transcriptional analysis using quantitative real-time PCR was performed to evaluate the expression level of acid-shock genes, such as clpB, zwf, nuoF, and gnd, from five S. aureus strains after the acid habituation of strains in tomato at 35°C for 15 min and 60 min in comparison with that of the nonhabituated strains. In comparison with the nonhabituated strains, the five tomato-habituated S. aureus strains did not show cross protection to heat, but tomato-habituated S. aureus ATCC 23235 showed acid resistance. In quantitative real-time-PCR analysis, the relative expression levels of acid-shock genes (clpB, zwf, nuoF, and gnd) were increased the most in S. aureus ATCC 23235 after 60 min of tomato habituation, but there was little difference in the expression levels among the five S. aureus strains after 15 min of tomato habituation. These results indicate that the variation of acid resistance of S. aureus is related to the expression of acid-shock genes during acid habituation. PMID:25285500

  6. Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar.

    PubMed

    Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng

    2016-05-01

    Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites.

  7. Use of Response Surface Methodology to Optimize Culture Conditions for Hydrogen Production by an Anaerobic Bacterial Strain from Soluble Starch

    NASA Astrophysics Data System (ADS)

    Kieu, Hoa Thi Quynh; Nguyen, Yen Thi; Dang, Yen Thi; Nguyen, Binh Thanh

    2016-05-01

    Biohydrogen is a clean source of energy that produces no harmful byproducts during combustion, being a potential sustainable energy carrier for the future. Therefore, biohydrogen produced by anaerobic bacteria via dark fermentation has attracted attention worldwide as a renewable energy source. However, the hydrogen production capability of these bacteria depends on major factors such as substrate, iron-containing hydrogenase, reduction agent, pH, and temperature. In this study, the response surface methodology (RSM) with central composite design (CCD) was employed to improve the hydrogen production by an anaerobic bacterial strain isolated from animal waste in Phu Linh, Soc Son, Vietnam (PL strain). The hydrogen production process was investigated as a function of three critical factors: soluble starch concentration (8 g L-1 to 12 g L-1), ferrous iron concentration (100 mg L-1 to 200 mg L-1), and l-cysteine concentration (300 mg L-1 to 500 mg L-1). RSM analysis showed that all three factors significantly influenced hydrogen production. Among them, the ferrous iron concentration presented the greatest influence. The optimum hydrogen concentration of 1030 mL L-1 medium was obtained with 10 g L-1 soluble starch, 150 mg L-1 ferrous iron, and 400 mg L-1 l-cysteine after 48 h of anaerobic fermentation. The hydrogen concentration produced by the PL strain was doubled after using RSM. The obtained results indicate that RSM with CCD can be used as a technique to optimize culture conditions for enhancement of hydrogen production by the selected anaerobic bacterial strain. Hydrogen production from low-cost organic substrates such as soluble starch using anaerobic fermentation methods may be one of the most promising approaches.

  8. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    PubMed Central

    Lui, Clarissa; Cady, Nathaniel C.; Batt, Carl A.

    2009-01-01

    The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform. PMID:22412335

  9. Isolating and evaluating lactic acid bacteria strains for effectiveness of Leymus chinensis silage fermentation.

    PubMed

    Zhang, Q; Li, X J; Zhao, M M; Yu, Z

    2014-10-01

    Five LAB strains were evaluated using the acid production ability test, morphological observation, Gram staining, physiological, biochemical and acid tolerance tests. All five strains (LP1, LP2, LP3, LC1 and LC2) grew at pH 4·0, and LP1 grew at 15°C. Strains LP1, LP2 and LP3 were identified as Lactobacillus plantarum, whereas LC1 and LC2 were classified as Lactobacillus casei by sequencing 16S rDNA. The five isolated strains and two commercial inoculants (PS and CL) were added to native grass and Leymus chinensis (Trin.) Tzvel. for ensiling. All five isolated strains decreased the pH and ammonia nitrogen content, increased the lactic acid content and LP1, LP2 and LP3 increased the acetic content and lactic/acetic acid ratio of L. chinensis silage significantly. The five isolated strains and two commercial inoculants decreased the butyric acid content of the native grass silage. LP2 treatment had lower butyric acid content and ammonia nitrogen content than the other treatments. The five isolated strains improved the quality of L. chinensis silage. The five isolated strains and the two commercial inoculants were not effective in improving the fermentation quality of the native grass silage, but LP2 performed better comparatively. Significance and impact of the study: Leymus chinensis is an important grass in China and Russia, being the primary grass of the short grassland 'steppe' regions of central Asia. However, it has been difficult to make high-quality silage of this species because of low concentration of water-soluble carbohydrates (WSC). Isolating and evaluating lactic acid bacteria strains will be helpful for improving the silage quality of this extensively grown species. PMID:24888497

  10. Butyric acid from anaerobic fermentation of lignocellulosic biomass hydrolysates by Clostridium tyrobutyricum strain RPT-4213

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A newly isolated Clostridium sp. strain RPT-4213 was found to produce butyrate under anaerobic conditions. Fermentations using Lactobacilli MRS Broth produced 9.47 g L-1 butyric acid from glucose (0.48 g/g glucose). However, the strain was not capable of utilizing five carbon sugars. To assess the a...

  11. Screening of Bifidobacterium strains isolated from human faeces for antagonistic activities against potentially bacterial pathogens.

    PubMed

    Bevilacqua, Lorella; Ovidi, Monia; Di Mattia, Elena; Trovatelli, Luigi Daniele; Canganella, Francesco

    2003-01-01

    As probiotic bacteria, strains belonging to the genus Bifidobacterium colonise the gastro-intestinal tract of humans and animals at the time of birth, and they are found in young as well as in adult individuals in great numbers. Moreover, they can interact with the development of enteric infections by the production of antimicrobial metabolites. In this work 281 strains of bifidobacteria were anaerobically isolated from human faecal samples, supplied by volunteers of different ages (youngs, adults, elders), and preliminarly described by microscopic observation. All strains were screened by the fructose 6-phosphate phosphoketolase (F6PPK) test in order to confirm their classification within the genus Bifidobacterium. Selected strains were used to evaluate their antagonistic activities against Escherichia coli, Salmonella thyphimurium, Staphylococcus lentus, Enterococcus faecalis, Acinetobacter calcoaceticus, Sphingomonas paucimobilis, Listeria monocytogenes, Yersinia enterocolitica, Bacillus cereus, Clostridium sporogenes. Experiments were performed in vitro by different methods based on the observation of growth inhibition in Petri dishes. The strains that showed the highest inhibiting activities were compared by SDS-PAGE for total cell proteins, using type strains of human origin as references. Representative isolates were metabolically characterised by the BIOLOG system; a specific database was created with strains obtained from our collection and a statistical evaluation for metabolic patterns was carried out.

  12. Natural history of the infant gut microbiome and impact of antibiotic treatment on bacterial strain diversity and stability.

    PubMed

    Yassour, Moran; Vatanen, Tommi; Siljander, Heli; Hämäläinen, Anu-Maaria; Härkönen, Taina; Ryhänen, Samppa J; Franzosa, Eric A; Vlamakis, Hera; Huttenhower, Curtis; Gevers, Dirk; Lander, Eric S; Knip, Mikael; Xavier, Ramnik J

    2016-06-15

    The gut microbial community is dynamic during the first 3 years of life, before stabilizing to an adult-like state. However, little is known about the impact of environmental factors on the developing human gut microbiome. We report a longitudinal study of the gut microbiome based on DNA sequence analysis of monthly stool samples and clinical information from 39 children, about half of whom received multiple courses of antibiotics during the first 3 years of life. Whereas the gut microbiome of most children born by vaginal delivery was dominated by Bacteroides species, the four children born by cesarean section and about 20% of vaginally born children lacked Bacteroides in the first 6 to 18 months of life. Longitudinal sampling, coupled with whole-genome shotgun sequencing, allowed detection of strain-level variation as well as the abundance of antibiotic resistance genes. The microbiota of antibiotic-treated children was less diverse in terms of both bacterial species and strains, with some species often dominated by single strains. In addition, we observed short-term composition changes between consecutive samples from children treated with antibiotics. Antibiotic resistance genes carried on microbial chromosomes showed a peak in abundance after antibiotic treatment followed by a sharp decline, whereas some genes carried on mobile elements persisted longer after antibiotic therapy ended. Our results highlight the value of high-density longitudinal sampling studies with high-resolution strain profiling for studying the establishment and response to perturbation of the infant gut microbiome.

  13. Natural history of the infant gut microbiome and impact of antibiotic treatment on bacterial strain diversity and stability.

    PubMed

    Yassour, Moran; Vatanen, Tommi; Siljander, Heli; Hämäläinen, Anu-Maaria; Härkönen, Taina; Ryhänen, Samppa J; Franzosa, Eric A; Vlamakis, Hera; Huttenhower, Curtis; Gevers, Dirk; Lander, Eric S; Knip, Mikael; Xavier, Ramnik J

    2016-06-15

    The gut microbial community is dynamic during the first 3 years of life, before stabilizing to an adult-like state. However, little is known about the impact of environmental factors on the developing human gut microbiome. We report a longitudinal study of the gut microbiome based on DNA sequence analysis of monthly stool samples and clinical information from 39 children, about half of whom received multiple courses of antibiotics during the first 3 years of life. Whereas the gut microbiome of most children born by vaginal delivery was dominated by Bacteroides species, the four children born by cesarean section and about 20% of vaginally born children lacked Bacteroides in the first 6 to 18 months of life. Longitudinal sampling, coupled with whole-genome shotgun sequencing, allowed detection of strain-level variation as well as the abundance of antibiotic resistance genes. The microbiota of antibiotic-treated children was less diverse in terms of both bacterial species and strains, with some species often dominated by single strains. In addition, we observed short-term composition changes between consecutive samples from children treated with antibiotics. Antibiotic resistance genes carried on microbial chromosomes showed a peak in abundance after antibiotic treatment followed by a sharp decline, whereas some genes carried on mobile elements persisted longer after antibiotic therapy ended. Our results highlight the value of high-density longitudinal sampling studies with high-resolution strain profiling for studying the establishment and response to perturbation of the infant gut microbiome. PMID:27306663

  14. Strain Dependent Genetic Networks for Antibiotic-Sensitivity in a Bacterial Pathogen with a Large Pan-Genome

    PubMed Central

    van Opijnen, Tim; Bento, José

    2016-01-01

    The interaction between an antibiotic and bacterium is not merely restricted to the drug and its direct target, rather antibiotic induced stress seems to resonate through the bacterium, creating selective pressures that drive the emergence of adaptive mutations not only in the direct target, but in genes involved in many different fundamental processes as well. Surprisingly, it has been shown that adaptive mutations do not necessarily have the same effect in all species, indicating that the genetic background influences how phenotypes are manifested. However, to what extent the genetic background affects the manner in which a bacterium experiences antibiotic stress, and how this stress is processed is unclear. Here we employ the genome-wide tool Tn-Seq to construct daptomycin-sensitivity profiles for two strains of the bacterial pathogen Streptococcus pneumoniae. Remarkably, over half of the genes that are important for dealing with antibiotic-induced stress in one strain are dispensable in another. By confirming over 100 genotype-phenotype relationships, probing potassium-loss, employing genetic interaction mapping as well as temporal gene-expression experiments we reveal genome-wide conditionally important/essential genes, we discover roles for genes with unknown function, and uncover parts of the antibiotic’s mode-of-action. Moreover, by mapping the underlying genomic network for two query genes we encounter little conservation in network connectivity between strains as well as profound differences in regulatory relationships. Our approach uniquely enables genome-wide fitness comparisons across strains, facilitating the discovery that antibiotic responses are complex events that can vary widely between strains, which suggests that in some cases the emergence of resistance could be strain specific and at least for species with a large pan-genome less predictable. PMID:27607357

  15. Strain Dependent Genetic Networks for Antibiotic-Sensitivity in a Bacterial Pathogen with a Large Pan-Genome.

    PubMed

    van Opijnen, Tim; Dedrick, Sandra; Bento, José

    2016-09-01

    The interaction between an antibiotic and bacterium is not merely restricted to the drug and its direct target, rather antibiotic induced stress seems to resonate through the bacterium, creating selective pressures that drive the emergence of adaptive mutations not only in the direct target, but in genes involved in many different fundamental processes as well. Surprisingly, it has been shown that adaptive mutations do not necessarily have the same effect in all species, indicating that the genetic background influences how phenotypes are manifested. However, to what extent the genetic background affects the manner in which a bacterium experiences antibiotic stress, and how this stress is processed is unclear. Here we employ the genome-wide tool Tn-Seq to construct daptomycin-sensitivity profiles for two strains of the bacterial pathogen Streptococcus pneumoniae. Remarkably, over half of the genes that are important for dealing with antibiotic-induced stress in one strain are dispensable in another. By confirming over 100 genotype-phenotype relationships, probing potassium-loss, employing genetic interaction mapping as well as temporal gene-expression experiments we reveal genome-wide conditionally important/essential genes, we discover roles for genes with unknown function, and uncover parts of the antibiotic's mode-of-action. Moreover, by mapping the underlying genomic network for two query genes we encounter little conservation in network connectivity between strains as well as profound differences in regulatory relationships. Our approach uniquely enables genome-wide fitness comparisons across strains, facilitating the discovery that antibiotic responses are complex events that can vary widely between strains, which suggests that in some cases the emergence of resistance could be strain specific and at least for species with a large pan-genome less predictable. PMID:27607357

  16. Protein, cell and bacterial response to atmospheric pressure plasma grafted hyaluronic acid on poly(methylmethacrylate).

    PubMed

    D'Sa, Raechelle A; Raj, Jog; Dickinson, Peter J; McMahon, M Ann S; McDowell, David A; Meenan, Brian J

    2015-11-01

    Hyaluronic acid (HA) has been immobilised on poly(methyl methacrylate) (PMMA) surfaces using a novel dielectric barrier discharge (DBD) plasma process for the purposes of repelling protein, cellular and bacterial adhesion in the context of improving the performance of ophthalmic devices. Grafting was achieved by the following steps: (1) treatment of the PMMA with a DBD plasma operating at atmospheric pressure, (2) amine functionalisation of the activated polymer surface by exposure to a 3-aminopropyltrimethoxysilane (APTMS) linker molecule and (3) reaction of HA with the surface bound amine. The mechanism and effectiveness of the grafting process was verified by surface analysis. XPS data indicates that the APTMS linker molecule binds to PMMA via the Si-O chemistry and has the required pendant amine moiety. The carboxylic acid moiety on HA then binds with this -NH2 group via standard carbodiimide chemistry. ToF-SIMS confirms the presence of a coherent HA layer the microstructure of which is verified by AFM. The plasma grafted HA coating surfaces showed a pronounced decrease in protein and cellular adhesion when tested with bovine serum albumin and human corneal epithelial cells, respectively. The ability of these coatings to resist bacterial adhesion was established using Staphylococcus aureus NTC8325. Interestingly, the coatings did not repel bacterial adhesion, indicating that the mechanism of adhesion of bacterial cells is different to that for the surface interactions of mammalian cells. It is proposed that this difference is a consequence of the specific HA conformation that occurs under the conditions employed here. Hence, it is apparent that the microstructure/architecture of the HA coatings is an important factor in fabricating surfaces intended to repel proteins, mammalian and bacterial cells.

  17. Protein, cell and bacterial response to atmospheric pressure plasma grafted hyaluronic acid on poly(methylmethacrylate).

    PubMed

    D'Sa, Raechelle A; Raj, Jog; Dickinson, Peter J; McMahon, M Ann S; McDowell, David A; Meenan, Brian J

    2015-11-01

    Hyaluronic acid (HA) has been immobilised on poly(methyl methacrylate) (PMMA) surfaces using a novel dielectric barrier discharge (DBD) plasma process for the purposes of repelling protein, cellular and bacterial adhesion in the context of improving the performance of ophthalmic devices. Grafting was achieved by the following steps: (1) treatment of the PMMA with a DBD plasma operating at atmospheric pressure, (2) amine functionalisation of the activated polymer surface by exposure to a 3-aminopropyltrimethoxysilane (APTMS) linker molecule and (3) reaction of HA with the surface bound amine. The mechanism and effectiveness of the grafting process was verified by surface analysis. XPS data indicates that the APTMS linker molecule binds to PMMA via the Si-O chemistry and has the required pendant amine moiety. The carboxylic acid moiety on HA then binds with this -NH2 group via standard carbodiimide chemistry. ToF-SIMS confirms the presence of a coherent HA layer the microstructure of which is verified by AFM. The plasma grafted HA coating surfaces showed a pronounced decrease in protein and cellular adhesion when tested with bovine serum albumin and human corneal epithelial cells, respectively. The ability of these coatings to resist bacterial adhesion was established using Staphylococcus aureus NTC8325. Interestingly, the coatings did not repel bacterial adhesion, indicating that the mechanism of adhesion of bacterial cells is different to that for the surface interactions of mammalian cells. It is proposed that this difference is a consequence of the specific HA conformation that occurs under the conditions employed here. Hence, it is apparent that the microstructure/architecture of the HA coatings is an important factor in fabricating surfaces intended to repel proteins, mammalian and bacterial cells. PMID:26449450

  18. Optimization of the mechanical performance of bacterial cellulose/poly(L-lactic) acid composites.

    PubMed

    Quero, Franck; Nogi, Masaya; Yano, Hiroyuki; Abdulsalami, Kovo; Holmes, Stuart M; Sakakini, Bahij H; Eichhorn, Stephen J

    2010-01-01

    Understanding the nature of the interface between nanofibers and polymer resins in composite materials is challenging because of the complexity of interactions that may occur between fibers and between the matrix and the fibers. The ability to select the most efficient amount of reinforcement for stress transfer, making a saving on both cost and weight, is also a key part of composite design. The use of Raman spectroscopy to investigate micromechanical properties of laminated bacterial cellulose (BC)/poly(l-lactic) acid (PLLA) resin composites is reported for the first time as a means for understanding the fundamental stress-transfer processes in these composites, but also as a tool to select appropriate processing and volume fraction of the reinforcing fibers. Two forms of BC networks are investigated, namely, one cultured for 3 days and another for 6 days. The mechanical properties of the latter were found to be higher than the former in terms of Young's modulus, stress at failure, and work of fracture. However, their specific Young's moduli (divided by density) were found to be similar. Young's modulus and stress at failure of transparent predominantly amorphous PLLA films were found to increase by 100 and 315%, respectively, for an 18% volume fraction of BC fibers. BC networks cultured for 3 days were shown to exhibit enhanced interaction with PLLA because of their higher total surface area compared, as measured by nitrogen adsorption, to the material cultured for 6 days. This enhanced interaction is confirmed by using the Raman spectroscopic approach, whereby larger band shift rates, of a peak initially located at 1095 cm(-1), with respect to both strain and stress, are observed, which is a quantitative measure of enhanced stress transfer. Thermal analysis (differential scanning calorimetry) and electron microscopy imaging (scanning electron microscopy) of the samples also confirms the enhanced coupling between the resin and the BC networks cultured for 3 days

  19. Mutations in y-aminobutyric acid (GABA) transaminase genes in plants or Pseudomonas syringae reduce bacterial virulence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pseudomonas syringae pv. tomato DC3000 is a bacterial pathogen of Arabidopsis and tomato that grows in the apoplast. The non-protein amino acid '-amino butyric acid (GABA) is produced by Arabidopsis and tomato and is the most abundant amino acid in the apoplastic fluid of tomato. The DC3000 genome h...

  20. Molecular characterization of Xanthomonas strains responsible for bacterial leaf spot of tomato in Ethiopia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial spot of tomato (BST) is a major constraint to tomato production in Ethiopia and many other countries leading to significant crop losses. In the present study, using pathogenicity tests, sensitivity to copper and streptomycin, and multilocus sequence analysis, a diverse group of Xanthomonas...

  1. A novel, sensitive method to evaluate potato germplasm for bacterial wilt resistance using a luminescent Ralstonia solanacearum reporter strain.

    PubMed

    Cruz, Andrea Paola Zuluaga; Ferreira, Virginia; Pianzzola, María Julia; Siri, María Inés; Coll, Núria S; Valls, Marc

    2014-03-01

    Several breeding programs are under way to introduce resistance to bacterial wilt caused by Ralstonia solanacearum in solanaceous crops. The lack of screening methods allowing easy measurement of pathogen colonization and the inability to detect latent (i.e., symptomless) infections are major limitations when evaluating resistance to this disease in plant germplasm. We describe a new method to study the interaction between R. solanacearum and potato germplasm that overcomes these restrictions. The R. solanacearum UY031 was genetically modified to constitutively generate light from a synthetic luxCDABE operon stably inserted in its chromosome. Colonization of this reporter strain on different potato accessions was followed using life imaging. Bacterial detection in planta by this nondisruptive system correlated with the development of wilting symptoms. In addition, we demonstrated that quantitative detection of the recombinant strain using a luminometer can identify latent infections on symptomless potato plants. We have developed a novel, unsophisticated, and accurate method for high-throughput evaluation of pathogen colonization in plant populations. We applied this method to compare the behavior of potato accessions with contrasting resistance to R. solanacearum. This new system will be especially useful to detect latency in symptomless parental lines before their inclusion in long-term breeding programs for disease resistance.

  2. Effects of the inoculant strain Sphingomonas paucimobilis 20006FA on soil bacterial community and biodegradation in phenanthrene-contaminated soil.

    PubMed

    Coppotelli, B M; Ibarrolaza, A; Del Panno, M T; Morelli, I S

    2008-02-01

    The effects of the inoculant strain Sphingomonas paucimobilis 20006FA (isolated from a phenanthrene-contaminated soil) on the dynamics and structure of microbial communities and phenanthrene elimination rate were studied in soil microcosms artificially contaminated with phenanthrene. The inoculant managed to be established from the first inoculation as it was evidenced by denaturing gradient gel electrophoresis analysis, increasing the number of cultivable heterotrophic and PAH-degrading cells and enhancing phenanthrene degradation. These effects were observed only during the inoculation period. Nevertheless, the soil biological activity (dehydrogenase activity and CO(2) production) showed a late increase. Whereas gradual and successive changes in bacterial community structures were caused by phenanthrene contamination, the inoculation provoked immediate, significant, and stable changes on soil bacterial community. In spite of the long-term establishment of the inoculated strain, at the end of the experiment, the bioaugmentation did not produce significant changes in the residual soil phenanthrene concentration and did not improve the residual effects on the microbial soil community.

  3. Beneficial Effect of Acetic Acid on the Xylose Utilization and Bacterial Cellulose Production by Gluconacetobacter xylinus.

    PubMed

    Yang, Xiao-Yan; Huang, Chao; Guo, Hai-Jun; Xiong, Lian; Luo, Jun; Wang, Bo; Chen, Xue-Fang; Lin, Xiao-Qing; Chen, Xin-De

    2014-09-01

    In this work, acetic acid was found as one promising substrate to improve xylose utilization by Gluconacetobacter xylinus CH001. Also, with the help of adding acetic acid into medium, the bacterial cellulose (BC) production by G. xylinus was increased significantly. In the medium containing 3 g l(-1) acetic acid, the optimal xylose concentration for BC production was 20 g l(-1). In the medium containing 20 g l(-1) xylose, the xylose utilization and BC production by G. xylinus were stimulated by acetic acid within certain concentration. The highest BC yield (1.35 ± 0.06 g l(-1)) was obtained in the medium containing 20 g l(-1) xylose and 3 g l(-1) acetic acid after 14 days. This value was 6.17-fold higher than the yield (0.21 ± 0.01 g l(-1)) in the medium only containing 20 g l(-1) xylose. The results analyzed by FE-SEM, FTIR, and XRD showed that acetic acid affected little on the microscopic morphology and physicochemical characteristics of BC. Base on the phenomenon observed, lignocellulosic acid hydrolysates (xylose and acetic acid are main carbon sources present in it) could be considered as one potential substrate for BC production.

  4. Production of putrescine-capped stable silver nanoparticle: its characterization and antibacterial activity against multidrug-resistant bacterial strains

    NASA Astrophysics Data System (ADS)

    Saha, Saswati; Gupta, Bhaskar; Gupta, Kamala; Chaudhuri, Mahua Ghosh

    2016-04-01

    Integration of biology with nanotechnology is now becoming attention-grabbing area of research. The antimicrobial potency of silver has been eminent from antiquity. Due to the recent desire for the enhancement of antibacterial efficacy of silver, various synthesis methods of silver in their nano dimensions are being practiced using a range of capping material. The present work highlights a facile biomimetic approach for production of silver nanoparticle being capped and stabilized by putrescine, possessing a diameter of 10-25 ± 1.5 nm. The synthesized nanoparticles have been analyzed spectrally and analytically. Morphological studies are carried out by high-resolution transmission electron microscopy and crystallinity by selected area electron diffraction patterns. Moreover, the elemental composition of the capped nanoparticles was confirmed by energy-dispersive X-ray spectroscopy analysis. A comparative study (zone of inhibition and minimum inhibitory concentration) regarding the interactions and antibacterial potentiality of the capped silver nanoparticles with respect to the bare ones reveal the efficiency of the capped one over the bare one. The bacterial kinetic study was executed to monitor the interference of nanoparticles with bacterial growth rate. The results also highlight the efficacy of putrescine-capped silver nanoparticles as effective growth inhibitors against multi-drug resistant human pathogenic bacterial strains, which may, thus, potentially be applicable as an effective antibacterial control system to fight diseases.

  5. Influence of yeast strain and aging time on free amino acid changes in sparkling ciders.

    PubMed

    Suárez Valles, Belén; Palacios García, Noemí; Rodríguez Madrera, Roberto; Picinelli Lobo, Anna

    2005-08-10

    An analytical method for the determination of free amino acids in ciders is reported. It is based on high-performance liquid chromatography with an automatic precolumn derivatization with o-phthaldehyde and 3-mercaptopropionic acid and diode array detection. The method was applied to monitor the amino acids during second fermentation of sparkling ciders. This paper reports the influence of yeast strains and aging time on the amino acid composition of sparkling ciders. The application of principal component analysis enables the ciders to be differentiated on the basis of the two factors considered (yeast strain and aging time). The first principal component, which accounts for 58% of the total variance, achieved the separation according to aging time with serine, glycine, alanine, valine, ornithine, leucine, and lysine as the most important variables. The second principal component, accounting for 28% of the explained variance, is closely related to aspartic acid and asparagine and separates the samples according to the yeast strain. PMID:16076126

  6. Omega-3 fatty acid production from enzyme saccharified hemp hydrolysate using a novel marine thraustochytrid strain.

    PubMed

    Gupta, Adarsha; Abraham, Reinu E; Barrow, Colin J; Puri, Munish

    2015-05-01

    In this work, a newly isolated marine thraustochytrid strain, Schizochytrium sp. DT3, was used for omega-3 fatty acid production by growing on lignocellulose biomass obtained from local hemp hurd (Cannabis sativa) biomass. Prior to enzymatic hydrolysis, hemp was pretreated with sodium hydroxide to open the biomass structure for the production of sugar hydrolysate. The thraustochytrid strain was able to grow on the sugar hydrolysate and accumulated polyunsaturated fatty acids (PUFAs). At the lowest carbon concentration of 2%, the PUFAs productivity was 71% in glucose and 59% in the sugars hydrolysate, as a percentage of total fatty acids. Saturated fatty acids (SFAs) levels were highest at about 49% of TFA using 6% glucose as the carbon source. SFAs of 41% were produced using 2% of SH. This study demonstrates that SH produced from lignocellulose biomass is a potentially useful carbon source for the production of omega-3 fatty acids in thraustochytrids, as demonstrated using the new strain, Schizochytrium sp. DT3.

  7. Genome Sequence of Acidovorax citrulli Group 1 Strain pslb65 Causing Bacterial Fruit Blotch of Melons.

    PubMed

    Wang, Tielin; Sun, Baixin; Yang, Yuwen; Zhao, Tingchang

    2015-04-23

    Acidovorax citrulli is typed into two groups, mainly based on the host. We determined the draft genome of A. citrulli group 1 strain pslb65. The strain was isolated from melon collected from Xinjiang province, China. The A. citrulli pslb65 genome contains 4,903,443 bp and has a G+C content of 68.8 mol%.

  8. Genome Sequence of Acidovorax citrulli Group 1 Strain pslb65 Causing Bacterial Fruit Blotch of Melons

    PubMed Central

    Wang, Tielin; Sun, Baixin; Yang, Yuwen

    2015-01-01

    Acidovorax citrulli is typed into two groups, mainly based on the host. We determined the draft genome of A. citrulli group 1 strain pslb65. The strain was isolated from melon collected from Xinjiang province, China. The A. citrulli pslb65 genome contains 4,903,443 bp and has a G+C content of 68.8 mol%. PMID:25908136

  9. Biodegradation of phenol by bacterial strains from petroleum-refining wastewater purification plant.

    PubMed

    Pakuła, A; Bieszkiewicz, E; Boszczyk-Maleszak, H; Mycielski, R

    1999-01-01

    The ability of four strains of bacteria derived from a biological petroleum-refining wastewater purification plant to carry out the biodegradation of phenol was studied. Two of the strains belonging to the genus Pseudomonas were found to be characterised by high effectiveness of the removal of phenol which was used as sole carbon and energy source (the strains were designated P1 and P2). In turn the effect of inoculum size, initial concentration of substrate (500 and 1,000 mg phenol/L) and temperature (10, 20 and 30 degrees C) on the rate of phenol degradation by strains P1, P2 and mixture of both was investigated. It was found that strain P1 which was identified as Pseudomonas fluorescens degraded phenol better than strain P2--Pseudomonas cepacia. The rate of phenol biodegradation was significantly affected by size of inoculum and temperature of incubation. Phenol was removed the fastest with the highest inoculum used. The optimal temperature was about 20 degrees C. At 10 and 30 degrees C the process of biodegradation was visibly inhibited. The rate of phenol utilisation was also found to decrease with increased concentration of substrate.

  10. Comparative Genomics between Two Xenorhabdus bovienii Strains Highlights Differential Evolutionary Scenarios within an Entomopathogenic Bacterial Species

    PubMed Central

    Bisch, Gaëlle; Ogier, Jean-Claude; Médigue, Claudine; Rouy, Zoé; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2016-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Within Xenorhabdus bovienii species, the X. bovienii CS03 strain (Xb CS03) is nonvirulent when directly injected into lepidopteran insects, and displays a low virulence when associated with its Steinernema symbiont. The genome of Xb CS03 was sequenced and compared with the genome of a virulent strain, X. bovienii SS-2004 (Xb SS-2004). The genome size and content widely differed between the two strains. Indeed, Xb CS03 had a large genome containing several specific loci involved in the inhibition of competitors, including a few NRPS-PKS loci (nonribosomal peptide synthetases and polyketide synthases) producing antimicrobial molecules. Consistently, Xb CS03 had a greater antimicrobial activity than Xb SS-2004. The Xb CS03 strain contained more pseudogenes than Xb SS-2004. Decay of genes involved in the host invasion and exploitation (toxins, invasins, or extracellular enzymes) was particularly important in Xb CS03. This may provide an explanation for the nonvirulence of the strain when injected into an insect host. We suggest that Xb CS03 and Xb SS-2004 followed divergent evolutionary scenarios to cope with their peculiar life cycle. The fitness strategy of Xb CS03 would involve competitor inhibition, whereas Xb SS-2004 would quickly and efficiently kill the insect host. Hence, Xenorhabdus strains would have widely divergent host exploitation strategies, which impact their genome structure. PMID:26769959

  11. Fatty acid composition of lipopolysaccharides of the strains of different species of Yersinia.

    PubMed

    Frolov, A F; Ruban, N M; Vasyurenko, Z P

    1989-01-01

    The fatty acid composition of lipopolysaccharides of the strains of Y. enterocolitica, Y. intermedia, Y. frederiksenii and Y. ruckeri studied during cultivation on meat-peptone agar is characterized by the predominance of 3-hydroxytetradecanoic and dodecanoic acids. Closely related to the mentioned bacteria is the strain of Y. kristensenii which is distinguished only by its higher level of hexadecanoic acid. The strains of Y. pseudotuberculosis and the vaccine strain of Y. pestis have a uniform fatty acid composition of lipopolysaccharides with predominance of 3-hydroxytetradecanoic acid. Their relatively low level of dodecanoic acid conditions the characteristic fatty acid spectrum of lipopolysaccharides which differs from that of the above mentioned group of Yersinia. The peculiarities of the fatty acid composition of lipopolysaccharides of both groups of Yersinia are preserved during growth on meat-peptone broth, but the increase in the level of hexadecanoic acid balances the differences between Y. kristensenii, the other Y. enterocolitica-like bacteria and Y. ruckeri. The obtained results confirm close relationship of Y. pseudotuberculosis and Y. pestis, and also of Y. enterocolitica and Y. enterocolitica-like bacteria, showing propinquity of Y. ruckeri to the latter.

  12. The two-component system Ihk/Irr contributes to the virulence of Streptococcus suis serotype 2 strain 05ZYH33 through alteration of the bacterial cell metabolism.

    PubMed

    Han, Huiming; Liu, Cuihua; Wang, Quanhui; Xuan, Chunling; Zheng, Beiwen; Tang, Jiaqi; Yan, Jinghua; Zhang, Jingren; Li, Ming; Cheng, Hao; Lu, Guangwen; Gao, George F

    2012-07-01

    Streptococcus suis serotype 2 (S. suis 2) is an important zoonotic pathogen. It causes heavy economic losses in the pig-farming industry and can be associated with severe infections in humans, e.g. streptococcal toxic shock syndrome. Understanding its pathogenesis is critical for prevention and control of diseases caused by S. suis 2. In this study, we show that deletion of a two-component system (TCS), 05SSU1660/1661 (orthologues of the Ihk/Irr TCS of Streptococcus pyogenes), in S. suis 2 strain 05ZYH33 results in notable attenuation of virulence, as exemplified by reduced adherence to mucosal epithelium cells, increased elimination by macrophages, reduced ability to survive in an acidic or oxidative-stressed environment, and lowered pathogenicity in mice. Further analysis of differential proteomics profiles by two-dimensional electrophoresis revealed that while many previously well-known virulence factors, such as suilysin, autolysin and muraminidase-released protein, were not expressed differentially, cell metabolism was downregulated in the Ihk/Irr deletion mutant. In addition, the oxidative-stress response gene for manganese-dependent superoxide dismutase (MnSOD) was also repressed significantly in the mutant. Collectively, our data suggest that the Ihk/Irr TCS contributes to the virulence of S. suis 2 strain 05ZYH33, mainly through alteration of the bacterial cell metabolism.

  13. Microbial production of amino acids and derived chemicals: synthetic biology approaches to strain development.

    PubMed

    Wendisch, Volker F

    2014-12-01

    Amino acids are produced at the multi-million-ton-scale with fermentative production of l-glutamate and l-lysine alone being estimated to amount to more than five million tons in the year 2013. Metabolic engineering constantly improves productivities of amino acid producing strains, mainly Corynebacterium glutamicum and Escherichia coli strains. Classical mutagenesis and screening have been accelerated by combination with intracellular metabolite sensing. Synthetic biology approaches have allowed access to new carbon sources to realize a flexible feedstock concept. Moreover, new pathways for amino acid production as well as fermentative production of non-native compounds derived from amino acids or their metabolic precursors were developed. These include dipeptides, α,ω-diamines, α,ω-diacids, keto acids, acetylated amino acids and ω-amino acids. PMID:24922334

  14. Growth and survival of various strains of enterohemorrhagic Escherichia coli in hydrochloric and acetic acid.

    PubMed

    McKellar, R C; Knight, K P

    1999-12-01

    Nineteen strains of enterohemorrhagic Escherichia coli isolated from humans and foods were examined for their ability to grow and survive at low pH in organic (acetic) and mineral (HCl) acids. Strains were subcultured in tryptic soy broth adjusted to various pH values (3.75 to 4.75 for HCl and 4.75 to 5.75 for acetic acid) and incubated for 72 h at 37 degrees C to determine the minimum growth pH value. Minimum pH values for growth of 4.25 and 5.5 were found for HCl and acetic acid, respectively. Strains were also exposed to pH 2.0 (HCl) and pH 4.0 (acetic acid) for up to 24 h at 37 degrees C to assess their ability to survive. HCl was a more effective inhibitor after 6 h of exposure, whereas acetic acid was more effective after 24 h. Outbreak strains survived acid treatment significantly (P < or = 0.05) better than strains isolated from fermented or high-pH foods or animal or human isolates. Significant (P < or = 0.05) differences among serotypes and between O157:H7 and other serotypes were apparent after 3 or 6 h of exposure to acids. PMID:10606153

  15. Differential infection of polarized epithelial cell lines by sialic acid-dependent and sialic acid-independent rotavirus strains.

    PubMed

    Ciarlet, M; Crawford, S E; Estes, M K

    2001-12-01

    epithelium, but SA-dependent and SA-independent rotavirus strains infect polarized epithelial cells by different mechanisms, which may be relevant for pathogenesis and selection of vaccine strains. Finally, rotavirus-induced alterations of the epithelial barrier and paracellular permeability suggest that common mechanisms of pathogenesis may exist between viral and bacterial pathogens of the intestinal tract. PMID:11689665

  16. Acid production by oral strains of Candida albicans and lactobacilli.

    PubMed

    Klinke, T; Kneist, S; de Soet, J J; Kuhlisch, E; Mauersberger, S; Forster, A; Klimm, W

    2009-01-01

    Both Candida albicans and lactobacilli are common colonizers of carious lesions in children and adolescents. The purpose of this study is to compare the velocity of acid production between C. albicans and several Lactobacillus species at different pH levels and concentrations of glucose. Washed, pure resting-cell suspensions were obtained by culturing a total of 28 oral isolates comprising the species C. albicans, Lactobacillus rhamnosus, Lactobacillus paracasei paracasei, Lactobacillus paracasei tolerans and Lactobacillus delbrueckii lactis. Acid production from glucose was determined at a constant pH of 7.0, 5.5, 5.0 and 4.0 by repeated titrations with NaOH in an automated pH-stat system. Acid formation rates of yeast and lactobacilli proved to be similar at both neutral and low pH, while in a moderately acidic environment C. albicans produced less acid than the lactobacilli. Ion chromatographic analysis of the cell-free medium after titration revealed pyruvate to be the predominant organic acid anion secreted by C. albicans. The proportion of organic acids to overall acid production by the yeast was below 10% at neutral conditions, in contrast to 42-66% at pH 4.0. Compared to lactobacilli, yeast required a concentration of glucose that was about 50 times higher to allow acid production at half the maximum speed. Considering the clinical data in the literature about the frequency and proportions of microorganisms present in early childhood caries lesions, the contribution of oral lactobacilli as well as C. albicans to overall microbial acid formation appears to be important. PMID:19246906

  17. Acid production by oral strains of Candida albicans and lactobacilli.

    PubMed

    Klinke, T; Kneist, S; de Soet, J J; Kuhlisch, E; Mauersberger, S; Forster, A; Klimm, W

    2009-01-01

    Both Candida albicans and lactobacilli are common colonizers of carious lesions in children and adolescents. The purpose of this study is to compare the velocity of acid production between C. albicans and several Lactobacillus species at different pH levels and concentrations of glucose. Washed, pure resting-cell suspensions were obtained by culturing a total of 28 oral isolates comprising the species C. albicans, Lactobacillus rhamnosus, Lactobacillus paracasei paracasei, Lactobacillus paracasei tolerans and Lactobacillus delbrueckii lactis. Acid production from glucose was determined at a constant pH of 7.0, 5.5, 5.0 and 4.0 by repeated titrations with NaOH in an automated pH-stat system. Acid formation rates of yeast and lactobacilli proved to be similar at both neutral and low pH, while in a moderately acidic environment C. albicans produced less acid than the lactobacilli. Ion chromatographic analysis of the cell-free medium after titration revealed pyruvate to be the predominant organic acid anion secreted by C. albicans. The proportion of organic acids to overall acid production by the yeast was below 10% at neutral conditions, in contrast to 42-66% at pH 4.0. Compared to lactobacilli, yeast required a concentration of glucose that was about 50 times higher to allow acid production at half the maximum speed. Considering the clinical data in the literature about the frequency and proportions of microorganisms present in early childhood caries lesions, the contribution of oral lactobacilli as well as C. albicans to overall microbial acid formation appears to be important.

  18. Impact on bacterial community in midguts of the Asian corn borer larvae by transgenic Trichoderma strain overexpressing a heterologous chit42 gene with chitin-binding domain.

    PubMed

    Li, Yingying; Fu, Kehe; Gao, Shigang; Wu, Qiong; Fan, Lili; Li, Yaqian; Chen, Jie

    2013-01-01

    This paper is the first report of the impact on the bacterial community in the midgut of the Asian corn borer (Ostrinia furnacalis) by the chitinase from the transgenic Trichoderma strain. In this study, we detected a change of the bacterial community in the midgut of the fourth instar larvae by using a culture-independent method. Results suggested that Proteobacteria and Firmicutes were the most highly represented phyla, being present in all the midgut bacterial communities. The observed species richness was simple, ranging from four to five of all the 16S rRNA clone libraries. When using Trichoderma fermentation liquids as additives, the percentages of the dominant flora in the total bacterial community in larval midgut changed significantly. The community of the genus Ochrobactrum in the midgut decreased significantly when the larvae were fed with the fermentation liquids of the transgenic Trichoderma strain Mc4. However, the Enterococcus community increased and then occupied the vacated niche of the Ochrobactrum members. Furthermore, the Shannon-Wiener (H) and the Simpson (1-D) indexes of the larval midgut bacterial library treated by feeding fermentation liquids of the transgenic Trichoderma strain Mc4 was the lowest compared with the culture medium, fermentation liquids of the wild type strain T30, and the sterile artificial diet. The Enterococcus sp. strain was isolated and characterized from the healthy larvae midgut of the Asian corn borer. An infection study of the Asian corn borer larvae using Enterococcus sp. ACB-1 revealed that a correlation existed between the increased Enterococcus community in the larval midgut and larval mortality. These results demonstrated that the transgenic Trichoderma strain could affect the composition of the midgut bacterial community. The change of the midgut bacterial community might be viewed as one of the factors resulting in the increased mortality of the Asian corn borer larvae.

  19. Synthesis of a novel acrylated abietic acid-g-bacterial cellulose hydrogel by gamma irradiation.

    PubMed

    Abeer, Muhammad Mustafa; Amin, Mohd Cairul Iqbal Mohd; Lazim, Azwan Mat; Pandey, Manisha; Martin, Claire

    2014-09-22

    Acrylated abietic acid (acrylated AbA) and acrylated abietic acid-grafted bacterial cellulose pH sensitive hydrogel (acrylated AbA-g-BC) were prepared by a one-pot synthesis. The successful dimerization of acrylic acid (AA) and abietic acid (AbA) and grafting of the dimer onto bacterial cellulose (BC) was confirmed by 13C solid state NMR as well as FT-IR. X-ray diffraction analysis showed characteristic peaks for AbA and BC; further, there was no effect of increasing amorphous AA content on the overall crystallinity of the hydrogel. Differential scanning calorimetry revealed a glass transition temperature of 80°C. Gel fraction and swelling studies gave insight into the features of the hydrogel, suggesting that it was suitable for future applications such as drug delivery. Scanning electron microscopy observations showed an interesting interpenetrating network within the walls of hydrogel samples with the lowest levels of AA and gamma radiation doses. Cell viability test revealed that the synthesized hydrogel is safe for future use in biomedical applications.

  20. Different strains of Saccharomyces cerevisiae differ in their effects on ruminal bacterial numbers in vitro and in sheep.

    PubMed

    Newbold, C J; Wallace, R J; Chen, X B; McIntosh, F M

    1995-06-01

    A ruminal simulation device (Rusitec) was used to compare the effects of Saccharomyces cerevisiae strains NCYC 240, NCYC 694, NCYC 1026, NCYC 1088, and Yea-Sacc (a commercial product containing S. cerevisiae) on ruminal fermentation. S. cerevisiae NCYC 240, NCYC 1088, NCYC 1026, and NCYC 694 were grown on malt extract at 30 degrees C in aerated fed-batch culture and harvested along with spent growth medium by freeze-drying. Each vessel received daily 20 g of a basal diet consisting of hay, barley, molasses, fishmeal, and a minerals/vitamins mixture at 500, 299.5, 100, 91, and 9.5 g/kg of DM, respectively. Yeast preparations (500 mg/d) were added along with the feed. S. cerevisiae NCYC 240, NCYC 1026, and Yea-Sacc stimulated total and cellulolytic bacterial numbers, whereas S. cerevisiae NCYC 694 and NCYC 1088 had no effect on the numbers of bacteria. The effects of S. cerevisiae NCYC 240, NCYC 1026, and Yea-Sacc on ruminal fermentation were further investigated in vivo using ruminally cannulated sheep fed 1.5 kg/d of the diet used in Rusitec, supplemented with 2 g/d of yeast culture. All treatments tended to stimulate total and cellulolytic bacterial numbers. However, the stimulation was only statistically significant for S. cerevisiae NCYC 1026 with total bacterial numbers and S. cerevisiae NCYC 240 with cellulolytic bacteria (P < .05). Increased bacterial numbers were associated with an increase in the rate of straw degradation in the rumen and a nonsignificant (P > .05) increase in the excretion of purine derivatives in the urine, measured as an index of microbial nitrogen leaving the rumen.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7673076

  1. Different strains of Saccharomyces cerevisiae differ in their effects on ruminal bacterial numbers in vitro and in sheep.

    PubMed

    Newbold, C J; Wallace, R J; Chen, X B; McIntosh, F M

    1995-06-01

    A ruminal simulation device (Rusitec) was used to compare the effects of Saccharomyces cerevisiae strains NCYC 240, NCYC 694, NCYC 1026, NCYC 1088, and Yea-Sacc (a commercial product containing S. cerevisiae) on ruminal fermentation. S. cerevisiae NCYC 240, NCYC 1088, NCYC 1026, and NCYC 694 were grown on malt extract at 30 degrees C in aerated fed-batch culture and harvested along with spent growth medium by freeze-drying. Each vessel received daily 20 g of a basal diet consisting of hay, barley, molasses, fishmeal, and a minerals/vitamins mixture at 500, 299.5, 100, 91, and 9.5 g/kg of DM, respectively. Yeast preparations (500 mg/d) were added along with the feed. S. cerevisiae NCYC 240, NCYC 1026, and Yea-Sacc stimulated total and cellulolytic bacterial numbers, whereas S. cerevisiae NCYC 694 and NCYC 1088 had no effect on the numbers of bacteria. The effects of S. cerevisiae NCYC 240, NCYC 1026, and Yea-Sacc on ruminal fermentation were further investigated in vivo using ruminally cannulated sheep fed 1.5 kg/d of the diet used in Rusitec, supplemented with 2 g/d of yeast culture. All treatments tended to stimulate total and cellulolytic bacterial numbers. However, the stimulation was only statistically significant for S. cerevisiae NCYC 1026 with total bacterial numbers and S. cerevisiae NCYC 240 with cellulolytic bacteria (P < .05). Increased bacterial numbers were associated with an increase in the rate of straw degradation in the rumen and a nonsignificant (P > .05) increase in the excretion of purine derivatives in the urine, measured as an index of microbial nitrogen leaving the rumen.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Proof of Principle for a Real-Time Pathogen Isolation Media Diagnostic: The Use of Laser-Induced Breakdown Spectroscopy to Discriminate Bacterial Pathogens and Antimicrobial-Resistant Staphylococcus aureus Strains Grown on Blood Agar.

    PubMed

    Multari, Rosalie A; Cremers, David A; Bostian, Melissa L; Dupre, Joanne M; Gustafson, John E

    2013-01-01

    Laser-Induced Breakdown Spectroscopy (LIBS) is a rapid, in situ, diagnostic technique in which light emissions from a laser plasma formed on the sample are used for analysis allowing automated analysis results to be available in seconds to minutes. This speed of analysis coupled with little or no sample preparation makes LIBS an attractive detection tool. In this study, it is demonstrated that LIBS can be utilized to discriminate both the bacterial species and strains of bacterial colonies grown on blood agar. A discrimination algorithm was created based on multivariate regression analysis of spectral data. The algorithm was deployed on a simulated LIBS instrument system to demonstrate discrimination capability using 6 species. Genetically altered Staphylococcus aureus strains grown on BA, including isogenic sets that differed only by the acquisition of mutations that increase fusidic acid or vancomycin resistance, were also discriminated. The algorithm successfully identified all thirteen cultures used in this study in a time period of 2 minutes. This work provides proof of principle for a LIBS instrumentation system that could be developed for the rapid discrimination of bacterial species and strains demonstrating relatively minor genomic alterations using data collected directly from pathogen isolation media.

  3. Diversity and spatiotemporal dynamics of bacterial communities: physicochemical and other drivers along an acid mine drainage.

    PubMed

    Volant, Aurélie; Bruneel, Odile; Desoeuvre, Angélique; Héry, Marina; Casiot, Corinne; Bru, Noëlle; Delpoux, Sophie; Fahy, Anne; Javerliat, Fabien; Bouchez, Olivier; Duran, Robert; Bertin, Philippe N; Elbaz-Poulichet, Françoise; Lauga, Béatrice

    2014-10-01

    Deciphering the biotic and abiotic factors that control microbial community structure over time and along an environmental gradient is a pivotal question in microbial ecology. Carnoulès mine (France), which is characterized by acid waters and very high concentrations of arsenic, iron, and sulfate, provides an excellent opportunity to study these factors along the pollution gradient of Reigous Creek. To this end, biodiversity and spatiotemporal distribution of bacterial communities were characterized using T-RFLP fingerprinting and high-throughput sequencing. Patterns of spatial and temporal variations in bacterial community composition linked to changes in the physicochemical conditions suggested that species-sorting processes were at work in the acid mine drainage. Arsenic, temperature, and sulfate appeared to be the most important factors that drove the composition of bacterial communities along this continuum. Time series investigation along the pollution gradient also highlighted habitat specialization for some major members of the community (Acidithiobacillus and Thiomonas), dispersal for Acidithiobacillus, and evidence of extinction/re-thriving processes for Gallionella. Finally, pyrosequencing revealed a broader phylogenetic range of taxa than previous clone library-based diversity. Overall, our findings suggest that in addition to environmental filtering processes, additional forces (dispersal, birth/death events) could operate in AMD community.

  4. Bioremediation of Cd and carbendazim co-contaminated soil by Cd-hyperaccumulator Sedum alfredii associated with carbendazim-degrading bacterial strains.

    PubMed

    Xiao, Wendan; Wang, Huan; Li, Tingqiang; Zhu, Zhiqiang; Zhang, Jie; He, Zhenli; Yang, Xiaoe

    2013-01-01

    The objective of this study was to develop a bioremediation strategy for cadmium (Cd) and carbendazim co-contaminated soil using a hyperaccumulator plant (Sedum alfredii) combined with carbendazim-degrading bacterial strains (Bacillus subtilis, Paracoccus sp., Flavobacterium and Pseudomonas sp.). A pot experiment was conducted under greenhouse conditions for 180 days with S. alfredii and/or carbendazim-degrading strains grown in soil artificially polluted with two levels of contaminants (low level, 1 mg kg(-1) Cd and 21 mg kg(-1) carbendazim; high level, 6 mg kg(-1) Cd and 117 mg kg(-1) carbendazim). Cd removal efficiencies were 32.3-35.1 % and 7.8-8.2 % for the low and high contaminant level, respectively. Inoculation with carbendazim-degrading bacterial strains significantly (P < 0.05) increased Cd removal efficiencies at the low level. The carbendazim removal efficiencies increased by 32.1-42.5 % by the association of S. alfredii with carbendazim-degrading bacterial strains, as compared to control, regardless of contaminant level. Cultivation with S. alfredii and inoculation of carbendazim-degrading bacterial strains increased soil microbial biomass, dehydrogenase activities and microbial diversities by 46.2-121.3 %, 64.2-143.4 %, and 2.4-24.7 %, respectively. Polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis revealed that S. alfredii stimulated the activities of Flavobacteria and Bradyrhizobiaceae. The association of S. alfredii with carbendazim-degrading bacterial strains enhanced the degradation of carbendazim by changing microbial activity and community structure in the soil. The results demonstrated that association of S. alfredii with carbendazim-degrading bacterial strains is promising for remediation of Cd and carbendazim co-contaminated soil. PMID:22529002

  5. Overexpression of a phosphatidic acid phosphatase type 2 leads to an increase in triacylglycerol production in oleaginous Rhodococcus strains.

    PubMed

    Hernández, Martín A; Comba, Santiago; Arabolaza, Ana; Gramajo, Hugo; Alvarez, Héctor M

    2015-03-01

    Oleaginous Rhodococcus strains are able to accumulate large amounts of triacylglycerol (TAG). Phosphatidic acid phosphatase (PAP) enzyme catalyzes the dephosphorylation of phosphatidic acid (PA) to yield diacylglycerol (DAG), a key precursor for TAG biosynthesis. Studies to establish its role in lipid metabolism have been mainly focused in eukaryotes but not in bacteria. In this work, we identified and characterized a putative PAP type 2 (PAP2) encoded by the ro00075 gene in Rhodococcus jostii RHA1. Heterologous expression of ro00075 in Escherichia coli resulted in a fourfold increase in PAP activity and twofold in DAG content. The conditional deletion of ro00075 in RHA1 led to a decrease in the content of DAG and TAG, whereas its overexpression in both RHA1 and Rhodococcus opacus PD630 promoted an increase up to 10 to 15 % by cellular dry weight in TAG content. On the other hand, expression of ro00075 in the non-oleaginous strain Rhodococcus fascians F7 promoted an increase in total fatty acid content up to 7 % at the expense of free fatty acid (FFA), DAG, and TAG fractions. Moreover, co-expression of ro00075/atf2 genes resulted in a fourfold increase in total fatty acid content by a further increase of the FFA and TAG fractions. The results of this study suggest that ro00075 encodes for a PAP2 enzyme actively involved in TAG biosynthesis. Overexpression of this gene, as single one or with an atf gene, provides an alternative approach to increase the biosynthesis and accumulation of bacterial oils as a potential source of raw material for biofuel production.

  6. Electrically conductive bacterial nanowires produced by Shewanella oneidensis strain MR-1 and other microorganisms

    PubMed Central

    Gorby, Yuri A.; Yanina, Svetlana; McLean, Jeffrey S.; Rosso, Kevin M.; Moyles, Dianne; Dohnalkova, Alice; Beveridge, Terry J.; Chang, In Seop; Kim, Byung Hong; Kim, Kyung Shik; Culley, David E.; Reed, Samantha B.; Romine, Margaret F.; Saffarini, Daad A.; Hill, Eric A.; Shi, Liang; Elias, Dwayne A.; Kennedy, David W.; Pinchuk, Grigoriy; Watanabe, Kazuya; Ishii, Shun’ichi; Logan, Bruce; Nealson, Kenneth H.; Fredrickson, Jim K.

    2006-01-01

    Shewanella oneidensis MR-1 produced electrically conductive pilus-like appendages called bacterial nanowires in direct response to electron-acceptor limitation. Mutants deficient in genes for c-type decaheme cytochromes MtrC and OmcA, and those that lacked a functional Type II secretion pathway displayed nanowires that were poorly conductive. These mutants were also deficient in their ability to reduce hydrous ferric oxide and in their ability to generate current in a microbial fuel cell. Nanowires produced by the oxygenic phototrophic cyanobacterium Synechocystis PCC6803 and the thermophilic, fermentative bacterium Pelotomaculum thermopropionicum reveal that electrically conductive appendages are not exclusive to dissimilatory metal-reducing bacteria and may, in fact, represent a common bacterial strategy for efficient electron transfer and energy distribution. PMID:16849424

  7. Biodegradation of oil spill by petroleum refineries using consortia of novel bacterial strains.

    PubMed

    Singh, Bina; Bhattacharya, Amit; Channashettar, Veeranna A; Jeyaseelan, C Paul; Gupta, Sachin; Sarma, Priyangshu M; Mandal, Ajoy K; Lal, Banwari

    2012-08-01

    Feasibility study carried out at the site prior to the full scale study showed that the introduced bacterial consortium effectively adapted to the local environment of the soil at bioremediation site. The soil samples were collected from the contaminated fields after treatment with bacterial consortium at different time intervals and analyzed by gas chromatography after extraction with hexane and toluene. At time zero (just before initiation of bioremediation), the concentration of total petroleum hydrocarbons in the soil (25-cm horizon) of plot A, B, C and D was 30.90 %, 18.80 %, 25.90 % and 29.90 % respectively, after 360 days of treatment with microbial consortia was reduced to 0.97 %, 1.0 %, 1.0 %, and 1.1 % respectively. Whereas, only 5 % degradation was observed in the control plot after 365 days (microbial consortium not applied).

  8. Enhanced production of bacterial cellulose by using Gluconacetobacter hansenii NCIM 2529 strain under shaking conditions.

    PubMed

    Mohite, Bhavna V; Salunke, Bipinchandra K; Patil, Satish V

    2013-03-01

    Bacterial cellulose (BC), a biopolymer, due to its unique properties is valuable for production of vital products in food, textile, medicine, and agriculture. In the present study, the optimal fermentation conditions for enhanced BC production by Gluconacetobacter hansenii NCIM 2529 were investigated under shaking conditions. The investigation on media components and culture parameters revealed that 2 % (w/v) sucrose as carbon source, 0.5 % (w/v) potassium nitrate as nitrogen source, 0.4 % (w/v) disodium phosphate as phosphate source, 0.04 % (w/v) magnesium sulfate, and 0.8 % (w/v) calcium chloride as trace elements, pH5.0, temperature 25 °C, and agitation speed 170 rpm with 6 days of fermentation period are optimal for maximum BC production. Production of BC using optimized media components and culture parameters was 1.66 times higher (5.0 g/l) than initial non optimized media (3.0 g/l). Fourier transform infrared spectroscopy spectrum and comparison with the available literature suggests that the produced component by G. hansenii in the present study is pure bacterial cellulose. The specific action of cellulase out of the investigated hydrolytic enzymes (cellulase, amylase, and protease) further confirmed purity of the produced BC. These findings give insight into conditions necessary for enhanced production of bacterial cellulose, which can be used for a variety of applications.

  9. Metabolism of cyclohexaneacetic acid and cyclohexanebutyric acid by Arthrobacter sp. strain CA1.

    PubMed Central

    Ougham, H J; Trudgill, P W

    1982-01-01

    A strain of Arthrobacter was isolated by enrichment culture with cyclohexaneacetate as the sole source of carbon and grew with a doubling time of 4.2 h. In addition to growing with cyclohexaneacetate, the organism also grew with cyclohexanebutyrate at concentrations not above 0.05%, and with a variety of alicyclic ketones and alcohols. Oxidation of cyclohexaneacetate proceeded through formation of the coenzyme A (CoA) ester followed by initiation of a beta-oxidation cycle. beta-Oxidation was blocked before the second dehydrogenation step due to the formation of a tertiary alcohol, and the side chain was eliminated as acetyl-CoA by the action of (1-hydroxycyclohexan-1-yl)acetyl-CoA lyase. The cyclohexanone thus formed was degraded by a well-described route that involves ring-oxygen insertion by a biological Baeyer-Villiger oxygenase. All enzymes of the proposed metabolic sequence were demonstrated in cell-free extracts. Arthrobacter sp. strain CA1 synthesized constitutive beta-oxidative enzymes, but further induction of enzymes active toward cyclohexaneacetate and its metabolites could occur during growth with the alicyclic acid. Other enzymes of the sequence, (1-hydroxycyclohexan-1-yl)acetyl-CoA lyase and enzymes of cyclohexanone oxidation, were present at negligible levels in succinate-grown cells but induced by growth with cyclohexaneacetate. The oxidation of cyclohexanebutyrate was integrated into the pathway for cyclohexaneacetate oxidation by a single beta-oxidation cycle. Oxidation of the compound could be divided into two phases. Initial oxidation to (1-hydroxycyclohexan-1-yl)acetate could be catalyzed by constitutive enzymes, whereas the further degradation of (1-hydroxycyclohexan-1-yl)acetate was dependent on induced enzyme synthesis which could be inhibited by chloramphenicol with the consequent accumulation of cyclohexaneacetate and (1-hydroxycyclohexan-1-yl)acetate. PMID:7076617

  10. [Construction and evaluation of an engineered bacterial strain for producing lipopeptide under anoxic conditions].

    PubMed

    Liang, Xiao-long; Zhao, Feng; Shi, Rong-jiu; Ban, Yun-he; Zhou, Ji-dong; Han, Si-qin; Zhang, Ying

    2015-08-01

    Biosurfactant-facilitated oil recovery is one of the most important aspects of microbial enhanced oil recovery (MEOR). However, the biosurfactant production by biosurfactant-producing microorganisms, most of which are aerobes, is severely suppressed due to the in-situ anoxic conditions within oil reservoirs. In this research, we successfully engineered a strain JD-3, which could grow rapidly and produce lipopeptide under anoxic conditions, by protoplast confusion using a Bacillus amyloliquefaciens strain BQ-2 which produces biosurfactant aerobically, and a facultative anaerobic Pseudomonas stutzeri strain DQ-1 as parent strains. The alignment of 16S rDNA sequence (99% similarity) and comparisons of cell colony morphology showed that fusant JD-3 was closer to the parental strain B. amyloliquefaciens BQ-2. The surface tension of culture broth of fusant JD-3, after 36-hour cultivation under anaerobic conditions, decreased from initially 63.0 to 32.5 mN · m(-1). The results of thin layer chromatography and infrared spectrum analysis demonstrated that the biosurfactant produced by JD-3 was lipopeptide. The surface-active lipopeptide had a low critical micelle concentration (CMC) of 90 mg · L(-1) and presented a good ability to emulsify various hydrocarbons such as crude oil, liquid paraffin, and kerosene. Strain JD-3 could utilize peptone as nitrogen source and sucrose, glucose, glycerin or other common organics as carbon sources for anaerobic lipopeptide synthesis. The subculture of fusant JD-3 showed a stable lipopeptide-producing ability even after ten serial passages. All these results indicated that fusant JD-3 holds a great potential to microbially enhance oil recovery under anoxic conditions. PMID:26685621

  11. Wall teichoic acid structure governs horizontal gene transfer between major bacterial pathogens.

    PubMed

    Winstel, Volker; Liang, Chunguang; Sanchez-Carballo, Patricia; Steglich, Matthias; Munar, Marta; Bröker, Barbara M; Penadés, Jose R; Nübel, Ulrich; Holst, Otto; Dandekar, Thomas; Peschel, Andreas; Xia, Guoqing

    2013-01-01

    Mobile genetic elements (MGEs) encoding virulence and resistance genes are widespread in bacterial pathogens, but it has remained unclear how they occasionally jump to new host species. Staphylococcus aureus clones exchange MGEs such as S. aureus pathogenicity islands (SaPIs) with high frequency via helper phages. Here we report that the S. aureus ST395 lineage is refractory to horizontal gene transfer (HGT) with typical S. aureus but exchanges SaPIs with other species and genera including Staphylococcus epidermidis and Listeria monocytogenes. ST395 produces an unusual wall teichoic acid (WTA) resembling that of its HGT partner species. Notably, distantly related bacterial species and genera undergo efficient HGT with typical S. aureus upon ectopic expression of S. aureus WTA. Combined with genomic analyses, these results indicate that a 'glycocode' of WTA structures and WTA-binding helper phages permits HGT even across long phylogenetic distances thereby shaping the evolution of Gram-positive pathogens.

  12. Ruthenium recovery from acetic acid waste water through sorption with bacterial biosorbent fibers.

    PubMed

    Kwak, In Seob; Won, Sung Wook; Chung, Yong Sik; Yun, Yeoung-Sang

    2013-01-01

    A fibrous bacterial biosorbent was developed to bind precious metal-organic complexes in batch and column processes. Polyethylenimine (PEI)-modified bacterial biosorbent fiber (PBBF) was prepared by spinning Corynebacterium glutamicum biomass-chitosan blends, coating them with PEI and cross-linking with glutaraldehyde. When an acetic acid waste solution containing 1822.9mg/L Ru was used as a model waste solution, Ru uptake by the PBBF was 16.5 times higher than that of the commercial ion exchange resin, Lewatit MonoPlus M600. The maximum amounts of Ru uptake were 110.5, 16.0 and 6.7mg/g for PBBF, raw biomass, and Lewatit MonoPlus M600, respectively. In a flow-through packed bed, PBBF exhibited the breakthrough time of 42.32h. Therefore, PBBF can be considered as an alternative sorbent for recovery of anionic metal-organic complexes from waste solutions.

  13. Bacillus rubiinfantis sp. nov. strain mt2T, a new bacterial species isolated from human gut

    PubMed Central

    Tidjiani Alou, M.; Rathored, J.; Khelaifia, S.; Michelle, C.; Brah, S.; Diallo, B.A.; Raoult, D.; Lagier, J.-C.

    2015-01-01

    Bacillus rubiinfantis sp. nov. strain mt2T is the type strain of B. rubiinfantis sp. nov., isolated from the fecal flora of a child with kwashiorkor in Niger. It is Gram-positive facultative anaerobic rod belonging to the Bacillaceae family. We describe the features of this organism alongside the complete genome sequence and annotation. The 4 311 083 bp long genome (one chromosome but no plasmid) contains 4028 protein-coding gene and 121 RNA genes including nine rRNA genes. PMID:27076912

  14. Butyric acid fermentation from pretreated and hydrolysed wheat straw by an adapted Clostridium tyrobutyricum strain

    PubMed Central

    Baroi, G N; Baumann, I; Westermann, P; Gavala, H N

    2015-01-01

    Butyric acid is a valuable building-block for the production of chemicals and materials and nowadays it is produced exclusively from petroleum. The aim of this study was to develop a suitable and robust strain of Clostridium tyrobutyricum that produces butyric acid at a high yield and selectivity from lignocellulosic biomasses. Pretreated (by wet explosion) and enzymatically hydrolysed wheat straw (PHWS), rich in C6 and C5 sugars (71.6 and 55.4 g l−1 of glucose and xylose respectively), was used as substrate. After one year of serial selections, an adapted strain of C. tyrobutyricum was developed. The adapted strain was able to grow in 80% (v v−1) PHWS without addition of yeast extract compared with an initial tolerance to less than 10% PHWS and was able to ferment both glucose and xylose. It is noticeable that the adapted C. tyrobutyricum strain was characterized by a high yield and selectivity to butyric acid. Specifically, the butyric acid yield at 60–80% PHWS lie between 0.37 and 0.46 g g−1 of sugar, while the selectivity for butyric acid was as high as 0.9–1.0 g g−1 of acid. Moreover, the strain exhibited a robust response in regards to growth and product profile at pH 6 and 7. PMID:26230610

  15. The Genomic Sequence of the Oral Pathobiont Strain NI1060 Reveals Unique Strategies for Bacterial Competition and Pathogenicity

    PubMed Central

    Jiao, Yizu; Hasegawa, Mizuho; Moon, Henry; Núñez, Gabriel; Inohara, Naohiro; Raes, Jeroen

    2016-01-01

    Strain NI1060 is an oral bacterium responsible for periodontitis in a murine ligature-induced disease model. To better understand its pathogenicity, we have determined the complete sequence of its 2,553,982 bp genome. Although closely related to Pasteurella pneumotropica, a pneumonia-associated rodent commensal based on its 16S rRNA, the NI1060 genomic content suggests that they are different species thriving on different energy sources via alternative metabolic pathways. Genomic and phylogenetic analyses showed that strain NI1060 is distinct from the genera currently described in the family Pasteurellaceae, and is likely to represent a novel species. In addition, we found putative virulence genes involved in lipooligosaccharide synthesis, adhesins and bacteriotoxic proteins. These genes are potentially important for host adaption and for the induction of dysbiosis through bacterial competition and pathogenicity. Importantly, strain NI1060 strongly stimulates Nod1, an innate immune receptor, but is defective in two peptidoglycan recycling genes due to a frameshift mutation. The in-depth analysis of its genome thus provides critical insights for the development of NI1060 as a prime model system for infectious disease. PMID:27409077

  16. Control Efficacy of an Endophytic Bacillus amyloliquefaciens Strain BZ6-1 against Peanut Bacterial Wilt, Ralstonia solanacearum

    PubMed Central

    Liang, Guobin

    2014-01-01

    We aimed to isolate and identify endophytic bacteria that might have efficacy against peanut bacterial wilt (BW) caused by Ralstonia solanacearum. Thirty-seven endophytic strains were isolated from healthy peanut plants in R. solanacearum-infested fields and eight showed antagonistic effects against R. solanacearum. Strain BZ6-1 with the highest antimicrobial activity was identified as Bacillus amyloliquefaciens based on morphology, biochemistry, and 16S rRNA analysis. Culture conditions of BZ6-1 were optimized using orthogonal test method and inhibitory zone diameter in dual culture plate assay reached 34.2 mm. Furthermore, main antimicrobial substances of surfactin and fengycin A homologues produced by BZ6-1 were analyzed by high performance liquid chromatography electrospray ionization tandem mass spectrometry. Finally, pot experiments were adopted to test the control efficiency of BZ6-1 against peanut BW. Disease incidence decreased significantly from 84.5% in the control to 12.1% with addition of 15 mL (108 cfu mL−1) culture broth for each seedling, suggesting the feasibility of strain BZ6-1 in the biological control of peanut plants BW. PMID:24527448

  17. The Genomic Sequence of the Oral Pathobiont Strain NI1060 Reveals Unique Strategies for Bacterial Competition and Pathogenicity.

    PubMed

    Darzi, Youssef; Jiao, Yizu; Hasegawa, Mizuho; Moon, Henry; Núñez, Gabriel; Inohara, Naohiro; Raes, Jeroen

    2016-01-01

    Strain NI1060 is an oral bacterium responsible for periodontitis in a murine ligature-induced disease model. To better understand its pathogenicity, we have determined the complete sequence of its 2,553,982 bp genome. Although closely related to Pasteurella pneumotropica, a pneumonia-associated rodent commensal based on its 16S rRNA, the NI1060 genomic content suggests that they are different species thriving on different energy sources via alternative metabolic pathways. Genomic and phylogenetic analyses showed that strain NI1060 is distinct from the genera currently described in the family Pasteurellaceae, and is likely to represent a novel species. In addition, we found putative virulence genes involved in lipooligosaccharide synthesis, adhesins and bacteriotoxic proteins. These genes are potentially important for host adaption and for the induction of dysbiosis through bacterial competition and pathogenicity. Importantly, strain NI1060 strongly stimulates Nod1, an innate immune receptor, but is defective in two peptidoglycan recycling genes due to a frameshift mutation. The in-depth analysis of its genome thus provides critical insights for the development of NI1060 as a prime model system for infectious disease. PMID:27409077

  18. Quantitative analysis of the lactic acid and acetaldehyde produced by Streptococcus thermophilus and Lactobacillus bulgaricus strains isolated from traditional Turkish yogurts using HPLC.

    PubMed

    Gezginc, Y; Topcal, F; Comertpay, S; Akyol, I

    2015-03-01

    The present study was conducted to evaluate the lactic acid- and acetaldehyde-producing abilities of lactic acid bacterial species isolated from traditionally manufactured Turkish yogurts using HPLC. The lactic acid bacterial species purified from the yogurts were the 2 most widely used species in industrial yogurt production: Streptococcus thermophilus and Lactobacillus bulgaricus. These bacteria have the ability to ferment hexose sugars homofermentatively to generate lactic acid and some carbonyl compounds, such as acetaldehyde through pyruvate metabolism. The levels of the compounds produced during fermentation influence the texture and the flavor of the yogurt and are themselves influenced by the chemical composition of the milk, processing conditions, and the metabolic activity of the starter culture. In the study, morphological, biochemical, and molecular characteristics were employed to identify the bacteria obtained from homemade yogurts produced in different regions of Turkey. A collection of 91 Strep. thermophilus and 35 L. bulgaricus strains were investigated for their lactic acid- and acetaldehyde-formation capabilities in various media such as cow milk, LM17 agar, and aerobic-anaerobic SM17 agar or de Man, Rogosa, and Sharpe agar. The amounts of the metabolites generated by each strain in all conditions were quantified by HPLC. The levels were found to vary depending on the species, the strain, and the growth conditions used. Whereas lactic acid production ranged between 0 and 77.9 mg/kg for Strep. thermophilus strains, it ranged from 0 to 103.5 mg/kg for L. bulgaricus. Correspondingly, the ability to generate acetaldehyde ranged from 0 to 105.9 mg/kg in Strep. thermophilus and from 0 to 126.9 mg/kg in L. bulgaricus. Our study constitutes the first attempt to determine characteristics of the wild strains isolated from traditional Turkish yogurts, and the approach presented here, which reveals the differences in metabolite production abilities of the

  19. Accuracy, reproducibility, and interpretation of fatty acid methyl ester profiles of model bacterial communities

    USGS Publications Warehouse

    Kidd, Haack S.; Garchow, H.; Odelson, D.A.; Forney, L.J.; Klug, M.J.

    1994-01-01

    We determined the accuracy and reproducibility of whole-community fatty acid methyl ester (FAME) analysis with two model bacterial communities differing in composition by using the Microbial ID, Inc. (MIDI), system. The biomass, taxonomic structure, and expected MIDI-FAME profiles under a variety of environmental conditions were known for these model communities a priori. Not all members of each community could be detected in the composite profile because of lack of fatty acid 'signatures' in some isolates or because of variations (approximately fivefold) in fatty acid yield across taxa. MIDI- FAME profiles of replicate subsamples of a given community were similar in terms of fatty acid yield per unit of community dry weight and relative proportions of specific fatty acids. Principal-components analysis (PCA) of MIDI-FAME profiles resulted in a clear separation of the two different communities and a clustering of replicates of each community from two separate experiments on the first PCA axis. The first PCA axis accounted for 57.1% of the variance in the data and was correlated with fatty acids that varied significantly between communities and reflected the underlying community taxonomic structure. On the basis of our data, community fatty acid profiles can be used to assess the relative similarities and differences of microbial communities that differ in taxonomic composition. However, detailed interpretation of community fatty acid profiles in terms of biomass or community taxonomic composition must be viewed with caution until our knowledge of the quantitative and qualitative distribution of fatty acids over a wide variety of taxa and the effects of growth conditions on fatty acid profiles is more extensive.

  20. A novel immunity system for bacterial nucleic acid degrading toxins and its recruitment in various eukaryotic and DNA viral systems

    PubMed Central

    Zhang, Dapeng; Iyer, Lakshminarayan M.; Aravind, L.

    2011-01-01

    The use of nucleases as toxins for defense, offense or addiction of selfish elements is widely encountered across all life forms. Using sensitive sequence profile analysis methods, we characterize a novel superfamily (the SUKH superfamily) that unites a diverse group of proteins including Smi1/Knr4, PGs2, FBXO3, SKIP16, Syd, herpesviral US22, IRS1 and TRS1, and their bacterial homologs. Using contextual analysis we present evidence that the bacterial members of this superfamily are potential immunity proteins for a variety of toxin systems that also include the recently characterized contact-dependent inhibition (CDI) systems of proteobacteria. By analyzing the toxin proteins encoded in the neighborhood of the SUKH superfamily we predict that they possess domains belonging to diverse nuclease and nucleic acid deaminase families. These include at least eight distinct types of DNases belonging to HNH/EndoVII- and restriction endonuclease-fold, and RNases of the EndoU-like and colicin E3-like cytotoxic RNases-folds. The N-terminal domains of these toxins indicate that they are extruded by several distinct secretory mechanisms such as the two-partner system (shared with the CDI systems) in proteobacteria, ESAT-6/WXG-like ATP-dependent secretory systems in Gram-positive bacteria and the conventional Sec-dependent system in several bacterial lineages. The hedgehog-intein domain might also release a subset of toxic nuclease domains through auto-proteolytic action. Unlike classical colicin-like nuclease toxins, the overwhelming majority of toxin systems with the SUKH superfamily is chromosomally encoded and appears to have diversified through a recombination process combining different C-terminal nuclease domains to N-terminal secretion-related domains. Across the bacterial superkingdom these systems might participate in discriminating `self’ or kin from `non-self’ or non-kin strains. Using structural analysis we demonstrate that the SUKH domain possesses a versatile

  1. Effect of acidic electrolyzed water-induced bacterial inhibition and injury in live clam (Venerupis philippinarum) and mussel (Mytilus edulis).

    PubMed

    Al-Qadiri, Hamzah M; Al-Holy, Murad A; Shiroodi, Setareh Ghorban; Ovissipour, Mahmoudreza; Govindan, Byju N; Al-Alami, Nivin; Sablani, Shyam S; Rasco, Barbara

    2016-08-16

    The effect of acidic electrolyzed water (AEW) on inactivating Escherichia coli O104:H4, Listeria monocytogenes, Aeromonas hydrophila, Vibrio parahaemolyticus and Campylobacter jejuni in laboratory contaminated live clam (Venerupis philippinarum) and mussel (Mytilus edulis) was investigated. The initial levels of bacterial contamination were: in clam 4.9 to 5.7log10CFU/g, and in mussel 5.1 to 5.5log10CFU/g. Two types of AEW were used for treatment time intervals of 1 and 2h: strong (SAEW) with an available chlorine concentration (ACC) of 20mg/L, pH=3.1, and an oxidation-reduction potential (ORP) of 1150mV, and weak (WAEW) at ACC of 10mg/L, pH=3.55 and ORP of 950mV. SAEW and WAEW exhibited significant inhibitory activity against inoculated bacteria in both shellfish species with significant differences compared to saline solutions treatments (1-2% NaCl) and untreated controls (0h). SAEW showed the largest inhibitory activity, the extent of reduction (log10CFU/g) ranged from 1.4-1.7 for E. coli O104:H4; 1.0-1.6 for L. monocytogenes; 1.3-1.6 for A. hydrophila; 1.0-1.5 for V. parahaemolyticus; and 1.5-2.2 for C. jejuni in both types of shellfish. In comparison, significantly (P<0.05) lower inhibitory effect of WAEW was achieved compared to SAEW, where the extent of reduction (log10CFU/g) ranged from 0.7-1.1 for E. coli O104:H4; 0.6-0.9 for L. monocytogenes; 0.6-1.3 for A. hydrophila; 0.7-1.3 for V. parahaemolyticus; and 0.8-1.9 for C. jejuni in both types of shellfish. Among all bacterial strains examined in this study, AEW induced less bacterial injury (~0.1-1.0log10CFU/g) and more inactivation effect. This study revealed that AEW (10-20mg/L ACC) could be used to reduce bacterial contamination in live clam and mussel, which may help control possible unhygienic practices during production and processing of shellfish without apparent changes in the quality of the shellfish. PMID:27208583

  2. The strains recommended for use in the bacterial reverse mutation test (OECD guideline 471) can be certified as non-genetically modified organisms.

    PubMed

    Sugiyama, Kei-Ichi; Yamada, Masami; Awogi, Takumi; Hakura, Atsushi

    2016-01-01

    The bacterial reverse mutation test, commonly called Ames test, is used worldwide. In Japan, the genetically modified organisms (GMOs) are regulated under the Cartagena Domestic Law, and organisms obtained by self-cloning and/or natural occurrence would be exempted from the law case by case. The strains of Salmonella typhimurium and Escherichia coli recommended for use in the bacterial reverse mutation test (OECD guideline 471), have been considered as non-GMOs because they can be constructed by self-cloning or naturally occurring bacterial strains, or do not disturb the biological diversity. The present article explains the reasons why these tester strains should be classified as non-GMOs. PMID:27350822

  3. Draft Genome Sequence of the Shellfish Bacterial Pathogen Vibrio sp. Strain B183.

    PubMed

    Schreier, Harold J; Schott, Eric J

    2014-09-18

    We report the draft genome sequence of Vibrio sp. strain B183, a Gram-negative marine bacterium isolated from shellfish that causes mortality in larval mariculture. The availability of this genome sequence will facilitate the study of its virulence mechanisms and add to our knowledge of Vibrio sp. diversity and evolution.

  4. [Processes of plant colonization by Methylobacterium strains and some bacterial properties ].

    PubMed

    Romanovskaia, V A; Stoliar, S M; Malashenko, Iu R; Dodatko, T N

    2001-01-01

    The pink-pigmented facultative methylotrophic bacteria (PPFMB) of the genus Methylobacterium are indespensible inhabitants of the plant phyllosphere. Using maize Zea mays as a model, the ways of plant colonization by PPFMB and some properties of the latter that might be beneficial to plants were studied. A marked strain, Methylobacterium mesophilicum APR-8 (pULB113), was generated to facilitate the detection of the methylotrophic bacteria inoculated into the soil or applied to the maize leaves. Colonization of maize leaves by M. mesophilicum APR-8 (pULB113) occurred only after the bacteria were applied onto the leaf surface. In this case, the number of PPFMB cells on inoculated leaves increased with plant growth. During seed germination, no colonization of maize leaves with M. mesophilicum cells occurred immediately from the soil inoculated with the marked strain. Thus, under natural conditions, colonization of plant leaves with PPFMB seems to occur via soil particle transfer to the leaves by air. PPFMB monocultures were not antagonistic to phytopathogenic bacteria. However, mixed cultures of epiphytic bacteria containing Methylobacterium mesophilicum or M. extorquens did exhibit an antagonistic effect against the phytopathogenic bacteria studied (Xanthomonas camprestris, Pseudomonas syringae, Erwinia carotovora, Clavibacter michiganense, and Agrobacterium tumifaciens). Neither epiphytic and soil strains of Methylobacterium extorquens, M. organophillum, M. mesophilicum, and M. fujisawaense catalyzed ice nucleation. Hence, they cause no frost injury to plants. Thus, the results indicate that the strains of the genus Methylobacterium can protect plants against adverse environmental factors. PMID:11386061

  5. Translation quality control is critical for bacterial responses to amino acid stress

    PubMed Central

    Bullwinkle, Tammy J.; Ibba, Michael

    2016-01-01

    Gene expression relies on quality control for accurate transmission of genetic information. One mechanism that prevents amino acid misincorporation errors during translation is editing of misacylated tRNAs by aminoacyl-tRNA synthetases. In the absence of editing, growth is limited upon exposure to excess noncognate amino acid substrates and other stresses, but whether these physiological effects result solely from mistranslation remains unclear. To explore if translation quality control influences cellular processes other than protein synthesis, an Escherichia coli strain defective in Tyr-tRNAPhe editing was used. In the absence of editing, cellular levels of aminoacylated tRNAPhe were elevated during amino acid stress, whereas in the wild-type strain these levels declined under the same growth conditions. In the editing-defective strain, increased levels of aminoacylated tRNAPhe led to continued synthesis of the PheL leader peptide and attenuation of pheA transcription under amino acid stress. Consequently, in the absence of editing, activation of the phenylalanine biosynthetic operon becomes less responsive to phenylalanine limitation. In addition to raising aminoacylated tRNA levels, the absence of editing lowered the amount of deacylated tRNAPhe in the cell. This reduction in deacylated tRNA was accompanied by decreased synthesis of the second messenger guanosine tetraphosphate and limited induction of stringent response-dependent gene expression in editing-defective cells during amino acid stress. These data show that a single quality-control mechanism, the editing of misacylated aminoacyl-tRNAs, provides a critical checkpoint both for maintaining the accuracy of translation and for determining the sensitivity of transcriptional responses to amino acid stress. PMID:26858451

  6. Sialic acid-containing lipopolysaccharides of Salmonella O48 strains--potential role in camouflage and susceptibility to the bactericidal effect of normal human serum.

    PubMed

    Bugla-Płoskońska, Gabriela; Rybka, Jacek; Futoma-Kołoch, Bozena; Cisowska, Agnieszka; Gamian, Andrzej; Doroszkiewicz, Włodzimierz

    2010-04-01

    Sialic acid (N-acetylneuraminic acid, NeuAc) plays an essential role in protecting gram-negative bacteria against the bactericidal activity of serum and may contribute to the pathogenicity of bacteria by mimicking epitopes that resemble host tissue components (molecular mimicry). The role of sialic acid (NeuAc)-containing lipopolysaccharides (LPS) of Salmonella O48 strains in the complement activation of normal human serum (NHS) was investigated. NeuAc-containing lipooligosaccharides cause a downregulation of complement activation and may serve to camouflage the bacterial surface from the immunological response of the host. Serotype O48 Salmonella strains have the O-antigen structure containing NeuAc while its serovars differ in outer membrane protein composition. In this study, the mechanisms of complement activation responsible for killing Salmonella O48 serum-sensitive rods by NHS were established. Four of such mechanisms involving pathways, which are important in the bactericidal mechanism of complement activation, were distinguished: only the classical/lectin pathways, independent activation of the classical/lectin or alternative pathway, parallel activation of the classical/lectin and alternative pathways, and only the alternative pathway important in the bactericidal action of human serum. To further study the role of NeuAc, its content in bacterial cells was determined by gas-liquid chromatography-mass spectrometry in relation to 3-deoxy-D-manno-2-octulosonic acid (Kdo), an inherent constituent of LPS. The results indicate that neither the presence of sialic acid in LPS nor the length of the O-specific part of LPS containing NeuAc plays a decisive role in determining bacterial resistance to the bactericidal activity of complement and that the presence of sialic acid in the structure of LPS is not sufficient to block the activation of the alternative pathway of complement. We observed that for three strains with a very high NeuAc/Kdo ratio the alternative

  7. Metabolic evolution of Escherichia coli strains that produce organic acids

    SciTech Connect

    Grabar, Tammy; Gong, Wei; Yocum, R Rogers

    2014-10-28

    This invention relates to the metabolic evolution of a microbial organism previously optimized for producing an organic acid in commercially significant quantities under fermentative conditions using a hexose sugar as sole source of carbon in a minimal mineral medium. As a result of this metabolic evolution, the microbial organism acquires the ability to use pentose sugars derived from cellulosic materials for its growth while retaining the original growth kinetics, the rate of organic acid production and the ability to use hexose sugars as a source of carbon. This invention also discloses the genetic change in the microorganism that confers the ability to use both the hexose and pentose sugars simultaneously in the production of commercially significant quantities of organic acids.

  8. Pyrolytic Methylation-Gas Chromatography of Whole Bacterial Cells for Rapid Profiling of Cellular Fatty Acids

    PubMed Central

    Dworzanski, Jacek P.; Berwald, Luc; Meuzelaar, Henk L. C.

    1990-01-01

    A novel, on-line derivatization technique has been developed which enables generation of fatty acid methyl ester (FAME) profiles from microorganisms by gas chromatography-mass spectrometry without the need for laborious and time-consuming sample preparation. Microgram amounts of bacterial cells are directly applied to a thin ferromagnetic filament and covered with a single drop of methanolic solution of tetramethylammonium hydroxide. After air drying, the filament is inserted into a special gas chromatograph inlet equipped with a high-frequency coil, thus enabling rapid inductive heating of the ferromagnetic filament. This so-called Curie-point heating technique is shown to produce patterns of bacterial FAMEs which are qualitatively and quantitatively nearly identical to those obtained from extracts of methylated lipids prepared by conventional sample pretreatment methods. Relatively minor differences involve the loss of hydroxy-substituted fatty acids by the pyrolytic approach as well as strongly enhanced signals of FAMEs derived from mycolic acids. This type of pyrolysis enables on-line derivatization and thermal extraction of volatile derivatives for analysis, whereas the residual components remain on a disposable probe (ferromagnetic wire) of a pyrolytic device. The reduced sample size (micrograms instead of milligrams) and the lack of sample preparation requirements open up the possibility of rapid microbiological identification of single colonies (thus overcoming the need for time-consuming subculturing) as well as analysis of FAME profiles directly from complex environmental samples. PMID:16348214

  9. Total lipid and fatty acid composition of eight strains of marine diatoms

    NASA Astrophysics Data System (ADS)

    Liang, Ying; Mai, Kang-Sen; Sun, Shi-Chun

    2000-12-01

    Fatty acid composition and total lipid content of 8 strains of marine diatoms ( Nitzschia frustrula, Nitzschia closterium, Nitzschia incerta, Navicula pelliculosa, Phaeodactylum tricornutum, Synedra fragilaroides) were examined. The microalgae were grown under defined conditions and harvested at the late exponential phase. The major fatty acids in most strains were 14∶0 (1.0% 6.3%), 16∶0 (13.5 26.4%), 16∶1n-7 (21.1% 46.3%) and 20∶5n-3 (6.5% 19.5%). The polyunsaturated fatty acids 16∶2n-4, 16∶3n-4, 16∶4n-1 and 20∶4n-6 also comprised a significant proportion of the total fatty acids in some strains. The characteristic fatty acid composition of diatoms is readily distinguishable from those of other microalgal groups. Significant concentration of the polyunsaturated fatty acid 20∶5n-3 (eicosapentaenoic acid) was present in each strain, with the highest proportion in B222 (19.5%).

  10. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, M.; Millard, C.S.; Stols, L.

    1998-06-23

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which as been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria. 2 figs.

  11. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

    2002-01-01

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which has been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

  12. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

    2001-09-25

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which has been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

  13. Mutant E. coli strain with increased succinic acid production

    DOEpatents

    Donnelly, Mark; Millard, Cynthia S.; Stols, Lucy

    1998-01-01

    A method for isolating succinic acid producing bacteria is provided comprising increasing the biomass of an organism which lacks the ability to catabolize pyruvate, and then subjecting the biomass to glucose-rich medium in an anaerobic environment to enable pyruvate-catabolizing mutants to grow. The invention also provides for a mutant that produces high amounts of succinic acid, which as been derived from a parent which lacked the genes for pyruvate formate lyase and lactate dehydrogenase, and which belongs to the E.coli Group of Bacteria.

  14. Isolation of bacterial cellulose nanocrystalline from pineapple peel waste: Optimization of acid concentration in the hydrolysis method

    NASA Astrophysics Data System (ADS)

    Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik

    2016-02-01

    Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.

  15. Susceptibility of different mice strains to okadaic acid, a diarrhetic shellfish poisoning toxin.

    PubMed

    Suzuki, Hodaka

    2012-08-01

    The mouse bioassay is widely used to detect diarrhetic shellfish poisoning (DSP) toxins. To the best of our knowledge, however, there have been no reports specifically on strain differences in susceptibility to DSP toxins. In this study, we investigated the susceptibility of different mice strains to okadaic acid (OA), one of the representative DSP toxins. A lethal dose of OA was injected intraperitoneally (i.p.) into mice. The mice were observed until 24 h after injection. Five inbred strains (A/J, BALB/c, C3H/He, C57BL/6, and DBA/2) and two non-inbred strains (ddY, and ICR) of mice were compared. All the mice were male, weighed 16-20 g, and were 4-5 weeks old. The lethality was 90-100% in the A/J, BALB/c, ddY, and ICR strains, 70-80% in the C3H/He and C57BL/6 strains, and 40% in DBA/2 strain. Survival analysis showed that the BALB/c, C57BL/6, ddY, and ICR strains died earlier and the A/J, C3H/He and DBA/2 strains survived longer. These results indicate that significant differences may exist in the susceptibility of mice strains to OA.

  16. Genomic survey of pathogenicity determinants and VNTR markers in the cassava bacterial pathogen Xanthomonas axonopodis pv. Manihotis strain CIO151.

    PubMed

    Arrieta-Ortiz, Mario L; Rodríguez-R, Luis M; Pérez-Quintero, Álvaro L; Poulin, Lucie; Díaz, Ana C; Arias Rojas, Nathalia; Trujillo, Cesar; Restrepo Benavides, Mariana; Bart, Rebecca; Boch, Jens; Boureau, Tristan; Darrasse, Armelle; David, Perrine; Dugé de Bernonville, Thomas; Fontanilla, Paula; Gagnevin, Lionel; Guérin, Fabien; Jacques, Marie-Agnès; Lauber, Emmanuelle; Lefeuvre, Pierre; Medina, Cesar; Medina, Edgar; Montenegro, Nathaly; Muñoz Bodnar, Alejandra; Noël, Laurent D; Ortiz Quiñones, Juan F; Osorio, Daniela; Pardo, Carolina; Patil, Prabhu B; Poussier, Stéphane; Pruvost, Olivier; Robène-Soustrade, Isabelle; Ryan, Robert P; Tabima, Javier; Urrego Morales, Oscar G; Vernière, Christian; Carrere, Sébastien; Verdier, Valérie; Szurek, Boris; Restrepo, Silvia; López, Camilo; Koebnik, Ralf; Bernal, Adriana

    2013-01-01

    Xanthomonas axonopodis pv. manihotis (Xam) is the causal agent of bacterial blight of cassava, which is among the main components of human diet in Africa and South America. Current information about the molecular pathogenicity factors involved in the infection process of this organism is limited. Previous studies in other bacteria in this genus suggest that advanced draft genome sequences are valuable resources for molecular studies on their interaction with plants and could provide valuable tools for diagnostics and detection. Here we have generated the first manually annotated high-quality draft genome sequence of Xam strain CIO151. Its genomic structure is similar to that of other xanthomonads, especially Xanthomonas euvesicatoria and Xanthomonas citri pv. citri species. Several putative pathogenicity factors were identified, including type III effectors, cell wall-degrading enzymes and clusters encoding protein secretion systems. Specific characteristics in this genome include changes in the xanthomonadin cluster that could explain the lack of typical yellow color in all strains of this pathovar and the presence of 50 regions in the genome with atypical nucleotide composition. The genome sequence was used to predict and evaluate 22 variable number of tandem repeat (VNTR) loci that were subsequently demonstrated as polymorphic in representative Xam strains. Our results demonstrate that Xanthomonas axonopodis pv. manihotis strain CIO151 possesses ten clusters of pathogenicity factors conserved within the genus Xanthomonas. We report 126 genes that are potentially unique to Xam, as well as potential horizontal transfer events in the history of the genome. The relation of these regions with virulence and pathogenicity could explain several aspects of the biology of this pathogen, including its ability to colonize both vascular and non-vascular tissues of cassava plants. A set of 16 robust, polymorphic VNTR loci will be useful to develop a multi-locus VNTR analysis

  17. Analysis of Vaginal Acetic Acid in Patients Undergoing Treatment for Bacterial Vaginosis

    PubMed Central

    Chaudry, Amjad N.; Travers, Paul J.; Yuenger, Jeffrey; Colletta, Lorraine; Evans, Phillip; Zenilman, Jonathan M.; Tummon, Andrew

    2004-01-01

    A “gold standard” method for the diagnosis of bacterial vaginosis (BV) is lacking. The clinical criteria described by the Amsel technique are subjective and difficult to quantify. Alternatively, the reading of Gram-stained vaginal smears by scoring techniques such as those that use the Nugent or Hay-Ison scoring systems is again subjective, requires expert personnel to perform the reading, and is infrequently used clinically. Recently, a new diagnostic device, the Osmetech Microbial Analyzer—Bacterial Vaginosis (OMA-BV), which determines a patient's BV status on the basis of measurement of the amount of acetic acid present in a vaginal swab specimen, was approved by the Food and Drug Administration. The present study uses the conducting polymer gas-sensing technology of OMA-BV to measure the concentration of acetic acid in the headspace above vaginal swab specimens from patients undergoing treatment for BV with metronidazole. In 97.8% of the cases the level of acetic acid detected fell sharply during the treatment period, crossing from above to below the diagnostic threshold of 900 ppm. The diagnosis obtained on the basis of the level of vaginal acetic acid was compared with the diagnoses obtained by use of the Amsel criteria and the Nugent scoring system both at the time of initial entry into the study and at the repeat samplings on days 7 and 14. The results obtained with OMA-BV showed overall agreements compared with the results of the Amsel and Nugent tests of 98 and 94%, respectively, for the 34 patients monitored through the treatment process. This provides further evidence that the measurement of vaginal acetic acid by headspace analysis with conducting polymer sensors is a valid alternative to present tests for the diagnosis of BV. PMID:15528711

  18. Purification and properties of an organophosphorus acid anhydrase from a halophilic bacterial isolate.

    PubMed Central

    DeFrank, J J; Cheng, T C

    1991-01-01

    A moderately halophilic bacterial isolate has been found to possess high levels of enzymatic activity against several highly toxic organophosphorus compounds. The predominant enzyme, designated organophosphorus acid anhydrase 2, has been purified 1,000-fold to homogeneity and characterized. The enzyme is a single polypeptide with a molecular weight of 60,000. With diisopropylfluorophosphate as a substrate, the enzyme has optimum activity at pH 8.5 and 50 degrees C, and it is stimulated by manganese and cobalt. Images PMID:2001997

  19. [Generation of nalidixic acid-resistant strains and signature-tagged mutants of Actinobacillus pleuropneumoniae].

    PubMed

    Shang, Lin; Li, Wei; Li, Liangjun; Li, Lu; Zhang, Sihua; Li, Tingting; Li, Yaokun; Liu, Lei; Guo, Zhiwei; Zhou, Rui; Chen, Huanchun

    2008-01-01

    Actinobacillus pleuropneumoniae is a very important respiratory pathogen for swine and causes great economic losses in pig industry worldwide. Signature-tagged mutagenesis (STM) is an effective method to identify virulence genes in bacteria. In this study, we selected nalidixic acid-resistant strains of APP serotypes 1 and 3 by in vitro cultivation, and used as receipt strains for constructing transposon mutants by mating with E. coli CC 118 lambdapir or S17-1 lambdapir containing mini-Tn10 tag plasmids pLOF/TAG1-48, with or without the help of E. coli DH5alpha (pRK2073). We screened mutant strains by antibiotics selection, PCR and Southern blot identification. Our data revealed that nalidixic acid-resistance of APP strains could easily be induced in vitro and the resistance was due to the mutation in the DNA gyrase A subunit gene gyrA. In the mating experiments, the bi-parental mating was more effective and easier than tri-parental mating. Different APP strains showed a different mating and transposon efficiency in the bi-parental mating, with the strains of serotype 1 much higher than serotype 3 and the reference strain of serotype 3 higher than the field strains. These data were helpful for the construction of STM mutants and pickup of virulence genes of APP. PMID:18338580

  20. Synergistic and Additive Effect of Oregano Essential Oil and Biological Silver Nanoparticles against Multidrug-Resistant Bacterial Strains.

    PubMed

    Scandorieiro, Sara; de Camargo, Larissa C; Lancheros, Cesar A C; Yamada-Ogatta, Sueli F; Nakamura, Celso V; de Oliveira, Admilton G; Andrade, Célia G T J; Duran, Nelson; Nakazato, Gerson; Kobayashi, Renata K T

    2016-01-01

    Bacterial resistance to conventional antibiotics has become a clinical and public health problem, making therapeutic decisions more challenging. Plant compounds and nanodrugs have been proposed as potential antimicrobial alternatives. Studies have shown that oregano (Origanum vulgare) essential oil (OEO) and silver nanoparticles have potent antibacterial activity, also against multidrug-resistant strains; however, the strong organoleptic characteristics of OEO and the development of resistance to these metal nanoparticles can limit their use. This study evaluated the antibacterial effect of a two-drug combination of biologically synthesized silver nanoparticles (bio-AgNP), produced by Fusarium oxysporum, and OEO against Gram-positive and Gram-negative bacteria, including multidrug-resistant strains. OEO and bio-AgNP showed bactericidal effects against all 17 strains tested, with minimal inhibitory concentrations (MIC) ranging from 0.298 to 1.193 mg/mL and 62.5 to 250 μM, respectively. Time-kill curves indicated that OEO acted rapidly (within 10 min), while the metallic nanoparticles took 4 h to kill Gram-negative bacteria and 24 h to kill Gram-positive bacteria. The combination of the two compounds resulted in a synergistic or additive effect, reducing their MIC values and reducing the time of action compared to bio-AgNP used alone, i.e., 20 min for Gram-negative bacteria and 7 h for Gram-positive bacteria. Scanning electron microscopy (SEM) revealed similar morphological alterations in Staphylococcus aureus (non-methicillin-resistant S. aureus, non-MRSA) cells exposed to three different treatments (OEO, bio-AgNP and combination of the two), which appeared cell surface blebbing. Individual and combined treatments showed reduction in cell density and decrease in exopolysaccharide matrix compared to untreated bacterial cells. It indicated that this composition have an antimicrobial activity against S. aureus by disrupting cells. Both compounds showed very low

  1. Synergistic and Additive Effect of Oregano Essential Oil and Biological Silver Nanoparticles against Multidrug-Resistant Bacterial Strains

    PubMed Central

    Scandorieiro, Sara; de Camargo, Larissa C.; Lancheros, Cesar A. C.; Yamada-Ogatta, Sueli F.; Nakamura, Celso V.; de Oliveira, Admilton G.; Andrade, Célia G. T. J.; Duran, Nelson; Nakazato, Gerson; Kobayashi, Renata K. T.

    2016-01-01

    Bacterial resistance to conventional antibiotics has become a clinical and public health problem, making therapeutic decisions more challenging. Plant compounds and nanodrugs have been proposed as potential antimicrobial alternatives. Studies have shown that oregano (Origanum vulgare) essential oil (OEO) and silver nanoparticles have potent antibacterial activity, also against multidrug-resistant strains; however, the strong organoleptic characteristics of OEO and the development of resistance to these metal nanoparticles can limit their use. This study evaluated the antibacterial effect of a two-drug combination of biologically synthesized silver nanoparticles (bio-AgNP), produced by Fusarium oxysporum, and OEO against Gram-positive and Gram-negative bacteria, including multidrug-resistant strains. OEO and bio-AgNP showed bactericidal effects against all 17 strains tested, with minimal inhibitory concentrations (MIC) ranging from 0.298 to 1.193 mg/mL and 62.5 to 250 μM, respectively. Time-kill curves indicated that OEO acted rapidly (within 10 min), while the metallic nanoparticles took 4 h to kill Gram-negative bacteria and 24 h to kill Gram-positive bacteria. The combination of the two compounds resulted in a synergistic or additive effect, reducing their MIC values and reducing the time of action compared to bio-AgNP used alone, i.e., 20 min for Gram-negative bacteria and 7 h for Gram-positive bacteria. Scanning electron microscopy (SEM) revealed similar morphological alterations in Staphylococcus aureus (non-methicillin-resistant S. aureus, non-MRSA) cells exposed to three different treatments (OEO, bio-AgNP and combination of the two), which appeared cell surface blebbing. Individual and combined treatments showed reduction in cell density and decrease in exopolysaccharide matrix compared to untreated bacterial cells. It indicated that this composition have an antimicrobial activity against S. aureus by disrupting cells. Both compounds showed very low

  2. High Frequency and Diversity of Antimicrobial Activities Produced by Nasal Staphylococcus Strains against Bacterial Competitors

    PubMed Central

    Janek, Daniela; Zipperer, Alexander; Kulik, Andreas; Krismer, Bernhard; Peschel, Andreas

    2016-01-01

    The human nasal microbiota is highly variable and dynamic often enclosing major pathogens such as Staphylococcus aureus. The potential roles of bacteriocins or other mechanisms allowing certain bacterial clones to prevail in this nutrient-poor habitat have hardly been studied. Of 89 nasal Staphylococcus isolates, unexpectedly, the vast majority (84%) was found to produce antimicrobial substances in particular under habitat-specific stress conditions, such as iron limitation or exposure to hydrogen peroxide. Activity spectra were generally narrow but highly variable with activities against certain nasal members of the Actinobacteria, Proteobacteria, Firmicutes, or several groups of bacteria. Staphylococcus species and many other Firmicutes were insusceptible to most of the compounds. A representative bacteriocin was identified as a nukacin-related peptide whose inactivation reduced the capacity of the producer Staphylococcus epidermidis IVK45 to limit growth of other nasal bacteria. Of note, the bacteriocin genes were found on mobile genetic elements exhibiting signs of extensive horizontal gene transfer and rearrangements. Thus, continuously evolving bacteriocins appear to govern bacterial competition in the human nose and specific bacteriocins may become important agents for eradication of notorious opportunistic pathogens from human microbiota. PMID:27490492

  3. High Frequency and Diversity of Antimicrobial Activities Produced by Nasal Staphylococcus Strains against Bacterial Competitors.

    PubMed

    Janek, Daniela; Zipperer, Alexander; Kulik, Andreas; Krismer, Bernhard; Peschel, Andreas

    2016-08-01

    The human nasal microbiota is highly variable and dynamic often enclosing major pathogens such as Staphylococcus aureus. The potential roles of bacteriocins or other mechanisms allowing certain bacterial clones to prevail in this nutrient-poor habitat have hardly been studied. Of 89 nasal Staphylococcus isolates, unexpectedly, the vast majority (84%) was found to produce antimicrobial substances in particular under habitat-specific stress conditions, such as iron limitation or exposure to hydrogen peroxide. Activity spectra were generally narrow but highly variable with activities against certain nasal members of the Actinobacteria, Proteobacteria, Firmicutes, or several groups of bacteria. Staphylococcus species and many other Firmicutes were insusceptible to most of the compounds. A representative bacteriocin was identified as a nukacin-related peptide whose inactivation reduced the capacity of the producer Staphylococcus epidermidis IVK45 to limit growth of other nasal bacteria. Of note, the bacteriocin genes were found on mobile genetic elements exhibiting signs of extensive horizontal gene transfer and rearrangements. Thus, continuously evolving bacteriocins appear to govern bacterial competition in the human nose and specific bacteriocins may become important agents for eradication of notorious opportunistic pathogens from human microbiota.

  4. Selection of bacterial strains efficient in decolorization of remazol black-B.

    PubMed

    Shah, Maulin P; Sebastian, Soniya; Mathukiya, Hemangi M; Darji, A M; Patel, Jigna; Patel, Kavita

    2013-01-01

    Azo dyes are released into wastewater streams without any pretreatment and polluted water and soil environments. To prevent contamination of our vulnerable resources, removal of these dye pollutants is of great importance. For this purpose, wastewater samples were collected from dye-contaminated sites of Ankleshwar, Gujarat, India. About 50 bacterial isolates were isolated through enrichment and then tested for their potential to remove Remazol Black-B azo dye in liquid medium. Three bacterial isolates capable of degrading Remazol Black-B azo dye efficiently were screened through experimentation on modified mineral salt medium. Isolate ETL-1 was able to completely remove the Remazol Black-B dye from the liquid medium in 18 h. Further, the isolate showed the best performance at the dye concentration of 100 mg L-1 medium (pH 7) and at temperature 35 degrees C. Similarly, yeast extract proved to be the best carbon source for decolorization purpose. The results imply that the isolate ETL-1 could be used for the removal of the reactive dyes from textile effluents.

  5. High Frequency and Diversity of Antimicrobial Activities Produced by Nasal Staphylococcus Strains against Bacterial Competitors.

    PubMed

    Janek, Daniela; Zipperer, Alexander; Kulik, Andreas; Krismer, Bernhard; Peschel, Andreas

    2016-08-01

    The human nasal microbiota is highly variable and dynamic often enclosing major pathogens such as Staphylococcus aureus. The potential roles of bacteriocins or other mechanisms allowing certain bacterial clones to prevail in this nutrient-poor habitat have hardly been studied. Of 89 nasal Staphylococcus isolates, unexpectedly, the vast majority (84%) was found to produce antimicrobial substances in particular under habitat-specific stress conditions, such as iron limitation or exposure to hydrogen peroxide. Activity spectra were generally narrow but highly variable with activities against certain nasal members of the Actinobacteria, Proteobacteria, Firmicutes, or several groups of bacteria. Staphylococcus species and many other Firmicutes were insusceptible to most of the compounds. A representative bacteriocin was identified as a nukacin-related peptide whose inactivation reduced the capacity of the producer Staphylococcus epidermidis IVK45 to limit growth of other nasal bacteria. Of note, the bacteriocin genes were found on mobile genetic elements exhibiting signs of extensive horizontal gene transfer and rearrangements. Thus, continuously evolving bacteriocins appear to govern bacterial competition in the human nose and specific bacteriocins may become important agents for eradication of notorious opportunistic pathogens from human microbiota. PMID:27490492

  6. Differential fusion expression and purification of a cystatin in two different bacterial strains.

    PubMed

    Gholizadeh, A

    2013-01-01

    To date, the identification of the novel multifunctional properties of cysteine proteinase inhibitors "known as cystatins" is the great of interests for molecular biologists. The efficient production, purification and correctly folded form of these proteins are the most important requirements for their any basic research. To the best of our knowledge, maltose-binding protein (MBP) fusion tags are being used to overcome the impediment to their heterologous recombinant expression in Escherichia coli as insoluble and bio-inactive inclusion bodies. In the present work, to evaluate the expression efficiency of a cystatin molecule in E. coli cells by using MBP tags, the expression of Celosia cystatin was studied in two different strains of this bacterium. The quantitative analysis results based on the one-step purification yield of the fused product showed the excellency of the E. coli TB1 strain in comparison to E. coli DH5alpha for the high-level production of active product.

  7. Degradation of nicosulfuron by a novel isolated bacterial strain Klebsiella sp. Y1: condition optimization, kinetics and degradation pathway.

    PubMed

    Wang, Lin; Zhang, Xiaolin; Li, Yongmei

    2016-01-01

    A novel bacterial strain Klebsiella sp. Y1 was isolated from the soil of a constructed wetland, and it was identified based on the 16S rDNA sequence analysis. The co-metabolic degradation of nicosulfuron with glucose by Klebsiella sp. Y1 was investigated. The response surface methodology analysis indicated that the optimal pH and temperature were 7.0 and 35 °C, respectively, for the degradation of nicosulfuron. Under the optimal conditions, the degradation of nicosulfuron fitted Haldane kinetics model well. The removal of nicosulfuron was triggered by the acidification of glucose, which accelerated the hydrolysis of nicosulfuron. Then, the C-N bond of the sulfonylurea bridge was attacked and cleaved. Finally, the detected intermediate 2-amino-4,6-dimethoxypyrimidine was further biodegraded.

  8. Degradation of nicosulfuron by a novel isolated bacterial strain Klebsiella sp. Y1: condition optimization, kinetics and degradation pathway.

    PubMed

    Wang, Lin; Zhang, Xiaolin; Li, Yongmei

    2016-01-01

    A novel bacterial strain Klebsiella sp. Y1 was isolated from the soil of a constructed wetland, and it was identified based on the 16S rDNA sequence analysis. The co-metabolic degradation of nicosulfuron with glucose by Klebsiella sp. Y1 was investigated. The response surface methodology analysis indicated that the optimal pH and temperature were 7.0 and 35 °C, respectively, for the degradation of nicosulfuron. Under the optimal conditions, the degradation of nicosulfuron fitted Haldane kinetics model well. The removal of nicosulfuron was triggered by the acidification of glucose, which accelerated the hydrolysis of nicosulfuron. Then, the C-N bond of the sulfonylurea bridge was attacked and cleaved. Finally, the detected intermediate 2-amino-4,6-dimethoxypyrimidine was further biodegraded. PMID:27332834

  9. Cooperative Mn(II) oxidation between two bacterial strains in an aquatic environment.

    PubMed

    Liang, Jinsong; Bai, Yaohui; Hu, Chengzhi; Qu, Jiuhui

    2016-02-01

    In natural or engineered environments, diverse interspecific interactions among two or more microbial taxa may profoundly affect the transformation of organic compounds in the media. Little is known, however, about how these organisms and interactions affect the transformation of heavy metals. Recently, we found an interaction between two non-Mn(II)-oxidizing (when in monoculture) strains, Arthrobacter sp. QXT-31 and Sphingopyxis sp. QXT-31, which, when cultured in combination, resulted in Mn(II)-oxidizing activity in synthetic media. In order to study the occurrence likelihood of cooperative Mn(II) oxidation in natural water and discharged effluent, we initially identified an optimal ratio of the two strains in a combined culture, as well as the impacts of external factors on the cooperative oxidation. Once preferred initial conditions were established, we assessed the degree and rate of Mn(II) oxidation mediated by the combined QXT-31 strains (henceforth referred to as simply 'QXT-31') in three different water types: groundwater, domestic sewage and coking wastewater. Results showed that Mn(II) oxidation only occurred when the two strains were within a specific ratios range. When introduced to the test waters at the preferred ratio, QXT-31 demonstrated high Mn(II)-oxidizing activities, even when relative abundance of QXT-31 was very low (roughly 1.6%, calculated by 454 pyrosequencing events on 16S rcDNA). Interestingly, even under low relative abundance of QXT-31, removal of total organic carbon and total nitrogen in the test waters was significantly higher than the control treatments that were not inoculated with QXT-31. Data from our study indicate that cooperative Mn(II) oxidation is most likely to occur in natural aquatic ecosystems, and also suggests an alternative method to treat wastewater containing high concentrations of Mn(II).

  10. Extracellular polymeric substances (EPS) producing bacterial strains of municipal wastewater sludge: isolation, molecular identification, EPS characterization and performance for sludge settling and dewatering.

    PubMed

    Bala Subramanian, S; Yan, S; Tyagi, R D; Surampalli, R Y

    2010-04-01

    Wastewater treatment plants often face the problems of sludge settling mainly due to sludge bulking. Generally, synthetic organic polymer and/or inorganic coagulants (ferric chloride, alum and quick lime) are used for sludge settling. These chemicals are very expensive and further pollute the environment. Whereas, the bioflocculants are environment friendly and may be used to flocculate the sludge. Extracellular polymeric substances (EPS) produced by sludge microorganisms play a definite role in sludge flocculation. In this study, 25 EPS producing strains were isolated from municipal wastewater treatment plant. Microorganisms were selected based on EPS production properties on solid agar medium. Three types of EPS (slime, capsular and bacterial broth mixture of both slime and capsular) were harvested and their characteristics were studied. EPS concentration (dry weight), viscosity and their charge (using a Zetaphoremeter) were also measured. Bioflocculability of obtained EPS was evaluated by measuring the kaolin clay flocculation activity. Six bacterial strains (BS2, BS8, BS9, BS11, BS15 and BS25) were selected based on the kaolin clay flocculation. The slime EPS was better for bioflocculation than capsular EPS and bacterial broth. Therefore, extracted slime EPS (partially purified) from six bacterial strains was studied in terms of sludge settling [sludge volume index (SVI)] and dewatering [capillary suction time (CST)]. Biopolymers produced by individual strains substantially improved dewaterability. The extracted slime EPS from six different strains were partially characterized.

  11. Control of Shigatoxin-producing Escherichia coli in cheese by dairy bacterial strains.

    PubMed

    Callon, Cécile; Arliguie, Céline; Montel, Marie-Christine

    2016-02-01

    Bio-preservation could be a valuable way to control Shigatoxin-producing Escherichia coli (STEC) in cheese. To this end, 41 strains were screened for their inhibitory potential on model cheese curd and on pasteurized and raw milk uncooked pressed cheeses. Strains of Lactococcus lactis, Lactococcus garvieae, Leuconostoc pseudomesenteroides, Leuconostoc citreum, Lactobacillus sp, Carnobacterium mobile, Enterococcus faecalis, Enterococcus faecium, Macrococcus caseolyticus and Hafnia alvei reduced STEC O26:H11 counts by 1.4-2.5 log cfu g(-1) and to a lesser extent STEC O157:H7 counts in pasteurized milk cheeses. Some strains can act in synergy to inhibit STEC in raw milk uncooked pressed cheeses. Inhibitory associations had no adverse effect on the sensory characteristics of these cheeses. The association of H. alvei, Lactobacillus plantarum and Lc. lactis was the most inhibitory: after inoculation of this consortium into milk, STEC O26:H11 and O157:H7, inoculated at 2 log cfu ml(-1), were reduced by up to 3 log cfu g(-1) in ripened cheese. Inhibition in cheese cannot be predicted from H2O2 production in BHI medium, decreased pH or milk reduction. It is not clear what role the rapid decrease in pH during the first 6 h may play in the inhibition. Further studies will be needed to determine the nature of the inhibition.

  12. Towards a tolerance toolkit: Gene expression signatures enabling the emergence of resistant bacterial strains

    NASA Astrophysics Data System (ADS)

    Erickson, Keesha; Chatterjee, Anushree

    2014-03-01

    Microbial pathogens are able to rapidly acquire tolerance to chemical toxins. Developing next-generation antibiotics that impede the emergence of resistance will help avoid a world-wide health crisis. Conversely, the ability to induce rapid tolerance gains could lead to high-yielding strains for sustainable production of biofuels and commodity chemicals. Achieving these goals requires an understanding of the general mechanisms allowing microbes to become resistant to diverse toxins. We apply top-down and bottom-up methodologies to identify biological network changes leading to adaptation and tolerance. Using a top-down approach, we perform evolution experiments to isolate resistant strains, collect samples for transcriptomic and proteomic analysis, and use the omics data to inform mathematical gene regulatory models. Using a bottom-up approach, we build and test synthetic genetic devices that enable increased or decreased expression of selected genes. Unique patterns in gene expression are identified in cultures actively gaining resistance, especially in pathways known to be involved with stress response, efflux, and mutagenesis. Genes correlated with tolerance could potentially allow the design of resistance-free antibiotics or robust chemical production strains.

  13. Control of Shigatoxin-producing Escherichia coli in cheese by dairy bacterial strains.

    PubMed

    Callon, Cécile; Arliguie, Céline; Montel, Marie-Christine

    2016-02-01

    Bio-preservation could be a valuable way to control Shigatoxin-producing Escherichia coli (STEC) in cheese. To this end, 41 strains were screened for their inhibitory potential on model cheese curd and on pasteurized and raw milk uncooked pressed cheeses. Strains of Lactococcus lactis, Lactococcus garvieae, Leuconostoc pseudomesenteroides, Leuconostoc citreum, Lactobacillus sp, Carnobacterium mobile, Enterococcus faecalis, Enterococcus faecium, Macrococcus caseolyticus and Hafnia alvei reduced STEC O26:H11 counts by 1.4-2.5 log cfu g(-1) and to a lesser extent STEC O157:H7 counts in pasteurized milk cheeses. Some strains can act in synergy to inhibit STEC in raw milk uncooked pressed cheeses. Inhibitory associations had no adverse effect on the sensory characteristics of these cheeses. The association of H. alvei, Lactobacillus plantarum and Lc. lactis was the most inhibitory: after inoculation of this consortium into milk, STEC O26:H11 and O157:H7, inoculated at 2 log cfu ml(-1), were reduced by up to 3 log cfu g(-1) in ripened cheese. Inhibition in cheese cannot be predicted from H2O2 production in BHI medium, decreased pH or milk reduction. It is not clear what role the rapid decrease in pH during the first 6 h may play in the inhibition. Further studies will be needed to determine the nature of the inhibition. PMID:26678131

  14. Trace Amounts of Furan-2-Carboxylic Acids Determine the Quality of Solid Agar Plates for Bacterial Culture

    PubMed Central

    Hara, Shintaro; Isoda, Reika; Tahvanainen, Teemu; Hashidoko, Yasuyuki

    2012-01-01

    Background Many investigators have recognised that a significant proportion of environmental bacteria exist in a viable but non-culturable state on agar plates, and some researchers have also noticed that some of such bacteria clearly recover their growth on matrices other than agar. However, the reason why agar is unsuitable for the growth of some bacteria has not been addressed. Methodology/Principal Findings According to the guide of a bioassay for swarming inhibition, we identified 5-hydroxymethylfuran-2-carboxylic acid (5-HMFA) and furan-2-carboxylic acid (FA) as factors that inhibit bacterial swarming and likely inhibit extracellular polysaccharide production on agar. The furan-2-carboxylic acids 5-HMFA and FA effectively inhibited the swarming and swimming of several environmental bacteria at concentrations of 1.8 and 2.3 µg L−1 (13 and 21 nmol L−1), respectively, which are equivalent to the concentrations of these compounds in 0.3% agar. On Luria-Bertani (LB) plates containing 1.0% agar that had been previously washed with MeOH, a mixture of 5-HMFA and FA in amounts equivalent to their original concentrations in the unwashed agar repressed the swarming of Escherichia coli K12 strain W3110, a representative swarming bacterium. Conclusions/Significance Agar that contains trace amounts of 5-HMFA and FA inhibits the proliferation of some slow-growing or difficult-to-culture bacteria on the plates, but it is useful for single colony isolation due to the ease of identification of swarmable bacteria as the non-swarmed colonies. PMID:22848437

  15. Microcultures of lactic acid bacteria: characterization and selection of strains, optimization of nutrients and gallic acid concentration.

    PubMed

    Guzmán-López, Oswaldo; Loera, Octavio; Parada, José Luis; Castillo-Morales, Alberto; Martínez-Ramírez, Cándida; Augur, Christopher; Gaime-Perraud, Isabelle; Saucedo-Castañeda, Gerardo

    2009-01-01

    Eighteen lactic acid bacteria (LAB) strains, isolated from coffee pulp silages were characterized according to both growth and gallic acid (GA) consumption. Prussian blue method was adapted to 96-well microplates to quantify GA in LAB microcultures. Normalized data of growth and GA consumption were used to characterize strains into four phenotypes. A number of 5 LAB strains showed more than 60% of tolerance to GA at 2 g/l; whereas at 10 g/l GA growth inhibition was detected to a different extent depending on each strain, although GA consumption was observed in seven studied strains (>60%). Lactobacillus plantarum L-08 was selected for further studies based on its capacity to degrade GA at 10 g/l (97%). MRS broth and GA concentrations were varied to study the effect on growth of LAB. Cell density and growth rate were optimized by response surface methodology and kinetic analysis. Maximum growth was attained after 7.5 h of cultivation, with a dilution factor of 1-1/2 and a GA concentration between 0.625 and 2.5 g/l. Results indicated that the main factor affecting LAB growth was GA concentration. The main contribution of this study was to propose a novel adaptation of a methodology to characterize and select LAB strains with detoxifying potential of simple phenolics based on GA consumption and tolerance. In addition, the methodology presented in this study integrated the well-known RSM with an experimental design based on successive dilutions.

  16. Genome-wide gene expression changes in an industrial clavulanic acid overproduction strain of Streptomyces clavuligerus.

    PubMed

    Medema, Marnix H; Alam, Mohammad T; Heijne, Wilbert H M; van den Berg, Marco A; Müller, Ulrike; Trefzer, Axel; Bovenberg, Roel A L; Breitling, Rainer; Takano, Eriko

    2011-03-01

    To increase production of the important pharmaceutical compound clavulanic acid, a β-lactamase inhibitor, both random mutagenesis approaches and rational engineering of Streptomyces clavuligerus strains have been extensively applied. Here, for the first time, we compared genome-wide gene expression of an industrial S. clavuligerus strain, obtained through iterative mutagenesis, with that of the wild-type strain. Intriguingly, we found that the majority of the changes contributed not to a complex rewiring of primary metabolism but consisted of a simple upregulation of various antibiotic biosynthesis gene clusters. A few additional transcriptional changes in primary metabolism at key points seem to divert metabolic fluxes to the biosynthetic precursors for clavulanic acid. In general, the observed changes largely coincide with genes that have been targeted by rational engineering in recent years, yet the presence of a number of previously unexplored genes clearly demonstrates that functional genomic analysis can provide new leads for strain improvement in biotechnology.

  17. Selection of a Bifidobacterium animalis subsp. lactis Strain with a Decreased Ability To Produce Acetic Acid

    PubMed Central

    Margolles, Abelardo

    2012-01-01

    We have characterized a new strain, Bifidobacterium animalis subsp. lactis CECT 7953, obtained by random UV mutagenesis, which produces less acetic acid than the wild type (CECT 7954) in three different experimental settings: De Man-Rogosa-Sharpe broth without sodium acetate, resting cells, and skim milk. Genome sequencing revealed a single Phe-Ser substitution in the acetate kinase gene product that seems to be responsible for the strain's reduced acid production. Accordingly, acetate kinase specific activity was lower in the low acetate producer. Strain CECT 7953 produced less acetate, less ethanol, and more yoghourt-related volatile compounds in skim milk than the wild type did. Thus, CECT 7953 shows promising potential for the development of dairy products fermented exclusively by a bifidobacterial strain. PMID:22389372

  18. Genome‐wide gene expression changes in an industrial clavulanic acid overproduction strain of Streptomyces clavuligerus

    PubMed Central

    Medema, Marnix H.; Alam, Mohammad T.; Heijne, Wilbert H. M.; van den Berg, Marco A.; Müller, Ulrike; Trefzer, Axel; Bovenberg, Roel A. L.; Breitling, Rainer; Takano, Eriko

    2011-01-01

    Summary To increase production of the important pharmaceutical compound clavulanic acid, a β‐lactamase inhibitor, both random mutagenesis approaches and rational engineering of Streptomyces clavuligerus strains have been extensively applied. Here, for the first time, we compared genome‐wide gene expression of an industrial S. clavuligerus strain, obtained through iterative mutagenesis, with that of the wild‐type strain. Intriguingly, we found that the majority of the changes contributed not to a complex rewiring of primary metabolism but consisted of a simple upregulation of various antibiotic biosynthesis gene clusters. A few additional transcriptional changes in primary metabolism at key points seem to divert metabolic fluxes to the biosynthetic precursors for clavulanic acid. In general, the observed changes largely coincide with genes that have been targeted by rational engineering in recent years, yet the presence of a number of previously unexplored genes clearly demonstrates that functional genomic analysis can provide new leads for strain improvement in biotechnology. PMID:21342474

  19. Applications of Gene Replacement Technology to Streptomyces clavuligerus Strain Development for Clavulanic Acid Production

    PubMed Central

    Paradkar, A. S.; Mosher, R. H.; Anders, C.; Griffin, A.; Griffin, J.; Hughes, C.; Greaves, P.; Barton, B.; Jensen, S. E.

    2001-01-01

    Cephamycin C production was blocked in wild-type cultures of the clavulanic acid-producing organism Streptomyces clavuligerus by targeted disruption of the gene (lat) encoding lysine ɛ-aminotransferase. Specific production of clavulanic acid increased in the lat mutants derived from the wild-type strain by 2- to 2.5-fold. Similar beneficial effects on clavulanic acid production were noted in previous studies when gene disruption was used to block the production of the non-clavulanic acid clavams produced by S. clavuligerus. Therefore, mutations in lat and in cvm1, a gene involved in clavam production, were introduced into a high-titer industrial strain of S. clavuligerus to create a double mutant with defects in production of both cephamycin C and clavams. Production of both cephamycin C and non-clavulanic acid clavams was eliminated in the double mutant, and clavulanic acid titers increased about 10% relative to those of the parental strain. This represents the first report of the successful use of genetic engineering to eliminate undesirable metabolic pathways in an industrial strain used for the production of an antibiotic important in human medicine. PMID:11319114

  20. A COMPARATIVE ANALYSIS OF THREE CLASSES OF BACTERIAL NON-SPECIFIC ACID PHOSPHATASES AND ARCHAEAL PHOSPHOESTERASES: EVOLUTIONARY PERSPECTIVE

    PubMed Central

    U. Gandhi, Neha; B. Chandra, Sathees

    2012-01-01

    Introduction: Bacterial nonspecific acid phosphohydrolases (NSAPs) or phosphatases are group of enzymes secreted as soluble periplasmic proteins or retained as membrane bound lipoproteins that are usually able to dephosphorylate a broad array of structurally unrelated organic phosphoesters (nucleotides, sugar phosphates, phytic acid etc.) to acquire inorganic phosphate (Pi) and organic byproducts. They exhibit optimal catalytic activity at acidic to neutral pH values. On the basis of amino acid sequence relatedness, phosphatase are grouped into different molecular families namely Class A, Class B and Class C acid phosphatase respectively. Results and discussion: In this article out of thirty three sequences, twenty six belonging to each of the three classes of bacterial acid phosphatase and seven belonging to archaeal phosphoesterases were analyzed using various tools of bioinformatics. Phylogenetic analysis, dot plot comparisons and motif analysis were done to identify a number of similarities and differences between three classes of bacterial acid phosphatases and archaeal phosphoesterases. In this research we have attempted to decipher evolutionary relationship between three classes of bacterial acid phosphatase and archaeal phosphoesterases using bioinformatics approach. PMID:23322973

  1. Endospore abundance and D:L-amino acid modeling of bacterial turnover in holocene marine sediment (Aarhus Bay)

    NASA Astrophysics Data System (ADS)

    Langerhuus, Alice T.; Røy, Hans; Lever, Mark A.; Morono, Yuki; Inagaki, Fumio; Jørgensen, Bo B.; Lomstein, Bente Aa.

    2012-12-01

    In order to study bacterial activity, and turnover times of bacterial necromass and biomass in marine sediment, two stations from the Aarhus Bay, Denmark were analyzed. Sediment cores were up to 11 m deep and covered a timescale from the present to ˜11,000 years ago. Sediment was analyzed for total hydrolysable amino acids (THAA), total hydrolysable amino sugars, the bacterial endospore marker dipicolinic acid (DPA), and amino acid enantiomers (L- and D-form) of aspartic acid. Turnover times of bacterial necromass and vegetative cells, as well as carbon oxidation rates were estimated by use of the D:L-amino acid racemization model. Diagenetic indicators were applied to evaluate the diagenetic state of the sedimentary organic matter. The contribution of amino acids to total organic carbon, and the ratio between the amino acids aspartic acid and glutamic acid, and their respective non protein degradation products, β-alanine and γ-amino butyric acid, all indicated increasing degradation state of the organic matter with sediment depth and age. Quantification of DPA showed that endospores were abundant, and increased with depth relative to vegetative cells. Most of the amino acids (97%) could be ascribed to microbial necromass, i.e. the remains of dead bacterial cells. Model estimates showed that the turnover times of microbial necromass were in the range of 0.5-1 × 105 years, while turnover times of vegetative cells were in the range of tens to hundreds of years. The turnover time of the TOC pool increased with depth in the sediment, indicating that the TOC pool became progressively more refractory and unavailable to microorganisms with depth and age of the organic matter.

  2. Biodegradable water absorbent synthesized from bacterial poly(amino acid)s.

    PubMed

    Kunioka, Masao

    2004-03-15

    Biodegradable hydrogels prepared by gamma-irradiation from microbial poly(amino acid)s have been studied. pH-Sensitive hydrogels were prepared by the gamma-irradiation of poly(gamma-glutamic acid) (PGA) produced by Bacillus subtilis and poly(epsilon-lysine) (PL) produced by Streptomyces albulus in aqueous solutions. When the gamma-irradiation dose was 19 kGy or more, and the concentration of PGA in water was 2 wt.-% or more, transparent hydrogels could be produced. For the 19 kGy dose, the produced hydrogel was very weak, however, the specific water content (wt. of absorbed water/wt. of dry hydrogel) of this PGA hydrogel was approximately 3,500. The specific water content decreased to 200, increasing when the gamma-irradiation dose was over 100 kGy. Under acid conditions or upon the addition of electrolytes, the PGA hydrogels shrunk. The PGA hydrogel was pH-sensitive and the change in the volume of the hydrogel depended on the pH value outside the hydrogel in the swelling medium. This PGA hydrogel was hydrodegradable and biodegradable. A new novel purifier reagent (coagulant), made from the PGA hydrogels, for contaminated turbid water has been found and developed by Japanese companies. A very small amount of this coagulant (only 2 ppm in turbid water) with poly(aluminum chloride) can be used for the purification of turbid water. A PL aqueous solution also can change into a hydrogel by gamma-irradiation. The specific water content of the PL hydrogel ranged from 20 to 160 depending on the preparation conditions. Under acid conditions, the PL hydrogel swelled because of the ionic repulsion of the protonated amino groups in the PL molecules. The rate of enzymatic degradation of the respective PL hydrogels by a neutral protease was much faster than the rate of simple hydrolytic degradation. PMID:15468223

  3. Complete Genome Sequence of Flavobacterium psychrophilum Strain CSF259-93, Used To Select Rainbow Trout for Increased Genetic Resistance against Bacterial Cold Water Disease.

    PubMed

    Wiens, Gregory D; LaPatra, Scott E; Welch, Timothy J; Rexroad, Caird; Call, Douglas R; Cain, Kenneth D; LaFrentz, Benjamin R; Vaisvil, Benjamin; Schmitt, Daniel P; Kapatral, Vinayak

    2014-01-01

    The genome sequence of Flavobacterium psychrophilum strain CSF259-93, isolated from rainbow trout (Oncorhynchus mykiss), consists of a single circular genome of 2,900,735 bp and 2,701 predicted open reading frames (ORFs). Strain CSF259-93 has been used to select a line of rainbow trout with increased genetic resistance against bacterial cold water disease. PMID:25237017

  4. Complete Genome Sequence of Flavobacterium psychrophilum Strain CSF259-93, Used To Select Rainbow Trout for Increased Genetic Resistance against Bacterial Cold Water Disease

    PubMed Central

    LaPatra, Scott E.; Welch, Timothy J.; Rexroad, Caird; Call, Douglas R.; Cain, Kenneth D.; LaFrentz, Benjamin R.; Vaisvil, Benjamin; Schmitt, Daniel P.; Kapatral, Vinayak

    2014-01-01

    The genome sequence of Flavobacterium psychrophilum strain CSF259-93, isolated from rainbow trout (Oncorhynchus mykiss), consists of a single circular genome of 2,900,735 bp and 2,701 predicted open reading frames (ORFs). Strain CSF259-93 has been used to select a line of rainbow trout with increased genetic resistance against bacterial cold water disease. PMID:25237017

  5. D-Amino acids inhibit biofilm formation in Staphylococcus epidermidis strains from ocular infections.

    PubMed

    Ramón-Peréz, Miriam L; Diaz-Cedillo, Francisco; Ibarra, J Antonio; Torales-Cardeña, Azael; Rodríguez-Martínez, Sandra; Jan-Roblero, Janet; Cancino-Diaz, Mario E; Cancino-Diaz, Juan C

    2014-10-01

    Biofilm formation on medical and surgical devices is a major virulence determinant for Staphylococcus epidermidis. The bacterium S. epidermidis is able to produce biofilms on biotic and abiotic surfaces and is the cause of ocular infection (OI). Recent studies have shown that d-amino acids inhibit and disrupt biofilm formation in the prototype strains Bacillus subtilis NCBI3610 and Staphylococcus aureus SCO1. The effect of d-amino acids on S. epidermidis biofilm formation has yet to be tested for clinical or commensal isolates. S. epidermidis strains isolated from healthy skin (n = 3), conjunctiva (n = 9) and OI (n = 19) were treated with d-Leu, d-Tyr, d-Pro, d-Phe, d-Met or d-Ala and tested for biofilm formation. The presence of d-amino acids during biofilm formation resulted in a variety of patterns. Some strains were sensitive to all amino acids tested, while others were sensitive to one or more, and one strain was resistant to all of them when added individually; in this way d-Met inhibited most of the strains (26/31), followed by d-Phe (21/31). Additionally, the use of d-Met inhibited biofilm formation on a contact lens. The use of l-isomers caused no defect in biofilm formation in all strains tested. In contrast, when biofilms were already formed d-Met, d-Phe and d-Pro were able to disrupt it. In summary, here we demonstrated the inhibitory effect of d-amino acids on biofilm formation in S. epidermidis. Moreover, we showed, for the first time, that S. epidermidis clinical strains have a different sensitivity to these compounds during biofilm formation.

  6. Electrochemical gating of tricarboxylic acid cycle in electricity-producing bacterial cells of Shewanella.

    PubMed

    Matsuda, Shoichi; Liu, Huan; Kouzuma, Atsushi; Watanabe, Kazuya; Hashimoto, Kazuhito; Nakanishi, Shuji

    2013-01-01

    Energy-conversion systems mediated by bacterial metabolism have recently attracted much attention, and therefore, demands for tuning of bacterial metabolism are increasing. It is widely recognized that intracellular redox atmosphere which is generally tuned by dissolved oxygen concentration or by appropriate selection of an electron acceptor for respiration is one of the important factors determining the bacterial metabolism. In general, electrochemical approaches are valuable for regulation of redox-active objects. However, the intracellular redox conditions are extremely difficult to control electrochemically because of the presence of insulative phospholipid bilayer membranes. In the present work, the limitation can be overcome by use of the bacterial genus Shewanella, which consists of species that are able to respire via cytochromes abundantly expressed in their outer-membrane with solid-state electron acceptors, including anodes. The electrochemical characterization and the gene expression analysis revealed that the activity of tricarboxylic acid (TCA) cycle in Shewanella cells can be reversibly gated simply by changing the anode potential. Importantly, our present results for Shewanella cells cultured in an electrochemical system under poised potential conditions showed the opposite relationship between the current and electron acceptor energy level, and indicate that this unique behavior originates from deactivation of the TCA cycle in the (over-)oxidative region. Our result obtained in this study is the first demonstration of the electrochemical gating of TCA cycle of living cells. And we believe that our findings will contribute to a deeper understanding of redox-dependent regulation systems in living cells, in which the intracellular redox atmosphere is a critical factor determining the regulation of various metabolic and genetic processes.

  7. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities

    PubMed Central

    Huete-Stauffer, Tamara M.; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G.

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  8. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities.

    PubMed

    Huete-Stauffer, Tamara M; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures. PMID:27242747

  9. Experimental Warming Decreases the Average Size and Nucleic Acid Content of Marine Bacterial Communities.

    PubMed

    Huete-Stauffer, Tamara M; Arandia-Gorostidi, Nestor; Alonso-Sáez, Laura; Morán, Xosé Anxelu G

    2016-01-01

    Organism size reduction with increasing temperature has been suggested as a universal response to global warming. Since genome size is usually correlated to cell size, reduction of genome size in unicells could be a parallel outcome of warming at ecological and evolutionary time scales. In this study, the short-term response of cell size and nucleic acid content of coastal marine prokaryotic communities to temperature was studied over a full annual cycle at a NE Atlantic temperate site. We used flow cytometry and experimental warming incubations, spanning a 6°C range, to analyze the hypothesized reduction with temperature in the size of the widespread flow cytometric bacterial groups of high and low nucleic acid content (HNA and LNA bacteria, respectively). Our results showed decreases in size in response to experimental warming, which were more marked in 0.8 μm pre-filtered treatment rather than in the whole community treatment, thus excluding the role of protistan grazers in our findings. Interestingly, a significant effect of temperature on reducing the average nucleic acid content (NAC) of prokaryotic cells in the communities was also observed. Cell size and nucleic acid decrease with temperature were correlated, showing a common mean decrease of 0.4% per °C. The usually larger HNA bacteria consistently showed a greater reduction in cell and NAC compared with their LNA counterparts, especially during the spring phytoplankton bloom period associated to maximum bacterial growth rates in response to nutrient availability. Our results show that the already smallest planktonic microbes, yet with key roles in global biogeochemical cycling, are likely undergoing important structural shrinkage in response to rising temperatures.

  10. Enhanced biodegradation of alkane hydrocarbons and crude oil by mixed strains and bacterial community analysis.

    PubMed

    Chen, Yu; Li, Chen; Zhou, Zhengxi; Wen, Jianping; You, Xueyi; Mao, Youzhi; Lu, Chunzhe; Huo, Guangxin; Jia, Xiaoqiang

    2014-04-01

    In this study, two strains, Acinetobacter sp. XM-02 and Pseudomonas sp. XM-01, were isolated from soil samples polluted by crude oil at Bohai offshore. The former one could degrade alkane hydrocarbons (crude oil and diesel, 1:4 (v/v)) and crude oil efficiently; the latter one failed to grow on alkane hydrocarbons but could produce rhamnolipid (a biosurfactant) with glycerol as sole carbon source. Compared with pure culture, mixed culture of the two strains showed higher capability in degrading alkane hydrocarbons and crude oil of which degradation rate were increased from 89.35 and 74.32 ± 4.09 to 97.41 and 87.29 ± 2.41 %, respectively. In the mixed culture, Acinetobacter sp. XM-02 grew fast with sufficient carbon source and produced intermediates which were subsequently utilized for the growth of Pseudomonas sp. XM-01 and then, rhamnolipid was produced by Pseudomonas sp. XM-01. Till the end of the process, Acinetobacter sp. XM-02 was inhibited by the rapid growth of Pseudomonas sp. XM-01. In addition, alkane hydrocarbon degradation rate of the mixed culture increased by 8.06 to 97.41 % compared with 87.29 % of the pure culture. The surface tension of medium dropping from 73.2 × 10(-3) to 28.6 × 10(-3) N/m. Based on newly found cooperation between the degrader and the coworking strain, rational investigations and optimal strategies to alkane hydrocarbons biodegradation were utilized for enhancing crude oil biodegradation. PMID:24532465

  11. Enhanced biodegradation of alkane hydrocarbons and crude oil by mixed strains and bacterial community analysis.

    PubMed

    Chen, Yu; Li, Chen; Zhou, Zhengxi; Wen, Jianping; You, Xueyi; Mao, Youzhi; Lu, Chunzhe; Huo, Guangxin; Jia, Xiaoqiang

    2014-04-01

    In this study, two strains, Acinetobacter sp. XM-02 and Pseudomonas sp. XM-01, were isolated from soil samples polluted by crude oil at Bohai offshore. The former one could degrade alkane hydrocarbons (crude oil and diesel, 1:4 (v/v)) and crude oil efficiently; the latter one failed to grow on alkane hydrocarbons but could produce rhamnolipid (a biosurfactant) with glycerol as sole carbon source. Compared with pure culture, mixed culture of the two strains showed higher capability in degrading alkane hydrocarbons and crude oil of which degradation rate were increased from 89.35 and 74.32 ± 4.09 to 97.41 and 87.29 ± 2.41 %, respectively. In the mixed culture, Acinetobacter sp. XM-02 grew fast with sufficient carbon source and produced intermediates which were subsequently utilized for the growth of Pseudomonas sp. XM-01 and then, rhamnolipid was produced by Pseudomonas sp. XM-01. Till the end of the process, Acinetobacter sp. XM-02 was inhibited by the rapid growth of Pseudomonas sp. XM-01. In addition, alkane hydrocarbon degradation rate of the mixed culture increased by 8.06 to 97.41 % compared with 87.29 % of the pure culture. The surface tension of medium dropping from 73.2 × 10(-3) to 28.6 × 10(-3) N/m. Based on newly found cooperation between the degrader and the coworking strain, rational investigations and optimal strategies to alkane hydrocarbons biodegradation were utilized for enhancing crude oil biodegradation.

  12. Genome sequencing and systems biology analysis of a lipase-producing bacterial strain.

    PubMed

    Li, N; Li, D D; Zhang, Y Z; Yuan, Y Z; Geng, H; Xiong, L; Liu, D L

    2016-01-01

    Lipase-producing bacteria are naturally-occurring, industrially-relevant microorganisms that produce lipases, which can be used to synthesize biodiesel from waste oils. The efficiency of lipase expression varies between various microbial strains. Therefore, strains that can produce lipases with high efficiency must be screened, and the conditions of lipase metabolism and optimization of the production process in a given environment must be thoroughly studied. A high efficiency lipase-producing strain was isolated from the sediments of Jinsha River, identified by 16S rRNA sequence analysis as Serratia marcescens, and designated as HS-L5. A schematic diagram of the genome sequence was constructed by high-throughput genome sequencing. A series of genes related to lipid degradation were identified by functional gene annotation through sequence homology analysis. A genome-scale metabolic model of HS-ML5 was constructed using systems biology techniques. The model consisted of 1722 genes and 1567 metabolic reactions. The topological graph of the genome-scale metabolic model was compared to that of conventional metabolic pathways using a visualization software and KEGG database. The basic components and boundaries of the tributyrin degradation subnetwork were determined, and its flux balance analyzed using Matlab and COBRA Toolbox to simulate the effects of different conditions on the catalytic efficiency of lipases produced by HS-ML5. We proved that the catalytic activity of microbial lipases was closely related to the carbon metabolic pathway. As production and catalytic efficiency of lipases varied greatly with the environment, the catalytic efficiency and environmental adaptability of microbial lipases can be improved by proper control of the production conditions. PMID:27050954

  13. Different response to acetic acid stress in Saccharomyces cerevisiae wild-type and l-ascorbic acid-producing strains.

    PubMed

    Martani, Francesca; Fossati, Tiziana; Posteri, Riccardo; Signori, Lorenzo; Porro, Danilo; Branduardi, Paola

    2013-09-01

    Biotechnological processes are of increasing significance for industrial production of fine and bulk chemicals, including biofuels. Unfortunately, under operative conditions microorganisms meet multiple stresses, such as non-optimal pH, temperature, oxygenation and osmotic stress. Moreover, they have to face inhibitory compounds released during the pretreatment of lignocellulosic biomasses, which constitute the preferential substrate for second-generation processes. Inhibitors include furan derivatives, phenolic compounds and weak organic acids, among which acetic acid is one of the most abundant and detrimental for cells. They impair cellular metabolism and growth, reducing the productivity of the process: therefore, the development of robust cell factories with improved production rates and resistance is of crucial importance. Here we show that a yeast strain engineered to endogenously produce vitamin C exhibits an increased tolerance compared to the parental strain when exposed to acetic acid at moderately toxic concentrations, measured as viability on plates. Starting from this evidence, we investigated more deeply: (a) the nature and levels of reactive oxygen species (ROS); (b) the activation of enzymes that act directly as detoxifiers of reactive oxygen species, such as superoxide dismutase (SOD) and catalase, in parental and engineered strains during acetic acid stress. The data indicate that the engineered strain can better recover from stress by limiting ROS accumulation, independently from SOD activation. The engineered yeast can be proposed as a model for further investigating direct and indirect mechanism(s) by which an antioxidant can rescue cells from organic acid damage; moreover, these studies will possibly provide additional targets for further strain improvements.

  14. Different response to acetic acid stress in Saccharomyces cerevisiae wild-type and l-ascorbic acid-producing strains.

    PubMed

    Martani, Francesca; Fossati, Tiziana; Posteri, Riccardo; Signori, Lorenzo; Porro, Danilo; Branduardi, Paola

    2013-09-01

    Biotechnological processes are of increasing significance for industrial production of fine and bulk chemicals, including biofuels. Unfortunately, under operative conditions microorganisms meet multiple stresses, such as non-optimal pH, temperature, oxygenation and osmotic stress. Moreover, they have to face inhibitory compounds released during the pretreatment of lignocellulosic biomasses, which constitute the preferential substrate for second-generation processes. Inhibitors include furan derivatives, phenolic compounds and weak organic acids, among which acetic acid is one of the most abundant and detrimental for cells. They impair cellular metabolism and growth, reducing the productivity of the process: therefore, the development of robust cell factories with improved production rates and resistance is of crucial importance. Here we show that a yeast strain engineered to endogenously produce vitamin C exhibits an increased tolerance compared to the parental strain when exposed to acetic acid at moderately toxic concentrations, measured as viability on plates. Starting from this evidence, we investigated more deeply: (a) the nature and levels of reactive oxygen species (ROS); (b) the activation of enzymes that act directly as detoxifiers of reactive oxygen species, such as superoxide dismutase (SOD) and catalase, in parental and engineered strains during acetic acid stress. The data indicate that the engineered strain can better recover from stress by limiting ROS accumulation, independently from SOD activation. The engineered yeast can be proposed as a model for further investigating direct and indirect mechanism(s) by which an antioxidant can rescue cells from organic acid damage; moreover, these studies will possibly provide additional targets for further strain improvements. PMID:23847041

  15. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

    PubMed Central

    Alonzo, Francis

    2016-01-01

    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

  16. Algal and Bacterial Activities in Acidic (pH 3) Strip Mine Lakes

    PubMed Central

    Gyure, Ruth A.; Konopka, Allan; Brooks, Austin; Doemel, William

    1987-01-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H2S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H2S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by [14C]glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake. PMID:16347430

  17. Archaeal and bacterial diversity in acidic to circumneutral hot springs in the Philippines.

    PubMed

    Huang, Qiuyuan; Jiang, Hongchen; Briggs, Brandon R; Wang, Shang; Hou, Weiguo; Li, Gaoyuan; Wu, Geng; Solis, Ramonito; Arcilla, Carlo A; Abrajano, Teofilo; Dong, Hailiang

    2013-09-01

    The microbial diversity was investigated in sediments of six acidic to circumneutral hot springs (Temperature: 60-92 °C, pH 3.72-6.58) in the Philippines using an integrated approach that included geochemistry and 16S rRNA gene pyrosequencing. Both bacterial and archaeal abundances were lower in high-temperature springs than in moderate-temperature ones. Overall, the archaeal community consisted of sequence reads that exhibited a high similarity (nucleotide identity > 92%) to phyla Crenarchaeota, Euryarchaeota, and unclassified Archaea. The bacterial community was composed of sequence reads moderately related (nucleotide identity > 90%) to 17 phyla, with Aquificae and Firmicutes being dominant. These phylogenetic groups were correlated with environmental conditions such as temperature, dissolved sulfate and calcium concentrations in spring water, and sediment properties including total nitrogen, pyrite, and elemental sulfur. Based on the phylogenetic inference, sulfur metabolisms appear to be key physiological functions in these hot springs. Sulfobacillus (within phylum Firmicutes) along with members within Sulfolobales were abundant in two high-temperature springs (> 76 °C), and they were hypothesized to play an important role in regulating the sulfur cycling under high-temperature conditions. The results of this study improve our understanding of microbial diversity and community composition in acidic to circumneutral terrestrial hot springs and their relationships with geochemical conditions.

  18. Algal and bacterial activities in acidic (pH 3) strip mine lakes

    SciTech Connect

    Gyure, R.A.; Konopka, A.; Brooks, A.; Doemel, W.

    1987-09-01

    Reservoir 29 and Lake B are extremely acid lakes (epilimnion pHs of 2.7 and 3.2, respectively), because they receive acidic discharges from coal refuse piles. They differ in that the pH of profundal sediments in Reservoir 29 increased from 2.7 to 3.8 during the period of thermal stratification, whereas permanently anoxic sediments in Lake B had a pH of 6.2. The pH rise in Reservoir 29 sediments was correlated with a temporal increase in H/sub 2/S concentration in the anaerobic hypolimnion from 0 to >1 mM. The chlorophyll a levels in the epilimnion of Reservoir 29 were low, and the rate of primary production was typical of an oligotrophic system. However, there was a dense 10-cm layer of algal biomass at the bottom of the metalimnion. Production by this layer was low owing to light limitation and possibly H/sub 2/S toxicity. The specific photosynthetic rates of epilimnetic algae were low, which suggests that nutrient availability is more important than pH in limiting production. The highest photosynthetic rates were obtained in water samples incubated at pH 2.7 to 4. Heterotrophic bacterial activity (measured by (/sup 14/C)glucose metabolism) was greatest at the sediment/water interface. Bacterial production (assayed by thymidine incorporation) was as high in Reservoir 29 as in a nonacid mesotrophic Indiana lake.

  19. Probing determinants of cyclopiazonic acid sensitivity of bacterial Ca2+-ATPases.

    PubMed

    Kotšubei, Aljona; Gorgel, Manuela; Morth, Jens P; Nissen, Poul; Andersen, Jacob L

    2013-11-01

    Cyclopiazonic acid (CPA) is a specific and potent inhibitor of the sarcoplasmic reticulum Ca(2+)-ATPase 1a (SERCA1a). Despite high sequence similarity to SERCA1a, Listeria monocytogenes Ca(2+)-ATPase 1 (LMCA1) is not inhibited by CPA. To test whether a CPA binding site could be created while maintaining the functionality of the ATPase we targeted four amino acid positions in LMCA1 for mutational studies based on a multiple sequence alignment of SERCA-like Ca(2+)-ATPases and structural analysis of the CPA site. The identification of CPA-sensitive gain-of-function mutants pinpointed key determinants of the CPA binding site. The importance of these determinants was further underscored by the characterization of the CPA sensitivity of two additional bacterial Ca(2+)-ATPases from Lactococcus lactis and Bacillus cereus. The CPA sensitivity was predicted from their sequence compared with the LMCA1 results, and this was experimentally confirmed. Interestingly, a cluster of Lactococcus bacteria applied in the production of fermented cheese display Ca(2+)-ATPases that are predictably CPA insensitive and may originate from their coexistence with CPA-producing Penicillum and Aspergillus fungi in the cheese. The differences between bacterial and mammalian binding pockets encompassing the CPA site suggest that CPA derivatives that are specific for bacteria or other pathogens can be developed. PMID:23621633

  20. Bioconversion of Styrene to Poly(hydroxyalkanoate) (PHA) by the New Bacterial Strain Pseudomonas putida NBUS12

    PubMed Central

    Tan, Giin-Yu Amy; Chen, Chia-Lung; Ge, Liya; Li, Ling; Tan, Swee Ngin; Wang, Jing-Yuan

    2015-01-01

    Styrene is a toxic pollutant commonly found in waste effluents from plastic processing industries. We herein identified and characterized microorganisms for bioconversion of the organic eco-pollutant styrene into a valuable biopolymer medium-chain-length poly(hydroxyalkanoate) (mcl-PHA). Twelve newly-isolated styrene-degrading Pseudomonads were obtained and partial phaC genes were detected by PCR in these isolates. These isolates assimilated styrene to produce mcl-PHA, forming PHA contents between 0.05±0.00 and 23.10±3.25% cell dry mass (% CDM). The best-performing isolate was identified as Pseudomonas putida NBUS12. A genetic analysis of 16S rDNA and phaZ genes revealed P. putida NBUS12 as a genetically-distinct strain from existing phenotypically-similar bacterial strains. This bacterium achieved a final biomass of 1.28±0.10 g L−1 and PHA content of 32.49±2.40% CDM. The extracted polymer was mainly comprised of 3-hydroxyhexanoate (C6 ), 3-hydroxyoctanoate (C8 ), 3-hydroxydecanoate (C10 ), 3-hydroxydodecanoate (C12 ), and 3-hydroxytetradecanoate (C14 ) monomers at a ratio of 2:42:1257:17:1. These results collectively suggested that P. putida NBUS12 is a promising candidate for the biotechnological conversion of styrene into mcl-PHA. PMID:25740622

  1. Assessment of Heat Resistance of Bacterial Spores from Food Product Isolates by Fluorescence Monitoring of Dipicolinic Acid Release

    PubMed Central

    Kort, Remco; O'Brien, Andrea C.; van Stokkum, Ivo H. M.; Oomes, Suus J. C. M.; Crielaard, Wim; Hellingwerf, Klaas J.; Brul, Stanley

    2005-01-01

    This study is aimed at the development and application of a convenient and rapid optical assay to monitor the wet-heat resistance of bacterial endospores occurring in food samples. We tested the feasibility of measuring the release of the abundant spore component dipicolinic acid (DPA) as a probe for heat inactivation. Spores were isolated from the laboratory type strain Bacillus subtilis 168 and from two food product isolates, Bacillus subtilis A163 and Bacillus sporothermodurans IC4. Spores from the lab strain appeared much less heat resistant than those from the two food product isolates. The decimal reduction times (D values) for spores from strains 168, A163, and IC4 recovered on Trypticase soy agar were 1.4, 0.7, and 0.3 min at 105°C, 120°C, and 131°C, respectively. The estimated Z values were 6.3°C, 6.1°C, and 9.7°C, respectively. The extent of DPA release from the three spore crops was monitored as a function of incubation time and temperature. DPA concentrations were determined by measuring the emission at 545 nm of the fluorescent terbium-DPA complex in a microtiter plate fluorometer. We defined spore heat resistance as the critical DPA release temperature (Tc), the temperature at which half the DPA content has been released within a fixed incubation time. We found Tc values for spores from Bacillus strains 168, A163, and IC4 of 108°C, 121°C, and 131°C, respectively. On the basis of these observations, we developed a quantitative model that describes the time and temperature dependence of the experimentally determined extent of DPA release and spore inactivation. The model predicts a DPA release rate profile for each inactivated spore. In addition, it uncovers remarkable differences in the values for the temperature dependence parameters for the rate of spore inactivation, DPA release duration, and DPA release delay. PMID:16000762

  2. Biodegradation of haloacetic acids by bacterial isolates and enrichment cultures from drinking water systems.

    PubMed

    Zhang, Ping; Lapara, Timothy M; Goslan, Emma H; Xie, Yuefeng; Parsons, Simon A; Hozalski, Raymond M

    2009-05-01

    Biodegradation is a potentially important loss process for haloacetic acids (HAAs), a class of chlorination byproducts, in water treatment and distribution systems, but little is known about the organisms involved (i.e., identity, substrate range, biodegradation kinetics). In this research, 10 biomass samples (i.e., tap water, distribution system biofilms, and prechlorinated granular activated carbon filters) from nine drinking water systems were used to inoculate a total of thirty enrichment cultures fed monochloroacetic acid (MCAA), dichloroacetic acid (DCAA), or trichloroacetic (TCAA) as sole carbon and energy source. HAA degraders were successfully enriched from the biofilm samples (GAC and distribution system) but rarely from tap water. Half of the MCAA and DCAA enrichment cultures were positive, whereas only one TCAA culture was positive (two were inconclusive). Eight unique HAA-degrading isolates were obtained including several Afipia spp. and a Methylobacterium sp.; all isolates were members of the phylum Proteobacteria. MCAA, monobromoacetic acid (MBAA), and monoiodoacetic acid (MIAA) were rapidly degraded by all isolates, and DCAA and tribromoacetic (TBAA) were also relatively labile. TCAA and dibromoacetic acid (DBAA)were degraded by only three isolates and degradation lagged behind the other HAAs. Detailed DCAA biodegradation kinetics were obtained for two selected isolates and two enrichment cultures. The maximum biomass-normalized degradation rates (Vm) were 0.27 and 0.97 microg DCAA/ microg protein/h for Methylobacterium fujisawaense strain PAWDI and Afipia felis strain EMD2, respectively, which were comparable to the values obtained for the enrichment cultures from which those organisms were isolated (0.39 and 1.37 microg DCAN/microg protein/h, respectively). The half-saturation constant (Km) values ranged from 4.38 to 77.91 microg DCAA/L and the cell yields ranged from 14.4 to 36.1 mg protein/g DCAA.

  3. Growth kinetics of a diesel-degrading bacterial strain from petroleum-contaminated soil.

    PubMed

    Dahalan, S F A; Yunus, I; Johari, W L W; Shukor, M Y; Halmi, M I E; Shamaan, N A; Syed, M A

    2014-03-01

    A diesel-degrading bacterium was isolated from a diesel-contaminated site in Selangor, Malaysia. The isolate was tentatively identified as Acinetobacter sp. strain DRY12 based on partial 16S rDNA molecular phylogeny and Biolog GN microplate panels and Microlog database. Optimum growth occurred from 3 to 5% diesel and the strain was able to tolerate as high as 8% diesel. The optimal pH that supported growth of the bacterium was between pH 7.5 to 8.0. The isolate exhibited optimal growth in between 30 and 35 degrees C. The best nitrogen source was potassium nitrate (between 0.6 and 0.9% (w/v)) followed by ammonium chloride, sodium nitrite and ammonium sulphate in descending order. An almost complete removal of diesel components was seen from the reduction in hydrocarbon peaks observed using Solid Phase Microextraction Gas Chromatography analysis after 10 days of incubation. The best growth kinetic model to fit experimental data was the Haldane model of substrate inhibiting growth with a correlation coefficient value of 0.97. The maximum growth rate- micromax was 0.039 hr(-1) while the saturation constant or half velocity constant Ks and inhibition constant Ki, were 0.387% and 4.46%, respectively. MATH assays showed that 75% of the bacterium was found in the hexadecane phase indicating that the bacterium was hydrophobic. The characteristics of this bacterium make it useful for bioremediation works in the Tropics.

  4. Growth kinetics of a diesel-degrading bacterial strain from petroleum-contaminated soil.

    PubMed

    Dahalan, S F A; Yunus, I; Johari, W L W; Shukor, M Y; Halmi, M I E; Shamaan, N A; Syed, M A

    2014-03-01

    A diesel-degrading bacterium was isolated from a diesel-contaminated site in Selangor, Malaysia. The isolate was tentatively identified as Acinetobacter sp. strain DRY12 based on partial 16S rDNA molecular phylogeny and Biolog GN microplate panels and Microlog database. Optimum growth occurred from 3 to 5% diesel and the strain was able to tolerate as high as 8% diesel. The optimal pH that supported growth of the bacterium was between pH 7.5 to 8.0. The isolate exhibited optimal growth in between 30 and 35 degrees C. The best nitrogen source was potassium nitrate (between 0.6 and 0.9% (w/v)) followed by ammonium chloride, sodium nitrite and ammonium sulphate in descending order. An almost complete removal of diesel components was seen from the reduction in hydrocarbon peaks observed using Solid Phase Microextraction Gas Chromatography analysis after 10 days of incubation. The best growth kinetic model to fit experimental data was the Haldane model of substrate inhibiting growth with a correlation coefficient value of 0.97. The maximum growth rate- micromax was 0.039 hr(-1) while the saturation constant or half velocity constant Ks and inhibition constant Ki, were 0.387% and 4.46%, respectively. MATH assays showed that 75% of the bacterium was found in the hexadecane phase indicating that the bacterium was hydrophobic. The characteristics of this bacterium make it useful for bioremediation works in the Tropics. PMID:24665769

  5. Acetic Acid Acts as a Volatile Signal To Stimulate Bacterial Biofilm Formation

    PubMed Central

    Chen, Yun; Gozzi, Kevin; Yan, Fang

    2015-01-01

    ABSTRACT Volatiles are small air-transmittable chemicals with diverse biological activities. In this study, we showed that volatiles produced by the bacterium Bacillus subtilis had a profound effect on biofilm formation of neighboring B. subtilis cells that grew in proximity but were physically separated. We further demonstrated that one such volatile, acetic acid, is particularly potent in stimulating biofilm formation. Multiple lines of genetic evidence based on B. subtilis mutants that are defective in either acetic acid production or transportation suggest that B. subtilis uses acetic acid as a metabolic signal to coordinate the timing of biofilm formation. Lastly, we investigated how B. subtilis cells sense and respond to acetic acid in regulating biofilm formation. We showed the possible involvement of three sets of genes (ywbHG, ysbAB, and yxaKC), all encoding putative holin-antiholin-like proteins, in cells responding to acetic acid and stimulating biofilm formation. All three sets of genes were induced by acetate. A mutant with a triple mutation of those genes showed a severe delay in biofilm formation, whereas a strain overexpressing ywbHG showed early and robust biofilm formation. Results of our studies suggest that B. subtilis and possibly other bacteria use acetic acid as a metabolic signal to regulate biofilm formation as well as a quorum-sensing-like airborne signal to coordinate the timing of biofilm formation by physically separated cells in the community. PMID:26060272

  6. Lactic Acid Production from Pretreated Hydrolysates of Corn Stover by a Newly Developed Bacillus coagulans Strain.

    PubMed

    Jiang, Ting; Qiao, Hui; Zheng, Zhaojuan; Chu, Qiulu; Li, Xin; Yong, Qiang; Ouyang, Jia

    2016-01-01

    An inhibitor-tolerance strain, Bacillus coagulans GKN316, was developed through atmospheric and room temperature plasma (ARTP) mutation and evolution experiment in condensed dilute-acid hydrolysate (CDH) of corn stover. The fermentabilities of other hydrolysates with B. coagulans GKN316 and the parental strain B. coagulans NL01 were assessed. When using condensed acid-catalyzed steam-exploded hydrolysate (CASEH), condensed acid-catalyzed liquid hot water hydrolysate (CALH) and condensed acid-catalyzed sulfite hydrolysate (CASH) as substrates, the concentration of lactic acid reached 45.39, 16.83, and 18.71 g/L by B. coagulans GKN316, respectively. But for B. coagulans NL01, only CASEH could be directly fermented to produce 15.47 g/L lactic acid. The individual inhibitory effect of furfural, 5-hydroxymethylfurfural (HMF), vanillin, syringaldehyde and p-hydroxybenzaldehyde (pHBal) on xylose utilization by B. coagulans GKN316 was also studied. The strain B. coagulans GKN316 could effectively convert these toxic inhibitors to the less toxic corresponding alcohols in situ. These results suggested that B. coagulans GKN316 was well suited to production of lactic acid from undetoxified lignocellulosic hydrolysates. PMID:26863012

  7. Pseudomonas mutant strains that accumulate androstane and seco-androstane intermediates from bile acids.

    PubMed Central

    Leppik, R A; Sinden, D J

    1987-01-01

    Transposon mutant strains which were affected in bile acid catabolism were isolated from four Pseudomonas spp. Two of the mutant groups isolated were found to accumulate 12 alpha-hydroxyandrosta-1,4-diene-3,17-dione as the major product from deoxycholic acid. Strains in one of these two groups were able to grow on steroids such as chenodeoxycholic acid, which lacks a 12 alpha-hydroxy function, whereas the one member of the second group could not. With chenodeoxycholic acid, this latter strain accumulated a yellow muconic-like derivative, tentatively identified as 3,7-dihydroxy-5,9,17-trioxo-4(5),9(10)-disecoandrosta-1(10)2 -dien-4-oic acid. Members of two further mutant groups accumulated either 12 beta-hydroxyandrosta-1,4-diene-3,17-dione or 3,12 beta-dihydroxy-9(10)-secoandrosta-1,3,5(10)-triene-9,17-dione as the major product from deoxycholic acid. The relationship between the catabolism of m- and p-cresol, 3-ethylphenol and the bile acids was also examined. PMID:3038076

  8. Lactic Acid Production from Pretreated Hydrolysates of Corn Stover by a Newly Developed Bacillus coagulans Strain

    PubMed Central

    Jiang, Ting; Qiao, Hui; Zheng, Zhaojuan; Chu, Qiulu; Li, Xin; Yong, Qiang; Ouyang, Jia

    2016-01-01

    An inhibitor-tolerance strain, Bacillus coagulans GKN316, was developed through atmospheric and room temperature plasma (ARTP) mutation and evolution experiment in condensed dilute-acid hydrolysate (CDH) of corn stover. The fermentabilities of other hydrolysates with B. coagulans GKN316 and the parental strain B. coagulans NL01 were assessed. When using condensed acid-catalyzed steam-exploded hydrolysate (CASEH), condensed acid-catalyzed liquid hot water hydrolysate (CALH) and condensed acid-catalyzed sulfite hydrolysate (CASH) as substrates, the concentration of lactic acid reached 45.39, 16.83, and 18.71 g/L by B. coagulans GKN316, respectively. But for B. coagulans NL01, only CASEH could be directly fermented to produce 15.47 g/L lactic acid. The individual inhibitory effect of furfural, 5-hydroxymethylfurfural (HMF), vanillin, syringaldehyde and p-hydroxybenzaldehyde (pHBal) on xylose utilization by B. coagulans GKN316 was also studied. The strain B. coagulans GKN316 could effectively convert these toxic inhibitors to the less toxic corresponding alcohols in situ. These results suggested that B. coagulans GKN316 was well suited to production of lactic acid from undetoxified lignocellulosic hydrolysates. PMID:26863012

  9. Occurrence of trans monounsaturated and polyunsaturated fatty acids in Colwellia psychrerythraea strain 34H.

    PubMed

    Hashimoto, Mikako; Orikasa, Yoshitake; Hayashi, Hidenori; Watanabe, Kentaro; Yoshida, Kiyohito; Okuyama, Hidetoshi

    2015-07-01

    Colwellia psychrerythraea strain 34H is an obligately psychrophilic bacterium that has been used as a model cold-adapted microorganism because of its psychrophilic growth profile, significant production of cold-active enzymes, and cryoprotectant extracellular polysaccharide substances. However, its fatty acid components, particularly trans unsaturated fatty acids and long-chain polyunsaturated fatty acids (LC-PUFAs), have not been fully investigated. In this study, we biochemically identified Δ9-trans hexadecenoic acid [16:1(9t)] and LC-PUFAs such as docosahexaenoic acid. These results are comparable with the fact that the strain 34H genome sequence includes pfa and cti genes that are responsible for the biosynthesis of LC-PUFAs and trans unsaturated fatty acids, respectively. Strain 34H cells grown under static conditions at 5 °C had higher levels of 16:1(9t) than those grown under shaken conditions, and this change was accompanied by an antiparallel decrease in the levels of Δ9-cis hexadecenoic acid [16:1(9c)], suggesting that the cis-to-trans isomerization reaction of 16:1(9c) is activated under static (microanaerobic) culture conditions, that is, the enzyme could be activated by the decreased dissolved oxygen concentration of cultures. On the other hand, the levels of LC-PUFAs were too low (less than 3% of the total), even for cells grown at 5 °C, to evaluate their cold-adaptive function in this bacterium.

  10. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120.

    PubMed

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-04-23

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion.

  11. Growth inhibition of Cronobacter spp. strains in reconstituted powdered infant formula acidified with organic acids supported by natural stomach acidity.

    PubMed

    Zhu, S; Schnell, S; Fischer, M

    2013-09-01

    Cronobacter is associated with outbreaks of rare, but life-threatening cases of meningitis, necrotizing enterocolitis, and sepsis in newborns. This study was conducted to determine the effect of organic acids on growth of Cronobacter in laboratory medium and reconstituted powdered infant formula (PIF) as well as the bacteriostatic effect of slightly acidified infant formula when combined with neonatal gastric acidity. Inhibitory effect of seven organic acids on four acid sensitive Cronobacter strains was determined in laboratory medium with broth dilution method at pH 5.0, 5.5 and 6.0. Acetic, butyric and propionic acids were most inhibitive against Cronobacter in the laboratory medium. The killing effect of these three acids was partially buffered in reconstituted PIF. Under neonatal gastric acid condition of pH 5.0, the slightly acidified formula which did not exert inhibition effect solely reduced significantly the Cronobacter populations. A synergistic effect of formula moderately acidified with organic acid combined with the physiological infant gastric acid was visible in preventing the rapid growth of Cronobacter in neonatal stomach. The study contributed to a better understanding of the inhibitory effect of organic acids on Cronobacter growth in different matrixes and provided new ideas in terms of controlling bacteria colonization and translocation by acidified formula.

  12. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120

    PubMed Central

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-01-01

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion. PMID:25915115

  13. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120.

    PubMed

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-01-01

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion. PMID:25915115

  14. Divalent cations enhance fluoride binding to Streptococcus mutans and Streptococcus sanguinis cells and subsequently inhibit bacterial acid production.

    PubMed

    Domon-Tawaraya, H; Nakajo, K; Washio, J; Ashizawa, T; Ichino, T; Sugawara, H; Fukumoto, S; Takahashi, N

    2013-01-01

    One preventive effect of topical fluoride application is derived from the fact that fluoride can inhibit bacterial acid production. Furthermore, divalent cations such as Ca(2+) and Mg(2+) increase the binding of fluoride to bacterial cells. These findings suggest that exposure of oral bacteria to fluoride in the presence of divalent cations increases fluoride binding to bacterial cells and subsequently enhances fluoride-induced inhibition of bacterial acid production. This study investigated the effects of fluoride exposure (0-20,000 ppm F) in the presence of Ca(2+) or Mg(2+) prior to glucose challenge on pH fall ability by bacterial sugar fermentation, as well as fluoride binding to bacterial cells by exposure to fluoride, and fluoride release from bacterial cells during bacterial sugar fermentation, using caries-related bacteria, Streptococcus mutans and Streptococcus sanguinis. The pH fall by both streptococci was inhibited by exposure to over 250 ppm F in the presence of Ca(2+) (p < 0.01), whereas in the presence of Mg(2+), the pH fall by S. mutans and S. sanguinis was inhibited after exposure to over 250 and 950 ppm F, respectively (p < 0.05). The amounts of fluoride binding to and released from streptococcal cells increased with the concentration of fluoride the cells were exposed to in the presence of Mg(2+), but were high enough even after 250 ppm F exposure in the presence of Ca(2+). The enhanced inhibition of acid production in the presence of divalent cations is probably due to the improved efficiency of fluoride binding to bacterial cells being improved via these divalent cations.

  15. Discovery of Bacterial Fatty Acid Synthase Type II Inhibitors Using a Novel Cellular Bioluminescent Reporter Assay

    PubMed Central

    Wallace, Joselynn; Bowlin, Nicholas O.; Mills, Debra M.; Saenkham, Panatda; Kwasny, Steven M.; Opperman, Timothy J.; Williams, John D.; Rock, Charles O.; Bowlin, Terry L.

    2015-01-01

    Novel, cellular, gain-of-signal, bioluminescent reporter assays for fatty acid synthesis type II (FASII) inhibitors were constructed in an efflux-deficient strain of Pseudomonas aeruginosa and based on the discovery that FASII genes in P. aeruginosa are coordinately upregulated in response to pathway disruption. A screen of 115,000 compounds identified a series of sulfonamidobenzamide (SABA) analogs, which generated strong luminescent signals in two FASII reporter strains but not in four control reporter strains designed to respond to inhibitors of pathways other than FASII. The SABA analogs selectively inhibited lipid biosynthesis in P. aeruginosa and exhibited minimal cytotoxicity to mammalian cells (50% cytotoxic concentration [CC50] ≥ 80 μM). The most potent SABA analogs had MICs of 0.5 to 7.0 μM (0.2 to 3.0 μg/ml) against an efflux-deficient Escherichia coli (ΔtolC) strain but had no detectable MIC against efflux-proficient E. coli or against P. aeruginosa (efflux deficient or proficient). Genetic, molecular genetic, and biochemical studies revealed that SABA analogs target the enzyme (AccC) catalyzing the biotin carboxylase half-reaction of the acetyl coenzyme A (acetyl-CoA) carboxylase step in the initiation phase of FASII in E. coli and P. aeruginosa. These results validate the capability and the sensitivity of this novel bioluminescent reporter screen to identify inhibitors of E. coli and P. aeruginosa FASII. PMID:26169404

  16. Clostridium strain which produces acetic acid from waste gases

    DOEpatents

    Gaddy, J.L.

    1997-01-14

    A method and apparatus are disclosed for converting waste gases from industrial processes such as oil refining, carbon black, coke, ammonia, and methanol production, into useful products. The method includes introducing the waste gases into a bioreactor where they are fermented to various organic acids or alcohols by anaerobic bacteria within the bioreactor. These valuable end products are then recovered, separated and purified. In an exemplary recovery process, the bioreactor raffinate is passed through an extraction chamber into which one or more non-inhibitory solvents are simultaneously introduced to extract the product. Then, the product is separated from the solvent by distillation. Gas conversion rates can be maximized by use of centrifuges, hollow fiber membranes, or other means of ultrafiltration to return entrained anaerobic bacteria from the bioreactor raffinate to the bioreactor itself, thus insuring the highest possible cell concentration. 4 figs.

  17. Utilization of corncob acid hydrolysate for bacterial cellulose production by Gluconacetobacter xylinus.

    PubMed

    Huang, Chao; Yang, Xiao-Yan; Xiong, Lian; Guo, Hai-Jun; Luo, Jun; Wang, Bo; Zhang, Hai-Rong; Lin, Xiao-Qing; Chen, Xin-De

    2015-02-01

    In this study, corncob acid hydrolysate was used as a substrate for bacterial cellulose (BC) production by Gluconacetobacter xylinus. After 2 weeks' static fermentation, a BC yield of 4 g/L could be obtained. Both effects of medium composition and fermentation condition on the BC production were evaluated. Most extra substrates (carbon and nitrogen sources) except mannitol, butyric acid, and levulinic acid showed no effect on the improvement of BC yield. Fermentation condition including fermentation mode, inoculation concentration, and initial pH showed certain influence on the BC yield and thus should be well controlled. The analysis by field emission scanning electron microscope (FE-SEM), Fourier transform infrared spectroscopy (FTIR), and X-ray diffraction (XRD) showed that the BC sample had obvious nano-network structure, clear functional groups that were found in cellulose, and relatively high crystallinity and crystallinity index value. Moreover, the BC sample had great water-holding capacity. Overall, corncob acid hydrolysate could be one promising substrate for BC production. PMID:25422061

  18. Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.

    PubMed

    Kaul, Tiffany K; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V; Kapahi, Pankaj; Gill, Matthew S

    2014-01-01

    The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit. PMID:24475206

  19. Linkage between the bacterial acid stress and stringent responses: the structure of the inducible lysine decarboxylase.

    PubMed

    Kanjee, Usheer; Gutsche, Irina; Alexopoulos, Eftichia; Zhao, Boyu; El Bakkouri, Majida; Thibault, Guillaume; Liu, Kaiyin; Ramachandran, Shaliny; Snider, Jamie; Pai, Emil F; Houry, Walid A

    2011-03-01

    The Escherichia coli inducible lysine decarboxylase, LdcI/CadA, together with the inner-membrane lysine-cadaverine antiporter, CadB, provide cells with protection against mild acidic conditions (pH∼5). To gain a better understanding of the molecular processes underlying the acid stress response, the X-ray crystal structure of LdcI was determined. The structure revealed that the protein is an oligomer of five dimers that associate to form a decamer. Surprisingly, LdcI was found to co-crystallize with the stringent response effector molecule ppGpp, also known as the alarmone, with 10 ppGpp molecules in the decamer. ppGpp is known to mediate the stringent response, which occurs in response to nutrient deprivation. The alarmone strongly inhibited LdcI enzymatic activity. This inhibition is important for modulating the consumption of lysine in cells during acid stress under nutrient limiting conditions. Hence, our data provide direct evidence for a link between the bacterial acid stress and stringent responses. PMID:21278708

  20. Utilization of corncob acid hydrolysate for bacterial cellulose production by Gluconacetobacter xylinus.

    PubMed

    Huang, Chao; Yang, Xiao-Yan; Xiong, Lian; Guo, Hai-Jun; Luo, Jun; Wang, Bo; Zhang, Hai-Rong; Lin, Xiao-Qing; Chen, Xin-De

    2015-02-01

    In this study, corncob acid hydrolysate was used as a substrate for bacterial cellulose (BC) production by Gluconacetobacter xylinus. After 2 weeks' static fermentation, a BC yield of 4 g/L could be obtained. Both effects of medium composition and fermentation condition on the BC production were evaluated. Most extra substrates (carbon and nitrogen sources) except mannitol, butyric acid, and levulinic acid showed no effect on the improvement of BC yield. Fermentation condition including fermentation mode, inoculation concentration, and initial pH showed certain influence on the BC yield and thus should be well controlled. The analysis by field emission scanning electron microscope (FE-SEM), Fourier transform infrared spectroscopy (FTIR), and X-ray diffraction (XRD) showed that the BC sample had obvious nano-network structure, clear functional groups that were found in cellulose, and relatively high crystallinity and crystallinity index value. Moreover, the BC sample had great water-holding capacity. Overall, corncob acid hydrolysate could be one promising substrate for BC production.

  1. Draft Genome Sequence of Paracoccus sp. MKU1, a New Bacterial Strain Isolated from an Industrial Effluent with Potential for Bioremediation.

    PubMed

    Nisha, Kamaldeen Nasrin; Sridhar, Jayavel; Varalakshmi, Perumal; Ashokkumar, Balasubramaniem

    2016-01-01

    Paracoccus sp. MKU1, a novel dimethylformamide degrading bacterial strain was originally isolated from an industrial effluent, Tirupur region, Tamil Nadu, India. Here, we report the draft genome sequence of Paracoccus sp. MKU1, which could provide the genetic insights on its evolution and application of this versatile bacterium for effective degradation of xenobiotics and thus in bioremediation. PMID:27326263

  2. Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.

    2012-07-01

    Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.

  3. Amino acids improve acid tolerance and internal pH maintenance in Bacillus cereus ATCC14579 strain.

    PubMed

    Senouci-Rezkallah, Khadidja; Schmitt, Philippe; Jobin, Michel P

    2011-05-01

    This study investigated the involvement of glutamate-, arginine- and lysine-dependent systems in the Acid Tolerance Response (ATR) of Bacillus cereus ATCC14579 strain. Cells were grown in a chemostat at external pH (pH(e)) 7.0 and 5.5. Population reduction after acid shock at pH 4.0 was strongly limited in cells grown at pH 5.5 (acid-adapted) compared with cells grown at pH 7.0 (unadapted), indicating that B. cereus cells grown at low pH(e) were able to induce a marked ATR. Glutamate, arginine and lysine enhanced the resistance of unadapted cells to pH 4.0 acid shock of 1-log or 2-log pop