SOA genes encode proteins controlling lipase expression in response to triacylglycerol utilization in the yeast Yarrowia lipolytica.

PubMed

Desfougères, Thomas; Haddouche, Ramdane; Fudalej, Franck; Neuvéglise, Cécile; Nicaud, Jean-Marc

2010-02-01

The oleaginous yeast Yarrowia lipolytica efficiently metabolizes hydrophobic substrates such as alkanes, fatty acids or triacylglycerol. This yeast has been identified in oil-polluted water and in lipid-rich food. The enzymes involved in lipid breakdown, for use as a carbon source, are known, but the molecular mechanisms controlling the expression of the genes encoding these enzymes are still poorly understood. The study of mRNAs obtained from cells grown on oleic acid identified a new group of genes called SOA genes (specific for oleic acid). SOA1 and SOA2 are two small genes coding for proteins with no known homologs. Single- and double-disrupted strains were constructed. Wild-type and mutant strains were grown on dextrose, oleic acid and triacylglycerols. The double mutant presents a clear phenotype consisting of a growth defect on tributyrin and triolein, but not on dextrose or oleic acid media. Lipase activity was 50-fold lower in this mutant than in the wild-type strain. The impact of SOA deletion on the expression of the main extracellular lipase gene (LIP2) was monitored using a LIP2-beta-galactosidase promoter fusion protein. These data suggest that Soa proteins are components of a molecular mechanism controlling lipase gene expression in response to extracellular triacylglycerol.

ISX is a retinoic acid-sensitive gatekeeper that controls intestinal β,β-carotene absorption and vitamin A production

PubMed Central

Lobo, Glenn P.; Hessel, Susanne; Eichinger, Anne; Noy, Noa; Moise, Alexander R.; Wyss, Adrian; Palczewski, Krzysztof; von Lintig, Johannes

2010-01-01

The uptake of dietary lipids from the small intestine is a complex process that depends on the activities of specific membrane receptors with yet unknown regulatory mechanisms. Using both mouse models and human cell lines, we show here that intestinal lipid absorption by the scavenger receptor class B type 1 (SR-BI) is subject to control by retinoid signaling. Retinoic acid via retinoic acid receptors induced expression of the intestinal transcription factor ISX. ISX then repressed the expression of SR-B1 and the carotenoid-15,15′-oxygenase Bcmo1. BCMO1 acts downstream of SR-BI and converts absorbed β,β-carotene to the retinoic acid precursor, retinaldehyde. Using BCMO1-knockout mice, we demonstrated increased intestinal SR-BI expression and systemic β,β-carotene accumulation. SR-BI-dependent accumulation of β,β-carotene was prevented by dietary retinoids that induced ISX expression. Thus, our study revealed a diet-responsive regulatory network that controls β,β-carotene absorption and vitamin A production by negative feedback regulation. The role of SR-BI in the intestinal absorption of other dietary lipids, including cholesterol, fatty acids, and tocopherols, implicates retinoid signaling in the regulation of lipid absorption more generally and has clinical implications for diseases associated with dyslipidemia.—Lobo, G. P., Hessel, S., Eichinger, A., Noy, N., Moise, A. R., Wyss, A., Palczewski, K., von Lintig, J. ISX is a retinoic acid-sensitive gatekeeper that controls intestinal β,β-carotene absorption and vitamin A production. PMID:20061533

Arabidopsis NAC Transcription Factor JUNGBRUNNEN1 Exerts Conserved Control Over Gibberellin and Brassinosteroid Metabolism and Signaling Genes in Tomato

PubMed Central

Shahnejat-Bushehri, Sara; Allu, Annapurna D.; Mehterov, Nikolay; Thirumalaikumar, Venkatesh P.; Alseekh, Saleh; Fernie, Alisdair R.; Mueller-Roeber, Bernd; Balazadeh, Salma

2017-01-01

The Arabidopsis thaliana NAC transcription factor JUNGBRUNNEN1 (AtJUB1) regulates growth by directly repressing GA3ox1 and DWF4, two key genes involved in gibberellin (GA) and brassinosteroid (BR) biosynthesis, respectively, leading to GA and BR deficiency phenotypes. AtJUB1 also reduces the expression of PIF4, a bHLH transcription factor that positively controls cell elongation, while it stimulates the expression of DELLA genes, which are important repressors of growth. Here, we extend our previous findings by demonstrating that AtJUB1 induces similar GA and BR deficiency phenotypes and changes in gene expression when overexpressed in tomato (Solanum lycopersicum). Importantly, and in accordance with the growth phenotypes observed, AtJUB1 inhibits the expression of growth-supporting genes, namely the tomato orthologs of GA3ox1, DWF4 and PIF4, but activates the expression of DELLA orthologs, by directly binding to their promoters. Overexpression of AtJUB1 in tomato delays fruit ripening, which is accompanied by reduced expression of several ripening-related genes, and leads to an increase in the levels of various amino acids (mostly proline, β-alanine, and phenylalanine), γ-aminobutyric acid (GABA), and major organic acids including glutamic acid and aspartic acid. The fact that AtJUB1 exerts an inhibitory effect on the GA/BR biosynthesis and PIF4 genes but acts as a direct activator of DELLA genes in both, Arabidopsis and tomato, strongly supports the model that the molecular constituents of the JUNGBRUNNEN1 growth control module are considerably conserved across species. PMID:28326087

Amino acid catabolism: a pivotal regulator of innate and adaptive immunity

PubMed Central

McGaha, Tracy L.; Huang, Lei; Lemos, Henrique; Metz, Richard; Mautino, Mario; Prendergast, George C.; Mellor, Andrew L.

2014-01-01

Summary Enhanced amino acid catabolism is a common response to inflammation, but the immunologic significance of altered amino acid consumption remains unclear. The finding that tryptophan catabolism helped maintain fetal tolerance during pregnancy provided novel insights into the significance of amino acid metabolism in controlling immunity. Recent advances in identifying molecular pathways that enhance amino acid catabolism and downstream mechanisms that affect immune cells in response to inflammatory cues support the notion that amino acid catabolism regulates innate and adaptive immune cells in pathologic settings. Cells expressing enzymes that degrade amino acids modulate antigen-presenting cell and lymphocyte functions and reveal critical roles for amino acid- and catabolite-sensing pathways in controlling gene expression, functions, and survival of immune cells. Basal amino acid catabolism may contribute to immune homeostasis that prevents autoimmunity, whereas elevated amino acid catalytic activity may reinforce immune suppression to promote tumorigenesis and persistence of some pathogens that cause chronic infections. For these reasons, there is considerable interest in generating novel drugs that inhibit or induce amino acid consumption and target downstream molecular pathways that control immunity. In this review, we summarize recent developments and highlight novel concepts and key outstanding questions in this active research field. PMID:22889220

Uncovering co-expression gene network regulating fruit acidity in diverse apples

USDA-ARS?s Scientific Manuscript database

Acidity is a major contributor to fruit quality. Several organic acids are present in apple fruit, but malic acid is predominant and determines fruit acidity. The trait is largely controlled by the Malic acid (Ma) locus, underpinning which Ma1 that encodes an Aluminum-activated Malate Transporter1 (...

Prenatal retinoic acid upregulates connexin 43 (Cx43) gene expression in pulmonary hypoplasia in the nitrofen-induced congenital diaphragmatic hernia rat model.

PubMed

Ruttenstock, Elke Maria; Doi, Takashi; Dingemann, Jens; Puri, Prem

2012-02-01

Connexin 43 (Cx43), a major gap junction protein, is necessary for alveologenesis and plays an important role in the differentiation of type II to type I alveolar epithelial cells. Knockout mice of Cx43 display severe pulmonary hypoplasia (PH). Prenatal administration of retinoic acid (RA) is known to stimulate alveologenesis in nitrofen-induced PH. Recent studies revealed that retinoids upregulate Cx43 expression. We hypothesized that gene expression of Cx43 is downregulated during alveologenesis and that administration of RA upregulates Cx43 expression in the nitrofen-induced PH. Pregnant rats were exposed to olive oil or nitrofen on day 9 (D9) of gestation. Retinoic acid was given intraperitoneally on D18, D19, and D20. Fetal lungs were harvested on D18 and D21 and divided into control, nitrofen, control+RA (D21), and nitrofen+RA (D21). The Cx43 expression levels were determined using reverse transcription polymerase chain reaction and immunohistochemistry. On D18 and D21, Cx43 relative messenger RNA expression levels were significantly downregulated in nitrofen compared with those in the control group. On D21, expression levels of Cx43 were significantly upregulated in nitrofen+RA and control+RA compared with those in nitrofen group. Immunohistochemical studies confirmed these results. Downregulation of Cx43 expression may interfere with normal alveologenesis. Upregulation of Cx43 pulmonary gene expression after RA treatment may promote lung growth by stimulating alveologenesis in nitrofen-induced PH. Copyright © 2012 Elsevier Inc. All rights reserved.

Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor.

PubMed

Ryan, J J; McReynolds, L J; Keegan, A; Wang, L H; Garfein, E; Rothman, P; Nelms, K; Paul, W E

1996-02-01

IL-4 causes hematopoietic cells to proliferate and express a series of genes, including CD23. We examined whether IL-4-mediated growth, as measured by 4PS phosphorylation, and gene induction were similarly controlled. Studies of M12.4.1 cells expressing human IL-4R truncation mutants indicated that the region between amino acids 557-657 is necessary for full gene expression, which correlated with Stat6 DNA binding activity. This region was not required for 4PS phosphorylation. Tyrosine-to-phenylalanine mutations in the interval between amino acids 557-657 revealed that as long as one tyrosine remained unmutated, CD23 was fully induced. When all three tyrosines were mutated, the receptor was unable to induce CD23. The results indicate that growth regulation and gene expression are principally controlled by distinct regions of IL-4R.

Docosahexaenoic Acid (DHA) and Hepatic Gene Transcription1,3

PubMed Central

Jump, Donald B.; Botolin, Daniela; Wang, Yun; Xu, Jinghua; Demeure, Olivier; Christian, Barbara

2008-01-01

The type and quantity of dietary fat ingested contributes to the onset and progression of chronic diseases, like diabetes and atherosclerosis. The liver plays a central role in whole body lipid metabolism and responds rapidly to changes in dietary fat composition. Polyunsaturated fatty acids (PUFA) play a key role in membrane composition and function, metabolism and the control of gene expression. Certain PUFA, like the n-3 PUFA, enhance hepatic fatty acid oxidation and inhibit fatty acid synthesis and VLDL secretion, in part, by regulating gene expression. Our studies have established that key transcription factors, like PPARα, SREBP-1, ChREBP and MLX, are regulated by n-3 PUFA, which in turn control levels of proteins involved in lipid and carbohydrate metabolism. Of the n-3 PUFA, 22:6,n-3 has recently been established as a key controller of hepatic lipid synthesis. 22:6,n-3 controls the 26S proteasomal degradation of the nuclear form of SREBP-1. SREBP-1 is a major transcription factor that controls the expression of multiple genes involved fatty acid synthesis and desaturation. 22:6,n-3 suppresses nuclear SREBP-1 which, in turn suppresses lipogenesis. This mechanism is achieved, in part, through control of the phosphorylation status of protein kinases. This review will examine both the general features of PUFA-regulated hepatic gene transcription and highlight the unique mechanisms by which 22:6,n-3 impacts gene expression. The outcome of this analysis will reveal that changes in hepatic 22:6,n-3 content has a major impact on hepatic lipid and carbohydrate metabolism. Moreover, the mechanisms involve 22:6,n-3 control of several well-known signaling pathways, such as Akt, Erk1/2, Gsk3β and PKC (novel or atypical). 22:6,n-3 control of these same signaling pathways in non-hepatic tissues may help explain the diverse actions of n-3 PUFA on such complex physiological processes as visual acuity and learning. PMID:18343222

Phenolic acid intake, delivered via moderate champagne wine consumption, improves spatial working memory via the modulation of hippocampal and cortical protein expression/activation.

PubMed

Corona, Giulia; Vauzour, David; Hercelin, Justine; Williams, Claire M; Spencer, Jeremy P E

2013-11-10

While much data exist for the effects of flavonoid-rich foods on spatial memory in rodents, there are no such data for foods/beverages predominantly containing hydroxycinnamates and phenolic acids. To address this, we investigated the effects of moderate Champagne wine intake, which is rich in these components, on spatial memory and related mechanisms relative to the alcohol- and energy-matched controls. In contrast to the isocaloric and alcohol-matched controls, supplementation with Champagne wine (1.78 ml/kg BW, alcohol 12.5% vol.) for 6 weeks led to an improvement in spatial working memory in aged rodents. Targeted protein arrays indicated that these behavioral effects were paralleled by the differential expression of a number of hippocampal and cortical proteins (relative to the isocaloric control group), including those involved in signal transduction, neuroplasticity, apoptosis, and cell cycle regulation. Western immunoblotting confirmed the differential modulation of brain-derived neurotrophic factor, cAMP response-element-binding protein (CREB), p38, dystrophin, 2',3'-cyclic-nucleotide 3'-phosphodiesterase, mammalian target of rapamycin (mTOR), and Bcl-xL in response to Champagne supplementation compared to the control drink, and the modulation of mTOR, Bcl-xL, and CREB in response to alcohol supplementation. Our data suggest that smaller phenolics such as gallic acid, protocatechuic acid, tyrosol, caftaric acid, and caffeic acid, in addition to flavonoids, are capable of exerting improvements in spatial memory via the modulation in hippocampal signaling and protein expression. Changes in spatial working memory induced by the Champagne supplementation are linked to the effects of absorbed phenolics on cytoskeletal proteins, neurotrophin expression, and the effects of alcohol on the regulation of apoptotic events in the hippocampus and cortex.

Characterization and Expression of Glutamate Dehydrogenase in Response to Acute Salinity Stress in the Chinese Mitten Crab, Eriocheir sinensis

PubMed Central

Wang, Yueru; Li, Erchao; Yu, Na; Wang, Xiaodan; Cai, Chunfang; Tang, Boping; Chen, Liqiao; Van Wormhoudt, Alain

2012-01-01

Background Glutamate dehydrogenase (GDH) is a key enzyme for the synthesis and catabolism of glutamic acid, proline and alanine, which are important osmolytes in aquatic animals. However, the response of GDH gene expression to salinity alterations has not yet been determined in macro-crustacean species. Methodology/Principal Findings GDH cDNA was isolated from Eriocheir sinensis. Then, GDH gene expression was analyzed in different tissues from normal crabs and the muscle of crabs following transfer from freshwater (control) directly to water with salinities of 16‰ and 30‰, respectively. Full-length GDH cDNA is 2,349 bp, consisting of a 76 bp 5′- untranslated region, a 1,695 bp open reading frame encoding 564 amino acids and a 578 bp 3′- untranslated region. E. sinensis GDH showed 64–90% identity with protein sequences of mammalian and crustacean species. Muscle was the dominant expression source among all tissues tested. Compared with the control, GDH expression significantly increased at 6 h in crabs transferred to 16‰ and 30‰ salinity, and GDH expression peaked at 48 h and 12 h, respectively, with levels approximately 7.9 and 8.5 fold higher than the control. The free amino acid (FAA) changes in muscle, under acute salinity stress (16‰ and 30‰ salinities), correlated with GDH expression levels. Total FAA content in the muscle, which was based on specific changes in arginine, proline, glycine, alanine, taurine, serine and glutamic acid, tended to increase in crabs following transfer to salt water. Among these, arginine, proline and alanine increased significantly during salinity acclimation and accounted for the highest proportion of total FAA. Conclusions E. sinensis GDH is a conserved protein that serves important functions in controlling osmoregulation. We observed that higher GDH expression after ambient salinity increase led to higher FAA metabolism, especially the synthesis of glutamic acid, which increased the synthesis of proline and alanine to meet the demand of osmoregulation at hyperosmotic conditions. PMID:22615974

Molecular characterization and expression profiling of BMP 3 gene in broiler and layer chicken.

PubMed

Divya, Devara; Bhattacharya, Tarun Kumar; Gnana Prakash, Manthani; Chatterjee, R N; Shukla, Renu; Guru Vishnu, Pothana Boyina; Vinoth, Amirthalingam; Dushyanth, Kotha

2018-04-10

A study was carried out to characterize and explore the expression profile of BMP 3 gene in control broiler and control layer chicken. The total open reading frame of BMP 3 (1389 bp) was cloned and sequenced. The control broiler and control layer chicken showed variation at nucleotide and amino acid level with reference gene (Gallus gallus, NCBI Acc. No. NM_001034819). When compared to reference gene, the control broiler showed four nucleotide differences (c.192A>G, c.519C>T, 903G>A and 960C>G), while, control layer showed variation at c.33G>C, 192A>G, 858G>A, 904G>A, 960C>G and 1257C>T making six differences in total. However, between control broiler and control layer lines, nucleotide differences was observed at c.33G>C, 519T>C, 858G>A, 903A>G, 904G>A and 1257C>T. The change at amino acid level between reference and control broiler was p.D320N and with control layer chicken, it was p.D302N and p.D320N. On the other hand, a single amino acid difference (p.D302N) was observed between the control broiler and control layer chicken lines. The phylogenetic study displayed a close relationship between broiler and layer lines and reference gene and also with other avian species resulting in a cluster formation. These cluster in turn displayed a distant link with the mammalian species. The expression profile of BMP 3 gene exhibited a variation at different stages of embryonic development and also at post embryonic period among the lines with control layer showing higher expression than that of broiler chicken. The protein was also detected in bone marrow tissue of broiler and layer lines by western blotting. It is concluded that the BMP 3 gene sequence differed at nucleotide and amino acid level among the lines and the gene expressed differentially at different periods of embryonic development and also at post hatch period.

Ascorbic acid deficiency stimulates hepatic expression of inflammatory chemokine, cytokine-induced neutrophil chemoattractant-1, in scurvy-prone ODS rats.

PubMed

Horio, Fumihiko; Kiyama, Keiichiro; Kobayashi, Misato; Kawai, Kaori; Tsuda, Takanori

2006-02-01

ODS rat has a hereditary defect in ascorbic acid biosynthesis and is a useful animal model for elucidating the physiological role of ascorbic acid. We previously demonstrated by using ODS rats that ascorbic acid deficiency changes the hepatic gene expression of acute phase proteins, as seen in acute inflammation. In this study, we investigated the effects of ascorbic acid deficiency on the production of inflammatory chemokine, cytokine-induced neutrophil chemoattractant-1 (CINC-1), in ODS rats. Male ODS rats (6 wk of age) were fed a basal diet containing ascorbic acid (300 mg/kg diet) or a diet without ascorbic acid for 14 d. Obvious symptoms of scurvy were not observed in the ascorbic acid-deficient rats. Ascorbic acid deficiency significantly elevated the serum concentration of CINC-1 on d 14. The liver and spleen CINC-1 concentrations in the ascorbic acid-deficient rats were significantly elevated to 600% and 180% of the respective values in the control rats. However, the lung concentration of CINC-1 was not affected by ascorbic acid deficiency. Ascorbic acid deficiency significantly elevated the hepatic mRNA level of CINC-1 (to 480% of the value in the control rats), but not the lung mRNA level. These results demonstrate that ascorbic acid deficiency elevates the serum, liver and spleen concentrations of CINC-1 as seen in acute inflammation, and suggest that ascorbic acid deficiency stimulate the hepatic CINC-1 gene expression.

[EFFECT OF α-LIPOIC ACID IN INHIBITING OXIDATIVE STRESS AND PROMOTING DIABETIC WOUND HEALING BY SUPPRESSING EXPRESSION OF miR-29b IN MICE].

PubMed

Wu, Jun; Tang, Huiqin; Liu, Qun; Gan, Dingyun; Zhou, Man

2016-08-08

To investigate the effect of α-lipoic acid on the oxidative stress of wound tissues and diabetic wound healing in mice with diabetic feet. Sixty male C57BL/6J mice weighting 200-300 g were randomly divided into model group (control group, n =15), α-lipoic acid-treated model group ( n =15), miR-29b mimic group ( n =15), and miR-29b mimic negative control group (NC group, n =15). All animals received intraperitoneal injection of streptozocin to establish the diabetic model. Then, a full thickness wound of 5 mm×2 mm in size was created at 4 weeks after modeling. All mice were administrated with high-sugar-fat-diet. At the same day after modeling, α-lipoic acid-treated model group was continuously given intravenous injection of 100 mg/(kg·d) α-lipoic acid for 14 days; miR-29b mimic group and NC group received the tail intravenous injection of lentiviral vector for miR-29b mimic and miR-29b mimic negative control (a total of 2×10 7 TU), respectively, with the treatment of α-lipoic acid. The wound healing was observed and wound area was measured at 7 and 14 days. The wound tissues were harvested to detect the levels of superoxide dismutase (SOD) and glutathione (GSH) using xanthine oxidase method and 5, 5-dithiobis-2-nitrobenzoic acid staining method at 14 days. At the same day, 7, and 14 days after modeling, the relative miR-29b expression in wound tissues from control and α-lipoic acid-treated model groups was detected by real-time fluorescence quantitative PCR. All mice survived to the experiment end. The wound healing was faster in α-lipoic acid-treated group than control group. At 7 and 14 days, the relative wound area and miR-29b expression level were significantly lower, while the contents of SOD and GSH were significantly higher in α-lipoic acid-treated group than control group ( P <0.05). In addition, miR-29b mimic group had significantly increased relative wound area and significantly decreased the contents of SOD and GSH when compared with NC group at 7 and 14 days ( P <0.05). α-lipoic acid could inhibit oxidative stress and promote diabetic wound healing by suppressing expression of miR-29b in mice.

BCL-2 and Bax Expression in Skin Flaps Treated with Finasteride or Azelaic Acid.

PubMed

Ayatollahi, Seyyed Abdulmajid; Ajami, Marjan; Reyhanfard, Hamed; Asadi, Yasin; Nassiri-Kashani, Mansour; Rashighi Firoozabadi, Mehdi; Davoodi, Sayed Hossein; Habibi, Esmaeil; Pazoki-Toroudi, Hamidreza

2012-01-01

Despite all modern surgical techniques, skin flap that is considered as the main method in most reconstructive surgeries puts the skin tissue at danger of necrosis and apoptosis derived from ischemia. Therefore, finding a treatment for decreasing the apoptosis derived from flap ischemia will be useful in clinic. In present study, we evaluated the effect of azelaic acid 20% and finasteride on expression of BCL-2 and bax proteins after the skin flap surgery. For this purpose, 21 rats were entered in three groups including control, azelaic acid 20% and finasteride, all experienced skin flap surgery and then flap tissue was assessed for determining the expression of proteins in 5 slices prepared from each rat that were graded between - to +++ scales. Both azelaic acid and finasteride increased the expression of BCL-2 protein (p < 0.05) and decrease the expression of bax protein (p < 0.05). These results suggested an antiapoptotic role for finasteride and azelaic acid in preserving the flap after the ischemia reperfusion insult.

BCL-2 and Bax Expression in Skin Flaps Treated with Finasteride or Azelaic Acid

PubMed Central

Ayatollahi, Seyyed Abdulmajid; Ajami, Marjan; Reyhanfard, Hamed; Asadi, Yasin; Nassiri-Kashani, Mansour; Rashighi Firoozabadi, Mehdi; Davoodi, Sayed Hossein; Habibi, Esmaeil; Pazoki-Toroudi, Hamidreza

2012-01-01

Despite all modern surgical techniques, skin flap that is considered as the main method in most reconstructive surgeries puts the skin tissue at danger of necrosis and apoptosis derived from ischemia. Therefore, finding a treatment for decreasing the apoptosis derived from flap ischemia will be useful in clinic. In present study, we evaluated the effect of azelaic acid 20% and finasteride on expression of BCL-2 and bax proteins after the skin flap surgery. For this purpose, 21 rats were entered in three groups including control, azelaic acid 20% and finasteride, all experienced skin flap surgery and then flap tissue was assessed for determining the expression of proteins in 5 slices prepared from each rat that were graded between – to +++ scales. Both azelaic acid and finasteride increased the expression of BCL-2 protein (p < 0.05) and decrease the expression of bax protein (p < 0.05). These results suggested an antiapoptotic role for finasteride and azelaic acid in preserving the flap after the ischemia reperfusion insult. PMID:24250563

Basic Aspects of Tumor Cell Fatty Acid-Regulated Signaling and Transcription Factors

PubMed Central

Comba, Andrea; Lin, Yi-Hui; Eynard, Aldo Renato; Valentich, Mirta Ana; Fernandez-Zapico, Martin Ernesto; Pasqualini, Marìa Eugenia

2012-01-01

This article reviews the current knowledge and experimental research about the mechanisms by which fatty acids and their derivatives control specific gene expression involved during carcinogenesis. Changes in dietary fatty acids, specifically the polyunsaturated fatty acids (PUFAs) of the ω-3 and ω-6 families and some derived eicosanoids from lipoxygenases (LOXs), cyclooxygenases (COXs), and cytochrome P-450 (CYP-450), seem to control the activity of transcription factor families involved in cancer cell proliferation or cell death. Their regulation may be carried out either through direct binding to DNA as peroxisome proliferator–activated receptors (PPARs) or via modulation in an indirect manner of signaling pathway molecules (e.g., protein kinase C [PKC]) and other transcription factors (nuclear factor kappa B [NFκB] and sterol regulatory element binding protein [SREBP]). Knowledge of the mechanisms by which fatty acids control specific gene expression may identify important risk factors for cancer, and provide insight into the development of new therapeutic strategies for a better management of whole-body lipid metabolism. PMID:22048864

Basic aspects of tumor cell fatty acid-regulated signaling and transcription factors.

PubMed

Comba, Andrea; Lin, Yi-Hui; Eynard, Aldo Renato; Valentich, Mirta Ana; Fernandez-Zapico, Martín Ernesto; Pasqualini, Marìa Eugenia

2011-12-01

This article reviews the current knowledge and experimental research about the mechanisms by which fatty acids and their derivatives control specific gene expression involved during carcinogenesis. Changes in dietary fatty acids, specifically the polyunsaturated fatty acids of the ω-3 and ω-6 families and some derived eicosanoids from lipoxygenases, cyclooxygenases, and cytochrome P-450, seem to control the activity of transcription factor families involved in cancer cell proliferation or cell death. Their regulation may be carried out either through direct binding to DNA as peroxisome proliferator-activated receptors or via modulation in an indirect manner of signaling pathway molecules (e.g., protein kinase C) and other transcription factors (nuclear factor kappa B and sterol regulatory element binding protein). Knowledge of the mechanisms by which fatty acids control specific gene expression may identify important risk factors for cancer and provide insight into the development of new therapeutic strategies for a better management of whole body lipid metabolism.

Elevated ATF4 Expression, in the Absence of Other Signals, Is Sufficient for Transcriptional Induction via CCAAT Enhancer-binding Protein-activating Transcription Factor Response Elements*

PubMed Central

Shan, Jixiu; Örd, Daima; Örd, Tõnis; Kilberg, Michael S.

2009-01-01

Protein limitation in vivo or amino acid deprivation of cells in culture causes a signal transduction cascade consisting of activation of the kinase GCN2 (general control nonderepressible 2), phosphorylation of eukaryotic initiation factor 2, and increased synthesis of activating transcription factor (ATF) 4 by a translational control mechanism. In a self-limiting transcriptional program, ATF4 transiently activates a wide range of downstream target genes involved in transport, cellular metabolism, and other cell functions. Simultaneous activation of other signal transduction pathways by amino acid deprivation led to the question of whether or not the increased abundance of ATF4 alone was sufficient to trigger the transcriptional control mechanisms. Using 293 cells that ectopically express ATF4 in a tetracycline-inducible manner showed that ATF4 target genes were activated in the absence of amino acid deprivation. Ectopic expression of ATF4 alone resulted in effective recruitment of the general transcription machinery, but some reduction in histone modification was observed. These data document that ATF4 alone is sufficient to trigger the amino acid-responsive transcriptional control program. However, the absolute amount of ectopic ATF4 required to achieve the same degree of transcriptional activation observed after amino acid limitation was greater, suggesting that other factors may serve to enhance ATF4 function. PMID:19509279

[Knockdown of dopamine receptor D2 upregulates the expression of adiogenic genes in mouse primary mesencephalic neurons].

PubMed

Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi

2018-01-01

Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.

FXR signaling in the enterohepatic system

PubMed Central

Matsubara, Tsutomu; Li, Fei; Gonzalez, Frank J.

2012-01-01

Enterohepatic circulation serves to capture bile acids and other steroid metabolites produced in the liver and secreted to the intestine, for reabsorption back into the circulation and reuptake to the liver. This process is under tight regulation by nuclear receptor signaling. Bile acids, produced from cholesterol, can alter gene expression in the liver and small intestine via activating the nuclear receptors farnesoid X receptor (FXR; NR1H4), pregnane X receptor (PXR; NR1I2), vitamin D receptor (VDR; NR1I1), G protein coupled receptor TGR5, and other cell signaling pathways (JNK1/2, AKT and ERK1/2). Among these controls, FXR is known to be a major bile acid-responsive ligand-activated transcription factor and a crucial control element for maintaining bile acid homeostasis. FXR has a high affinity for several major endogenous bile acids, notably cholic acid, deoxycholic acid, chenodeoxycholic acid, and lithocholic acid. By responding to excess bile acids, FXR is a bridge between the liver and small intestine to control bile acid levels and regulate bile acid synthesis and enterohepatic flow. FXR is highly expressed in the liver and gut, relative to other tissues, and contributes to the maintenance of cholesterol/bile acid homeostasis by regulating a variety of metabolic enzymes and transporters. FXR activation also affects lipid and glucose metabolism, and can influence drug metabolism. PMID:22609541

Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

PubMed

Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

2017-05-01

Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

Non-coding nucleotides and amino acids near the active site regulate peptide deformylase expression and inhibitor susceptibility in Chlamydia trachomatis

PubMed Central

Bao, Xiaofeng; Pachikara, Niseema D.; Oey, Christopher B.; Balakrishnan, Amit; Westblade, Lars F.; Tan, Ming; Chase, Theodore; Nickels, Bryce E.

2011-01-01

Chlamydia trachomatis, an obligate intracellular bacterium, is a highly prevalent human pathogen. Hydroxamic-acid-based matrix metalloprotease inhibitors can effectively inhibit the pathogen both in vitro and in vivo, and have exhibited therapeutic potential. Here, we provide genome sequencing data indicating that peptide deformylase (PDF) is the sole target of the inhibitors in this organism. We further report molecular mechanisms that control chlamydial PDF (cPDF) expression and inhibition efficiency. In particular, we identify the σ66-dependent promoter that controls cPDF gene expression and demonstrate that point mutations in this promoter lead to resistance by increasing cPDF transcription. Furthermore, we show that substitution of two amino acids near the active site of the enzyme alters enzyme kinetics and protein stability. PMID:21719536

Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity

PubMed Central

Wang, Yun; Botolin, Daniela; Xu, Jinghua; Christian, Barbara; Mitchell, Ernestine; Jayaprakasam, Bolleddula; Nair, Muraleedharan; Peters, Jeffery M.; Busik, Julia; Olson, L. Karl; Jump, Donald B.

2009-01-01

Fatty acid elongases and desaturases play an important role in hepatic and whole body lipid composition. We examined the role that key transcription factors played in the control of hepatic elongase and desaturase expression. Studies with peroxisome proliferator-activated receptor α (PPARα)-deficient mice establish that PPARα was required for WY14643-mediated induction of fatty acid elongase-5 (Elovl-5), Elovl-6, and all three desaturases [Δ5 desaturase (Δ5D), Δ6D, and Δ9D]. Increased nuclear sterol-regulatory element binding protein-1 (SREBP-1) correlated with enhanced expression of Elovl-6, Δ5D, Δ6D, and Δ9D. Only Δ9D was also regulated independently by liver X receptor (LXR) agonist. Glucose induction of L-type pyruvate kinase, Δ9D, and Elovl-6 expression required the carbohydrate-regulatory element binding protein/MAX-like factor X (ChREBP/MLX) heterodimer. Suppression of Elovl-6 and Δ9D expression in livers of streptozotocin-induced diabetic rats and high fat-fed glucose-intolerant mice correlated with low levels of nuclear SREBP-1. In leptin-deficient obese mice (Lepob/ob), increased SREBP-1 and MLX nuclear content correlated with the induction of Elovl-5, Elovl-6, and Δ9D expression and the massive accumulation of monoun-saturated fatty acids (18:1,n-7 and 18:1,n-9) in neutral lipids. Diabetes- and obesity-induced changes in hepatic lipid composition correlated with changes in elongase and desaturase expression. In conclusion, these studies establish a role for PPARα, LXR, SREBP-1, ChREBP, and MLX in the control of hepatic fatty acid elongase and desaturase expression and lipid composition. PMID:16790840

Omega-3 fatty acid deficiency selectively up-regulates delta6-desaturase expression and activity indices in rat liver: prevention by normalization of omega-3 fatty acid status.

PubMed

Hofacer, Rylon; Jandacek, Ronald; Rider, Therese; Tso, Patrick; Magrisso, I Jack; Benoit, Stephen C; McNamara, Robert K

2011-09-01

This study investigated the effects of perinatal dietary omega-3 (n-3) fatty acid depletion and subsequent repletion on the expression of genes that regulate long-chain (LC) polyunsaturated fatty acid biosynthesis in rat liver and brain. It was hypothesized that chronic n-3 fatty acid deficiency would increase liver Fads1 and Fads2 messenger RNA (mRNA) expression/activity and that n-3 fatty acid repletion would normalize this response. Adult rats fed the n-3-free diet during perinatal development exhibited significantly lower erythrocyte, liver, and frontal cortex LCn-3 fatty acid composition and reciprocal elevations in LC omega-6 (n-6) fatty acid composition compared with controls (CONs) and repleted rats. Liver Fads2, but not Fads1, Elovl2, or Elovl5, mRNA expression was significantly greater in n-3-deficient (DEF) rats compared with CONs and was partially normalized in repleted rats. The liver 18:3n-6/18:2n-6 ratio, an index of delta6-desturase activity, was significantly greater in DEF rats compared with CON and repleted rats and was positively correlated with Fads2 mRNA expression among all rats. The liver 18:3n-6/18:2n-6 ratio, but not Fads2 mRNA expression, was also positively correlated with erythrocyte and frontal cortex LCn-6 fatty acid compositions. Neither Fads1 or Fads2 mRNA expression was altered in brain cortex of DEF rats. These results confirm previous findings that liver, but not brain, delta6-desaturase expression and activity indices are negatively regulated by dietary n-3 fatty acids. Copyright © 2011 Elsevier Inc. All rights reserved.

Plants having modified response to ethylene by transformation with an ETR nucleic acid

DOEpatents

Meyerowitz, Elliott M.; Chang, Caren; Bleecker, Anthony B.

2001-01-01

The invention includes transformed plants having at least one cell transformed with a modified ETR nucleic acid. Such plants have a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a plant not containing the transformed plant cell. Tissue and/or temporal specificity for expression of the modified ETR nucleic acid is controlled by selecting appropriate expression regulation sequences to target the location and/or time of expression of the transformed nucleic acid. The plants are made by transforming at least one plant cell with an appropriate modified ETR nucleic acid, regenerating plants from one or more of the transformed plant cells and selecting at least one plant having the desired phenotype.

76 FR 77016 - Controlled Substances: Final Adjusted Aggregate Production Quotas for 2011

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-09

... substances previously referenced, expressed in grams of anhydrous acid or base, as follows: Final adjusted...), diphenoxylate, fentanyl, gamma hydroxybutyric acid, hydrocodone, meperidine, methadone, methadone [[Page 77017... 2011 aggregate production quotas for alfentanil, diphenoxylate, gamma hydroxybutyric acid, meperidine...

Expression of a coriander desaturase results in petroselinic acid production in transgenic tobacco

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cahoon, E.B.; Shanklin, J.; Ohlrogge, J.B.

1992-12-01

Little is known about the metabolic origin of petroselinic acid (18:1[Delta][sup 6cis]), the principal fatty acid of the seed oil of most Umbelliferae, Araliaceae, and Garryaceae species. To examine the possibility that petroselinic acid is the product of an acyl-acyl carrier protein (ACP) desaturase, Western blots of coriander and other Umbelliferae seed extracts were probed with antibodies against the [Delta][sup 9]-stearoyl-ACP desaturase of avocado. In these extracts, proteins of 39 and 36 kDa were detected. Of these, only the 36-kDa peptide was specific to tissues which synthesize petroselinic acid. A cDNA encoding the 36-kDa peptide was isolated from a coriandermore » endosperm cDNA library, placed under control of the cauliflower mosaic virus 35S promoter, and introduced into tobacco by Agrobacterium tumefaciens-mediated transformation. Expression of this cDNA in transgenic tobacco callus was accompanied by the accumulation of petroselinic acid and [Delta][sup 4]-hexadecenoic acid, both of which were absent from control callus. These results demonstrate the involvement of a 36-kDa putative acyl-ACP desaturase in the biosynthetic pathway of petroselinic acid and the ability to produce fatty acids of unusual structure in transgenic plants by the expression of the gene for this desaturase. 27 refs., 5 figs.« less

Stimulation of d- and l-lactate dehydrogenases transcriptional levels in presence of diammonium hydrogen phosphate resulting to enhanced lactic acid production by Lactobacillus strain.

PubMed

Singhvi, Mamata; Zendo, Takeshi; Iida, Hiroshi; Gokhale, Digambar; Sonomoto, Kenji

2017-12-01

The present study revealed the effect of nitrogen sources on lactic acid production and stimulation of d- and l-lactate dehydrogenases (LDH) of parent Lactobacillus lactis NCIM 2368 and its mutant RM2-24 generated after UV mutagenesis. Both the parent and mutant strains were evaluated for d-lactic acid production in control and modified media. The modified media did not show remarkable effect on lactic acid production in case of parent whereas mutant exhibited significant enhancement in d-lactic acid production along with the appearance of l-lactic acid in the broth. Both LDH activities and specific activities were found to be higher in mutant than the parent strain. These results suggested that the diammonium hydrogen phosphate in modified media triggered the expression of LDH genes leading to enhanced lactic acid production. This observation has been proved by studying the expression levels of d- and l-LDH genes of parent and mutant in control and modified media using quantitative RT-PCR technique. In case of mutant, the transcriptional levels of d-LDH and l-LDH increased ∼17 fold and ∼1.38 fold respectively in modified medium compared to the values obtained with control medium. In case of parent, no significant change in transcriptional levels of d- and l-LDH was found when the cells were grown in either control medium or modified medium. This study suggested that the mutant, RM2-24 has l-LDH gene which is expressed in presence of (NH 4 ) 2 HPO 4 resulting in l-lactic acid production. Co-production of l-lactic acid in d-lactic acid fermentation may be detrimental in the PLA production. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Branched-Chain Amino Acid Negatively Regulates KLF15 Expression via PI3K-AKT Pathway

PubMed Central

Liu, Yunxia; Dong, Weibing; Shao, Jing; Wang, Yibin; Zhou, Meiyi; Sun, Haipeng

2017-01-01

Recent studies have linked branched-chain amino acid (BCAA) with numerous metabolic diseases. However, the molecular basis of BCAA's roles in metabolic regulation remains to be established. KLF15 (Krüppel-like factor 15) is a transcription factor and master regulator of glycemic, lipid, and amino acids metabolism. In the present study, we found high concentrations of BCAA suppressed KLF15 expression while BCAA starvation induced KLF15 expression, suggesting KLF15 expression is negatively controlled by BCAA.Interestingly, BCAA starvation induced PI3K-AKT signaling. KLF15 induction by BCAA starvation was blocked by PI3K and AKT inhibitors, indicating the activation of PI3K-AKT signaling pathway mediated the KLF15 induction. BCAA regulated KLF15 expression at transcriptional level but not post-transcriptional level. However, BCAA starvation failed to increase the KLF15-promoter-driven luciferase expression, suggesting KLF15 promoter activity was not directly controlled by BCAA. Finally, fasting reduced BCAA abundance in mice and KLF15 expression was dramatically induced in muscle and white adipose tissue, but not in liver. Together, these data demonstrated BCAA negatively regulated KLF15 expression, suggesting a novel molecular mechanism underlying BCAA's multiple functions in metabolic regulation. PMID:29118722

Branched-Chain Amino Acid Negatively Regulates KLF15 Expression via PI3K-AKT Pathway.

PubMed

Liu, Yunxia; Dong, Weibing; Shao, Jing; Wang, Yibin; Zhou, Meiyi; Sun, Haipeng

2017-01-01

Recent studies have linked branched-chain amino acid (BCAA) with numerous metabolic diseases. However, the molecular basis of BCAA's roles in metabolic regulation remains to be established. KLF15 (Krüppel-like factor 15) is a transcription factor and master regulator of glycemic, lipid, and amino acids metabolism. In the present study, we found high concentrations of BCAA suppressed KLF15 expression while BCAA starvation induced KLF15 expression, suggesting KLF15 expression is negatively controlled by BCAA.Interestingly, BCAA starvation induced PI3K-AKT signaling. KLF15 induction by BCAA starvation was blocked by PI3K and AKT inhibitors, indicating the activation of PI3K-AKT signaling pathway mediated the KLF15 induction. BCAA regulated KLF15 expression at transcriptional level but not post-transcriptional level. However, BCAA starvation failed to increase the KLF15-promoter-driven luciferase expression, suggesting KLF15 promoter activity was not directly controlled by BCAA. Finally, fasting reduced BCAA abundance in mice and KLF15 expression was dramatically induced in muscle and white adipose tissue, but not in liver. Together, these data demonstrated BCAA negatively regulated KLF15 expression, suggesting a novel molecular mechanism underlying BCAA's multiple functions in metabolic regulation.

The Effects of Angiotensin II and Angiotensin-(1–7) in the Rostral Ventrolateral Medulla of Rats on Stress-Induced Hypertension

PubMed Central

Du, Dongshu; Chen, Jun; Liu, Min; Zhu, Minxia; Jing, Haojia; Fang, Jie; Shen, Linlin; Zhu, Danian; Yu, Jerry; Wang, Jin

2013-01-01

We have shown that angiotensin II (Ang II) and angiotensin-(1–7) [Ang-(1–7)] increased arterial blood pressure (BP) via glutamate release when microinjected into the rostral ventrolateral medulla (RVLM) in normotensive rats (control). In the present study, we tested the hypothesis that Ang II and Ang-(1–7) in the RVLM are differentially activated in stress-induced hypertension (SIH) by comparing the effects of microinjection of Ang II, Ang-(1–7), and their receptor antagonists on BP and amino acid release in SIH and control rats. We found that Ang II had greater pressor effect, and more excitatory (glutamate) and less inhibitory (taurine and γ-aminobutyric acid) amino acid release in SIH than in control animals. Losartan, a selective AT1 receptor (AT1R) antagonist, decreased mean BP in SIH but not in control rats. PD123319, a selective AT2 receptor (AT2R) antagonist, increased mean BP in control but not in SIH rats. However, Ang-(1–7) and its selective Mas receptor antagonist Ang779 evoked similar effects on BP and amino acid release in both SIH and control rats. Furthermore, we found that in the RVLM, AT1R, ACE protein expression (western blot) and ACE mRNA (real-time PCR) were significantly higher, whereas AT2R protein, ACE2 mRNA and protein expression were significantly lower in SIH than in control rats. Mas receptor expression was similar in the two groups. The results support our hypothesis and demonstrate that upregulation of Ang II by AT1R, not Ang-(1–7), system in the RVLM causes hypertension in SIH rats by increasing excitatory and suppressing inhibitory amino acid release. PMID:23967142

The barley MATE gene, HvAACT1, increases citrate efflux and Al(3+) tolerance when expressed in wheat and barley.

PubMed

Zhou, Gaofeng; Delhaize, Emmanuel; Zhou, Meixue; Ryan, Peter R

2013-08-01

Aluminium is toxic in acid soils because the soluble Al(3+) inhibits root growth. A mechanism of Al(3+) tolerance discovered in many plant species involves the release of organic anions from root apices. The Al(3+)-activated release of citrate from the root apices of Al(3+)-tolerant genotypes of barley is controlled by a MATE gene named HvAACT1 that encodes a citrate transport protein located on the plasma membrane. The aim of this study was to investigate whether expressing HvAACT1 with a constitutive promoter in barley and wheat can increase citrate efflux and Al(3+) tolerance of these important cereal species. HvAACT1 was over-expressed in wheat (Triticum aestivum) and barley (Hordeum vulgare) using the maize ubiquitin promoter. Root apices of transgenic and control lines were analysed for HvAACT1 expression and organic acid efflux. The Al(3+) tolerance of transgenic and control lines was assessed in both hydroponic solution and acid soil. Increased HvAACT1 expression in both cereal species was associated with increased citrate efflux from root apices and enhanced Al(3+) tolerance, thus demonstrating that biotechnology can complement traditional breeding practices to increase the Al(3+) tolerance of important crop plants.

A grape polyphenol extract modulates muscle membrane fatty acid composition and lipid metabolism in high-fat--high-sucrose diet-fed rats.

PubMed

Aoun, Manar; Michel, Francoise; Fouret, Gilles; Schlernitzauer, Audrey; Ollendorff, Vincent; Wrutniak-Cabello, Chantal; Cristol, Jean-Paul; Carbonneau, Marie-Annette; Coudray, Charles; Feillet-Coudray, Christine

2011-08-01

Accumulation of muscle TAG content and modification of muscle phospholipid fatty acid pattern may have an impact on lipid metabolism, increasing the risk of developing diabetes. Some polyphenols have been reported to modulate lipid metabolism, in particular those issued from red grapes. The present study was designed to determine whether a grape polyphenol extract (PPE) modulates skeletal muscle TAG content and phospholipid fatty acid composition in high-fat-high-sucrose (HFHS) diet-fed rats. Muscle plasmalemmal and mitochondrial fatty acid transporters, GLUT4 and lipid metabolism pathways were also explored. The PPE decreased muscle TAG content in HFHS/PPE diet-fed rats compared with HFHS diet-fed rats and induced higher proportions of n-3 PUFA in phospholipids. The PPE significantly up-regulated GLUT4 mRNA expression. Gene and protein expression of muscle fatty acid transporter cluster of differentiation 36 (CD36) was increased in HFHS diet-fed rats but returned to control values in HFHS/PPE diet-fed rats. Carnitine palmitoyltransferase 1 protein expression was decreased with the PPE. Mitochondrial β-hydroxyacyl CoA dehydrogenase was increased in HFHS diet-fed rats and returned to control values with PPE supplementation. Lipogenesis, mitochondrial biogenesis and mitochondrial activity were not affected by the PPE. In conclusion, the PPE modulated membrane phospholipid fatty acid composition and decreased muscle TAG content in HFHS diet-fed rats. The PPE lowered CD36 gene and protein expression, probably decreasing fatty acid transport and lipid accumulation within skeletal muscle, and increased muscle GLUT4 expression. These effects of the PPE are in favour of a better insulin sensibility.

Uncoupling Lipid Metabolism from Inflammation through Fatty Acid Binding Protein-Dependent Expression of UCP2

PubMed Central

Xu, Hongliang; Hertzel, Ann V.; Steen, Kaylee A.; Wang, Qigui; Suttles, Jill

2015-01-01

Chronic inflammation in obese adipose tissue is linked to endoplasmic reticulum (ER) stress and systemic insulin resistance. Targeted deletion of the murine fatty acid binding protein (FABP4/aP2) uncouples obesity from inflammation although the mechanism underlying this finding has remained enigmatic. Here, we show that inhibition or deletion of FABP4/aP2 in macrophages results in increased intracellular free fatty acids (FFAs) and elevated expression of uncoupling protein 2 (UCP2) without concomitant increases in UCP1 or UCP3. Silencing of UCP2 mRNA in FABP4/aP2-deficient macrophages negated the protective effect of FABP loss and increased ER stress in response to palmitate or lipopolysaccharide (LPS). Pharmacologic inhibition of FABP4/aP2 with the FABP inhibitor HTS01037 also upregulated UCP2 and reduced expression of BiP, CHOP, and XBP-1s. Expression of native FABP4/aP2 (but not the non-fatty acid binding mutant R126Q) into FABP4/aP2 null cells reduced UCP2 expression, suggesting that the FABP-FFA equilibrium controls UCP2 expression. FABP4/aP2-deficient macrophages are resistant to LPS-induced mitochondrial dysfunction and exhibit decreased mitochondrial protein carbonylation and UCP2-dependent reduction in intracellular reactive oxygen species. These data demonstrate that FABP4/aP2 directly regulates intracellular FFA levels and indirectly controls macrophage inflammation and ER stress by regulating the expression of UCP2. PMID:25582199

Hyaluronic acid effect on adipose-derived stem cells. Biological in vitro evaluation.

PubMed

Moreno, A; Martínez, A; Olmedillas, S; Bello, S; de Miguel, F

2015-01-01

To evaluate the in vitro effects of hyaluronic acid (HA) on adipose-derived stem cells (ASC) in order to consider the possibility of their combined used in the treatment of knee arthrosis. The ASC cells were grown both in the presence and absence of AH, and several studies were carried out: proliferation (WST8) and cell viability studies (Alamar Blue® and Trypan Blue), possible chondrogenic differentiation (collagen type 2 expression) by RT-PCR, AH receptor expression (CD44) by flow cytometry and RT-QPCR, and expression of inflammatory and anti-inflammatory factors (IL-6, TGFß, IL-10) by RT-QPCR. The number of ASC significantly increased after 7 days with HA (158±39%, p <0.05). Additionally, the cell viability of the ASC treated with HA after 1, 3, 5 and 7 days was similar to that of the control cells, being considered non-toxic. There were no changes observed in the expression of CD44 and chondrogenic differentiation. TGFß expression was not modified after AH treatment, but there was a 4-fold decrease in IL-6 expression and IL-10 expression increased up to 2-fold compared to control cells. Hyaluronic acid favours ASC proliferation without causing cellular toxicity, and inducing an anti-inflammatory profile in these cells. Hyaluronic acid appears to be a suitable vehicle for the intra-articular administration of mesenchymal stem cells. Copyright © 2014 SECOT. Published by Elsevier Espana. All rights reserved.

Protein Expression Level of Skin Wrinkle-Related Factors in Hairless Mice Fed Hyaluronic Acid.

PubMed

Yun, Min-Kyu; Lee, Sung-Jin; Song, Hye-Jin; Yu, Heui-Jong; Rha, Chan Su; Kim, Dae-Ok; Choe, Soo-Young; Sohn, Johann

2017-04-01

The aim of this study was to evaluate the wrinkle improving effect of hyaluronic acid intakes. Wrinkles were induced by exposing the skin of hairless mice to ultraviolet B (UVB) irradiation for 14 weeks. Hyaluronic acid was administered to the mice for 14 weeks including 4 weeks before experiments. Skin tissue was assayed by enzyme-linked immunosorbent assay to determine protein expression of wrinkle-related markers. The group supplemented with high concentrations of hyaluronic acid appeared significantly better than control group for collagen, matrix metalloproteinase 1, interleukin (IL)-1β, and IL-6 assay. Transforming growth factor-β1 (TGF-β1) and hyaluronic acid synthase 2 (HAS-2) were not shown to be significantly different. In conclusion, hyaluronic acid administration regulated expression levels of proteins associated with skin integrity, and improved the wrinkle level in skin subjected to UVB irradiation.

The Mediator subunit SFR6/MED16 controls defence gene expression mediated by salicylic acid and jasmonate responsive pathways.

PubMed

Wathugala, Deepthi L; Hemsley, Piers A; Moffat, Caroline S; Cremelie, Pieter; Knight, Marc R; Knight, Heather

2012-07-01

• Arabidopsis SENSITIVE TO FREEZING6 (SFR6) controls cold- and drought-inducible gene expression and freezing- and osmotic-stress tolerance. Its identification as a component of the MEDIATOR transcriptional co-activator complex led us to address its involvement in other transcriptional responses. • Gene expression responses to Pseudomonas syringae, ultraviolet-C (UV-C) irradiation, salicylic acid (SA) and jasmonic acid (JA) were investigated in three sfr6 mutant alleles by quantitative real-time PCR and susceptibility to UV-C irradiation and Pseudomonas infection were assessed. • sfr6 mutants were more susceptible to both Pseudomonas syringae infection and UV-C irradiation. They exhibited correspondingly weaker PR (pathogenesis-related) gene expression than wild-type Arabidopsis following these treatments or after direct application of SA, involved in response to both UV-C and Pseudomonas infection. Other genes, however, were induced normally in the mutants by these treatments. sfr6 mutants were severely defective in expression of plant defensin genes in response to JA; ectopic expression of defensin genes was provoked in wild-type but not sfr6 by overexpression of ERF5. • SFR6/MED16 controls both SA- and JA-mediated defence gene expression and is necessary for tolerance of Pseudomonas syringae infection and UV-C irradiation. It is not, however, a universal regulator of stress gene transcription and is likely to mediate transcriptional activation of specific regulons only. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Plants having modified response to ethylene

DOEpatents

Meyerowitz, Elliott M.; Chang, Caren; Bleecker, Anthony B.

1997-01-01

The invention includes transformed plants having at least one cell transformed with a modified ETR nucleic acid. Such plants have a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a plant not containing the transformed plant cell. Tissue and/or temporal specificity for expression of the modified ETR nucleic acid is controlled by selecting appropriate expression regulation sequences to target the location and/or time of expression of the transformed nucleic acid. The plants are made by transforming at least one plant cell with an appropriate modified ETR nucleic acid, regenerating plants from one or more of the transformed plant cells and selecting at least one plant having the desired phenotype.

Plants having modified response to ethylene

DOEpatents

Meyerowitz, E.M.; Chang, C.; Bleecker, A.B.

1998-10-20

The invention includes transformed plants having at least one cell transformed with a modified ETR nucleic acid. Such plants have a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a plant not containing the transformed plant cell. Tissue and/or temporal specificity for expression of the modified ETR nucleic acid is controlled by selecting appropriate expression regulation sequences to target the location and/or time of expression of the transformed nucleic acid. The plants are made by transforming at least one plant cell with an appropriate modified ETR nucleic acid, regenerating plants from one or more of the transformed plant cells and selecting at least one plant having the desired phenotype. 67 figs.

Plants having modified response to ethylene

DOEpatents

Meyerowitz, Elliot M.; Chang, Caren; Bleecker, Anthony B.

1998-01-01

The invention includes transformed plants having at least one cell transformed with a modified ETR nucleic acid. Such plants have a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a plant not containing the transformed plant cell. Tissue and/or temporal specificity for expression of the modified ETR nucleic acid is controlled by selecting appropriate expression regulation sequences to target the location and/or time of expression of the transformed nucleic acid. The plants are made by transforming at least one plant cell with an appropriate modified ETR nucleic acid, regenerating plants from one or more of the transformed plant cells and selecting at least one plant having the desired phenotype.

Plants having modified response to ethylene

DOEpatents

Meyerowitz, E.M.; Chang, C.; Bleecker, A.B.

1997-11-18

The invention includes transformed plants having at least one cell transformed with a modified ETR nucleic acid. Such plants have a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a plant not containing the transformed plant cell. Tissue and/or temporal specificity for expression of the modified ETR nucleic acid is controlled by selecting appropriate expression regulation sequences to target the location and/or time of expression of the transformed nucleic acid. The plants are made by transforming at least one plant cell with an appropriate modified ETR nucleic acid, regenerating plants from one or more of the transformed plant cells and selecting at least one plant having the desired phenotype. 31 figs.

Periodic variation in bile acids controls circadian changes in uric acid via regulation of xanthine oxidase by the orphan nuclear receptor PPARα.

PubMed

Kanemitsu, Takumi; Tsurudome, Yuya; Kusunose, Naoki; Oda, Masayuki; Matsunaga, Naoya; Koyanagi, Satoru; Ohdo, Shigehiro

2017-12-29

Xanthine oxidase (XOD), also known as xanthine dehydrogenase, is a rate-limiting enzyme in purine nucleotide degradation, which produces uric acid. Uric acid concentrations in the blood and liver exhibit circadian oscillations in both humans and rodents; however, the underlying mechanisms remain unclear. Here, we demonstrate that XOD expression and enzymatic activity exhibit circadian oscillations in the mouse liver. We found that the orphan nuclear receptor peroxisome proliferator-activated receptor-α (PPARα) transcriptionally activated the mouse XOD gene and that bile acids suppressed XOD transactivation. The synthesis of bile acids is known to be under the control of the circadian clock, and we observed that the time-dependent accumulation of bile acids in hepatic cells interfered with the recruitment of the co-transcriptional activator p300 to PPARα, thereby repressing XOD expression. This time-dependent suppression of PPARα-mediated transactivation by bile acids caused an oscillation in the hepatic expression of XOD, which, in turn, led to circadian alterations in uric acid production. Finally, we also demonstrated that the anti-hyperuricemic effect of the XOD inhibitor febuxostat was enhanced by administering it at the time of day before hepatic XOD activity increased. These results suggest an underlying mechanism for the circadian alterations in uric acid production and also underscore the importance of selecting an appropriate time of day for administering XOD inhibitors. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Hypersensitivity to acid is associated with impaired esophageal mucosal integrity in patients with gastroesophageal reflux disease with and without esophagitis.

PubMed

Weijenborg, Pim W; Smout, André J P M; Verseijden, Caroline; van Veen, Henk A; Verheij, Joanne; de Jonge, Wouter J; Bredenoord, Albert J

2014-08-01

Increased esophageal sensitivity and impaired mucosal integrity have both been described in patients with gastroesophageal reflux disease, but the relationship between hypersensitivity and mucosal integrity is unclear. The aim of the present study was to investigate acid sensitivity in patients with erosive and nonerosive reflux disease and control subjects to determine the relation with functional esophageal mucosal integrity changes as well as to investigate cellular mechanisms of impaired mucosal integrity in these patients. In this prospective experimental study, 12 patients with nonerosive reflux disease, 12 patients with esophagitis grade A or B, and 11 healthy control subjects underwent an acid perfusion test and upper endoscopy. Mucosal integrity was measured during endoscopy by electrical tissue impedance spectroscopy and biopsy specimens were analyzed in Ussing chambers for transepithelial electrical resistance, transepithelial permeability and gene expression of tight junction proteins and filaggrin. Patients with nonerosive reflux disease and esophagitis were more sensitive to acid perfusion compared with control subjects, having a shorter time to perception of heartburn and higher perceived intensity of heartburn. In reflux patients, enhanced acid sensitivity was associated with impairment of in vivo and vitro esophageal mucosal integrity. Mucosal integrity was significantly impaired in patients with esophagitis, displaying higher transepithelial permeability and lower extracellular impedance. Although no significant differences in the expression of tight junction proteins were found in biopsies among patient groups, mucosal integrity parameters in reflux patients correlated negatively with the expression of filaggrin. In conclusion, sensitivity to acid is enhanced in patients with gastroesophageal reflux disease, irrespective of the presence of erosions, and is associated with impaired esophageal mucosal integrity. Mucosal integrity of the esophagus is associated with the expression of filaggrin. Copyright © 2014 the American Physiological Society.

The α-lipoic acid improves high-fat diet-induced cerebral damage through inhibition of oxidative stress and inflammatory reaction.

PubMed

Liu, Yang; Zhang, Qinghua; Wang, Li; Wang, Hui; Sun, Tao; Xia, Hechun; Yang, Yi; Zhang, Li

2017-12-01

This study is to clarify the protective role of α-lipoic acid in high-fat diet-induced cerebral damage mice. The mice were divided into 5 groups: normal control group, high-fat diet (HFD) group, low-dose α-lipoic acid group for prevention, high-dose α-lipoic acid group for prevention, and high-dose α-lipoic acid group for treatment. The groups' weights and blood glucose changes were monitored. We used HE staining to observe morphological changes in the cerebral cortex. The expression levels of the oxidative stress proteins SOD2, catalase, and the inflammatory pathway proteins p-JNK, p-ERK were measured by western blot and immunochemistry. Compared with the control group, the quantity of cortical neurons in the HFD group was decreased, and the samples exhibited retrogression. However, the lipoic acid significantly protected and promoted the cortical neurons survival. Moreover, compared with the HFD group, the expression levels of SOD2 and catalase in the three α-lipoic acid obtained groups were significantly increased. However, the expression levels of the inflammatory pathway proteins p-JNK and p-ERK were significantly decreased. These results indicate that theα-lipoic acid greatly protects the cortical neurons, and inhibited the oxidative stress and inflammatory reactions in the high-fat diet mice. Copyright © 2017 Elsevier B.V. All rights reserved.

Silicic Acid and Beer Consumption Reverses the Metal Imbalance and the Prooxidant Status Induced by Aluminum Nitrate in Mouse Brain.

PubMed

González-Muñoz, María José; Garcimartán, Alba; Meseguer, Isabel; Mateos-Vega, Carmen José; Orellana, José María; Peña-Fernández, Antonio; Benedí, Juana; Sánchez-Muniz, Francisco J

2017-01-01

Emerging evidence suggests that by affecting mineral balance, aluminum (Al) may enhance some events associated with neurodegenerative diseases. To examine the effect of Al(NO3)3 exposure on brain Al, cooper (Cu), iron (Fe), magnesium (Mg), manganese (Mn), silicon (Si), and zinc (Zn) levels, and the metal-change implication in brain oxidant and inflammatory status. Four groups of six-week-old male NMRI mice were treated for three months: i) controls, administrated with deionized water; ii) Al, which received Al(NO3)3; iii) Al+silicic acid, which were given Al(NO3)3 plus silicic acid; and iv) Al+beer, which received Al(NO3)3 plus beer. Brain Al and TBARS levels and TNFα and GPx expressions increased, while Cu, Mn, and Zn levels, and catalase and CuZn-SOD expression decreased (at least, p < 0.05) in Al versus control animals. Al, Si, and TBARS levels and TNFα expression decreased (p < 0.05) in Al+silicic acid and Al+beer specimens while Cu, Mn, and Zn levels and antioxidant expression increased versus the Al group. Brain Al levels correlated negatively with those of Cu, Fe, Mn, and Zn, and catalase, CuZn-SOD, and GPx enzyme expressions but positively with Si and TBARS levels and TNFα expression. Two components of the principal component analysis (PCA) explained 71.2% of total data variance (p < 0.001). PCA connected the pro-oxidant markers with brain Al content, while brain Zn and Cu levels were closer to antioxidant enzyme expression. Administration of Al(NO3)3 induced metal imbalance, inflammation, and antioxidant status impairment in the brain. Those effects were blocked to a significant extent by silicic acid and beer administration.

Alpha-Lipoic Acid Alleviates Acute Inflammation and Promotes Lipid Mobilization During the Inflammatory Response in White Adipose Tissue of Mice.

PubMed

Guo, Jun; Gao, Shixing; Liu, Zhiqing; Zhao, Ruqian; Yang, Xiaojing

2016-10-01

Recently, white adipose tissue has been shown to exhibit immunological activity, and may play an important role in host defense and protection against bacterial infection. Αlpha-lipoic acid (α-LA) has been demonstrated to function as an anti-inflammatory and anti-oxidant agent. However, its influence on the inflammatory response and metabolic changes in white adipose tissue remains unknown. We used male C57BL/6 mice as models to study the effect of α-LA on the inflammatory response and metabolic changes in white adipose tissue after stimulation with lipopolysaccharide (LPS). The non-esterified fatty acid content was measured by an automatic biochemical analyzer. The expression of inflammation-, lipid- and energy metabolism-related genes and proteins was determined by quantitative real-time polymerase chain reaction and western blotting. The results indicated that α-LA significantly decreased the epididymis fat weight index and the non-esterified fatty acid content in plasma compared with the control group. LPS significantly increased the expression of inflammation genes and α-LA reduced their expression. The LPS-induced expression of nuclear factor-κB protein was decreased by α-LA. Regarding lipid metabolism, α-LA significantly counteracted the inhibitory effects of LPS on the expression of hormone-sensitive lipase gene and protein. α-LA evidently increased the gene expression of fatty acid transport protein 1 and cluster of differentiation 36. Regarding energy metabolism, α-LA significantly increased the expression of most of mitochondrial DNA-encoded genes compared with the control and LPS group. Accordingly, α-LA can alleviate acute inflammatory response and this action may be related with the promotion of lipid mobilization in white adipose tissue.

Fatty acid-binding protein 4 (FABP4) and FABP5 modulate cytokine production in the mouse thymic epithelial cells.

PubMed

Adachi, Yasuhiro; Hiramatsu, Sumie; Tokuda, Nobuko; Sharifi, Kazem; Ebrahimi, Majid; Islam, Ariful; Kagawa, Yoshiteru; Koshy Vaidyan, Linda; Sawada, Tomoo; Hamano, Kimikazu; Owada, Yuji

2012-09-01

Thymic stromal cells, including cortical thymic epithelial cells (cTEC) produce many humoral factors, such as cytokines and eicosanoids to modulate thymocyte homeostasis, thereby regulating the peripheral immune responses. In this study, we identified fatty acid-binding protein (FABP4), an intracellular fatty acid chaperone, in the mouse thymus, and examined its role in the control of cytokine production in comparison with FABP5. By immunofluorescent staining, FABP4(+) cells enclosing the thymocytes were scattered throughout the thymic cortex with a spatial difference from the FABP5(+) cell that were distributed widely throughout the cTEC. The FABP4(+) cells were immunopositive for MHC class II, NLDC145 and cytokeratin 8, and were identified as part of cTEC. The FABP4(+) cells were identified as thymic nurse cells (TNC), a subpopulation of cTEC, by their active phagocytosis of apoptotic thymocytes. Furthermore, FABP4 expression was confirmed in the isolated TNC at the gene and protein levels. To explore the function of FABP in TNC, TSt-4/DLL1 cells stably expressing either FABP4 or FABP5 were established and the gene expressions of various cytokines were examined. The gene expression of interleukin (IL)-7 and IL-18 was increased both in FABP4 and FABP5 over-expressing cells compared with controls, and moreover, the increase in their expressions by adding of stearic acids was significantly enhanced in the FABP4 over-expressing cells. These data suggest that both FABPs are involved in the maintenance of T lymphocyte homeostasis through the modulation of cytokine production, which is possibly regulated by cellular fatty acid-mediated signaling in TEC, including TNC.

Uncoupling of Obesity from Insulin Resistance Through a Targeted Mutation in aP2, the Adipocyte Fatty Acid Binding Protein

NASA Astrophysics Data System (ADS)

Hotamisligil, Gokhan S.; Johnson, Randall S.; Distel, Robert J.; Ellis, Ramsey; Papaioannou, Virginia E.; Spiegelman, Bruce M.

1996-11-01

Fatty acid binding proteins (FABPs) are small cytoplasmic proteins that are expressed in a highly tissue-specific manner and bind to fatty acids such as oleic and retinoic acid. Mice with a null mutation in aP2, the gene encoding the adipocyte FABP, were developmentally and metabolically normal. The aP2-deficient mice developed dietary obesity but, unlike control mice, they did not develop insulin resistance or diabetes. Also unlike their obese wild-type counterparts, obese aP2-/- animals failed to express in adipose tissue tumor necrosis factor-α (TNF-α), a molecule implicated in obesity-related insulin resistance. These results indicate that aP2 is central to the pathway that links obesity to insulin resistance, possibly by linking fatty acid metabolism to expression of TNF-α.

Tumorigenic properties of iron regulatory protein 2 (IRP2) mediated by its specific 73-amino acids insert.

PubMed

Maffettone, Carmen; Chen, Guohua; Drozdov, Ignat; Ouzounis, Christos; Pantopoulos, Kostas

2010-04-13

Iron regulatory proteins, IRP1 and IRP2, bind to mRNAs harboring iron responsive elements and control their expression. IRPs may also perform additional functions. Thus, IRP1 exhibited apparent tumor suppressor properties in a tumor xenograft model. Here we examined the effects of IRP2 in a similar setting. Human H1299 lung cancer cells or clones engineered for tetracycline-inducible expression of wild type IRP2, or the deletion mutant IRP2(Delta73) (lacking a specific insert of 73 amino acids), were injected subcutaneously into nude mice. The induction of IRP2 profoundly stimulated the growth of tumor xenografts, and this response was blunted by addition of tetracycline in the drinking water of the animals, to turnoff the IRP2 transgene. Interestingly, IRP2(Delta73) failed to promote tumor growth above control levels. As expected, xenografts expressing the IRP2 transgene exhibited high levels of transferrin receptor 1 (TfR1); however, the expression of other known IRP targets was not affected. Moreover, these xenografts manifested increased c-MYC levels and ERK1/2 phosphorylation. A microarray analysis identified distinct gene expression patterns between control and tumors containing IRP2 or IRP1 transgenes. By contrast, gene expression profiles of control and IRP2(Delta73)-related tumors were more similar, consistently with their growth phenotype. Collectively, these data demonstrate an apparent pro-oncogenic activity of IRP2 that depends on its specific 73 amino acids insert, and provide further evidence for a link between IRPs and cancer biology.

Tumorigenic Properties of Iron Regulatory Protein 2 (IRP2) Mediated by Its Specific 73-Amino Acids Insert

PubMed Central

Maffettone, Carmen; Chen, Guohua; Drozdov, Ignat; Ouzounis, Christos; Pantopoulos, Kostas

2010-01-01

Iron regulatory proteins, IRP1 and IRP2, bind to mRNAs harboring iron responsive elements and control their expression. IRPs may also perform additional functions. Thus, IRP1 exhibited apparent tumor suppressor properties in a tumor xenograft model. Here we examined the effects of IRP2 in a similar setting. Human H1299 lung cancer cells or clones engineered for tetracycline-inducible expression of wild type IRP2, or the deletion mutant IRP2Δ73 (lacking a specific insert of 73 amino acids), were injected subcutaneously into nude mice. The induction of IRP2 profoundly stimulated the growth of tumor xenografts, and this response was blunted by addition of tetracycline in the drinking water of the animals, to turnoff the IRP2 transgene. Interestingly, IRP2Δ73 failed to promote tumor growth above control levels. As expected, xenografts expressing the IRP2 transgene exhibited high levels of transferrin receptor 1 (TfR1); however, the expression of other known IRP targets was not affected. Moreover, these xenografts manifested increased c-MYC levels and ERK1/2 phosphorylation. A microarray analysis identified distinct gene expression patterns between control and tumors containing IRP2 or IRP1 transgenes. By contrast, gene expression profiles of control and IRP2Δ73-related tumors were more similar, consistently with their growth phenotype. Collectively, these data demonstrate an apparent pro-oncogenic activity of IRP2 that depends on its specific 73 amino acids insert, and provide further evidence for a link between IRPs and cancer biology. PMID:20405006

Agdc1p – a Gallic Acid Decarboxylase Involved in the Degradation of Tannic Acid in the Yeast Blastobotrys (Arxula) adeninivorans

PubMed Central

Meier, Anna K.; Worch, Sebastian; Böer, Erik; Hartmann, Anja; Mascher, Martin; Marzec, Marek; Scholz, Uwe; Riechen, Jan; Baronian, Kim; Schauer, Frieder; Bode, Rüdiger; Kunze, Gotthard

2017-01-01

Tannins and hydroxylated aromatic acids, such as gallic acid (3,4,5-trihydroxybenzoic acid), are plant secondary metabolites which protect plants against herbivores and plant-associated microorganisms. Some microbes, such as the yeast Arxula adeninivorans are resistant to these antimicrobial substances and are able to use tannins and gallic acid as carbon sources. In this study, the Arxula gallic acid decarboxylase (Agdc1p) which degrades gallic acid to pyrogallol was characterized and its function in tannin catabolism analyzed. The enzyme has a higher affinity for gallic acid (Km −0.7 ± 0.2 mM, kcat −42.0 ± 8.2 s−1) than to protocatechuic acid (3,4-dihydroxybenzoic acid) (Km −3.2 ± 0.2 mM, kcat −44.0 ± 3.2 s−1). Other hydroxylated aromatic acids, such as 3-hydroxybenzoic acid, 4-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid and 2,5-dihydroxybenzoic acid are not gallic acid decarboxylase substrates. A. adeninivorans G1212/YRC102-AYNI1-AGDC1, which expresses the AGDC1 gene under the control of the strong nitrate inducible AYNI1 promoter achieved a maximum gallic acid decarboxylase activity of 1064.4 U/l and 97.5 U/g of dry cell weight in yeast grown in minimal medium with nitrate as nitrogen source and glucose as carbon source. In the same medium, gallic acid decarboxylase activity was not detected for the control strain G1212/YRC102 with AGDC1 expression under the control of the endogenous promoter. Gene expression analysis showed that AGDC1 is induced by gallic acid and protocatechuic acid. In contrast to G1212/YRC102-AYNI1-AGDC1 and G1212/YRC102, A. adeninivorans G1234 [Δagdc1] is not able to grow on medium with gallic acid as carbon source but can grow in presence of protocatechuic acid. This confirms that Agdc1p plays an essential role in the tannic acid catabolism and could be useful in the production of catechol and cis,cis-muconic acid. However, the protocatechuic acid catabolism via Agdc1p to catechol seems to be not the only degradation pathway. PMID:28966611

Agdc1p - a Gallic Acid Decarboxylase Involved in the Degradation of Tannic Acid in the Yeast Blastobotrys (Arxula) adeninivorans.

PubMed

Meier, Anna K; Worch, Sebastian; Böer, Erik; Hartmann, Anja; Mascher, Martin; Marzec, Marek; Scholz, Uwe; Riechen, Jan; Baronian, Kim; Schauer, Frieder; Bode, Rüdiger; Kunze, Gotthard

2017-01-01

Tannins and hydroxylated aromatic acids, such as gallic acid (3,4,5-trihydroxybenzoic acid), are plant secondary metabolites which protect plants against herbivores and plant-associated microorganisms. Some microbes, such as the yeast Arxula adeninivorans are resistant to these antimicrobial substances and are able to use tannins and gallic acid as carbon sources. In this study, the Arxula gallic acid decarboxylase (Agdc1p) which degrades gallic acid to pyrogallol was characterized and its function in tannin catabolism analyzed. The enzyme has a higher affinity for gallic acid (K m -0.7 ± 0.2 mM, k cat -42.0 ± 8.2 s -1 ) than to protocatechuic acid (3,4-dihydroxybenzoic acid) (K m -3.2 ± 0.2 mM, k cat -44.0 ± 3.2 s -1 ). Other hydroxylated aromatic acids, such as 3-hydroxybenzoic acid, 4-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid and 2,5-dihydroxybenzoic acid are not gallic acid decarboxylase substrates. A. adeninivorans G1212/YRC102-AYNI1-AGDC1, which expresses the AGDC1 gene under the control of the strong nitrate inducible AYNI1 promoter achieved a maximum gallic acid decarboxylase activity of 1064.4 U/l and 97.5 U/g of dry cell weight in yeast grown in minimal medium with nitrate as nitrogen source and glucose as carbon source. In the same medium, gallic acid decarboxylase activity was not detected for the control strain G1212/YRC102 with AGDC1 expression under the control of the endogenous promoter. Gene expression analysis showed that AGDC1 is induced by gallic acid and protocatechuic acid. In contrast to G1212/YRC102-AYNI1-AGDC1 and G1212/YRC102, A. adeninivorans G1234 [Δ agdc1 ] is not able to grow on medium with gallic acid as carbon source but can grow in presence of protocatechuic acid. This confirms that Agdc1p plays an essential role in the tannic acid catabolism and could be useful in the production of catechol and cis,cis -muconic acid. However, the protocatechuic acid catabolism via Agdc1p to catechol seems to be not the only degradation pathway.

Down-Regulation of Placental Transport of Amino Acids Precedes the Development of Intrauterine Growth Restriction in Maternal Nutrient Restricted Baboons1

PubMed Central

Pantham, Priyadarshini; Rosario, Fredrick J.; Weintraub, Susan T.; Nathanielsz, Peter W.; Powell, Theresa L.; Li, Cun; Jansson, Thomas

2016-01-01

Intrauterine growth restriction (IUGR) is an important risk factor for perinatal complications and adult disease. IUGR is associated with down-regulation of placental amino acid transporter expression and activity at birth. It is unknown whether these changes are a cause or a consequence of human IUGR. We hypothesized that placental amino acid transport capacity is reduced prior to onset of reduced fetal growth in baboons with maternal nutrient restriction (MNR). Pregnant baboons were fed either a control (n = 8) or MNR diet (70% of control diet, n = 9) from Gestational Day 30. At Gestational Day 120 (0.65 of gestation), fetuses and placentas were collected. Microvillous (MVM) and basal (BM) plasma membrane vesicles were isolated. System A and system L transport activity was determined in MVM, and leucine transporter activity was assessed in BM using radiolabeled substrates. MVM amino acid transporter isoform expression (SNAT1, SNAT2, and SNAT4 and LAT1 and LAT2) was measured using Western blots. LAT1 and LAT2 expression were also determined in BM. Maternal and fetal plasma amino acids concentrations were determined using mass spectrometry. Fetal and placental weights were unaffected by MNR. MVM system A activity was decreased by 37% in MNR baboon placentas (P = 0.03); however MVM system A amino acid transporter protein expression was unchanged. MVM system L activity and BM leucine transporter activity were not altered by MNR. Fetal plasma concentrations of essential amino acids isoleucine and leucine were reduced, while citrulline increased (P < 0.05) in MNR fetuses compared to controls. In this primate model of IUGR, placental MVM system A amino acid transporter activity is decreased prior to the onset of reduction in the fetal growth trajectory. The reduction in plasma leucine and isoleucine in MNR fetuses may be caused by reduced activity of MVM system A, which is strongly coupled with system L essential amino acid uptake. Our findings indicate that reduced placental amino acid transport may be a cause rather than a consequence of IUGR due to inadequate maternal nutrition. PMID:27605346

Down-Regulation of Placental Transport of Amino Acids Precedes the Development of Intrauterine Growth Restriction in Maternal Nutrient Restricted Baboons.

PubMed

Pantham, Priyadarshini; Rosario, Fredrick J; Weintraub, Susan T; Nathanielsz, Peter W; Powell, Theresa L; Li, Cun; Jansson, Thomas

2016-11-01

Intrauterine growth restriction (IUGR) is an important risk factor for perinatal complications and adult disease. IUGR is associated with down-regulation of placental amino acid transporter expression and activity at birth. It is unknown whether these changes are a cause or a consequence of human IUGR. We hypothesized that placental amino acid transport capacity is reduced prior to onset of reduced fetal growth in baboons with maternal nutrient restriction (MNR). Pregnant baboons were fed either a control (n = 8) or MNR diet (70% of control diet, n = 9) from Gestational Day 30. At Gestational Day 120 (0.65 of gestation), fetuses and placentas were collected. Microvillous (MVM) and basal (BM) plasma membrane vesicles were isolated. System A and system L transport activity was determined in MVM, and leucine transporter activity was assessed in BM using radiolabeled substrates. MVM amino acid transporter isoform expression (SNAT1, SNAT2, and SNAT4 and LAT1 and LAT2) was measured using Western blots. LAT1 and LAT2 expression were also determined in BM. Maternal and fetal plasma amino acids concentrations were determined using mass spectrometry. Fetal and placental weights were unaffected by MNR. MVM system A activity was decreased by 37% in MNR baboon placentas (P = 0.03); however MVM system A amino acid transporter protein expression was unchanged. MVM system L activity and BM leucine transporter activity were not altered by MNR. Fetal plasma concentrations of essential amino acids isoleucine and leucine were reduced, while citrulline increased (P < 0.05) in MNR fetuses compared to controls. In this primate model of IUGR, placental MVM system A amino acid transporter activity is decreased prior to the onset of reduction in the fetal growth trajectory. The reduction in plasma leucine and isoleucine in MNR fetuses may be caused by reduced activity of MVM system A, which is strongly coupled with system L essential amino acid uptake. Our findings indicate that reduced placental amino acid transport may be a cause rather than a consequence of IUGR due to inadequate maternal nutrition. © 2016 by the Society for the Study of Reproduction, Inc.

Maternal protein restriction in the rat inhibits placental insulin, mTOR, and STAT3 signaling and down-regulates placental amino acid transporters.

PubMed

Rosario, Fredrick J; Jansson, Nina; Kanai, Yoshikatsu; Prasad, Puttur D; Powell, Theresa L; Jansson, Thomas

2011-03-01

The mechanisms underlying reduced fetal growth in response to maternal protein restriction are not well established. Maternal levels of insulin, IGF-I, and leptin are decreased in rats fed a low protein (LP) diet. Because these hormones stimulate placental amino acid transporters in vitro, we hypothesized that maternal protein restriction inhibits placental leptin, insulin/IGF-I, and mammalian target of rapamycin signaling and down-regulates the expression and activity of placental amino acid transporters. Pregnant rats were fed either an isocaloric low protein (LP, 4% protein) or control diet (18% protein) and studied at gestational day (GD)15, GD19, or GD21 (term 23). At GD19 and GD21, placental expression of phosphorylated eukaryotic initiation factor 4E binding protein 1 (Thr-36/46 or Thr-70) and phosphorylated S6 ribosomal protein (Ser-235/236) was decreased in the LP group. In addition, placental expression of phosphorylated S6 kinase 1 (Thr-389), phosphorylated Akt (Thr-308), and phosphorylated signal transducer and activator of transcription 3 (Tyr-705) was reduced at GD21. In microvillous plasma membranes (MVM) isolated from placentas of LP animals, protein expression of the sodium-coupled neutral amino acid transporter (SNAT)2 and the large neutral amino acid transporters 1 and 2 was reduced at GD19 and GD21. MVM SNAT1 protein expression was reduced at GD21 in LP rats. SNAT4 and 4F2 heavy chain expression in MVM was unaltered. System A and L amino acid transporter activity was decreased in MVM from LP animals at GD19 and GD21. In conclusion, maternal protein restriction inhibits placental insulin, mammalian target of rapamycin signaling, and signal transducer and activator of transcription 3 signaling, which is associated with a down-regulation of placental amino acid transporters. We speculate that maternal endocrine and metabolic control of placental nutrient transport reduces fetal growth in response to protein restriction.

A SHATTERPROOF-like gene controls ripening in non-climacteric strawberries, and auxin and abscisic acid antagonistically affect its expression.

PubMed

Daminato, Margherita; Guzzo, Flavia; Casadoro, Giorgio

2013-09-01

Strawberries (Fragaria×ananassa) are false fruits the ripening of which follows the non-climacteric pathway. The role played by a C-type MADS-box gene [SHATTERPROOF-like (FaSHP)] in the ripening of strawberries has been studied by transiently modifying gene expression through either over-expression or RNA-interference-mediated down-regulation. The altered expression of the FaSHP gene caused a change in the time taken by the over-expressing and the down- regulated fruits to attain the pink stage, which was slightly shorter and much longer, respectively, compared to controls. In parallel with the modified ripening times, the metabolome components and the expression of ripening-related genes also appeared different in the transiently modified fruits. Differences in the response time of the analysed genes suggest that FaSHP can control the expression of ripening genes either directly or indirectly through other transcription factor-encoding genes. Because fleshy strawberries are false fruits these results indicate that C-type MADS-box genes like SHATTERPROOF may act as modulators of ripening in fleshy fruit-like structures independently of their anatomical origin. Treatment of strawberries with either auxin or abscisic acid had antagonistic impacts on both the expression of FaSHP and the expression of ripening-related genes and metabolome components.

Increased PSA expression on prostate cancer exosomes in in vitro condition and in cancer patients.

PubMed

Logozzi, Mariantonia; Angelini, Daniela F; Iessi, Elisabetta; Mizzoni, Davide; Di Raimo, Rossella; Federici, Cristina; Lugini, Luana; Borsellino, Giovanna; Gentilucci, Alessandro; Pierella, Federico; Marzio, Vittorio; Sciarra, Alessandro; Battistini, Luca; Fais, Stefano

2017-09-10

Prostate specific antigen (PSA) test is the most common, clinically validated test for the diagnosis of prostate cancer (PCa). While neoplastic lesions of the prostate may cause aberrant levels of PSA in the blood, the quantitation of free or complexed PSA poorly discriminates cancer patients from those developing benign lesions, often leading to invasive and unnecessary surgical procedures. Microenvironmental acidity increases exosome release by cancer cells. In this study we evaluated whether acidity, a critical phenotype of malignancy, could influence exosome release and increase the PSA expression in nanovesicles released by PCa cells. To this aim, we exploited Nanoparticle Tracking Analysis (NTA), an immunocapture-based ELISA, and nanoscale flow-cytometry. The results show that microenvironmental acidity induces an increased release of nanovesicles expressing both PSA and the exosome marker CD81. In order to verify whether the changes induced by the local selective pressure of extracellular acidity may correspond to a clinical pathway we used the same approach to evaluate the levels of PSA-expressing exosomes in the plasma of PCa patients and controls, including subjects with benign prostatic hypertrophy (BPH). The results show that only PCa patients have high levels of nanovesicles expressing both CD81 and PSA. This study shows that tumor acidity exerts a selective pressure leading to the release of extracellular vesicles that express both PSA and exosome markers. A comparable scenario was shown in the plasma of prostate cancer patients as compared to both BPH and healthy controls. These results suggest that microenvironmental acidity may represent a key factor which determines qualitatively and quantitatively the release of extracellular vesicles by malignant tumors, including prostate cancer. This condition leads to the spill-over of nanovesicles into the peripheral blood of prostate cancer patients, where the levels of tumor biomarkers expressed by exosomes, such as PSA-exosomes, may represent a novel, non-invasive clinical tool for the screening and early diagnosis of prostate cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

Citrulline and Nonessential Amino Acids Prevent Fructose-Induced Nonalcoholic Fatty Liver Disease in Rats.

PubMed

Jegatheesan, Prasanthi; Beutheu, Stéphanie; Ventura, Gabrielle; Nubret, Esther; Sarfati, Gilles; Bergheim, Ina; De Bandt, Jean-Pascal

2015-10-01

Fructose induces nonalcoholic fatty liver disease (NAFLD). Citrulline (Cit) may exert a beneficial effect on steatosis. We compared the effects of Cit and an isonitrogenous mixture of nonessential amino acids (NEAAs) on fructose-induced NAFLD. Twenty-two male Sprague Dawley rats were randomly assigned into 4 groups (n = 4-6) to receive for 8 wk a 60% fructose diet, either alone or supplemented with Cit (1 g · kg(-1) · d(-1)), or an isonitrogenous amount of NEAAs, or the same NEAA-supplemented diet with starch and maltodextrin instead of fructose (controls). Nutritional and metabolic status, liver function, and expression of genes of hepatic lipid metabolism were determined. Compared with controls, fructose led to NAFLD with significantly higher visceral fat mass (128%), lower lean body mass (-7%), insulin resistance (135%), increased plasma triglycerides (TGs; 67%), and altered plasma amino acid concentrations with decreased Arg bioavailability (-27%). This was corrected by both NEAA and Cit supplementation. Fructose caused a 2-fold increase in the gene expression of fatty acid synthase (Fas) and 70% and 90% decreases in that of carnitine palmitoyl-transferase 1a and microsomal TG transfer protein via a nearly 10-fold higher gene expression of sterol regulatory element-binding protein-1c (Srebp1c) and carbohydrate-responsive element-binding protein (Chrebp), and a 90% lower gene expression of peroxisome proliferator-activated receptor α (Ppara). NEAA or Cit supplementation led to a Ppara gene expression similar to controls and decreased those of Srebp1c and Chrebp in the liver by 50-60%. Only Cit led to Fas gene expression and Arg bioavailability similar to controls. In our rat model, Cit and NEAAs effectively prevented fructose-induced NAFLD. On the basis of literature data and our findings, we propose that NEAAs may exert their effects specifically on the liver, whereas Cit presumably acts at both the hepatic and whole-body level, in part via improved peripheral Arg metabolism. © 2015 American Society for Nutrition.

IL-33 stimulates expression of the GPR84 (EX33) fatty acid receptor gene and of cytokine and chemokine genes in human adipocytes.

PubMed

Zaibi, Mohamed S; Kępczyńska, Małgorzata A; Harikumar, Parvathy; Alomar, Suliman Y; Trayhurn, Paul

2018-05-15

Expression of GPCR fatty acid sensor/receptor genes in adipocytes is modulated by inflammatory mediators, particularly IL-1β. In this study we examined whether the IL-1 gene superfamily member, IL-33, also regulates expression of the fatty acid receptor genes in adipocytes. Human fat cells, differentiated from preadipocytes, were incubated with IL-33 at three different dose levels for 3 or 24 h and mRNA measured by qPCR. Treatment with IL-33 induced a dose-dependent increase in GPR84 mRNA at 3 h, the level with the highest dose being 13.7-fold greater than in controls. Stimulation of GPR84 expression was transitory; the mRNA level was not elevated at 24 h. In contrast to GPR84, IL-33 had no effect on GPR120 expression. IL-33 markedly stimulated expression of the IL1B, CCL2, IL6, CXCL2 and CSF3 genes, but there was no effect on ADIPOQ expression. The largest effect was on CSF3, the mRNA level of which increased 183-fold over controls at 3 h with the highest dose of IL-33; there was a parallel increase in the secretion of G-CSF protein into the medium. It is concluded that in human adipocytes IL-33, which is synthesised in adipose tissue, has a strong stimulatory effect on the expression of cytokine and chemokine genes, particularly CSF3, and on the expression of GPR84, a pro-inflammatory fatty acid receptor. Copyright © 2018 Elsevier Ltd. All rights reserved.

Molecular cloning and characterization of a KCS gene from Cardamine graeca and its heterologous expression in Brassica oilseeds to engineer high nervonic acid oils for potential medical and industrial use.

PubMed

Taylor, David C; Francis, Tammy; Guo, Yiming; Brost, Jennifer M; Katavic, Vesna; Mietkiewska, Elzbieta; Michael Giblin, E; Lozinsky, Sharla; Hoffman, Travis

2009-12-01

Nervonic acid 24:1 Delta15 (cis-tetracos-15-enoic acid) is a very long-chain monounsaturated fatty acid and exists in nature as an elongation product of oleic acid. There is an increasing interest in production of high nervonic acid oils for pharmaceutical, nutraceutical and industrial applications. Using a polymerase chain reaction approach, we have isolated a gene from Cardamine graeca L., which encodes a 3-ketoacyl-CoA synthase (KCS), the first component of the elongation complex involved in synthesis of nervonic acid. Expression of the Cardamine KCS in yeast resulted in biosynthesis of nervonic acid, which is not normally present in yeast cells. We transformed Arabidopsis and Brassica carinata with the Cardamine KCS under the control of the seed-specific promoter, napin. The T(3) generations of transgenic Arabidopsis and B. carinata plants expressing the Cardamine KCS showed that seed-specific expression resulted in relatively large comparative increases in nervonic acid proportions in Arabidopsis seed oil, and 15-fold increase in nervonic acid proportions in B. carinata seed oil. The highest nervonic acid level in transgenic B. carinata lines reached 44%, with only 6% of residual erucic acid. In contrast, similar transgenic expression of the Cardamine KCS in high erucic B. napus resulted in 30% nervonic acid but with 20% residual erucic acid. Experiments using the Lunaria KCS gene gave results similar to the latter. In both cases, the erucic acid content is too high for human or animal consumption. Thus, the Cardamine KCS: B. carinata high nervonic/highly reduced erucic transgenic seed oils will be the most suitable for testing in pharmaceutical/nutraceutical applications to improve human and animal health.

Dietary fish oil supplements increase tissue n-3 fatty acid composition and expression of delta-6 desaturase and elongase-2 in Jade Tiger hybrid abalone.

PubMed

Mateos, Hintsa T; Lewandowski, Paul A; Su, Xiao Q

2011-08-01

This study was conducted to investigate the effects of fish oil (FO) supplements on fatty acid composition and the expression of ∆6 desaturase and elongase 2 genes in Jade Tiger abalone. Five test diets were formulated to contain 0.5, 1.0, 1.5, 2.0 and 2.5% of FO respectively, and the control diet was the normal commercial abalone diet with no additional FO supplement. The muscle, gonad and digestive glands (DG) of abalone fed with all of the five test diets showed significantly high levels of total n-3 polyunsaturated fatty acid (PUFA), eicosapentaenoic acid (EPA), docosapentaenoic acid n-3 (DPAn-3), and docosahexaenoic acid (DHA) than the control group. In all three types of tissue, abalone fed diet supplemented with 1.5% FO showed the highest level of these fatty acids (P < 0.05). For DPAn-3 the higher level was also found in muscle and gonad of abalone fed diet supplemented with 2% FO (P < 0.05). Elongase 2 expression was markedly higher in the muscle of abalone fed diet supplemented with 1.5% FO (P < 0.05), followed by the diet containing 2% FO supplement. For ∆6 desaturase, significantly higher expression was observed in muscle of abalone fed with diet containing 0.5% FO supplement (P < 0.05). Supplementation with FO in the normal commercial diet can significantly improve long chain n-3 PUFA level in cultured abalone, with 1.5% being the most effective supplementation level.

The Effects of Omega-3 Fatty Acids Supplementation on Gene Expression Involved in the Insulin and Lipid Signaling Pathway in Patients with Polycystic Ovary Syndrome.

PubMed

Nasri, Khadijeh; Hantoushzadeh, Sedigheh; Aghadavod, Esmat; Taghizadeh, Mohsen; Asemi, Zatollah

2017-06-01

Limited data are available evaluating the effects of omega-3 fatty acids supplementation on gene expression involved in the insulin and lipid-signaling pathway in women with polycystic ovary syndrome (PCOS). This study was conducted to evaluate the effects of omega-3 fatty acids supplementation on gene expression involved in the insulin and lipid signaling pathway in women with PCOS. This randomized double blind, placebo-controlled trial was done among 60 women aged 18-40 years old and diagnosed with PCOS according to the Rotterdam criteria. Participants were randomly assigned into 2 groups to receive either 1 000 mg omega-3 fatty acids from flaxseed oil containing 400 mg α-linolenic acid (n=30) or placebo (n=30) twice a day for 12 weeks. Gene expressions involved in the insulin and lipid-signaling pathway were quantified in blood samples of PCOS women with RT-PCR method. Quantitative results of RT-PCR demonstrated that compared with the placebo, omega-3 fatty acids supplementation upregulated peroxisome proliferator-activated receptor gamma (PPAR-γ) mRNA (p=0.005) in peripheral blood mononuclear cells of women with PCOS. In addition, compared to the placebo, omega-3 fatty acids supplementation downregulated expressed levels of oxidized low-density lipoprotein receptor (LDLR) mRNA (p=0.002) in peripheral blood mononuclear cells of women with PCOS. We did not observe any significant effect of omega-3 fatty acids supplementation on expressed levels of glucose transporter 1 (GLUT-1) and lipoprotein(a) [Lp(a)] genes in peripheral blood mononuclear cells. Overall, omega-3 fatty acids supplementation for 12 weeks in PCOS women significantly improved gene expression of PPAR-γ and LDLR. © Georg Thieme Verlag KG Stuttgart · New York.

A randomized controlled experimental study of the efficacy of platelet-rich plasma and hyaluronic acid for the prevention of adhesion formation in a rat uterine horn model.

PubMed

Oz, Murat; Cetinkaya, Nilufer; Bas, Sevda; Korkmaz, Elmas; Ozgu, Emre; Terzioglu, Gokay Serdar; Buyukkagnici, Umran; Akbay, Serap; Caydere, Muzaffer; Gungor, Tayfun

2016-09-01

Platelet-rich plasma (PRP) has been known to possess an efficacy in tissue regeneration. The aim of this study was to determine the role of PRP on post-operative adhesion formation in an experimental rat study. Thirty Sprague-Dawley rats were randomly divided into control, hyaluronic acid, and PRP treatment groups and operated on for uterine horn adhesion modeling. Blood was collected to produce a PRP with platelet counts of 688 × 10(3)/μL, and 1 ml of either hyaluronic acid gel or PRP was administered over the standard lesions, while the control group received no medication. The evaluation of post-operative adhesions was done on the 30th post-operative day. The location, extent, type, and tenacity of adhesions as well as total adhesion scores, tissue inflammation, fibrosis and transforming growth factor-1beta (TGF-1β) expressions were evaluated. The total adhesion score was significantly lower in the PRP group (3.2 ± 1.5) compared with the hyaluronic acid (5.0 ± 1.3) and control (8.1 ± 1.7) groups. The extent of the adhesions was significantly lower in the PRP group. There was no significant difference in the type and tenacity of adhesions between the hyaluronic acid and the PRP group. The level of inflammation was significantly higher in the control group than the others, while there was no difference between the PRP and hyaluronic acid groups. TGF-1β expression was significantly lesser in the PRP group than the control and hyaluronic acid groups. PRP is more effective than hyaluronic acid treatment in preventing post-operative adhesion formation in an experimental rat uterine horn adhesion model.

Regulation of renal amino acid transporters during metabolic acidosis.

PubMed

Moret, Caroline; Dave, Mital H; Schulz, Nicole; Jiang, Jean X; Verrey, Francois; Wagner, Carsten A

2007-02-01

The kidney plays a major role in acid-base homeostasis by adapting the excretion of acid equivalents to dietary intake and metabolism. Urinary acid excretion is mediated by the secretion of protons and titratable acids, particularly ammonia. NH(3) is synthesized in proximal tubule cells from glutamine taken up via specific amino acid transporters. We tested whether kidney amino acid transporters are regulated in mice in which metabolic acidosis was induced with NH(4)Cl. Blood gas and urine analysis confirmed metabolic acidosis. Real-time RT-PCR was performed to quantify the mRNAs of 16 amino acid transporters. The mRNA of phosphoenolpyruvate carboxykinase (PEPCK) was quantified as positive control for the regulation and that of GAPDH, as internal standard. In acidosis, the mRNA of kidney system N amino acid transporter SNAT3 (SLC38A3/SN1) showed a strong induction similar to that of PEPCK, whereas all other tested mRNAs encoding glutamine or glutamate transporters were unchanged or reduced in abundance. At the protein level, Western blotting and immunohistochemistry demonstrated an increased abundance of SNAT3 and reduced expression of the basolateral cationic amino acid/neutral amino acid exchanger subunit y(+)-LAT1 (SLC7A7). SNAT3 was localized to the basolateral membrane of the late proximal tubule S3 segment in control animals, whereas its expression was extended to the earlier S2 segment of the proximal tubule during acidosis. Our results suggest that the selective regulation of SNAT3 and y(+)LAT1 expression may serve a major role in the renal adaptation to acid secretion and thus for systemic acid-base balance.

Improvement of Blood-Brain Barrier Integrity in Traumatic Brain Injury and Hemorrhagic Shock Following Treatment With Valproic Acid and Fresh Frozen Plasma.

PubMed

Nikolian, Vahagn C; Dekker, Simone E; Bambakidis, Ted; Higgins, Gerald A; Dennahy, Isabel S; Georgoff, Patrick E; Williams, Aaron M; Andjelkovic, Anuska V; Alam, Hasan B

2018-01-01

Combined traumatic brain injury and hemorrhagic shock are highly lethal. Following injuries, the integrity of the blood-brain barrier can be impaired, contributing to secondary brain insults. The status of the blood-brain barrier represents a potential factor impacting long-term neurologic outcomes in combined injuries. Treatment strategies involving plasma-based resuscitation and valproic acid therapy have shown efficacy in this setting. We hypothesize that a component of this beneficial effect is related to blood-brain barrier preservation. Following controlled traumatic brain injury, hemorrhagic shock, various resuscitation and treatment strategies were evaluated for their association with blood-brain barrier integrity. Analysis of gene expression profiles was performed using Porcine Gene ST 1.1 microarray. Pathway analysis was completed using network analysis tools (Gene Ontology, Ingenuity Pathway Analysis, and Parametric Gene Set Enrichment Analysis). Female Yorkshire swine were subjected to controlled traumatic brain injury and 2 hours of hemorrhagic shock (40% blood volume, mean arterial pressure 30-35 mmHg). Subjects were resuscitated with 1) normal saline, 2) fresh frozen plasma, 3) hetastarch, 4) fresh frozen plasma + valproic acid, or 5) hetastarch + valproic acid (n = 5 per group). After 6 hours of observation, brains were harvested for evaluation. Immunofluoroscopic evaluation of the traumatic brain injury site revealed significantly increased expression of tight-junction associated proteins (zona occludin-1, claudin-5) following combination therapy (fresh frozen plasma + valproic acid and hetastarch + valproic acid). The extracellular matrix protein laminin was found to have significantly improved expression with combination therapies. Pathway analysis indicated that valproic acid significantly modulated pathways involved in endothelial barrier function and cell signaling. Resuscitation with fresh frozen plasma results in improved expression of proteins essential for blood-brain barrier integrity. The addition of valproic acid provides significant improvement to these protein expression profiles. This is likely secondary to activation of key pathways related to endothelial functions.

The Arabidopsis tandem CCCH zinc finger proteins AtTZF4, 5 and 6 are involved in light-, abscisic acid- and gibberellic acid-mediated regulation of seed germination.

PubMed

Bogamuwa, Srimathi; Jang, Jyan-Chyun

2013-08-01

Tandem CCCH zinc finger proteins (TZFs) are post-transcriptional regulators of gene expression in animals and yeast. Genetic studies indicate that plant TZFs are involved in hormone-mediated developmental and environmental responses. We have demonstrated previously that Arabidopsis AtTZF1 can localize to processing bodies (PBs) and stress granules (SGs), and affects abscisic acid (ABA)- and gibberellic acid (GA)-mediated growth, stress and gene expression responses. Here we show that AtTZF4, 5 and 6 are specifically expressed in seeds. Consistent with the observation that their expression levels decline during seed imbibition, AtTZF4, 5 and 6 are up-regulated by ABA and down-regulated by GA. Mutant analyses indicate that AtTZF4, 5 and 6 act as positive regulators for ABA- and negative regulators for light- and GA-mediated seed germination responses. Results of gene expression analysis indicate that AtTZF4, 5 and 6 affect seed germination by controlling genes critical for ABA and GA response. Furthermore, AtTZF4, 5 and 6 can co-localize with both PB and SG markers in Arabidopsis cells. Specifically, AtTZF6 can be assembled into PBs and SGs in embryos with the induction of stress hormone methyl jasmonate under the control of native AtTZF6 promoter. © 2013 John Wiley & Sons Ltd.

Branched-chain amino acids alleviate hepatic steatosis and liver injury in choline-deficient high-fat diet induced NASH mice.

PubMed

Honda, Takashi; Ishigami, Masatoshi; Luo, Fangqiong; Lingyun, Ma; Ishizu, Yoji; Kuzuya, Teiji; Hayashi, Kazuhiko; Nakano, Isao; Ishikawa, Tetsuya; Feng, Guo-Gang; Katano, Yoshiaki; Kohama, Tomoya; Kitaura, Yasuyuki; Shimomura, Yoshiharu; Goto, Hidemi; Hirooka, Yoshiki

2017-04-01

For successful treatment for nonalcoholic steatohepatitis (NASH), it may be important to treat the individual causative factors. At present, however, there is no established treatment for this disease. Branched-chain amino acids (BCAAs) have been used to treat patients with decompensated cirrhosis. In order to elucidate the mechanisms responsible for the effects of BCAAs on hepatic steatosis and disease progression, we investigated the effects of BCAA supplementation in mice fed a choline-deficient high-fat diet (CDHF), which induces NASH. Male mice were divided into four groups that received (1) choline-sufficient high fat (HF) diet (HF-control), (2) HF plus 2% BCAA in drinking water (HF-BCAA), (3) CDHF diet (CDHF-control), or (4) CDHF-BCAA for 8weeks. We monitored liver injury, hepatic steatosis and cholesterol, gene expression related to lipid metabolism, and hepatic fat accumulation. Serum alanine aminotransferase (ALT) levels and hepatic triglyceride (TG) were significantly elevated in CDHF-control relative to HF-control. Liver histopathology revealed severe steatosis, inflammation, and pericellular fibrosis in CDHF-control, confirming the NASH findings. Serum ALT levels and hepatic TG and lipid droplet areas were significantly lower in CDHF-BCAA than in CDHF-control. Gene expression and protein level of fatty acid synthase (FAS), which catalyzes the final step in fatty acid biosynthesis, was significantly decreased in CDHF-BCAA than in CDHF-control (P<0.05). Moreover, hepatic total and free cholesterol of CDHF-BCAA was significantly lower than those of CDHF-control. BCAA can alleviate hepatic steatosis and liver injury associated with NASH by suppressing FAS gene expression and protein levels. Copyright © 2017 Elsevier Inc. All rights reserved.

The barley MATE gene, HvAACT1, increases citrate efflux and Al3+ tolerance when expressed in wheat and barley

PubMed Central

Zhou, Gaofeng; Delhaize, Emmanuel; Zhou, Meixue; Ryan, Peter R.

2013-01-01

Background and Aims Aluminium is toxic in acid soils because the soluble Al3+ inhibits root growth. A mechanism of Al3+ tolerance discovered in many plant species involves the release of organic anions from root apices. The Al3+-activated release of citrate from the root apices of Al3+-tolerant genotypes of barley is controlled by a MATE gene named HvAACT1 that encodes a citrate transport protein located on the plasma membrane. The aim of this study was to investigate whether expressing HvAACT1 with a constitutive promoter in barley and wheat can increase citrate efflux and Al3+ tolerance of these important cereal species. Methods HvAACT1 was over-expressed in wheat (Triticum aestivum) and barley (Hordeum vulgare) using the maize ubiquitin promoter. Root apices of transgenic and control lines were analysed for HvAACT1 expression and organic acid efflux. The Al3+ tolerance of transgenic and control lines was assessed in both hydroponic solution and acid soil. Key Results and Conclusions Increased HvAACT1 expression in both cereal species was associated with increased citrate efflux from root apices and enhanced Al3+ tolerance, thus demonstrating that biotechnology can complement traditional breeding practices to increase the Al3+ tolerance of important crop plants. PMID:23798600

Expression of a major surface protein of Trypanosoma brucei insect forms is controlled by the activity of mitochondrial enzymes.

PubMed

Vassella, Erik; Probst, Matthias; Schneider, André; Studer, Erwin; Renggli, Christina Kunz; Roditi, Isabel

2004-09-01

In cycling between the mammalian host and the tsetse fly vector, trypanosomes undergo major changes in energy metabolism and surface coat composition. Early procyclic (insect) forms in the tsetse fly midgut are coated by glycoproteins known as EP and GPEET procyclins. EP expression continues in late procyclic forms, whereas GPEET is down-regulated. In culture, expression of GPEET is modulated by glycerol or glucose. Here, we demonstrate that a glycerol-responsive element of 25 nucleotides within the 3' untranslated region of GPEET mRNA also controls expression by glucose and during development in the fly. In trypanosomes, mitochondrial ATP is produced mainly by the acetate: succinate-CoA transferase/succinyl-CoA synthetase (ASCT) cycle, the citric acid cycle, and the cytochromes. Silencing of the pyruvate dehydrogenase or succinyl-CoA synthetase from the ASCT cycle by RNA interference induces reexpression of GPEET in late procyclic forms, whereas inhibition of the citric acid cycle or the cytochromes has no effect. In contrast, inhibition of the alternative oxidase, the second branch of the electron transport chain, with salicylhydroxamic acid overrides the effect of glucose or glycerol and causes a reduction in the level of GPEET mRNA. Our results reveal a new mechanism by which expression of a surface glycoprotein is controlled by the activity of mitochondrial enzymes.

Involvement of Resveratrol and ω-3 Polyunsaturated Fatty Acids on Sirtuin 1 Gene Expression in THP1 Cells.

PubMed

Tsuchiya, Takafumi; Endo, Ayano; Tsujikado, Kyoko; Inukai, Toshihiko

2017-10-01

Resveratrol, a kind of polyphenol, has the potential to activate the longevity gene in several cells, in the same manner as calorie restriction. We investigated the effect of resveratrol and ω-3-line polyunsaturated fatty acid on surtuin 1 (SIRT1) gene expression in human monocytes (THP1) cells. We examined the gene expression of THP1 cells using real-time polymerase chain reaction and Western blotting analysis. Resveratol, eicosapentaenoic acid (EPA) and docosahexaeanoic acid (DHA) as n-3 polyunsaturated fatty acid were added on THP1 cells. We observed the changes in the SIRT1 gene expression in those cells, under various doses of agents and in time courses. Then, we examined the interaction of glucose and mannitol on those agents׳ effect of the gene expression. The concentration range of glucose and mannitol was from 5-20mM, respectively. The SIRT1 gene expression could be defined in 24 and 48 hours both in real-time polymerase chain reaction analysis and in Western blotting. Resveratrol showed SIRT1 gene expression in a dose-dependent manner in the range of 0-20μM in both analyses. Although EPA at 10μM showed marked increase in SIRT1 gene expression compared to control condition in Western blotting, this phenomenon was not in dose-dependent manner. DHA did not exhibit any augmentation of SIRT1 gene expression in a dose-dependent manner in the range of 0-20μM in both analyses. We refined the dose-dependent inhibition of the SIRT1 gene expression within 20mM glucose medium. Although 20mM did not exhibit any inhibition, 10μM resveratrol induced the gene expression compared to control medium. Both 5 and 15mM mannitol medium did not significantly alter basic gene expression and 10μM resveratrol-induced gene expression. The present results suggest that resveratrol and EPA, but not DHA, markedly activated the SIRT1 gene expression in THP1 cells, and that high glucose medium could inhibit the basic gene expression, but not powerful resveratrol-induced gene expression, in those cells. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

Immunohistochemical characterization of hemangiopericytomas and other spindle cell tumors in the dog.

PubMed

Pérez, J; Bautista, M J; Rollón, E; de Lara, F C; Carrasco, L; Martin de las Mulas, J

1996-07-01

The immunohistochemical expression of muscle actin has been studied in 45 canine hemangiopericytomas (CHP) using a monoclonal antibody (HHF35) and formalin-fixed, paraffin-embedded specimens. The distribution of vimentin, desmin, cytokeratins, lysozyme, factor VIII-related antigen, S-100 protein, and glial fibrillary acidic protein was studied both in CHP and in some canine soft-tissue neoplasms (seven fibrosarcomas, seven benign schwannomas, seven benign fibrous histiocytomas, and six leiomyosarcomas) used as controls for differential diagnosis. All CHP and control tumors expressed vimentin. Twenty-three CHP expressed muscle actin, whereas all control tumors analyzed were muscle actin-negative, with the exception of leiomyosarcomas. Among muscle actin- and vimentin-positive CHP, one case could be reclassified as leiomyosarcoma because it was desmin-positive, two cases expressed lysozyme, and nine cases expressed S-100 protein. Among muscle actin-negative and vimentin-positive CHP, seven expressed S-100 protein. In addition, S-100 protein was detected in five schwannomas. All CHP and control tumors analyzed were negative for cytokeratins, factor VIII-related antigen, and glial fibrillary acidic protein. Our results support the hypothesis of a pericytic origin of CHP, and suggest that muscle actin, desmin, vimentin, and lysozyme could be useful for the differential diagnosis of canine spindle cell tumors, but not all these neoplasms can be identified with these tumor tissue markers.

A novel riboregulator switch system of gene expression for enhanced microbial production of succinic acid.

PubMed

Wang, Jing; Wang, Haoyuan; Yang, Le; Lv, Liping; Zhang, Zhe; Ren, Bin; Dong, Lichun; Li, Ning

2018-04-01

In this paper, a novel riboregulator Switch System of Gene Expression including an OFF-TO-ON switch and an ON-TO-OFF switch was designed to regulate the expression state of target genes between "ON" and "OFF" by switching the identifiability of ribosome recognition site (RBS) based on the thermodynamic stability of different RNA-RNA hybridizations between RBS and small noncoding RNAs. The proposed riboregulator switch system was employed for the fermentative production of succinic acid using an engineered strain of E. coli JW1021, during which the expression of mgtC gene was controlled at "ON" state and that of pepc and ecaA genes were controlled at the "OFF" state in the lag phase and switched to the "OFF" and "ON" state once the strain enters the logarithmic phase. The results showed that using the strain of JW1021, the yield and productivity of succinic acid can reach 0.91 g g -1 and 3.25 g L -1  h -1 , respectively, much higher than those using the strains without harboring the riboregulator switch system.

Betaine Attenuates Alcohol-Induced Pancreatic Steatosis.

PubMed

Yang, Wenjuan; Gao, Jinhang; Tai, Yang; Chen, Meng; Huang, Luming; Wen, Shilei; Huang, Zhiyin; Liu, Rui; Li, Jing; Tang, Chengwei

2016-07-01

To explore the effect of betaine on alcoholic pancreatic steatosis and its mechanism. Rats were randomly assigned to control, ethanol, or ethanol + betaine groups. Changes in pancreatic morphology; serum lipid levels; and pancreatic lipid, amylase and lipase levels were determined. The serum and adipose tissue adiponectin level was measured by an enzyme-linked immunoassay. Adiponectin receptor-1 (AdipoR1), AdipoR2, sterol regulatory element binding protein-1c (SREBP-1c), SREBP-2, and fatty acid synthetase expression levels were quantified. The SREBP-1c expression in SW1990 cells treated with various concentrations of ethanol or ethanol plus betaine and/or adiponectin was assessed. Alcohol-induced changes in pancreatic morphology were attenuated by betaine. Pancreatic triglyceride, free fatty acid and expression levels of SREBP-1c and fatty acid synthetase were elevated after ethanol feeding but remained at control levels after betaine supplementation. Alcohol-induced decreases in serum and adipose tissue adiponectin, pancreatic AdipoR1, amylase, and lipase were attenuated by betaine. Serum triglyceride and free fatty acid levels were elevated after alcohol consumption and remained higher after betaine supplementation compared with controls. Betaine and/or adiponectin suppressed alcohol-induced SREBP-1c upregulation in vitro. Betaine attenuated alcoholic-induced pancreatic steatosis most likely by suppressing pancreatic SREBP-1c both directly and through the restoration of adiponectin signaling.

Gene expression of fatty acid transport and binding proteins in the blood-brain barrier and the cerebral cortex of the rat: differences across development and with different DHA brain status.

PubMed

Pélerin, Hélène; Jouin, Mélanie; Lallemand, Marie-Sylvie; Alessandri, Jean-Marc; Cunnane, Stephen C; Langelier, Bénédicte; Guesnet, Philippe

2014-11-01

Specific mechanisms for maintaining docosahexaenoic acid (DHA) concentration in brain cells but also transporting DHA from the blood across the blood-brain barrier (BBB) are not agreed upon. Our main objective was therefore to evaluate the level of gene expression of fatty acid transport and fatty acid binding proteins in the cerebral cortex and at the BBB level during the perinatal period of active brain DHA accretion, at weaning, and until the adult age. We measured by real time RT-PCR the mRNA expression of different isoforms of fatty acid transport proteins (FATPs), long-chain acyl-CoA synthetases (ACSLs), fatty acid binding proteins (FABPs) and the fatty acid transporter (FAT)/CD36 in cerebral cortex and isolated microvessels at embryonic day 18 (E18) and postnatal days 14, 21 and 60 (P14, P21 and P60, respectively) in rats receiving different n-3 PUFA dietary supplies (control, totally deficient or DHA-supplemented). In control rats, all the genes were expressed at the BBB level (P14 to P60), the mRNA levels of FABP5 and ACSL3 having the highest values. Age-dependent differences included a systematic decrease in the mRNA expressions between P14-P21 and P60 (2 to 3-fold), with FABP7 mRNA abundance being the most affected (10-fold). In the cerebral cortex, mRNA levels varied differently since FATP4, ACSL3 and ACSL6 and the three FABPs genes were highly expressed. There were no significant differences in the expression of the 10 genes studied in n-3 deficient or DHA-supplemented rats despite significant differences in their brain DHA content, suggesting that brain DHA uptake from the blood does not necessarily require specific transporters within cerebral endothelial cells and could, under these experimental conditions, be a simple passive diffusion process. Copyright © 2014 Elsevier Ltd. All rights reserved.

Differential expression of decorin and biglycan genes during palatogenesis in normal and retinoic acid-treated mice.

PubMed

Zhang, Yuxiang; Mori, Tetsuji; Iseki, Ken; Hagino, Seita; Takaki, Hiromi; Takeuchi, Mayumi; Hikake, Tsuyoshi; Tase, Choichiro; Murakawa, Masahiro; Yokoya, Sachihiko; Wanaka, Akio

2003-04-01

Proteoglycans are involved in secondary palate formation. In the present study, we focused on two small leucine-rich proteoglycans, decorin and biglycan, because they assembled extracellular matrix molecules such as collagens and modulated signaling pathway of transforming growth factor-beta. To investigate the functions of decorin and biglycan in palatogenesis, we compared their mRNA expression patterns between normal palate and retinoic acid-induced cleft palate in mice by using in situ hybridization analysis during the period of embryonic day 13.5 (E13.5) to E15.5. On E13.5, decorin mRNA was expressed in the epithelia and mesenchyme on the nasal side of the developing secondary palate. During the period the palate shelves were fusing (E14.5), decorin mRNA was strongly expressed in the mesenchyme but its expression pattern was asymmetric; decorin mRNA expression area in the nasal side was broader than that in the oral side. The expression of decorin mRNA was hardly detected in the mesenchyme on either side of the medial edge epithelium. After fusion (E15.5), its expression converged to the mesenchyme just around the palatine bone. Biglycan mRNA was ubiquitously distributed throughout the palatal mesenchyme for the mid-gestation period. Its expression area became limited to the ossification area within the palate after the late gestation period. In the retinoic acid-treated mice, the area of the decorin gene expression expanded to the core region of the palate primordium where little signal was observed in control mice. On the other hand, biglycan in the retinoic acid-treated mice did not show remarkable change in its distribution patterns compared with that in the control mice. These findings suggest that decorin and biglycan play distinct roles in palatogenesis, and decorin was more actively involved in the process of secondary palate formation than biglycan. Up-regulation of decorin gene expression in the retinoic acid-treated mice might influence the pathogenesis of cleft palate. Copyright 2003 Wiley-Liss, Inc.

Depressed expression of FAE1 and FAD2 genes modifies fatty acid profiles and storage compounds accumulation in Brassica napus seeds.

PubMed

Shi, Jianghua; Lang, Chunxiu; Wang, Fulin; Wu, Xuelong; Liu, Renhu; Zheng, Tao; Zhang, Dongqing; Chen, Jinqing; Wu, Guanting

2017-10-01

In plants, the enzymes fatty acid dehydrogenase 2 (FAD2) and fatty acid elongase 1 (FAE1) have been shown in previous studies to play important roles in the de novo biosynthesis of fatty acids. However, the effects of depressed expression of FAD2 and FAE1 on seed storage compounds accumulation remains to be elucidated. In this study, we produced RNA interfering transgenic rapeseeds lines, BnFAD2-Ri, BnFAE1-Ri and BnFAD2/BnFAE1-Ri, which exhibited depressed expression of the BnFAD2 and BnFAE1 genes under the control of seed-specific napin A promoter. These transgenic rapeseeds showed normal growth and development as compared with the wild type (CY2). Depressed expression of BnFAD2 and BnFAE1 genes modified fatty acid profiles, leading to increased oleic acid and decreased erucic acid contents in transgenic seeds. Consistent with these results, the ratios of C18:1/C18:2 and C18:1/C18:3 in C18 unsaturated fatty acids were greatly increased due to increased oleic acid content in transgenic seeds. Moreover, depressed expression of BnFAD2 and BnFAE1 genes resulted in slightly decreased oil contents and increased protein contents in transgenic seeds. Our results demonstrated that depressed expression of BnFAD2 and BnFAE1 greatly improves seed nutritional quality by modulating the fatty acid metabolism and storage products accumulation and that BnFAD2 and BnFAE1 are reliable targets for genetic improvement of rapeseed in seed nutritional quality. Copyright © 2017 Elsevier B.V. All rights reserved.

Combinatorial Effects of Fatty Acid Elongase Enzymes on Nervonic Acid Production in Camelina sativa

PubMed Central

Huai, Dongxin; Zhang, Yuanyuan; Zhang, Chunyu; Cahoon, Edgar B.; Zhou, Yongming

2015-01-01

Very long chain fatty acids (VLCFAs) with chain lengths of 20 carbons and longer provide feedstocks for various applications; therefore, improvement of VLCFA contents in seeds has become an important goal for oilseed enhancement. VLCFA biosynthesis is controlled by a multi-enzyme protein complex referred to as fatty acid elongase, which is composed of β-ketoacyl-CoA synthase (KCS), β-ketoacyl-CoA reductase (KCR), β-hydroxyacyl-CoA dehydratase (HCD) and enoyl reductase (ECR). KCS has been identified as the rate-limiting enzyme, but little is known about the involvement of other three enzymes in VLCFA production. Here, the combinatorial effects of fatty acid elongase enzymes on VLCFA production were assessed by evaluating the changes in nervonic acid content. A KCS gene from Lunaria annua (LaKCS) and the other three elongase genes from Arabidopsis thaliana were used for the assessment. Five seed-specific expressing constructs, including LaKCS alone, LaKCS with AtKCR, LaKCS with AtHCD, LaKCS with AtECR, and LaKCS with AtKCR and AtHCD, were transformed into Camelina sativa. The nervonic acid content in seed oil increased from null in wild type camelina to 6-12% in LaKCS-expressing lines. However, compared with that from the LaKCS-expressing lines, nervonic acid content in mature seeds from the co-expressing lines with one or two extra elongase genes did not show further increases. Nervonic acid content from LaKCS, AtKCR and AtHCD co-expressing line was significantly higher than that in LaKCS-expressing line during early seed development stage, while the ultimate nervonic acid content was not significantly altered. The results from this study thus provide useful information for future engineering of oilseed crops for higher VLCFA production. PMID:26121034

Cloning and characterization of acid invertase genes in the roots of the metallophyte Kummerowia stipulacea (Maxim.) Makino from two populations: Differential expression under copper stress.

PubMed

Zhang, Luan; Xiong, Zhi-ting; Xu, Zhong-rui; Liu, Chen; Cai, Shen-wen

2014-06-01

The roots of metallophytes serve as the key interface between plants and heavy metal-contaminated underground environments. It is known that the roots of metallicolous plants show a higher activity of acid invertase enzymes than those of non-metallicolous plants when under copper stress. To test whether the higher activity of acid invertases is the result of increased expression of acid invertase genes or variations in the amino acid sequences between the two population types, we isolated full cDNAs for acid invertases from two populations of Kummerowia stipulacea (from metalliferous and non-metalliferous soils), determined their nucleotide sequences, expressed them in Pichia pastoris, and conducted real-time PCR to determine differences in transcript levels during Cu stress. Heterologous expression of acid invertase cDNAs in P. pastoris indicated that variations in the amino acid sequences of acid invertases between the two populations played no significant role in determining enzyme characteristics. Seedlings of K. stipulacea were exposed to 0.3µM Cu(2+) (control) and 10µM Cu(2+) for 7 days under hydroponics׳ conditions. The transcript levels of acid invertases in metallicolous plants were significantly higher than in non-metallicolous plants when under copper stress. The results suggest that the expression of acid invertase genes in metallicolous plants of K. stipulacea differed from those in non-metallicolous plants under such conditions. In addition, the sugars may play an important role in regulating the transcript level of acid invertase genes and acid invertase genes may also be involved in root/shoot biomass allocation. Copyright © 2014 Elsevier Inc. All rights reserved.

A fish protein hydrolysate alters fatty acid composition in liver and adipose tissue and increases plasma carnitine levels in a mouse model of chronic inflammation.

PubMed

Bjørndal, Bodil; Berge, Christ; Ramsvik, Marie Sannes; Svardal, Asbjørn; Bohov, Pavol; Skorve, Jon; Berge, Rolf K

2013-10-07

There is growing evidence that fish protein hydrolysate (FPH) diets affect mitochondrial fatty acid metabolism in animals. The aim of the study was to determine if FPH could influence fatty acid metabolism and inflammation in transgene mice expressing human tumor necrosis factor alpha (hTNFα). hTNFα mice (C57BL/6 hTNFα) were given a high-fat (23%, w/w) diet containing 20% casein (control group) or 15% FPH and 5% casein (FPH group) for two weeks. After an overnight fast, blood, adipose tissue, and liver samples were collected. Gene expression and enzyme activity was analysed in liver, fatty acid composition was analyzed in liver and ovarian white adipose tissue, and inflammatory parameters, carnitine, and acylcarnitines were analyzed in plasma. The n-3/n-6 fatty acid ratio was higher in mice fed the FPH diet than in mice fed the control diet in both adipose tissue and liver, and the FPH diet affected the gene expression of ∆6 and ∆9 desaturases. Mice fed this diet also demonstrated lower hepatic activity of fatty acid synthase. Concomitantly, a lower plasma INF-γ level was observed. Plasma carnitine and the carnitine precursor γ-butyrobetaine was higher in the FPH-group compared to control, as was plasma short-chained and medium-chained acylcarnitine esters. The higher level of plasma acetylcarnitine may reflect a stimulated mitochondrial and peroxisomal β-oxidation of fatty acids, as the hepatic activities of peroxisomal acyl-CoA oxidase 1 and mitochondrial carnitine palmitoyltransferase-II were higher in the FPH-fed mice. The FPH diet was shown to influence hepatic fatty acid metabolism and fatty acid composition. This indicates that effects on fatty acid metabolism are important for the bioactivity of protein hydrolysates of marine origin.

Control of the Biofilms Formed by Curli- and Cellulose-Expressing Shiga Toxin-Producing Escherichia coli Using Treatments with Organic Acids and Commercial Sanitizers.

PubMed

Park, Yoen Ju; Chen, Jinru

2015-05-01

Biofilms are a mixture of bacteria and extracellular products secreted by bacterial cells and are of great concern to the food industry because they offer physical, mechanical, and biological protection to bacterial cells. This study was conducted to quantify biofilms formed by different Shiga toxin-producing Escherichia coli (STEC) strains on polystyrene and stainless steel surfaces and to determine the effectiveness of sanitizing treatments in control of these biofilms. STEC producing various amounts of cellulose (n = 6) or curli (n = 6) were allowed to develop biofilms on polystyrene and stainless steel surfaces at 28°C for 7 days. The biofilms were treated with 2% acetic or lactic acid and manufacturer-recommended concentrations of acidic or alkaline sanitizers, and residual biofilms were quantified. Treatments with the acidic and alkaline sanitizers were more effective than those with the organic acids for removing the biofilms. Compared with their counterparts, cells expressing a greater amount of cellulose or curli formed more biofilm mass and had greater residual mass after sanitizing treatments on polystyrene than on stainless steel. Research suggests that the organic acids and sanitizers used in the present study differed in their ability to control biofilms. Bacterial surface components and cell contact surfaces can influence both biofilm formation and the efficacy of sanitizing treatments. These results provide additional information on control of biofilms formed by STEC.

Light Moderates the Induction of Phosphoenolpyruvate Carboxylase by NaCl and Abscisic Acid in Mesembryanthemum crystallinum 1

PubMed Central

McElwain, Elizabeth F.; Bohnert, Hans J.; Thomas, John C.

1992-01-01

In Mesembryanthemum crystallinum, phosphoenolpyruvate carboxylase is synthesized de novo in response to osmotic stress, as part of the switch from C3-photosynthesis to Crassulacean acid metabolism. To better understand the environmental signals involved in this pathway, we have investigated the effects of light on the induced expression of phosphoenolpyruvate carboxylase mRNA and protein in response to stress by 400 millimolar NaCl or 10 micromolar abscisic acid in hydroponically grown plants. When plants were grown in high-intensity fluorescent or incandescent light (850 microeinsteins per square meter per second), NaCl and abscisic acid induced approximately an eightfold accumulation of phosphoenolpyruvate carboxylase mRNA when compared to untreated controls. Levels of phosphoenolpyruvate carboxylase protein were high in these abscisic acid- and NaCl-treated plants, and detectable in the unstressed control. Growth in high-intensity incandescent (red) light resulted in approximately twofold higher levels of phosphoenolpyruvate carboxylase mRNA in the untreated plants when compared to control plants grown in high-intensity fluorescent light. In low light (300 microeinsteins per square meter per second fluorescent), only NaCl induced mRNA levels significantly above the untreated controls. Low light grown abscisic acid- and NaCl-treated plants contained a small amount of phosphoenolpyruvate carboxylase protein, whereas the (untreated) control plants did not contain detectable amounts of phosphoenolpyruvate carboxylase. Environmental stimuli, such as light and osmotic stress, exert a combined effect on gene expression in this facultative halophyte. ImagesFigure 1Figure 2 PMID:16668999

Highly efficient production of hyaluronic acid by Streptococcus zooepidemicus R42 derived from heterologous expression of bacterial haemoglobin and mutant selection.

PubMed

Lu, J F; Zhu, Y; Sun, H L; Liang, S; Leng, F F; Li, H Y

2016-04-01

During Streptococcus zooepidemicus fermentation, most carbon sources are used to synthesize lactic acid, which can inhibit strain growth and hyaluronic acid production. Here, we expressed bacterial haemoglobin (Vhb) in Strep. zooepidemicus. Due to highly efficient oxygen use, only 15·26 g l(-1) lactic acid was produced, which is 0·73 times the quantity produced by the control strain. Compared with the control strain (1·61 g l(-1) ), hyaluronic acid (HA) production in this strain did not substantially increase, only to 2·16 g l(-1) . Next, we used a series of N-methyl-N'-nitro-N-nitroso-guanidine (NTG) treatments and selection programmes. Finally, we generated a hyaluronidase-negative and rifampin-resistant mutant strain that produces high levels of HA. The optimum carbon concentration for maximum hyaluronic acid production is only 30 g l(-1) of sucrose, which is lower than the control strain (60 g l(-1) ). The oxygen transfer rate coefficient KL a increased significantly to 372 ± 53 h(-1) from 18 ± 4 h(-1) of the control. The optimum carbon source for this strain is 21 g l(-1) of sucrose, 9 g l(-1) of maltose and 5 g l(-1) of glutamic acid. Hyaluronic acid accumulated at 6·7 g l(-1) in the culture broth. However, the molecular weight of HA decreased from 1835 KDa (Control) to 429 kDa. The prepared low-molecular weight HA could function as potential antiangiogenic substances, antiviral and antitumour agents to possibly be used as functional food ingredients. Hyaluronic acid (HA) has been used for a wide range of applications in health, cosmetic and clinical fields. During fermentation of Streptococcus to produce HA, 80-85% of the carbon source is used to produce lactic acid and acetic acid, and only approx. 5 and 10% of the carbon source is used to produce HA and biomass respectively. Here, we expressed bacteria haemoglobin (Vhb) in Streptococcus zooepidemicus, which can dramatically inhibit lactic acid production. After NTG treatments and selection programmes, we identified a mutant strain with highly efficient hyaluronic acid production (6·7 g l(-1) ) under economic fermentation conditions. © 2016 The Society for Applied Microbiology.

Acetylated sialic acid residues and blood group antigens localise within the epithelium in microvillous atrophy indicating internal accumulation of the glycocalyx

PubMed Central

Phillips, A D; Brown, A; Hicks, S; Schüller, S; Murch, S H; Walker-Smith, J A; Swallow, D M

2004-01-01

Background: Microvillous atrophy, a disorder of intractable diarrhoea in infancy, is characterised by the intestinal epithelial cell abnormalities of abnormal accumulation of periodic acid-Schiff (PAS) positive secretory granules within the apical cytoplasm and the presence of microvillous inclusions. The identity of the PAS positive material is not known, and the aim of this paper was to further investigate its composition. Methods: Formaldehyde fixed sections were stained with alcian blue/PAS to identify the acidic or neutral nature of the material, phenylhydrazine blocking was employed to stain specifically for sialic acid, and saponification determined the presence of sialic acid acetylation. The specificity of sialic acid staining was tested by digestion with mild sulphuric acid. Expression of blood group related antigens was tested immunochemically. Results: Alcian blue/PAS staining identified a closely apposed layer of acidic material on the otherwise neutral (PAS positive) brush border in controls. In microvillous atrophy, a triple layer was seen with an outer acidic layer, an unstained brush border region, and accumulation within the epithelium of a neutral glycosubstance that contained acetylated sialic acid. Blood group antigens were detected on the brush border, in mucus, and within goblet cells in controls. In microvillous atrophy they were additionally expressed within the apical cytoplasm of epithelial cells mirroring the PAS abnormality. Immuno electron microscopy localised expression to secretory granules. Conclusions: A neutral, blood group antigen positive, glycosubstance that contains acetylated sialic acid accumulates in the epithelium in microvillous atrophy. Previous studies have demonstrated that the direct and indirect constitutive pathways are intact in this disorder and it is speculated that the abnormal staining pattern reflects accumulation of glycocalyx related material. PMID:15542511

Arachidonic acid can function as a signaling modulator by activating the TRPM5 cation channel in taste receptor cells.

PubMed

Oike, Hideaki; Wakamori, Minoru; Mori, Yasuo; Nakanishi, Hiroki; Taguchi, Ryo; Misaka, Takumi; Matsumoto, Ichiro; Abe, Keiko

2006-09-01

Vertebrate sensory cells such as vomeronasal neurons and Drosophila photoreceptor cells use TRP channels to respond to exogenous stimuli. In mammalian taste cells, bitter and sweet substances as well as some amino acids are received by G protein-coupled receptors (T2Rs or T1Rs). As a result of activation of G protein and phospholipase Cbeta2, the TRPM5 channel is activated. Intracellular Ca(2+) is known to be a TRPM5 activator, but the participation of lipid activators remains unreported. To clarify the effect of arachidonic acid on TRPM5 in taste cells, we investigated the expression profile of a series of enzymes involved in controlling the intracellular free arachidonic acid level, with the result that in a subset of taste bud cells, monoglyceride lipase (MGL) and cyclooxygenase-2 (COX-2) are expressed as well as the previously reported group IIA phospholipase A(2) (PLA(2)-IIA). Double-labeling analysis revealed that MGL, COX-2 and PLA(2)-IIA are co-expressed in some cells that express TRPM5. We then investigated whether arachidonic acid activates TRPM5 via a heterologous expression system in HEK293 cells, and found that its activation occurred at 10 microM arachidonic acid. These results strongly suggest the possibility that arachidonic acid acts as a modulator of TRPM5 in taste signaling pathways.

Nuclear factor-E2-related factor 2 is a major determinant of bile acid homeostasis in the liver and intestine

PubMed Central

Weerachayaphorn, Jittima; Mennone, Albert; Soroka, Carol J.; Harry, Kathy; Hagey, Lee R.; Kensler, Thomas W.

2012-01-01

The transcription factor nuclear factor-E2-related factor 2 (Nrf2) is a key regulator for induction of hepatic detoxification and antioxidant mechanisms, as well as for certain hepatobiliary transporters. To examine the role of Nrf2 in bile acid homeostasis and cholestasis, we assessed the determinants of bile secretion and bile acid synthesis and transport before and after bile duct ligation (BDL) in Nrf2−/− mice. Our findings indicate reduced rates of biliary bile acid and GSH excretion, higher levels of intrahepatic bile acids, and decreased expression of regulators of bile acid synthesis, Cyp7a1 and Cyp8b1, in Nrf2−/− compared with wild-type control mice. The mRNA expression of the bile acid transporters bile salt export pump (Bsep) and organic solute transporter (Ostα) were increased in the face of impaired expression of the multidrug resistance-associated proteins Mrp3 and Mrp4. Deletion of Nrf2 also decreased ileal apical sodium-dependent bile acid transporter (Asbt) expression, leading to reduced bile acid reabsorption and increased loss of bile acid in feces. Finally, when cholestasis is induced by BDL, liver injury was not different from that in wild-type BDL mice. These Nrf2−/− mice also had increased pregnane X receptor (Pxr) and Cyp3a11 mRNA expression in association with enhanced hepatic bile acid hydroxylation. In conclusion, this study finds that Nrf2 plays a major role in the regulation of bile acid homeostasis in the liver and intestine. Deletion of Nrf2 results in a cholestatic phenotype but does not augment liver injury following BDL. PMID:22345550

Cloning and characterization of the nagA gene that encodes beta-n-acetylglucosaminidase from Aspergillus nidulans and its expression in Aspergillus oryzae.

PubMed

Kim, Sunhwa; Matsuo, Ichiro; Ajisaka, Katsumi; Nakajima, Harushi; Kitamoto, Katsuhiko

2002-10-01

We isolated a beta-N-acetylglucosaminidase encoding gene and its cDNA from the filamentous fungus Aspergillus nidulans, and designated it nagA. The nagA gene contained no intron and encoded a polypeptide of 603 amino acids with a putative 19-amino acid signal sequence. The deduced amino acid sequence was very similar to the sequence of Candida albicans Hex1 and Trichoderma harzianum Nag1. Yeast cells containing the nagA cDNA under the control of the GAL1 promoter expressed beta-N-acetylglucosaminidase activity. The chromosomal nagA gene of A. nidulans was disrupted by replacement with the argB marker gene. The disruptant strains expressed low levels of beta-N-acetylglucosaminidase activity and showed poor growth on a medium containing chitobiose as a carbon source. Aspergillus oryzae strain carrying the nagA gene under the control of the improved glaA promoter produced large amounts of beta-N-acetylglucosaminidase in a wheat bran solid culture.

Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory.

PubMed

Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J; Honjo, Mie N; Fukuda, Hirokazu

2015-01-01

In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions.

Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory

PubMed Central

Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J.; Honjo, Mie N.; Fukuda, Hirokazu

2015-01-01

In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions. PMID:26624004

Anti-inflammatory effects of conjugated linoleic acid isomers and essential fatty acids in bovine mammary epithelial cells.

PubMed

Dipasquale, D; Basiricò, L; Morera, P; Primi, R; Tröscher, A; Bernabucci, U

2018-01-09

Fatty acids are important modulators of inflammatory responses, in particular, n-3 and n-6 essential fatty acids and CLA have received particular attention for their ability to modulate inflammation. The objectives of this study were to compare the effects of CLA and essential fatty acids on the expression of pro and anti- inflammatory cytokines and their protective efficacy against inflammatory status in mammary gland by an in vitro model based on bovine mammary epithelial cells (BME-UV1). Bovine mammary epithelial cells were treated with complete medium containing either 50 µM of cis-9, trans-11 CLA (c9,t11 CLA) or trans-10, cis-12 CLA (t10,c12 CLA) or (α)-linolenic acid (aLnA) or (γ)-linolenic acid (gLnA) or linoleic acid (LA). After 48 h by fatty acids administration the cells were treated for 3 h with 20 µM of lipopolysaccharide (LPS) to induce inflammatory stimulus. Reactive oxygen species (ROS) production after treatments was assessed to verify and to compare the potential protection of different fatty acids against LPS-induced oxidative stress. The messenger RNA abundance of bovine pro and anti-inflammatory cytokines (tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6) and interleukine-10 (IL-10)) and peroxisome proliferator receptor-α/γ (PPARγ/α) were determined in BME-UV1 by real-time PCR. The results showed that cells treated with fatty acids and LPS increased ROS production compared with control cells. Among treatments, cells treated with c9,t11 CLA and t10,c12 CLA isomers revealed significant lower levels of ROS production compared with other fatty acids. All fatty acids reduced the gene expression of pro- and anti-inflammatory cytokines. Among fatty acids, t10,c12 CLA, LA and gLnA showed an homogeneous reduction of the three pro-inflammatory cytokines and this may correspond to more balanced and efficient physiological activity and may trigger a better protective effect. The PPARγ gene expression was significantly greater in cells treated with t10,c12 CLA, aLnA and LA, whereas the PPARα gene expression levels were significantly lower in cells treated with all different fatty acids, compared with the control. These results suggest that fatty acids inhibited the transcription of pro-inflammatory cytokines by the upregulation of PPARγ expression.

The effects of Bacillus coagulans-fermented and non-fermented Ginkgo biloba on abdominal fat deposition and meat quality of Peking duck.

PubMed

Liu, Xiaoyan; Cao, Guanjun; Zhou, Jinglong; Yao, Xuan; Fang, Binghu

2017-07-01

In order to evaluate the effects of Bacillus coagulans-fermented Ginkgo biloba (FG) and non-fermented G. biloba (NFG) on abdominal fat deposition and meat quality, 270 female Peking ducks were randomly assigned to the following experimental groups: a control group (fed a basal diet), an NFG group (fed a basal diet + 0.3% NFG), and an FG group (fed a basal diet + 0.3% FG). Body weight and feed intake were recorded weekly, and feed conversion ratio was calculated to assess growth performance. After 6 wk, 18 ducks from each group were killed. Abdominal fat ratio and pH (at 45 min and 24 h postmortem), color parameters (lightness, redness, and yellowness), water-holding capacity, cooking loss, shear force, and intramuscular fat and fatty acid contents were measured. Six more ducks were killed to isolate RNA from their abdominal fat tissue for measurements of peroxisome proliferator-activated receptor-γ (PPARγ), obese (leptin), and adiponectin (ADP) expression using real-time polymerase chain reaction. The results revealed that body weight gain was higher in the FG group than in the control and NFG groups, whereas feed conversion ratio was lower (P < 0.05). The abdominal fat contents were lower in the NFG and FG groups than in the control group (P < 0.05). The NFG and FG groups had lower levels of saturated fatty acids (mainly palmitic acid) and higher levels of polyunsaturated fatty acids (mainly linoleic acid and arachidonic acid) than the control group. The mRNA expressions of PPARγ, leptin, and ADP in abdominal fat tissue were significantly increased in the NFG and FG groups, and the mRNA expression of PPARγ was higher in the FG group than in the NFG group (P < 0.05). These results suggest that fermenting G. biloba reduces the deposition of abdominal fat and improves the fatty acid profile of Peking duck meat. © 2017 Poultry Science Association Inc.

Fatty Acid Oxidation Changes and the Correlation with Oxidative Stress in Different Preeclampsia-Like Mouse Models

PubMed Central

Ding, Xiaoyan; Yang, Zi; Han, Yiwei; Yu, Huan

2014-01-01

Background Long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) expression is decreased in placenta of some cases of preeclampsia (PE) which may result in free fatty acid (FFA) increased. High FFA level will induce oxidative stress, so abnormal long-chain fatty acid-oxidation may participate in the pathogenesis of PE through oxidative stress pathway. Methods PE-like groups were ApoC3 transgenic mice with abnormal fatty acid metabolism, classical PE-like models with injection of Nw-nitro-L-arginine-methyl ester (L-NA) or lipopolysaccharide (LPS) and the antiphospholipid syndrome (APS) mouse model with β2GPI injection (ApoC3+NS, ApoC3+L-NA, L-NA, LPS and β2GPI groups). The control group was wild-type mice with normal saline injection. Except for β2GPI mice, the other mice were subdivided into pre-implantation (Pre) and mid-pregnancy (Mid) subgroups by injection time. Results All PE-like groups showed hypertension and proteinuria except ApoC3+NS mice only showed hypertension. Serum FFA levels increased significantly except in LPS group compared to controls (P<0.05). LCHAD mRNA and protein expression in the liver and placenta was significantly higher for ApoC3+NS, ApoC3+L-NA and β2GPI mice and lower for L-NA mice than controls (P<0.05) but did not differ between LPS mice and controls. P47phox mRNA and protein expression in the liver significantly increased in all PE-like groups except LPS group, while P47phox expression in the placenta only significantly increased in L-NA and β2GPI groups. Conclusions Abnormal long-chain fatty acid-oxidation may play a different role in different PE-like models and in some cases participate in the pathogenesis of PE through oxidative stress pathway. PMID:25302499

Investigation of brain-derived neurotrophic factor (BDNF) gene expression in hypothalamus of obese rats: Modulation by omega-3 fatty acids.

PubMed

Abdel-Maksoud, Sahar M; Hassanein, Sally I; Gohar, Neveen A; Attia, Saad M M; Gad, Mohamed Z

2017-10-01

The aim of this study was investigating the effect of omega-3 fatty acids (ω-3 FAs) on brain-derived neurotrophic factor (BDNF) gene expression, using in vivo and in vitro models, to unravel the potential mechanisms of polyunsaturated fatty acids use in obesity. Twenty-nine Sprague-Dawley rats were divided into three groups; lean controls fed normal chow diet for 14 weeks, obese controls fed 60% of their diet as saturated fats for 14 weeks, and ω-3 FAs-treated rats fed 60% saturated fat diet for 14 weeks with concomitant oral administration of 400 mg/kg/day ω-3 FAs, mainly docosahexaenoic acid and EPA, from week 12 to week 14. For the in vitro experiment, hypothalamic cells from six obese rats were cultured in the presence of different concentrations of ω-3 FAs to determine its direct effect on BDNF expression. In vivo results showed that obesity has negative effect on BDNF gene expression in rat hypothalamus that was reversed by administration of ω-3 FAs. Obese rats showed hypercholesterolemia, hypertriglyceridemia, normoinsulinemia, hyperglycemia and hyperleptinemia. Treatment with ω-3 FAs showed significant decrease in serum total cholesterol and TAG. Also serum glucose level and HOMA index were decreased significantly. In vitro results demonstrated the increase in BDNF expression by ω-3 FAs in a dose-dependent manner. Obesity causes down-regulation of BDNF gene expression that can be reversed by ω-3 FAs treatment, making them an interesting treatment approach for obesity and metabolic disease.

The YvqE two-component system controls biofilm formation and acid production in Streptococcus pyogenes.

PubMed

Isaka, Masanori; Tatsuno, Ichiro; Maeyama, Jun-Ichi; Matsui, Hideyuki; Zhang, Yan; Hasegawa, Tadao

2016-07-01

In Streptococcus pyogenes, proteins involved in determining virulence are controlled by stand-alone response regulators and by two-component regulatory systems. Previous studies reported that, compared to the parental strain, the yvqE sensor knockout strain showed significantly reduced growth and lower virulence. To determine the function of YvqE, we performed biofilm analysis and pH assays on yvqE mutants, and site-directed mutagenesis of YvqE. The yvqE deletion mutant showed a slower acid production rate, indicating that YvqE regulates acid production from sugar fermentation. The mutant strain, in which the Asp(26) residue in YvqE was replaced with Asn, affected biofilm formation, suggesting that this amino acid senses hydrogen ions produced by fermentative sugar metabolism. Signals received by YvqE were directly or indirectly responsible for inducing pilus expression. This study shows that at low environmental pH, biofilm formation in S. pyogenes is mediated by YvqE and suggests that regulation of pilus expression by environmental acidification could be directly under the control of YvqE. © 2016 APMIS. Published by John Wiley & Sons Ltd.

NR4A orphan nuclear receptors influence retinoic acid and docosahexaenoic acid signaling via up-regulation of fatty acid binding protein 5

DOE Office of Scientific and Technical Information (OSTI.GOV)

Volakakis, Nikolaos; Joodmardi, Eliza; Perlmann, Thomas, E-mail: thomas.perlmann@licr.ki.se

2009-12-25

The orphan nuclear receptor (NR) Nurr1 is expressed in the developing and adult nervous system and is also induced as an immediate early gene in a variety of cell types. In silico analysis of human promoters identified fatty acid binding protein 5 (FABP5), a protein shown to enhance retinoic acid-mediated PPAR{beta}/{delta} signaling, as a potential Nurr1 target gene. Nurr1 has previously been implicated in retinoid signaling via its heterodimerization partner RXR. Since NRs are commonly involved in cross-regulatory control we decided to further investigate the regulatory relationship between Nurr1 and FABP5. FABP5 expression was up-regulated by Nurr1 and other NR4Amore » NRs in HEK293 cells, and Nurr1 was shown to activate and bind to the FABP5 promoter, supporting that FABP5 is a direct downstream target of NR4A NRs. We also show that the RXR ligand docosahexaenoic acid (DHA) can induce nuclear translocation of FABP5. Moreover, via up-regulation of FABP5 Nurr1 can enhance retinoic acid-induced signaling of PPAR{beta}/{delta} and DHA-induced activation of RXR. We also found that other members of the NR4A orphan NRs can up-regulate FABP5. Thus, our findings suggest that NR4A orphan NRs can influence signaling events of other NRs via control of FABP5 expression levels.« less

Genetic variation of an acid phosphatase (Acp-2) in the laboratory rat: possible homology with mouse AP-1 and human ACP2.

PubMed

Bender, K; Bissbort, S; Kuhn, A; Nagel, M; Günther, E

1986-02-01

A genetic locus controlling the electrophoretic mobility of an acid phosphatase in the rat (Rattus norvegicus) is described. The locus, designed Acp-2, is not expressed in erythrocytes but is expressed in all other tissues studied. The product of Acp-2 hydrolyzes a wide variety of phosphate monoesters and is inhibited by L(+)-tartaric acid. Inbred rat strains have fixed either allele Acp-2a or allele Acp-2b. Codominant expression is observed in the respective F1 hybrids. Backcross progenies revealed the expected 1:1 segregation ratio. Possible loose linkage was found between the Acp-2 and the Pep-3 gene loci at a recombination frequency of 0.36 +/- 0.06.

Functional role of pyruvate kinase from Lactobacillus bulgaricus in acid tolerance and identification of its transcription factor by bacterial one-hybrid

PubMed Central

Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling

2015-01-01

Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5′-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5′-TGTAAGCCCTAACA-3′) upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network. PMID:26581248

Chronic Mild Stress Alters Kynurenine Pathways Changing the Glutamate Neurotransmission in Frontal Cortex of Rats.

PubMed

Martín-Hernández, David; Tendilla-Beltrán, Hiram; Madrigal, José L M; García-Bueno, Borja; Leza, Juan C; Caso, Javier R

2018-05-03

Immune stimulation might be involved in the pathophysiology of major depressive disorder (MDD). This stimulation induces indoleamine 2,3-dioxygenase (IDO), an enzyme that reduces the tryptophan bioavailability to synthesize serotonin. IDO products, kynurenine metabolites, exert neurotoxic/neuroprotective actions through glutamate receptors. Thus, we study elements of these pathways linked to kynurenine metabolite activity examining whether antidepressants (ADs) can modulate them. Male Wistar rats were exposed to chronic mild stress (CMS), and some of them were treated with ADs. The expression of elements of the IDO pathway, including kynurenine metabolites, and their possible modulation by ADs was studied in the frontal cortex (FC). CMS increased IDO expression in FC compared to control group, and ADs restored the IDO expression levels to control values. CMS-induced IDO expression led to increased levels of the excitotoxic quinolinic acid (QUINA) compared to control, and ADs prevented the rise in such levels. Neither CMS nor ADs changed significantly the antiexcitotoxic kynurenic acid (KYNA) levels. The QUINA/KYNA ratio, calculated as excitotoxicity risk indicator, increased after CMS and ADs prevented this increase. CMS lowered excitatory amino acid transporter (EAAT)-1 and EAAT-4 expression, and some ADs restored their expression levels. Furthermore, CMS decreased N-methyl-D-aspartate receptor (NMDAR)-2A and 2B protein expression, and ADs mitigated this decrease. Our research examines the link between CMS-induced pro-inflammatory cytokines and the kynurenine pathway; it shows that CMS alters the kynurenine pathway in rat FC. Importantly, it also reveals the ability of classic ADs to prevent potentially harmful situations related to the brain scenario caused by CMS.

Dietary Glutamate Supplementation Ameliorates Mycotoxin-Induced Abnormalities in the Intestinal Structure and Expression of Amino Acid Transporters in Young Pigs

PubMed Central

Wu, Miaomiao; Liao, Peng; Deng, Dun; Liu, Gang; Wen, Qingqi; Wang, Yongfei; Qiu, Wei; Liu, Yan; Wu, Xingli; Ren, Wenkai; Tan, Bie; Chen, Minghong; Xiao, Hao; Wu, Li; Li, Tiejun; Nyachoti, Charles M.; Adeola, Olayiwola; Yin, Yulong

2014-01-01

The purpose of this study was to investigate the hypothesis that dietary supplementation with glutamic acid has beneficial effects on growth performance, antioxidant system, intestinal morphology, serum amino acid profile and the gene expression of intestinal amino acid transporters in growing swine fed mold-contaminated feed. Fifteen pigs (Landrace×Large White) with a mean body weight (BW) of 55 kg were randomly divided into control group (basal feed), mycotoxin group (contaminated feed) and glutamate group (2% glutamate+contaminated feed). Compared with control group, mold-contaminated feed decreased average daily gain (ADG) and increased feed conversion rate (FCR). Meanwhile, fed mold-contaminated feed impaired anti-oxidative system and intestinal morphology, as well as modified the serum amino acid profile in growing pigs. However, supplementation with glutamate exhibited potential positive effects on growth performance of pigs fed mold-contaminated feed, ameliorated the imbalance antioxidant system and abnormalities of intestinal structure caused by mycotoxins. In addition, dietary glutamate supplementation to some extent restored changed serum amino acid profile caused by mold-contaminated feed. In conclusion, glutamic acid may be act as a nutritional regulating factor to ameliorate the adverse effects induced by mycotoxins. PMID:25405987

Effects of supplementation with docosahexaenoic acid on reproduction of dairy cows.

PubMed

Sinedino, Letícia D P; Honda, Paula M; Souza, Letícia R L; Lock, Adam L; Boland, Maurice P; Staples, Charles R; Thatcher, William W; Santos, José E P

2017-05-01

The objectives were to determine the effects of supplementing docosahexaenoic acid (DHA)-rich algae on reproduction of dairy cows. Holstein cows were assigned randomly to either a control ( n  = 373) or the same diet supplemented daily with 100 g/cow of an algae product containing 10% DHA (algae, n  = 366) from 27 to 147 days postpartum. Measurements included yields of milk and milk components, fatty acids (FA) profiles in milk fat and plasma phospholipids, resumption of ovulation by 57 days postpartum, pregnancy per artificial insemination (AI) and expression of interferon-stimulated genes in leukocytes. Feeding algae increased resumption of estrous cyclicity (77.6 vs 65.9%) and pregnancy at first AI (47.6 vs 32.8%) in primiparous cows. Algae increased pregnancy per AI in all AI in both primiparous and multiparous cows (41.6 vs 30.7%), which reduced days to pregnancy by 22 days (102 vs 124 days) compared with control cows. Pregnant cows fed algae had greater expression of RTP4 in blood leukocytes compared with those in pregnant control cows. Feeding algae increased the incorporation of DHA, eicosapentaenoic acid, conjugated linoleic acid isomers cis -9 trans -11, trans -10 cis -12 and total n-3 FA in phospholipids in plasma and milk fat. Yields of milk and true protein increased by 1.1 kg/day and 30 g/day respectively, whereas fat yield decreased 40 g/day in algae compared with that in control. Supplementing DHA-rich algae altered the FA composition of lipid fractions and improved reproduction in dairy cows. The benefits on reproduction might be mediated by enhanced embryo development based on changes in interferon-stimulated gene expression. © 2017 Society for Reproduction and Fertility.

Differential expression of acid invertase genes in roots of metallicolous and non-metallicolous populations of Rumex japonicus under copper stress.

PubMed

Huang, Wu-Xing; Cao, Yi; Huang, Li-Juan; Ren, Cong; Xiong, Zhi-Ting

2011-09-01

Recent evidence indicates that during copper (Cu) stress, the roots of metallicolous plants manifest a higher activity of acid invertase enzymes, which are rate-limiting in sucrose catabolism, than non-metallicolous plants. To test whether the higher activity of acid invertases is the result of higher expression of acid invertase genes, we isolated partial cDNAs for acid invertases from two populations of Rumex japonicus (from metalliferous and non-metalliferous soils), determined their nucleotide sequences, and designed primers to measure changes in transcript levels during Cu stress. We also determined the growth of the plants' roots, Cu accumulation, and acid invertase activities. The seedlings of R. japonicus were exposed to control or 20 μM Cu(2+) for 6d under hydroponic conditions. The transcript level and enzyme activity of acid invertases in metallicolous plants were both significantly higher than those in non-metallicolous plants when treated with 20 μM. Under Cu stress, the root length and root biomass of metallicolous plants were also significantly higher than those of non-metallicolous plants. The results suggested that under Cu stress, the expression of acid invertase genes in metallicolous plants of R. japonicus differed from those in non-metallicolous plants. Furthermore, the higher acid invertase activities of metallicolous plants under Cu stress could be due in part to elevated expression of acid invertase genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

Reduced fat mass in rats fed a high oleic acid-rich safflower oil diet is associated with changes in expression of hepatic PPARalpha and adipose SREBP-1c-regulated genes.

PubMed

Hsu, Shan-Ching; Huang, Ching-Jang

2006-07-01

PPARs and sterol regulatory element-binding protein-1c (SREPB-1c) are fatty acid-regulated transcription factors that control lipid metabolism at the level of gene expression. This study compared a high oleic acid-rich safflower oil (ORSO) diet and a high-butter diet for their effect on adipose mass and expressions of genes regulated by PPAR and SREPB-1c in rats. Four groups of Wistar rats were fed 30S (30% ORSO), 5S (5% ORSO), 30B (29% butter + 1% ORSO), or 5B (4% butter plus 1% ORSO) diets for 15 wk. Compared with the 30B group, the 30S group had less retroperitoneal white adipose tissue (RWAT) mass and lower mRNA expressions of lipoprotein lipase, adipocyte fatty acid-binding protein, fatty acid synthase, acetyl CoA carboxylase, and SREBP-1c in the RWAT, higher mRNA expressions of acyl CoA oxidase, carnitine palmitoyl-transferase 1A, fatty acid binding protein, and mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase in the liver (P < 0.05). The 18:2(n-6) and 20:4(n-6) contents in the liver and RWAT of the 30S group were >2 fold those of the 30B group (P < 0.05). These results suggested that the smaller RWAT mass in rats fed the high-ORSO diet might be related to the higher tissue 18:2(n-6) and 20:4(n-6). This in turn could upregulate the expressions of fatty acid catabolic genes through the activation of PPARalpha in the liver and downregulate the expressions of lipid storage and lipogenic gene through the suppression of SREBP-1c in the RWAT.

Bile Acid-regulated Peroxisome Proliferator-activated Receptor-α (PPARα) Activity Underlies Circadian Expression of Intestinal Peptide Absorption Transporter PepT1/Slc15a1*

PubMed Central

Okamura, Ayako; Koyanagi, Satoru; Dilxiat, Adila; Kusunose, Naoki; Chen, Jia Jun; Matsunaga, Naoya; Shibata, Shigenobu; Ohdo, Shigehiro

2014-01-01

Digested proteins are mainly absorbed as small peptides composed of two or three amino acids. The intestinal absorption of small peptides is mediated via only one transport system: the proton-coupled peptide transporter-1 (PepT1) encoded from the soluble carrier protein Slc15a1. In mammals, intestinal expression of PepT1/Slc15a1 oscillates during the daily feeding cycle. Although the oscillation in the intestinal expression of PepT1/Slc15a1 is suggested to be controlled by molecular components of circadian clock, we demonstrated here that bile acids regulated the oscillation of PepT1/Slc15a1 expression through modulating the activity of peroxisome proliferator-activated receptor α (PPARα). Nocturnally active mice mainly consumed their food during the dark phase. PPARα activated the intestinal expression of Slc15a1 mRNA during the light period, and protein levels of PepT1 peaked before the start of the dark phase. After food intake, bile acids accumulated in intestinal epithelial cells. Intestinal accumulated bile acids interfered with recruitment of co-transcriptional activator CREB-binding protein/p300 on the promoter region of Slc15a1 gene, thereby suppressing PPARα-mediated transactivation of Slc15a1. The time-dependent suppression of PPARα-mediated transactivation by bile acids caused an oscillation in the intestinal expression of PepT1/Slc15a1 during the daily feeding cycle that led to circadian changes in the intestinal absorption of small peptides. These findings suggest a molecular clock-independent mechanism by which bile acid-regulated PPARα activity governs the circadian expression of intestinal peptide transporter. PMID:25016014

Dietary Docosahexaenoic Acid Supplementation Enhances Expression of Fatty Acid-Binding Protein 5 at the Blood-Brain Barrier and Brain Docosahexaenoic Acid Levels.

PubMed

Pan, Yijun; Morris, Elonie R; Scanlon, Martin J; Marriott, Philip J; Porter, Christopher Jh; Nicolazzo, Joseph A

2018-03-27

The cytoplasmic trafficking of docosahexaenoic acid (DHA), a cognitively-beneficial fatty acid, across the blood-brain barrier (BBB) is governed by fatty acid-binding protein 5 (FABP5). Lower levels of brain DHA have been observed in Alzheimer's disease (AD), which is associated with diminished BBB expression of FABP5. Therefore, upregulating FABP5 expression at the BBB may be a novel approach for enhancing BBB transport of DHA in AD. DHA supplementation has been shown to be beneficial in various mouse models of AD, and therefore, the aim of this study was to determine whether DHA has the potential to upregulate the BBB expression of FABP5, thereby enhancing its own uptake into the brain. Treating human brain microvascular brain endothelial (hCMEC/D3) cells with the maximum tolerable concentration of DHA (12.5 μM) for 72 hr resulted in a 1.4-fold increase in FABP5 protein expression. Associated with this was increased expression of fatty acid transport proteins 1 and 4. To study the impact of dietary DHA supplementation, 6-8 week old C57BL/6 mice were fed with a control diet or a DHA-enriched diet for 21 days. Brain microvascular FABP5 protein expression was upregulated 1.7-fold in mice fed the DHA-enriched diet, and this was associated with increased brain DHA levels (1.3-fold). Despite an increase in brain DHA levels, reduced BBB transport of 14 C-DHA was observed over a 1 min perfusion, possibly as a result of competitive binding to FABP5 between dietary DHA and 14 C-DHA. The current study has demonstrated that DHA can increase BBB expression of FABP5, as well as fatty acid transporters, overall increasing brain DHA levels. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Dietary arachidonic acid and docosahexaenoic acid regulate liver fatty acid desaturase (FADS) alternative transcript expression in suckling piglets.

PubMed

Wijendran, Vasuki; Downs, Ian; Srigley, Cynthia Tyburczy; Kothapalli, Kumar S D; Park, Woo Jung; Blank, Bryant S; Zimmer, J Paul; Butt, C M; Salem, Norman; Brenna, J Thomas

2013-10-01

Molecular regulation of fatty acid desaturase (Fads) gene expression by dietary arachidonic acid (ARA) and docosahexaenoic acid (DHA) during early post-natal period, when the demand for long chain polyunsaturated fatty acids (LC-PUFA) is very high, has not been well defined. The objective of the current study was to determine regulation of liver Fads1, Fads2 and Fads3 classical (CS) and alternative transcripts (AT) expression by dietary ARA and DHA, within the physiological range present in human breast milk, in suckling piglets. Piglets were fed one of six milk replacer formula diets (formula-reared groups, FR) with varying ARA and DHA content from days 3-28 of age. The ARA/DHA levels of the six formula diets were as follows (% total fatty acid, FA/FA): (A1) 0.1/1.0; (A2) 0.53/1.0; (A3-D3) 0.69/1.0; (A4) 1.1/1.0; (D2) 0.67/0.62; and (D1) 0.66/0.33. The control maternal-reared (MR) group remained with the dam. Fads1 expression was not significantly different between FR and MR groups. Fads2 expression was down-regulated significantly in diets with 1:1 ratio of ARA:DHA, compared to MR. Fads2 AT1 expression was highly correlated to Fads2 expression. Fads3 AT7 was the only Fads3 transcript sensitive to dietary LC-PUFA intake and was up-regulated in the formula diets with lowest ARA and DHA contents compared to MR. Thus, the present study provides evidence that the proportion of dietary ARA:DHA is a significant determinant of Fads2 expression and LC-PUFA metabolism during the early postnatal period. Further, the data suggest that Fads3 AT7 may have functional significance when dietary supply of ARA and DHA are low during early development. © 2013 Elsevier Ltd. All rights reserved.

Prenatal administration of retinoic acid increases the trophoblastic insulin-like growth factor 2 protein expression in the nitrofen model of congenital diaphragmatic hernia.

PubMed

Kutasy, Balazs; Friedmacher, Florian; Duess, Johannes W; Puri, Prem

2014-02-01

The high mortality rate in congenital diaphragmatic hernia (CDH) is attributed to pulmonary hypoplasia (PH). Insulin-like growth factor 2 (IGF2) is an important regulator of fetal growth. The highest levels of IGF2 expression are found in the placenta, which are negatively regulated by decidual retinoid acid receptor alpha (RARα). It has been demonstrated that prenatal administration of retinoic acid (RA) suppresses decidual RARα expression. Previous studies have further shown that prenatal administration of RA can reverse PH in nitrofen-induced CDH model. In IGF2 knockout animals, low levels of IGF2 are associated with decreased placental growth and PH. We therefore hypothesized that nitrofen decreases trophoblastic IGF2 expression and prenatal administration of RA increases it through decidual RARα in the nitrofen-induced CDH model. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). RA was given intraperitoneally on D18, D19 and D20. Fetuses were harvested on D21 and divided into three groups: control, CDH and nitrofen+RA. Immunohistochemistry was performed to evaluate decidual RARα and trophoblastic IGF2 expression. Protein levels of IGF2 in serum, intra-amniotic fluid and left lungs were measured by enzyme-linked immunosorbent assay. Significant growth retardation of placenta and left lungs was observed in the CDH group compared to control and nitrofen+RA group. Markedly increased decidual RARα and decreased IGF2 immunoreactivity were found in the CDH group compared to control and nitrofen+RA group. Significantly decreased IGF2 protein levels were detected in serum, intra-amniotic fluid and left lungs in the CDH group compared to control and nitrofen+RA group. Our findings suggest that nitrofen may disturb trophoblastic IGF2 expression through decidual RARα resulting in retarded placental growth and PH in the nitrofen-induced CDH. Prenatal administration of RA may promote lung and placental growth by increasing trophoblastic IGF2 expression.

Fatty Acid–Regulated Transcription Factors in the Liver

PubMed Central

Jump, Donald B.; Tripathy, Sasmita; Depner, Christopher M.

2014-01-01

Fatty acid regulation of hepatic gene transcription was first reported in the early 1990s. Several transcription factors have been identified as targets of fatty acid regulation. This regulation is achieved by direct fatty acid binding to the transcription factor or by indirect mechanisms where fatty acids regulate signaling pathways controlling the expression of transcription factors or the phosphorylation, ubiquitination, or proteolytic cleavage of the transcription factor. Although dietary fatty acids are well-established regulators of hepatic transcription factors, emerging evidence indicates that endogenously generated fatty acids are equally important in controlling transcription factors in the context of glucose and lipid homeostasis. Our first goal in this review is to provide an up-to-date examination of the molecular and metabolic bases of fatty acid regulation of key transcription factors controlling hepatic metabolism. Our second goal is to link these mechanisms to nonalcoholic fatty liver disease (NAFLD), a growing health concern in the obese population. PMID:23528177

Interacting signal pathways control defense gene expression in Arabidopsis in response to cell wall-degrading enzymes from Erwinia carotovora.

PubMed

Norman-Setterblad, C; Vidal, S; Palva, E T

2000-04-01

We have characterized the role of salicylic acid (SA)-independent defense signaling in Arabidopsis thaliana in response to the plant pathogen Erwinia carotovora subsp. carotovora. Use of pathway-specific target genes as well as signal mutants allowed us to elucidate the role and interactions of ethylene, jasmonic acid (JA), and SA signal pathways in this response. Gene expression studies suggest a central role for both ethylene and JA pathways in the regulation of defense gene expression triggered by the pathogen or by plant cell wall-degrading enzymes (CF) secreted by the pathogen. Our results suggest that ethylene and JA act in concert in this regulation. In addition, CF triggers another, strictly JA-mediated response inhibited by ethylene and SA. SA does not appear to have a major role in activating defense gene expression in response to CF. However, SA may have a dual role in controlling CF-induced gene expression, by enhancing the expression of genes synergistically induced by ethylene and JA and repressing genes induced by JA alone.

Effect of Psidium cattleianum leaf extract on Streptococcus mutans viability, protein expression and acid production.

PubMed

Brighenti, F L; Luppens, S B I; Delbem, A C B; Deng, D M; Hoogenkamp, M A; Gaetti-Jardim, E; Dekker, H L; Crielaard, W; ten Cate, J M

2008-01-01

Plants naturally produce secondary metabolites that can be used as antimicrobials. The aim of this study was to assess the effects of Psidium cattleianum leaf extract on Streptococcus mutans. The extract (100%) was obtained by decoction of 100 g of leaves in 600 ml of deionized water. To assess killing, S. mutans biofilms were treated with water (negative control) or various extract dilutions [100, 50, 25% (v/v) in water] for 5 or 60 min. To evaluate the effect on protein expression, biofilms were exposed to water or 1.6% (v/v) extract for 120 min, proteins were extracted and submitted to 2-dimensional difference gel electrophoresis. Differentially expressed proteins were identified by mass spectrometry. The effect of 1.6% (v/v) extract on acid production was determined by pH measurements and compared to a water control. Viability was similar after 5 min of treatment with the 100% extract or 60 min with the 50% extract (about 0.03% survival). There were no differences in viability between the biofilms exposed to the 25 or 50% extract after 60 min of treatment (about 0.02% survival). Treatment with the 1.6% extract significantly changed protein expression. The abundance of 24 spots was decreased compared to water (p < 0.05). The extract significantly inhibited acid production (p < 0.05). It is concluded that P. cattleianum leaf extract kills S. mutans grown in biofilms when applied at high concentrations. At low concentrations it inhibits S. mutans acid production and reduces the expression of proteins involved in general metabolism, glycolysis and lactic acid production. (c) 2008 S. Karger AG, Basel

Increased Flow of Fatty Acids toward β-Oxidation in Developing Seeds of Arabidopsis Deficient in Diacylglycerol Acyltransferase Activity or Synthesizing Medium-Chain-Length Fatty Acids1

PubMed Central

Poirier, Yves; Ventre, Giovanni; Caldelari, Daniela

1999-01-01

Synthesis of polyhydroxyalkanoates (PHAs) from intermediates of fatty acid β-oxidation was used as a tool to study fatty acid degradation in developing seeds of Arabidopsis. Transgenic plants expressing a peroxisomal PHA synthase under the control of a napin promoter accumulated PHA in developing seeds to a final level of 0.06 mg g−1 dry weight. In plants co-expressing a plastidial acyl-acyl carrier protein thioesterase from Cuphea lanceolata and a peroxisomal PHA synthase, approximately 18-fold more PHA accumulated in developing seeds. The proportion of 3-hydroxydecanoic acid monomer in the PHA was strongly increased, indicating a large flow of capric acid toward β-oxidation. Furthermore, expression of the peroxisomal PHA synthase in an Arabidopsis mutant deficient in the enzyme diacylglycerol acyltransferase resulted in a 10-fold increase in PHA accumulation in developing seeds. These data indicate that plants can respond to the inadequate incorporation of fatty acids into triacylglycerides by recycling the fatty acids via β-oxidation and that a considerable flow toward β-oxidation can occur even in a plant tissue primarily devoted to the accumulation of storage lipids. PMID:10594123

Increased flow of fatty acids toward beta-oxidation in developing seeds of Arabidopsis deficient in diacylglycerol acyltransferase activity or synthesizing medium-chain-length fatty acids.

PubMed

Poirier, Y; Ventre, G; Caldelari, D

1999-12-01

Synthesis of polyhydroxyalkanoates (PHAs) from intermediates of fatty acid beta-oxidation was used as a tool to study fatty acid degradation in developing seeds of Arabidopsis. Transgenic plants expressing a peroxisomal PHA synthase under the control of a napin promoter accumulated PHA in developing seeds to a final level of 0. 06 mg g(-1) dry weight. In plants co-expressing a plastidial acyl-acyl carrier protein thioesterase from Cuphea lanceolata and a peroxisomal PHA synthase, approximately 18-fold more PHA accumulated in developing seeds. The proportion of 3-hydroxydecanoic acid monomer in the PHA was strongly increased, indicating a large flow of capric acid toward beta-oxidation. Furthermore, expression of the peroxisomal PHA synthase in an Arabidopsis mutant deficient in the enzyme diacylglycerol acyltransferase resulted in a 10-fold increase in PHA accumulation in developing seeds. These data indicate that plants can respond to the inadequate incorporation of fatty acids into triacylglycerides by recycling the fatty acids via beta-oxidation and that a considerable flow toward beta-oxidation can occur even in a plant tissue primarily devoted to the accumulation of storage lipids.

Effect of Concentrated Apple Extract on Experimental Colitis Induced by Acetic Acid.

PubMed

Pastrelo, Maurício Mercaldi; Dias Ribeiro, Carla Caroline; Duarte, Joselmo Willamys; Bioago Gollücke, Andréa Pitelli; Artigiani-Neto, Ricardo; Ribeiro, Daniel Araki; Miszputen, Sender Jankiel; Fujiyama Oshima, Celina Tizuko; Ribeiro Paiotti, Ana Paula

2017-01-01

Reactive oxygen and nitrogen species (ROS/RNS) play a crucial role in inflammatory bowel disease (IBD) exacerbating the chronic inflammatory process. Endogenous and diet antioxidants can neutralize these compounds. The apple is widely consumed, with several antioxidant activity compounds. The present study evaluated the effects of concentrated apple extract (CAE) in acetic acid induced colitis. 29 Wistar male rats were randomized into 5 groups. G1-Sham/saline solution, G2-CAE/control, G3-acetic acid/control, G4-curative- CAE treatment and G5-preventive-CAE treatment. Eight days later, the animals were euthanized and the colonic segment resected for macroscopic and histological analysis. Gene expression was evaluated for inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), catalase and copper and zinc superoxide dismutase (CuZnSOD) by quantitative real time PCR, while protein expression was assessed for iNOS, COX-2 and 8-hydroxy-20-deoxyguanosine (8-OHdG) via immunohistochemistry. The groups G3, G4 and G5 had weight loss, while G5 had weight increase at the end of the experiment. The treatment with CAE reduced the macroscopic and microscopic injury, decreased iNOS mRNA expression and increased CuZnSOD mRNA expression in animals with induced acetic acid-colitis. The findings of the present study suggest that CAE treatment exerts an antioxidant role by downregulating iNOS and upregulating CuZnSOD.

Folic Acid supplementation stimulates notch signaling and cell proliferation in embryonic neural stem cells.

PubMed

Liu, Huan; Huang, Guo-Wei; Zhang, Xu-Mei; Ren, Da-Lin; X Wilson, John

2010-09-01

The present study investigated the effect of folic acid supplementation on the Notch signaling pathway and cell proliferation in rat embryonic neural stem cells (NSCs). The NSCs were isolated from E14-16 rat brain and grown as neurospheres in serum-free suspension culture. Individual cultures were assigned to one of 3 treatment groups that differed according to the concentration of folic acid in the medium: Control (baseline folic acid concentration of 4 mg/l), low folic acid supplementation (4 mg/l above baseline, Folate-L) and high folic acid supplementation (40 mg/l above baseline, Folate-H). NSCs were identified by their expression of immunoreactive nestin and proliferating cells by incorporation of 5'bromo-2'deoxyuridine. Cell proliferation was also assessed by methyl thiazolyl tetrazolium assay. Notch signaling was analyzed by real-time PCR and western blot analyses of the expression of Notch1 and hairy and enhancer of split 5 (Hes5). Supplementation of NSCs with folic acid increased the mRNA and protein expression levels of Notch1 and Hes5. Folic acid supplementation also stimulated NSC proliferation dose-dependently. Embryonic NSCs respond to folic acid supplementation with increased Notch signaling and cell proliferation. This mechanism may mediate the effects of folic acid supplementation on neurogenesis in the embryonic nervous system.

Cafeteria diet overfeeding in young male rats impairs the adaptive response to fed/fasted conditions and increases adiposity independent of body weight.

PubMed

Castro, H; Pomar, C A; Picó, C; Sánchez, J; Palou, A

2015-03-01

We analyzed the effects of a short exposure to a cafeteria diet during early infancy in rats on their metabolic response to fed/fasting conditions in key tissues involved in energy homeostasis. Ten-day-old male pups were fed a control or a cafeteria diet for 12 days and then killed under ad libitum feeding conditions or 12 h fasting. The expression of key genes related to energy metabolism in liver, retroperitoneal white adipose tissue (WAT) and hypothalamus were analyzed. Despite no differences in body weight, cafeteria-fed animals had almost double the fat mass of control rats. They also showed higher food intake, higher leptinemia and altered hypothalamic expression of Neuropetide Y, suggesting a dysfunction in the control of food intake. Unlike controls, cafeteria-fed animals did not decrease WAT expression of Pparg, sterol regulatory element binding transcription factor 1 or Cidea under fasting conditions, and displayed lower Pnpla2 expression than controls. In liver, compared with controls, cafeteria animals presented: (i) lower expression of genes related with fatty acid uptake and lipogenesis under ad libitum-fed conditions; (ii) higher expression of fatty acid oxidation-related genes and glucokinase under fasting conditions; (iii) greater expression of leptin and insulin receptors; and higher protein levels of insulin receptor and the pAMPK/AMPK ratio. A short period of exposure to a cafeteria diet in early infancy in rat pups is enough to disturb the metabolic response to fed/fasting conditions in key tissues involved in energy homeostasis, particularly in WAT, and hence induces an exacerbated body fat accumulation and increased metabolic risk, with no apparent effects on body weight.

Dysregulation of hepatic fatty acid metabolism in chronic kidney disease.

PubMed

Jin, Kyubok; Norris, Keith; Vaziri, Nosratola D

2013-02-01

Chronic kidney disease (CKD) results in hypertriglyceridemia which is largely due to impaired clearance of triglyceride-rich lipoproteins occasioned by downregulation of lipoprotein lipase and very low-density lipoprotein (LDL) receptor in the skeletal muscle and adipose tissue and of hepatic lipase and LDL receptor-related protein in the liver. However, data on the effect of CKD on fatty acid metabolism in the liver is limited and was investigated here. Male Sprague-Dawley rats were randomized to undergo 5/6 nephrectomy (CRF) or sham operation (control) and observed for 12 weeks. The animals were then euthanized and their liver tissue tested for nuclear translocation (activation) of carbohydrate-responsive element binding protein (ChREBP) and sterol-responsive element binding protein-1 (SREBP-1) which independently regulate the expression of key enzyme in fatty acid synthesis, i.e. fatty acid synthase (FAS) and acyl-CoA carboxylase (ACC) as well as nuclear Peroxisome proliferator-activated receptor alpha (PPARα) which regulates the expression of enzymes involved in fatty acid oxidation and transport, i.e. L-FABP and CPT1A. In addition, the expression of ATP synthase α, ATP synthase β, glycogen synthase and diglyceride acyltransferase 1 (DGAT1) and DGAT2 were determined. Compared with controls, the CKD rats exhibited hypertriglyceridemia, elevated plasma and liver tissue free fatty acids, increased nuclear ChREBP and reduced nuclear SREBP-1 and PPARα, upregulation of ACC and FAS and downregulation of L-FABP, CPT1A, ATP synthase α, glycogen synthase and DGAT in the liver tissue. Liver in animals with advanced CKD exhibits ChREBP-mediated upregulation of enzymes involved in fatty acid synthesis, downregulation of PPARα-regulated fatty acid oxidation system and reduction of DGAT resulting in reduced fatty acid incorporation in triglyceride.

Parthenolide accumulation and expression of genes related to parthenolide biosynthesis affected by exogenous application of methyl jasmonate and salicylic acid in Tanacetum parthenium.

PubMed

Majdi, Mohammad; Abdollahi, Mohammad Reza; Maroufi, Asad

2015-11-01

Up-regulation of germacrene A synthase and down-regulation of parthenolide hydroxylase genes play key role in parthenolide accumulation of feverfew plants treated with methyl jasmonate and salicylic acid. Parthenolide is an important sesquiterpene lactone due to its anti-migraine and anti-cancer properties. Parthenolide amount was quantified by high-performance liquid chromatography after foliar application of methyl jasmonate (100 µM) or salicylic acid (1.0 mM) on feverfew leaves in time course experiment (3-96 h). Results indicate that exogenous application of methyl jasmonate or salicylic acid activated parthenolide biosynthesis. Parthenolide content reached its highest amount at 24 h after methyl jasmonate or salicylic acid treatments, which were 3.1- and 1.96-fold higher than control plants, respectively. Parthenolide transiently increased due to methyl jasmonate or salicylic acid treatments until 24 h, but did not show significant difference compared with control plants at 48 and 96 h time points in both treatments. Also, the transcript levels of early pathway (upstream) genes of terpene biosynthesis including 3-hydroxy-3-methylglutaryl-coenzyme A reductase, 1-deoxy-D-xylulose-5-phosphate reductoisomerase and hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase and the biosynthetic genes of parthenolide including germacrene A synthase, germacrene A oxidase, costunolide synthase and parthenolide synthase were increased by methyl jasmonate and salicylic acid treatments, but with different intensity. The transcriptional levels of these genes were higher in methyl jasmonate-treated plants than salicylic acid-treated plants. Parthenolide content measurements along with expression pattern analysis of the aforementioned genes and parthenolide hydroxylase as side branch gene of parthenolide suggest that the expression patterns of early pathway genes were not directly consistent with parthenolide accumulation pattern; hence, parthenolide accumulation is probably further modulated by the expression of its biosynthetic genes, especially germacrene A synthase and also its side branch gene, parthenolide hydroxylase.

Expression of HSP72 in the gastric mucosa is regulated by gastric acid in rats-Correlation of HSP72 expression with mucosal protection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wada, Isao; Otaka, Michiro; Jin, Mario

2006-10-20

Background and aim: The real mechanism of adaptive cytoprotection in the gastric mucosa is not well established. In the present study, we investigated the effect of acid suppressing agents on a 72-kDa heat shock protein (HSP72) expression, which is known as endogenous cytoprotective factor, in the gastric mucosa. Also, the association of gastric mucosal protective function against HCl-challenge was compared between HSP72-induced and -reduced group. Materials and methods: Expression of HSP72 was measured by Western blotting in the gastric mucosa before and after administration of famotidine or omeprazole. The gastric mucosal protective function against 0.6 N HCl was compared betweenmore » control group and HSP72-reduced group. Also, the effect of increased expression of gastric HSP72 by additional administration of zinc sulfate or zinc L-carnosine, which is known as HSP72-inducer, on mucosal protective function was studied. Results: HSP72 expression in the gastric mucosa was reduced by acid suppressing agents. The lowest expression level of HSP72 was observed 12 h (famotidine, H2-receptor antagonist) or 48 h (omeprazole, proton pump inhibitor) after administration. The gastric mucosal protective ability against 0.6 N HCl was also reduced when HSP72 expression was decreased by famotidine or omeprazole. This phenomenon was reversed by HSP72 induction by additional administration of zinc derivatives. Conclusion: Our results might indicate that the expression of HSP72 in the gastric mucosa is physiologically regulated by gastric acid, and that HSP72 induction could be important in view of mucosal protection especially when HSP72 expression is reduced by administration of acid suppressing agents such as proton pump inhibitor or H2 receptor antagonist.« less

Novel linear polymers able to inhibit bacterial quorum sensing.

PubMed

Cavaleiro, Eliana; Duarte, Ana Sofia; Esteves, Ana Cristina; Correia, António; Whitcombe, Michael J; Piletska, Elena V; Piletsky, Sergey A; Chianella, Iva

2015-05-01

Bacterial phenotypes, such as biofilm formation, antibiotic resistance and virulence expression, are associated with quorum sensing. Quorum sensing is a density-dependent regulatory system of gene expression controlled by specific signal molecules, such as N-acyl homoserine lactones (AHLs), produced and released by bacteria. This study reports the development of linear polymers capable to attenuate quorum sensing by adsorption of AHLs. Linear polymers were synthesized using MMA as backbone monomer and methacrylic acid and itaconic acid as functional monomers. Two different quorum sensing-controlled phenotypes, Vibrio fischeri bioluminescence and Aeromonas hydrophila biofilm formation, were evaluated to test the polymers' efficiency. Results showed that both phenotypes were significantly affected by the polymers, with the itaconic acid-containing material being more effective than the methacrylic acid one. The polymer inhibitory effects were reverted by the addition of lactones, confirming attenuation of quorum sensing through sequestration of signal molecules. The polymers also showed no cytotoxicity when tested using a mammalian cell line. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Carcass and Meat Characteristics and Gene Expression in Intramuscular Adipose Tissue of Korean Native Cattle Fed Finishing Diets Supplemented with 5% Palm Oil.

PubMed

Park, Sungkwon; Yan, Zhang; Choi, Changweon; Kim, Kyounghoon; Lee, Hyunjeong; Oh, Youngkyoon; Jeong, Jinyoung; Lee, Jonggil; Smith, Stephen B; Choi, Seongho

2017-01-01

We hypothesized that supplementing finishing diets with palm oil would promote adipogenic gene expression but depress stearoyl-CoA desaturase ( SCD ) gene expression in intramuscular (i.m.) adipose tissues of Hanwoo steers during fattening period (from 16 to 32 mon of age). Fourteen Hanwoo steers were allotted randomly to 2 groups of 7 steers based on initial BW and fed either a basal diet (control) or the basal diet supplemented with 5% palm oil (BDSP). At slaughter, i.m. adipose tissue was harvested for analysis of adipogenic gene expression and fatty acid composition. There were no differences in BW or average daily gain between treatment groups. Supplemental palm oil had no effect on carcass quality traits (carcass weight, backfat thickness, loin muscle area, or marbling scores) or meat color values. Palm oil increased ( p <0.05) expression of AMP-activated protein kinase-α and peroxisome proliferator-activated receptor-γ, but decreased ( p <0.05) CAAT/enhancer binding protein-β gene expression and tended to decrease stearoyl-CoA desaturase gene expression in i.m. adipose tissue. Palm oil increased total i.m. polyunsaturated fatty acids ( p <0.05) compared to the control i.m. adipose tissue, but had no effect on saturated or monounsaturated fatty acids. Although there were significant effects of supplemental palm oil on i.m. adipose tissue gene expression, the absence of negative effects on carcass and meat characteristics indicates that palm oil could be a suitable dietary supplement for the production of Hanwoo beef cattle.

Carcass and Meat Characteristics and Gene Expression in Intramuscular Adipose Tissue of Korean Native Cattle Fed Finishing Diets Supplemented with 5% Palm Oil

PubMed Central

Park, Sungkwon; Yan, Zhang; Choi, Changweon; Kim, Kyounghoon; Lee, Hyunjeong; Oh, Youngkyoon; Jeong, Jinyoung; Lee, Jonggil; Smith, Stephen B.; Choi, Seongho

2017-01-01

We hypothesized that supplementing finishing diets with palm oil would promote adipogenic gene expression but depress stearoyl-CoA desaturase (SCD) gene expression in intramuscular (i.m.) adipose tissues of Hanwoo steers during fattening period (from 16 to 32 mon of age). Fourteen Hanwoo steers were allotted randomly to 2 groups of 7 steers based on initial BW and fed either a basal diet (control) or the basal diet supplemented with 5% palm oil (BDSP). At slaughter, i.m. adipose tissue was harvested for analysis of adipogenic gene expression and fatty acid composition. There were no differences in BW or average daily gain between treatment groups. Supplemental palm oil had no effect on carcass quality traits (carcass weight, backfat thickness, loin muscle area, or marbling scores) or meat color values. Palm oil increased (p<0.05) expression of AMP-activated protein kinase-α and peroxisome proliferator-activated receptor-γ, but decreased (p<0.05) CAAT/enhancer binding protein-β gene expression and tended to decrease stearoyl-CoA desaturase gene expression in i.m. adipose tissue. Palm oil increased total i.m. polyunsaturated fatty acids (p<0.05) compared to the control i.m. adipose tissue, but had no effect on saturated or monounsaturated fatty acids. Although there were significant effects of supplemental palm oil on i.m. adipose tissue gene expression, the absence of negative effects on carcass and meat characteristics indicates that palm oil could be a suitable dietary supplement for the production of Hanwoo beef cattle. PMID:28515640

Metabolic dependent and independent pH-drop shuts down VirSR quorum sensing in Clostridium perfringens.

PubMed

Adachi, Keika; Ohtani, Kaori; Kawano, Michio; Singh, Ravindra Pal; Yousuf, Basit; Sonomoto, Kenji; Shimizu, Tohru; Nakayama, Jiro

2018-05-01

Clostridium perfringens produces various exotoxins and enzymes that cause food poisoning and gas gangrene. The genes involved in virulence are regulated by the agr-like quorum sensing (QS) system, which consists of a QS signal synthesis system and a VirSR two-component regulatory system (VirSR TCS) which is a global regulatory system composed of signal sensor kinase (VirS) and response regulator (VirR). We found that the perfringolysin O gene (pfoA) was transiently expressed during mid-log phase of bacterial growth; its expression was rapidly shut down thereafter, suggesting the existence of a self-quorum quenching (sQQ) system. The sQQ system was induced by the addition of stationary phase culture supernatant (SPCS). Activity of the sQQ system was heat stable, and was present following filtration through the ultrafiltration membrane, suggesting that small molecules acted as sQQ agents. In addition, sQQ was also induced by pure acetic and butyric acids at concentrations equivalent to those in the stationary phase culture, suggesting that organic acids produced by C. perfringens were involved in sQQ. In pH-controlled batch culture, sQQ was greatly diminished; expression level of pfoA extended to late-log growth phase, and was eventually increased by one order of magnitude. Furthermore, hydrochloric acid induced sQQ at the same pH as was used in organic acids. SPCS also suppressed the expression of genes regulated by VirSR TCS. Overall, the expression of virulence factors of C. perfringens was downregulated by the sQQ system, which was mediated by primary acidic metabolites and acidic environments. This suggested the possibility of pH-controlled anti-virulence strategies. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Low-protein diet induces, whereas high-protein diet reduces hepatic FGF21 production in mice, but glucose and not amino acids up-regulate FGF21 in cultured hepatocytes.

PubMed

Chalvon-Demersay, Tristan; Even, Patrick C; Tomé, Daniel; Chaumontet, Catherine; Piedcoq, Julien; Gaudichon, Claire; Azzout-Marniche, Dalila

2016-10-01

Fibroblast growth factor 21 (FGF21) is a polypeptide secreted by the liver and involved in several metabolic processes such as thermogenesis and lipid oxidation. The nutritional mechanisms controlling FGF21 production are poorly understood. This study aimed to investigate how dietary carbohydrates and proteins impact FGF21 production and how in turn, FGF21 is involved in the metabolic adaptation to changes in the carbohydrate and protein contents of the diet. For that purpose, we fed 25 male C57BL/6 mice diets composed of different protein and carbohydrate contents (normal-protein and carbohydrate diet (N=9, NPNC), low-protein high-carbohydrate diet (N=8, LPHC), high-protein low-carbohydrate diet (N=8, HPLC) for 3 weeks. We measured liver Fgf21 gene expression, synthesis and secretion as well as different parameters related to energy and glucose metabolism. We also investigated the direct role of amino acids and glucose in the control of Fgf21 gene expression in hepatocyte primary cultures (n=6). In vivo, FGF21 responds acutely to LPHC intake whereas under an HPLC diet, plasma FGF21 circulating levels are low in the fasted and refed states. In hepatocytes, Fgf21 expression was controlled by glucose but not amino acids. Both diets increased the thermic effect of feeding (TEF) and ketogenesis was increased in fasted HPLC mice. The results presented suggest that dietary glucose, rather than amino acids, directly controls FGF21 secretion, and that FGF21 may be involved in the increased TEF response to LPHC. The effects of the HPLC diet on ketogenesis and TEF are probably controlled by other metabolic pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

Muscarinic Control of MIN6 Pancreatic β Cells Is Enhanced by Impaired Amino Acid Signaling*

PubMed Central

Guerra, Marcy L.; Wauson, Eric M.; McGlynn, Kathleen; Cobb, Melanie H.

2014-01-01

We have shown recently that the class C G protein-coupled receptor T1R1/T1R3 taste receptor complex is an early amino acid sensor in MIN6 pancreatic β cells. Amino acids are unable to activate ERK1/2 in β cells in which T1R3 has been depleted. The muscarinic receptor agonist carbachol activated ERK1/2 better in T1R3-depleted cells than in control cells. Ligands that activate certain G protein-coupled receptors in pancreatic β cells potentiate glucose-stimulated insulin secretion. Among these is the M3 muscarinic acetylcholine receptor, the major muscarinic receptor in β cells. We found that expression of M3 receptors increased in T1R3-depleted MIN6 cells and that calcium responses were altered. To determine whether these changes were related to impaired amino acid signaling, we compared responses in cells exposed to reduced amino acid concentrations. M3 receptor expression was increased, and some, but not all, changes in calcium signaling were mimicked. These findings suggest that M3 acetylcholine receptors are increased in β cells as a mechanism to compensate for amino acid deficiency. PMID:24695728

Effects of Diets Differing in Composition of 18-C Fatty Acids on Adipose Tissue Thermogenic Gene Expression in Mice Fed High-Fat Diets

PubMed Central

Shin, Sunhye

2018-01-01

Dietary fatty acids play important roles in the regulation of fat accumulation or metabolic phenotype of adipocytes, either as brown or beige fat. However, a systematic comparison of effects of diets with different composition of 18-C fatty acids on browning/beiging phenotype has not been done. In this study, we compared the effects of different dietary fats, rich in specific 18-carbon fatty acids, on thermogenesis and lipid metabolism. Male C57BL/6 mice were fed a control diet containing 5.6% kcal fat from lard and 4.4% kcal fat from soybean oil (CON) or high-fat diets (HFD) containing 25% kcal from lard and 20% kcal fat from shea butter (stearic acid-rich fat; SHB), olive oil (oleic acid-rich oil; OO), safflower oil (linoleic acid-rich oil; SFO), or soybean oil (mixed oleic, linoleic, and α-linolenic acids; SBO) ad libitum for 12 weeks, with or without a terminal 4-h norepinephrine (NE) treatment. When compared to SHB, feeding OO, SFO, and SBO resulted in lower body weight gain. The OO fed group had the highest thermogenesis level, which resulted in lower body fat accumulation and improved glucose and lipid metabolism. Feeding SFO downregulated expression of lipid oxidation-related genes and upregulated expression of lipogenic genes, perhaps due to its high n-6:n-3 ratio. In general, HFD-feeding downregulated Ucp1 expression in both subcutaneous and epididymal white adipose tissue, and suppressed NE-induced Pgc1a expression in brown adipose tissue. These results suggest that the position of double bonds in dietary fatty acids, as well as the quantity of dietary fat, may have a significant effect on the regulation of oxidative and thermogenic conditions in vivo. PMID:29473916

Effects of Diets Differing in Composition of 18-C Fatty Acids on Adipose Tissue Thermogenic Gene Expression in Mice Fed High-Fat Diets.

PubMed

Shin, Sunhye; Ajuwon, Kolapo M

2018-02-23

Dietary fatty acids play important roles in the regulation of fat accumulation or metabolic phenotype of adipocytes, either as brown or beige fat. However, a systematic comparison of effects of diets with different composition of 18-C fatty acids on browning/beiging phenotype has not been done. In this study, we compared the effects of different dietary fats, rich in specific 18-carbon fatty acids, on thermogenesis and lipid metabolism. Male C57BL/6 mice were fed a control diet containing 5.6% kcal fat from lard and 4.4% kcal fat from soybean oil (CON) or high-fat diets (HFD) containing 25% kcal from lard and 20% kcal fat from shea butter (stearic acid-rich fat; SHB), olive oil (oleic acid-rich oil; OO), safflower oil (linoleic acid-rich oil; SFO), or soybean oil (mixed oleic, linoleic, and α-linolenic acids; SBO) ad libitum for 12 weeks, with or without a terminal 4-h norepinephrine (NE) treatment. When compared to SHB, feeding OO, SFO, and SBO resulted in lower body weight gain. The OO fed group had the highest thermogenesis level, which resulted in lower body fat accumulation and improved glucose and lipid metabolism. Feeding SFO downregulated expression of lipid oxidation-related genes and upregulated expression of lipogenic genes, perhaps due to its high n-6:n-3 ratio. In general, HFD-feeding downregulated Ucp1 expression in both subcutaneous and epididymal white adipose tissue, and suppressed NE-induced Pgc1a expression in brown adipose tissue. These results suggest that the position of double bonds in dietary fatty acids, as well as the quantity of dietary fat, may have a significant effect on the regulation of oxidative and thermogenic conditions in vivo.

Mechanism of body weight reducing effect of oral boric Acid intake.

PubMed

Aysan, Erhan; Sahin, Fikrettin; Telci, Dilek; Erdem, Merve; Muslumanoglu, Mahmut; Yardımcı, Erkan; Bektasoglu, Huseyin

2013-01-01

Objective. The effect of oral boric acid intake on reducing body weight has been previously demonstrated although the mechanism has been unclear. This research study reveals the mechanism. Subjects. Twelve mice were used, in groups of six each in the control and study groups. For five days, control group mice drank standard tap water while during the same time period the study group mice drank tap water which contains 0.28 mg/250 mL boric acid. After a 5-day period, gene expression levels for uncoupling proteins (UCPs) in the white adipose tissue (WAT), brown adipose tissue (BAT), and skeletal muscle tissue (SMT) and total body weight changes were analyzed. Results. Real time PCR analysis revealed no significant change in UCP3 expressions, but UCP2 in WAT (P: 0.0317), BAT (P: 0.014), and SMT (P: 0.0159) and UCP1 in BAT (P: 0.026) were overexpressed in the boric acid group. In addition, mice in the boric acid group lost body weight (mean 28.1%) while mice in the control group experienced no weight loss but a slight weight gain (mean 0.09%, P < 0.001). Conclusion. Oral boric acid intake causes overexpression of thermogenic proteins in the adipose and skeletal muscle tissues. Increasing thermogenesis through UCP protein pathway results in the accelerated lipolysis and body weight loss.

Proximal tubule glutamine synthetase expression is necessary for the normal response to dietary protein restriction.

PubMed

Lee, Hyun-Wook; Osis, Gunars; Handlogten, Mary E; Verlander, Jill W; Weiner, I David

2017-07-01

Dietary protein restriction has multiple benefits in kidney disease. Because protein intake is a major determinant of endogenous acid production, it is important that net acid excretion changes in parallel during changes in dietary protein intake. Dietary protein restriction decreases endogenous acid production and decreases urinary ammonia excretion, a major component of net acid excretion. Glutamine synthetase (GS) catalyzes the reaction of [Formula: see text] and glutamate, which regenerates the essential amino acid glutamine and decreases net ammonia generation. Because renal proximal tubule GS expression increases during dietary protein restriction, this could contribute to the decreased ammonia excretion. The purpose of the current study was to determine the role of proximal tubule GS in the renal response to protein restriction. We generated mice with proximal tubule-specific GS deletion (PT-GS-KO) using Cre-loxP techniques. Cre-negative (Control) and PT-GS-KO mice in metabolic cages were provided 20% protein diet for 2 days and were then changed to low-protein (6%) diet for the next 7 days. Additional PT-GS-KO mice were maintained on 20% protein diet. Dietary protein restriction caused a rapid decrease in urinary ammonia excretion in both genotypes, but PT-GS-KO blunted this adaptive response significantly. This occurred despite no significant genotype-dependent differences in urinary pH or in serum electrolytes. There were no significant differences between Control and PT-GS-KO mice in expression of multiple other proteins involved in renal ammonia handling. We conclude that proximal tubule GS expression is necessary for the appropriate decrease in ammonia excretion during dietary protein restriction.

Transcriptional regulation of fatty acid biosynthesis in mycobacteria

PubMed Central

Mondino, S.; Gago, G.; Gramajo, H.

2013-01-01

SUMMARY The main purpose of our study is to understand how mycobacteria exert control over the biosynthesis of their membrane lipids and find out the key components of the regulatory network that control fatty acid biosynthesis at the transcriptional level. In this paper we describe the identification and purification of FasR, a transcriptional regulator from Mycobacterium sp. that controls the expression of the fatty acid synthase (fas) and the 4-phosphopantetheinyl transferase (acpS) encoding genes, whose products are involved in the fatty acid and mycolic acid biosynthesis pathways. In vitro studies demonstrated that fas and acpS genes are part of the same transcriptional unit and that FasR specifically binds to three conserved operator sequences present in the fas-acpS promoter region (Pfas). The construction and further characterization of a fasR conditional mutant confirmed that FasR is a transcriptional activator of the fas-acpS operon and that this protein is essential for mycobacteria viability. Furthermore, the combined used of Pfas-lacZ fusions in different fasR backgrounds and electrophoretic mobility shift assays experiments, strongly suggested that long-chain acyl-CoAs are the effector molecules that modulate the affinity of FasR for its DNA binding sequences and therefore the expression of the essential fas-acpS operon. PMID:23721164

Novel Omega-3 Fatty Acid Epoxygenase Metabolite Reduces Kidney Fibrosis

PubMed Central

Sharma, Amit; Khan, Md. Abdul Hye; Levick, Scott P.; Lee, Kin Sing Stephen; Hammock, Bruce D.; Imig, John D.

2016-01-01

Cytochrome P450 (CYP) monooxygenases epoxidize the omega-3 polyunsaturated fatty acid (PUFA) docosahexaenoic acid into novel epoxydocosapentaenoic acids (EDPs) that have multiple biological actions. The present study determined the ability of the most abundant EDP regioisomer, 19,20-EDP to reduce kidney injury in an experimental unilateral ureteral obstruction (UUO) renal fibrosis mouse model. Mice with UUO developed kidney tubular injury and interstitial fibrosis. UUO mice had elevated kidney hydroxyproline content and five-times greater collagen positive fibrotic area than sham control mice. 19,20-EDP treatment to UUO mice for 10 days reduced renal fibrosis with a 40%–50% reduction in collagen positive area and hydroxyproline content. There was a six-fold increase in kidney α-smooth muscle actin (α-SMA) positive area in UUO mice compared to sham control mice, and 19,20-EDP treatment to UUO mice decreased α-SMA immunopositive area by 60%. UUO mice demonstrated renal epithelial-to-mesenchymal transition (EMT) with reduced expression of the epithelial marker E-cadherin and elevated expression of multiple mesenchymal markers (FSP-1, α-SMA, and desmin). Interestingly, 19,20-EDP treatment reduced renal EMT in UUO by decreasing mesenchymal and increasing epithelial marker expression. Overall, we demonstrate that a novel omega-3 fatty acid metabolite 19,20-EDP, prevents UUO-induced renal fibrosis in mice by reducing renal EMT. PMID:27213332

TOFA (5-tetradecyl-oxy-2-furoic acid) reduces fatty acid synthesis, inhibits expression of AR, neuropilin-1 and Mcl-1 and kills prostate cancer cells independent of p53 status.

PubMed

Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B

2011-07-01

A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.

Activation of Pathogenesis-related Genes by the Rhizobacterium, Bacillus sp. JS, Which Induces Systemic Resistance in Tobacco Plants.

PubMed

Kim, Ji-Seong; Lee, Jeongeun; Lee, Chan-Hui; Woo, Su Young; Kang, Hoduck; Seo, Sang-Gyu; Kim, Sun-Hyung

2015-06-01

Plant growth promoting rhizobacteria (PGPR) are known to confer disease resistance to plants. Bacillus sp. JS demonstrated antifungal activities against five fungal pathogens in in vitro assays. To verify whether the volatiles of Bacillus sp. JS confer disease resistance, tobacco leaves pre-treated with the volatiles were damaged by the fungal pathogen, Rhizoctonia solani and oomycete Phytophthora nicotianae. Pre-treated tobacco leaves had smaller lesion than the control plant leaves. In pathogenesis-related (PR) gene expression analysis, volatiles of Bacillus sp. JS caused the up-regulation of PR-2 encoding β-1,3-glucanase and acidic PR-3 encoding chitinase. Expression of acidic PR-4 encoding chitinase and acidic PR-9 encoding peroxidase increased gradually after exposure of the volatiles to Bacillus sp. JS. Basic PR-14 encoding lipid transfer protein was also increased. However, PR-1 genes, as markers of salicylic acid (SA) induced resistance, were not expressed. These results suggested that the volatiles of Bacillus sp. JS confer disease resistance against fungal and oomycete pathogens through PR genes expression.

In vivo Expression of a Light-activatable Potassium Channel Using Unnatural Amino Acids

PubMed Central

Kang, Ji-Yong; Kawaguchi, Daichi; Coin, Irene; Xiang, Zheng; O’Leary, Dennis D. M.; Slesinger, Paul A.; Wang, Lei

2013-01-01

SUMMARY Optical control of protein function provides excellent spatial-temporal resolution for studying proteins in situ. Although light-sensitive exogenous proteins and ligands have been employed to manipulate neuronal activity, a method for optical control of neuronal proteins using unnatural amino acids (Uaa) in vivo is lacking. Here, we describe the genetic incorporation of a photoreactive Uaa into the pore of an inwardly-rectifying potassium channel Kir2.1. The Uaa occluded the pore, rendering the channel non-conducting, and upon brief light illumination, was released to permit outward K+ current. Expression of this photo-inducible inwardly rectifying potassium (PIRK) channel in rat hippocampal neurons created a light-activatable PIRK switch for suppressing neuronal firing. We also expressed PIRK channels in embryonic mouse neocortex in vivo and demonstrated a light-activated PIRK current in cortical neurons. The principles applied here to a potassium channel could be generally expanded to other proteins expressed in the brain to enable optical regulation. PMID:24139041

Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

PubMed

Rao, Suryadevara S; Hildebrand, David

2009-10-01

The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

[Improvement of acetic acid tolerance and fermentation performance of industrial Saccharomyces cerevisiae by overexpression of flocculent gene FLO1 and FLO1c].

PubMed

Du, Zhaoli; Cheng, Yanfei; Zhu, Hui; He, Xiuping; Zhang, Borun

2015-02-01

Flocculent gene FLO1 and its truncated form FLO1c with complete deletion of repeat unit C were expressed in a non-flocculent industrial strain Saccharomyces cerevisiae CE6 to generate recombinant flocculent strains 6-AF1 and 6-AF1c respectively. Both strains of 6-AF1 and 6-AF1c displayed strong flocculation and better cell growth than the control strain CE6-V carrying the empty vector under acetic acid stress. Moreover, the flocculent strains converted glucose to ethanol at much higher rates than the control strain CE6-V under acetic acid stress. In the presence of 0.6% (V/V) acetic acid, the average ethanol production rates of 6-AF1 and 6-AF1c were 1.56 and 1.62 times of that of strain CE6-V, while the ethanol production rates of 6-AF1 and 6-AF1c were 1.21 and 1.78 times of that of strain CE6-V under 1.0% acetic acid stress. Results in this study indicate that acetic acid tolerance and fermentation performance of industrial S. cerevisiae under acetic acid stress can be improved largely by flocculation endowed by expression of flocculent genes, especially FLO1c.

Effect of 50 Hz electric field in diacylglycerol acyltransferase mRNA expression level and plasma concentration of triacylglycerol, free fatty acid, phospholipid and total cholesterol

PubMed Central

2012-01-01

Background The effects of exposure to a 50 Hz electric field (EF) on plasma level of triacylglycerol, free fatty acids, total cholesterol and phospholipid and mRNA expression level of diacylglycerol acyltransferase (DGAT) 1 and 2 in liver and intestines from C57BL/6 J mice were studied. Methods The test was based on comparison between mice post treated with 50 Hz EF of 45 kV/m intensity for 30 min per day for 11 days or without EF. DGATs mRNA expression was analyzed by real-time quantitative polymerase chain reaction. Results There was no difference in the gene expression level of DGAT1 in liver and intestines. The DGAT2 gene expression level in liver derived from mice treated with EF was significantly lower than those in the control (P < 0.001). Both plasma total cholesterol (P < 0.01) and phospholipid (P < 0.05) in the group exposed to EF were lower than those in the control, but there was no difference in triacylglycerol or free fatty acid levels. Conclusion Exposure to 50 Hz EF decrease the plasma levels of total cholesterol and phospholipids, and downregulated DGAT2 mRNA expression in liver. The mechanisms for the effects of EF on lipid metabolism are not well understand yet, but altered DGAT2 activity may be involved. PMID:22676350

Folic Acid Supplementation Promotes Mammary Tumor Progression in a Rat Model

PubMed Central

Deghan Manshadi, Shaidah; Ishiguro, Lisa; Sohn, Kyoung-Jin; Medline, Alan; Renlund, Richard; Croxford, Ruth; Kim, Young-In

2014-01-01

Folic acid supplementation may prevent the development of cancer in normal tissues but may promote the progression of established (pre)neoplastic lesions. However, whether or not folic acid supplementation can promote the progression of established (pre)neoplastic mammary lesions is unknown. This is a critically important issue because breast cancer patients and survivors in North America are likely exposed to high levels of folic acid owing to folic acid fortification and widespread supplemental use after cancer diagnosis. We investigated whether folic acid supplementation can promote the progression of established mammary tumors. Female Sprague-Dawley rats were placed on a control diet and mammary tumors were initiated with 7,12-dimethylbenza[a]anthracene at puberty. When the sentinel tumor reached a predefined size, rats were randomized to receive a diet containing the control, 2.5x, 4x, or 5x supplemental levels of folic acid for up to 12 weeks. The sentinel mammary tumor growth was monitored weekly. At necropsy, the sentinel and all other mammary tumors were analyzed histologically. The effect of folic acid supplementation on the expression of proteins involved in proliferation, apoptosis, and mammary tumorigenesis was determined in representative sentinel adenocarcinomas. Although no clear dose-response relationship was observed, folic acid supplementation significantly promoted the progression of the sentinel mammary tumors and was associated with significantly higher sentinel mammary tumor weight and volume compared with the control diet. Furthermore, folic acid supplementation was associated with significantly higher weight and volume of all mammary tumors. The most significant and consistent mammary tumor-promoting effect was observed with the 2.5x supplemental level of folic acid. Folic acid supplementation was also associated with an increased expression of BAX, PARP, and HER2. Our data suggest that folic acid supplementation may promote the progression of established mammary tumors. The potential tumor-promoting effect of folic acid supplementation in breast cancer patients and survivors needs further clarification. PMID:24465421

Prenatal administration of retinoic acid upregulates connective tissue growth factor in the nitrofen CDH model.

PubMed

Ruttenstock, Elke Maria; Doi, Takashi; Dingemann, Jens; Puri, Prem

2011-06-01

Recent studies have suggested that retinoids may be involved in the molecular mechanisms of pulmonary hypoplasia (PH) in congenital diaphragmatic hernia (CDH). Connective tissue growth factor (CTGF) plays a key role in foetal lung development and remodelling during later gestation. CTGF knockout mice exhibit PH with similar characteristics to the human and nitrofen-induced PH. Prenatal administration of retinoic acid (RA) has been shown to stimulate alveologenesis in nitrofen-induced PH. In vitro studies have revealed that RA can induce CTGF gene expression. We hypothesized that pulmonary gene expression of CTGF is downregulated during the later stages of lung development, and that prenatal administration of RA upregulates CTGF in the nitrofen CDH model. Pregnant rats were exposed to either olive oil or nitrofen on day 9 (D9) of gestation. RA was given intraperitoneally on D18, D19 and D20. Foetuses were harvested on D21 and divided into control, CDH, control + RA and CDH + RA group. Pulmonary CTGF gene and protein expression levels were determined using RT-PCR and immunohistochemistry. On D21, CTGF relative mRNA expression levels were significantly downregulated in CDH group compared to controls. After RA treatment, expression levels of CTGF were significantly upregulated in CDH + RA and control + RA compared to the CDH group. Immunohistochemical studies confirmed these results. Downregulation of pulmonary CTGF gene and protein expression during later stages of lung development may interfere with normal alveologenesis in the nitrofen CDH model. Upregulation of CTGF pulmonary gene expression after prenatal RA treatment may promote lung growth by promoting alveologenesis in the nitrofen-induced CDH model.

Intercellular and intracellular signalling systems that globally control the expression of virulence genes in plant pathogenic bacteria.

PubMed

Ham, Jong Hyun

2013-04-01

Plant pathogenic bacteria utilize complex signalling systems to control the expression of virulence genes at the cellular level and within populations. Quorum sensing (QS), an important intercellular communication mechanism, is mediated by different types of small molecules, including N-acyl homoserine lactones (AHLs), fatty acids and small proteins. AHL-mediated signalling systems dependent on the LuxI and LuxR family proteins play critical roles in the virulence of a wide range of Gram-negative plant pathogenic bacteria belonging to the Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria. Xanthomonas spp. and Xylella fastidiosa, members of the Gammaproteobacteria, however, possess QS systems that are mediated by fatty acid-type diffusible signal factors (DSFs). Recent studies have demonstrated that Ax21, a 194-amino-acid protein in Xanthomonas oryzae pv. oryzae, plays dual functions in activating a rice innate immune pathway through binding to the rice XA21 pattern recognition receptor and in regulating bacterial virulence and biofilm formation as a QS signal molecule. In xanthomonads, DSF-mediated QS systems are connected with the signalling pathways mediated by cyclic diguanosine monophosphate (c-di-GMP), which functions as a second messenger for the control of virulence gene expression in these bacterial pathogens. © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

Dietary Lipid Levels Influence Lipid Deposition in the Liver of Large Yellow Croaker (Larimichthys crocea) by Regulating Lipoprotein Receptors, Fatty Acid Uptake and Triacylglycerol Synthesis and Catabolism at the Transcriptional Level.

PubMed

Yan, Jing; Liao, Kai; Wang, Tianjiao; Mai, Kangsen; Xu, Wei; Ai, Qinghui

2015-01-01

Ectopic lipid accumulation has been observed in fish fed a high-lipid diet. However, no information is available on the mechanism by which dietary lipid levels comprehensively regulate lipid transport, uptake, synthesis and catabolism in fish. Therefore, the present study aimed to gain further insight into how dietary lipids affect lipid deposition in the liver of large yellow croaker(Larimichthys crocea). Fish (150.00±4.95 g) were fed a diet with a low (6%), moderate (12%, the control diet) or high (18%) crude lipid content for 10 weeks. Growth performance, plasma biochemical indexes, lipid contents and gene expression related to lipid deposition, including lipoprotein assembly and clearance, fatty acid uptake and triacylglycerol synthesis and catabolism, were assessed. Growth performance was not significantly affected. However, the hepato-somatic and viscera-somatic indexes as well as plasma triacylglycerol, non-esterified fatty acids and LDL-cholesterol levels were significantly increased in fish fed the high-lipid diet. In the livers of fish fed the high-lipid diet, the expression of genes related to lipoprotein clearance (LDLR) and fatty acid uptake (FABP11) was significantly up-regulated, whereas the expression of genes involved in lipoprotein assembly (apoB100), triacylglycerol synthesis and catabolism (DGAT2, CPT I) was significantly down-regulated compared with fish fed the control diet, and hepatic lipid deposition increased. In fish fed the low-lipid diet, the expression of genes associated with lipoprotein assembly and clearance (apoB100, LDLR, LRP-1), fatty acid uptake (CD36, FATP1, FABP3) and triacylglycerol synthesis (FAS) was significantly increased, whereas the expression of triacylglycerol catabolism related genes (ATGL, CPT I) was reduced compared with fish fed the control diet. However, hepatic lipid content in fish fed the low-lipid diet decreased mainly due to low dietary lipid intake. In summary, findings of this study provide molecular insight into the role of lipid deposition in the liver in response to different dietary lipid contents.

Dietary Lipid Levels Influence Lipid Deposition in the Liver of Large Yellow Croaker (Larimichthys crocea) by Regulating Lipoprotein Receptors, Fatty Acid Uptake and Triacylglycerol Synthesis and Catabolism at the Transcriptional Level

PubMed Central

Yan, Jing; Liao, Kai; Wang, Tianjiao; Mai, Kangsen; Xu, Wei; Ai, Qinghui

2015-01-01

Ectopic lipid accumulation has been observed in fish fed a high-lipid diet. However, no information is available on the mechanism by which dietary lipid levels comprehensively regulate lipid transport, uptake, synthesis and catabolism in fish. Therefore, the present study aimed to gain further insight into how dietary lipids affect lipid deposition in the liver of large yellow croaker(Larimichthys crocea). Fish (150.00±4.95 g) were fed a diet with a low (6%), moderate (12%, the control diet) or high (18%) crude lipid content for 10 weeks. Growth performance, plasma biochemical indexes, lipid contents and gene expression related to lipid deposition, including lipoprotein assembly and clearance, fatty acid uptake and triacylglycerol synthesis and catabolism, were assessed. Growth performance was not significantly affected. However, the hepato-somatic and viscera-somatic indexes as well as plasma triacylglycerol, non-esterified fatty acids and LDL-cholesterol levels were significantly increased in fish fed the high-lipid diet. In the livers of fish fed the high-lipid diet, the expression of genes related to lipoprotein clearance (LDLR) and fatty acid uptake (FABP11) was significantly up-regulated, whereas the expression of genes involved in lipoprotein assembly (apoB100), triacylglycerol synthesis and catabolism (DGAT2, CPT I) was significantly down-regulated compared with fish fed the control diet, and hepatic lipid deposition increased. In fish fed the low-lipid diet, the expression of genes associated with lipoprotein assembly and clearance (apoB100, LDLR, LRP-1), fatty acid uptake (CD36, FATP1, FABP3) and triacylglycerol synthesis (FAS) was significantly increased, whereas the expression of triacylglycerol catabolism related genes (ATGL, CPT I) was reduced compared with fish fed the control diet. However, hepatic lipid content in fish fed the low-lipid diet decreased mainly due to low dietary lipid intake. In summary, findings of this study provide molecular insight into the role of lipid deposition in the liver in response to different dietary lipid contents. PMID:26114429

A multicentre, double-masked, randomized, controlled trial assessing the effect of oral supplementation of omega-3 and omega-6 fatty acids on a conjunctival inflammatory marker in dry eye patients.

PubMed

Brignole-Baudouin, Françoise; Baudouin, Christophe; Aragona, Pasquale; Rolando, Maurizio; Labetoulle, Marc; Pisella, Pierre Jean; Barabino, Stefano; Siou-Mermet, Raphaele; Creuzot-Garcher, Catherine

2011-11-01

To determine whether oral supplementation with omega-3 and omega-6 fatty acids can reduce conjunctival epithelium expression of the inflammatory marker human leucocyte antigen-DR (HLA-DR) in patients with dry eye syndrome (DES). This 3-month, double-masked, parallel-group, controlled study was conducted in nine centres, in France and Italy. Eligible adult patients with mild to moderate DES were randomized to receive a placebo containing medium-chain triglycerides or treatment supplement containing omega-3 and omega-6 fatty acids, vitamins and zinc. Treatment regimen was three capsules daily. Impression cytology (IC) was performed at baseline and at month 3 to assess the percentage of cells expressing HLA-DR and to evaluate fluorescence intensity, an alternate measure of HLA-DR. Dry eye symptoms and objective signs were also evaluated. Analyses were performed on the full analysis set (FAS) and per-protocol set (PPS). In total, 138 patients were randomized; 121 patients with available IC were included in the FAS, and of these, 106 patients had no major protocol deviations (PPS). In the PPS, there was a significant reduction in the percentage of HLA-DR-positive cells in the fatty acids group (p = 0.021). Expression of HLA-DR as measured by fluorescence intensity quantification was also significantly reduced in the fatty acids group [FAS (p = 0.041); PPS (p = 0.017)]. No significant difference was found for the signs and symptoms, but there was a tendency for improvement in patients receiving the fatty acids treatment. This study demonstrates that supplementation with omega-3 and omega-6 fatty acids can reduce expression of HLA-DR conjunctival inflammatory marker and may help improve DES symptoms. © 2011 The Authors. Acta Ophthalmologica © 2011 Acta Ophthalmologica Scandinavica Foundation.

The anti-inflammatory and anti-apoptotic effects of gallic acid against mucosal inflammation- and erosions-induced by gastric ischemia-reperfusion in rats

PubMed Central

Mard, Seyyed Ali; Mojadami, Shahnaz; Farbood, Yaghoob; Gharib Naseri, Mohammad Kazem

2015-01-01

The present study aimed to evaluate the protective effect of gallic acid on gastric mucosal lesions caused by ischemia-reperfusion (I/R) injury in rat. Forty male rats were randomly divided into sham, control (I/R injury) and three gallic acid-pretreated groups. To induce I/R lesions, the celiac artery was clamped for 30 min and then the clamp was removed to allow reperfusion for 6 hr. Pretreated rats received gallic acid (15, 30 or 60 mg kg-1, intraperitoneally) 30 min prior to the induction of I/R injury. Macroscopic and microscopic evaluations of the areas of ulceration were compared. Samples of gastric mucosa were collected to evaluate the protein expression of pro-apoptotic factor, caspase-3, and pro-inflammatory enzyme, inducible nitric oxide synthase (iNOS) using western blot. Pretreatment with gallic acid decreased the total area of gastric lesions. Gallic acid at 30 mg kg-1 decreased the levels of protein expression of caspase-3 and iNOS induced by I/R injury. Our findings showed the protective effect of gallic acid on gastric mucosa against ischemia-reperfusion injury. This effect of gallic acid was mainly mediated by reducing protein expression of iNOS and caspase-3. PMID:26973766

The anti-inflammatory and anti-apoptotic effects of gallic acid against mucosal inflammation- and erosions-induced by gastric ischemia-reperfusion in rats.

PubMed

Mard, Seyyed Ali; Mojadami, Shahnaz; Farbood, Yaghoob; Gharib Naseri, Mohammad Kazem

2015-01-01

The present study aimed to evaluate the protective effect of gallic acid on gastric mucosal lesions caused by ischemia-reperfusion (I/R) injury in rat. Forty male rats were randomly divided into sham, control (I/R injury) and three gallic acid-pretreated groups. To induce I/R lesions, the celiac artery was clamped for 30 min and then the clamp was removed to allow reperfusion for 6 hr. Pretreated rats received gallic acid (15, 30 or 60 mg kg(-1), intraperitoneally) 30 min prior to the induction of I/R injury. Macroscopic and microscopic evaluations of the areas of ulceration were compared. Samples of gastric mucosa were collected to evaluate the protein expression of pro-apoptotic factor, caspase-3, and pro-inflammatory enzyme, inducible nitric oxide synthase (iNOS) using western blot. Pretreatment with gallic acid decreased the total area of gastric lesions. Gallic acid at 30 mg kg(-1) decreased the levels of protein expression of caspase-3 and iNOS induced by I/R injury. Our findings showed the protective effect of gallic acid on gastric mucosa against ischemia-reperfusion injury. This effect of gallic acid was mainly mediated by reducing protein expression of iNOS and caspase-3.

Impact of gastro-esophageal reflux on mucin mRNA expression in the esophageal mucosa.

PubMed

van Roon, Aafke H C; Mayne, George C; Wijnhoven, Bas P L; Watson, David I; Leong, Mary P; Neijman, Gabriëlle E; Michael, Michael Z; McKay, Andrew R; Astill, David; Hussey, Damian J

2008-08-01

Changes in the expression of mucin genes in the esophageal mucosa associated with uncomplicated gastro-esophageal reflux disease have not been evaluated even though such changes could be associated with reflux-induced mucosal damage. We therefore sought to identify reflux-induced changes in mucin gene expression using a cell line and biopsies from the esophageal mucosa in patients with and without reflux. MUC-1, MUC-3, MUC-4, and MUC-5AC gene expressions were investigated in the HET-1A cell line following exposure to acid (pH 4) and/or bile (120 muM of a bile salt milieu), and in esophageal mucosal biopsies from controls, subjects with non-erosive gastro-esophageal reflux, and subjects with reflux associated with ulcerative esophagitis (erosive). The mucosal biopsies were also evaluated for IL-6 mRNA expression (inflammatory marker) and CK-14 mRNA expression (mucosal basal cell layer marker). Gene expression was determined using real-time reverse transcriptase-polymerase chain reaction analysis. In the cell line studies, there were differences in mRNA levels for all of the evaluated mucins following treatment with either acid or the acid and bile combination. In the studies which evaluated tissue specimens, IL-6 and CK-14 mRNA levels increased according to degree of reflux pathology. The expression of MUC-1 and MUC-4 in mucosa from patients with erosive reflux was lower than in subjects without reflux and in patients with non-erosive reflux, whereas the expression of MUC-3 and MUC-5AC was increased (although these differences did not reach significance at p < 0.05). When mRNA expression data for tissue samples from all groups were combined, significant correlations were identified between IL-6 vs. CK-14 and IL-6 vs. MUC-3, MUC-3 vs. CK-14 and MUC-3 vs. MUC-5AC, and for MUC-1 vs. MUC-5AC. The correlation between IL-6 and CK-14 was also significant within the control and non-erosive reflux groups. The correlation between IL-6 and MUC-3 was significant within the control and erosive reflux groups, and the correlation between MUC-1 and MUC-5AC was significant within the erosive reflux group. The results of this study suggest that the profile of mucin expression in the esophageal mucosa is influenced by the pH and composition of the gastro-esophageal reflux. Further work should explore the response of these genes to acid and bile reflux, and their role in the etiology of mucosal damage in gastro-esophageal reflux.

Do rice suspension-cultured cells treated with abscisic acid mimic developing seeds?

PubMed

Matsuno, Koya; Fujimura, Tatsuhito

2015-08-01

Starch synthesis is activated in the endosperm during seed development and also in rice suspension cells cultured with abscisic acid. In the anticipation that the mechanisms of starch synthesis are similar between the endosperm and the suspension cells cultured with abscisic acid, expression of genes involved in starch synthesis was evaluated in the suspension cells after abscisic acid treatment. However, it was found that the regulatory mechanism of starch synthesis in the suspension cells cultured with abscisic acid was different from that in developing seeds. Expression analyses of genes involved in oil bodies, which accumulate in the embryo and aleurone layer, and seed storage proteins, which accumulate mainly in the endosperm, showed that the former were activated in the suspension cells cultured with abscisic acid, but the latter were not. Master regulators for embryogenesis, OsVP1 (homologue of AtABI3) and OsLFL1 (homologue of AtFUS3 or AtLFL2), were expressed in the suspension cells at levels comparable to those in the embryo. From these results, it is suggested that interactions between regulators and abscisic acid control the synthesis of phytic acid and oil bodies in the cultured cells and embryo. We suggest that the system of suspension cells cultured with abscisic acid helps to reveal the mechanisms of phytic acid and oil body synthesis in embryo.

Ceruloplasmin and Hypoferremia: Studies in Burn and Non-Burn Trauma Patients

DTIC Science & Technology

2015-03-06

Minneapolis, MN, USA). Serum uric acid concentrations were determined by standard clinical chemistry assay. Glutathione peroxidase activity was...Although serum total antioxidant potential was lower than control values throughout, glutathione peroxidase activity and uric acid levels were within...2 reducing potential and uric acid concentrations in 10 thermally injured subjects. Data expressed as mean ± SE. Dotted lines denote the upper and

Induction of 1-acylglycerophosphocholine acyltransferase genes by fibrates in the liver of rats.

PubMed

Yamazaki, Tohru; Wakabayashi, Michiko; Ikeda, Erika; Tanaka, Shizuyo; Sakamoto, Takeshi; Mitsumoto, Atsushi; Kudo, Naomi; Kawashima, Yoichi

2012-01-01

The effect of fibrates (clofibric acid, bezafibrate and fenofibrate) on the gene expression and activity of 1-acylglycerophosphocholine acyltransferase (LPCAT) was investigated. The administration of 0.1% (w/w) clofibric acid, bezafibrate or fenofibrate in diet for 14 d to rats induced LPCAT activity in hepatic microsomes in the following order: fenofibrate>bezafibrate>clofibric acid. The LPCAT induced by fenofibrate preferred to arachidonoyl-CoA and linoleoyl-CoA to a greater extent than did LPCAT in control microsomes. The treatment with the fibrates resulted in upregulation of the relative expression of mRNAs encoding LPCAT3 and LPCAT4 in the following order: fenofibrate>bezafibrate>clofibric acid. The administration of fibrates did not change the expression of genes encoding either LPCAT1 or LPCAT2. The treatment with fibrates elevated relative levels of both mRNAs encoding Δ6 desaturase (Fads2) and Δ5 desaturase (Fads1) in the order of fenofibrate>bezafibrate>clofibric acid, and the extent of the increase in the level of Δ6 desaturase mRNA was greater than that of Δ5 desaturase. Fatty acid profile in hepatic phosphatidylcholine (PC) was significantly changed by the treatments with fibrates. These results suggest (i) that fibrates induce LPCAT activity in hepatic microsomes by elevating the expression of genes encoding LPCAT3 and LPCAT4, (ii) that the changes in fatty acid profile of hepatic PC are, in part, due to the elevated expression of two isoforms, LPCAT3 and LPCAT4, and (iii) that the ability of fibrates to induce these changes are in the order of fenofibrate>bezafibrate>clofibric acid.

Evaluation of the reversal of multidrug resistance by MDR1 ribonucleic acid interference in a human colon cancer model using a Renilla luciferase reporter gene and coelenterazine.

PubMed

Jeon, Yong Hyun; Bae, Seon-ae; Lee, Yong Jin; Lee, You La; Lee, Sang-Woo; Yoon, Ghil-Suk; Ahn, Byeong-Cheol; Ha, Jeoung-Hee; Lee, Jaetae

2010-12-01

The reversal effect of multidrug resistance (MDR1) gene expression by adenoviral vector-mediated MDR1 ribonucleic acid interference was assessed in a human colon cancer animal model using bioluminescent imaging with Renilla luciferase (Rluc) gene and coelenterazine, a substrate for Rluc or MDR1 gene expression. A fluorescent microscopic examination demonstrated an increased green fluorescent protein signal in Ad-shMDR1- (recombinant adenovirus that coexpressed MDR1 small hairpin ribonucleic acid [shRNA] and green fluorescent protein) infected HCT-15/Rluc cells in a virus dose-dependent manner. Concurrently, with an increasing administered virus dose (0, 15, 30, 60, and 120 multiplicity of infection), Rluc activity was significantly increased in Ad-shMDR1-infected HCT-15/Rluc cells in a virus dose-dependent manner. In vivo bioluminescent imaging showed about 7.5-fold higher signal intensity in Ad-shMDR1-infected tumors than in control tumors (p < .05). Immunohistologic analysis demonstrated marked reduction of P-glycoprotein expression in infected tumor but not in control tumor. In conclusion, the reversal of MDR1 gene expression by MDR1 shRNA was successfully evaluated by bioluminescence imaging with Rluc activity using an in vivo animal model with a multidrug resistance cancer xenograft.

The histone-like protein HU has a role in gene expression during the acid adaptation response in Helicobacter pylori.

PubMed

Álvarez, Alhejandra; Toledo, Héctor

2017-08-01

Gastritis, ulcers, and gastric malignancy have been linked to human gastric epithelial colonization by Helicobacter pylori. Characterization of the mechanisms by which H. pylori adapts to the human stomach environment is of crucial importance to understand H. pylori pathogenesis. In an effort to extend our knowledge of these mechanisms, we used proteomic analysis and qRT-PCR to characterize the role of the histone-like protein HU in the response of H. pylori to low pH. Proteomic analysis revealed that genes involved in chemotaxis, oxidative stress, or metabolism are under control of the HU protein. Also, expression of the virulence factors Ggt and NapA is affected by the null mutation of hup gene both at neutral and acid pH, as evidenced by qRT-PCR analysis. Those results showed that H. pylori gene expression is altered by shift to low pH, thus confirming that acid exposure leads to profound changes in genomic expression, and suggest that the HU protein is a regulator that may help the bacterium adapt to the acid stress. In accordance with previous reports, we found that the HU protein participates in gene expression regulation when the microorganism is exposed to acid stress. Such transcriptional regulation underlies protein accumulation in the H. pylori cell. © 2017 John Wiley & Sons Ltd.

Molecular cloning, expression analysis, and potential food intake attenuation effect of peptide YY in grass carp (Ctenopharyngodon idellus).

PubMed

Chen, Yong; Shen, Yubang; Pandit, Narayan Prasad; Fu, Jianjun; Li, Da; Li, Jiale

2013-06-15

The peptide YY (PYY) is a 36 amino acid peptide involved in the food intake control in vertebrates. We have cloned and characterized a PYY gene from grass carp Ctenopharyngodon idellus. The full-length cDNA encodes a precursor protein of grass carp PYY (gcPYY) that consists of a putative 28-amino acid signal peptide, a 36-amino acid mature peptide, an amidation-proteolytic site, and a 30-amino acid carboxy-terminal extension. The gcPYY gene is comprised of 4 exons interspaced by 3 introns as seen in PYYs from other species. Amino acid alignment and gene structure comparison indicate that the structure of PYY is well preserved throughout vertebrate phylogeny. The tissue distribution and postprandial changes in gcPYY mRNA expression were evaluated by real-time PCR, which showed that the gcPYY is expressed abundantly in the central nervous system, with significantly increased expression following a single meal. During embryogenesis, the presence of gcPYY mRNA was detected in early developing embryos, and high expression levels were observed when most larvae completed their switch from endogenous nourishment to exogenous feeding. Reduced food intake by juveniles during a single meal after giving perpheral injection of gcPYY1-36 suggests a potentially important role of PYY in the food intake attenuation in grass carp. Copyright © 2013 Elsevier Inc. All rights reserved.

Overexpression of DYRK1A inhibits choline acetyltransferase induction by oleic acid in cellular models of Down syndrome.

PubMed

Hijazi, Maruan; Fillat, Cristina; Medina, José M; Velasco, Ana

2013-01-01

Histological brain studies of individuals with DS have revealed an aberrant formation of the cerebral cortex. Previous work from our laboratory has shown that oleic acid acts as a neurotrophic factor and induces neuronal differentiation. In order to characterize the effects of oleic acid in a cellular model of DS, immortalized cell lines derived from the cortex of trisomy Ts16 (CTb) and normal mice (CNh) were incubated in the absence or presence of oleic acid. Oleic acid increased choline acetyltransferase expression (ChAT), a marker of cholinergic differentiation in CNh cells. However, in trisomic cells (CTb line) oleic acid failed to increase ChAT expression. These results suggest that the overdose of specific genes in trisomic lines delays differentiation in the presence of oleic acid by inhibiting acetylcholine production mediated by ChAT. The dual-specificity tyrosine (Y) phosphorylation-regulated kinase 1A (DYRK1A) gene is located on human chromosome 21 and encodes a proline-directed protein kinase. It has been proposed that DYRK1A plays a prominent role in several biological functions, leading to mental retardation in DS patients. Here we explored the potential role of DYRK1A in the modulation of ChAT expression in trisomic cells and in the signaling pathways of oleic acid. Down-regulation of DYRK1A by siRNA in trisomic CTb cells rescued ChAT expression up to levels similar to those of normal cells in the presence of oleic acid. In agreement with these results, oleic acid was unable to increase ChAT expression in neuronal cultures of transgenic mice overexpressing DYRK1A. In summary, our results highlight the role played by DYRK1A in brain development through the control of ChAT expression. In addition, the overexpression of DYRK1A in DS models prevented the neurotrophic effect of oleic acid, a fact that may account for mental retardation in DS patients. Copyright © 2012 Elsevier Inc. All rights reserved.

Association between Serum Uric Acid Level and Carotid Atherosclerosis in Chinese Individuals Aged 75 Years or Older: A Hospital-Based Case-Control Study.

PubMed

Feng, L; Hua, C; Sun, H; Qin, L-Y; Niu, P-P; Guo, Z-N; Yang, Y

2018-01-01

To investigate the association between serum uric acid level and the presence and progression of carotid atherosclerosis in Chinese individuals aged 75 years or older. Case-control study. In a teaching hospital. Five hundred and sixty-four elderlies (75 years or above) who underwent general health screening in our hospital were enrolled. The detailed carotid ultrasound results, physical examination information, medical history, and laboratory test results including serum uric acid level were recorded, these data were used to analyze the relationship between serum uric acid level and carotid atherosclerosis. Then, subjects who underwent the second carotid ultrasound 1.5-2 years later were further identified to analyzed the relationship between serum uric acid and the progression of carotid atherosclerosis. A total of 564 subjects were included, carotid plaque was found in 482 (85.5%) individuals. Logistic regression showed that subjects with elevated serum uric acid (expressed per 1 standard deviation change) had significantly higher incidence of carotid plaque (odds ratio, 1.37; 95% confidence interval, 1.07-1.75; P= 0.012) after controlling for other factors. A total of 236 subjects underwent the follow-up carotid ultrasound. Linear regression showed that serum uric acid level (expressed per 1 standard deviation change; 1 standard deviation = 95.5 μmol/L) was significantly associated with percentage of change of plaque score (P = 0.008). Multivariable linear regression showed that 1 standard deviation increase in serum uric acid levels was expected to increase 0.448% of plaque score (P = 0.023). The elevated serum uric acid level may be independently and significantly associated with the presence and progression of carotid atherosclerosis in Chinese individuals aged 75 years or older.

Colonic mucosal gene expression and genotype in irritable bowel syndrome patients with normal or elevated fecal bile acid excretion

PubMed Central

Carlson, Paula; Acosta, Andres; Busciglio, Irene

2015-01-01

The mucosal gene expression in rectosigmoid mucosa (RSM) in irritable bowel syndrome with diarrhea (IBS-D) is unknown. Our objectives were, first, to study mRNA expression [by RT2 PCR of 19 genes pertaining to tight junctions, immune activation, intestinal ion transport and bile acid (BA) homeostasis] in RSM in IBS-D patients (n = 47) and healthy controls (n = 17) and study expression of a selected protein (PDZD3) in 10 IBS-D patients and 4 healthy controls; second, to assess RSM mRNA expression according to genotype and fecal BA excretion (high ≥2,337 μmol/48 h); and third, to determine whether genotype or mucosal mRNA expression is associated with colonic transit or BA parameters. Fold changes were corrected for false detection rate for 19 genes studied (P < 0.00263). In RSM in IBS-D patients compared with controls, mRNA expression of GUC2AB, PDZD3, and PR2Y4 was increased, whereas CLDN1 and FN1 were decreased. One immune-related gene was upregulated (C4BP4) and one downregulated (CCL20). There was increased expression of a selected ion transport protein (PDZD3) on immunohistochemistry and Western blot in IBS-D compared with controls (P = 0.02). There were no significant differences in mucosal mRNA in 20 IBS-D patients with high compared with 27 IBS-D patients with normal BA excretion. GPBAR1 (P < 0.05) was associated with colonic transit. We concluded that mucosal ion transport mRNA (for several genes and PDZD3 protein) is upregulated and barrier protein mRNA downregulated in IBS-D compared with healthy controls, independent of genotype. There are no differences in gene expression in IBS-D with high compared with normal fecal BA excretion. PMID:25930081

Colonic mucosal gene expression and genotype in irritable bowel syndrome patients with normal or elevated fecal bile acid excretion.

PubMed

Camilleri, Michael; Carlson, Paula; Acosta, Andres; Busciglio, Irene

2015-07-01

The mucosal gene expression in rectosigmoid mucosa (RSM) in irritable bowel syndrome with diarrhea (IBS-D) is unknown. Our objectives were, first, to study mRNA expression [by RT(2) PCR of 19 genes pertaining to tight junctions, immune activation, intestinal ion transport and bile acid (BA) homeostasis] in RSM in IBS-D patients (n = 47) and healthy controls (n = 17) and study expression of a selected protein (PDZD3) in 10 IBS-D patients and 4 healthy controls; second, to assess RSM mRNA expression according to genotype and fecal BA excretion (high ≥ 2,337 μmol/48 h); and third, to determine whether genotype or mucosal mRNA expression is associated with colonic transit or BA parameters. Fold changes were corrected for false detection rate for 19 genes studied (P < 0.00263). In RSM in IBS-D patients compared with controls, mRNA expression of GUC2AB, PDZD3, and PR2Y4 was increased, whereas CLDN1 and FN1 were decreased. One immune-related gene was upregulated (C4BP4) and one downregulated (CCL20). There was increased expression of a selected ion transport protein (PDZD3) on immunohistochemistry and Western blot in IBS-D compared with controls (P = 0.02). There were no significant differences in mucosal mRNA in 20 IBS-D patients with high compared with 27 IBS-D patients with normal BA excretion. GPBAR1 (P < 0.05) was associated with colonic transit. We concluded that mucosal ion transport mRNA (for several genes and PDZD3 protein) is upregulated and barrier protein mRNA downregulated in IBS-D compared with healthy controls, independent of genotype. There are no differences in gene expression in IBS-D with high compared with normal fecal BA excretion. Copyright © 2015 the American Physiological Society.

The bile acid receptor GPBAR1 (TGR5) is expressed in human gastric cancers and promotes epithelial-mesenchymal transition in gastric cancer cell lines

PubMed Central

Cipriani, Sabrina; Marchianò, Silvia; Marino, Elisabetta; Zampella, Angela; Rende, Mario; Mosci, Paolo; Distrutti, Eleonora; Donini, Annibale; Fiorucci, Stefano

2016-01-01

GPBAR1 (also known as TGR5) is a bile acid activated receptor expressed in several adenocarcinomas and its activation by secondary bile acids increases intestinal cell proliferation. Here, we have examined the expression of GPBAR1 in human gastric adenocarcinomas and investigated whether its activation promotes the acquisition of a pro-metastatic phenotype. By immunohistochemistry and RT-PCR analysis we found that expression of GPBAR1 associates with advanced gastric cancers (Stage III-IV). GPBAR1 expression in tumors correlates with the expression of N-cadherin, a markers of epithelial-mesenchymal transition (EMT) (r=0.52; P<0.01). Expression of GPBAR1, mRNA and protein, was detected in cancer cell lines, with MKN 45 having the higher expression. Exposure of MKN45 cells to GPBAR1 ligands, TLCA, oleanolic acid or 6-ECDCA (a dual FXR and GPBAR1 ligand) increased the expression of genes associated with EMT including KDKN2A, HRAS, IGB3, MMP10 and MMP13 and downregulated the expression of CD44 and FAT1 (P<0.01 versus control cells). GPBAR1 activation in MKN45 cells associated with EGF-R and ERK1 phosphorylation. These effects were inhibited by DFN406, a GPBAR1 antagonist, and cetuximab. GPBAR1 ligands increase MKN45 migration, adhesion to peritoneum and wound healing. Pretreating MKN45 cells with TLCA increased propensity toward peritoneal dissemination in vivo. These effects were abrogated by cetuximab. In summary, we report that GPBAR1 is expressed in advanced gastric cancers and its expression correlates with markers of EMT. GPBAR1 activation in MKN45 cells promotes EMT. These data suggest that GPBAR1 antagonist might have utility in the treatment of gastric cancers. PMID:27409173

Expression of genes controlling fat deposition in two genetically diverse beef cattle breeds fed high or low silage diets

PubMed Central

2013-01-01

Background Both genetic background and finishing system can alter fat deposition, thus indicating their influence on adipogenic and lipogenic factors. However, the molecular mechanisms underlying fat deposition and fatty acid composition in beef cattle are not fully understood. This study aimed to assess the effect of breed and dietary silage level on the expression patterns of key genes controlling lipid metabolism in subcutaneous adipose tissue (SAT) and longissimus lumborum (LL) muscle of cattle. To that purpose, forty bulls from two genetically diverse Portuguese bovine breeds with distinct maturity rates, Alentejana and Barrosã, were selected and fed either low (30% maize silage/70% concentrate) or high silage (70% maize silage/30% concentrate) diets. Results The results suggested that enhanced deposition of fatty acids in the SAT from Barrosã bulls, when compared to Alentejana, could be due to higher expression levels of lipogenesis (SCD and LPL) and β-oxidation (CRAT) related genes. Our results also indicated that SREBF1 expression in the SAT is increased by feeding the low silage diet. Together, these results point out to a higher lipid turnover in the SAT of Barrosã bulls when compared to Alentejana. In turn, lipid deposition in the LL muscle is related to the expression of adipogenic (PPARG and FABP4) and lipogenic (ACACA and SCD) genes. The positive correlation between ACACA expression levels and total lipids, as well trans fatty acids, points to ACACA as a major player in intramuscular deposition in ruminants. Moreover, results reinforce the role of FABP4 in intramuscular fat development and the SAT as the major site for lipid metabolism in ruminants. Conclusions Overall, the results showed that SAT and LL muscle fatty acid composition are mostly dependent on the genetic background. In addition, dietary silage level impacted on muscle lipid metabolism to a greater extent than on that of SAT, as evaluated by gene expression levels of adipogenic and lipogenic factors. Moreover, the response to diet composition evaluated through mRNA levels and fatty acid composition showed interesting differences between Alentejana and Barrosã bulls. These findings provide evidence that the genetic background should be taken into account while devising diet-based strategies to manipulate fatty acid composition of beef cattle tissues. PMID:23767408

Nitric Oxide Mediates the Hormonal Control of Crassulacean Acid Metabolism Expression in Young Pineapple Plants1[W][OA

PubMed Central

Freschi, Luciano; Rodrigues, Maria Aurineide; Domingues, Douglas Silva; Purgatto, Eduardo; Van Sluys, Marie-Anne; Magalhaes, Jose Ronaldo; Kaiser, Werner M.; Mercier, Helenice

2010-01-01

Genotypic, developmental, and environmental factors converge to determine the degree of Crassulacean acid metabolism (CAM) expression. To characterize the signaling events controlling CAM expression in young pineapple (Ananas comosus) plants, this photosynthetic pathway was modulated through manipulations in water availability. Rapid, intense, and completely reversible up-regulation in CAM expression was triggered by water deficit, as indicated by the rise in nocturnal malate accumulation and in the expression and activity of important CAM enzymes. During both up- and down-regulation of CAM, the degree of CAM expression was positively and negatively correlated with the endogenous levels of abscisic acid (ABA) and cytokinins, respectively. When exogenously applied, ABA stimulated and cytokinins repressed the expression of CAM. However, inhibition of water deficit-induced ABA accumulation did not block the up-regulation of CAM, suggesting that a parallel, non-ABA-dependent signaling route was also operating. Moreover, strong evidence revealed that nitric oxide (NO) may fulfill an important role during CAM signaling. Up-regulation of CAM was clearly observed in NO-treated plants, and a conspicuous temporal and spatial correlation was also evident between NO production and CAM expression. Removal of NO from the tissues either by adding NO scavenger or by inhibiting NO production significantly impaired ABA-induced up-regulation of CAM, indicating that NO likely acts as a key downstream component in the ABA-dependent signaling pathway. Finally, tungstate or glutamine inhibition of the NO-generating enzyme nitrate reductase completely blocked NO production during ABA-induced up-regulation of CAM, characterizing this enzyme as responsible for NO synthesis during CAM signaling in pineapple plants. PMID:20147491

Effects of Leucine Supplementation and Serum Withdrawal on Branched-Chain Amino Acid Pathway Gene and Protein Expression in Mouse Adipocytes

PubMed Central

Vivar, Juan C.; Knight, Megan S.; Pointer, Mildred A.; Gwathmey, Judith K.; Ghosh, Sujoy

2014-01-01

The essential branched-chain amino acids (BCAA), leucine, valine and isoleucine, are traditionally associated with skeletal muscle growth and maintenance, energy production, and generation of neurotransmitter and gluconeogenic precursors. Recent evidence from human and animal model studies has established an additional link between BCAA levels and obesity. However, details of the mechanism of regulation of BCAA metabolism during adipogenesis are largely unknown. We interrogated whether the expression of genes and proteins involved in BCAA metabolism are sensitive to the adipocyte differentiation process, and responsive to nutrient stress from starvation or BCAA excess. Murine 3T3-L1 preadipocytes were differentiated to adipocytes under control conditions and under conditions of L-leucine supplementation or serum withdrawal. RNA and proteins were isolated at days 0, 4 and 10 of differentiation to represent pre-differentiation, early differentiation and late differentiation stages. Expression of 16 BCAA metabolism genes was quantified by quantitative real-time PCR. Expression of the protein levels of branched-chain amino acid transaminase 2 (Bcat2) and branched-chain alpha keto acid dehydrogenase (Bckdha) was quantified by immunoblotting. Under control conditions, all genes displayed induction of gene expression during early adipogenesis (Day 4) compared to Day 0. Leucine supplementation resulted in an induction of Bcat2 and Bckdha genes during early and late differentiation. Western blot analysis demonstrated condition-specific concordance between gene and protein expression. Serum withdrawal resulted in undetectable Bcat2 and Bckdha protein levels at all timepoints. These results demonstrate that the expression of genes related to BCAA metabolism are regulated during adipocyte differentiation and influenced by nutrient levels. These results provide additional insights on how BCAA metabolism is associated with adipose tissue function and extends our understanding of the transcriptomic response of this pathway to variations in nutrient availability. PMID:25050624

Metabolic Regulation of Manganese Superoxide Dismutase Expression via Essential Amino Acid Deprivation*

PubMed Central

Aiken, Kimberly J.; Bickford, Justin S.; Kilberg, Michael S.; Nick, Harry S.

2008-01-01

Organisms respond to available nutrient levels by rapidly adjusting metabolic flux, in part through changes in gene expression. A consequence of adaptations in metabolic rate is the production of mitochondria-derived reactive oxygen species. Therefore, we hypothesized that nutrient sensing could regulate the synthesis of the primary defense of the cell against superoxide radicals, manganese superoxide dismutase. Our data establish a novel nutrient-sensing pathway for manganese superoxide dismutase expression mediated through essential amino acid depletion concurrent with an increase in cellular viability. Most relevantly, our results are divergent from current mechanisms governing amino acid-dependent gene regulation. This pathway requires the presence of glutamine, signaling via the tricarboxylic acid cycle/electron transport chain, an intact mitochondrial membrane potential, and the activity of both the MEK/ERK and mammalian target of rapamycin kinases. Our results provide evidence for convergence of metabolic cues with nutrient control of antioxidant gene regulation, revealing a potential signaling strategy that impacts free radical-mediated mutations with implications in cancer and aging. PMID:18187411

Metabolic regulation of manganese superoxide dismutase expression via essential amino acid deprivation.

PubMed

Aiken, Kimberly J; Bickford, Justin S; Kilberg, Michael S; Nick, Harry S

2008-04-18

Organisms respond to available nutrient levels by rapidly adjusting metabolic flux, in part through changes in gene expression. A consequence of adaptations in metabolic rate is the production of mitochondria-derived reactive oxygen species. Therefore, we hypothesized that nutrient sensing could regulate the synthesis of the primary defense of the cell against superoxide radicals, manganese superoxide dismutase. Our data establish a novel nutrient-sensing pathway for manganese superoxide dismutase expression mediated through essential amino acid depletion concurrent with an increase in cellular viability. Most relevantly, our results are divergent from current mechanisms governing amino acid-dependent gene regulation. This pathway requires the presence of glutamine, signaling via the tricarboxylic acid cycle/electron transport chain, an intact mitochondrial membrane potential, and the activity of both the MEK/ERK and mammalian target of rapamycin kinases. Our results provide evidence for convergence of metabolic cues with nutrient control of antioxidant gene regulation, revealing a potential signaling strategy that impacts free radical-mediated mutations with implications in cancer and aging.

Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

PubMed Central

Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

1998-01-01

The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

40 CFR 79.67 - Glial fibrillary acidic protein assay.

Code of Federal Regulations, 2011 CFR

2011-07-01

... immunoreactivity of individual samples (both control and exposed groups) with that of the sample used to generate... the control groups is normalized to 100 percent and all data are expressed as a percentage of control... emission-exposed and unexposed control animals. It is based on modifications (O'Callaghan & Miller 1985 in...

40 CFR 79.67 - Glial fibrillary acidic protein assay.

Code of Federal Regulations, 2014 CFR

2014-07-01

... immunoreactivity of individual samples (both control and exposed groups) with that of the sample used to generate... the control groups is normalized to 100 percent and all data are expressed as a percentage of control... emission-exposed and unexposed control animals. It is based on modifications (O'Callaghan & Miller 1985 in...

40 CFR 79.67 - Glial fibrillary acidic protein assay.

Code of Federal Regulations, 2012 CFR

2012-07-01

... immunoreactivity of individual samples (both control and exposed groups) with that of the sample used to generate... the control groups is normalized to 100 percent and all data are expressed as a percentage of control... emission-exposed and unexposed control animals. It is based on modifications (O'Callaghan & Miller 1985 in...

40 CFR 79.67 - Glial fibrillary acidic protein assay.

Code of Federal Regulations, 2010 CFR

2010-07-01

... immunoreactivity of individual samples (both control and exposed groups) with that of the sample used to generate... the control groups is normalized to 100 percent and all data are expressed as a percentage of control... emission-exposed and unexposed control animals. It is based on modifications (O'Callaghan & Miller 1985 in...

40 CFR 79.67 - Glial fibrillary acidic protein assay.

Code of Federal Regulations, 2013 CFR

2013-07-01

... immunoreactivity of individual samples (both control and exposed groups) with that of the sample used to generate... the control groups is normalized to 100 percent and all data are expressed as a percentage of control... emission-exposed and unexposed control animals. It is based on modifications (O'Callaghan & Miller 1985 in...

The Effect of Simvastatin on mRNA Expression of Transforming Growth Factor-β1, Bone Morphogenetic Protein-2 and Vascular Endothelial Growth Factor in Tooth Extraction Socket

PubMed Central

Liu, Chang; Wu, Zhe; Sun, Hong-chen

2009-01-01

Aim To determine the effect of local simvastatin application on the mRNA expression level of transforming growth factor-β1 (TGF-β1), bone morphogenetic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF) in the tooth sockets of rat. Methodology Forty-eight male Wistar rats were randomly divided into experimental and control groups (n=24). Polylactic acid/polyglycolic acid copolymer carriers, with or without simvastatin, were implanted into extraction sockets of right mandibular incisors. The expression of TGF-β1, BMP-2 and VEGF mRNA was determined by in situ hybridization in the tooth extraction socket at five days, one week, two weeks and four weeks after implantation. Results The fusiform stroma cells in the tooth extraction socket began to express TGF-β1, BMP-2 and VEGF mRNA in both experimental and control groups from one week after tooth extraction until the end of experiment. The expression of TGF-β1 and BMP-2 mRNA in the experimental group was significantly up-regulated after one, two and four weeks, and expression of VEGF mRNA was significantly increased after one and two weeks compared with that in the control group. Conclusion The findings indicate that local administration of simvastatin can influence alveolar bone remodeling by regulating the expression of a school of growth factors which are crucial to osteogenesis in the tooth extraction socket. PMID:20687301

Expression of the long-chain fatty acid receptor GPR120 in the gonadotropes of the mouse anterior pituitary gland.

PubMed

Moriyama, Ryutaro; Deura, Chikaya; Imoto, Shingo; Nose, Kazuhiro; Fukushima, Nobuyuki

2015-01-01

G-protein-coupled receptor 120 (GPR120) has been known to be a receptor of long-chain fatty acids. Here, we investigated GPR120 expression in the mouse pituitary gland via real-time PCR, in situ hybridization, and immunohistochemistry. GPR120 mRNA was abundantly expressed in the pituitary gland of ad-lib fed animals. In situ hybridization and immunohistochemistry revealed GPR120 expression in the gonadotropes of the anterior pituitary gland, but not in thyrotropes, somatotropes, lactotropes, corticotropes, melanotropes, and the posterior pituitary gland. Furthermore, 24 h of fasting induced an increase in GPR120 mRNA expression in the pituitary gland. These results demonstrate that GPR120 in mouse pituitary gonadotropes is upregulated by fasting and that it may play a role in controlling gonadotropin secretion.

In vitro effects of docosahexaenoic and eicosapentaenoic acid on human meibomian gland epithelial cells.

PubMed

Hampel, Ulrike; Krüger, Magret; Kunnen, Carolina; Garreis, Fabian; Willcox, Mark; Paulsen, Friedrich

2015-11-01

To investigate the effect of ω-3 fatty acids on human meibomian gland epithelial cells (HMGECs, cell line) in vitro. HMGECs were stimulated with docosahexaenoic acid (DHA) or combinations with eicosapentaenoic acid (EPA) and acetyl sialic acid (ASA). Sudan III fat staining, viability and proliferation assays, electric cell-substrate impedance sensing, real-time PCR for gene expression of cyclooxygenase-2 and 15-lipoxygenase and ELISAs for resolvin D1 (RvD1), IFNγ, TNFα and IL-6 were applied. Lipid droplet accumulation and viability was increased by 100 μM DHA in the presence or absence of EPA in serum cultured HMGECs. In contrast, HMGECs cultured with DHA and EPA under serum-free conditions showed minimal lipid accumulation, decreased proliferation and viability. Normalized impedance was significantly reduced in serum-free cultured HMGECs when stimulated with DHA and EPA. HMGECs cultured in serum containing medium showed increased normalized impedance under DHA and EPA stimulation compared to DHA or EPA alone or controls. IL-6 and IFNγ were downregulated in HMGECs treated for 72 h with DHA and EPA. In general, TNFα, IFNγ and IL-6 levels were decreased after 72 h compared to 24 h in serum containing medium with or without DHA or EPA. The concentration of RvD1 was elevated 2-fold after DHA treatment. Cyclooxygenase-2 gene expression decreased compared to controls during DHA stimulation after 72 h. Treatment with DHA and ASA revealed a decreased 15-lipoxygenase gene expression which was reduced after three days of DHA incubation. DHA and EPA supplementation affected HMGECs in vitro and supported anti-inflammatory effects by influencing cytokine levels, decreasing COX-2 expression and increasing the production of RvD1. Copyright © 2015 Elsevier Ltd. All rights reserved.

Metabolic pathway profiling of mitochondrial respiratory chain mutants in C. elegans

PubMed Central

MJ, Falk; Z, Zhang; Rosenjack; Nissim; E, Daikhin; Nissim; MM, Sedensky; M, Yudkoff; PG, Morgan

2008-01-01

C. elegans affords a model of primary mitochondrial dysfunction that provides insight into cellular adaptations which accompany mutations in nuclear gene that encode mitochondrial proteins. To this end, we characterized genome-wide expression profiles of C. elegans strains with mutations in nuclear-encoded subunits of respiratory chain complexes. Our goal was to detect concordant changes among clusters of genes that comprise defined metabolic pathways. Results indicate that respiratory chain mutants significantly upregulate a variety of basic cellular metabolic pathways involved in carbohydrate, amino acid, and fatty acid metabolism, as well as cellular defense pathways such as the metabolism of P450 and glutathione. To further confirm and extend expression analysis findings, quantitation of whole worm free amino acid levels was performed in C. elegans mitochondrial mutants for subunits of complexes I, II, and III. Significant differences were seen for 13 of 16 amino acid levels in complex I mutants compared with controls, as well as overarching similarities among profiles of complex I, II, and III mutants compared with controls. The specific pattern of amino acid alterations observed provides novel evidence to suggest that an increase in glutamate-linked transamination reactions caused by the failure of NAD+ dependent oxidation of ketoacids occurs in primary mitochondrial respiratory chain mutants. Recognition of consistent alterations among patterns of nuclear gene expression for multiple biochemical pathways and in quantitative amino acid profiles in a translational genetic model of mitochondrial dysfunction allows insight into the complex pathogenesis underlying primary mitochondrial disease. Such knowledge may enable the development of a metabolomic profiling diagnostic tool applicable to human mitochondrial disease. PMID:18178500

Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowden, Michael J.; Skorupski, Karen; Pellegrini, Maria

2010-03-04

Cholera is an acute intestinal infection caused by the bacterium Vibrio cholerae. In order for V. cholerae to cause disease, it must produce two virulence factors, the toxin-coregulated pilus (TCP) and cholera toxin (CT), whose expression is controlled by a transcriptional cascade culminating with the expression of the AraC-family regulator, ToxT. We have solved the 1.9 {angstrom} resolution crystal structure of ToxT, which reveals folds in the N- and C-terminal domains that share a number of features in common with AraC, MarA, and Rob as well as the unexpected presence of a buried 16-carbon fatty acid, cis-palmitoleate. The finding thatmore » cis-palmitoleic acid reduces TCP and CT expression in V. cholerae and prevents ToxT from binding to DNA in vitro provides a direct link between the host environment of V. cholerae and regulation of virulence gene expression.« less

The Acid-Secreting Parietal Cell as an Endocrine Source of Sonic Hedgehog During Gastric Repair

PubMed Central

Engevik, Amy C.; Feng, Rui; Yang, Li

2013-01-01

Sonic Hedgehog (Shh) has been shown to regulate wound healing in various tissues. Despite its known function in tissue regeneration, the role of Shh secreted from the gastric epithelium during tissue repair in the stomach remains unknown. Here we tested the hypothesis that Shh secreted from the acid-secreting parietal cell is a fundamental circulating factor that drives gastric repair. A mouse model expressing a parietal cell-specific deletion of Shh (PC-ShhKO) was generated using animals bearing loxP sites flanking exon 2 of the Shh gene (Shhflx/flx) and mice expressing a Cre transgene under the control of the H+,K+-ATPase β-subunit promoter. Shhflx/flx, the H+,K+-ATPase β-subunit promoter, and C57BL/6 mice served as controls. Ulcers were induced via acetic acid injury. At 1, 2, 3, 4, 5, and 7 days after the ulcer induction, gastric tissue and blood samples were collected. Parabiosis experiments were used to establish the effect of circulating Shh on ulcer repair. Control mice exhibited an increased expression of Shh in the gastric tissue and plasma that correlated with the repair of injury within 7 days after surgery. PC-ShhKO mice showed a loss of ulcer repair and reduced Shh tissue and plasma concentrations. In a parabiosis experiment whereby a control mouse was paired with a PC-ShhKO littermate and both animals subjected to gastric injury, a significant increase in the circulating Shh was measured in both parabionts. Elevated circulating Shh concentrations correlated with the repair of gastric ulcers in the PC-ShhKO parabionts. Therefore, the acid-secreting parietal cell within the stomach acts as an endocrine source of Shh during repair. PMID:24092639

Eicosapentaenoic and docosahexaenoic acids have different effects on peripheral phospholipase A2 gene expressions in acute depressed patients.

PubMed

Su, Kuan-Pin; Yang, Hui-Ting; Chang, Jane Pei-Chen; Shih, Yin-Hua; Guu, Ta-Wei; Kumaran, Satyanarayanan Senthil; Gałecki, Piotr; Walczewska, Anna; Pariante, Carmine M

2018-01-03

Omega-3 polyunsaturated fatty acids (PUFAs) have been proven critical in the development and management of major depressive disorder (MDD) by a number of epidemiological, clinical and preclinical studies, but the molecular mechanisms underlying this therapeutic action are yet to be understood. Although eicosapentaenoic acid (EPA) seems to be the active component of omega-3 PUFAs' antidepressant effects, the biological research about the difference of specific genetic regulations between EPA and docosahexaenoic acid (DHA), the two main components of omega-3 PUFAs, is still lacking in human subjects. We conducted a 12-week randomized-controlled trial comparing the effects of EPA and DHA on gene expressions of phospholipase A2 (cPLA2) and cyclooxygenase-2 (COX2), serotonin transporter (5HTT), and Tryptophan hydroxylase 2 (TPH-2) in 27 MDD patients. In addition, the erythrocyte PUFA compositions and the candidate gene expressions were also compared between these 27 MDD patients and 22 healthy controls. EPA was associated with a significant decrease in HAM-D scores (CI: -13 to -21, p<0.001) and significant increases in erythrocyte levels of EPA (CI: +1.0% to +2.9%, p=0.001) and DHA (CI: +2.9% to +5.6%, p=0.007). DHA treatment was associated with a significant decrease in HAM-D scores (CI: -6 to -14, p<0.001) and a significant increase in DHA levels (CI: +0.2% to +2.3%, p=0.047), but not of EPA levels. The cPLA2 gene expression levels were significantly increased in patients received EPA (1.9 folds, p=0.038), but not DHA (1.08 folds, p=0.92). There was a tendency for both EPA and DHA groups to decrease COX-2 gene expressions. The gene expressions of COX-2, cPLA2, TPH-2 and 5-HTT did not differ between MDD cases and healthy controls. EPA differentiates from DHA in clinical antidepressant efficacy and in upregulating cPLA2 gene regulations, which supports the clinical observation showing the superiority of EPA's antidepressant effects. ClinicalTrials.gov identifier: NCT02615405. Copyright © 2017 Elsevier Inc. All rights reserved.

Chronic Mild Cold Conditioning Modulates the Expression of Hypothalamic Neuropeptide and Intermediary Metabolic-Related Genes and Improves Growth Performances in Young Chicks.

PubMed

Nguyen, Phuong; Greene, Elizabeth; Ishola, Peter; Huff, Geraldine; Donoghue, Annie; Bottje, Walter; Dridi, Sami

2015-01-01

Low environmental temperatures are among the most challenging stressors in poultry industries. Although landmark studies using acute severe cold exposure have been conducted, still the molecular mechanisms underlying cold-stress responses in birds are not completely defined. In the present study we determine the effect of chronic mild cold conditioning (CMCC) on growth performances and on the expression of key metabolic-related genes in three metabolically important tissues: brain (main site for feed intake control), liver (main site for lipogenesis) and muscle (main site for thermogenesis). 80 one-day old male broiler chicks were divided into two weight-matched groups and maintained in two different temperature floor pen rooms (40 birds/room). The temperature of control room was 32°C, while the cold room temperature started at 26.7°C and gradually reduced every day (1°C/day) to reach 19.7°C at the seventh day of the experiment. At day 7, growth performances were recorded (from all birds) and blood samples and tissues were collected (n = 10). The rest of birds were maintained at the same standard environmental condition for two more weeks and growth performances were measured. Although feed intake remained unchanged, body weight gain was significantly increased in CMCC compared to the control chicks resulting in a significant low feed conversion ratio (FCR). Circulating cholesterol and creatine kinase levels were higher in CMCC chicks compared to the control group (P<0.05). CMCC significantly decreased the expression of both the hypothalamic orexigenic neuropeptide Y (NPY) and anorexigenic cocaine and amphetamine regulated transcript (CART) in chick brain which may explain the similar feed intake between the two groups. Compared to the control condition, CMCC increased the mRNA abundance of AMPKα1/α2 and decreased mTOR gene expression (P<0.05), the master energy and nutrient sensors, respectively. It also significantly decreased the expression of fatty acid synthase (FAS) gene in chick brain compared to the control. Although their roles are still unknown in avian species, adiponectin (Adpn) and its related receptors (AdipoR1 and 2) were down regulated in the brain of CMCC compared to control chicks (P<0.05). In the liver, CMCC significantly down regulated the expression of lipogenic genes namely FAS, acetyl-CoA carboxylase alpha (ACCα) and malic enzyme (ME) and their related transcription factors sterol regulatory element binding protein 1/2 (SREBP-1 and 2). Hepatic mTOR mRNA levels and phosphorylated mTOR at Ser2448 were down regulated (P<0.05), however phosphorylated ACCαSer79 (inactivation) was up regulated (P<0.05) in CMCC compared to control chicks, indicating that CMCC switch hepatic catabolism on and inhibits hepatic lipogenesis. In the muscle however, CMCC significantly up regulated the expression of carnitine palmitoyltransferase 1 (CPT-1) gene and the mRNA and phosphorylated protein levels of mTOR compared to the control chicks, indicating that CMCC enhanced muscle fatty acid β-oxidation. In conclusion, this is the first report indicating that CMCC may regulate AMPK-mTOR expression in a tissue specific manner and identifying AMPK-mTOR as a potential molecular signature that controls cellular fatty acid utilization (inhibition of hepatic lipogenesis and induction of muscle fatty acid β-oxidation) to enhance growth performance during mild cold acclimation.

REDUCING TOXICITY AND INCREASING EFFICIENCY: ACONITINE WITH LIQUIRITIN AND GLYCYRRHETINIC ACID REGULATE CALCIUM REGULATORY PROTEINS IN RAT MYOCARDIAL CELL.

PubMed

Zhang, Yuyan; Yu, Li; Jin, Weifeng; Fan, Hongjing; Li, Min; Zhou, Tianmei; Wan, Haitong; Yang, Jiehong

2017-01-01

Compatibility of Radix Aconiti Carmichaeli and Liquorice is known to treat heart diseases such as heart failure and cardiac arrhythmias. This work answers the question that whether the active components (Aconitine, Liquiritin and Glycyrrhetinic Acid) of Radix Aconiti Carmichaeli and Liquorice could result in regulating intracellular calcium homeostasis and calcium cycling, and thereby verifies the therapeutic material basis. The myocardial cells were divided into twelve groups randomly as control group, Aconitine group, nine different dose groups that orthogonal combined with Aconitine, Liquiritin and Glycyrrhetinic Acid, and Verapamil group. The myocardial cellular survival rate and morphology were assessed. The expression of calcium regulation protein(RyR2, NCX1, DHPR-a1) in the myocardial cell by Western-blotting. The results exhibited that Aconitine (120 uM) significantly damaged on myocardial cell, decreased the survival rate and expression of Na + /Ca 2+ exchangers (NCX1) and dihydropteridine reducta-α1 (DHPR-a1), and increased the expression of ryanodine receptor type2 (RyR2) obviously. The compatibility groups (Aconitine, Liquiritin and Glycyrrhetinic Acid) all could against the damage on the myocardial cell by Aconitine at different levels. Aconitine with Liquiritin and Glycyrrhetinic Acid may regulate the expression of calcium-regulated proteins to protect myocardial cells from damage.

Acute heat stress up-regulates neuropeptide Y precursor mRNA expression and alters brain and plasma concentrations of free amino acids in chicks.

PubMed

Ito, Kentaro; Bahry, Mohammad A; Hui, Yang; Furuse, Mitsuhiro; Chowdhury, Vishwajit S

2015-09-01

Heat stress causes an increase in body temperature and reduced food intake in chickens. Several neuropeptides and amino acids play a vital role in the regulation of food intake. However, the responses of neuropeptides and amino acids to heat-stress-induced food-intake regulation are poorly understood. In the current study, the hypothalamic mRNA expression of some neuropeptides related to food intake and the content of free amino acids in the brain and plasma was examined in 14-day-old chicks exposed to a high ambient temperature (HT; 40±1 °C for 2 or 5 h) or to a control thermoneutral temperature (CT; 30±1 °C). HT significantly increased rectal temperature and plasma corticosterone level and suppressed food intake. HT also increased the expression of neuropeptide Y (NPY) and agouti-signaling protein (ASIP) precursor mRNA, while no change was observed in pro-opiomelanocortin, cholecystokinin, ghrelin, or corticotropin-releasing hormone precursor mRNA. It was further found that the diencephalic content of free amino acids - namely, tryptophan, leucine, isoleucine, valine and serine - was significantly higher in HT chicks with some alterations in their plasma amino acids in comparison with CT chicks. The induction of NPY and ASIP expression and the alteration of some free amino acids during HT suggest that these changes can be the results or causes the suppression of food intake. Copyright © 2015. Published by Elsevier Inc.

Identification and expression of fructose-1,6-bisphosphate aldolase genes and their relations to oil content in developing seeds of tea oil tree (Camellia oleifera).

PubMed

Zeng, Yanling; Tan, Xiaofeng; Zhang, Lin; Jiang, Nan; Cao, Heping

2014-01-01

Tea oil tree (Camellia oleifera, Co) provides a fine edible oil source in China. Tea oil from the seeds is very beneficial to human health. Fructose-1,6-bisphosphate aldolase (FBA) hydrolyzes fructose-1,6-bisphosphate into dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, two critical metabolites for oil biosynthesis. The objectives of this study were to identify FBA genes and investigate the relationship between FBA gene expression and oil content in developing seeds of tea oil tree. In this paper, four developmentally up-regulated CoFBA genes were identified in Camellia oleifera seeds based on the transcriptome from two seed developmental stages corresponding to the initiation and peak stages of lipid biosynthesis. The expression of CoFBA genes, along with three key oil biosynthesis genes CoACP, CoFAD2 and CoSAD were analyzed in seeds from eight developmental stages by real-time quantitative PCR. The oil content and fatty acid composition were also analyzed. The results showed that CoFBA and CoSAD mRNA levels were well-correlated with oil content whereas CoFAD2 gene expression levels were correlated with fatty acid composition in Camellia seeds. We propose that CoFBA and CoSAD are two important factors for determining tea oil yield because CoFBA gene controls the flux of key intermediates for oil biosynthesis and CoSAD gene controls the synthesis of oleic acid, which accounts for 80% of fatty acids in tea oil. These findings suggest that tea oil yield could be improved by enhanced expression of CoFBA and CoSAD genes in transgenic plants.

Modulatory effects of arginine, glutamine and branched-chain amino acids on heat shock proteins, immunity and antioxidant response in exercised rats.

PubMed

Moura, Carolina Soares; Lollo, Pablo Christiano Barboza; Morato, Priscila Neder; Risso, Eder Muller; Amaya-Farfan, Jaime

2017-09-20

Heat shock proteins (HSPs) are endogenous proteins whose function is to maintain the cell's tolerance to insult, and glutamine supplementation is known to increase HSP expression during intense exercise. Since few studies have addressed the possibility that supplementation with other amino acids could have similar effects to that of glutamine, our objective was to evaluate the effects of leucine, valine, isoleucine and arginine as potential stimulators of HSPs 25, 60, 70 and 90 in rats subjected to acute exercise as a stressing factor. The immune markers, antioxidant system, blood parameters, glycogen and amino acid profile responses were also assessed. Male Wistar rats were divided into seven groups: control (rest, without gavage), vehicle (water), l-leucine, l-isoleucine, l-valine, l-arginine and l-glutamine. Except for the control, all animals were exercised and received every amino acid by oral gavage. Arginine supplementation up-regulated muscle HSP70 and HSP90 and serum HSP70, however, none of the amino acids affected the HSP25. All amino acids increased exercise-induced HSP60 expression, except for valine. Antioxidant enzymes were reduced by exercise, but both glutamine and arginine restored glutathione peroxidase, while isoleucine and valine restored superoxide dismutase. Exercise reduced monocyte, platelet, lymphocyte and erythrocyte levels, while leucine stimulated immune response, preserved the levels of the lymphocytes and increased leukocytes and maintained platelets at control levels. Plasma and muscle amino acid profiles showed specific metabolic features. The data suggest that the tissue-protecting effects of arginine could proceed by enhancing specific HSPs in the body.

Exploiting genes and functional diversity of chlorogenic acid and luteolin biosyntheses in Lonicera japonica and their substitutes.

PubMed

Yuan, Yuan; Wang, Zhouyong; Jiang, Chao; Wang, Xumin; Huang, Luqi

2014-01-25

Chlorogenic acids (CGAs) and luteolin are active compounds in Lonicera japonica, a plant of high medicinal value in traditional Chinese medicine. This study provides a comprehensive overview of gene families involved in chlorogenic acid and luteolin biosynthesis in L. japonica, as well as its substitutes Lonicera hypoglauca and Lonicera macranthoides. The gene sequence feature and gene expression patterns in various tissues and buds of the species were characterized. Bioinformatics analysis revealed that 14 chlorogenic acid and luteolin biosynthesis-related genes were identified from the L. japonica transcriptome assembly. Phylogenetic analyses suggested that the function of individual gene could be differentiation and induce active compound diversity. Their orthologous genes were also recognized in L. hypoglauca and L. macranthoides genomic datasets, except for LHCHS1 and LMC4H2. The expression patterns of these genes are different in the tissues of L. japonica, L. hypoglauca and L. macranthoides. Results also showed that CGAs were controlled in the first step of biosynthesis, whereas both steps controlled luteolin in the bud of L. japonica. The expression of LJFNS2 exhibited positive correlation with luteolin levels in L. japonica. This study provides significant information for understanding the functional diversity of gene families involved in chlorogenic acid and the luteolin biosynthesis, active compound diversity of L. japonica and its substitutes, and the different usages of the three species. Copyright © 2012. Published by Elsevier B.V.

Altered fatty acid metabolism and reduced stearoyl-coenzyme a desaturase activity in asthma.

PubMed

Rodriguez-Perez, N; Schiavi, E; Frei, R; Ferstl, R; Wawrzyniak, P; Smolinska, S; Sokolowska, M; Sievi, N A; Kohler, M; Schmid-Grendelmeier, P; Michalovich, D; Simpson, K D; Hessel, E M; Jutel, M; Martin-Fontecha, M; Palomares, O; Akdis, C A; O'Mahony, L

2017-11-01

Fatty acids and lipid mediator signaling play an important role in the pathogenesis of asthma, yet this area remains largely underexplored. The aims of this study were (i) to examine fatty acid levels and their metabolism in obese and nonobese asthma patients and (ii) to determine the functional effects of altered fatty acid metabolism in experimental models. Medium- and long-chain fatty acid levels were quantified in serum from 161 human volunteers by LC/MS. Changes in stearoyl-coenzyme A desaturase (SCD) expression and activity were evaluated in the ovalbumin (OVA) and house dust mite (HDM) murine models. Primary human bronchial epithelial cells from asthma patients and controls were evaluated for SCD expression and activity. The serum desaturation index (an indirect measure of SCD) was significantly reduced in nonobese asthma patients and in the OVA murine model. SCD1 gene expression was significantly reduced within the lungs following OVA or HDM challenge. Inhibition of SCD in mice promoted airway hyper-responsiveness. SCD1 expression was suppressed in bronchial epithelial cells from asthma patients. IL-4 and IL-13 reduced epithelial cell SCD1 expression. Inhibition of SCD reduced surfactant protein C expression and suppressed rhinovirus-induced IP-10 secretion, which was associated with increased viral titers. This is the first study to demonstrate decreased fatty acid desaturase activity in humans with asthma. Experimental models in mice and human epithelial cells suggest that inhibition of desaturase activity leads to airway hyper-responsiveness and reduced antiviral defense. SCD may represent a new target for therapeutic intervention in asthma patients. © 2017 EAACI and John Wiley and Sons A/S. Published by John Wiley and Sons Ltd.

Characterization and developmental expression of genes encoding the early carotenoid biosynthetic enzymes in Citrus paradisi Macf.

PubMed

Costa, Marcio G C; Moreira, Cristina D; Melton, John R; Otoni, Wagner C; Moore, Gloria A

2012-02-01

In the present study, the full-length cDNA sequences of PSY, PDS, and ZDS, encoding the early carotenoid biosynthetic enzymes in the carotenoid pathway of grapefruit (Citrus paradisi), were isolated and characterized for the first time. CpPSY contained a 1311-bp open reading frame (ORF) encoding a polypeptide of 436 amino acids, CpPDS contained a 1659-bp ORF encoding a polypeptide of 552 amino acids, and CpZDS contained a 1713-bp ORF encoding a polypeptide of 570 amino acids. Phylogenetic analysis indicated that CpPSY shares homology with PSYs from Citrus, tomato, pepper, Arabidopsis, and the monocot PSY1 group, while CpPDS and CpZDS are most closely related to orthologs from Citrus and tomato. Expression analysis revealed fluctuations in CpPSY, CpPDS, and CpZDS transcript abundance and a non-coordinated regulation between the former and the two latter genes during fruit development in albedo and juice vesicles of white ('Duncan') and red ('Flame') grapefruits. A 3× higher upregulation of CpPSY expression in juice vesicles of red-fleshed 'Flame' as compared to white-fruited 'Duncan' was observed in the middle stages of fruit development, which correlates with the well documented accumulation pattern of lycopene in red grapefruit. Together with previous data, our results suggest that the primary mechanism controlling lycopene accumulation in red grapefruit involves the transcriptional upregulation of CpPSY, which controls the flux into the carotenoid pathway, and the downregulated expression of CpLCYB2, which controls the step of cyclization of lycopene in chromoplasts during fruit ripening. A correlation between CpPSY expression and fruit color evolution in red grapefruit is demonstrated.

Expression analysis of some genes regulated by retinoic acid in controls and triadimefon-exposed embryos: is the amphibian Xenopus laevis a suitable model for gene-based comparative teratology?

PubMed

Di Renzo, Francesca; Rossi, Federica; Bacchetta, Renato; Prati, Mariangela; Giavini, Erminio; Menegola, Elena

2011-06-01

The use of nonmammal models in teratological studies is a matter of debate and seems to be justified if the embryotoxic mechanism involves conserved processes. Published data on mammals and Xenopus laevis suggest that azoles are teratogenic by altering the endogenous concentration of retinoic acid (RA). The expression of some genes (Shh, Ptch-1, Gsc, and Msx2) controlled by retinoic acid is downregulated in rat embryos exposed at the phylotypic stage to the triazole triadimefon (FON). In order to propose X. laevis as a model for gene-based comparative teratology, this work evaluates the expression of Shh, Ptch-1, Gsc, and Msx2 in FON-exposed X. laevis embryos. Embryos, exposed to a high concentration level (500 µM) of FON from stage 13 till 17, were examined at stages 17, 27, and 47. Stage 17 and 27 embryos were processed to perform quantitative RT-PCR. The developmental rate was never affected by FON at any considered stage. FON-exposed stage 47 larvae showed the typical craniofacial malformations. A significant downregulation of Gsc was observed in FON-exposed stage 17 embryos. Shh, Ptch-1, Msx2 showed a high fluctuation of expression both in control and in FON-exposed samples both at stages 17 and 27. The downregulation of Gsc mimics the effects of FON on rat embryos, showing for this gene a common effect of FON in the two vertebrate classes. The high fluctuation observed in the gene expression of the other genes, however, suggests that X. laevis at this stage has limited utility for gene-based comparative teratology. © 2011 Wiley-Liss, Inc.

Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptor.

PubMed Central

Göttlicher, M; Widmark, E; Li, Q; Gustafsson, J A

1992-01-01

Peroxisome proliferators such as clofibric acid, nafenopin, and WY-14,643 have been shown to activate PPAR (peroxisome proliferator-activated receptor), a member of the steroid nuclear receptor superfamily. We have cloned the cDNA from the rat that is homologous to that from the mouse [Issemann, I. & Green, S. (1990) Nature (London) 347, 645-650], which encodes a 97% similar protein with a particularly well-conserved putative ligand-binding domain. To search for physiologically occurring activators, we established a transcriptional transactivation assay by stably expressing in CHO cells a chimera of rat PPAR and the human glucocorticoid receptor that activates expression of the placental alkaline phosphatase reporter gene under the control of the mouse mammary tumor virus promoter. Testing of compounds related to lipid metabolism or peroxisomal proliferation revealed that 150 microM concentrations of arachidonic or linoleic acid but not of dehydroepiandrosterone, cholesterol, or 25-hydroxy-cholesterol, activate the receptor chimera. In addition, saturated fatty acids induce the reporter gene. Shortening the chain length to n = 6 or introduction of an omega-terminal carboxylic group abolished the activation potential of the fatty acid. In conclusion, the present results indicate that fatty acids can regulate gene expression mediated by a member of the steroid nuclear receptor superfamily. Images PMID:1316614

Characterization of a novel rice gene OsATX and modulation of its expression by components of the stress signalling pathways.

PubMed

Agrawal, Ganesh K; Rakwal, Randeep; Jwa, N-S; Agrawal, Vishwanath P

2002-09-01

In our search to identify gene(s) involved in the rice self-defense responses, we cloned a novel rice (Oryza sativa L. cv. Nipponbare) gene, OsATX, a single copy gene, from the JA treated rice seedling leaves cDNA library. This gene encodes a 69 amino acid polypeptide with a predicted molecular mass of 7649.7 and a pI of 5.6. OsATX was responsive to cutting (wounding by cutting the excised leaf), over its weak constitutive expression in the healthy leaves. The critical signalling molecules, jasmonic acid (JA), salicylic acid (SA), abscisic acid (ABA), and hydrogen peroxide, together with protein phosphatase inhibitors, effectively up-regulated the OsATX expression with time, over the excised leaf cut control, whereas ethylene had no affect. Furthermore, copper, a heavy metal, also up-regulated OsATX expression. Moreover, induced expression of OsATX mRNA was influenced by light signal(s), and showed a requirement for de novo synthesized protein factors. Additionally, co-application of either JA or ABA with SA drastically suppressed the induced OsATX mRNA level. Finally, the blast pathogen, Magnaporthe grisea, triggered OsATX mRNA accumulation. These results strongly suggest a function/role(s) for OsATX in defense/stress responses in rice.

Gene expression in the rectus abdominus muscle of patients with and without pelvic organ prolapse.

PubMed

Hundley, Andrew F; Yuan, Lingwen; Visco, Anthony G

2008-02-01

The objective of the study was to compare gene expression in a group of actin and myosin-related proteins in the rectus muscle of 15 patients with pelvic organ prolapse and 13 controls. Six genes previously identified by microarray GeneChip analysis were examined using real-time quantitative reverse transcriptase-polymerase chain reaction analysis, including 2 genes showing differential expression in pubococcygeus muscle. Samples and controls were run in triplicate in multiplexed wells, and levels of gene expression were analyzed using the comparative critical threshold method. One gene, MYH3, was 3.2 times overexpressed in patients with prolapse (P = .032), but no significant differences in expression were seen for the other genes examined. An age-matched subset of 9 patients and controls showed that MYH3 gene expression was no longer significantly different (P = .058). Differential messenger ribonucleic acid levels of actin and myosin-related genes in patients with pelvic organ prolapse and controls may be limited to skeletal muscle from the pelvic floor.

Effects of Addition of Linseed and Marine Algae to the Diet on Adipose Tissue Development, Fatty Acid Profile, Lipogenic Gene Expression, and Meat Quality in Lambs

PubMed Central

Urrutia, Olaia; Mendizabal, José Antonio; Insausti, Kizkitza; Soret, Beatriz; Purroy, Antonio; Arana, Ana

2016-01-01

This study examined the effect of linseed and algae on growth and carcass parameters, adipocyte cellularity, fatty acid profile and meat quality and gene expression in subcutaneous and intramuscular adipose tissues (AT) in lambs. After weaning, 33 lambs were fed three diets up to 26.7 ± 0.3 kg: Control diet (barley and soybean); L diet (barley, soybean and 10% linseed) and L-A diet (barley, soybean, 5% linseed and 3.89% algae). Lambs fed L-A diet showed lower average daily gain and greater slaughter age compared to Control and L (P < 0.001). Carcass traits were not affected by L and L-A diets, but a trend towards greater adipocyte diameter was observed in L and L-A in the subcutaneous AT (P = 0.057). Adding either linseed or linseed and algae increased α-linolenic acid and eicosapentaenoic acid contents in both AT (P < 0.001); however, docosahexaenoic acid was increased by L-A (P < 0.001). The n-6/n-3 ratio decreased in L and L-A (P < 0.001). Algae had adverse effects on meat quality, with greater lipid oxidation and reduced ratings for odor and flavor. The expression of lipogenic genes was downregulated in the subcutaneous AT (P < 0.05): acetyl-CoA carboxylase 1 (ACACA) in L and L-A and lipoprotein lipase (LPL) and stearoyl-CoA desaturase (SCD) in L-A. Fatty acid desaturase 1 (FADS1), fatty acid desaturase 2 (FADS2) and fatty acid elongase 5 (ELOVL5) were unaffected. In the subcutaneous AT, supplementing either L or L-A increased peroxisome proliferator-activated receptor gamma (PPARG) and CAAT-enhancer binding protein alpha (CEBPA) (P < 0.05), although it had no effect on sterol regulatory element-binding factor 1 (SREBF1). In the intramuscular AT, expression of ACACA, SCD, FADS1 and FADS2 decreased in L and L-A (P < 0.001) and LPL in L (P < 0.01), but PPARG, CEBPA and SREBF1 were unaffected. PMID:27253325

Activation of UCPs gene expression in skeletal muscle can be independent on both circulating fatty acids and food intake. Involvement of ROS in a model of mouse cancer cachexia.

PubMed

Busquets, Sílvia; Almendro, Vanessa; Barreiro, Esther; Figueras, Maite; Argilés, Josep M; López-Soriano, Francisco J

2005-01-31

Implantation of a fast growing tumour to mice (Lewis lung carcinoma) resulted in a clear cachectic state characterized by a profound muscle wasting. This was accompanied by a significant increase in both UCP2 and UCP3 gene expression in skeletal muscle and heart. Interestingly, this increase in gene expression was not linked to a rise in circulating fatty acids or in a decrease in food intake, as previously reported in other pathophysiological states. These results question the concept that hyperlipaemia is the only factor controlling UCP gene expression in different pathophysiological conditions. In addition, the present work suggests that UCPs might participate in a counter-regulatory mechanism to lower the production of ROS.

Caffeine Promotes Conversion of Palmitic Acid to Palmitoleic Acid by Inducing Expression of fat-5 in Caenorhabditis elegans and scd1 in Mice.

PubMed

Du, Xiaocui; Huang, Qin; Guan, Yun; Lv, Ming; He, Xiaofang; Fang, Chongye; Wang, Xuanjun; Sheng, Jun

2018-01-01

The synthesis and metabolism of fatty acids in an organism is related to many biological processes and is involved in several diseases. The effects of caffeine on fatty acid synthesis and fat storage in Caenorhabditis elegans and mice were studied. After 6 h of food deprivation, adult C. elegans were treated with 0.1 mg/mL caffeine for 24 h. Quantitative reverse-transcription polymerase chain reaction showed that, among all the genes involved in fat accumulation, the mRNA expression of fat-5 in caffeine-treated C. elegans was significantly higher than that of controls, whereas fat-6 and fat-7 displayed no significant difference. Gas chromatography-mass spectrometry was used to verify the fatty acid composition of C. elegans . Results showed that the ratio of palmitoleic acid (16:1) to that of palmitic acid (16:0) was higher in the caffeine-treated group. Several mutant strains, including those involved in the insulin-like growth factor-1, dopamine, and serotonin pathways, and nuclear hormone receptors ( nhrs ), were used to assess their necessity to the effects of caffeine. We found that mdt-15 was essential for the effects of caffeine, which was independent of nhr-49 and nhr -80. Caffeine may increase fat-5 expression by acting on mdt-15 . In high fat diet (HFD), but not in normal diet (ND) mice, caffeine induced expression of scd1 in both subcutaneous and epididymal white adipose tissue, which was consistent with the palmitoleic/palmitic ratio results by gas chromatograph analysis. In mature adipocytes, caffeine treatment induced both mRNA and protein expression of scd1 and pgc-1 α. Overall, our results provided a possible mechanism on how caffeine modulates metabolism homeostasis in vivo .

Effect of collecting duct-specific deletion of both Rh B Glycoprotein (Rhbg) and Rh C Glycoprotein (Rhcg) on renal response to metabolic acidosis

PubMed Central

Lee, Hyun-Wook; Verlander, Jill W.; Handlogten, Mary E.; Han, Ki-Hwan

2013-01-01

The Rhesus (Rh) glycoproteins, Rh B and Rh C Glycoprotein (Rhbg and Rhcg, respectively), are ammonia-specific transporters expressed in renal distal nephron and collecting duct sites that are necessary for normal rates of ammonia excretion. The purpose of the current studies was to determine the effect of their combined deletion from the renal collecting duct (CD-Rhbg/Rhcg-KO) on basal and acidosis-stimulated acid-base homeostasis. Under basal conditions, urine pH and ammonia excretion and serum HCO3− were similar in control (C) and CD-Rhbg/Rhcg-KO mice. After acid-loading for 7 days, CD-Rhbg/Rhcg-KO mice developed significantly more severe metabolic acidosis than did C mice. Acid loading increased ammonia excretion, but ammonia excretion increased more slowly in CD-Rhbg/Rhcg-KO and it was significantly less than in C mice on days 1–5. Urine pH was significantly more acidic in CD-Rhbg/Rhcg-KO mice on days 1, 3, and 5 of acid loading. Metabolic acidosis increased phosphenolpyruvate carboxykinase (PEPCK) and Na+/H+ exchanger NHE-3 and decreased glutamine synthetase (GS) expression in both genotypes, and these changes were significantly greater in CD-Rhbg/Rhcg-KO than in C mice. We conclude that 1) Rhbg and Rhcg are critically important in the renal response to metabolic acidosis; 2) the significantly greater changes in PEPCK, NHE-3, and GS expression in acid-loaded CD-Rhbg/Rhcg-KO compared with acid-loaded C mice cause the role of Rhbg and Rhcg to be underestimated quantitatively; and 3) in mice with intact Rhbg and Rhcg expression, metabolic acidosis does not induce maximal changes in PEPCK, NHE-3, and GS expression despite the presence of persistent metabolic acidosis. PMID:24338819

Functional characterization of a novel jasmonate ZIM-domain interactor (NINJA) from upland cotton (Gossypium hirsutum).

PubMed

Wang, Le; Wu, Shu-Ming; Zhu, Yue; Fan, Qiang; Zhang, Zhen-Nan; Hu, Guang; Peng, Qing-Zhong; Wu, Jia-He

2017-03-01

The jasmonic acid (JA) signalling pathway plays roles in plant development and defence against biotic and abiotic stresses. We isolated a cotton NINJA (novel interactor of JA ZIM-domain) gene, designated GhNINJA, which contains a 1305 bp open read frame. The GhNINJA gene encodes a 434 amino acid peptide. According to quantitative real-time PCR analysis, GhNINJA is preferentially expressed in roots, and its expression level is greatly induced by Verticillium dahliae infection. Through a virus-induced gene silencing technique, we developed GhNINJA-silenced cotton plants, which had significantly decreased expression of the target gene with an average expression of 6% of the control. The regenerating lateral root growth of silenced plants was largely inhibited compared to the control. Analysis by microscopy demonstrated that the cell length of the root differentiation zone in GhNINJA-silenced plants is significantly shorter than those of the control. Moreover, the silenced plants exhibited higher tolerance to V. dahliae infection compared to the control, which was linked to the increased expression of the defence marker genes PDF1.2 and PR4. Together, these data indicated that knockdown of GhNINJA represses the root growth and enhances the tolerance to V. dahliae. Therefore, GhNINJA gene can be used as a candidate gene to breed the new cultivars for improving cotton yield and disease resistance. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Phytohormonal Networks Promote Differentiation of Fiber Initials on Pre-Anthesis Cotton Ovules Grown In Vitro and In Planta

PubMed Central

Kim, Hee Jin; Hinchliffe, Doug J.; Triplett, Barbara A.; Chen, Z. Jeffrey; Stelly, David M.; Yeater, Kathleen M.; Moon, Hong S.; Gilbert, Matthew K.; Thyssen, Gregory N.; Turley, Rickie B.; Fang, David D.

2015-01-01

The number of cotton (Gossypium sp.) ovule epidermal cells differentiating into fiber initials is an important factor affecting cotton yield and fiber quality. Despite extensive efforts in determining the molecular mechanisms regulating fiber initial differentiation, only a few genes responsible for fiber initial differentiation have been discovered. To identify putative genes directly involved in the fiber initiation process, we used a cotton ovule culture technique that controls the timing of fiber initial differentiation by exogenous phytohormone application in combination with comparative expression analyses between wild type and three fiberless mutants. The addition of exogenous auxin and gibberellins to pre-anthesis wild type ovules that did not have visible fiber initials increased the expression of genes affecting auxin, ethylene, ABA and jasmonic acid signaling pathways within 1 h after treatment. Most transcripts expressed differentially by the phytohormone treatment in vitro were also differentially expressed in the ovules of wild type and fiberless mutants that were grown in planta. In addition to MYB25-like, a gene that was previously shown to be associated with the differentiation of fiber initials, several other differentially expressed genes, including auxin/indole-3-acetic acid (AUX/IAA) involved in auxin signaling, ACC oxidase involved in ethylene biosynthesis, and abscisic acid (ABA) 8'-hydroxylase an enzyme that controls the rate of ABA catabolism, were co-regulated in the pre-anthesis ovules of both wild type and fiberless mutants. These results support the hypothesis that phytohormonal signaling networks regulate the temporal expression of genes responsible for differentiation of cotton fiber initials in vitro and in planta. PMID:25927364

Prenatal retinoic acid treatment upregulates late gestation lung protein 1 in the nitrofen-induced hypoplastic lung in late gestation.

PubMed

Ruttenstock, Elke Maria; Doi, Takashi; Dingemann, Jens; Puri, Prem

2011-02-01

Pulmonary hypoplasia (PH), the leading cause of mortality in congenital diaphragmatic hernia (CDH), is associated with arrested alveolarization. Late gestation lung protein 1 (LGL1) plays a crucial role in the regulation of alveolarization. Inhibition of LGL1 impairs alveolar maturation in fetal rat lungs. LGL1 heterozygotus knockout mice display delayed lung maturation. It is well known that prenatal administration of retinoic acid (RA) stimulates alveologenesis in nitrofen-induced PH. In vitro studies have reported that RA is a key modulator of LGL1 during alveologenesis. We hypothesized, that pulmonary gene expression of LGL1 is downregulated in the late stage of lung development, and that prenatal administration of RA upregulates pulmonary LGL1 expression in the nitrofen CDH model. Pregnant rats were exposed to nitrofen on day 9 (D9) of gestation. RA was given intraperitoneally on D18, D19 and D20. Fetal lungs were dissected on D21 and divided into control, control + RA, CDH and CDH + RA group. Expression levels of LGL1 were determined using RT-PCR and immunohistochemistry. On D21, LGL1 relative mRNA expression levels were significantly downregulated in CDH group compared to controls. After RA treatment, gene expression levels of LGL1 were significantly upregulated in CDH + RA and control + RA compared to CDH group. Immunohistochemical studies confirmed these results. Downregulation of pulmonary LGL1 gene expression in the late stage of lung development may interfere with normal alveologenesis. Upregulation of LGL1 pulmonary gene expression after RA treatment may promote lung growth by stimulating alveologenesis in the nitrofen CDH model.

Effect of α-linolenic acid and DHA intake on lipogenesis and gene expression involved in fatty acid metabolism in growing-finishing pigs.

PubMed

De Tonnac, A; Labussière, E; Vincent, A; Mourot, J

2016-07-01

The regulation of lipogenesis mechanisms related to consumption of n-3 PUFA is poorly understood. The aim of the present study was to find out whether α-linolenic acid (ALA) or DHA uptake can have an effect on activities and gene expressions of enzymes involved in lipid metabolism in the liver, subcutaneous adipose tissue and longissimus dorsi (LD) muscle of growing-finishing pigs. Six groups of ten pigs received one of six experimental diets supplemented with rapeseed oil in the control diet, extruded linseed, microalgae or a mixture of both to implement different levels of ALA and DHA with the same content in total n-3. Results were analysed for linear and quadratic effects of DHA intake. The results showed that activities of malic enzyme (ME) and fatty acid synthase (FAS) decreased linearly in the liver with dietary DHA. Although the expression of the genes of these enzymes and their activities were poorly correlated, ME and FAS expressions also decreased linearly with DHA intake. The intake of DHA down-regulates the expressions of other genes involved in fatty acid (FA) metabolism in some tissues of pigs, such as fatty acid desaturase 2 and sterol-regulatory element binding transcription factor 1 in the liver and 2,4-dienoyl CoA reductase 2 in the LD muscle. FA oxidation in the LD muscle and FA synthesis decreased in the liver with increasing amount of dietary DHA, whereas a retroconversion of DHA into EPA seems to be set up in this last tissue.

Mechanisms of triglyceride metabolism in patients with bile acid diarrhea

PubMed Central

Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

2016-01-01

Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

Bioactivity of food peptides: biological response of rats to bovine milk whey peptides following acute exercise

PubMed Central

Moura, Carolina Soares; Lollo, Pablo Christiano Barboza; Morato, Priscila Neder; Risso, Eder Muller; Amaya-Farfan, Jaime

2017-01-01

ABSTRACT Background: Several physiologically beneficial effects of consuming a whey protein hydrolysate (WPH) have been attributed to the greater availability of bioactive peptides. Aims: The aim was to investigate the effect of four branched-chain amino acid- (BCAA-)containing dipeptides, present in WPH, on immune modulation, stimulation of HSP expression, muscle protein synthesis, glycogen content, satiety signals and the impact of these peptides on the plasma free amino acid profiles. Methods: The animals were divided in groups: control (rest, without gavage), vehicle (water), L-isoleucyl-L-leucine (lle-Leu), L-leucyl-L-isoleucine (Leu-lle), L-valyl-Lleucine (Val-Leu), L-leucyl-L-valine (Leu-Val) and WPH. All animals were submitted to acute exercise, except for control. Results: lle-Leu stimulated immune response, hepatic and muscle glycogen and HSP60 expression, whereas Leu-Val enhanced HSP90 expression. All dipeptides reduced glucagon-like peptide-1 and glucose-dependent insulinotropic polypeptide, no changes were observed on leptin. All peptides inhibited NF-kB expression. The plasma amino acid time-course showed peptide-specific and isomer-specific metabolic features, including increases of the BCAAs. Conclusion: The data indicate that lle-Leu was effective to attenuate immune-suppression exercise-induced, promoted glycogen content and stimulated anti-stress effect (HSP). Furthermore, Leu-Val increased HSP90, p-4EBP1, p-mTOR and p-AMPK expression. The data suggest the involvement of these peptides in various beneficial functions of WPH consumption. PMID:28326005

Effect of acidity on the physicochemical properties of α- and β-chitin nanofibers.

PubMed

Suenaga, Shin; Totani, Kazuhide; Nomura, Yoshihiro; Yamashita, Kazuhiko; Shimada, Iori; Fukunaga, Hiroshi; Takahashi, Nobuhide; Osada, Mitsumasa

2017-09-01

We have investigated whether acidity can be used to control the physicochemical properties of chitin nanofibers (ChNFs). In this study, we define acidity as the molar ratio of dissociated protons from the acid to the amino groups in the raw chitin powder. The effect of acidity on the physicochemical properties of α- and β-ChNFs was compared. The transmittance and viscosity of the β-ChNFs drastically and continuously increased with increasing acidity, while those of the α-ChNFs were not affected by acidity. These differences are because of the higher ability for cationization based on the more flexible crystal structure of β-chitin than α-chitin. In addition, the effect of the acid species on the transmittance of β-ChNFs was investigated. The transmittance of β-ChNFs can be expressed by the acidity regardless of the acid species, such as hydrochloric acid, phosphoric acid, and acetic acid. These results indicate that the acidity defined in this work is an effective parameter to define and control the physicochemical properties of ChNFs. Copyright © 2017 Elsevier B.V. All rights reserved.

[Effects of SREBP-1 over-expression on fatty acid metabolism related genes expression in goats].

PubMed

Xu, Huifen; Luo, Jun; Li, Fang; Yu, Kang; Shi, Hengbo; Li, Jun; Lin, Xianzi; Zhu, Jiangjiang

2012-11-01

The aim of the study was to construct a recombinant adenovirus overexpression vector for Sterol Regulatory Element Binding Protein-1 (SREBP-1) of Xinong Saanen dairy goat, and to detect its effect on genes related to fatty acid metabolism in goat mammary epithelial cells, to establish foundation for further study of its roles in metabolism of fatty acid synthesis and lactation. First, we designed primers based on the SREBP-1 gene sequence in GenBank for PCR amplification and inserted the sequence into shuttle vector pAdTrack-CMV. The recombinant plasmid pAdTrack-CMV-SREBP-1 linearized by Pme I was transformed into E. coli BJ5183 competence cell containing the backbone vector pAdEasy-1 to obtain recombinant vector pAd-SREBP-1 by homologous recombination. pAd-SREBP-1 was linearized by Pac I and transfected into HEK 293 cell. Then we infected goat mammary epithelial cells with recombinant adenovirus which was packaged in HEK 293 cell line. The results showed that the recombinant adenovirus vector containing SREBP-1 was successfully constructed, and the titer of virus was 10(9) U/mL. Compared with the control group, mRNA level of SREBP-1 increased by about 15 times after infected for 48 h and 30 times after infected for 72 h. Fatty acid synthase (FASN) and Acetyl-CoA carboxylase (ACC) was upregulated by almost 2 times. The expression level of Peroxisome proliferator activated receptorgamma (PPARgamma) increased by 1.5 times. Liver X receptoralpha (LXRalpha) and Adipose triglyceride lipase (ATGL) upregulated by 1.2 times compared with that of control. But Stearoyl-coenzyme A desaturase (SCD) had no obvious change. In conclusion, SREBP-1 can activate the expression of genes related to fatty acid synthesis in mammary epithelial cells of Xinong Saanen dairy goat, demonstrated a regulatory function on the fatty acid metabolism in goat mammary gland.

The comparison of the rejuvenation effects on the skin of Wistar rats between 10600 nm CO2 fractional laser and retinoic acid.

PubMed

Qu, Y; Ma, W-Y; Sun, Q

2017-04-01

The fractional laser and topical retinoic acid treatment have been applied for skin rejuvenation; however, the possible molecular mechanism of promoting remodeling of dermis is not clearly. Here we aimed to compare the effects of 10600 nm CO2 fractional laser and topical retinoic acid formulation on the skin collagen proliferation of Wistar rats, and to further explore the possible molecular mechanism of promoting remodeling of dermis. The hair on the back of Wistar rats was removed, and the back was divided equally into four regions with the cross-streaking method: A (the control group), B (the retinoic acid group), C (retinoic acid and fractional laser combination treatment group), and D (the fractional laser group). Specimens were collected at 3rd day and in 1-8 weeks after CO2 fractional laser irradiation; then they were used for detection of the changes of dermis thickness and content of hydroxyproline in the four regions of the rats' back. Real-time PCR method was used to detect the dynamic changes of the expression level of type III procollagen mRNA and the expression levels of miR-29a, Akt and transforming growth factor-β (TGF-β) mRNA at 3rd week in the skin tissue of Wistar rats. The thickness of dermis, content of hydroxyproline and expression level of type III procollagen mRNA in the treatment groups (B, C, and D) were found all significantly increased compared with those in the control group (A) (p<0.05); at 3rd week, up-regulation of Akt and TGF-β mRNA expression and down-regulation of miR-29a mRNA expression were observed in the treatment groups (B, C, and D). The difference in the combination treatment group (C) was the most significant (p<0.05). These results demonstrate that retinoic acid formulation and CO2 fractional laser both can promote collagen proliferation and reconstruction, with the skin rejuvenation efficacy in group C > group D > group B. miR-29a/Akt/TGF-β signal pathways may play a certain role in the promotion of collagen synthesis and proliferation.

Leptin reverts pro-apoptotic and antiproliferative effects of α-linolenic acids in BCR-ABL positive leukemic cells: involvement of PI3K pathway.

PubMed

Beaulieu, Aurore; Poncin, Géraldine; Belaid-Choucair, Zakia; Humblet, Chantal; Bogdanovic, Gordana; Lognay, Georges; Boniver, Jacques; Defresne, Marie-Paule

2011-01-01

It is suspected that bone marrow (BM) microenvironmental factors may influence the evolution of chronic myeloid leukaemia (CML). In this study, we postulated that adipocytes and lipids could be involved in the progression of CML. To test this hypothesis, adipocytes were co-cultured with two BCR-ABL positive cell lines (PCMDS and K562). T cell (Jurkat) and stroma cell (HS-5) lines were used as controls. In the second set of experiments, leukemic cell lines were treated with stearic, oleic, linoleic or α-linolenic acids in presence or absence of leptin. Survival, proliferation, leptin production, OB-R isoforms (OB-Ra and OB-Rb), phosphoinositide 3-kinase (PI3k) and BCL-2 expression have been tested after 24h, 48h and 72h of treatment. Our results showed that adipocytes induced a decrease of CML proliferation and an increase in lipid accumulation in leukemic cells. In addition, CML cell lines induced adipocytes cell death. Chromatography analysis showed that BM microenvironment cells were full of saturated (SFA) and monounsaturated (MUFA) fatty acids, fatty acids that protect tumor cells against external agents. Stearic acid increased Bcl-2 expression in PCMDS, whereas oleic and linoleic acids had no effects. In contrast, α-linolenic acid decreased the proliferation and the survival of CML cell lines as well as BCL-2 and OB-R expression. The effect of α-linolenic acids seemed to be due to PI3K pathway and Bcl-2 inhibition. Leptin production was detected in the co-culture medium. In the presence of leptin, the effect of α-linolenic acid on proliferation, survival, OB-R and BCl-2 expression was reduced.

Improving the acetic acid tolerance and fermentation of Acetobacter pasteurianus by nucleotide excision repair protein UvrA.

PubMed

Zheng, Yu; Wang, Jing; Bai, Xiaolei; Chang, Yangang; Mou, Jun; Song, Jia; Wang, Min

2018-05-21

Acetic acid bacteria (AAB) are widely used in acetic acid fermentation due to their remarkable ability to oxidize ethanol and high tolerance against acetic acid. In Acetobacter pasteurianus, nucleotide excision repair protein UvrA was up-regulated 2.1 times by acetic acid when compared with that without acetic acid. To study the effects of UvrA on A. pasteurianus acetic acid tolerance, uvrA knockout strain AC2005-ΔuvrA, uvrA overexpression strain AC2005 (pMV24-uvrA), and the control strain AC2005 (pMV24), were constructed. One percent initial acetic acid was almost lethal to AC2005-ΔuvrA. However, the biomass of the UvrA overexpression strain was higher than that of the control under acetic acid concentrations. After 6% acetic acid shock for 20 and 40 min, the survival ratios of AC2005 (pMV24-uvrA) were 2 and 0.12%, respectively; however, they were 1.5 and 0.06% for the control strain AC2005 (pMV24). UvrA overexpression enhanced the acetification rate by 21.7% when compared with the control. The enzymes involved in ethanol oxidation and acetic acid tolerance were up-regulated during acetic acid fermentation due to the overexpression of UvrA. Therefore, in A. pasteurianus, UvrA could be induced by acetic acid and is related with the acetic acid tolerance by protecting the genome against acetic acid to ensure the protein expression and metabolism.

[Functional expression of an omega-3 fatty acid desaturase gene from Glycine max in Saccharomyces cerevisiae].

PubMed

Zhang, Hong-Tao; Yang, Jia-Sen; Shan, Lei; Bi, Yu-Ping

2006-01-01

Alpha-linolenic acid(ALA, C18:3delta9,12,15 ) is an essential fatty acid which has many sanitary functions to human. However, its contents in diets are often not enough. In plants, omega-3 fatty acid desaturases(FAD) catalyze linoleic acid(LA, C18:2delta9,12) into ALA. The seed oil of Glycine max contains high level of ALA. To investigate the functions of Glycine max omega-3FAD, the cDNA of GmFAD3 C was amplified by RT-PCR from immature seeds, then cloned into the shuttle expression vector p416 to generate the recombinant vector p4GFAD3C. The resulting vector was transformed into Saccharomyces cerevisiae K601 throuth LiAc method. The positive clones were screened on the CM(Ura-) medium and identified by PCR, and then cultured in CM (Ura-) liquid medium with exogenous LA in 20 degrees C for three days. The intracellular fatty acid composition of the engineering strain Kp416 and Kp4GFAD3C was analyzed by gas chromatography (GC). A novel peak in strain Kp4GFAD3C was detected,which was not detectable in control, Comparison of the retention times of the newly yielded peak with that of authentic standard indicated that the fatty acid is ALA. The content of ALA reached to 3.1% of the total fatty acid in recombinant strain, the content of LA correspondingly decreased from 22% to 16.2% by contrast. It was suggested that the protein encoded by GmFAD3 C can specifically catalyze 18 carbon PUFA substrate of LA into ALA by taking off hydrogen atoms at delta15 location. In this study, we expressed a Glycine max omega-3 fatty acid desaturase gene in S. cerevisiae; An efficient and economical yeast expressing system(K601-p416 system) which is suitable for the expression of FAD was built.

The Randle cycle revisited: a new head for an old hat

PubMed Central

Hue, Louis; Taegtmeyer, Heinrich

2009-01-01

In 1963, Lancet published a paper by Randle et al. that proposed a “glucose-fatty acid cycle” to describe fuel flux between and fuel selection by tissues. The original biochemical mechanism explained the inhibition of glucose oxidation by fatty acids. Since then, the principle has been confirmed by many investigators. At the same time, many new mechanisms controlling the utilization of glucose and fatty acids have been discovered. Here, we review the known short- and long-term mechanisms involved in the control of glucose and fatty acid utilization at the cytoplasmic and mitochondrial level in mammalian muscle and liver under normal and pathophysiological conditions. They include allosteric control, reversible phosphorylation, and the expression of key enzymes. However, the complexity is formidable. We suggest that not all chapters of the Randle cycle have been written. PMID:19531645

[Overexpression of four fatty acid synthase genes elevated the efficiency of long-chain polyunsaturated fatty acids biosynthesis in mammalian cells].

PubMed

Zhu, Guiming; Saleh, Abdulmomen Ali Mohammed; Bahwal, Said Ahmed; Wang, Kunfu; Wang, Mingfu; Wang, Didi; Ge, Tangdong; Sun, Jie

2014-09-01

Three long-chain polyunsaturated fatty acids, docosahexaenoic acid (DHA, 22:6n-3), eicosapentaenoic acid (EPA, 20:5n-3) and arachidonic acid (ARA, 20:4n-6), are the most biologically active polyunsaturated fatty acids in the body. They are important in developing and maintaining the brain function, and in preventing and treating many diseases such as cardiovascular disease, inflammation and cancer. Although mammals can biosynthesize these long-chain polyunsaturated fatty acids, the efficiency is very low and dietary intake is needed to meet the requirement. In this study, a multiple-genes expression vector carrying mammalian A6/A5 fatty acid desaturases and multiple-genes expression vector carrying mammalian Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases coding genes was used to transfect HEK293T cells, then the overexpression of the target genes was detected. GC-MS analysis shows that the biosynthesis efficiency and level of DHA, EPA and ARA were significantly increased in cells transfected with the multiple-genes expression vector. Particularly, DHA level in these cells was 2.5 times higher than in the control cells. This study indicates mammal possess a certain mechanism for suppression of high level of biosynthesis of long chain polyunsaturated fatty acids, and the overexpression of Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases broke this suppression mechanism so that the level of DHA, EPA and ARA was significantly increased. This study also provides a basis for potential applications of this gene construct in transgenic animal to produce high level of these long-chain polyunsaturated fatty acid.

Aspartate protects Lactobacillus casei against acid stress.

PubMed

Wu, Chongde; Zhang, Juan; Du, Guocheng; Chen, Jian

2013-05-01

The aim of this study was to investigate the effect of aspartate on the acid tolerance of L. casei. Acid stress induced the accumulation of intracellular aspartate in L. casei, and the acid-resistant mutant exhibited 32.5 % higher amount of aspartate than that of the parental strain at pH 4.3. Exogenous aspartate improved the growth performance and acid tolerance of Lactobacillus casei during acid stress. When cultivated in the presence of 50 mM aspartate, the biomass of cells increased 65.8 % compared with the control (without aspartate addition). In addition, cells grown at pH 4.3 with aspartate addition were challenged at pH 3.3 for 3 h, and the survival rate increased 42.26-fold. Analysis of the physiological data showed that the aspartate-supplemented cells exhibited higher intracellular pH (pHi), intracellular NH4 (+) content, H(+)-ATPase activity, and intracellular ATP pool. In addition, higher contents of intermediates involved in glycolysis and tricarboxylic acid cycle were observed in cells in the presence of aspartate. The increased contents of many amino acids including aspartate, arginine, leucine, isoleucine, and valine in aspartate-added cells may contribute to the regulation of pHi. Transcriptional analysis showed that the expression of argG and argH increased during acid stress, and the addition of aspartate induced 1.46- and 3.06-fold higher expressions of argG and argH, respectively, compared with the control. Results presented in this manuscript suggested that aspartate may protect L. casei against acid stress, and it may be used as a potential protectant during the production of probiotics.

A New Pain Regulatory System via the Brain Long Chain Fatty Acid Receptor GPR40/FFA1 Signal.

PubMed

Nakamoto, Kazuo

2017-01-01

An increasingly large number of pharmacological and physiological works on fatty acids have shown that the functional properties of fatty acids are regulated by the amount of individual fatty acid intake and the distribution of fatty acids among organs. Recently, it has been determined that G-protein-coupled receptor 40/free fatty acid receptor 1 (GPR40/FFA1) is activated by long-chain fatty acids, such as docosahexaenoic acid (DHA). GPR40/FFA1 is mainly expressed in the β cell of the pancreas, spinal cord and brain. It is reported that this receptor has a functional role in controlling blood glucose levels via the modulation of insulin secretion. However, its physiological function in the brain remains unknown. Our previous studies have shown that GPR40/FFA1 is expressed in pro-opiomelanocortin (POMC)-positive neurons of the arcuate nucleus, serotonergic neurons in the nucleus raphe magnus, and in noradrenergic neurons in the locus coeruleus. Furthermore, the intracerebroventricular injection of DHA or GW9508, which is a selective GPR40/FFA1 agonist, attenuates formalin-induced inflammatory pain behavior through increasing β-endorphin release in the hypothalamus. It also suppresses complete Freund's adjuvant-induced mechanical allodynia and thermal hyperalgesia. Our findings suggest that brain free long-chain fatty acids-GPR40/FFA1 signaling might have an important role in the modulation of endogenous pain control systems. In this review, I discuss the current status and our recent study regarding a new pain regulatory system via the brain long chain fatty acid receptor GPR40/FFA1 signal.

Control of Citrus Huanglongbing via Trunk Injection of Plant Defense Activators and Antibiotics.

PubMed

Hu, J; Jiang, J; Wang, N

2018-02-01

Citrus huanglongbing (HLB) or greening is a devastating disease of citrus worldwide and no effective control measure is currently available. Plant defense activators environmentally friendly compounds capable of inducing resistance against many plant pathogens. Earlier studies showed that foliar spray of plant defense inducers could slow down HLB disease progress. In this study, eight plant defense activators and three antibiotics were evaluated in three field trials for their effect to control HLB by trunk injection of young and mature sweet orange trees. Results showed that four trunk injections of several activators, including salicylic acid, oxalic acid, acibenzolar-S-methyl, and potassium phosphate, provided significant control of HLB by suppressing 'Candidatus Liberibacter asiaticus' titer and disease progress. Trunk injection of penicillin, streptomycin, and oxytetracycline hydrochloride resulted in excellent control of HLB. In general, antibiotics were more effective in reduction of 'Ca. L. asiaticus' titer and HLB symptom expressions than plant defense activators. These treatments also resulted in increased yield and better fruit quality. Injection of both salicylic acid and acibenzolar-S-methyl led to significant induction of pathogenesis-related (PR) genes PR-1 and PR-2 genes. Meanwhile, injection of either potassium phosphate or oxalic acid resulted in significant induction of PR-2 or PR-15 gene expression, respectively. These results suggested that HLB diseased trees remained inducible for systemic acquired resistance under field conditions. In summary, this study presents information regarding controlling HLB via trunk injection of plant defense activators and antibiotics, which helps citrus growers in decision making regarding developing an effective HLB management program.

[Expression and significance of adipocyte fatty acid-binding protein in placenta, serum and umbilical cord blood in preeclampsia].

PubMed

Yan, Jian-Ying; Wang, Xiao-Juan

2010-12-01

To investigate the change of adipocyte fatty acid-binding protein (FABP4) in maternal serum and umbilical cord blood and FABP4 mRNA placental expression in patients with preeclampsia (PE). A total of 60 women with PE and 60 normal pregnant women as control participated in this study.All are admitted to Fujian Maternity and Children Health Hospital for delivery from December 2008 to October 2009. Patients with PE were divided into early-onset group (n = 30, presented at ≤ 34 weeks of gestation) and late-onset group (n = 30, presented at > 34 weeks of gestation), with 30 normal pregnant women as early control group (≤ 34 weeks of gestation) and 30 as late control group (> 34 weeks of gestation). Enzyme-linked immunosorbent assay (ELISA) was used to detect FABP4, fasting serum glucose, fasting insulin (FINS) in maternal serum and FABP4 in umbilical cord blood. Real-time fluorescent quantitative reverse transcription PCR was used to detect placental FABP4 mRNA expression. Furthermore, clinical and biochemical parameters were recorded, such as body mass index (BMI), systolic pressure (SP), diastolic pressure (DP), mean arterial pressure (MAP), total cholesterol (TC), triglyceride (TG), low density lipoprotein (LDL), high density lipoprotein (HDL), creatinine (Cr), uric acid (UA), glomerular filtration rate (GFR), 24 hours urine protein in pregnant women and neonatal weight. (1) Maternal serum FABP4 was (176 ± 9) ng/L in early-onset PE group and (170 ± 9) ng/L in late-onset PE group, significantly elevated as compared to (81 ± 13) ng/L in early control group and (94 ± 15) ng/L in late control group. (2) Mean maternal FINS, homeostasis model of assessment for insulin resistence index (HOMA-IR) were significantly elevated in the early-onset PE group and late-onset PE group as compared to control groups, respectively. (3) Mean placental FABP4 mRNA expression were significantly elevated in the early-onset PE group and late-onset PE group as compared to late control group. However, no significant difference was found in placental FABP4 mRNA expression between early-onset and late-onset PE groups. (4) Mean umbilical cord blood FABP4 concentrations were significantly decreased in the early-onset PE group and late-onset PE group as compared to late control group. Furthermore, umbilical cord blood FABP4 concentration correlated negatively with maternal serum FABP4 level and placental FABP4 mRNA expression, but positively with neonatal weight. (5) Mean maternal serum FABP4 concentrations correlated positively with placental FABP4 mRNA expression, TG, FINS, HOMA-IR, Cr, UA; and negatively with HDL, GFR. Increased FABP4 expression in maternal serum and placenta may be involved in the pathogenesis of preeclampsia. Increased FABP4 mRNA expression in placenta may contribute to high serum FABP4 level in women with PE.

Reduction of liver fructokinase expression and improved hepatic inflammation and metabolism in liquid fructose-fed rats after atorvastatin treatment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vila, Laia; Rebollo, Alba; Adalsteisson, Gunnar S.

Consumption of beverages that contain fructose favors the increasing prevalence of metabolic syndrome alterations in humans, including non-alcoholic fatty liver disease (NAFLD). Although the only effective treatment for NAFLD is caloric restriction and weight loss, existing data show that atorvastatin, a hydroxymethyl-glutaryl-CoA reductase inhibitor, can be used safely in patients with NAFLD and improves hepatic histology. To gain further insight into the molecular mechanisms of atorvastatin's therapeutic effect on NAFLD, we used an experimental model that mimics human consumption of fructose-sweetened beverages. Control, fructose (10% w/v solution) and fructose + atorvastatin (30 mg/kg/day) Sprague-Dawley rats were sacrificed after 14 days.more » Plasma and liver tissue samples were obtained to determine plasma analytes, liver histology, and the expression of liver proteins that are related to fatty acid synthesis and catabolism, and inflammatory processes. Fructose supplementation induced hypertriglyceridemia and hyperleptinemia, hepatic steatosis and necroinflammation, increased the expression of genes related to fatty acid synthesis and decreased fatty acid {beta}-oxidation activity. Atorvastatin treatment completely abolished histological signs of necroinflammation, reducing the hepatic expression of metallothionein-1 and nuclear factor kappa B binding. Furthermore, atorvastatin reduced plasma (x 0.74) and liver triglyceride (x 0.62) concentrations, decreased the liver expression of carbohydrate response element binding protein transcription factor (x0.45) and its target genes, and increased the hepatic activity of the fatty acid {beta}-oxidation system (x 1.15). These effects may be related to the fact that atorvastatin decreased the expression of fructokinase (x 0.6) in livers of fructose-supplemented rats, reducing the metabolic burden on the liver that is imposed by continuous fructose ingestion. - Graphical Abstract: Display Omitted Research Highlights: >Fructose administration as a liquid solution to Sprague-Dawley male rats induced hypertriglyceridemia, hyperleptinemia, hepatic steatosis and necroinflammation. >Atorvastatin administration: >Abolished histological sings of necroinflammation and reduced plasma and liver triglyceride concentrations. >Reduced the expression of phospho-I{kappa}B >Reduced the expression of fructokinase, a key enzyme controlling fructose metabolism« less

Maternal Diabetes Leads to Adaptation in Embryonic Amino Acid Metabolism during Early Pregnancy.

PubMed

Gürke, Jacqueline; Hirche, Frank; Thieme, René; Haucke, Elisa; Schindler, Maria; Stangl, Gabriele I; Fischer, Bernd; Navarrete Santos, Anne

2015-01-01

During pregnancy an adequate amino acid supply is essential for embryo development and fetal growth. We have studied amino acid composition and branched chain amino acid (BCAA) metabolism at day 6 p.c. in diabetic rabbits and blastocysts. In the plasma of diabetic rabbits the concentrations of 12 amino acids were altered in comparison to the controls. Notably, the concentrations of the BCAA leucine, isoleucine and valine were approximately three-fold higher in diabetic rabbits than in the control. In the cavity fluid of blastocysts from diabetic rabbits BCAA concentrations were twice as high as those from controls, indicating a close link between maternal diabetes and embryonic BCAA metabolism. The expression of BCAA oxidizing enzymes and BCAA transporter was analysed in maternal tissues and in blastocysts. The RNA amounts of three oxidizing enzymes, i.e. branched chain aminotransferase 2 (Bcat2), branched chain ketoacid dehydrogenase (Bckdha) and dehydrolipoyl dehydrogenase (Dld), were markedly increased in maternal adipose tissue and decreased in liver and skeletal muscle of diabetic rabbits than in those of controls. Blastocysts of diabetic rabbits revealed a higher Bcat2 mRNA and protein abundance in comparison to control blastocysts. The expression of BCAA transporter LAT1 and LAT2 were unaltered in endometrium of diabetic and healthy rabbits, whereas LAT2 transcripts were increased in blastocysts of diabetic rabbits. In correlation to high embryonic BCAA levels the phosphorylation amount of the nutrient sensor mammalian target of rapamycin (mTOR) was enhanced in blastocysts caused by maternal diabetes. These results demonstrate a direct impact of maternal diabetes on BCAA concentrations and degradation in mammalian blastocysts with influence on embryonic mTOR signalling.

Maternal Diabetes Leads to Adaptation in Embryonic Amino Acid Metabolism during Early Pregnancy

PubMed Central

Gürke, Jacqueline; Hirche, Frank; Thieme, René; Haucke, Elisa; Schindler, Maria; Stangl, Gabriele I.; Fischer, Bernd; Navarrete Santos, Anne

2015-01-01

During pregnancy an adequate amino acid supply is essential for embryo development and fetal growth. We have studied amino acid composition and branched chain amino acid (BCAA) metabolism at day 6 p.c. in diabetic rabbits and blastocysts. In the plasma of diabetic rabbits the concentrations of 12 amino acids were altered in comparison to the controls. Notably, the concentrations of the BCAA leucine, isoleucine and valine were approximately three-fold higher in diabetic rabbits than in the control. In the cavity fluid of blastocysts from diabetic rabbits BCAA concentrations were twice as high as those from controls, indicating a close link between maternal diabetes and embryonic BCAA metabolism. The expression of BCAA oxidizing enzymes and BCAA transporter was analysed in maternal tissues and in blastocysts. The RNA amounts of three oxidizing enzymes, i.e. branched chain aminotransferase 2 (Bcat2), branched chain ketoacid dehydrogenase (Bckdha) and dehydrolipoyl dehydrogenase (Dld), were markedly increased in maternal adipose tissue and decreased in liver and skeletal muscle of diabetic rabbits than in those of controls. Blastocysts of diabetic rabbits revealed a higher Bcat2 mRNA and protein abundance in comparison to control blastocysts. The expression of BCAA transporter LAT1 and LAT2 were unaltered in endometrium of diabetic and healthy rabbits, whereas LAT2 transcripts were increased in blastocysts of diabetic rabbits. In correlation to high embryonic BCAA levels the phosphorylation amount of the nutrient sensor mammalian target of rapamycin (mTOR) was enhanced in blastocysts caused by maternal diabetes. These results demonstrate a direct impact of maternal diabetes on BCAA concentrations and degradation in mammalian blastocysts with influence on embryonic mTOR signalling. PMID:26020623

75 FR 79404 - Controlled Substances: Established Initial Aggregate Production Quotas for 2011

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-20

... quotas for the following controlled substances, expressed in grams of anhydrous acid or base, be... sale) 20,000,000 g Methadone Intermediate 26,000,000 g Methamphetamine 3,130,000 g [750,000 grams of levo-desoxyephedrine for use in a non-controlled, non- prescription product; 2,331,000 grams for...

Prenatal administration of retinoic acid upregulates insulin-like growth factor receptors in the nitrofen-induced hypoplastic lung.

PubMed

Ruttenstock, Elke; Doi, Takashi; Dingemann, Jens; Puri, Prem

2011-04-01

Pulmonary hypoplasia (PH) is the main cause of mortality in newborns with congenital diaphragmatic hernia (CDH). Prenatal administration of retinoic acid (RA) stimulates alveologenesis in the nitrofen-induced pulmonary hypoplasia. Insulin-like growth factor receptors (IGFRs) play a crucial role in alveologenesis during lung development. We recently demonstrated that IGFRs were downregulated in later stages of lung development in the nitrofen CDH model. Several studies suggest the ability of RA to regulate insulin-like growth factor signaling. We hypothesized that IGFRs pulmonary gene expression is upregulated after the administration of RA in the nitrofen-induced CDH model. Pregnant rats were exposed to either olive oil or nitrofen on day 9 (D9) of gestation. RA was given intraperitoneally on days D18, D19, and D20. Fetal lungs were dissected on D21 and divided into control, control + RA, CDH, and CDH + RA group. IGFRs gene and protein expression were determined using RT-PCR and immunohistochemistry. mRNA expression levels of IGFRs were significantly increased in control + RA and CDH + RA compared with CDH group. Immunoreactivity of IGFRs was markedly increased in control + RA and CDH + RA compared with CDH lungs. Upregulation of pulmonary gene and protein expression of IGFRs after prenatal RA treatment in the nitrofen model suggests that RA may promote lung growth by stimulating IGFRs mediated alveologenesis. © 2011 Wiley-Liss, Inc.

Peroxisome proliferator-activated receptor ligands regulate lipid content, metabolism, and composition in fetal lungs of diabetic rats.

PubMed

Kurtz, M; Capobianco, E; Careaga, V; Martinez, N; Mazzucco, M B; Maier, M; Jawerbaum, A

2014-03-01

Maternal diabetes impairs fetal lung development. Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors relevant in lipid homeostasis and lung development. This study aims to evaluate the effect of in vivo activation of PPARs on lipid homeostasis in fetal lungs of diabetic rats. To this end, we studied lipid concentrations, expression of lipid metabolizing enzymes and fatty acid composition in fetal lungs of control and diabetic rats i) after injections of the fetuses with Leukotriene B4 (LTB4, PPARα ligand) or 15deoxyΔ(12,14)prostaglandin J2 (15dPGJ2, PPARγ ligand) and ii) fed during pregnancy with 6% olive oil- or 6% safflower oil-supplemented diets, enriched with PPAR ligands were studied. Maternal diabetes increased triglyceride concentrations and decreased expression of lipid-oxidizing enzymes in fetal lungs of diabetic rats, an expression further decreased by LTB4 and partially restored by 15dPGJ2 in lungs of male fetuses in the diabetic group. In lungs of female fetuses in the diabetic group, maternal diets enriched with olive oil increased triglyceride concentrations and fatty acid synthase expression, while those enriched with safflower oil increased triglyceride concentrations and fatty acid transporter expression. Both olive oil- and safflower oil-supplemented diets decreased cholesterol and cholesteryl ester concentrations and increased the expression of the reverse cholesterol transporter ATP-binding cassette A1 in fetal lungs of female fetuses of diabetic rats. In fetal lungs of control and diabetic rats, the proportion of polyunsaturated fatty acids increased with the maternal diets enriched with olive and safflower oils. Our results revealed important changes in lipid metabolism in fetal lungs of diabetic rats, and in the ability of PPAR ligands to modulate the composition of lipid species relevant in the lung during the perinatal period.

Hepatic SIRT1 attenuates hepatic steatosis and controls energy balance in mice by inducing fibroblast growth factor 21.

PubMed

Li, Yu; Wong, Kimberly; Giles, Amber; Jiang, Jianwei; Lee, Jong Woo; Adams, Andrew C; Kharitonenkov, Alexei; Yang, Qin; Gao, Bin; Guarente, Leonard; Zang, Mengwei

2014-02-01

The hepatocyte-derived hormone fibroblast growth factor 21 (FGF21) is a hormone-like regulator of metabolism. The nicotinamide adenine dinucleotide-dependent deacetylase SIRT1 regulates fatty acid metabolism through multiple nutrient sensors. Hepatic overexpression of SIRT1 reduces steatosis and glucose intolerance in obese mice. We investigated mechanisms by which SIRT1 controls hepatic steatosis in mice. Liver-specific SIRT1 knockout (SIRT1 LKO) mice and their wild-type littermates (controls) were divided into groups that were placed on a normal chow diet, fasted for 24 hours, or fasted for 24 hours and then fed for 6 hours. Liver tissues were collected and analyzed by histologic examination, gene expression profiling, and real-time polymerase chain reaction assays. Human HepG2 cells were incubated with pharmacologic activators of SIRT1 (resveratrol or SRT1720) and mitochondrion oxidation consumption rate and immunoblot analyses were performed. FGF21 was overexpressed in SIRT1 LKO mice using an adenoviral vector. Energy expenditure was assessed by indirect calorimetry. Prolonged fasting induced lipid deposition in livers of control mice, but severe hepatic steatosis in SIRT1 LKO mice. Gene expression analysis showed that fasting up-regulated FGF21 in livers of control mice but not in SIRT1 LKO mice. Decreased hepatic and circulating levels of FGF21 in fasted SIRT1 LKO mice were associated with reduced hepatic expression of genes involved in fatty acid oxidation and ketogenesis, and increased expression of genes that control lipogenesis, compared with fasted control mice. Resveratrol or SRT1720 each increased the transcriptional activity of the FGF21 promoter (-2070/+117) and levels of FGF21 messenger RNA and protein in HepG2 cells. Surprisingly, SIRT1 LKO mice developed late-onset obesity with impaired whole-body energy expenditure. Hepatic overexpression of FGF21 in SIRT1 LKO mice increased the expression of genes that regulate fatty acid oxidation, decreased fasting-induced steatosis, reduced obesity, increased energy expenditure, and promoted browning of white adipose tissue. SIRT1-mediated activation of FGF21 prevents liver steatosis caused by fasting. This hepatocyte-derived endocrine signaling appears to regulate expression of genes that control a brown fat-like program in white adipose tissue, energy expenditure, and adiposity. Strategies to activate SIRT1 or FGF21 could be used to treat fatty liver disease and obesity. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.

BAD-LAMP controls TLR9 trafficking and signalling in human plasmacytoid dendritic cells.

PubMed

Combes, Alexis; Camosseto, Voahirana; N'Guessan, Prudence; Argüello, Rafael J; Mussard, Julie; Caux, Christophe; Bendriss-Vermare, Nathalie; Pierre, Philippe; Gatti, Evelina

2017-10-13

Toll-like receptors (TLR) are essential components of the innate immune system. Several accessory proteins, such as UNC93B1, are required for transport and activation of nucleic acid sensing Toll-like receptors in endosomes. Here, we show that BAD-LAMP (LAMP5) controls TLR9 trafficking to LAMP1 + late endosomes in human plasmacytoid dendritic cells (pDC), leading to NF-κB activation and TNF production upon DNA detection. An inducible VAMP3 +/ LAMP2 +/ LAMP1 - endolysosome compartment exists in pDCs from which TLR9 activation triggers type I interferon expression. BAD-LAMP-silencing enhances TLR9 retention in this compartment and consequent downstream signalling events. Conversely, sustained BAD-LAMP expression in pDCs contributes to their lack of type I interferon production after exposure to a TGF-β-positive microenvironment or isolation from human breast tumours. Hence, BAD-LAMP limits interferon expression in pDCs indirectly, by promoting TLR9 sorting to late endosome compartments at steady state and in response to immunomodulatory cues.TLR9 is highly expressed by plasmacytoid dendritic cells and detects nucleic acids, but to discriminate between host and microbial nucleic acids TLR9 is sorted into different endosomal compartments. Here the authors show that BAD-LAMP limits type 1 interferon responses by sorting TLR9 to late endosomal compartments.

Methods and compositions for controlling gene expression by RNA processing

DOEpatents

Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

2017-08-29

The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

Se metallomics during lactic fermentation of Se-enriched yogurt.

PubMed

Palomo, María; Gutiérrez, Ana M; Pérez-Conde, M Concepción; Cámara, Carmen; Madrid, Yolanda

2014-12-01

Selenium biotransformation by lactic acid bacteria during the preparation of Se-enriched yogurt was evaluated. The study focused on the distribution of selenium in the aqueous soluble protein fraction and the detection of selenoamino acids. Screening of selenium in Tris-buffer-urea soluble fraction was carried out by sodium dodecyl sulphate polyacrylamide gel electrophoresis after pre-fractionating with asymmetric field flow fractionation using inductively coupled plasma-mass spectrometry as the detector. Selenium-containing fractions were identified by peptide mapping using nano LC-ESI/LTQMS. Proteins such as thioredoxin, glutaredoxin, albumin, β-lactoglobulin, and lactoperoxidase were identified in the selenium-containing fraction. All these proteins were detected in both the control and the selenium-enriched yogurt except chaperones, which were only detected in the control samples. Chaperones are heat-shock proteins expressed in response to elevated temperature or other cellular stresses. Selenium may have an effect on chaperones expression in Lactobacillus. For the amino acids analysis, selenocysteine was the primary seleno-containing species. Copyright © 2014 Elsevier Ltd. All rights reserved.

Effective combination treatment of GD2-expressing neuroblastoma and Ewing's sarcoma using anti-GD2 ch14.18/CHO antibody with Vγ9Vδ2+ γδT cells.

PubMed

Fisher, Jonathan P H; Flutter, Barry; Wesemann, Florian; Frosch, Jennifer; Rossig, Claudia; Gustafsson, Kenth; Anderson, John

Gamma delta T lymphocytes (γδT cells) have pleiotropic properties including innate cytotoxicity, which make them attractive effectors for cancer immunotherapy. Combination treatment with zoledronic acid and IL-2 can activate and expand the most common subset of blood γδT, which express the Vγ9Vδ2 T cell receptor (TCR) (Vδ2 T cells). Vγ9Vδ2 T cells are equipped for antibody-dependent cell-mediated cytotoxicity (ADCC) through expression of the low-affinity FcγR CD16. GD2 is a highly ranked tumor associated antigen for immunotherapy due to bright expression on the cell surface, absent expression on normal tissues and availability of therapeutic antibodies with known efficacy in neuroblastoma. To explore the hypothesis that zoledronic acid, IL-2 and anti-GD2 antibodies will synergize in a therapeutic combination, we evaluated in vitro cytotoxicity and tumor growth inhibition in the GD2 expressing cancers neuroblastoma and Ewing's sarcoma. Vδ2 T cells exert ADCC against GD2-expressing Ewing's sarcoma and neuroblastoma cell lines, an effect which correlates with the brightness of GD2 expression. In an immunodeficient mouse model of small established GD2-expressing Ewing's sarcoma or neuroblastoma tumors, the combination of adoptively transferred Vδ2+ T cells, expanded in vitro with zoledronic acid and IL-2, with anti-GD2 antibody ch14.18/CHO, and with systemic zoledronic acid, significantly suppressed tumor growth compared to antibody or γδT cell-free controls. Combination treatment using ch14.18/CHO, zoledronic acid and IL-2 is more effective than their use in isolation. The already-established safety profiles of these agents make testing of the combination in GD2 positive cancers such as neuroblastoma or Ewing's sarcoma both rational and feasible.

Effective combination treatment of GD2-expressing neuroblastoma and Ewing's sarcoma using anti-GD2 ch14.18/CHO antibody with Vγ9Vδ2+ γδT cells

PubMed Central

Fisher, Jonathan P H; Flutter, Barry; Wesemann, Florian; Frosch, Jennifer; Rossig, Claudia; Gustafsson, Kenth; Anderson, John

2016-01-01

Gamma delta T lymphocytes (γδT cells) have pleiotropic properties including innate cytotoxicity, which make them attractive effectors for cancer immunotherapy. Combination treatment with zoledronic acid and IL-2 can activate and expand the most common subset of blood γδT, which express the Vγ9Vδ2 T cell receptor (TCR) (Vδ2 T cells). Vγ9Vδ2 T cells are equipped for antibody-dependent cell-mediated cytotoxicity (ADCC) through expression of the low-affinity FcγR CD16. GD2 is a highly ranked tumor associated antigen for immunotherapy due to bright expression on the cell surface, absent expression on normal tissues and availability of therapeutic antibodies with known efficacy in neuroblastoma. To explore the hypothesis that zoledronic acid, IL-2 and anti-GD2 antibodies will synergize in a therapeutic combination, we evaluated in vitro cytotoxicity and tumor growth inhibition in the GD2 expressing cancers neuroblastoma and Ewing's sarcoma. Vδ2 T cells exert ADCC against GD2-expressing Ewing's sarcoma and neuroblastoma cell lines, an effect which correlates with the brightness of GD2 expression. In an immunodeficient mouse model of small established GD2-expressing Ewing's sarcoma or neuroblastoma tumors, the combination of adoptively transferred Vδ2+ T cells, expanded in vitro with zoledronic acid and IL-2, with anti-GD2 antibody ch14.18/CHO, and with systemic zoledronic acid, significantly suppressed tumor growth compared to antibody or γδT cell-free controls. Combination treatment using ch14.18/CHO, zoledronic acid and IL-2 is more effective than their use in isolation. The already-established safety profiles of these agents make testing of the combination in GD2 positive cancers such as neuroblastoma or Ewing's sarcoma both rational and feasible. PMID:26942051

Cardiac Expression of Microsomal Triglyceride Transfer Protein Is Increased in Obesity and Serves to Attenuate Cardiac Triglyceride Accumulation

PubMed Central

Bartels, Emil D.; Nielsen, Jan M.; Hellgren, Lars I.; Ploug, Thorkil; Nielsen, Lars B.

2009-01-01

Obesity causes lipid accumulation in the heart and may lead to lipotoxic heart disease. Traditionally, the size of the cardiac triglyceride pool is thought to reflect the balance between uptake and β-oxidation of fatty acids. However, triglycerides can also be exported from cardiomyocytes via secretion of apolipoproteinB-containing (apoB) lipoproteins. Lipoprotein formation depends on expression of microsomal triglyceride transfer protein (MTP); the mouse expresses two isoforms of MTP, A and B. Since many aspects of the link between obesity-induced cardiac disease and cardiac lipid metabolism remain unknown, we investigated how cardiac lipoprotein synthesis affects cardiac expression of triglyceride metabolism-controlling genes, insulin sensitivity, and function in obese mice. Heart-specific ablation of MTP-A in mice using Cre-loxP technology impaired upregulation of MTP expression in response to increased fatty acid availability during fasting and fat feeding. This resulted in cardiac triglyceride accumulation but unaffected cardiac insulin-stimulated glucose uptake. Long-term fat-feeding of male C57Bl/6 mice increased cardiac triglycerides, induced cardiac expression of triglyceride metabolism-controlling genes and attenuated heart function. Abolishing cardiac triglyceride accumulation in fat-fed mice by overexpression of an apoB transgene in the heart prevented the induction of triglyceride metabolism-controlling genes and improved heart function. The results suggest that in obesity, the physiological increase of cardiac MTP expression serves to attenuate cardiac triglyceride accumulation albeit without major effects on cardiac insulin sensitivity. Nevertheless, the data suggest that genetically increased lipoprotein secretion prevents development of obesity-induced lipotoxic heart disease. PMID:19390571

Sea Buckthorn Pomace Supplementation in the Diet of Growing Pigs-Effects on Fatty Acid Metabolism, HPA Activity and Immune Status.

PubMed

Dannenberger, Dirk; Tuchscherer, Margret; Nürnberg, Gerd; Schmicke, Marion; Kanitz, Ellen

2018-02-21

There is evidence that sea buckthorn, as a source of n -3 polyunsaturated fatty acids ( n -3 PUFA), possesses health-enhancing properties and may modulate neuroendocrine and immune functions. In the present study, we investigated the effect of sea buckthorn pomace (SBP) supplementation in the diet of growing German Landrace pigs on fatty acids in the blood and hypothalamus, peripheral immune parameters and mRNA expression of corticotropin-releasing hormone (CRH), mineralocorticoid receptor (MR) and glucocorticoid receptor (GR) in the hypothalamus and spleen. Pigs were fed diets supplemented with 12% of dried SBP or 0% SBP (control group) over an intervention period of eight weeks. The fatty acid profiles in blood plasma were significantly affected by SBP supplementation only for C18:2 n -6 and n -6/ n -3 PUFA ratio compared with the control group. SBP supplementation did not significantly affect the fatty acid concentrations in the hypothalamus. Furthermore, there were no significant differences in mRNA expression of CRH, MR and GR in the hypothalamus or of GR mRNA expression in the spleen. Concerning the immune status, the plasma IgG levels tended to be higher in SBP pigs, whereas the leukocyte distribution, mitogen-stimulated lymphocyte proliferation, and serum IgM levels remained unchanged. In conclusion, the SBP supplementation of the diet only caused moderate effects on fatty acid metabolism, but no significant effects on hypothalamic-pituitary-adrenal (HPA) activity and immunity in growing pigs. It seems that a beneficial effect of dietary n -3 PUFA on health and welfare is more likely to be expected during stressful situations.

Sea Buckthorn Pomace Supplementation in the Diet of Growing Pigs—Effects on Fatty Acid Metabolism, HPA Activity and Immune Status

PubMed Central

Dannenberger, Dirk; Tuchscherer, Margret; Nürnberg, Gerd; Kanitz, Ellen

2018-01-01

There is evidence that sea buckthorn, as a source of n-3 polyunsaturated fatty acids (n-3 PUFA), possesses health-enhancing properties and may modulate neuroendocrine and immune functions. In the present study, we investigated the effect of sea buckthorn pomace (SBP) supplementation in the diet of growing German Landrace pigs on fatty acids in the blood and hypothalamus, peripheral immune parameters and mRNA expression of corticotropin-releasing hormone (CRH), mineralocorticoid receptor (MR) and glucocorticoid receptor (GR) in the hypothalamus and spleen. Pigs were fed diets supplemented with 12% of dried SBP or 0% SBP (control group) over an intervention period of eight weeks. The fatty acid profiles in blood plasma were significantly affected by SBP supplementation only for C18:2n-6 and n-6/n-3 PUFA ratio compared with the control group. SBP supplementation did not significantly affect the fatty acid concentrations in the hypothalamus. Furthermore, there were no significant differences in mRNA expression of CRH, MR and GR in the hypothalamus or of GR mRNA expression in the spleen. Concerning the immune status, the plasma IgG levels tended to be higher in SBP pigs, whereas the leukocyte distribution, mitogen-stimulated lymphocyte proliferation, and serum IgM levels remained unchanged. In conclusion, the SBP supplementation of the diet only caused moderate effects on fatty acid metabolism, but no significant effects on hypothalamic–pituitary–adrenal (HPA) activity and immunity in growing pigs. It seems that a beneficial effect of dietary n-3 PUFA on health and welfare is more likely to be expected during stressful situations. PMID:29466282

WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

PubMed Central

Browse, John

2016-01-01

Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

Thyroid hormones increase stomach goblet cell numbers and mucin expression during indomethacin induced ulcer healing in Wistar rats.

PubMed

Namulema, Jackline; Nansunga, Miriam; Kato, Charles Drago; Kalange, Muhammudu; Olaleye, Samuel Babafemi

2018-01-01

Gastric ulcers are mucosal discontinuities that may extend into the mucosa, submucosa or even deeper. They result from an imbalance between mucosal aggressors and protective mechanisms that include the mucus bicarbonate layer. Thyroid hormones have been shown to accelerate gastric ulcer healing in part by increasing the adherent mucus levels. However, the effects of thyroid hormones on goblet cell numbers and expression of neutral and acidic mucins during ulcer healing have not been investigated. Thirty six adult male Wistar rats were randomly divided into six groups each with six animals. Group 1 (normal control) and group 2 (negative control) were given normal saline for eight weeks. Groups 3 and 4 were given 100 μg/kg per day per os of thyroxine so as to induce hyperthyroidism. Groups 5 and 6 received 0.01% ( w / v ) Propylthiouracil (PTU) for 8 weeks so as to induce hypothyroidism. After thyroid hormonal levels were confirmed using radioimmunoassay and immunoradiometric assays, ulcer induction was done using 40 mg/kg intragastric single dose of Indomethacin in groups 2, 3 and 5. Stomachs were extracted after day 3 and 7 of ulcer induction for histological examination. Histochemistry was carried out using Periodic Acid Shiff and Alcian Blue. The number of acidic and neutral goblet cells were determined by counting numbers per field. Mucin expression (%) was determined using Quick Photo Industrial software version 3.1. The numbers of neutral goblet cells (cells/field) increased significantly ( P  < 0.05) in the ulcer+thyroxine (14.67 ± 0.33), thyroxine (17.04 ± 1.71) and ulcer+PTU (12.89 ± 1.06) groups compared to the normal control (10.78 ± 1.07) at day 3. For the acidic goblet cells, differences between treatment groups were more pronounced at day 7 between the ulcer+thyroxine (22.56 ± 1.26) and thyroxine (22.89 ± 0.80). We further showed that percentage expression of both neutral and acidic mucins was significantly higher in the ulcer+thyroxine (9.23 ± 0.17 and 6.57 ± 0.35 respectively) and thyroxine groups (9.66 ± 0.21 and 6.33 ± 0.38 respectively) as compared to the normal control group (4.08 ± 0.20 and 4.38 ± 0.11 respectively) at day 3 after ulcer induction. This study confirms the role played by thyroid hormones in healing of indomethacin induced gastric ulcers. The study further demonstrates increased numbers of both neutral and acidic goblet cells and the increase in expression of both neutral and acidic mucins during healing of indomethacin induced ulcers.

Effect of dietary sunflower oil and coconut oil on adipose tissue gene expression, fatty acid composition and serum lipid profile of grower pigs.

PubMed

Iyer, Mohan N Harihara; Sarmah, Babul C; Tamuli, Madan K; Das, Anubrata; Kalita, Dhireswar

2012-08-01

The present study was conducted to assess whether the partial replacement of feed energy by vegetable oils containing high medium-chain saturated fatty acids (MCFA) and n-6 polyunsaturated fatty acids (PUFA) would modify lipogenic gene expression and other parameter of fat metabolism in pigs. Eighteen pigs (17-19 kg body weight) received one of three experimental diets for 60 days (six animals per group): (i) Control diet; (ii) a diet with sunflower oil (SO) or (iii) a diet with coconut oil (CO). In diets SO and CO, 10% of the feed energy was replaced by the respective oils. The experimental treatment did not influence the performance of the pigs. In blood serum, an increased content of total cholesterol was observed for SO and CO fed animals, whereas no significant changes for total triglycerides and different lipoprotein fractions were detected. The fatty acid composition of adipose tissue was significantly modified, with an increased content of MCFA and n-6 PUFA in CO and SO fed pigs, respectively. The gene expression for fatty acid synthase was decreased for SO and CO fed pigs; for stearoyl CoA desaturase and sterol regulatory element binding protein, a depression was observed in SO but not in CO fed pigs. The results of present study suggest that the type of dietary fat can modulate the adipose tissue gene expression and fatty acid composition differentially, with minimal effect on serum lipid profile.

Exploring metabolic engineering design principles for the photosynthetic production of lactic acid by Synechocystis sp. PCC6803

PubMed Central

2014-01-01

Background Molecular engineering of the intermediary physiology of cyanobacteria has become important for the sustainable production of biofuels and commodity compounds from CO2 and sunlight by “designer microbes.” The chemical commodity product L-lactic acid can be synthesized in one step from a key intermediary metabolite of these organisms, pyruvate, catalyzed by a lactate dehydrogenase. Synthetic biology engineering to make “designer microbes” includes the introduction and overexpression of the product-forming biochemical pathway. For further optimization of product formation, modifications in the surrounding biochemical network of intermediary metabolism have to be made. Results To improve light-driven L-lactic acid production from CO2, we explored several metabolic engineering design principles, using a previously engineered L-lactic acid producing mutant strain of Synechocystis sp. PCC6803 as the benchmark. These strategies included: (i) increasing the expression level of the relevant product-forming enzyme, lactate dehydrogenase (LDH), for example, via expression from a replicative plasmid; (ii) co-expression of a heterologous pyruvate kinase to increase the flux towards pyruvate; and (iii) knockdown of phosphoenolpyruvate carboxylase to decrease the flux through a competing pathway (from phosphoenolpyruvate to oxaloacetate). In addition, we tested selected lactate dehydrogenases, some of which were further optimized through site-directed mutagenesis to improve the enzyme’s affinity for the co-factor nicotinamide adenine dinucleotide phosphate (NADPH). The carbon partitioning between biomass and lactic acid was increased from about 5% to over 50% by strain optimization. Conclusion An efficient photosynthetic microbial cell factory will display a high rate and extent of conversion of substrate (CO2) into product (here: L-lactic acid). In the existing CO2-based cyanobacterial cell factories that have been described in the literature, by far most of the control over product formation resides in the genetically introduced fermentative pathway. Here we show that a strong promoter, in combination with increased gene expression, can take away a significant part of the control of this step in lactic acid production from CO2. Under these premises, modulation of the intracellular precursor, pyruvate, can significantly increase productivity. Additionally, production enhancement is achieved by protein engineering to increase co-factor specificity of the heterologously expressed LDH. PMID:24991233

Linoleic acid causes greater weight gain than saturated fat without hypothalamic inflammation in the male mouse.

PubMed

Mamounis, Kyle J; Yasrebi, Ali; Roepke, Troy A

2017-02-01

A significant change in the Western diet, concurrent with the obesity epidemic, was a substitution of saturated fatty acids with polyunsaturated, specifically linoleic acid (LA). Despite increasing investigation on type as well as amount of fat, it is unclear which fatty acids are most obesogenic. The objective of this study was to determine the obesogenic potency of LA vs. saturated fatty acids and the involvement of hypothalamic inflammation. Forty-eight mice were divided into four groups: low-fat or three high-fat diets (HFDs, 45% kcals from fat) with LA comprising 1%, 15% and 22.5% of kilocalories, the balance being saturated fatty acids. Over 12 weeks, bodyweight, body composition, food intake, calorimetry, and glycemia assays were performed. Arcuate nucleus and blood were collected for mRNA and protein analysis. All HFD-fed mice were heavier and less glucose tolerant than control. The diet with 22.5% LA caused greater bodyweight gain, decreased activity, and insulin resistance compared to control and 1% LA. All HFDs elevated leptin and decreased ghrelin in plasma. Neuropeptides gene expression was higher in 22.5% HFD. The inflammatory gene Ikk was suppressed in 1% and 22.5% LA. No consistent pattern of inflammatory gene expression was observed, with suppression and augmentation of genes by one or all of the HFDs relative to control. These data indicate that, in male mice, LA induces obesity and insulin resistance and reduces activity more than saturated fat, supporting the hypothesis that increased LA intake may be a contributor to the obesity epidemic. Copyright © 2016 Elsevier Inc. All rights reserved.

Barley malt increases hindgut and portal butyric acid, modulates gene expression of gut tight junction proteins and Toll-like receptors in rats fed high-fat diets, but high advanced glycation end-products partially attenuate the effects.

PubMed

Zhong, Yadong; Teixeira, Cristina; Marungruang, Nittaya; Sae-Lim, Watina; Tareke, Eden; Andersson, Roger; Fåk, Frida; Nyman, Margareta

2015-09-01

Barley malt, a product of controlled germination, has been shown to produce high levels of butyric acid in the cecum and portal serum of rats and may therefore have anti-inflammatory effects. The aim of the study was to investigate how four barley malts, caramelized and colored malts, 50-malt and 350-malt, differing in functional characteristics concerning beta-glucan content and color, affect short-chain fatty acids (SCFA), barrier function and inflammation in the hindgut of rats fed high-fat diets. Male Wistar rats were given malt-supplemented high-fat diets for four weeks. Low and high-fat diets containing microcrystalline cellulose were incorporated as controls. All diets contained 70 g kg(-1) dietary fiber. The malt-fed groups were found to have had induced higher amounts of butyric and propionic acids in the hindgut and portal serum compared with controls, while cecal succinic acid only increased to a small extent. Fat increased the mRNA expression of tight junction proteins and Toll-like receptors (TLR) in the small intestine and distal colon of the rats, as well as the concentration of some amino acids in the portal plasma, but malt seemed to counteract these adverse effects to some extent. However, the high content of advanced glycation end-products (AGE) in caramelized malt tended to prohibit the positive effects on occludin in the small intestine and plasma amino acids seen with the other malt products. In conclusion, malting seems to be an interesting process for producing foods with positive health effects, but part of these effects may be destroyed if the malt contains a high content of AGE.

Ascorbic acid deficiency decreases hepatic cytochrome P-450, especially CYP2B1/2B2, and simultaneously induces heme oxygenase-1 gene expression in scurvy-prone ODS rats.

PubMed

Kobayashi, Misato; Hoshinaga, Yukiko; Miura, Natsuko; Tokuda, Yuki; Shigeoka, Shigeru; Murai, Atsushi; Horio, Fumihiko

2014-01-01

The mechanisms underlying the decrease in hepatic cytochrome P-450 (CYP) content in ascorbic acid deficiency was investigated in scurvy-prone ODS rats. First, male ODS rats were fed a diet containing sufficient ascorbic acid (control) or a diet without ascorbic acid (deficient) for 18 days, with or without the intraperitoneal injection of phenobarbital. Ascorbic acid deficiency decreased hepatic microsomal total CYP content, CYP2B1/2B2 protein, and mitochondrial cytochrome oxidase (COX) complex IV subunit I protein, and simultaneously increased heme oxygenase-1 protein in microsomes and mitochondria. Next, heme oxygenase-1 inducers, that is lipopolysaccharide and hemin, were administered to phenobaribital-treated ODS rats fed sufficient ascorbic acid. The administration of these inducers decreased hepatic microsomal total CYP content, CYP2B1/2B2 protein, and mitochondrial COX complex IV subunit I protein. These results suggested that the stimulation of hepatic heme oxygenase-1 expression by ascorbic acid deficiency caused the decrease in CYP content in liver.

REDUCING TOXICITY AND INCREASING EFFICIENCY: ACONITINE WITH LIQUIRITIN AND GLYCYRRHETINIC ACID REGULATE CALCIUM REGULATORY PROTEINS IN RAT MYOCARDIAL CELL

PubMed Central

Zhang, Yuyan; Yu, Li; Jin, Weifeng; Fan, Hongjing; Li, Min; Zhou, Tianmei; Wan, Haitong; Yang, Jiehong

2017-01-01

Background: Compatibility of Radix Aconiti Carmichaeli and Liquorice is known to treat heart diseases such as heart failure and cardiac arrhythmias. This work answers the question that whether the active components (Aconitine, Liquiritin and Glycyrrhetinic Acid) of Radix Aconiti Carmichaeli and Liquorice could result in regulating intracellular calcium homeostasis and calcium cycling, and thereby verifies the therapeutic material basis. Materials and Methods: The myocardial cells were divided into twelve groups randomly as control group, Aconitine group, nine different dose groups that orthogonal combined with Aconitine, Liquiritin and Glycyrrhetinic Acid, and Verapamil group. The myocardial cellular survival rate and morphology were assessed. The expression of calcium regulation protein(RyR2, NCX1, DHPR-a1) in the myocardial cell by Western-blotting. Results: The results exhibited that Aconitine (120 uM) significantly damaged on myocardial cell, decreased the survival rate and expression of Na+/Ca2+ exchangers (NCX1) and dihydropteridine reducta-α1 (DHPR-a1), and increased the expression of ryanodine receptor type2 (RyR2) obviously. The compatibility groups (Aconitine, Liquiritin and Glycyrrhetinic Acid) all could against the damage on the myocardial cell by Aconitine at different levels. Conclusion: Aconitine with Liquiritin and Glycyrrhetinic Acid may regulate the expression of calcium-regulated proteins to protect myocardial cells from damage. PMID:28638869

Roles of PPARγ/NF-κB signaling pathway in the pathogenesis of intrahepatic cholestasis of pregnancy.

PubMed

Zhang, Yan; Hu, Lingqing; Cui, Yan; Qi, Zhigang; Huang, Xiaoping; Cai, Liyi; Zhang, Ting; Yin, Yongxiang; Lu, Zhiyi; Xiang, Jingying

2014-01-01

Intrahepatic cholestasis of pregnancy (ICP) is the most prevalent pregnancy specific liver disease. However, the pathogenesis and etiology of ICP is poorly understood. To assess the expression of peroxisome proliferator-activated receptorγ (PPARγ) and nuclear factor kappa B (NF-κB) in placenta and HTR-8/SVneo cell, and evaluate the serum levels of cytokines, bile acids, hepatic function and lipids in control and ICP patients and the fetal outcome, in order to explore the role of PPARγ/NF-κB signaling pathway in the possible mechanism of ICP. Clinical data of the pregnant women were collected and serum levels of cytokines, bile acids, hepatic function and lipids were measured. Expressions of PPARγ and NF-κB in placenta and HTR-8/SVneo cell were determined. The new-born information was collected to demonstrate the relationship between PPARγ/NF-κB signaling pathway and ICP. The serum levels of bile acids, hepatic function, triglycerides (TG), total cholesterol (TC), IL-6, IL-12 and TNF-α in ICP group were significantly increased (P<0.01), and serum level of IL-4 was significantly decreased (P<0.01). PPARγ and NF-κB staining were found in the membrane and cytoplasm of placental trophoblast cell. The expression of PPARγ and NF-κB were significantly higher in ICP group and taurocholate acid (TCA) treated HTR-8/SVneo cell (P<0.01). The new-born information in severe ICP group were significantly different as compared to that in control group (P<0.05), and part of information in mild ICP group were also difference to that in control group (P<0.05). The higher expressions of PPARγ and NF-κB in ICP placenta and TCA treated HTR-8/SVneo cell, together with the abnormal serum levels of cytokines, might induced by the imbalance of inflammatory and immune reaction, and then disturb placental bile acid and serum lipids transportation, finally result in fatal cholestasis which probably be one of the mechanism of ICP.

[The antagonistic properties of microaerophilic bacteria isolated from the human and mink digestive tracts].

PubMed

Sudenko, V I; Groma, L I; Podgorskiĭ, V S

1996-01-01

Study of antagonistic properties of microaerophilic bacteria isolated from human and mink gastroenteric tract have helped to establish differences in species composition, quantity and level of antagonistic activity of the studied microorganisms in respect to pathogenic microflora. It is shown that lactic acid bacteria identified as Lactobacillus fermentum and L. reuteri prevail among the strains isolated from the stomach and thin intestine of minks kept in the 30-km zone of Chernobyl NPP. Species composition of microaerophilic bacteria isolated from the digestive tract of the control minks is more variable. Antagonistically active bifidobacteria prevail in large intestine of experimental and control animals. Strains of lactic acid bacteria with the expressed antagonistic activity belonging to L. bavaricus, L. reuteri, L. coryniformis and L. maltaromicus have been found parallel with such known producers of antibiotic-like substances as L. fermentum. L. acidophilum. Streptococcus faecalis and bifidobacteria. L. maltaromicus most frequently occurred among antagonistically active strains revealed in feces of people which stayed in the zone of liquidation of the Chernobyl accident. Microaerophilic strains of bacteria (lactic acid, bifidobacteria and enterococci) manifest the expressed antagonistic activity connected with the capacity to not only acid formation but also to accumulation of antibiotic products of unknown nature. A strain of lactic acid bacteria L. fermentum 91 has been isolated from the contents of human gastroenteric tract. These bacteria are distinguished by most expressed and stable antagonism and characterized by the lack of pathogenicity in respect of albino mice that may be used to raise the microorganism resistance to gastric diseases.

Eicosapentaenoic acid prevents arterial calcification in klotho mutant mice.

PubMed

Nakamura, Kazufumi; Miura, Daiji; Saito, Yukihiro; Yunoki, Kei; Koyama, Yasushi; Satoh, Minoru; Kondo, Megumi; Osawa, Kazuhiro; Hatipoglu, Omer F; Miyoshi, Toru; Yoshida, Masashi; Morita, Hiroshi; Ito, Hiroshi

2017-01-01

The klotho gene was identified as an "aging-suppressor" gene that accelerates arterial calcification when disrupted. Serum and vascular klotho levels are reduced in patients with chronic kidney disease, and the reduced levels are associated with arterial calcification. Intake of eicosapentaenoic acid (EPA), an n-3 fatty acid, reduces the risk of fatal coronary artery disease. However, the effects of EPA on arterial calcification have not been fully elucidated. The aim of this study was to determine the effect of EPA on arterial calcification in klotho mutant mice. Four-week-old klotho mutant mice and wild-type (WT) mice were given a diet containing 5% EPA (EPA food, klotho and WT: n = 12, each) or not containing EPA (control food, klotho and WT: n = 12, each) for 4 weeks. Calcium volume scores of thoracic and abdominal aortas assessed by computed tomography were significantly elevated in klotho mice after 4 weeks of control food, but they were not elevated in klotho mice after EPA food or in WT mice. Serum levels of EPA and resolvin E1, an active metabolite of EPA, in EPA food-fed mice were significantly increased compared to those in control food-fed mice. An oxidative stress PCR array followed by quantitative PCR revealed that NADPH oxidase-4 (NOX4), an enzyme that generates superoxide, gene expression was up-regulated in arterial smooth muscle cells (SMCs) of klotho mice. Activity of NOX was also significantly higher in SMCs of klotho mice than in those of WT mice. EPA decreased expression levels of the NOX4 gene and NOX activity. GPR120, a receptor of n-3 fatty acids, gene knockdown by siRNA canceled effects of EPA on NOX4 gene expression and NOX activity in arterial SMCs of klotho mice. EPA prevents arterial calcification together with reduction of NOX gene expression and activity via GPR120 in klotho mutant mice.

Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

PubMed

Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

2016-01-01

Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to milk fat synthesis and lipid droplet formation, only LPIN1 and DGAT1 were upregulated by Ad-nSREBP1. Compared with the Ad-GFP, the cellular triacylglycerol content was higher and the percentage of C16:0 and C18:1 increased, whereas that of C16:1, C18:0, and C18:2 decreased in Ad-nSREBP1 cells. Overall, the data provide strong support for a central role of SREBP1 in the regulation of milk fat synthesis in goat mammary cells. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Effect of dietary fat type on intestinal digestibility of fatty acids, fatty acid profiles of breast meat and abdominal fat, and mRNA expression of lipid-related genes in broiler chickens.

PubMed

Skřivan, Miloš; Marounek, Milan; Englmaierová, Michaela; Čermák, Ladislav; Vlčková, Jana; Skřivanová, Eva

2018-01-01

A group of 240-day-old Ross cockerels were used in a 4-week experiment to assess the effect of the fat type on the intestinal digestibility of fatty acids (FAs), the FA profiles of breast meat and abdominal fat, and the mRNA expression of six hepatic lipid-related genes. Experimental diets were supplemented with rapeseed oil, pork lard or palm oil at 60 g/kg. In the control diet, wheat starch was substituted for the fat source. The highest ileal digestibility of the fat and all FAs (except stearic acid) was observed in chickens fed lard. The content of fat in the breast meat of chickens was not significantly influenced by the fat supplements. The FA profiles of breast meat and abdominal fat reflected the FA composition of the diet. In the meat of chickens fed rapeseed oil, oleic acid was the predominant FA. Palmitic acid was the most abundant FA in the meat of chickens fed lard or palm oil. Oleic acid was the most abundant FA in the abdominal fat of all chickens. The highest mRNA expression of desaturases (Δ5-, Δ6- and Δ9-) was observed in chickens fed palm oil. The mRNA expression of hepatic FA synthase was higher in chickens fed palm oil or lard than in chickens fed rapeseed oil. The expression of HMG-CoA reductase was higher in chickens fed palm oil than in those fed rapeseed oil or lard. It can be concluded that rapeseed oil and lard are better sources of lipids than palm oil. These former two sources contain more digestible fatty acids and provide a lower concentration of SFAs in the meat and fat of chickens.

Effect of dietary fat type on intestinal digestibility of fatty acids, fatty acid profiles of breast meat and abdominal fat, and mRNA expression of lipid-related genes in broiler chickens

PubMed Central

Marounek, Milan; Englmaierová, Michaela; Čermák, Ladislav; Vlčková, Jana; Skřivanová, Eva

2018-01-01

A group of 240-day-old Ross cockerels were used in a 4-week experiment to assess the effect of the fat type on the intestinal digestibility of fatty acids (FAs), the FA profiles of breast meat and abdominal fat, and the mRNA expression of six hepatic lipid-related genes. Experimental diets were supplemented with rapeseed oil, pork lard or palm oil at 60 g/kg. In the control diet, wheat starch was substituted for the fat source. The highest ileal digestibility of the fat and all FAs (except stearic acid) was observed in chickens fed lard. The content of fat in the breast meat of chickens was not significantly influenced by the fat supplements. The FA profiles of breast meat and abdominal fat reflected the FA composition of the diet. In the meat of chickens fed rapeseed oil, oleic acid was the predominant FA. Palmitic acid was the most abundant FA in the meat of chickens fed lard or palm oil. Oleic acid was the most abundant FA in the abdominal fat of all chickens. The highest mRNA expression of desaturases (Δ5-, Δ6- and Δ9-) was observed in chickens fed palm oil. The mRNA expression of hepatic FA synthase was higher in chickens fed palm oil or lard than in chickens fed rapeseed oil. The expression of HMG-CoA reductase was higher in chickens fed palm oil than in those fed rapeseed oil or lard. It can be concluded that rapeseed oil and lard are better sources of lipids than palm oil. These former two sources contain more digestible fatty acids and provide a lower concentration of SFAs in the meat and fat of chickens. PMID:29672634

Folate depletion changes gene expression of fatty acid metabolism, DNA synthesis, and circadian cycle in male mice.

PubMed

Champier, Jacques; Claustrat, Francine; Nazaret, Nicolas; Fèvre Montange, Michelle; Claustrat, Bruno

2012-02-01

Folate is essential for purine and thymidylate biosynthesis and in methyl transfer for DNA methylation. Folate deficiency alters the secretion of melatonin, a hormone involved in circadian rhythm entrainment, and causes hyperhomocysteinemia because of disruption of homocysteine metabolism. Adverse effects of homocysteine include the generation of free radicals, activation of proliferation or apoptosis, and alteration of gene expression. The liver is an important organ for folate metabolism, and its genome analysis has revealed numerous clock-regulated genes. The variations at the level of their expression during folate deficiency are not known. The aim of our study was to investigate the effects of folate deficiency on gene expression in the mouse liver. A control group receiving a synthetic diet and a folate-depleted group were housed for 4 weeks on a 12-hour/12-hour light/dark cycle. Three mice from each group were euthanized under dim red light at the beginning of the light cycle, and 3, at the beginning of the dark period. Gene expression was studied in a microarray analysis. Of the 53 genes showing modified daily expression in the controls, 52 showed a less marked or no difference after folate depletion. Only 1, lpin1, showed a more marked difference. Ten genes coding for proteins involved in lipid metabolism did not show a morning/evening difference in controls but did after folate depletion. This study shows that, in the mouse liver, dietary folate depletion leads to major changes in expression of several genes involved in fatty acid metabolism, DNA synthesis, and expression of circadian genes. Copyright © 2012 Elsevier Inc. All rights reserved.

Gene expression profiles of Arabidopsis Cvi seeds during dormancy cycling indicate a common underlying dormancy control mechanism.

PubMed

Cadman, Cassandra S C; Toorop, Peter E; Hilhorst, Henk W M; Finch-Savage, William E

2006-06-01

Physiologically dormant seeds, like those of Arabidopsis, will cycle through dormant states as seasons change until the environment is favourable for seedling establishment. This phenomenon is widespread in the plant kingdom, but has not been studied at the molecular level. Full-genome microarrays were used for a global transcript analysis of Arabidopsis thaliana (accession Cvi) seeds in a range of dormant and dry after-ripened states during cycling. Principal component analysis of the expression patterns observed showed that they differed in newly imbibed primary dormant seeds, as commonly used in experimental studies, compared with those in the maintained primary and secondary dormant states that exist during cycling. Dormant and after-ripened seeds appear to have equally active although distinct gene expression programmes, dormant seeds having greatly reduced gene expression associated with protein synthesis, potentially controlling the completion of germination. A core set of 442 genes were identified that had higher expression in all dormant states compared with after-ripened states. Abscisic acid (ABA) responsive elements were significantly over-represented in this set of genes the expression of which was enhanced when multiple copies of the elements were present. ABA regulation of dormancy was further supported by expression patterns of key genes in ABA synthesis/catabolism, and dormancy loss in the presence of fluridone. The data support an ABA-gibberelic acid hormone balance mechanism controlling cycling through dormant states that depends on synthetic and catabolic pathways of both hormones. Many of the most highly expressed genes in dormant states were stress-related even in the absence of abiotic stress, indicating that ABA, stress and dormancy responses overlap significantly at the transcriptome level.

[Effect of ferulic acid on cholesterol efflux in macrophage foam cell formation and potential mechanism].

PubMed

Chen, Fu-xin; Wang, Lian-kai

2015-02-01

The formation of macrophage-derived foam cells is a typical feature of atherosclerosis (AS). Reverse cholesterol efflux (RCT) is one of important factors for the formation of macrophage foam cells. In this study, macrophage form cells were induced by oxidized low density lipoprotein (ox-LDL) and then treated with different concentrations of ferulic acid, so as to observe the effect of ferulic acid on the intracellular lipid metabolism in the ox-LDL-induced macrophage foam cell formation, the cholesterol efflux and the mRNA expression and protein levels of ATP binding cassette transporter A1 (ABCA1) and ATP binding cassette transporter G1 (ABCG1) that mediate cholesterol efflux, and discuss the potential mechanism of ferulic acid in resisting AS. According to the findings, compared with the control group, the ox-LDL-treated group showed significant increase in intracellular lipid content, especially for the cholesterol content; whereas the intracellular lipid accumulation markedly decreased, after the treatment with ferulic acid. The data also demonstrated that the mRNA and protein expressions of ABCA1 and ABCG1 significantly increased after macrophage foam cells were treated with different concentrations of ferulic acid. In summary, ferulic acid may show the anti-atherosclerosis effect by increasing the surface ABCA1 and ABCG1 expressions of macrophage form cells and promoting cholesterol efflux.

Involvement of the ornithine decarboxylase gene in acid stress response in probiotic Lactobacillus delbrueckii UFV H2b20.

PubMed

Ferreira, A B; Oliveira, M N V de; Freitas, F S; Paiva, A D; Alfenas-Zerbini, P; Silva, D F da; Queiroz, M V de; Borges, A C; Moraes, C A de

2015-01-01

Amino acid decarboxylation is important for the maintenance of intracellular pH under acid stress. This study aims to carry out phylogenetic and expression analysis by real-time PCR of two genes that encode proteins involved in ornithine decarboxylation in Lactobacillus delbrueckii UFV H2b20 exposed to acid stress. Sequencing and phylogeny analysis of genes encoding ornithine decarboxylase and amino acid permease in L. delbrueckii UFV H2b20 showed their high sequence identity (99%) and grouping with those of L. delbrueckii subsp. bulgaricus ATCC 11842. Exposure of L. delbrueckii UFV H2b20 cells in MRS pH 3.5 for 30 and 60 min caused a significant increase in expression of the gene encoding ornithine decarboxylase (up to 8.1 times higher when compared to the control treatment). Increased expression of the ornithine decarboxylase gene demonstrates its involvement in acid stress response in L. delbrueckii UFV H2b20, evidencing that the protein encoded by that gene could be involved in intracellular pH regulation. The results obtained show ornithine decarboxylation as a possible mechanism of adaptation to an acidic environmental condition, a desirable and necessary characteristic for probiotic cultures and certainly important to the survival and persistence of the L. delbrueckii UFV H2b20 in the human gastrointestinal tract.

Adipose differentiation-related protein regulates lipids and insulin in pancreatic islets

PubMed Central

Faleck, D. M.; Ali, K.; Roat, R.; Graham, M. J.; Crooke, R. M.; Battisti, R.; Garcia, E.; Ahima, R. S.

2010-01-01

The excess accumulation of lipids in islets is thought to contribute to the development of diabetes in obesity by impairing β-cell function. However, lipids also serve a nutrient function in islets, and fatty acids acutely increase insulin secretion. A better understanding of lipid metabolism in islets will shed light on complex effects of lipids on β-cells. Adipose differentiation-related protein (ADFP) is localized on the surface of lipid droplets in a wide range of cells and plays an important role in intracellular lipid metabolism. We found that ADFP was highly expressed in murine β-cells. Moreover, islet ADFP was increased in mice on a high-fat diet (3.5-fold of control) and after fasting (2.5-fold of control), revealing dynamic changes in ADFP in response to metabolic cues. ADFP expression was also increased by addition of fatty acids in human islets. The downregulation of ADFP in MIN6 cells by antisense oligonucleotide (ASO) suppressed the accumulation of triglycerides upon fatty acid loading (56% of control) along with a reduction in the mRNA levels of lipogenic genes such as diacylglycerol O-acyltransferase-2 and fatty acid synthase. Fatty acid uptake, oxidation, and lipolysis were also reduced by downregulation of ADFP. Moreover, the reduction of ADFP impaired the ability of palmitate to increase insulin secretion. These findings demonstrate that ADFP is important in regulation of lipid metabolism and insulin secretion in β-cells. PMID:20484013

Effects of Exogenous Salicylic Acid on Ganoderic Acid Biosynthesis and the Expression of Key Genes in the Ganoderic Acid Biosynthesis Pathway in the Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Agaricomycetes).

PubMed

Cao, Peng-Fei; Wu, Chen-Gao; Dang, Zhi-Hao; Shi, Liang; Jiang, Ai-Liang; Ren, Ang; Zhao, Ming-Wen

2017-01-01

We demonstrate herein that salicylic acid (SA) can enhance ganoderic acid (GA) accumulation in the lingzhi or reishi medicinal mushroom Ganoderma lucidum. Following treatment with different concentrations of SA, the GA content was increased 22.72% to 43.04% compared with the control group. When the fungi were treated with 200 μmol/L SA at different times, the GA content was improved 10.21% to 35.24% compared with the control group. By choosing the optimum point based on response surface methodology, the GA content could be increased up to 229.03 μg/100 mg, which was improved 66.38% compared with the control group. When the fungi were treated with 200 μmol/L SA, the transcription levels of key genes in the GA biosynthesis pathway-squalene (SQ) synthase (sqs), lanosterol (Lano; osc), and hydroxy-3-methylglutaryl-coenzyme A reductase (hmgr)-were improved 119.6-, 3.2-, and 4.2-fold, respectively. In addition, following treatment with 100 μmol/L SA, the levels of Lano and SQ, which are intermediate metabolites of GA biosynthesis, were increased 2.8- and 1.4-fold, respectively. These results indicate that SA can regulate the expression of genes related to GA biosynthesis and increases the metabolic levels of Lano and SQ, thereby resulting in the accumulation of GA.

Induction of Salivary Proteins Modifies Measures of Both Orosensory and Postingestive Feedback during Exposure to a Tannic Acid Diet

PubMed Central

Torregrossa, Ann-Marie; Nikonova, Larissa; Bales, Michelle B.; Villalobos Leal, Maria; Smith, James C.; Contreras, Robert J.; Eckel, Lisa A.

2014-01-01

There are hundreds of proteins in saliva. Although it has long been hypothesized that these proteins modulate taste by interacting with taste receptors or taste stimuli, the functional impact of these proteins on feeding remains relatively unexplored. We have developed a new technique for saliva collection that does not interfere with daily behavioral testing and allows us to explore the relationship between feeding behavior and salivary protein expression. First, we monitored the alterations in salivary protein expression while simultaneously monitoring the animals' feeding behavior and meal patterns on a custom control diet or on the same diet mixed with 3% tannic acid. We demonstrated that six protein bands increased in density with dietary tannic acid exposure. Several of these bands were significantly correlated with behaviors thought to represent both orosensory and postingestive signaling. In a follow-up experiment, unconditioned licking to 0.01–3% tannic acid solutions was measured during a brief-access taste test before and after exposure to the tannic acid diet. In this experiment, rats with salivary proteins upregulated found the tannin solution less aversive (i.e., licked more) than those in the control condition. These data suggest a role for salivary proteins in mediating changes in both orosensory and postingestive feedback. PMID:25162297

Biocompatibility of a bicarbonate-buffered amino-acid-based solution for peritoneal dialysis.

PubMed

Bender, Thorsten O; Witowski, Janusz; Aufricht, Christoph; Endemann, Michaela; Frei, Ulrich; Passlick-Deetjen, Jutta; Jörres, Achim

2008-09-01

Amino-acid-based peritoneal dialysis (PD) fluids have been developed to improve the nutritional status of PD patients. As they may potentially exacerbate acidosis, an amino-acid-containing solution buffered with bicarbonate (Aminobic) has been proposed to effectively maintain acid-base balance. The aim of this study was to evaluate the mesothelial biocompatibility profile of this solution in comparison with a conventional low-glucose-based fluid. Omentum-derived human peritoneal mesothelial cells (HPMC) were preexposed to test PD solutions for up to 120 min, then allowed to recover in control medium for 24 h, and assessed for heat-shock response, viability, and basal and stimulated cytokine [interleukin (IL)-6] and prostaglandin (PGE(2)) release. Acute exposure of HPMC to conventional low-glucose-based PD solution resulted in a time-dependent increase in heat-shock protein (HSP-72) expression, impaired viability, and reduced ability to release IL-6 in response to stimulation. In contrast, in cells treated with Aminobic, the expression of HSP-72 was significantly lower, and viability and cytokine-producing capacity were preserved and did not differ from those seen in control cells. In addition, exposure to Aminobic increased basal release of IL-6 and PGE(2). These data point to a favorable biocompatibility profile of the amino-acid-based bicarbonate-buffered PD solution toward HPMC.

Laccase Gene Expression and Vinasse Biodegradation by Trametes hirsuta Strain Bm-2.

PubMed

Tapia-Tussell, Raúl; Pérez-Brito, Daisy; Torres-Calzada, Claudia; Cortés-Velázquez, Alberto; Alzate-Gaviria, Liliana; Chablé-Villacís, Rubí; Solís-Pereira, Sara

2015-08-19

Vinasse is the dark-colored wastewater that is generated by bioethanol distilleries from feedstock molasses. The vinasse that is generated from molasses contains high amounts of pollutants, including phenolic compounds and melanoindin. The goal of this work was to study the expression of laccase genes in the Trametes hirsuta strain Bm-2, isolated in Yucatan, Mexico, in the presence of phenolic compounds, as well as its effectiveness in removing colorants from vinasse. In the presence of all phenolic compounds tested (guaiacol, ferulic acid, and vanillic acid), increased levels of laccase-encoding mRNA were observed. Transcript levels in the presence of guaiacol were 40 times higher than those in the control. The lcc1 and lcc2 genes of T. hirsuta were differentially expressed; guaiacol and vanillin induced the expression of both genes, whereas ferulic acid only induced the expression of lcc2. The discoloration of vinasse was concomitant with the increase in laccase activity. The highest value of enzyme activity (2543.7 U/mL) was obtained in 10% (v/v) vinasse, which corresponded to a 69.2% increase in discoloration. This study demonstrates the potential of the Bm-2 strain of T. hirsuta for the biodegradation of vinasse.

A natural mutation-led truncation in one of the two aluminum-activated malate transporter-like genes at the Ma locus is associated with low fruit acidity in apple.

PubMed

Bai, Yang; Dougherty, Laura; Li, Mingjun; Fazio, Gennaro; Cheng, Lailiang; Xu, Kenong

2012-08-01

Acidity levels greatly affect the taste and flavor of fruit, and consequently its market value. In mature apple fruit, malic acid is the predominant organic acid. Several studies have confirmed that the major quantitative trait locus Ma largely controls the variation of fruit acidity levels. The Ma locus has recently been defined in a region of 150 kb that contains 44 predicted genes on chromosome 16 in the Golden Delicious genome. In this study, we identified two aluminum-activated malate transporter-like genes, designated Ma1 and Ma2, as strong candidates of Ma by narrowing down the Ma locus to 65-82 kb containing 12-19 predicted genes depending on the haplotypes. The Ma haplotypes were determined by sequencing two bacterial artificial chromosome clones from G.41 (an apple rootstock of genotype Mama) that cover the two distinct haplotypes at the Ma locus. Gene expression profiling in 18 apple germplasm accessions suggested that Ma1 is the major determinant at the Ma locus controlling fruit acidity as Ma1 is expressed at a much higher level than Ma2 and the Ma1 expression is significantly correlated with fruit titratable acidity (R (2) = 0.4543, P = 0.0021). In the coding sequences of low acidity alleles of Ma1 and Ma2, sequence variations at the amino acid level between Golden Delicious and G.41 were not detected. But the alleles for high acidity vary considerably between the two genotypes. The low acidity allele of Ma1, Ma1-1455A, is mainly characterized by a mutation at base 1455 in the open reading frame. The mutation leads to a premature stop codon that truncates the carboxyl terminus of Ma1-1455A by 84 amino acids compared with Ma1-1455G. A survey of 29 apple germplasm accessions using marker CAPS(1455) that targets the SNP(1455) in Ma1 showed that the CAPS(1455A) allele was associated completely with high pH and highly with low titratable acidity, suggesting that the natural mutation-led truncation is most likely responsible for the abolished function of Ma for low pH or high acidity in apple.

Effects of perfluorooctanoic acid (PFOA) on expression of ...

EPA Pesticide Factsheets

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO

Engineering Isoprene Synthase Expression and Activity in Cyanobacteria.

PubMed

Chaves, Julie E; Rueda-Romero, Paloma; Kirst, Henning; Melis, Anastasios

2017-12-15

Efforts to heterologously produce quantities of isoprene hydrocarbons (C 5 H 8 ) renewably from CO 2 and H 2 O through the photosynthesis of cyanobacteria face barriers, including low levels of recombinant enzyme accumulation compounded by their slow innate catalytic activity. The present work sought to alleviate the "expression level" barrier upon placing the isoprene synthase (IspS) enzyme in different fusion configurations with the cpcB protein, the highly expressed β-subunit of phycocyanin. Different cpcB*IspS fusion constructs were made, distinguished by the absence or presence of linker amino acids between the two proteins. Composition of linker amino acids was variable with lengths of 7, 10, 16, and 65 amino acids designed to test for optimal activity of the IspS through spatial positioning between the cpcB and IspS. Results showed that fusion constructs with the highly expressed cpcB gene, as the leader sequence, improved transgene expression in the range of 61 to 275-fold over what was measured with the unfused IspS control. However, the specific activity of the IspS enzyme was attenuated in all fusion transformants, possibly because of allosteric effects exerted by the leader cpcB fusion protein. This inhibition varied depending on the nature of the linker amino acids between the cpcB and IspS proteins. In terms of isoprene production, the results further showed a trade-off between specific activity and transgenic enzyme accumulation. For example, the cpcB*L7*IspS strain showed only about 10% the isoprene synthase specific-activity of the unfused cpcB-IspS control, but it accumulated 254-fold more IspS enzyme. The latter more than countered the slower specific activity and made the cpcB*L7*IspS transformant the best isoprene producing strain in this work. Isoprene to biomass yield ratios improved from 0.2 mg g -1 in the unfused cpcB-IspS control to 5.4 mg g -1 in the cpcB*L7*IspS strain, a 27-fold improvement.

Soy protein diet alters expression of hepatic genes regulating fatty acid and thyroid hormone metabolism in the male rat

USDA-ARS?s Scientific Manuscript database

We determined effects of soy protein (SPI) and the isoflavone genistein (GEN) on mRNA expression of key lipid metabolism and thyroid hormone system genes in young adult, male Sprague-Dawley rats. SPI-fed rats had less retroperitoneal fat and less hepato-steatosis than casein (CAS, control protein)-...

Differential regulation of preprotachykinin-A mRNA expression in striatum by excitation of hippocampal neurons.

PubMed

Brené, S; Lindefors, N; Herrera-Marschitz, M; Persson, H

1993-07-01

In this report we have studied the influence of hippocampal neurons on neuropeptide mRNA expression in both dorsal and ventral striatum in the rat. Intrahippocampal unilateral kainic acid injections were performed in control animals and in animals with a unilateral 6-hydroxydopamine-induced dopamine deafferentation of the striatum. In situ hybridization combined with quantitative image analysis was used to study the expression of preprotachykinin A mRNA encoding the neuropeptides substance P and neurokinin A. The 6-hydroxydopamine-induced lesion caused a decrease of preprotachykinin A mRNA levels in the ipsilateral dorsal striatum and in both sides of the ventral striatum. In normal rats, the intrahippocampal kainic acid injection caused a twofold increase in preprotachykinin A mRNA in the limbic parts of the striatum, which are innervated by the hippocampus. No effect of the kainic acid injection was seen in the lateral parts of the dorsal striatum, a region which does not appear to be innervated by the hippocampus. Animals with a 6-hydroxydopamine lesion showed a similar kainic acid-mediated increase in preprotachykinin A mRNA in parts of the ventral striatum. In the dopamine-lesioned dorsal striatum and ventral striatum the decreased preprotachykinin A mRNA levels were normalized by the intrahippocampal kainic acid injection. These results show that kainic acid-mediated excitation of hippocampal neurons causes a dopamine-independent induction of preprotachykinin A mRNA expression in parts of the ventral striatum, and reverses the dopamine deafferentation-induced decrease of preprotachykinin A mRNA in both dorsal and ventral striatum. Combined, our results suggest that hippocampal neurons can regulate preprotachykinin A mRNA expression in both the ventral and the dorsal striatum.

Development of high-lysine rice via endosperm-specific expression of a foreign LYSINE RICH PROTEIN gene.

PubMed

Liu, Xin; Zhang, Cuicui; Wang, Xiurong; Liu, Qiaoquan; Yuan, Dingyang; Pan, Gang; Sun, Samuel S M; Tu, Jumin

2016-06-29

Lysine (Lys) is considered to be the first limiting essential amino acid in rice. Although there have been extensive efforts to improve the Lys content of rice through traditional breeding and genetic engineering, no satisfactory products have been achieved to date. We expressed a LYSINE-RICH PROTEIN gene (LRP) from Psophocarpus tetragonolobus (L.) DC using an endosperm-specific GLUTELIN1 promoter (GT1) in Peiai64S (PA64S), an elite photoperiod-thermo sensitive male sterility (PTSMS) line. The expression of the foreign LRP protein was confirmed by Western blot analysis. The Lys level in the transgenic rice seeds increased more than 30 %, the total amount of other amino acids also increased compared to wild-type. Persistent investigation of amino acids in 3 generations showed that the Lys content was significantly increased in seeds of transgenic rice. Furthermore, Lys content in the hybrid of the transgenic plants also had an approximate 20 % increase compared to hybrid control. At the grain-filling stage, we monitored the transcript abundance of many genes encoding key enzymes involved in amino acid metabolism, and the results suggested that reduced amino acid catabolism led to the accumulation of amino acids in the transgenic plants. The genetically engineered rice showed unfavorable grain phenotypes compared to wild-type, however, its hybrid displayed little negative effects on grain. Endosperm-specific expression of foreign LRP significantly increased the Lys content in the seeds of transgenic plant, and the the Lys increase was stably heritable with 3 generation investigation. The hybrid of the transgenic plants also showed significant increases of Lys content in the seeds. These results indicated that expression of LRP in rice seeds may have promising applications in improving Lys levels in rice.

Molecular cloning and characterization of genistein 4'-O-glucoside specific glycosyltransferase from Bacopa monniera.

PubMed

Ruby; Santosh Kumar, R J; Vishwakarma, Rishi K; Singh, Somesh; Khan, Bashir M

2014-07-01

Health related benefits of isoflavones such as genistein are well known. Glycosylation of genistein yields different glycosides like genistein 7-O-glycoside (genistin) and genistein 4'-O-glycoside (sophoricoside). This is the first report on isolation, cloning and functional characterization of a glycosyltransferase specific for genistein 4'-O-glucoside from Bacopa monniera, an important Indian medicinal herb. The glycosyltransferase from B. monniera (UGT74W1) showed 49% identity at amino acid level with the glycosyltransferases from Lycium barbarum. The UGT74W1 sequence contained all the conserved motifs present in plant glycosyltransferases. UGT74W1 was cloned in pET-30b (+) expression vector and transformed into E. coli. The molecular mass of over expressed protein was found to be around 52 kDa. Functional characterization of the enzyme was performed using different substrates. Product analysis was done using LC-MS and HPLC, which confirmed its specificity for genistein 4'-O-glucoside. Immuno-localization studies of the UGT74W1 showed its localization in the vascular bundle. Spatio-temporal expression studies under normal and stressed conditions were also performed. The control B. monniera plant showed maximum expression of UGT74W1 in leaves followed by roots and stem. Salicylic acid treatment causes almost tenfold increase in UGT74W1 expression in roots, while leaves and stem showed decrease in expression. Since salicylic acid is generated at the time of injury or wound caused by pathogens, this increase in UGT74W1 expression under salicylic acid stress might point towards its role in defense mechanism.

Phenolic compounds increase the transcription of mouse intestinal maltase-glucoamylase and sucrase-isomaltase.

PubMed

Simsek, Meric; Quezada-Calvillo, Roberto; Nichols, Buford L; Hamaker, Bruce R

2017-05-24

Diverse natural phenolic compounds show inhibition activity of intestinal α-glucosidases, which may constitute the molecular basis for their ability to control systemic glycemia. Additionally, phenolics can modify mRNA expression for proteins involved in nutritional, metabolic or immune processes. To explore the possibility that phenolics can regulate the mRNA expression, enzymatic activity, and protein synthesis/processing of intestinal Maltase-Glucoamylase (MGAM) and Sucrase-Isomaltase (SI), small intestinal explants from Balb/c mice were cultured for 24 h in the presence or absence of gallic acid, caffeic acid, and (+)-catechin at 0.1, 0.5, and 1 mM. We measured the levels of MGAM and SI mRNA expression by qRT-PCR, maltase and sucrase activities by a standard colorimetric method and the molecular size distribution of MGAM and SI proteins by western blotting. mRNA expression for MGAM was induced by the three phenolic compounds at 0.1 mM. mRNA expression for SI was induced by caffeic and gallic acids, but not by (+)-catechin. Caffeic acid was the most effective inducer of mRNA expression of these enzymes. Total maltase and sucrase activities were not affected by treatment with phenolics. The proportion of high molecular size forms of MGAM was significantly increased by two of the three phenolic compounds, but little effect was observed on SI proteins. Thus, changes in the protein synthesis/processing, affecting the proportions of the different molecular forms of MGAM, may account for the lack of correlation between mRNA expression and enzymatic activity.

Downregulated Kynurenine 3-Monooxygenase Gene Expression and Enzyme Activity in Schizophrenia and Genetic Association With Schizophrenia Endophenotypes

PubMed Central

Wonodi, Ikwunga; Stine, O. Colin; Sathyasaikumar, Korrapati V.; Roberts, Rosalinda C.; Mitchell, Braxton D.; Hong, L. Elliot; Kajii, Yasushi; Thaker, Gunvant K.; Schwarcz, Robert

2013-01-01

Context Kynurenic acid, a metabolite of the kynurenine pathway of tryptophan degradation, is an antagonist at N-methyl-d-aspartate and α7 nicotinic acetylcholine receptors and modulates glutamate, dopamine, and acetylcholine signaling. Cortical kynurenic acid concentrations are elevated in the brain and cerebrospinal fluid of schizophrenia patients. The proximal cause may be an impairment of kynurenine 3-monooxygenase (KMO), a rate-limiting enzyme at the branching point of the kynurenine pathway. Objectives To examine KMO messenger RNA expression and KMO enzyme activity in postmortem tissue from the frontal eye field (FEF; Brodmann area 6) obtained from schizophrenia individuals compared with healthy control individuals and to explore the relationship between KMO single-nucleotide polymorphisms and schizophrenia oculomotor endophenotypes. Design Case-control postmortem and clinical study. Setting Maryland Brain Collection, outpatient clinics. Participants Postmortem specimens from schizophrenia patients (n=32) and control donors (n=32) and a clinical sample of schizophrenia patients (n=248) and healthy controls (n=228). Main Outcome Measures Comparison of quantitative KMO messenger RNA expression and KMO enzyme activity in postmortem FEF tissue between schizophrenia patients and controls and association of KMO single-nucleotide polymorphisms with messenger RNA expression in postmortem FEF and schizophrenia and oculomotor endophenotypes (ie, smooth pursuit eye movements and oculomotor delayed response). Results In postmortem tissue, we found a significant and correlated reduction in KMO gene expression and KMO enzyme activity in the FEF in schizophrenia patients. In the clinical sample, KMO rs2275163 was not associated with a diagnosis of schizophrenia but showed modest effects on predictive pursuit and visuospatial working memory endophenotypes. Conclusion Our results provide converging lines of evidence implicating reduced KMO activity in the etiopathophysiology of schizophrenia and related neurocognitive deficits. PMID:21727251

Downregulated kynurenine 3-monooxygenase gene expression and enzyme activity in schizophrenia and genetic association with schizophrenia endophenotypes.

PubMed

Wonodi, Ikwunga; Stine, O Colin; Sathyasaikumar, Korrapati V; Roberts, Rosalinda C; Mitchell, Braxton D; Hong, L Elliot; Kajii, Yasushi; Thaker, Gunvant K; Schwarcz, Robert

2011-07-01

Kynurenic acid, a metabolite of the kynurenine pathway of tryptophan degradation, is an antagonist at N-methyl-d-aspartate and α7 nicotinic acetylcholine receptors and modulates glutamate, dopamine, and acetylcholine signaling. Cortical kynurenic acid concentrations are elevated in the brain and cerebrospinal fluid of schizophrenia patients. The proximal cause may be an impairment of kynurenine 3-monooxygenase (KMO), a rate-limiting enzyme at the branching point of the kynurenine pathway. To examine KMO messenger RNA expression and KMO enzyme activity in postmortem tissue from the frontal eye field (FEF; Brodmann area 6) obtained from schizophrenia individuals compared with healthy control individuals and to explore the relationship between KMO single-nucleotide polymorphisms and schizophrenia oculomotor endophenotypes. Case-control postmortem and clinical study. Maryland Brain Collection, outpatient clinics. Postmortem specimens from schizophrenia patients (n = 32) and control donors (n = 32) and a clinical sample of schizophrenia patients (n = 248) and healthy controls (n = 228). Comparison of quantitative KMO messenger RNA expression and KMO enzyme activity in postmortem FEF tissue between schizophrenia patients and controls and association of KMO single-nucleotide polymorphisms with messenger RNA expression in postmortem FEF and schizophrenia and oculomotor endophenotypes (ie, smooth pursuit eye movements and oculomotor delayed response). In postmortem tissue, we found a significant and correlated reduction in KMO gene expression and KMO enzyme activity in the FEF in schizophrenia patients. In the clinical sample, KMO rs2275163 was not associated with a diagnosis of schizophrenia but showed modest effects on predictive pursuit and visuospatial working memory endophenotypes. Our results provide converging lines of evidence implicating reduced KMO activity in the etiopathophysiology of schizophrenia and related neurocognitive deficits.

The Polyunsaturated Fatty Acids Arachidonic Acid and Docosahexaenoic Acid Induce Mouse Dendritic Cells Maturation but Reduce T-Cell Responses In Vitro

PubMed Central

Carlsson, Johan A.; Wold, Agnes E.; Sandberg, Ann-Sofie; Östman, Sofia M.

2015-01-01

Long-chain polyunsaturated fatty acids (PUFAs) might regulate T-cell activation and lineage commitment. Here, we measured the effects of omega-3 (n-3), n-6 and n-9 fatty acids on the interaction between dendritic cells (DCs) and naïve T cells. Spleen DCs from BALB/c mice were cultured in vitro with ovalbumin (OVA) with 50 μM fatty acids; α-linolenic acid, arachidonic acid (AA), eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), linoleic acid or oleic acid and thereafter OVA-specific DO11.10 T cells were added to the cultures. Fatty acids were taken up by the DCs, as shown by gas chromatography analysis. After culture with arachidonic acid or DHA CD11c+ CD11b+ and CD11c+ CD11bneg DCs expressed more CD40, CD80, CD83, CD86 and PDL-1, while IAd remained unchanged. However, fewer T cells co-cultured with these DCs proliferated (CellTrace Violetlow) and expressed CD69 or CD25, while more were necrotic (7AAD+). We noted an increased proportion of T cells with a regulatory T cell (Treg) phenotype, i.e., when gating on CD4+ FoxP3+ CTLA-4+, CD4+ FoxP3+ Helios+ or CD4+ FoxP3+ PD-1+, in co-cultures with arachidonic acid- or DHA-primed DCs relative to control cultures. The proportion of putative Tregs was inversely correlated to T-cell proliferation, indicating a suppressive function of these cells. With arachidonic acid DCs produced higher levels of prostaglandin E2 while T cells produced lower amounts of IL-10 and IFNγ. In conclusion arachidonic acid and DHA induced up-regulation of activation markers on DCs. However arachidonic acid- and DHA-primed DCs reduced T-cell proliferation and increased the proportion of T cells expressing FoxP3, indicating that these fatty acids can promote induction of regulatory T cells. PMID:26619195

A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

PubMed

Kück, Ulrich

2005-10-01

Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

γEpithelial Na(+) Channel (γENaC) and the Acid-Sensing Ion Channel 1 (ASIC1) expression in the urothelium of patients with neurogenic detrusor overactivity.

PubMed

Traini, Chiara; Del Popolo, Giulio; Lazzeri, Massimo; Mazzaferro, Katia; Nelli, Federico; Calosi, Laura; Vannucchi, Maria Giuliana

2015-11-01

To investigate the expression of two types of cation channels, γEpithelial Na(+) Channel (γENaC) and the Acid-Sensing Ion Channel 1 (ASIC1), in the urothelium of controls and in patients affected by neurogenic detrusor overactivity (NDO). In parallel, urodynamic parameters were collected and correlated to the immunohistochemical results. Four controls and 12 patients with a clinical diagnosis of NDO and suprasacral spinal cord lesion underwent urodynamic measurements and cystoscopy. Cold-cup biopsies were frozen and processed for immunohistochemistry and Western Blot. Spearman's correlation coefficient between morphological and urodynamic data was applied. One-way anova followed by Newman-Keuls multiple comparison post hoc test was applied for Western Blot results. In the controls, γENaC and ASIC1 were expressed in the urothelium with differences in their cell distribution and intensity. In patients with NDO, both markers showed consistent changes either in cell distribution and labelling intensity compared with the controls. A significant correlation between a higher intensity of γENaC expression in the urothelium of patients with NDO and lower values of bladder compliance was detected. The present findings show important changes in the expression of γENaC and ASIC1 in NDO human urothelium. Notably, while the changes in γENaC might impair the mechanosensory function of the urothelium, the increase of ASIC1 might represent an attempt to compensate for the excess in local sensitivity. © 2014 The Authors BJU International © 2014 BJU International Published by John Wiley & Sons Ltd.

Changes in cardiac energy metabolic pathways in overweighed rats fed a high-fat diet.

PubMed

Modrego, Javier; de las Heras, Natalia; Zamorano-León, Jose J; Mateos-Cáceres, Petra J; Martín-Fernández, Beatriz; Valero-Muñoz, Maria; Lahera, Vicente; López-Farré, Antonio J

2013-03-01

Heart produces ATP through long-chain fatty acids beta oxidation. To analyze whether in ventricular myocardium, high-fat diet may modify the expression of proteins associated with energy metabolism before myocardial function was affected. Wistar Kyoto rats were divided into two groups: (a) rats fed standard diet (control; n = 6) and (b) rats fed high-fat diet (HFD; n = 6). Proteins from left ventricles were analyzed by two-dimensional electrophoresis, mass spectrometry and Western blotting. Rats fed with HFD showed higher body weight, insulin, glucose, leptin and total cholesterol plasma levels as compared with those fed with standard diet. However, myocardial functional parameters were not different between them. The protein expression of 3-ketoacyl-CoA thiolase, acyl-CoA hydrolase mitochondrial precursor and enoyl-CoA hydratase, three long-chain fatty acid β-oxidation-related enzymes, and carnitine-O-palmitoyltransferase I was significantly higher in left ventricles from HFD rats. Protein expression of triosephosphate isomerase was higher in left ventricles from HFD rats than in those from control. Two α/β-enolase isotypes and glyceraldehyde-3-phosphate isomerase were significantly increased in HFD rats as compared with control. Pyruvate and lactate contents were similar in HFD and control groups. Expression of proteins associated with Krebs cycle and mitochondrial oxidative phosphorylation was higher in HFD rats. Expression of proteins involved in left ventricle metabolic energy was enhanced before myocardial functionality was affected in rats fed with HFD. These findings may probably indicate higher cardiac energy requirement due to weight increase by HFD.

Changes in fatty acid composition in plant tissues expressing a mammalian delta9 desaturase.

PubMed

Moon, H; Hazebroek, J; Hildebrand, D F

2000-05-01

Plant tissues expressing a mammalian stearoyl-CoA delta9 desaturase were reported to accumulate delta9 hexadecenoic acid (16:1), normally very minor in most plant tissues. The transgenic plants were thoroughly analyzed for alterations of individual lipids in different subcellular sites. Western blot analysis indicated that the animal desaturase was targeted to the microsomes. The delta9 16:1 was incorporated into both the sn-1 and sn-2 positions of all the major membrane lipids tested, indicating that the endoplasmic reticulum acyltransferases do not exclude unsaturated C16 fatty acids from the sn-2 position. In addition to increases in monounsaturated and decreases in saturated fatty acids, accumulation of 16:1 was accompanied by a reduction in 18:3 in all the lipids tested except phosphatidylglycerol, and increases in 18:2 in phospholipids. Total C16 fatty acid content in the galactolipids of the transgenics was significantly higher than that in the control, but those in the phospholipids were unchanged. In transgenics, delta11 18:1 was detected in the sn-1 position of the lipids tested except phosphatidylinositol and phosphatidylserine. Introduction of the animal desaturase, controlled by a seed-specific phaseolin promoter, into soybean somatic embryo resulted in a significant reduction in saturated fatty acids. Such effects were greater in cotyledons than hypocotyl-radicles. This study demonstrated that the animal desaturase can be used to decrease the levels of saturated fatty acids in a crop plant.

Inhibition of l-type amino acid transporter 1 activity as a new therapeutic target for cholangiocarcinoma treatment.

PubMed

Yothaisong, Supak; Dokduang, Hasaya; Anzai, Naohiko; Hayashi, Keitaro; Namwat, Nisana; Yongvanit, Puangrat; Sangkhamanon, Sakkarn; Jutabha, Promsuk; Endou, Hitoshi; Loilome, Watcharin

2017-03-01

Unlike normal cells, cancer cells undergo unlimited growth and multiplication, causing them to require massive amounts of amino acid to support their continuous metabolism. Among the amino acid transporters expressed on the plasma membrane, l-type amino acid transporter-1, a Na + -independent neutral amino acid transporter, is highly expressed in many types of human cancer including cholangiocarcinoma. Our previous study reported that l-type amino acid transporter-1 and its co-functional protein CD98 were highly expressed and implicated in cholangiocarcinoma progression and carcinogenesis. Therefore, this study determined the effect of JPH203, a selective inhibitor of l-type amino acid transporter-1 activity, on cholangiocarcinoma cell inhibition both in vitro and in vivo. JPH203 dramatically suppressed [ 14 C]l-leucine uptake as well as cell growth in cholangiocarcinoma cell lines along with altering the expression of l-type amino acid transporter-1 and CD98 in response to amino acid depletion. We also demonstrated that JPH203 induced both G2/M and G0/G1 cell cycle arrest, as well as reduced the S phase accompanied by altered expression of the proteins in cell cycle progression: cyclin D1, CDK4, and CDK6. There was also cell cycle arrest of the related proteins, P21 and P27, in KKU-055 and KKU-213 cholangiocarcinoma cells. Apoptosis induction, detected by an increase in trypan blue-stained cells along with a cleaved caspase-3/caspase-3 ratio, occurred in JPH203-treated cholangiocarcinoma cells at the highest concentration tested (100 µM). As expected, daily intravenous administration of JPH203 (12.5 and 25 mg/kg) significantly inhibited tumor growth in KKU-213 cholangiocarcinoma cell xenografts in the nude mice model in a dose-dependent manner with no statistically significant change in the animal's body weight and with no differences in the histology and appearance of the internal organs compared with the control group. Our study demonstrates that suppression of l-type amino acid transporter-1 activity using JPH203 might be used as a new therapeutic strategy for cholangiocarcinoma treatment.

Uric acid upregulates the adiponectin-adiponectin receptor 1 pathway in renal proximal tubule epithelial cells

PubMed Central

Yang, Qingmei; Fu, Chensheng; Xiao, Jing; Ye, Zhibin

2018-01-01

Adiponectin (APN) is a protein hormone that is primarily derived from adipocytes. It can also be secreted by renal cells. Hypoadiponectinemia has been documented in patients with hyperuricemia, however, whether soluble uric acid (SUA) regulates the expression of APN and APN receptor 1 (AdipoR1) in renal proximal tubule epithelial cells (PTECs) remains to be elucidated. The present study investigated the expression of APN and AdipoR1 in cultured PTECs that were exposed to SUA through immunofluorescence and western blot analysis. In addition, Sprague-Dawley rats with oxonic acid-induced hyperuricemia (HUA) with or without febuxostat treatment were employed as an animal model to measure 24 h urine protein, serum creatinine, urea nitrogen, uric acid and homeostasis model assessment of insulin resistance. Renal pathology was evaluated using hematoxylin and eosin and immunohistochemical staining. APN and AdipoR1 expression in the renal cortex were evaluated by western blotting. The results demonstrated that, in PTECs, the expression of APN and AdipoR1 was constant and increased upon SUA exposure. Similar observations were made within the proximal renal tubules of rats, and the oxonic acid-induced increases in APN and AdipoR1 were offset by febuxostat treatment. Furthermore, SUA-treated PTECs exhibited an increase in the expression of NLR family pyrin domain-containing (NLRP) 3, which was dose-dependent. NLRP3 expression was also significantly increased in the renal cortex of HUA rats compared with control and febuxostat-treated rats. In conclusion, SUA enhanced the expression of APN and AdipoR1 in PTECs, which was associated with an increase in NLRP3 expression. The APN-AdipoR1 pathway was demonstrated to have an important role in in vitro and in vivo models of renal proximal tubule inflammatory injury. Therefore, this pathway may be a potential therapy target in urate nephropathy. PMID:29359786

Regulation of xanthine dehydrogensase gene expression and uric acid production in human airway epithelial cells

PubMed Central

Huff, Ryan D.; Hsu, Alan C-Y.; Nichol, Kristy S.; Jones, Bernadette; Knight, Darryl A.; Wark, Peter A. B.; Hansbro, Philip M.

2017-01-01

Introduction The airway epithelium is a physical and immunological barrier that protects the pulmonary system from inhaled environmental insults. Uric acid has been detected in the respiratory tract and can function as an antioxidant or damage associated molecular pattern. We have demonstrated that human airway epithelial cells are a source of uric acid. Our hypothesis is that uric acid production by airway epithelial cells is induced by environmental stimuli associated with chronic respiratory diseases. We therefore examined how airway epithelial cells regulate uric acid production. Materials and methods Allergen and cigarette smoke mouse models were performed using house dust mite (HDM) and cigarette smoke exposure, respectively, with outcome measurements of lung uric acid levels. Primary human airway epithelial cells isolated from clinically diagnosed patients with asthma and chronic obstructive pulmonary disease (COPD) were grown in submerged cultures and compared to age-matched healthy controls for uric acid release. HBEC-6KT cells, a human airway epithelial cell line, were grown under submerged monolayer conditions for mechanistic and gene expression studies. Results HDM, but not cigarette smoke exposure, stimulated uric acid production in vivo and in vitro. Primary human airway epithelial cells from asthma, but not COPD patients, displayed elevated levels of extracellular uric acid in culture. In HBEC-6KT, production of uric acid was sensitive to the xanthine dehydrogenase (XDH) inhibitor, allopurinol, and the ATP Binding Cassette C4 (ABCC4) inhibitor, MK-571. Lastly, the pro-inflammatory cytokine combination of TNF-α and IFN-γ elevated extracellular uric acid levels and XDH gene expression in HBEC-6KT cells. Conclusions Our results suggest that the active production of uric acid from human airway epithelial cells may be intrinsically altered in asthma and be further induced by pro-inflammatory cytokines. PMID:28863172

Feeding steam-pelleted rapeseed affects expression of genes involved in hepatic lipid metabolism and fatty acid composition of chicken meat.

PubMed

Li, S; Vestergren, A Schiller; Wall, H; Trattner, S; Pickova, J; Ivarsson, E

2017-08-01

This study investigated the dietary effect of steam-pelleted rapeseed (RS) diets with different inclusion levels on the fatty acid composition of chicken meat and the expression of lipid metabolism-related genes in the liver. Experimental diets included 6 different wheat-soybean meal based diets either in nonpelleted or steam-pelleted form supplemented with 80, 160, and 240 g RS/kg feed and one nonpelleted wheat-soybean meal based diet without RS supplementation as the control. These diets were fed to newly hatched broiler chickens (Ross 308) for 34 days. Compared to the control diet, steam-pelleted diets containing 160 or 240 g/kg RS significantly increased the content of omega-3 long chain polyunsaturated fatty acids (n-3 LC-PUFA) in the breast and drumstick, while their meat yields were not affected. Moreover, the mRNA levels of fatty acid desaturase 1 (FADS1) and acyl-coenzyme A oxidase 1 (ACOX1) in their livers increased. Therefore, steam-pelleted diets with 160 or 240 g/kg RS can be used to increase the n-3 LC-PUFA content in chicken meat without compromising meat yield. © 2017 Poultry Science Association Inc.

Stereoselective bioaccumulation of chiral PCB 91 in earthworm and its metabolomic and lipidomic responses.

PubMed

He, Zeying; Wang, Yuehua; Zhang, Yanwei; Cheng, Haiyan; Liu, Xiaowei

2018-07-01

Stereoselective bioaccumulation, elimination, metabolomic and lipidomic responses of earthworm Eisenia fetida exposed to chiral polychlorinated biphenyl (PCB) 91 in an earthworm-soil system were investigated. Preferential bioaccumulation of (-)-PCB 91 and elimination of (+)-PCB 91 were observed following 50 and 500 μg/kg dwt exposures. Enantiomer fraction (EF) values decreased over time during the uptake and elimination periods. Metabolomics and lipidomics techniques based on ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry (UPLC-QTOF-MS) revealed significant changes in 108 metabolites after earthworms exposure to (+)-, (-)-, and (±)-PCB 91, compared to control groups. Forty two of these metabolites were identified as amino acids, nucleosides, fatty acids, dicarboxylic acids, vitamins or others. Lysophospholipids including six lysophosphatidylcholines (LPC), six lysophosphatidylethanolamine (LPE), eight lysophosphatidylinositol (LPI) and five lysophosphatidylserine (LPS) were also differentially expressed between exposure and control groups. Alterations in the levels of metabolites and lipids indicated stereoselective effects of chiral PCB 91 on earthworm amino acid, energy, and nucleotide metabolism, neurodevelopment and gene expression. Overall, the effects of (+)-PCB 91 were more pronounced than that of (-)- and (±)-PCB 91. Copyright © 2018 Elsevier Ltd. All rights reserved.

AtMYB44 regulates WRKY70 expression and modulates antagonistic interaction between salicylic acid and jasmonic acid signaling.

PubMed

Shim, Jae Sung; Jung, Choonkyun; Lee, Sangjoon; Min, Kyunghun; Lee, Yin-Won; Choi, Yeonhee; Lee, Jong Seob; Song, Jong Tae; Kim, Ju-Kon; Choi, Yang Do

2013-02-01

The role of AtMYB44, an R2R3 MYB transcription factor, in signaling mediated by jasmonic acid (JA) and salicylic acid (SA) is examined. AtMYB44 is induced by JA through CORONATINE INSENSITIVE 1 (COI1). AtMYB44 over-expression down-regulated defense responses against the necrotrophic pathogen Alternaria brassicicola, but up-regulated WRKY70 and PR genes, leading to enhanced resistance to the biotrophic pathogen Pseudomonas syringae pv. tomato DC3000. The knockout mutant atmyb44 shows opposite effects. Induction of WRKY70 by SA is reduced in atmyb44 and npr1-1 mutants, and is totally abolished in atmyb44 npr1-1 double mutants, showing that WRKY70 is regulated independently through both NPR1 and AtMYB44. AtMYB44 over-expression does not change SA content, but AtMYB44 over-expression phenotypes, such as retarded growth, up-regulated PR1 and down-regulated PDF1.2 are reversed by SA depletion. The wrky70 mutation suppressed AtMYB44 over-expression phenotypes, including up-regulation of PR1 expression and down-regulation of PDF1.2 expression. β-estradiol-induced expression of AtMYB44 led to WRKY70 activation and thus PR1 activation. AtMYB44 binds to the WRKY70 promoter region, indicating that AtMYB44 acts as a transcriptional activator of WRKY70 by directly binding to a conserved sequence element in the WRKY70 promoter. These results demonstrate that AtMYB44 modulates antagonistic interaction by activating SA-mediated defenses and repressing JA-mediated defenses through direct control of WRKY70. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

Hyperuricemia Causes Pancreatic β-Cell Death and Dysfunction through NF-κB Signaling Pathway

PubMed Central

Jia, Lu; Xing, Jing; Ding, Ying; Shen, Yachen; Shi, Xuhui; Ren, Wei; Wan, Meng; Guo, Jianjin; Zheng, Shujing; Liu, Yun; Liang, Xiubin; Su, Dongming

2013-01-01

Accumulating clinical evidence suggests that hyperuricemia is associated with an increased risk of type 2 diabetes. However, it is still unclear whether elevated levels of uric acid can cause direct injury of pancreatic β-cells. In this study, we examined the effects of uric acid on β-cell viability and function. Uric acid solution or normal saline was administered intraperitoneally to mice daily for 4 weeks. Uric acid-treated mice exhibited significantly impaired glucose tolerance and lower insulin levels in response to glucose challenge than did control mice. However, there were no significant differences in insulin sensitivity between the two groups. In comparison to the islets in control mice, the islets in the uric acid–treated mice were markedly smaller in size and contained less insulin. Treatment of β-cells in vitro with uric acid activated the NF-κB signaling pathway through IκBα phosphorylation, resulting in upregulated inducible nitric oxide synthase (iNOS) expression and excessive nitric oxide (NO) production. Uric acid treatment also increased apoptosis and downregulated Bcl-2 expression in Min6 cells. In addition, a reduction in insulin secretion under glucose challenge was observed in the uric acid–treated mouse islets. These deleterious effects of uric acid on pancreatic β-cells were attenuated by benzbromarone, an inhibitor of uric acid transporters, NOS inhibitor L-NMMA, and Bay 11–7082, an NF-κB inhibitor. Further investigation indicated that uric acid suppressed levels of MafA protein through enhancing its degradation. Collectively, our data suggested that an elevated level of uric acid causes β-cell injury via the NF-κB-iNOS-NO signaling axis. PMID:24205181

Altered Expression of the Malate-Permeable Anion Channel OsALMT4 Reduces the Growth of Rice Under Low Radiance

PubMed Central

Liu, Jie; Xu, Muyun; Estavillo, Gonzalo M.; Delhaize, Emmanuel; White, Rosemary G.; Zhou, Meixue; Ryan, Peter R.

2018-01-01

We examined the function of OsALMT4 in rice (Oryza sativa L.) which is a member of the aluminum-activated malate transporter family. Previous studies showed that OsALMT4 localizes to the plasma membrane and that expression in transgenic rice lines results in a constitutive release of malate from the roots. Here, we show that OsALMT4 is expressed widely in roots, shoots, flowers, and grain but not guard cells. Expression was also affected by ionic and osmotic stress, light and to the hormones ABA, IAA, and salicylic acid. Malate efflux from the transgenic plants over-expressing OsALMT4 was inhibited by niflumate and salicylic acid. Growth of transgenic lines with either increased OsALMT4 expression or reduced expression was measured in different environments. Light intensity caused significant differences in growth between the transgenic lines and controls. When day-time light was reduced from 700 to 300 μmol m-2s-1 independent transgenic lines with either increased or decreased OsALMT4 expression accumulated less biomass compared to their null controls. This response was not associated with differences in photosynthetic capacity, stomatal conductance or sugar concentrations in tissues. We propose that by disrupting malate fluxes across the plasma membrane carbon partitioning and perhaps signaling are affected which compromises growth under low light. We conclude that OsALMT4 is expressed widely in rice and facilitates malate efflux from different cell types. Altering OsALMT4 expression compromises growth in low-light environments. PMID:29774038

Leucine deprivation inhibits proliferation and induces apoptosis of human breast cancer cells via fatty acid synthase

PubMed Central

Xiao, Fei; Wang, Chunxia; Yin, Hongkun; Yu, Junjie; Chen, Shanghai; Fang, Jing; Guo, Feifan

2016-01-01

Substantial studies on fatty acid synthase (FASN) have focused on its role in regulating lipid metabolism and researchers have a great interest in treating cancer with dietary manipulation of amino acids. In the current study, we found that leucine deprivation caused the FASN-dependent anticancer effect. Here we showed that leucine deprivation inhibited cell proliferation and induced apoptosis of MDA-MB-231 and MCF-7 breast cancer cells. In an in vivo tumor xenograft model, the leucine-free diet suppressed the growth of human breast cancer tumors and triggered widespread apoptosis of the cancer cells. Further study indicated that leucine deprivation decreased expression of lipogenic gene FASN in vitro and in vivo. Over-expression of FASN or supplementation of palmitic acid (the product of FASN action) blocked the effects of leucine deprivation on cell proliferation and apoptosis in vitro and in vivo. Moreover, leucine deprivation suppressed the FASN expression via regulating general control non-derepressible (GCN)2 and sterol regulatory element-binding protein 1C (SREBP1C). Taken together, our study represents proof of principle that anticancer effects can be obtained with strategies to deprive tumors of leucine via suppressing FASN expression, which provides important insights in prevention of breast cancer via metabolic intervention. PMID:27579768

Corticotropin-releasing hormone expression in patients with intrahepatic cholestasis of pregnancy after ursodeoxycholic acid treatment: an initial experience.

PubMed

Zhou, Fan; Zhang, Li; He, Mao Mao; Liu, Zheng Fei; Gao, Bing Xin; Wang, Xiao Dong

2014-08-01

Corticotropin-releasing hormone (CRH) is one of the most potent vasodilatory factors in the human feto-placental circulation. The expression of CRH was significantly down-regulated in patients with intrahepatic cholestasis of pregnancy (ICP). One hundred pregnant women diagnosed with ICP at 34-34(+6) weeks of gestation agreed to participate in this prospective nested case-control study. Thirty ICP patients were finally recruited in this study, with 16 cases in the ursodeoxycholic acid (UDCA) group (UDCA 750 mg/d) and 14 cases in the control group (Transmetil 1000 mg/d or Essentiale 1368 mg/d). Maternal serum samples were obtained in diagnosis and at 37-37(+6) weeks of gestation. Placental tissues were obtained from participants after delivery. ELISA, enzymatic colorimetric and Western blotting were used to evaluate the concentrations of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bile acid (TBA) and CRH in maternal serum and expression of CRH in placenta tissues. The UDCA group had greater reduction in maternal serum ALT, AST and TBA levels in ICP patients (all p < 0.01). Maternal serum CRH concentrations in the UDCA group after treatment (122.10 ± 44.20) pg/ml was significantly higher than pretreatment (95.45 ± 26.47) pg/ml (p < 0.01). After treatment, maternal serum CRH concentrations of the UDCA group (122.10 ± 44.20) pg/ml was significantly higher than in the control group (80.71 ± 41.10) pg/ml (p < 0.01). Placental CRH expression in the UDCA group (2.79 ± 1.72) was significantly higher than in the control group (0.69 ± 0.36) (p < 0.01). Maternal serum and placental CRH expression in ICP patients were up-regulated after treatment of UDCA. The up-regulation of CRH expression after UDCA treatment may play an important role in the therapeutic mechanism of ICP. All patients recruited in this study had severe cholestasis (TBA ≥ 40 µmol/L). Further studies are warranted in different gestational weeks and TBA levels to provide more evidence for the correlation between UDCA treatment and CRH expression in ICP patients.

Alterations of Na,K-ATPase isoenzymes in the rat diabetic neuropathy: protective effect of dietary supplementation with n-3 fatty acids.

PubMed

Gerbi, A; Maixent, J M; Barbey, O; Jamme, I; Pierlovisi, M; Coste, T; Pieroni, G; Nouvelot, A; Vague, P; Raccah, D

1998-08-01

Diabetic neuropathy is a degenerative complication of diabetes accompanied by an alteration of nerve conduction velocity (NCV) and Na,K-ATPase activity. The present study in rats was designed first to measure diabetes-induced abnormalities in Na,K-ATPase activity, isoenzyme expression, fatty acid content in sciatic nerve membranes, and NCV and second to assess the preventive ability of a fish oil-rich diet (rich in n-3 fatty acids) on these abnormalities. Diabetes was induced by intravenous streptozotocin injection. Diabetic animals (D) and nondiabetic control animals (C) were fed the standard rat chow either without supplementation or supplemented with either fish oil (DM, CM) or olive oil (DO, CO) at a daily dose of 0.5 g/kg by gavage during 8 weeks. Analysis of the fatty acid composition of purified sciatic nerve membranes from diabetic animals showed a decreased incorporation of C16:1(n-7) fatty acids and arachidonic acids. Fish oil supplementation changed the fatty acid content of sciatic nerve membranes, decreasing C18:2(n-6) fatty acids and preventing the decreases of arachidonic acids and C18:1(n-9) fatty acids. Protein expression of Na,K-ATPase alpha subunits, Na,K-ATPase activity, and ouabain affinity were assayed in purified sciatic nerve membranes from CO, DO, and DM. Na,K-ATPase activity was significantly lower in sciatic nerve membranes of diabetic rats and significantly restored in diabetic animals that received fish oil supplementation. Diabetes induced a specific decrease of alpha1- and alpha3-isoform activity and protein expression in sciatic nerve membranes. Fish oil supplementation restored partial activity and expression to varying degrees depending on the isoenzyme. These effects were associated with a significant beneficial effect on NCV. This study indicates that fish oil has beneficial effects on diabetes-induced alterations in sciatic nerve Na,K-ATPase activity and function.

A controlled study of comparative efficacy of oral retinoids and topical betamethasone/salicylic acid for chronic hyperkeratotic palmoplantar dermatitis.

PubMed

Capella, Giovanni Luigi; Fracchiolla, Claudio; Frigerio, Elena; Altomare, Gianfranco

2004-04-01

Chronic hyperkeratotic dermatitis of the palms and soles represents a severe multi-etiological problem, too often faced with ineffective or tedious topical remedies. A single-blind, matched-sample design investigation was carried out of 42 patients with chronic hyperkeratotic palmoplantar dermatitis, who were administered acitretin 25-50 mg/day for 1 month, which was controlled versus a conventional topical treatment (betamethasone/salicylic acid ointment). Therapeutic improvement was expressed with the reduction of severity score (expressed on a 0-10 scale). Acitretin was significantly better than the conventional treatment after 30 days (two sided p<0.0001). Moreover, improvement significantly persisted 5 months after suspension of acitretin (p<0.0001), while this was not the case after suspension of the control treatment (p=0.3019). Lesions improved more rapidly with acitretin than with the control treatment (p<0.0002). Some cases of loss of sensitization in patch-test-positive patients were observed. Side effects were minimal or absent, and patients expressed overtly their preference for acitretin treatment. After evaluating the former literature, the risks and the benefits, as well as the overt superiority of retinoid treatment, the authors conclude that acitretin should be considered a first choice treatment for this fastidious condition.

Transcriptional and metabolomic analysis of Ascophyllum nodosum mediated freezing tolerance in Arabidopsis thaliana

PubMed Central

2012-01-01

Background We have previously shown that lipophilic components (LPC) of the brown seaweed Ascophyllum nodosum (ANE) improved freezing tolerance in Arabidopsis thaliana. However, the mechanism(s) of this induced freezing stress tolerance is largely unknown. Here, we investigated LPC induced changes in the transcriptome and metabolome of A. thaliana undergoing freezing stress. Results Gene expression studies revealed that the accumulation of proline was mediated by an increase in the expression of the proline synthesis genes P5CS1 and P5CS2 and a marginal reduction in the expression of the proline dehydrogenase (ProDH) gene. Moreover, LPC application significantly increased the concentration of total soluble sugars in the cytosol in response to freezing stress. Arabidopsis sfr4 mutant plants, defective in the accumulation of free sugars, treated with LPC, exhibited freezing sensitivity similar to that of untreated controls. The 1H NMR metabolite profile of LPC-treated Arabidopsis plants exposed to freezing stress revealed a spectrum dominated by chemical shifts (δ) representing soluble sugars, sugar alcohols, organic acids and lipophilic components like fatty acids, as compared to control plants. Additionally, 2D NMR spectra suggested an increase in the degree of unsaturation of fatty acids in LPC treated plants under freezing stress. These results were supported by global transcriptome analysis. Transcriptome analysis revealed that LPC treatment altered the expression of 1113 genes (5%) in comparison with untreated plants. A total of 463 genes (2%) were up regulated while 650 genes (3%) were down regulated. Conclusion Taken together, the results of the experiments presented in this paper provide evidence to support LPC mediated freezing tolerance enhancement through a combination of the priming of plants for the increased accumulation of osmoprotectants and alteration of cellular fatty acid composition. PMID:23171218

Colonic Saturated Fatty Acid Concentrations and Expression of COX-1, but not Diet, Predict Prostaglandin E2 in Normal Human Colon Tissue.

PubMed

Sidahmed, ElKhansa; Sen, Ananda; Ren, Jianwei; Patel, Arsh; Turgeon, D Kim; Ruffin, Mack T; Brenner, Dean E; Djuric, Zora

2016-10-01

Prostaglandin E2 (PGE2) in the colon is a pro-inflammatory mediator that is associated with increased risk of colon cancer. In this study, expression of genes in the PGE2 pathway were quantified in colon biopsies from a trial of a Mediterranean versus a Healthy Eating diet in 113 individuals at high risk for colon cancer. Colon biopsies were obtained before and after 6 months of intervention. Quantitative, real-time PCR was used to measure mRNA expression of prostaglandin H synthases (PTGS1 and 2), prostaglandin E synthases (PTGES1 and 3), prostaglandin dehydrogenase (HPGD), and PGE2 receptors (PTGER2, PTGER4). The most highly expressed genes were HPGD and PTGS1. In multivariate linear regression models of baseline data, both colon saturated fatty acid concentrations and PTGS1 expression were significant, positive predictors of colon PGE2 concentrations after controlling for nonsteroidal anti-inflammatory drug use, gender, age, and smoking status. The effects of dietary intervention on gene expression were minimal with small increases in expression noted for PTGES3 in both arms and in PTGER4 in the Mediterranean arm. These results indicate that short-term dietary change had little effect on enzymes in the prostaglandin pathway in the colon and other factors, such as differences in fatty acid metabolism, might be more influential.

Propolis prevents diet-induced hyperlipidemia and mitigates weight gain in diet-induced obesity in mice.

PubMed

Koya-Miyata, Satomi; Arai, Norie; Mizote, Akiko; Taniguchi, Yoshifumi; Ushio, Shimpei; Iwaki, Kanso; Fukuda, Shigeharu

2009-12-01

We examined the hypolipidemic effect of propolis in a mouse obesity model induced by a high fat-diet. C57BL/6N mice were fed a high-fat diet ad libitum and given propolis extract intragastrically at 0 mg/kg (control), 5 mg/kg or 50 mg/kg twice daily for 10 d. Compared with mice in the control group, mice in the propolis extract-administrated groups displayed a reduction in all of the following parameters: body weight gain, weight of visceral adipose tissue, liver and serum triglycerides, cholesterol, and non-esterified fatty acids. Real-time polymerase chain reaction analysis of the liver showed down-regulation of mRNA expression associated with fatty acid biosynthesis, including fatty acid synthase, acetyl-CoA carboxylase alpha, and sterol regulatory element binding protein in the propolis-administrated mice. Subsequently, obese C57BL/6N mice that had been administered a high-fat diet were given propolis extract at 0 mg/kg (control), 2.5 mg/kg or 25 mg/kg for 4 weeks. The propolis extract treated mice showed a decrease in weight gain, a reduction of serum non-esterified fatty acids, and lipid accumulation in the liver. These results suggest that propolis extract prevented and mitigated high-fat diet-induced hyperlipidemia by down-regulating the expression of genes associated with lipid metabolism.

Auxin Controls Arabidopsis Adventitious Root Initiation by Regulating Jasmonic Acid Homeostasis[W

PubMed Central

Gutierrez, Laurent; Mongelard, Gaëlle; Floková, Kristýna; Păcurar, Daniel I.; Novák, Ondřej; Staswick, Paul; Kowalczyk, Mariusz; Păcurar, Monica; Demailly, Hervé; Geiss, Gaia; Bellini, Catherine

2012-01-01

Vegetative shoot-based propagation of plants, including mass propagation of elite genotypes, is dependent on the development of shoot-borne roots, which are also called adventitious roots. Multiple endogenous and environmental factors control the complex process of adventitious rooting. In the past few years, we have shown that the auxin response factors ARF6 and ARF8, targets of the microRNA miR167, are positive regulators of adventitious rooting, whereas ARF17, a target of miR160, is a negative regulator. We showed that these genes have overlapping expression profiles during adventitious rooting and that they regulate each other’s expression at the transcriptional and posttranscriptional levels by modulating the homeostasis of miR160 and miR167. We demonstrate here that this complex network of transcription factors regulates the expression of three auxin-inducible Gretchen Hagen3 (GH3) genes, GH3.3, GH3.5, and GH3.6, encoding acyl-acid-amido synthetases. We show that these three GH3 genes are required for fine-tuning adventitious root initiation in the Arabidopsis thaliana hypocotyl, and we demonstrate that they act by modulating jasmonic acid homeostasis. We propose a model in which adventitious rooting is an adaptive developmental response involving crosstalk between the auxin and jasmonate regulatory pathways. PMID:22730403

[Influence of raising oxygen content on function of platelet concentrate during preservation].

PubMed

Zhan, Tong; Xiao, Jian-Yu; Tao, Jing; Miao, Xi-Feng; Liu, Yan-Cun; Tang, Rong-Cai

2006-08-01

To explore the influence of raising oxygen (dissolved oxygen) content on function of platelet concentrate, the platelet concentrate was prepared by a CS-3000 plus blood cell separator. Experiments were divided into 2 groups: test group and control group. After raising oxygen content in platelet plasma under sterile operation, the platelet samples of two groups were preserved in oscillator with horizontal oscillation at 22 +/- 2 degrees C. The platelet count, platelet aggregation rate, lactic acid content and CD62p expression level of platelet were detected on 0, 1, 2, 3, 4, 5 days of platelet preservation. The results showed that the platelet count and platelet aggregation rate decreased with prolongation of preserved time, while the lactic acid content and CD62p expression level of platelet increased gradually. Compared with control group, there were significant differences in aggregation rate of platelet preserved for 2-3 days, and in CD62p expression level of platelet preserved for 1-3 days, while significant difference was found in lactic acid content of platelet preserved for 1-3 days. It is concluded that raising content of oxygen in platelet plasma can provide more oxygen to compensate oxygen supply deficiency for platelet metabolism and improve the efficiency of platelet oxygenic metabolism and the quality of platelet during preservation.

Glucomannan- and glucomannan plus spirulina-enriched pork affect liver fatty acid profile, LDL receptor expression and antioxidant status in Zucker fa/fa rats fed atherogenic diets

PubMed Central

González-Torres, Laura; Matos, Cátia; Vázquez-Velasco, Miguel; Santos-López, Jorge A.; Sánchez-Martínez, Iria; García–Fernández, Camino; Bastida, Sara; Benedí, Juana; Sánchez-Muniz, Francisco J.

2017-01-01

ABSTRACT We evaluated the effects of glucomannan or glucomannan plus spirulina-restructured pork (RP) on liver fatty acid profile, desaturase/elongase enzyme activities and oxidative status of Zucker fa/fa rats for seven weeks. Control (C), glucomannan (G) and glucomannan/spirulina (GS)-RP; HC (cholesterol-enriched control), HG and HGS (cholesterol-enriched glucomannan and glucomannan/spirulina-RP) experimental diets were tested. Increased metabolic syndrome markers were found in C, G and GS rats. Cholesterol feeding increased liver size, fat, and cholesterol and reduced antioxidant enzyme levels and expressions. Cholesterolemia was lower in HG and HGS than in HC. GS vs. G showed higher stearic but lower oleic levels. SFA and PUFA decreased while MUFA increased by cholesterol feeding. The arachidonic/linoleic and docosahexaenoic/alpha-linolenic ratios were lower in HC, HG, and HGS vs. C, G, and GS, respectively, suggesting a delta-6-elongase-desaturase system inhibition. Moreover, cholesterol feeding, mainly in HGS, decreased low-density-lipoprotein receptor expression and the delta-5-desaturase activity and increased the delta-9-desaturase activity. In conclusion, the liver production of highly unsaturated fatty acids was limited to decrease their oxidation in presence of hypercholesterolaemia. Glucomannan or glucomannan/spirulina-RP has added new attributes to their functional properties in meat, partially arresting the negative effects induced by high-fat-high-cholesterol feeding on the liver fatty acid and antioxidant statuses. PMID:28325998

Central insulin-mediated regulation of hepatic glucose production [Review].

PubMed

Inoue, Hiroshi

2016-01-01

Insulin controls hepatic glucose production (HGP) and maintains glucose homeostasis through the direct action of hepatic insulin receptors, as well as the indirect action of insulin receptors in the central nervous system. Insulin acts on insulin receptors in the hypothalamic arcuate nucleus, activates ATP-sensitive potassium channels in a phosphoinositide 3-kinase (PI3K)-dependent manner, induces hyperpolarization of the hypothalamic neurons, and regulates HGP via the vagus nerve. In the liver, central insulin action augments IL-6 expression in Kupffer cells and activates STAT3 transcription factors in hepatocytes. Activated STAT3 suppresses the gene expression of gluconeogenic enzymes, thereby reducing HGP. It has become evident that nutrients such as glucose, fatty acids, and amino acids act upon the hypothalamus together with insulin, affecting HGP. On the other hand, HGP control by central insulin action is impeded in obesity and impeded by insulin resistance due to disturbance of PI3K signaling and inflammation in the hypothalamus or inhibition of STAT3 signaling in the liver. Although the mechanism of control of hepatic gluconeogenic gene expression by central insulin action is conserved across species, its importance in human glucose metabolism has not been made entirely clear and its elucidation is anticipated in the future.

Human Norovirus and Its Surrogates Induce Plant Immune Response in Arabidopsis thaliana and Lactuca sativa.

PubMed

Markland, Sarah M; Bais, Harsh; Kniel, Kalmia E

2017-08-01

Human norovirus is the leading cause of foodborne illness worldwide with the majority of outbreaks linked to fresh produce and leafy greens. It is essential that we thoroughly understand the type of relationship and interactions that take place between plants and human norovirus to better utilize control strategies to reduce transmission of norovirus in the field onto plants harvested for human consumption. In this study the expression of gene markers for the salicylic acid (SA) and jasmonic acid (JA) plant defense pathways was measured and compared in romaine lettuce (Lactuca sativa) and Arabidopsis thaliana Col-0 plants that were inoculated with Murine Norovirus-1, Tulane Virus, human norovirus GII.4, or Hank's Balanced Salt Solution (control). Genes involving both the SA and JA pathways were expressed in both romaine lettuce and A. thaliana for all three viruses, as well as controls. Studies, including gene expression of SA- and JA-deficient A. thaliana mutant lines, suggest that the JA pathway is more likely involved in the plant immune response to human norovirus. This research provides the first pieces of information regarding how foodborne viruses interact with plants in the preharvest environment.

Down-regulation of increased TRAF6 expression in the peripheral mononuclear cells of patients with primary Sjögren's syndrome by an EBV-EBER1-specific synthetic single-stranded complementary DNA molecule.

PubMed

Sipka, Sándor; Zilahi, Erika; Papp, Gábor; Chen, Ji-Qing; Nagy, Andrea; Hegyi, Katalin; Kónya, József; Zeher, Margit

2017-05-01

We described earlier a simultaneously increased that the increased expression of miRNA-146a/b was accompanied by an increase in the expression of and TRAF6 and a decrease in the expression of IRAK1 genes in the peripheral mononuclear cells (PBMCs) of patients with primary Sjogren's syndrome (pSS) patients. Recently, the expression of EBV encoded. RNA (EBER) was published in the B cells of salivary glands of in pSS. In the present study, we applied an EBV-EBER1 specific synthetic single stranded complementary DNA molecule (EBV-EBER1-cDNA) to test whether any EBER1 related effect exists also in PBMCs of pSS patients. In the PBMCs of pSS patients and healthy controls, we investigated in vitro the effects of a synthetic single stranded EBV-EBER1-cDNA molecule, synthetic double-stranded (ds)RNA polyinosinic-polycytidylic acid [poly (I:C)] and polyadenylic acid potassium salt poly-adenylic acid [poly-(A)] on the expression of TRAF6 gene tested by qRTPCR. The release of interferon -α was detected by ELISA. EBV-EBER1-cDNA resulted in a significant reduction in the expression of TRAF6 in the cells of patients, but in the healthy controls not, whereas the treatments with poly (I:C) and poly-(A) could not reduce the TRAF6 over-expression. No release of EBER1 could be observed in the culture supernatants of patients with pSS. Only the treatment with poly (I:C) resulted in a significant increase of interferon -α release, and only in the heathy controls. No release of EBER1 molecules took place during the culturing of cells. EBV-EBER- cDNA acted functionally on the cells of patients only. These findings give a further evidence of the linkage between EBV and pSS, furthermore, they show the possible role of EBV-EBER1 in the induction of increased TRAF6 expression in the peripheral B cells of Sjögren's patients. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

Nuclear hormone receptor NHR-49 controls fat consumption and fatty acid composition in C. elegans.

PubMed

Van Gilst, Marc R; Hadjivassiliou, Haralambos; Jolly, Amber; Yamamoto, Keith R

2005-02-01

Mammalian nuclear hormone receptors (NHRs), such as liver X receptor, farnesoid X receptor, and peroxisome proliferator-activated receptors (PPARs), precisely control energy metabolism. Consequently, these receptors are important targets for the treatment of metabolic diseases, including diabetes and obesity. A thorough understanding of NHR fat regulatory networks has been limited, however, by a lack of genetically tractable experimental systems. Here we show that deletion of the Caenorhabditis elegans NHR gene nhr-49 yielded worms with elevated fat content and shortened life span. Employing a quantitative RT-PCR screen, we found that nhr-49 influenced the expression of 13 genes involved in energy metabolism. Indeed, nhr-49 served as a key regulator of fat usage, modulating pathways that control the consumption of fat and maintain a normal balance of fatty acid saturation. We found that the two phenotypes of the nhr-49 knockout were linked to distinct pathways and were separable: The high-fat phenotype was due to reduced expression of enzymes in fatty acid beta-oxidation, and the shortened adult life span resulted from impaired expression of a stearoyl-CoA desaturase. Despite its sequence relationship with the mammalian hepatocyte nuclear factor 4 receptor, the biological activities of nhr-49 were most similar to those of the mammalian PPARs, implying an evolutionarily conserved role for NHRs in modulating fat consumption and composition. Our findings in C. elegans provide novel insights into how NHR regulatory networks are coordinated to govern fat metabolism.

Chondrogenic differentiation potential of human mesenchymal stem cells photoencapsulated within poly(ethylene glycol)-arginine-glycine-aspartic acid-serine thiol-methacrylate mixed-mode networks.

PubMed

Salinas, Chelsea N; Cole, Brook B; Kasko, Andrea M; Anseth, Kristi S

2007-05-01

Chondrogenesis of human mesenchymal stem cells (hMSCs) encapsulated in poly(ethylene glycol) (PEG)-based hydrogels was studied in the presence and absence of 5 ng/mL transforming growth factor beta and chondrogenic medium to better understand the role of the gel environment on this process. The lack of any cell-polymer interactions led to decreasing cell viability, as measured using adenosine triphosphate, over a 14-day period. The extent of chondrogenic differentiation was evaluated by immunostaining, and although viability dramatically decreased, cells cultured in chondrogenic differentiation medium expressed higher levels of collagen type II. Cells cultured in hMSC control medium remained undifferentiated and continued to express CD105, a MSC marker. To increase cell survival, arginine-glycine-aspartic acid-serine (RGDS) was incorporated into gels using a novel mixed-mode thiol-ene reaction by synthesizing a cysteine-cysteine-arginine-glycine-aspartic acid-serine-cysteine-cysteine-glycine, N-terminus to C-terminus peptide sequence with pendant cysteine residues. A concentration of 5 mM RGDS incorporated into the network maintained 75% viability in control cultures. Further studies demonstrated that 5-mM RGDS chondrogenic cultures had greater gene expression for aggrecan and collagen II in conjunction with producing twice as much glycosaminoglycan as 0-mM chondrogenic cultures and 7 times that of control cultures. Incorporation of this peptide sequence not only allows for sustained viability, but also contributes to initiating chondrogenesis.

The Arabidopsis MYB96 Transcription Factor Is a Positive Regulator of ABSCISIC ACID-INSENSITIVE4 in the Control of Seed Germination1

PubMed Central

Lee, Kyounghee; Lee, Hong Gil; Kim, Hyun Uk; Seo, Pil Joon

2015-01-01

Seed germination is a key developmental transition that initiates the plant life cycle. The timing of germination is determined by the coordinated action of two phytohormones, gibberellin and abscisic acid (ABA). In particular, ABA plays a key role in integrating environmental information and inhibiting the germination process. The utilization of embryonic lipid reserves contributes to seed germination by acting as an energy source, and ABA suppresses lipid degradation to modulate the germination process. Here, we report that the ABA-responsive R2R3-type MYB transcription factor MYB96, which is highly expressed in embryo, regulates seed germination by controlling the expression of ABSCISIC ACID-INSENSITIVE4 (ABI4) in Arabidopsis (Arabidopsis thaliana). In the presence of ABA, germination was accelerated in MYB96-deficient myb96-1 seeds, whereas the process was significantly delayed in MYB96-overexpressing activation-tagging myb96-ox seeds. Consistently, myb96-1 seeds degraded a larger extent of lipid reserves even in the presence of ABA, while reduced lipid mobilization was observed in myb96-ox seeds. MYB96 directly regulates ABI4, which acts as a repressor of lipid breakdown, to define its spatial and temporal expression. Genetic analysis further demonstrated that ABI4 is epistatic to MYB96 in the control of seed germination. Taken together, the MYB96-ABI4 module regulates lipid mobilization specifically in the embryo to ensure proper seed germination under suboptimal conditions. PMID:25869652

Evaluating water deficit and glyphosate treatment on the accumulation of phenolic compounds and photosynthesis rate in transgenic Codonopsis lanceolata (Siebold & Zucc.) Trautv. over-expressing γ-tocopherol methyltransferase (γ-tmt) gene.

PubMed

Ghimire, Bimal Kumar; Son, Na-Young; Kim, Seung-Hyun; Yu, Chang Yeon; Chung, Ill-Min

2017-07-01

The effect of water stress and herbicide treatment on the phenolic compound concentration and photosynthesis rate in transgenic Codonopsis lanceolata plants over-expressing the γ-tmt gene was investigated and compared to that in control non-transgenic C. lanceolata plants. The total phenolic compound content was investigated using high-performance liquid chromatography combined with diode array detection in C. lanceolata seedlings 3 weeks after water stress and treatment with glyphosate. Changes in the composition of phenolic compounds were observed in leaf and root extracts from transformed C. lanceolata plants following water stress and treatment with glyphosate. The total concentration of phenolic compounds in the leaf extracts of transgenic samples after water stress ranged from 3455.13 ± 40.48 to 8695.00 ± 45.44 µg g -1 dry weight (DW), whereas the total concentration phenolic compound in the leaf extracts of non-transgenic control samples was 5630.83 ± 45.91 µg g -1  DW. The predominant phenolic compounds that increased after the water stress in the transgenic leaf were (+) catechin, benzoic acid, chlorogenic acid, ferulic acid, gallic acid, rutin, vanillic acid, and veratric acid. The total concentration of phenolic compounds in the leaf extracts of transgenic samples after glyphosate treatment ranged from 4744.37 ± 81.81 to 12,051.02 ± 75.00 µg g -1 DW, whereas the total concentration of the leaf extracts of non-transgenic control samples after glyphosate treatment was 3778.28 ± 59.73 µg g -1 DW. Major phenolic compounds that increased in the transgenic C. lanceolata plants after glyphosate treatment included kaempherol, gallic acid, myricetin, p-hydroxybenzjoic acid, quercetin, salicylic acid, t-cinnamic acid, catechin, benzoicacid, ferulic acid, protocatechuic acid, veratric acid, and vanillic acid. Among these, vanillic acid showed the greatest increase in both leaf and root extracts from transgenic plants relative to those from control C. lanceolata plants following treatment with glyphosate, which could affect the 5-enol-pyruvyl shikimate-3-phosphate (EPSP) synthase, an enzyme in the shikimate pathway. We observed enhanced stomatal conductance (gs) and photosynthesis rate (A) in the transgenic plants treated with water stress and glyphosate treatment. The results of this study demonstrated large variations in the functioning of secondary metabolites pathway in response glyphosate and water stress in transgenic C. lanceolata.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Effects of dietary n-3 highly unsaturated fatty acids (HUFAs) on growth, fatty acid profiles, antioxidant capacity and immunity of sea cucumber Apostichopus japonicus (Selenka).

PubMed

Yu, Haibo; Gao, Qinfeng; Dong, Shuanglin; Zhou, Jishu; Ye, Zhi; Lan, Ying

2016-07-01

The present study was conducted to understand the effects of dietary n-3 highly unsaturated fatty acids (HUFAs) on growth, fatty acid profiles, antioxidant capacity and the immunity of sea cucumber Apostichopus japonicus (Selenka). Five experimental diets were prepared, containing graded levels of n-3 HUFAs (0.46%, 0.85%, 1.25%, 1.61% and 1.95%, respectively), and the 0.46% group was used as control group. The specific growth rates, fatty acid profiles, activities and gene expression of antioxidative enzymes and lysozyme of the sea cucumbers that were fed with the 5 experimental diets were determined. The results showed that the specific growth rate of sea cucumbers in all the treatment groups significantly increased compared to the control group (P < 0.05), indicating the positive effects of n-3 HUFAs on the growth of sea cucumbers. The contents of eicosapentaenoic acid (EPA; 20:5n-3) and docosahexaenoic acid (DHA; 22:6n-3) in the body wall of the sea cucumbers gradually increased with the increasing levels of n-3 HUFAs in the diets. The suitable supplement of n-3 HUFAs in diets improved the activities of superoxide dismutase (SOD) and catalase (CAT) of sea cucumbers by up-regulating the expression of SOD and CAT mRNA in sea cucumbers. However, excess n-3 HUFAs in diets caused lipid peroxidation, inhibited the expression of lysozyme (LSZ) mRNA and decreased the activities of LSZ in sea cucumbers. In summary, the suitable supplement levels of n-3 HUFAs in diets of sea cucumbers A. japonicus were estimated between 0.85% and 1.25% considering the growth performance, cost and the indicators of antioxidant capacity and immunity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast.

PubMed

Young, Eric M; Zhao, Zheng; Gielesen, Bianca E M; Wu, Liang; Benjamin Gordon, D; Roubos, Johannes A; Voigt, Christopher A

2018-05-09

Metabolic engineering requires multiple rounds of strain construction to evaluate alternative pathways and enzyme concentrations. Optimizing multigene pathways stepwise or by randomly selecting enzymes and expression levels is inefficient. Here, we apply methods from design of experiments (DOE) to guide the construction of strain libraries from which the maximum information can be extracted without sampling every possible combination. We use Saccharomyces cerevisiae as a host for a novel six-gene pathway to itaconic acid, selected by comparing alternative shunt pathways that bypass the mitochondrial TCA cycle. The pathway is distinctive for the use of acetylating acetaldehyde dehydrogenase to increase cytosolic acetyl-CoA pools, a bacterial enzyme to synthesize citrate in the cytosol, and an itaconic acid exporter. Precise control over the expression of each gene is enabled by a set of promoter-terminator pairs that span a 174-fold range. Two large combinatorial libraries (160 variants, 2.4Mb and 32 variants, 0.6Mb) are designed where the expression levels are selected by statistical methods (I-optimal response surface methodology, full factorial, or Plackett-Burman) with the intent of extracting different types of guiding information after the screen. This is applied to the design of a third library (24 variants, 0.5Mb) intended to alleviate a bottleneck in cis-aconitate decarboxylase (CAD) expression. The top strain produces 815mg/l itaconic acid, a 4-fold improvement over the initial strain achieved by iteratively balancing pathway expression. Including a methylated product in the total, the strain produces 1.3g/l combined itaconic acids. Further, a regression analysis of the libraries reveals the optimal expression level of CAD as well as pairwise interdependencies between genes that result in increased titer and purity of itaconic acid. This work demonstrates adapting algorithmic design strategies to guide automated yeast strain construction and learn information after each iteration. Copyright © 2018. Published by Elsevier Inc.

Production of 3-hydroxypropionic acid by balancing the pathway enzymes using synthetic cassette architecture.

PubMed

Sankaranarayanan, Mugesh; Somasundar, Ashok; Seol, Eunhee; Chauhan, Ashish Singh; Kwon, Seongjin; Jung, Gyoo Yeol; Park, Sunghoon

2017-10-10

Biological 3-hydroxypropionic acid (3-HP) production from glycerol is a two-step reaction catalyzed by glycerol dehydratase (GDHt) and aldehyde dehydrogenase (ALDH). Recombinant strains developed for 3-HP production often suffer from the accumulation of a toxic intermediate, 3-hydroxypropionaldehyde (3-HPA). In order to avoid 3-HPA accumulation, balancing of the two enzymatic activities, in the present study, was attempted by employment of synthetic-regulatory cassettes comprising varying-strength promoters and bicistronic ribosome-binding sites (RBSs). When tested in recombinant Escherichia coli, the cassettes could precisely and differentially control the gene expression in transcription, protein expression and enzymatic activity. Five recombinant strains showing different expressions for GDHt were developed and studied for 3-HPA accumulation and 3-HP production. It was found that 3-HPA accumulation could be completely abolished when expressing ALDH at a level approximately 8-fold higher than that of GDHt. One of the strains, SP4, produced 625mM (56.4g/L) of 3-HP in a fed-batch bioreactor, though late-period production was limited by acetate accumulation. Overall, this study demonstrated the importance of pathway balancing in 3-HP production as well as the utility of the synthetic cassette architecture for precise control of bacterial gene expression. Copyright © 2017 Elsevier B.V. All rights reserved.

Oxidation of fatty acid may be enhanced by a combination of pomegranate fruit phytochemicals and acetic acid in HepG2 cells.

PubMed

Kim, Ji Yeon; Ok, Elly; Kim, You Jin; Choi, Kyoung-Sook; Kwon, Oran

2013-06-01

We investigated whether the combination of phytochemicals and acetic acid in the form of fruit vinegar provides an additive effect on changes of mRNA levels related to fatty acid oxidation in human hepatocyte (HepG2). Among the seven fruit vinegars (Rubuscoreanus, Opuntia, blueberry, cherry, red ginseng, mulberry, and pomegranate) studied, treatment of HepG2 with pomegranate vinegar (PV) at concentrations containing 1 mM acetic acid showed the highest in vitro potentiating effect on the mRNA expression levels of peroxisome proliferator-activated receptor α, carnitinepalmitoyl transferase-1, and acyl-CoA oxidase compared to the control group (P < 0.05). Reversed-phase liquid chromatography in combination with quadrupole time-of-flight mass spectrometry analysis revealed four potential compounds (punicalagin B, ellagic acid, and two unidentified compounds) responsible for altered gene expression in HepG2 cells treated with PV as compared with the others. Further investigations are warranted to determine if drinking PV beverages may help to maintain a healthy body weight in overweight subjects.

Regulation of metabolic products and gene expression in Fusarium asiaticum by agmatine addition.

PubMed

Suzuki, Tadahiro; Kim, Young-Kyung; Yoshioka, Hifumi; Iwahashi, Yumiko

2013-05-01

The metabolic products resulting from the cultivation of F. asiaticum in agmatine were identified using capillary electrophoresis-time of flight mass spectrometry. Glyoxylic acid was detected from fungal cultures grown in agmatine, while it was absent in control cells. The abundance of other metabolic products of the glycolytic pathway also increased because of agmatine; however, there was no increase in the amounts of pyruvic acid or metabolites from the tricarboxylic acid cycle. Moreover, gene expression levels within Fusarium asiaticum exposed to agmatine were analyzed by DNA microarray. Changes in gene expression levels directed the changes in metabolic products. Our results suggest that acetyl coenzyme A, which is a starting substrate for the biosynthesis of deoxynivalenol (DON), was simultaneously produced by activated β-oxidation. Furthermore, the content of 4-aminobutyrate (GABA) was increased in the agmatine addition culture medium. GABA can be synthesized from agmatine through putrescine and might influence the regulation of DON-related genes.

Functional assessment of plant and microalgal lipid pathway genes in yeast to enhance microbial industrial oil production.

PubMed

Peng, Huadong; Moghaddam, Lalehvash; Brinin, Anthony; Williams, Brett; Mundree, Sagadevan; Haritos, Victoria S

2018-03-01

As promising alternatives to fossil-derived oils, microbial lipids are important as industrial feedstocks for biofuels and oleochemicals. Our broad aim is to increase lipid content in oleaginous yeast through expression of lipid accumulation genes and use Saccharomyces cerevisiae to functionally assess genes obtained from oil-producing plants and microalgae. Lipid accumulation genes DGAT (diacylglycerol acyltransferase), PDAT (phospholipid: diacylglycerol acyltransferase), and ROD1 (phosphatidylcholine: diacylglycerol choline-phosphotransferase) were separately expressed in yeast and lipid production measured by fluorescence, solvent extraction, thin layer chromatography, and gas chromatography (GC) of fatty acid methyl esters. Expression of DGAT1 from Arabidopsis thaliana effectively increased total fatty acids by 1.81-fold above control, and ROD1 led to increased unsaturated fatty acid content of yeast lipid. The functional assessment approach enabled the fast selection of candidate genes for metabolic engineering of yeast for production of lipid feedstocks. © 2017 International Union of Biochemistry and Molecular Biology, Inc.

Incorporating Geochemical And Microbial Kinetics In Reactive Transport Models For Generation Of Acid Rock Drainage

NASA Astrophysics Data System (ADS)

Andre, B. J.; Rajaram, H.; Silverstein, J.

2010-12-01

Acid mine drainage, AMD, results from the oxidation of metal sulfide minerals (e.g. pyrite), producing ferrous iron and sulfuric acid. Acidophilic autotrophic bacteria such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans obtain energy by oxidizing ferrous iron back to ferric iron, using oxygen as the electron acceptor. Most existing models of AMD do not account for microbial kinetics or iron geochemistry rigorously. Instead they assume that oxygen limitation controls pyrite oxidation and thus focus on oxygen transport. These models have been successfully used for simulating conditions where oxygen availability is a limiting factor (e.g. source prevention by capping), but have not been shown to effectively model acid generation and effluent chemistry under a wider range of conditions. The key reactions, oxidation of pyrite and oxidation of ferrous iron, are both slow kinetic processes. Despite being extensively studied for the last thirty years, there is still not a consensus in the literature about the basic mechanisms, limiting factors or rate expressions for microbially enhanced oxidation of metal sulfides. An indirect leaching mechanism (chemical oxidation of pyrite by ferric iron to produce ferrous iron, with regeneration of ferric iron by microbial oxidation of ferrous iron) is used as the foundation of a conceptual model for microbially enhanced oxidation of pyrite. Using literature data, a rate expression for microbial consumption of ferrous iron is developed that accounts for oxygen, ferrous iron and pH limitation. Reaction rate expressions for oxidation of pyrite and chemical oxidation of ferrous iron are selected from the literature. A completely mixed stirred tank reactor (CSTR) model is implemented coupling the kinetic rate expressions, speciation calculations and flow. The model simulates generation of AMD and effluent chemistry that qualitatively agrees with column reactor and single rock experiments. A one dimensional reaction diffusion model at the scale of a single rock is developed incorporating the proposed kinetic rate expressions. Simulations of initiation, washout and AMD flows are discussed to gain a better understanding of the role of porosity, effective diffusivity and reactive surface area in generating AMD. Simulations indicate that flow boundary conditions control generation of acid rock drainage as porosity increases.

Combined α-tocopherol and ascorbic acid protects against smoke-induced lung squamous metaplasia in ferrets.

PubMed

Kim, Yuri; Chongviriyaphan, Nalinee; Liu, Chun; Russell, Robert M; Wang, Xiang-Dong

2012-01-01

Many epidemiological studies show the benefit of fruits and vegetables on reducing risk of lung cancer, the leading cause of cancer death in the United States. Previously, we demonstrated that cigarette smoke exposure (SM)-induced lung lesions in ferrets were prevented by a combination of low dose of β-carotene, α-tocopherol (AT), and ascorbic acid (AA). However, the role of a combination of AT and AA alone in the protective effect on lung carcinogenesis remains to be examined. In the present study, we investigated whether the combined AT (equivalent to ∼100 mg/day in the human) and AA (equivalent to ∼210 mg/day) supplementation prevents against SM (equivalent to 1.5 packs of cigarettes/day) induced lung squamous metaplasia in ferrets. Ferrets were treated for 6 weeks in the following three groups (9 ferrets/group): (i) Control (no SM, no AT+AA), (ii) SM alone, and (iii) SM+AT+AA. Results showed that SM significantly decreased concentrations of retinoic acid, AT, and reduced form of AA, not total AA, retinol and retinyl palmitate, in the lungs of ferrets. Combined AT+AA treatment partially restored the lowered concentrations of AT, reduced AA and retinoic acid in the lungs of SM-exposed ferrets to the levels in the control group. Furthermore, the combined AT+AA supplementation prevented SM-induced squamous metaplasia [0 positive/9 total ferrets (0%) vs. 5/8 (62%); p<0.05] and cyclin D1 expression (p<0.05) in the ferret lungs, in which both were positively correlated with expression of c-Jun expression. Although there were no significant differences in lung microsomal malondialdehyde (MDA) levels among the three groups, we found a positive correlation between MDA levels and cyclin D1, as well as c-Jun expressions in the lungs of ferrets. These data indicate that the combination of antioxidant AT+AA alone exerts protective effects against SM-induced lung lesions through inhibiting cyclin D1 expression and partially restoring retinoic acid levels to normal. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Expression of tropodithietic acid biosynthesis is controlled by a novel autoinducer.

PubMed

Geng, Haifeng; Belas, Robert

2010-09-01

The interactions between marine prokaryotic and eukaryotic microorganisms are crucial to many biological and biogeochemical processes in the oceans. Often the interactions are mutualistic, as in the symbiosis between phytoplankton, e.g., the dinoflagellate Pfiesteria piscicida and Silicibacter sp. TM1040, a member of the Roseobacter taxonomic lineage. It is hypothesized that an important component of this symbiosis is bacterial production of tropodithietic acid (TDA), a biologically active tropolone compound whose synthesis requires the expression of tdaABCDEF (tdaA-F), as well as six additional genes (cysI, malY, paaIJK, and tdaH). The factors controlling tda gene expression are not known, although growth in laboratory standing liquid cultures drastically increases TDA levels. In this report, we measured the transcription of tda genes to gain a greater understanding of the factors controlling their expression. While the expression of tdaAB was constitutive, tdaCDE and tdaF mRNA increased significantly (3.7- and 17.4-fold, respectively) when cells were grown in standing liquid broth compared to their levels with shaking liquid culturing. No transcription of tdaC was detected when a tdaCp::lacZ transcriptional fusion was placed in 11 of the 12 Tda(-) mutant backgrounds, with cysI being the sole exception. The expression of tdaC could be restored to 9 of the remaining 11 Tda(-) mutants-tdaA and tdaH failed to respond-by placing wild-type (Tda(+)) strains in close proximity or by supplying exogenous TDA to the mutant, suggesting that TDA induces tda gene expression. These results indicate that TDA acts as an autoinducer of its own synthesis and suggest that roseobacters may use TDA as a quorum signal.

Expression of Tropodithietic Acid Biosynthesis Is Controlled by a Novel Autoinducer▿ †

PubMed Central

Geng, Haifeng; Belas, Robert

2010-01-01

The interactions between marine prokaryotic and eukaryotic microorganisms are crucial to many biological and biogeochemical processes in the oceans. Often the interactions are mutualistic, as in the symbiosis between phytoplankton, e.g., the dinoflagellate Pfiesteria piscicida and Silicibacter sp. TM1040, a member of the Roseobacter taxonomic lineage. It is hypothesized that an important component of this symbiosis is bacterial production of tropodithietic acid (TDA), a biologically active tropolone compound whose synthesis requires the expression of tdaABCDEF (tdaA-F), as well as six additional genes (cysI, malY, paaIJK, and tdaH). The factors controlling tda gene expression are not known, although growth in laboratory standing liquid cultures drastically increases TDA levels. In this report, we measured the transcription of tda genes to gain a greater understanding of the factors controlling their expression. While the expression of tdaAB was constitutive, tdaCDE and tdaF mRNA increased significantly (3.7- and 17.4-fold, respectively) when cells were grown in standing liquid broth compared to their levels with shaking liquid culturing. No transcription of tdaC was detected when a tdaCp::lacZ transcriptional fusion was placed in 11 of the 12 Tda− mutant backgrounds, with cysI being the sole exception. The expression of tdaC could be restored to 9 of the remaining 11 Tda− mutants—tdaA and tdaH failed to respond—by placing wild-type (Tda+) strains in close proximity or by supplying exogenous TDA to the mutant, suggesting that TDA induces tda gene expression. These results indicate that TDA acts as an autoinducer of its own synthesis and suggest that roseobacters may use TDA as a quorum signal. PMID:20601479

Analysis of porcine adipose tissue transcriptome reveals differences in de novo fatty acid synthesis in pigs with divergent muscle fatty acid composition.

PubMed

Corominas, Jordi; Ramayo-Caldas, Yuliaxis; Puig-Oliveras, Anna; Estellé, Jordi; Castelló, Anna; Alves, Estefania; Pena, Ramona N; Ballester, Maria; Folch, Josep M

2013-12-01

In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases.

Differential effects of omega-3 fatty acid docosahexaenoic acid and palmitate on the circadian transcriptional profile of clock genes in immortalized hypothalamic neurons.

PubMed

Greco, James A; Oosterman, Johanneke E; Belsham, Denise D

2014-10-15

Diets high in saturated fatty acids (SFAs) are associated with the development of circadian dysregulation, obesity, and Type 2 diabetes mellitus. Conversely, polyunsaturated fatty acids (PUFAs) have recently been identified to improve insulin sensitivity, reduce weight gain, and relieve obesity-induced inflammation. While saturated fatty acids, such as the prevalent dietary fatty acid palmitate, have been implicated in circadian disruption, there is a paucity of studies regarding the effects of PUFAs on circadian parameters. Therefore, the immortalized murine neuronal model, mHypoE-37, was utilized to examine the effects of the SFA palmitate and omega-3 PUFA docosahexaenoic acid (DHA) on circadian rhythms. The mHypoE-37 neurons express the core clock genes, Bmal1, Per2, and Rev-erbα, in a circadian manner. 25 μM of palmitate significantly increased the transcriptional expression of Bmal1, without altering the expression of inflammatory markers TLR4, IκBα, and IL-6, nor the orexigenic neuropeptide AgRP, suggesting that the observed disruption of the molecular clock is the result of a mechanism distinct from that of hypothalamic cellular inflammation. Furthermore, treatment with the PUFA DHA resulted in alterations in the circadian expression profile of Bmal1, although differentially from the effects of palmitate. In the presence of DHA, the disruptive effects of palmitate on Bmal1 were less pronounced, suggesting a protective effect of DHA. These studies are the first to identify the potential for omega-3 PUFAs to protect against palmitate-mediated dysregulation of circadian parameters and will ultimately improve the understanding of circadian control mechanisms. Copyright © 2014 the American Physiological Society.

Increased ubiquitination and reduced plasma membrane trafficking of placental amino acid transporter SNAT-2 in human IUGR.

PubMed

Chen, Yi-Yung; Rosario, Fredrick J; Shehab, Majida Abu; Powell, Theresa L; Gupta, Madhulika B; Jansson, Thomas

2015-12-01

Placental amino acid transport is decreased in intrauterine growth restriction (IUGR); however, the underlying mechanisms remain largely unknown. We have shown that mechanistic target of rapamycin (mTOR) signalling regulates system A amino acid transport by modulating the ubiquitination and plasma membrane trafficking of sodium-coupled neutral amino acid transporter 2 (SNAT-2) in cultured primary human trophoblast cells. We hypothesize that IUGR is associated with (1) inhibition of placental mTORC1 and mTORC2 signalling pathways, (2) increased amino acid transporter ubiquitination in placental homogenates and (3) decreased protein expression of SNAT-2 in the syncytiotrophoblast microvillous plasma membrane (MVM). To test this hypothesis, we collected placental tissue and isolated MVM from women with pregnancies complicated by IUGR (n=25) and gestational age-matched women with appropriately grown control infants (n=19, birth weights between the twenty-fifth to seventy-fifth percentiles). The activity of mTORC1 and mTORC2 was decreased whereas the protein expression of the ubiquitin ligase NEDD4-2 (neural precursor cell expressed developmentally down-regulated protein 4-2; +72%, P<0.0001) and the ubiquitination of SNAT-2 (+180%, P<0.05) were increased in homogenates of IUGR placentas. Furthermore, IUGR was associated with decreased system A amino acid transport activity (-72%, P<0.0001) and SNAT-1 (-42%, P<0.05) and SNAT-2 (-31%, P<0.05) protein expression in MVM. In summary, these findings are consistent with the possibility that decreased placental mTOR activity causes down-regulation of placental system A activity by shifting SNAT-2 trafficking towards proteasomal degradation, thereby contributing to decreased fetal amino acid availability and restricted fetal growth in IUGR. © 2015 Authors; published by Portland Press Limited.

Increased ubiquitination and reduced plasma membrane trafficking of placental amino acid transporter SNAT-2 in human IUGR

PubMed Central

Rosario, Fredrick J.; Shehab, Majida Abu; Powell, Theresa L.; Gupta, Madhulika B.; Jansson, Thomas

2015-01-01

Placental amino acid transport is decreased in intrauterine growth restriction (IUGR); however, the underlying mechanisms remain largely unknown. We have shown that mechanistic target of rapamycin (mTOR) signalling regulates system A amino acid transport by modulating the ubiquitination and plasma membrane trafficking of sodium-coupled neutral amino acid transporter 2 (SNAT-2) in cultured primary human trophoblast cells. We hypothesize that IUGR is associated with (1) inhibition of placental mTORC1 and mTORC2 signalling pathways, (2) increased amino acid transporter ubiquitination in placental homogenates and (3) decreased protein expression of SNAT-2 in the syncytiotrophoblast microvillous plasma membrane (MVM). To test this hypothesis, we collected placental tissue and isolated MVM from women with pregnancies complicated by IUGR (n=25) and gestational age-matched women with appropriately grown control infants (n=19, birth weights between the twenty-fifth to seventy-fifth percentiles). The activity of mTORC1 and mTORC2 was decreased whereas the protein expression of the ubiquitin ligase NEDD4-2 (neural precursor cell expressed developmentally down-regulated protein 4-2; +72%, P<0.0001) and the ubiquitination of SNAT-2 (+180%, P<0.05) were increased in homogenates of IUGR placentas. Furthermore, IUGR was associated with decreased system A amino acid transport activity (–72%, P<0.0001) and SNAT-1 (–42%, P<0.05) and SNAT-2 (–31%, P<0.05) protein expression in MVM. In summary, these findings are consistent with the possibility that decreased placental mTOR activity causes down-regulation of placental system A activity by shifting SNAT-2 trafficking towards proteasomal degradation, thereby contributing to decreased fetal amino acid availability and restricted fetal growth in IUGR. PMID:26374858

Effects of dietary chitosan on growth, lipid metabolism, immune response and antioxidant-related gene expression in Misgurnus anguillicaudatus.

PubMed

Yan, J; Guo, C; Dawood, M A O; Gao, J

2017-05-30

This study was performed to evaluate the effects of dietary chitosan supplementation on growth performance, lipid metabolism, gut microbial, antioxidant status and immune responses of juvenile loach (Misgurnus anguillicaudatus). Five experimental diets were formulated to contain graded levels of chitosan (0 (control), 0.5, 1, 2 and 5% CHI) for 50 days. Results of the present study showed that body weight gain was significantly higher in fish fed chitosan supplemented diets in dose dependent manner than control group. Increasing dietary chitosan levels reduced gut lipid content. Meanwhile the mRNA expression levels of intestine lipoprotein lipase and fatty acid binding protein 2 were significantly reduced with incremental dietary chitosan level. The percentages of total monounsaturated fatty acid decreased, while polyunsaturated fatty acid increased with dietary chitosan. The fish fed 0.5% CHI had higher mucus lysozyme activity (LZM) than those fed 0% CHI, but the LZM activity was significantly decreased with advancing chitosan supplement. The expression levels of superoxide dismutase, catalase and glutathione peroxidase revealed a similar trend, where the highest expressions were found in fish fed 5% CHI diet. In the term of intestine microbiota between 0 and 1% CHI groups, the proportion of bacteria in the phylum Bacteroidetes increased, whereas the proportion of bacteria in the phylum Firmicutes decreased as the fish supplemented chitosan. In conclusion, supplementation of chitosan improved growth performance, antioxidant status and immunological responses in loach.

A system dynamics model integrating physiology and biochemical regulation predicts extent of crassulacean acid metabolism (CAM) phases.

PubMed

Owen, Nick A; Griffiths, Howard

2013-12-01

A system dynamics (SD) approach was taken to model crassulacean acid metabolism (CAM) expression from measured biochemical and physiological constants. SD emphasizes state-dependent feedback interaction to describe the emergent properties of a complex system. These mechanisms maintain biological systems with homeostatic limits on a temporal basis. Previous empirical studies on CAM have correlated biological constants (e.g. enzyme kinetic parameters) with expression over the CAM diel cycle. The SD model integrates these constants within the architecture of the CAM 'system'. This allowed quantitative causal connections to be established between biological inputs and the four distinct phases of CAM delineated by gas exchange and malic acid accumulation traits. Regulation at flow junctions (e.g. stomatal and mesophyll conductance, and malic acid transport across the tonoplast) that are subject to feedback control (e.g. stomatal aperture, malic acid inhibition of phosphoenolpyruvate carboxylase, and enzyme kinetics) was simulated. Simulated expression for the leaf-succulent Kalanchoë daigremontiana and more succulent tissues of Agave tequilana showed strong correlation with measured gas exchange and malic acid accumulation (R(2)  = 0.912 and 0.937, respectively, for K. daigremontiana and R(2)  = 0.928 and 0.942, respectively, for A. tequilana). Sensitivity analyses were conducted to quantitatively identify determinants of diel CO2 uptake. The transition in CAM expression from low to high volume/area tissues (elimination of phase II-IV carbon-uptake signatures) was achieved largely by the manipulation three input parameters. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Conjugated linoleic acid synthesis-related protein proteasome subunit α 5 (PSMA5) is increased by vaccenic acid treatment in goat mammary tissue.

PubMed

Jin, Y C; Li, Z H; Hong, Z S; Xu, C X; Han, J A; Choi, S H; Yin, J L; Zhang, Q K; Lee, K B; Kang, S K; Song, M K; Kim, Y J; Kang, H S; Choi, Y J; Lee, H G

2012-08-01

This study was conducted to identify proteins associated with the endogenous synthesis of conjugated linoleic acid (CLA) from trans-vaccenic acid (TVA; trans-11 C18:1, a precursor for CLA endogenous synthesis) in mammary tissues. Six lactating goats were divided into 2 groups. One group was given an intravenous bolus injection of TVA (150mg) twice daily over 4 d; the other group received saline injections. Treatment with TVA increased the concentration of cis-9,trans-11 CLA and TVA in goat milk. Additionally, TVA treatment increased the expression of stearoyl-CoA desaturase (SCD) in mammary tissue. Using 2-dimensional gel electrophoresis and electrospray ionization quadrupole time-of-flight mass spectrometry, 3 proteins affected by infusions of TVA were identified. Proteasome (prosome, macropain) subunit α type 5 (PSMA5) was upregulated, whereas peroxiredoxin-1 and translationally controlled tumor protein 1 were downregulated in TVA-treated animals compared with the vehicle-injected controls. Only the effect of TVA on PSMA5 could be confirmed by Western blot analysis. To further explore the regulation of PSMA5 in mammary epithelial cells when TVA is converted into CLA, we used a differentiated bovine mammary epithelial cell line treated with TVA for 6h. Changes in cis-9,trans-11 CLA concentrations and mRNA expression patterns of both SCD and PSMA5 were monitored. The concentration of cis-9,trans-11 CLA increased after TVA treatment. The mRNA expression level of PSMA5 was significantly elevated to 6h, but SCD mRNA expression only increased in 2h after TVA treatment. These results indicate that PSMA5 is highly expressed in goat mammary tissue and bovine mammary epithelial cells when TVA is converted into CLA. Our data suggest that PSMA5 protein is associated with CLA biosynthesis in mammary tissue. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Combination of n-3 polyunsaturated fatty acids reduces atherogenesis in apolipoprotein E-deficient mice by inhibiting macrophage activation.

PubMed

Takashima, Akira; Fukuda, Daiju; Tanaka, Kimie; Higashikuni, Yasutomi; Hirata, Yoichiro; Nishimoto, Sachiko; Yagi, Shusuke; Yamada, Hirotsugu; Soeki, Takeshi; Wakatsuki, Tetsuzo; Taketani, Yutaka; Shimabukuro, Michio; Sata, Masataka

2016-11-01

Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) are major components of n-3 polyunsaturated fatty acids (n-3 PUFAs) which inhibit atherogenesis, although few studies have examined the effects of the combination of EPA and DHA on atherogenesis. The aim of this study was to investigate whether DHA has additional anti-atherosclerotic effects when combined with EPA. Male 8-week-old apolipoprotein E-deficient (Apoe -/- ) mice were fed a western-type diet supplemented with different amounts of EPA and DHA; EPA (2.5%, w/w), low-dose EPA + DHA (2.5%, w/w), or high-dose EPA + DHA (5%, w/w) for 20 weeks. The control group was fed a western-type diet containing no n-3 PUFA. Histological and gene expression analysis were performed in atherosclerotic lesions in the aorta. To address the mechanisms, RAW264.7 cells were used. All n-3 PUFA treatments significantly attenuated the development and destabilization of atherosclerotic plaques compared with the control. The anti-atherosclerotic effects were enhanced in the high-dose EPA + DHA group (p < 0.001), whereas the pure EPA group and low-dose EPA + DHA group showed similar results. EPA and DHA additively attenuated the expression of inflammatory molecules in RAW264.7 cells stimulated with LPS. DHA or EPA + DHA suppressed LPS-induced toll-like receptor 4 (TLR4) expression in lipid rafts on RAW264.7 cells (p < 0.05). Lipid raft disruption by methyl-β-cyclodextrin suppressed mRNA expression of inflammatory molecules in LPS-stimulated macrophages. n-3 PUFAs suppressed atherogenesis. DHA combined with EPA had additional anti-inflammatory effects and inhibited atherogenesis in Apoe -/- mice. The reduction of TLR4 expression in lipid rafts in macrophages by DHA might be involved in this mechanism, at least partially. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Uncovering co-expression gene network modules regulating fruit acidity in diverse apples.

PubMed

Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Zhong, Gan-Yuan; Xu, Kenong

2015-08-16

Acidity is a major contributor to fruit quality. Several organic acids are present in apple fruit, but malic acid is predominant and determines fruit acidity. The trait is largely controlled by the Malic acid (Ma) locus, underpinning which Ma1 that putatively encodes a vacuolar aluminum-activated malate transporter1 (ALMT1)-like protein is a strong candidate gene. We hypothesize that fruit acidity is governed by a gene network in which Ma1 is key member. The goal of this study is to identify the gene network and the potential mechanisms through which the network operates. Guided by Ma1, we analyzed the transcriptomes of mature fruit of contrasting acidity from six apple accessions of genotype Ma_ (MaMa or Mama) and four of mama using RNA-seq and identified 1301 fruit acidity associated genes, among which 18 were most significant acidity genes (MSAGs). Network inferring using weighted gene co-expression network analysis (WGCNA) revealed five co-expression gene network modules of significant (P < 0.001) correlation with malate. Of these, the Ma1 containing module (Turquoise) of 336 genes showed the highest correlation (0.79). We also identified 12 intramodular hub genes from each of the five modules and 18 enriched gene ontology (GO) terms and MapMan sub-bines, including two GO terms (GO:0015979 and GO:0009765) and two MapMap sub-bins (1.3.4 and 1.1.1.1) related to photosynthesis in module Turquoise. Using Lemon-Tree algorithms, we identified 12 regulator genes of probabilistic scores 35.5-81.0, including MDP0000525602 (a LLR receptor kinase), MDP0000319170 (an IQD2-like CaM binding protein) and MDP0000190273 (an EIN3-like transcription factor) of greater interest for being one of the 18 MSAGs or one of the 12 intramodular hub genes in Turquoise, and/or a regulator to the cluster containing Ma1. The most relevant finding of this study is the identification of the MSAGs, intramodular hub genes, enriched photosynthesis related processes, and regulator genes in a WGCNA module Turquoise that not only encompasses Ma1 but also shows the highest modular correlation with acidity. Overall, this study provides important insight into the Ma1-mediated gene network controlling acidity in mature apple fruit of diverse genetic background.

HNF-4α regulated miR-122 contributes to development of gluconeogenesis and lipid metabolism disorders in Type 2 diabetic mice and in palmitate-treated HepG2 cells.

PubMed

Wei, Shengnan; Zhang, Ming; Yu, Yang; Xue, Huan; Lan, Xiaoxin; Liu, Shuping; Hatch, Grant; Chen, Li

2016-11-15

Hepatocyte Nuclear Factor-4α (HNF-4α) is a key nuclear receptor protein required for liver development. miR-122 is a predominant microRNA expressed in liver and is involved in the regulation of cholesterol and fatty acid metabolism. HNF-4α is know to regulate expression of miR-122 in liver. We examined how HNF-4α regulated gluconeogenesis and lipid metabolism through miR-122 in vivo and in vitro. Expression of miR-122, HNF-4α, phosphoenolpyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G6Pase), sterol response elementary binding protein-1 (SREBP-1), fatty acid synthase-1 (FAS-1), carnitine palmitoyltransferase-1 (CPT-1) and acetyl Coenzyme A carboxylase alpha (ACCα) were determined in livers of Type 2 diabetic mice and in insulin resistant palmitate-treated HepG2 cells. CPT-1 and phosphorylated ACCα expression were significantly decreased in livers of Type 2 diabetic mice and in palmitate-treated HepG2 cells compared to controls. In contrast, expression of miR-122, HNF-4α, PEPCK, G6Pase, SREBP-1, FAS-1 and ACCα were significantly elevated in liver of Type 2 diabetic mice and in palmitate-treated HepG2 cells compared to controls. Expression of HNF-4α increased whereas siRNA knockdown of HNF-4α decreased miR-122 levels in HepG2 cells compared to controls. In addition, expression of HNF-4α in HepG2 cells increased PEPCK, G6Pase, SREBP-1, FAS-1, ACCα mRNA and protein expression and decreased CPT-1 and p-ACCα mRNA and protein expression compared to controls. Addition of miR-122 inhibitors attenuated the HNF-4α mediated effect on expression of these gluconeogenic and lipid metabolism proteins. The results indicate that HNF-4α regulated miR-122 contributes to development of the gluconeogenic and lipid metabolism alterations observed in Type 2 diabetic mice and in palmitate-treated HepG2 cells. Copyright © 2016 Elsevier B.V. All rights reserved.

Lipidomic fatty acid profile and global gene expression pattern in mammary gland of rats that were exposed to lard-based high fat diet during fetal and lactation periods associated to breast cancer risk in adulthood.

PubMed

Andrade, Fábia de Oliveira; de Assis, Sonia; Jin, Lu; Fontelles, Camile Castilho; Barbisan, Luís Fernando; Purgatto, Eduardo; Hilakivi-Clarke, Leena; Ong, Thomas Prates

2015-09-05

The persistent effects of animal fat consumption during pregnancy and nursing on the programming of breast cancer risk among female offspring were studied here. We have previously found that female offspring of rat dams that consumed a lard-based high-fat (HF) diet (60% fat-derived energy) during pregnancy, or during pregnancy and lactation, were at a reduced risk of developing mammary cancer. To better understand the unexpected protective effects of early life lard exposure, we have applied lipidomics and nutrigenomics approaches to investigate the fatty acid profile and global gene expression patterns in the mammary tissue of the female offspring. Consumption of this HF diet during gestation had few effects on the mammary tissue fatty acids profile of young adult offspring, while exposure from gestation throughout nursing promoted significant alterations in the fatty acids profile. Major differences were related to decreases in saturated fatty acids (SFA) and increases in omega-6 polyunsaturated fatty acids (PUFAs), monounsaturated fatty acids (MUFAs) and conjugated linolenic acid (CLA) concentrations. In addition several differences in gene expression patterns by microarray analysis between the control and in utero or in utero and during lactation HF exposed offspring were identified. Differential dependency network (DDN) analysis indicated that many of the genes exhibited unique connections to other genes only in the HF offspring. These unique connections included Hrh1-Ythdf1 and Repin1-Elavl2 in the in utero HF offspring, and Rnf213-Htr3b and Klf5-Chrna4 in the in utero and lactation HF offspring, compared with the control offspring. We conclude that an exposure to a lard-based HF diet during early life changes the fatty acid profile and transcriptional network in mammary gland in young adult rats, and these changes appear to be consistent with reduced mammary cancer risk observed in our previous study. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Environmentally relevant concentration of arsenic trioxide and humic acid promoted tumor progression of human cervical cancer cells: In vivo and in vitro studies.

PubMed

Tsai, Min-Ling; Yen, Cheng-Chieh; Lu, Fung-Jou; Ting, Hung-Chih; Chang, Horng-Rong

2016-09-01

In a previous study, treatment at higher concentrations of arsenic trioxide or co-exposure to arsenic trioxide and humic acid was found to be inhibited cell growth of cervical cancer cells (SiHa cells) by reactive oxygen species generation. However, treatment at lower concentrations slightly increased cell viability. Here, we investigate the enhancement of progression effects of environmentally relevant concentration of humic acid and arsenic trioxide in SiHa cell lines in vitro and in vivo by measuring cell proliferation, migration, invasion, and the carcinogenesis-related protein (MMP-2, MMP-9, and VEGF-A) expressions. SiHa cells treated with low concentrations of humic acid and arsenic trioxide alone or in co-exposure significantly increased reactive oxygen species, glutathione levels, cell proliferation, scratch wound-healing activities, migration abilities, and MMP-2 expression as compared to the untreated control. In vivo the tumor volume of either single drug (humic acid or arsenic trioxide) or combined drug-treated group was significantly larger than that of the control for an additional 45 days after tumor cell injection on the back of NOD/SCID mice. Levels of MMP-2, MMP-9, and VEGF-A, also significantly increased compared to the control. Histopathologic effects of all tumor cells appeared round in cell shape with high mitosis, focal hyperkeratosis and epidermal hyperplasia in the skin, and some tumor growth in the muscle were observed. Our results may indicate that exposure to low concentrations of arsenic trioxide and humic acid is associated with the progression of cervical cancer. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 1121-1132, 2016. © 2015 Wiley Periodicals, Inc.

Effects of omeprazole treatment on nucleoside transporter expression and adenosine uptake in rat gastric mucosa.

PubMed

Redzic, Zoran B; Hasan, Fuad A; Al-Sarraf, Hameed

2009-05-01

Increased adenosine concentration inhibits gastric acid secretion in rat via adenosine A1 and A2A receptors, whereas achlorhydria suppresses A1 and A2A receptor gene expression. This study aimed to examine the effects of omeprazole-induced achlorhydria on the expression and functional activity of nucleoside transporters in rat gastric mucosa. Wistar rats were treated for either 1 or 3 days with 0.4 mmol/kg omeprazole via gavage; controls were treated with vehicle. The expression of nucleoside transporters at the transcript level was explored by quantitative real-time polymerase chain reaction assays; the functional activity of nucleoside transporters in gastric mucosa was explored by observing [3H]adenosine uptake in vitro. Gastric mucosa expressed rat equilibrative nucleoside transporter (rENT) 1 and 2, and rat concentrative nucleoside transporter (rCNT) 1, 2, and 3 at the transcript level, and the estimated values for the threshold cycles for target amplification (Ct) were 31.5 +/- 2, 28.5 +/- 2.1, 32.9 +/- 2.2, 29.1 +/- 2, and 28.9 +/- 2.5, respectively (n = 3 or 4). The Ct value for rat beta-actin was 21.9 +/- 1.8 (n = 4). In vitro uptake of [3H]adenosine by gastric mucosa samples consisted of Na+-dependent and Na+-independent components. One-day omeprazole treatment caused no change in nucleoside transporter mRNA levels or in [3H]adenosine uptake. Three-day omeprazole treatments, however, led to a 12-fold and 17-fold increase in rENT2 and rCNT1 mRNA levels, respectively. Samples taken after 3 days of treatment also took up significantly more [3H]adenosine than did samples from the corresponding control. In conclusion, the possible modification of nucleoside transport activities by changes in intraluminal acidity may have significance as part of a purinergic regulatory feedback mechanism in the control of gastric acid secretion.

Effects of grain processing methods on the expression of genes involved in volatile fatty acid transport and pH regulation, and keratinization in rumen epithelium of beef cattle

PubMed Central

Del Bianco Benedeti, Pedro; Silva, Breno de Castro; Pacheco, Marcos Vinícius Carneiro; Carvalho Filho, Ivan; Lopes, Mariana Mescouto; Marcondes, Marcos Inácio; Mantovani, Hilário Cuquetto; Valadares Filho, Sebastião de Campos; Detmann, Edenio

2018-01-01

Two experiments were carried out to evaluate the effects of corn and sorghum with different processing methods on the expression of genes involved in volatile fatty acids transport and pH regulation, and ruminal keratinization in rumen epithelium of finishing bulls. For Exp. 1, five rumen cannulated Nellore bulls were used in a 5x5 Latin square arrangement, with 14 d for adaptation and 9 d for sample collection. Treatments were: dry ground corn, dry ground sorghum, reconstituted corn, reconstituted sorghum, and control (forage-based diet). Samples of rumen epithelium from ventral sac were excised, rinsed, snap-frozen and stored at -80°C until total RNA isolation and quantitative real-time PCR analysis. In the Exp. 2, 24 Nellore bulls were assigned to a completely randomized design lasting 168 d. Experimental treatments were similar to those at Exp. 1, but without the control treatment. After the experimental period, bulls were slaughtered and rumen epithelium samples were rapidly excised for further histological analysis. Rumen epithelial tissue from animals fed reconstituted corn had lower expression of downregulated-in-adenoma (P = 0.03) and Na+/H+ exchanger 2 (trend; P = 0.09). The expression of Na+/ H+ exchanger 1 (P = 0.10) and putative anion transporter (P = 0.06) tended to be lower in rumen epithelium of bulls fed reconstituted grains. Ruminal concentration of valerate was greater for animals fed reconstituted grain (P = 0.01). Likewise, animals fed reconstituted corn tended to have greater butyrate ruminal concentration (P = 0.08). Keratinized layer thickness did not differ among treatments (P > 0.10). Therefore, reconstituted grains (especially corn) decrease the mRNA expression of genes involved in volatile fatty acids transport and pH control in the rumen epithelium. PMID:29902237

Responsiveness to acidity via metal ion regulators mediates virulence in the gastric pathogen Helicobacter pylori.

PubMed

Bury-Moné, Stéphanie; Thiberge, Jean-Michel; Contreras, Monica; Maitournam, Aboubakar; Labigne, Agnès; De Reuse, Hilde

2004-07-01

The virulence of pathogenic bacteria is dependent on their adaptation to and survival in the stressful conditions encountered in their hosts. Helicobacter pylori exclusively colonizes the acid stomach of primates, making it an ideal study model. Little is known about how H. pylori responds to the moderately acidic conditions encountered at its colonization site, the gastric mucus layer. Thus, we compared gene expression profiles of H. pylori 26695 grown at neutral and acidic pH, and validated the data for a selection of genes by real-time polymerase chain reaction, dot-blots or enzymatic assays. During growth in acidic conditions, 56 genes were upregulated and 45 genes downregulated. We found that acidity is a signal modulating the expression of several virulence factors. Regulation of genes related to metal ion homeostasis suggests protective mechanisms involving diminished transport and enhanced storage. Genes encoding subunits of the F0F1 ATPase and of a newly identified Na+/H+ antiporter (NhaC-HP0946) were downregulated, revealing that this bacterium uses original mechanisms to control proton entry. Five of the upregulated genes encoded proteins controlling intracellular ammonia synthesis, including urease, amidase and formamidase, underlining the major role of this buffering compound in the protection against acidity in H. pylori. Regulatory networks and transcriptome analysis as well as enzymatic assays implicated two metal-responsive transcriptional regulators (NikR and Fur) and an essential two-component response regulator (HP0166, OmpR-like) as effectors of the H. pylori acid response. Finally, a nikR-fur mutant is attenuated in the mouse model, emphasizing the link between response to acidity, metal metabolism and virulence in this gastric pathogen.

Impact of diesel exhaust exposure on the liver of mice fed on omega-3 polyunsaturated fatty acids-deficient diet.

PubMed

Umezawa, Masakazu; Nakamura, Masayuki; El-Ghoneimy, Ashraf A; Onoda, Atsuto; Shaheen, Hazem M; Hori, Hiroshi; Shinkai, Yusuke; El-Sayed, Yasser S; El-Far, Ali H; Takeda, Ken

2018-01-01

Exposure to diesel exhaust (DE) exacerbates non-alcoholic fatty liver disease, and may systemically affect lipid metabolism. Omega-3 polyunsaturated fatty acids (n-3 PUFA) have anti-inflammatory activity and suppresses hepatic triacylglycerol accumulation, but many daily diets are deficient in this nutrient. Therefore, the effect of DE exposure in mice fed n-3 PUFA-deficient diet was investigated. Mice were fed control chow or n-3 PUFA-deficient diet for 4 weeks, then exposed to clean air or DE by inhalation for further 4 weeks. Liver histology, plasma parameters, and expression of fatty acid synthesis-related genes were evaluated. N-3 PUFA-deficient diet increased hepatic lipid droplets accumulation and expression of genes promoting fatty acid synthesis: Acaca, Acacb, and Scd1. DE further increased the plasma leptin and the expression of fatty acid synthesis-related genes: Acacb, Fasn, and Scd1. N-3 PUFA-deficient diet and DE exposure potentially enhanced hepatic fatty acid synthesis and subsequently accumulation of lipid droplets. The combination of low-dose DE exposure and intake of n-3 PUFA-deficient diet may be an additional risk factor for the incidence of non-alcoholic fatty liver disease. The present study suggests an important mechanism for preventing toxicity of DE on the liver through the incorporation of n-3 PUFAs in the diet. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effects of alpha-lipoic acid on retinal ganglion cells, retinal thicknesses, and VEGF production in an experimental model of diabetes.

PubMed

Kan, Emrah; Alici, Ömer; Kan, Elif Kılıç; Ayar, Ahmet

2017-12-01

The purpose of the present study was to investigate the effect of alpha-lipoic acid (ALA) on the thicknesses of various retinal layers and on the numbers of retinal ganglion cells and vascular endothelial growth factor levels in experimental diabetic mouse retinas. Twenty-one male BALB/C mice were made diabetic by the intraperitoneal administration of streptozotocin (200 mg/kg). One week after the induction of diabetes, the mice were divided randomly into three groups: control group (non-diabetic mice treated with alpha-lipoic acid, n = 7), diabetic group (diabetic mice without treatment, n = 7), and alpha-lipoic acid treatment group (diabetic mice with alpha-lipoic acid treatment, n = 7). At the end of the 8th week, the thicknesses of the inner nuclear layer (INL), outer nuclear layer (ONL), and full-length retina were measured; also retinal ganglion cells and VEGF expressions were counted on the histological sections of the mouse retinas and compared with each other. The thicknesses of the full-length retina, ONL, and INL were significantly reduced in the diabetic group compared to the control and ALA treatment groups (p = 0.001), whereas the thicknesses of these layers did not show a significant difference between ALA treatment and control groups. The number of ganglion cells in the diabetic group was significantly lower than those in the control and ALA treatment groups (p = 0.001). The VEGF expression was significantly higher in the diabetic group and mostly observed in the ganglion cell and inner nuclear layers compared to the control and ALA treatment groups (p = 0.001). Therefore, the number of ganglion cells and VEGF levels did not show significant differences between the ALA treatment and control groups (p = 0.7). Our results show that alpha-lipoic acid treatment may have an impact on reducing VEGF levels, protecting ganglion cells, and preserving the thicknesses of the inner and outer layers in diabetic mouse retinas.

Effects of branched-chain volatile fatty acids on lactation performance and mRNA expression of genes related to fatty acid synthesis in mammary gland of dairy cows.

PubMed

Liu, Q; Wang, C; Guo, G; Huo, W J; Zhang, S L; Pei, C X; Zhang, Y L; Wang, H

2018-02-12

Branched-chain volatile fatty acids (BCVFA) supplements could promote lactation performance and milk quality by improving ruminal fermentation and milk fatty acid synthesis. This study was conducted to evaluate the effects of BCVFA supplementation on milk performance, ruminal fermentation, nutrient digestibility and mRNA expression of genes related to fatty acid synthesis in mammary gland of dairy cows. A total of 36 multiparous Chinese Holstein cows averaging 606±4.7 kg of BW, 65±5.2 day in milk (DIM) with daily milk production of 30.6±0.72 kg were assigned to one of four groups blocked by lactation number, milk yield and DIM. The treatments were control, low-BCVFA (LBCVFA), medium-BCVFA (MBCVFA) and high-BCVFA (HBCVFA) with 0, 30, 60 and 90 g BCVFA per cow per day, respectively. Experimental periods were 105 days with 15 days of adaptation and 90 days of data collection. Dry matter (DM) intake tended to increase, but BW changes were similar among treatments. Yields of actual milk, 4% fat corrected milk, milk fat and true protein linearly increased, but feed conversion ratio (FCR) linearly decreased with increasing BCVFA supplementation. Milk fat content linearly increased, but true protein content tended to increase. Contents of C4:0, C6:0, C8:0, C10:0, C12:0, C14:0 and C15:0 fatty acids in milk fat linearly increased, whereas other fatty acids were not affected with increasing BCVFA supplementation. Ruminal pH, ammonia N concentration and propionate molar proportion linearly decreased, but total VFA production and molar proportions of acetate and butyrate linearly increased with increasing BCVFA supplementation. Consequently, acetate to propionate ratios linearly increased. Digestibilities of DM, organic matter, CP, NDF and ADF also linearly increased. In addition, mRNA expressions of peroxisome proliferator-activated receptor γ, sterol regulatory element-binding factor 1 and fatty acid-binding protein 3 linearly increased, mRNA expressions of acetyl-coenzyme A carboxylase-α, fatty acid synthase and stearoyl-CoA desaturase quadratically increased. However, lipoprotein lipase mRNA expression was not affected by treatments. The results indicated that lactation performance and milk fat synthesis increased with BCVFA supplementation by improving ruminal fermentation, nutrient digestibility and mRNA expressions of genes related to milk fat synthesis.

Effects of immunosuppressive treatment on protein expression in rat kidney

PubMed Central

Kędzierska, Karolina; Sporniak-Tutak, Katarzyna; Sindrewicz, Krzysztof; Bober, Joanna; Domański, Leszek; Parafiniuk, Mirosław; Urasińska, Elżbieta; Ciechanowicz, Andrzej; Domański, Maciej; Smektała, Tomasz; Masiuk, Marek; Skrzypczak, Wiesław; Ożgo, Małgorzata; Kabat-Koperska, Joanna; Ciechanowski, Kazimierz

2014-01-01

The structural proteins of renal tubular epithelial cells may become a target for the toxic metabolites of immunosuppressants. These metabolites can modify the properties of the proteins, thereby affecting cell function, which is a possible explanation for the mechanism of immunosuppressive agents’ toxicity. In our study, we evaluated the effect of two immunosuppressive strategies on protein expression in the kidneys of Wistar rats. Fragments of the rat kidneys were homogenized after cooling in liquid nitrogen and then dissolved in lysis buffer. The protein concentration in the samples was determined using a protein assay kit, and the proteins were separated by two-dimensional electrophoresis. The obtained gels were then stained with Coomassie Brilliant Blue, and their images were analyzed to evaluate differences in protein expression. Identification of selected proteins was then performed using mass spectrometry. We found that the immunosuppressive drugs used in popular regimens induce a series of changes in protein expression in target organs. The expression of proteins involved in drug, glucose, amino acid, and lipid metabolism was pronounced. However, to a lesser extent, we also observed changes in nuclear, structural, and transport proteins’ synthesis. Very slight differences were observed between the group receiving cyclosporine, mycophenolate mofetil, and glucocorticoids (CMG) and the control group. In contrast, compared to the control group, animals receiving tacrolimus, mycophenolate mofetil, and glucocorticoids (TMG) exhibited higher expression of proteins responsible for renal drug metabolism and lower expression levels of cytoplasmic actin and the major urinary protein. In the TMG group, we observed higher expression of proteins responsible for drug metabolism and a decrease in the expression of respiratory chain enzymes (thioredoxin-2) and markers of distal renal tubular damage (heart fatty acid-binding protein) compared to expression in the CMG group. The consequences of the reported changes in protein expression require further study. PMID:25328384

Chronic sucrose intake decreases concentrations of n6 fatty acids, but not docosahexaenoic acid in the rat brain phospholipids.

PubMed

Mašek, Tomislav; Starčević, Kristina

2017-07-13

We investigated the influence of high sucrose intake, administered in drinking water, on the lipid profile of the brain and on the expression of SREBP1c and Δ-desaturase genes. Adult male rats received 30% sucrose solution for 20 weeks (Sucrose group), or plain water (Control group). After the 20th week of sucrose treatment, the Sucrose group showed permanent hyperglycemia. Sucrose treatment also increased the amount of total lipids and fatty acids in the brain. The brain fatty acid profile of total lipids as well as phosphatidylethanolamine, phosphatidylcholine and cardiolipin of the Sucrose group was extensively changed. The most interesting change was a significant decrease in n6 fatty acids, including the important arachidonic acid, whereas the content of oleic and docosahexaenoic acid remained unchanged. RT-qPCR revealed an increase in Δ-5-desaturase and SREBP1c gene expression. In conclusion, high sucrose intake via drinking water extensively changes rat brain fatty acid profile by decreasing n6 fatty acids, including arachidonic acid. In contrast, the content of docosahexaenoic acid remains constant in the brain total lipids as well as in phospholipids. Changes in the brain fatty acid profile reflect changes in the lipid metabolism of the rat lipogenic tissues and concentrations in the circulation. Copyright © 2017 Elsevier B.V. All rights reserved.

Activation of choline kinase drives aberrant choline metabolism in esophageal squamous cell carcinomas.

PubMed

Ma, Wang; Wang, Shuangyuan; Zhang, Tengfei; Zhang, Erik Y; Zhou, Lina; Hu, Chunxiu; Yu, Jane J; Xu, Guowang

2018-06-05

Esophageal squamous cell carcinoma (ESCC) is a major health threat worldwide. Research focused on molecular events associated with ESCC carcinogenesis for diagnosis, treatment and prevention is needed. Our goal is to discover novel biomarkers and investigate the underlying molecular mechanisms of ESCC progression by employing a global metabolomic approach. Sera from 34 ESCC patients and 32 age and sex matched healthy controls were profiled using two-dimensional liquid chromatography-mass spectrometry (2D LC-MS). We identified 120 differential metabolites in ESCC patient serums compared to healthy controls. Several amino acids, serine, arginine, lysine and histidine were significantly changed in ESCC patients. Most importantly, we found dysregulated lipid metabolism as an important characteristic in ESCC patients. Several free fat acids (FFA) and carnitines were found down-regulated in ESCC patients. Choline was significantly increased and phosphatidylcholines (PC) were significantly decreased in ESCC serum. The high expression of choline and low expression of total PC in patient serum were associated with the high expression of choline kinase (Chok) and activated Kennedy pathway in ESCC cells. Chok expression can serve as a significant biomarker for ESCC prognosis. In conclusion, metabolite profiles in the ESCC patient serum were significantly different from those in the healthy controls. Phosphatidylcholines and Chok, the key enzyme in the PC metabolism pathway, may serve as novel biomarkers for ESCC. Copyright © 2018 Elsevier B.V. All rights reserved.

Conjugated linoleic acid supplementation caused reduction of perilipin1 and aberrant lipolysis in epididymal adipose tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cai, Demin; Li, Hongji; Zhou, Bo

2012-06-15

Highlights: Black-Right-Pointing-Pointer Conjugated linoleic acid supplementation suppresses perilipin1 in epididymal fat. Black-Right-Pointing-Pointer Conjugated linoleic acid inhibits promoter activity of perilipin1 in 3T3-L1 cells. Black-Right-Pointing-Pointer Conjugated linoleic acids elevate basal but blunt hormone-stimulated lipolysis. -- Abstract: Perilipin1, a coat protein of lipid droplet, plays a key role in adipocyte lipolysis and fat formation of adipose tissues. However, it is not clear how the expression of perilipin1 is affected in the decreased white adipose tissues (WAT) of mice treated with dietary supplement of conjugated linoleic acids (CLA). Here we obtained lipodystrophic mice by dietary administration of CLA which exhibited reduced epididymal (EPI)more » WAT, aberrant adipocytes and decreased expression of leptin in this tissue. We found both transcription and translation of perilipin1 was suppressed significantly in EPI WAT of CLA-treated mice compared to that of control mice. The gene expression of negative regulator tumor necrosis factor {alpha} (TNF{alpha}) and the positive regulator Peroxisome Proliferator-Activated Receptor-{gamma} (PPAR{gamma}) of perilipin1 was up-regulated and down-regulated, respectively. In cultured 3T3-L1 cells the promoter activity of perilipin1 was dramatically inhibited in the presence of CLA. Using ex vivo experiment we found that the basal lipolysis was elevated but the hormone-stimulated lipolysis blunted in adipose explants of CLA-treated mice compared to that of control mice, suggesting that the reduction of perilipin1 in white adipose tissues may at least in part contribute to CLA-mediated alternation of lipolysis of WAT.« less

Peroxisome proliferator-activated receptor gamma modulation and lipogenic response in adipocytes of small-for-gestational age offspring

PubMed Central

2012-01-01

Background Small-for-gestational age (SGA) at birth increases risk of development of adult obesity and insulin resistance. A model of SGA rat offspring has been shown to exhibit increased adipose tissue expression of a key adipogenic transcription factor, peroxisome proliferator-activated receptor gamma (PPARγ), and increased fatty acid de novo synthesis during the nursing period, prior to onset of obesity. PPARγ agonists have been studied for potential use in the prevention of insulin resistance. Moreover, SGA adipocytes exhibit age-dependent differences in lipogenesis as mediated by PPARγ. The effects of PPARγ modulators on lipogenic gene expression and de novo lipogenesis on the age-dependent changes in SGA adipocytes are not known. The objectives of this study were: 1) to determine the adipogenic and lipogenic potential in SGA adipocytes at postnatal day 1 (p1) and day 21 (p21), 2) to determine how the PPARγ activator- and repressor-ligands affect the lipogenic potential, and 3) to determine the fatty acid metabolic response to PPARγ activator-ligand treatment. Methods Primary adipocyte cultures from p1 and p21 SGA and Control male offspring were established from a known maternal food-restriction model of SGA. Cell proliferation and Oil Red O (ORO) staining were quantified. Adipocytes were treated with increasing doses of rosiglitazone or bisphenol-A diglycidyl ether (BADGE). PPARγ and SREBP1 protein expression were determined. De novo lipogenesis with rosiglitazone treatment at p21 was studied using 50% U13C-glucose and gas chromatography/mass spectrometry. Results At p1 and p21, SGA demonstrated increased cell proliferation and increased ORO staining. At p21, SGA demonstrated increased lipogenic gene expression and increased glucose-mediated fatty acid de novo synthesis compared with Controls. In response to rosiglitazone, SGA adipocytes further increased glucose utilization for fatty acid synthesis. SGA lipogenic gene expression demonstrated resistance to BADGE treatment. Conclusions SGA adipocytes exhibit an enhanced adipogenic and lipogenic potential in early postnatal life. By p21, SGA demonstrated resistance to PPARγ repressor-ligand treatment, and selective response to high dose PPARγ activator-ligand treatment in adipogenic and lipogenic gene expression. p21 SGA adipocytes revealed increased fatty acid de novo synthesis through a complex relationship with glucose metabolism. PMID:22726273

Pleiotropic Roles of Bile Acids in Metabolism

PubMed Central

de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Edwards, Peter A.

2013-01-01

Summary Enzymatic oxidation of cholesterol generates numerous distinct bile acids that function both as detergents that facilitate digestion and absorption of dietary lipids, and as hormones that activate four distinct receptors. Activation of these receptors alters gene expression in multiple tissues leading to changes not only in bile acid metabolism, but also in glucose homeostasis, lipid and lipoprotein metabolism, energy expenditure, intestinal motility and bacterial growth, inflammation, liver regeneration and hepato-carcinogenesis. This review covers the roles of specific bile acids, synthetic agonists and their cognate receptors in controlling these diverse functions, as well as their current use in treating human diseases. PMID:23602448

Effect of Dietary Fatty Acids on Inflammatory Gene Expression in Healthy Humans*

PubMed Central

Weaver, Kelly L.; Ivester, Priscilla; Seeds, Michael; Case, L. Douglas; Arm, Jonathan P.; Chilton, Floyd H.

2009-01-01

Over the past 100 years, changes in the food supply in Western nations have resulted in alterations in dietary fatty acid consumption, leading to a dramatic increase in the ratio of omega-6 (ω6) to ω3 polyunsaturated fatty acids (PUFA) in circulation and in tissues. Increased ω6/ω3 ratios are hypothesized to increase inflammatory mediator production, leading to higher incidence of inflammatory diseases, and may impact inflammatory gene expression. To determine the effect of reducing the ω6/ω3 ratio on expression of inflammatory pathway genes in mononuclear cells, healthy humans were placed on a controlled diet for 1 week, then given fish oil and borage oil for an additional 4 weeks. Serum and neutrophil fatty acid composition and ex vivo leukotriene B4 production from stimulated neutrophils were measured at the start and end of the supplementation period and after a 2-week washout. RNA was isolated from mononuclear cells and expression of PI3K, Akt, NFκB, and inflammatory cytokines was measured by real-time PCR. A marked increase was seen in serum and neutrophil levels of long-chain ω3 PUFA concomitant with a reduction in the ω6/ω3 PUFA ratio (40%). The ex vivo capacity of stimulated neutrophils to produce leukotriene B4 was decreased by 31%. Expression of PI3Kα and PI3Kγ and the quantity of PI3Kα protein in mononuclear cells was reduced after supplementation, as was the expression of several proinflammatory cytokines. These data reveal that PUFA may exert their clinical effects via their capacity to regulate the expression of signal transduction genes and genes for proinflammatory cytokines. PMID:19359242

The influence of chosen fungicides on the activity of aminopeptidases in winter oilseed rape during pods development.

PubMed

Kania, Joanna; Mączyńska, Agnieszka; Głazek, Mariola; Krawczyk, Tomasz; Gillner, Danuta M

2018-06-01

Cultivation of oilseed rape requires application of specific fungicides. Besides their protective role, they can potentially influence the expression and activity of crucial enzymes in the plant. Among the large number of enzymes expressed in plants, aminopeptidases play a key role in all crucial physiological processes during the whole life cycle (e.g. storage protein mobilization and thus supplying plant with needed amino acids, as well as plant aging, protection and defense responses). In the present paper, we evaluate for the first time, the influence of the treatment of winter oilseed rape with commercially available fungicides (Pictor 400 SC, Propulse 250 SE and Symetra 325 SC), on the activity of aminopeptidases expressed in each plant organ (flowers, leaves, stems and pods separately). Fungicides were applied once, at one of the three stages of oilseed rape development (BBCH 59-61, BBCH 63-65 and BBCH 67-69). The aminopeptidase activity was determined using six different amino acid p-nitroanilides as substrates. The results have shown, that in control plants, at the beginning of intensive pods development and seeds production, hydrophobic amino acids with bulky side chains (Phe, Leu) were preferentially hydrolysed. In control plants, the activity was ~3.5 times higher in stems and pods, compared to leaves. The treatment with all pesticides caused significant increase in aminopeptidases hydrolytic activity toward small amino acids Gly, Ala as well as proline, mostly in flowers and leaves. These amino acids are proven to be crucial in the mechanisms of delaying of plant aging, development of better resistance to stress and plant defense. It can be suggested, that studied fungicides enhance such mechanisms, by activating the expression of genes coding for aminopeptidases, which are active in hydrolysis of N-terminal amino acids such as Gly, Ala, Pro from storage peptides and proteins. Depending on fungicide, the major increase of aminopeptidase activity was observed after application at BBCH 67-69 (Pictor 400 SC and Symetra 325 SC) and BBCH 63-65 (Propulse 250 SE) stages of development. Our study revealed, that agrochemical treatment and time of application, influenced the expression and activity of aminopeptidases, even though they were not molecular targets of applied fungicides. Since aminopeptidases are widely distributed throughout all organisms and are crucial in many key physiological processes, it can be expected, that factors influencing their expression and activity in plants, can also influence these enzymes in other organisms, especially humans and other mammals. Copyright © 2018 Elsevier Inc. All rights reserved.

The aconitate hydratase family from Citrus

PubMed Central

2010-01-01

Background Research on citrus fruit ripening has received considerable attention because of the importance of citrus fruits for the human diet. Organic acids are among the main determinants of taste and organoleptic quality of fruits and hence the control of fruit acidity loss has a strong economical relevance. In citrus, organic acids accumulate in the juice sac cells of developing fruits and are catabolized thereafter during ripening. Aconitase, that transforms citrate to isocitrate, is the first step of citric acid catabolism and a major component of the citrate utilization machinery. In this work, the citrus aconitase gene family was first characterized and a phylogenetic analysis was then carried out in order to understand the evolutionary history of this family in plants. Gene expression analyses of the citrus aconitase family were subsequently performed in several acidic and acidless genotypes to elucidate their involvement in acid homeostasis. Results Analysis of 460,000 citrus ESTs, followed by sequencing of complete cDNA clones, identified in citrus 3 transcription units coding for putatively active aconitate hydratase proteins, named as CcAco1, CcAco2 and CcAco3. A phylogenetic study carried on the Aco family in 14 plant species, shows the presence of 5 Aco subfamilies, and that the ancestor of monocot and dicot species shared at least one Aco gene. Real-time RT-PCR expression analyses of the three aconitase citrus genes were performed in pulp tissues along fruit development in acidic and acidless citrus varieties such as mandarins, oranges and lemons. While CcAco3 expression was always low, CcAco1 and CcAco2 genes were generally induced during the rapid phase of fruit growth along with the maximum in acidity and the beginning of the acid reduction. Two exceptions to this general pattern were found: 1) Clemenules mandarin failed inducing CcAco2 although acid levels were rapidly reduced; and 2) the acidless "Sucreña" orange showed unusually high levels of expression of both aconitases, an observation correlating with the acidless phenotype. However, in the acidless "Dulce" lemon aconitase expression was normal suggesting that the acidless trait in this variety is not dependent upon aconitases. Conclusions Phylogenetic studies showed the occurrence of five different subfamilies of aconitate hydratase in plants and sequence analyses indentified three active genes in citrus. The pattern of expression of two of these genes, CcAco1 and CcAco2, was normally associated with the timing of acid content reduction in most genotypes. Two exceptions to this general observation suggest the occurrence of additional regulatory steps of citrate homeostasis in citrus. PMID:20958971

76 FR 65537 - Controlled Substances: Proposed Aggregate Production Quotas for 2012

Federal Register 2010, 2011, 2012, 2013, 2014

2011-10-21

..., expressed in grams of anhydrous acid or base, be established as follows: Proposed 2012 Basic class--Schedule... Methadone Intermediate 26,000,000 Methamphetamine 3,130,000 [750,000 grams of levo-desoxyephedrine for use in a non-controlled, non- prescription product; 2,331,000 grams for methamphetamine mostly for...

Characterization of Stearoyl-CoA Desaturases from a Psychrophilic Antarctic Copepod, Tigriopus kingsejongensis.

PubMed

Jung, Woongsic; Kim, Eun Jae; Han, Se Jong; Choi, Han-Gu; Kim, Sanghee

2016-10-01

Stearoyl-CoA desaturase is a key regulator in fatty acid metabolism that catalyzes the desaturation of stearic acid to oleic acid and controls the intracellular levels of monounsaturated fatty acids (MUFAs). Two stearoyl-CoA desaturases (SCD, Δ9 desaturases) genes were identified in an Antarctic copepod, Tigriopus kingsejongensis, that was collected in a tidal pool near the King Sejong Station, King George Island, Antarctica. Full-length complementary DNA (cDNA) sequences of two T. kingsejongensis SCDs (TkSCDs) were obtained from next-generation sequencing and isolated by reverse transcription PCR. DNA sequence lengths of the open reading frames of TkSCD-1 and TkSCD-2 were determined to be 1110 and 681 bp, respectively. The molecular weights deduced from the corresponding genes were estimated to be 43.1 kDa (TkSCD-1) and 26.1 kDa (TkSCD-2). The amino acid sequences were compared with those of fatty acid desaturases and sterol desaturases from various organisms and used to analyze the relationships among TkSCDs. As assessed by heterologous expression of recombinant proteins in Escherichia coli, the enzymatic functions of both stearoyl-CoA desaturases revealed that the amount of C16:1 and C18:1 fatty acids increased by greater than 3-fold after induction with isopropyl β-D-thiogalactopyranoside. In particular, C18:1 fatty acid production increased greater than 10-fold in E. coli expressing TkSCD-1 and TkSCD-2. The results of this study suggest that both SCD genes from an Antarctic marine copepod encode a functional desaturase that is capable of increasing the amounts of palmitoleic acid and oleic acid in a prokaryotic expression system.

Serum metabolomics of Indian women with polycystic ovary syndrome using 1H NMR coupled with a pattern recognition approach.

PubMed

RoyChoudhury, Sourav; Mishra, Biswa Prasanna; Khan, Tila; Chattopadhayay, Ratna; Lodh, Indrani; Datta Ray, Chaitali; Bose, Gunja; Sarkar, Himadri S; Srivastava, Sudha; Joshi, Mamata V; Chakravarty, Baidyanath; Chaudhury, Koel

2016-10-18

Polycystic ovary syndrome (PCOS) is one of the most commonly occurring metabolic and endocrinological disorders affecting women of reproductive age. Metabolomics is an emerging field that holds promise in understanding disease pathophysiology. Recently, a few metabolomics based studies have been attempted in PCOS patients; however, none of them have included patients from the Indian population. The main objective of this study was to investigate the serum metabolomic profile of Indian women with PCOS and compare them with controls. Proton nuclear magnetic resonance ( 1 H NMR) was used to first identify the differentially expressed metabolites among women with PCOS from the Eastern region of India during the discovery phase and further validated in a separate cohort of PCOS and control subjects. Multivariate analysis of the binned spectra indicated 16 dysregulated bins in the sera of these women with PCOS. Out of these 16 bins, 13 identified bins corresponded to 12 metabolites including 8 amino acids and 4 energy metabolites. Amongst the amino acids, alanine, valine, leucine and threonine and amongst the energy metabolites, lactate and acetate were observed to be significantly up-regulated in women with PCOS when compared with controls. The remaining 4 amino acids, l-glutamine, proline, glutamate and histidine were down-regulated along with 2 energy metabolites: glucose and 3-hydroxybutyric acid. Our findings showed dysregulations in the expression of different metabolites in the serum of women with PCOS suggesting the involvement of multiple pathways including amino acid metabolism, carbohydrate/lipid metabolism, purine and pyrimidine metabolism and protein synthesis.

Effects of topical hyaluronic acid on corneal wound healing in dogs: a pilot study.

PubMed

Gronkiewicz, Kristina M; Giuliano, Elizabeth A; Sharma, Ajay; Mohan, Rajiv R

2017-03-01

To investigate the efficacy of topical 0.2% hyaluronic acid in canine corneal ulcers in vivo. Six purpose-bred beagles were randomly assigned into two groups (three dogs/group): group A received experimental product (Optimend ™ , containing 0.2% hyaluronic acid, KineticVet ™ ); group B received control product (Optimend ™ without 0.2% hyaluronic acid and supplemented with carboxymethylcellulose). The clinical scorer was masked to product content and subject assignment. Under sedation and topical anesthesia, 6-mm axial corneal epithelial debridements were performed in the left eye. Wounded corneas received standard ulcer treatment and topical product (group A) or control product (group B) three times a day (TID) until ulcers were healed. Slit-lamp biomicroscopy was performed 6 h after wounding and then every 12 h; findings were graded according to modified McDonald-Shadduck scoring system; extraocular photography was performed after fluorescein stain application at all examination time points. Images were analyzed using NIH image j software to quantify rate of corneal epithelialization. Gelatin zymography was used to analyze matrix metalloproteinase (MMP) 2 and 9 protein expression in tears collected at set time points during the study period. No statistical differences in clinical ophthalmic examination scores, rate of corneal epithelialization, or MMP2 or MMP9 protein expression were found between groups at any tested time point. The application of 0.2% hyaluronic acid to standard ulcer medical management is well tolerated. Topical addition of the viscoelastic did not accelerate corneal wound healing compared to a topical control with similar viscosity in this study. © 2016 American College of Veterinary Ophthalmologists.

Disruption of Lipid Uptake in Astroglia Exacerbates Diet-Induced Obesity.

PubMed

Gao, Yuanqing; Layritz, Clarita; Legutko, Beata; Eichmann, Thomas O; Laperrousaz, Elise; Moullé, Valentine S; Cruciani-Guglielmacci, Celine; Magnan, Christophe; Luquet, Serge; Woods, Stephen C; Eckel, Robert H; Yi, Chun-Xia; Garcia-Caceres, Cristina; Tschöp, Matthias H

2017-10-01

Neuronal circuits in the brain help to control feeding behavior and systemic metabolism in response to afferent nutrient and hormonal signals. Although astrocytes have historically been assumed to have little relevance for such neuroendocrine control, we investigated whether lipid uptake via lipoprotein lipase (LPL) in astrocytes is required to centrally regulate energy homeostasis. Ex vivo studies with hypothalamus-derived astrocytes showed that LPL expression is upregulated by oleic acid, whereas it is decreased in response to palmitic acid or triglycerides. Likewise, astrocytic LPL deletion reduced the accumulation of lipid droplets in those glial cells. Consecutive in vivo studies showed that postnatal ablation of LPL in glial fibrillary acidic protein-expressing astrocytes induced exaggerated body weight gain and glucose intolerance in mice exposed to a high-fat diet. Intriguingly, astrocytic LPL deficiency also triggered increased ceramide content in the hypothalamus, which may contribute to hypothalamic insulin resistance. We conclude that hypothalamic LPL functions in astrocytes to ensure appropriately balanced nutrient sensing, ceramide distribution, body weight regulation, and glucose metabolism. © 2017 by the American Diabetes Association.

Saponins extracted from Dioscorea collettii rhizomes regulate the expression of urate transporters in chronic hyperuricemia rats.

PubMed

Zhu, Liran; Dong, Yifan; Na, Sha; Han, Ru; Wei, Chengyin; Chen, Guangliang

2017-09-01

The current study aimed to investigate whether the saponins, bioactive component of effects of D. collettii, could reduce the serum uric acid level in a hyperuricemic mouse via regulation of urate transporters. Chronic hyperuricemia model was established by combine administration of adenine (100mg/kg) and ethambutol (250mg/kg). In the model group, the serum uric acid (SUA), urine uric acid (UUA) volume, and 24-h UUA values increased significantly, while the uric acid clearance rate (CUr) and creatinine clearance rate (CCr) values decreased. Further, the model groups showed significantly lower expression of organic anion transporter 1 (OAT1) and organic anion transporter 3 (OAT3) and significantly higher expression of renal tubular urate transporter 1 (URAT1), glucose transporter 9 (GLUT9) and URAT1 mRNA than the normal control group. Saponins administration was found to have a dose-dependent effect, as evidenced by the increase in the 24-h UUA, CUr and CCr values; the decrease in SUA; the decrease in the renal expression of URAT1 mRNA and URAT1 and GLUT9 proteins; and the increase in the renal expression of the OAT1 and OAT3 proteins. The saponins extracted from D. collettii rhizomes had an obvious anti-hyperuricemic effect through downregulation of the URAT1 mRNA and the URAT1 and GLUT9 proteins and upregulation of the OAT1 and OAT3 proteins. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Dietary fat types differently modulate the activity and expression of mitochondrial carnitine/acylcarnitine translocase in rat liver.

PubMed

Priore, Paola; Stanca, Eleonora; Gnoni, Gabriele Vincenzo; Siculella, Luisa

2012-10-01

The carnitine/acylcarnitine translocase (CACT), an integral protein of the mitochondrial inner membrane, belongs to the carnitine-dependent system of fatty acid transport into mitochondria, where beta-oxidation occurs. CACT exchanges cytosolic acylcarnitine or free carnitine for carnitine in the mitochondrial matrix. The object of this study was to investigate in rat liver the effect, if any, of diets enriched with saturated fatty acids (beef tallow, BT, the control), n-3 polyunsaturated fatty acids (PUFA) (fish oil, FO), n-6 PUFA (safflower oil, SO), and mono-unsaturated fatty acids (MUFA) (olive oil, OO) on the activity and expression of CACT. Translocase exchange rates increased, in parallel with CACT mRNA abundance, upon FO-feeding, whereas OO-dietary treatment induced a decrease in both CACT activity and expression. No changes were observed upon SO-feeding. Nuclear run-on assay revealed that FO-treatment increased the transcriptional rate of CACT mRNA. On the other hand, only in the nuclei of hepatocytes from OO-fed rats splicing of the last intron of CACT pre-mRNA and the rate of formation of the 3'-end were affected. Overall, these findings suggest that compared to the BT-enriched diet, the SO-enriched diet did not influence CACT activity and expression, whereas FO- and OO-feeding alters CACT activity in an opposite fashion, i.e. modulating its expression at transcriptional and post-transcriptional levels, respectively. Copyright © 2012 Elsevier B.V. All rights reserved.

Myosin-cross-reactive antigen (MCRA) protein from Bifidobacterium breve is a FAD-dependent fatty acid hydratase which has a function in stress protection.

PubMed

Rosberg-Cody, Eva; Liavonchanka, Alena; Göbel, Cornelia; Ross, R Paul; O'Sullivan, Orla; Fitzgerald, Gerald F; Feussner, Ivo; Stanton, Catherine

2011-02-17

The aim of this study was to determine the catalytic activity and physiological role of myosin-cross-reactive antigen (MCRA) from Bifidobacterium breve NCIMB 702258. MCRA from B. breve NCIMB 702258 was cloned, sequenced and expressed in heterologous hosts (Lactococcus and Corynebacterium) and the recombinant proteins assessed for enzymatic activity against fatty acid substrates. MCRA catalysed the conversion of palmitoleic, oleic and linoleic acids to the corresponding 10-hydroxy fatty acids, but shorter chain fatty acids were not used as substrates, while the presence of trans-double bonds and double bonds beyond the position C12 abolished hydratase activity. The hydroxy fatty acids produced were not metabolised further. We also found that heterologous Lactococcus and Corynebacterium expressing MCRA accumulated increasing amounts of 10-HOA and 10-HOE in the culture medium. Furthermore, the heterologous cultures exhibited less sensitivity to heat and solvent stresses compared to corresponding controls. MCRA protein in B. breve can be classified as a FAD-containing double bond hydratase, within the carbon-oxygen lyase family, which may be catalysing the first step in conjugated linoleic acid (CLA) production, and this protein has an additional function in bacterial stress protection.

HPLC-PDA analysis and anti-inflammatory effects of Mori Cortex Radicis.

PubMed

Seo, Chang-Seob; Lim, Hye-Sun; Jeong, Soo-Jin; Ha, Hyekyung; Shin, Hyeun-Kyoo

2013-10-01

Mori Cortex Radicis (MCR, Moraceae) is used traditionally in the treatment ofjaundice, hematemesis, edema, and pollakisuria in Korea. In this study, the antiinflammatory effects of MCR extract were investigated using RAW 264.7 cells. The simultaneous analysis of five components present (neochlorogenic acid, chlorogenic acid, cryptochlorogenic acid, caffeic acid, and p-coumaric acid) in the MCR extract was performed using high-performance liquid chromatography (HPLC) coupled with photodiode array (PDA) detection. We determined the effects of MCR extract and its components on the production of nitric oxide (NO), prostaglandin E2 (PGE2), and mRNA expression of cyclooxygenase-2 (COX-2) in RAW 264.7 cells. MCR extract suppressed the production of NO and PGE2 in RAW 264.7 cells in a dose-dependent manner. None of the five components of the MCR extract had any influence on the production of NO. However, caffeic acid and p-coumaric acid inhibited the production of PGE2 and mRNA expression of COX-2 in RAW 264.7 cells. Our results suggest that MCR extract may offer potential as a therapeutic agent for the treatment of inflammation. The method we have established will help to improve the quality control of MCR extracts.

Intestinal absorption of the bile acid analogue 75Se-homocholic acid-taurine is increased in primary biliary cirrhosis, and reverts to normal during ursodeoxycholic acid administration.

PubMed

Lanzini, A; De Tavonatti, M G; Panarotto, B; Scalia, S; Mora, A; Benini, F; Baisini, O; Lanzarotto, F

2003-09-01

Whether ileal absorption of bile acid is up or downregulated in chronic cholestasis is still debated, and most evidence has come from animal studies. To compare ileal bile acid absorption in patients with primary biliary cirrhosis (PBC) and in healthy control subjects, and to assess the effect of ursodeoxycholic acid (UDCA). We studied 14 PBC patients before and during (n=11) UDCA administration, 14 healthy control subjects, and 14 Crohn's disease patients (as disease controls). We used cholescintigraphy to measure retention in the enterohepatic circulation over five successive days of the bile acid analogue (75)Se-homocholic acid-taurine ((75)SeHCAT) as an index of ileal bile acid absorption. Results were expressed as (75)SeHCAT fractional turnover rate (FTR) and t(1/2)12. (75)SeHCAT FTR was 0.19 (0.11)/day, 0.34 (0.11)/day (p<0.001), and 0.83 (0.32)/day in PBC patients, healthy controls (p<0.0001), and Crohn's patients (p<0.001), respectively, which increased to 0.36 (0.16)/day in PBC patients during UDCA treatment (p<0.005). (75)SeHCAT t(1/2)12 was 4.8 (2.1) days in PBC patients, 2.2 (0.5) days (p<0.001) in healthy controls, and 1.0 (0.5) days (p<0.001) in Crohn's disease patients. (75)SeHCAT t(1/2)12 decreased to 2.2 (0.93) days (p< 0.001) in PBC patients during UDCA treatment. Our results support the concept that ileal bile acid absorption is upregulated in PBC patients, and that this effect may contribute towards damaging the cholestatic liver. This upregulation of bile acid absorption is abolished by UDCA.

Changes in liver PPARalpha mRNA expression in response to two levels of high-safflower-oil diets correlate with changes in adiposity and serum leptin in rats and mice.

PubMed

Hsu, Shan-Ching; Huang, Ching-jang

2007-02-01

The ligand-dependent transcription factor peroxisome proliferator-activated receptor alpha (PPARalpha) is known to be activated by common fatty acids and to regulate the expression of genes of various lipid oxidation pathways and transport. High-fat diets provide more fatty acids, which presumably could enhance lipid catabolism through up-regulation of PPARalpha signaling. However, high intake of fat could also lead to obesity. To examine PPARalpha signaling in high-fat feeding and obesity, this study examined the hepatic mRNA expression of PPARalpha and some of its target genes in Wistar rats and C57BL/6J mice fed two levels (20% or 30% wt/wt) of high-safflower-oil (SFO; oleic-acid-rich) diets until animals showed significantly higher body weight (13 weeks for rats and 22 weeks for mice) than those of control groups fed a 5% SFO diet. At the end of these respective feeding periods, only the rats fed 30% SFO and the mice fed 20% SFO among the two groups fed high-fat diets showed significantly higher body weight, white adipose tissue weight, serum leptin and mRNA expression of PPARalpha (P<.05) compared to the respective control groups. Despite elevated acyl-CoA (a PPARalpha target gene) protein and activity in both groups fed high-fat diets, the mRNA expression level of most PPARalpha target genes examined correlated mainly to PPARalpha mRNA levels and not to fat intake or liver lipid levels. The observation that the liver PPARalpha mRNA expression in groups fed high-fat diets was significantly higher only in obese animals with elevated serum leptin implied that obesity and associated hyperleptinemia might have a stronger impact than dietary SFO intake per se on PPARalpha-regulated mRNA expression in the liver.

Xuebijing injection improves the respiratory function in rabbits with oleic acid-induced acute lung injury by inhibiting IL-6 expression and promoting IL-10 expression at the protein and mRNA levels

PubMed Central

WANG, YUXIA; JI, MINGLI; WANG, LEI; CHEN, LIPING; LI, JING

2014-01-01

Xuebijing injection is a complex herbal medicine, and clinical and experimental studies have shown that it has a significant effect on acute respiratory distress syndrome and multiple organ dysfunction syndrome. However, the majority of studies regarding Xuebijing injection have focused on serum inflammatory factors, and few studies have been carried out from the perspective of the protein and mRNA expression of inflammatory cytokines. In this study, 60 healthy rabbits of mixed gender were randomly assigned to a normal control group (CG), oleic acid group (model group; MG) and oleic acid + Xuebijing injection group (treatment group; TG). Rabbits of the CG were treated with normal saline through the ear vein, rabbits of the MG were injected with oleic acid (0.4 ml/kg) and rabbits of the TG received 0.4 ml/kg oleic acid + 10 ml/kg Xuebijing injection. Blood samples were collected from the common carotid artery of all rabbits of all groups 1 h after the ear vein was injected with the corresponding reagent, and was used to measure the arterial partial pressure of oxygen (PaO2) and of carbon dioxide (PaCO2). The activity of myeloperoxidase (MPO) was tested, and the protein and mRNA expression levels of interleukin (IL)-6 and IL-10 were determined. Rabbits of the MG exhibited evident respiratory dysfunction (PaO2 and PaCO2 were low), histopathological lung damage and overactive inflammatory responses (the expression of the proinflammatory cytokine IL-6 and the anti-inflammatory cytokine IL-10 was increased at the protein and mRNA levels). Following the administration of the Xuebijing injection, the inflammatory response of the rabbits was significantly reduced. Xuebijing injection raised PaO2 and PaCO2, weakened the activity of MPO in the lung tissue, downregulated the expression of the proinflammatory cytokine IL-6 and further increased the expression of the anti-inflammatory cytokine IL-10. These results demonstrated that Xuebijing injection improved the respiratory function of rabbits with acute oleic acid-induced lung injury by inhibiting IL-6 expression and promoting IL-10 expression. PMID:25289065

Alterations of polyunsaturated fatty acid metabolism in ovarian tissues of polycystic ovary syndrome rats.

PubMed

Huang, Rong; Xue, Xinli; Li, Shengxian; Wang, Yuying; Sun, Yun; Liu, Wei; Yin, Huiyong; Tao, Tao

2018-03-30

The metabolism of polyunsaturated fatty acids (PUFAs) remains poorly characterized in ovarian tissues of patients with polycystic ovary syndrome (PCOS). This study aimed to explore alterations in the levels of PUFAs and their metabolites in serum and ovarian tissues in a PCOS rat model treated with a high-fat diet and andronate. Levels of PUFAs and their metabolites were measured using gas/liquid chromatography-mass spectrometry after the establishment of a PCOS rat model. Only 3 kinds of PUFAs [linoleic acid, arachidonic acid (AA) and docosahexaenoic acid] were detected in both the circulation and ovarian tissues of the rats, and their concentrations were lower in ovarian tissues than in serum. Moreover, significant differences in the ovarian levels of AA were observed between control, high-fat diet-fed and PCOS rats. The levels of prostaglandins, AA metabolites via the cyclooxygenase (COX) pathway, in ovarian tissues of the PCOS group were significantly increased compared to those in the controls. Further studies on the mechanism underlying this phenomenon showed a correlation between decreased expression of phosphorylated cytosolic phospholipase A2 (p-cPLA2) and increased mRNA and protein expression of COX2, potentially leading to a deeper understanding of altered AA and prostaglandin levels in ovarian tissues of PCOS rats. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Carnosic acid attenuates obesity-induced glucose intolerance and hepatic fat accumulation by modulating genes of lipid metabolism in C57BL/6J-ob/ob mice.

PubMed

Park, Mi-Young; Sung, Mi-Kyung

2015-03-15

Carnosic acid (CA), a major bioactive component of rosemary (Rosmarinus officinalis) leaves, is known to possess antioxidant and anti-adipogenic activities. In this study it was hypothesized that CA would ameliorate obesity-induced glucose intolerence and hepatic fat accumulation, and possible mechanisms are suggested. It was observed that a 0.02% (w/w) CA diet effectively decreased body weight, liver weight and blood triglyceride (TG) and total cholesterol levels (P < 0.05) compared with the control diet. CA at 0.02% significantly improved glucose tolerance, and hepatic TG accumulation was reduced in a dose-dependent manner. Hepatic lipogenic-related gene (L-FABP, SCD1 and FAS) expression decreased whereas lipolysis-related gene (CPT1) expression increased in animals fed the 0.02% CA diet (P < 0.05). Long-chain fatty acid content and the ratio of C18:1/C18:0 fatty acids were decreased in adipose tissue of animals fed the 0.02% CA diet (P < 0.05). Serum inflammatory mediators were also decreased significantly in animals fed the 0.02% CA diet compared with those of the obese control group (P < 0.05). These results suggest that CA is an effective anti-obesity agent that regulates fatty acid metabolism in C57BL/6J-ob/ob mice. © 2014 Society of Chemical Industry.

Rhizomucor miehei triglyceride lipase is processed and secreted from transformed Aspergillus oryzae.

PubMed

Huge-Jensen, B; Andreasen, F; Christensen, T; Christensen, M; Thim, L; Boel, E

1989-09-01

The cDNA encoding the precursor of the Rhizomucor miehei triglyceride lipase was inserted in an Aspergillus oryzae expression vector. In this vector the expression of the lipase cDNA is under control of the Aspergillus oryzae alpha-amylase gene promoter and the Aspergillus niger glucoamylase gene terminator. The recombinant plasmid was introduced into Aspergillus oryzae, and transformed colonies were selected and screened for lipase expression. Lipase-positive transformants were grown in a small fermentor, and recombinant triglyceride lipase was purified from the culture broth. The purified enzymatically active recombinant lipase (rRML) secreted from A. oryzae was shown to have the same characteristics with respect to mobility on reducing SDS-gels and amino acid composition as the native enzyme. N-terminal amino acid sequencing indicated that approximately 70% of the secreted rRML had the same N-terminal sequence as the native Rhizomucor miehei enzyme, whereas 30% of the secreted rRML was one amino acid residue shorter in the N-terminal. The recombinant lipase precursor, which has a 70 amino acid propeptide, is thus processed in and secreted from Aspergillus oryzae. We have hereby demonstrated the utility of this organism as a host for the production of recombinant triglyceride lipases.

Identification of a Specific Isoform of Tomato Lipoxygenase (TomloxC) Involved in the Generation of Fatty Acid-Derived Flavor Compounds1

PubMed Central

Chen, Guoping; Hackett, Rachel; Walker, David; Taylor, Andy; Lin, Zhefeng; Grierson, Donald

2004-01-01

There are at least five lipoxygenases (TomloxA, TomloxB, TomloxC, TomloxD, and TomloxE) present in tomato (Lycopersicon esculentum Mill.) fruit, but their role in generation of fruit flavor volatiles has been unclear. To assess the physiological role of TomloxC in the generation of volatile C6 aldehyde and alcohol flavor compounds, we produced transgenic tomato plants with greatly reduced TomloxC using sense and antisense constructs under control of the cauliflower mosaic virus 35S promoter. The expression level of the TomloxC mRNA in some transgenic plants was selectively reduced by gene silencing or antisense inhibition to between 1% and 5% of the wild-type controls, but the expression levels of mRNAs for the four other isoforms were unaffected. The specific depletion of TomloxC in transgenic tomatoes led to a marked reduction in the levels of known flavor volatiles, including hexanal, hexenal, and hexenol, to as little as 1.5% of those of wild-type controls following maceration of ripening fruit. Addition of linoleic or linolenic acid to fruit homogenates significantly increased the levels of flavor volatiles, but the increase with the TomloxC-depleted transgenic fruit extracts was much lower than with the wild-type control. Confocal imaging of tobacco (Nicotiana tabacum) leaf cells expressing a TomloxC-GFP fusion confirmed a chloroplast localization of the protein. Together, these results suggest that TomloxC is a chloroplast-targeted lipoxygenase isoform that can use both linoleic and linolenic acids as substrates to generate volatile C6 flavor compounds. The roles of the other lipoxygenase isoforms are discussed. PMID:15347800

Gastroprotective actions of Taraxacum coreanum Nakai water extracts in ethanol-induced rat models of acute and chronic gastritis.

PubMed

Yang, Hye Jeong; Kim, Min Jung; Kwon, Dae Young; Kang, Eun Seon; Kang, Suna; Park, Sunmin

2017-08-17

Taraxacum coreanum Nakai has been traditionally used for treating inflammatory diseases including gastrointestinal diseases. We studied whether water extracts of Taraxacum coreanum Nakai (TCN) had a protective effect on acute and chronic gastritis induced by ethanol/HCl in an animal model of gastritis and its mechanism was also explored. In the acute study, rats were orally administered 0.15g/mL dextrin (normal-control), 0.15g/mL dextrin (control), 0.05g/mL TCN (TCN-L), 0.15g/mL TCN (TCN-H), or 0.01g/mL omeprazole (orally; positive-control), followed by oral administration of 1mL of 60% ethanol plus 150mM HCl (inducer). In the chronic study, rats were administered 10% diluted inducer in drinking water, and 0.6% dextrin, 0.2% or 0.6% TCN, and 0.05% omeprazole were administered in chow for 4 weeks. Acid content, gastric structure, oxidative stress, and markers of inflammation in the stomach tissue were measured at the end of experiment. Acute and chronic ethanol/HCl administration caused the inner layer of the stomach to redden, hemorrhage, and edema in the control group; TCN-H reduced these symptoms more effectively than did the omeprazole positive-control. Acid production and total acidity in the stomach increased in the control group, which was markedly suppressed by omeprazole. TCN also reduced the acid production and acidity, but not to the same degree as omeprazole. H-E and PAS staining revealed that in the inner layer of the stomach, cellular structure was disrupted, with an increased nuclear size and thickness, disarrangement, and decreased mucin in the control group. TCN prevented the cellular disruption in the inner layer, and TCN-H was more effective than the positive-control. This was associated with oxidative stress and inflammation. TCN dose-dependently reduced the infiltration of mast cells and TNF-α expression in the inner layer of the stomach, and decreased lipid peroxides by increasing superoxide dismutase and glutathione peroxidase expression. TCN-H acutely and chronically protected against gastritis and gastric ulcer by reducing oxidative stress and inflammation, not by completely suppressing gastric acid production. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

Effects of down-regulating ornithine decarboxylase upon putrescine-associated metabolism and growth in Nicotiana tabacum L.

PubMed Central

Dalton, Heidi L.; Blomstedt, Cecilia K.; Neale, Alan D.; Gleadow, Ros; DeBoer, Kathleen D.; Hamill, John D.

2016-01-01

Transgenic plants of Nicotiana tabacum L. homozygous for an RNAi construct designed to silence ornithine decarboxylase (ODC) had significantly lower concentrations of nicotine and nornicotine, but significantly higher concentrations of anatabine, compared with vector-only controls. Silencing of ODC also led to significantly reduced concentrations of polyamines (putrescine, spermidine and spermine), tyramine and phenolamides (caffeoylputrescine and dicaffeoylspermidine) with concomitant increases in concentrations of amino acids ornithine, arginine, aspartate, glutamate and glutamine. Root transcript levels of S-adenosyl methionine decarboxylase, S-adenosyl methionine synthase and spermidine synthase (polyamine synthesis enzymes) were reduced compared with vector controls, whilst transcript levels of arginine decarboxylase (putrescine synthesis), putrescine methyltransferase (nicotine production) and multi-drug and toxic compound extrusion (alkaloid transport) proteins were elevated. In contrast, expression of two other key proteins required for alkaloid synthesis, quinolinic acid phosphoribosyltransferase (nicotinic acid production) and a PIP-family oxidoreductase (nicotinic acid condensation reactions), were diminished in roots of odc-RNAi plants relative to vector-only controls. Transcriptional and biochemical differences associated with polyamine and alkaloid metabolism were exacerbated in odc-RNAi plants in response to different forms of shoot damage. In general, apex removal had a greater effect than leaf wounding alone, with a combination of these injury treatments producing synergistic responses in some cases. Reduced expression of ODC appeared to have negative effects upon plant growth and vigour with some leaves of odc-RNAi lines being brittle and bleached compared with vector-only controls. Together, results of this study demonstrate that ornithine decarboxylase has important roles in facilitating both primary and secondary metabolism in Nicotiana. PMID:27126795

Inorganic arsenic exposure increased expression of Fas and Bax gene in vivo and vitro.

PubMed

He, Yuefeng; Zhang, Ruobing; Xiaoxiao, Song; Li, Shang; Xinan, Wu; Huang, Dahai

2018-06-01

Accumulating evidences have shown that apoptosis plays an important role in mediating the therapeutic effects and toxicity of arsenic. Fas and Bax genes are critical regulatory genes for apoptosis. In this study, we investigated the association between levels of Fas and Bax expression and the three arsenic species (inorganic arsenic (iAs), monomethylarsonic acid (MMA) and dimethylarsinic acid (DMA)) in vivo and vitro. Three arsenic species in urine were measured and levels of Fas and Bax expression were examined by the quantitative real-time PCR (qPCR) for all subjects. We found that Fas and Bax mRNA expression in the exposed group were significantly higher than that in the control group. The levels of gene expression were positively correlated with the concentrations of urinary iAs, MMA and DMA in all subjects. Sodium arsenite induced Fas and Bax mRNA expression, then MMA and DMA did not induce mRNA expression in MDA-MB-231 and XWLC-05 cells. The findings of the present study indicated that iAs, MMA, and DMA had different effects on expression of Bax and Fas gene. Copyright © 2017. Published by Elsevier B.V.

Omega-3 Fatty Acid Deficiency Augments Risperidone-Induced Hepatic Steatosis in Rats: Positive Association with Stearoyl-CoA Desaturase

PubMed Central

McNamara, Robert K.; Magrisso, I. Jack; Hofacer, Rylon; Jandacek, Ronald; Rider, Therese; Tso, Patrick; Benoit, Stephen C.

2012-01-01

Psychiatric patients frequently exhibit long-chain n-3 (LCn-3) fatty acid deficits and elevated triglyceride (TAG) production following chronic exposure to second generation antipsychotics (SGA). Emerging evidence suggests that SGAs and LCn-3 fatty acids have opposing effects on stearoyl-CoA desaturase-1 (SCD1), which plays a pivotal role in TAG biosynthesis. Here we evaluated whether low LCn-3 fatty acid status would augment elevations in rat liver and plasma TAG concentrations following chronic treatment with the SGA risperidone (RSP), and evaluated relationships with hepatic SCD1 expression and activity indices. In rats maintained on the n-3 fatty acid-fortified (control) diet, chronic RSP treatment significantly increased liver SCD1 mRNA and activity indices (18:1/18:0 and 16:1/16:0 ratios), and significantly increased liver, but not plasma, TAG concentrations. Rats maintained on the n-3 deficient diet exhibited significantly lower liver and erythrocyte LCn-3 fatty acid levels, and associated elevations in LCn-6/LCn-3 ratio. In n-3 deficient rats, RSP-induced elevations in liver SCD1 mRNA and activity indices (18:1/18:0 and 16:1/16:0 ratios) and liver and plasma TAG concentrations were significantly greater than those observed in RSP-treated controls. Plasma glucose levels were not altered by diet or RSP, and body weight was lower in RSP- and VEH-treated n-3 deficient rats. These preclinical data support the hypothesis that low n-3 fatty acid status exacerbates RSP-induced hepatic steatosis by augmenting SCD1 expression and activity. PMID:22750665

Short-term glutamine supplementation decreases lung inflammation and the receptor for advanced glycation end-products expression in direct acute lung injury in mice.

PubMed

Chuang, Yin-Ching; Shaw, Huey-Mei; Chen, Chi-Chung; Pan, He-Jia; Lai, Wei-Chih; Huang, Hui-Ling

2014-07-15

Glutamine (GLN) has been reported to improve clinical and experimental sepsis outcomes. However, the mechanisms underlying the actions of GLN remain unclear, and may depend upon the route of GLN administration and the model of acute lung injury (ALI) used. The aim of this study was to investigate whether short-term GLN supplementation had an ameliorative effect on the inflammation induced by direct acid and lipopolysaccharide (LPS) challenge in mice. Female BALB/c mice were divided into two groups, a control group and a GLN group (4.17% GLN supplementation). After a 10-day feeding period, ALI was induced by intratracheal administration of hydrochloric acid (pH 1.0; 2 mL/kg of body weight [BW]) and LPS (5 mg/kg BW). Mice were sacrificed 3 h after ALI challenge. In this early phase of ALI, serum, lungs, and bronchoalveolar lavage fluid (BALF) from the mice were collected for further analysis. The results of this study showed that ALI-challenged mice had a significant increase in myeloperoxidase activity and expression of interleukin (IL)-1β, IL-6, and tumor necrosis factor-α in the lung compared with unchallenged mice. Compared with the control group, GLN pretreatment in ALI-challenged mice reduced the levels of receptor for advanced glycation end-products (RAGE) and IL-1β production in BALF, with a corresponding decrease in their mRNA expression. The GLN group also had markedly lower in mRNA expression of cyclooxygenase-2 and NADPH oxidase-1. These results suggest that the benefit of dietary GLN may be partly contributed to an inhibitory effect on RAGE expression and pro-inflammatory cytokines production at an early stage in direct acid and LPS-induced ALI in mice.

Effect of the difference in vehicles on gene expression in the rat liver--analysis of the control data in the Toxicogenomics Project Database.

PubMed

Takashima, Kayoko; Mizukawa, Yumiko; Morishita, Katsumi; Okuyama, Manabu; Kasahara, Toshihiko; Toritsuka, Naoki; Miyagishima, Toshikazu; Nagao, Taku; Urushidani, Tetsuro

2006-05-08

The Toxicogenomics Project is a 5-year collaborative project by the Japanese government and pharmaceutical companies in 2002. Its aim is to construct a large-scale toxicology database of 150 compounds orally administered to rats. The test consists of a single administration test (3, 6, 9 and 24 h) and a repeated administration test (3, 7, 14 and 28 days), and the conventional toxicology data together with the gene expression data in liver as analyzed by using Affymetrix GeneChip are being accumulated. In the project, either methylcellulose or corn oil is employed as vehicle. We examined whether the vehicle itself affects the analysis of gene expression and found that corn oil alone affected the food consumption and biochemical parameters mainly related to lipid metabolism, and this accompanied typical changes in the gene expression. Most of the genes modulated by corn oil were related to cholesterol or fatty acid metabolism (e.g., CYP7A1, CYP8B1, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase, squalene epoxidase, angiopoietin-like protein 4, fatty acid synthase, fatty acid binding proteins), suggesting that the response was physiologic to the oil intake. Many of the lipid-related genes showed circadian rhythm within a day, but the expression pattern of general clock genes (e.g., period 2, arylhydrocarbon nuclear receptor translocator-like, D site albumin promoter binding protein) were unaffected by corn oil, suggesting that the effects are specific for lipid metabolism. These results would be useful for usage of the database especially when drugs with different vehicle control are compared.

Alterations of intercellular junctions in peritoneal mesothelial cells from patients undergoing dialysis: effect of retinoic Acid.

PubMed

Retana, Carmen; Sanchez, Elsa; Perez-Lopez, Alejandro; Cruz, Armando; Lagunas, Jesus; Cruz, Carmen; Vital, Socorro; Reyes, Jose L

2015-01-01

Dialysis patients are classified according to their peritoneal permeability as low transporter (LT, low solute permeability) or high transporter (HT, high solute permeability). Tight junction (TJ) proteins are critical to maintain ions, molecules and water paracellular transport through peritoneum. Exposure to peritoneal dialysis solutions causes damage to TJ in human peritoneal mesothelial cells (HPMCs). We analyzed the quantity, distribution and function of TJ proteins: claudin-1, -2 and -8, ZO-1 and occludin, in HPMC cultures from LT and HT patients. Since all-trans retinoic acid (ATRA) might modify the expression of TJ proteins, we studied its effect on HPMCs. Control HPMCs were isolated from human omentum, while HT or LT cells were obtained from dialysis effluents. Cells were cultured in presence of ATRA 0, 50 or 100 nM. Transepithelial electrical resistance (TER) measurement, immunostaining and Western blot analyses were performed. HT exhibited lower TER than control and LT monolayers. Immunofluorescence for TJ was weak and discontinuous along the cell contour, in LT and HT. Furthermore, claudin-1, occludin and ZO-1 expressions were decreased. In all groups, claudin-2 was localized at nuclei. We observed that ATRA improved TJ distribution and increased TJ expression in HT. This retinoid did not modify claudin-2 and -8 expressions. All-trans retinoic acid decreased TER in HT, but had no effect in LT. Tight junctions were altered in HPMCs from dialyzed patients. The HT monolayer has lower TER than LT, which might be associated with the peritoneal permeability in these patients. ATRA might be a therapeutic alternative to maintain mesothelial integrity, since it improved TJ localization and expression. Copyright © 2015 International Society for Peritoneal Dialysis.

Alterations of Intercellular Junctions in Peritoneal Mesothelial Cells from Patients Undergoing Dialysis: Effect of Retinoic Acid

PubMed Central

Retana, Carmen; Sanchez, Elsa; Perez-Lopez, Alejandro; Cruz, Armando; Lagunas, Jesus; Cruz, Carmen; Vital, Socorro; Reyes, Jose L.

2015-01-01

♦ Background: Dialysis patients are classified according to their peritoneal permeability as low transporter (LT, low solute permeability) or high transporter (HT, high solute permeability). Tight junction (TJ) proteins are critical to maintain ions, molecules and water paracellular transport through peritoneum. Exposure to peritoneal dialysis solutions causes damage to TJ in human peritoneal mesothelial cells (HPMCs). We analyzed the quantity, distribution and function of TJ proteins: claudin-1, -2 and -8, ZO-1 and occludin, in HPMC cultures from LT and HT patients. Since all-trans retinoic acid (ATRA) might modify the expression of TJ proteins, we studied its effect on HPMCs. ♦ Methods: Control HPMCs were isolated from human omentum, while HT or LT cells were obtained from dialysis effluents. Cells were cultured in presence of ATRA 0, 50 or 100 nM. Transepithelial electrical resistance (TER) measurement, immunostaining and Western blot analyses were performed. ♦ Results: HT exhibited lower TER than control and LT monolayers. Immunofluorescence for TJ was weak and discontinuous along the cell contour, in LT and HT. Furthermore, claudin-1, occludin and ZO-1 expressions were decreased. In all groups, claudin-2 was localized at nuclei. We observed that ATRA improved TJ distribution and increased TJ expression in HT. This retinoid did not modify claudin-2 and -8 expressions. All-trans retinoic acid decreased TER in HT, but had no effect in LT. ♦ Conclusions: Tight junctions were altered in HPMCs from dialyzed patients. The HT monolayer has lower TER than LT, which might be associated with the peritoneal permeability in these patients. ATRA might be a therapeutic alternative to maintain mesothelial integrity, since it improved TJ localization and expression. PMID:24584604

Genetic elicitation by inducible expression of β-cryptogein stimulates secretion of phenolics from Coleus blumei hairy roots.

PubMed

Vuković, Rosemary; Bauer, Nataša; Curković-Perica, Mirna

2013-02-01

The accumulation of phenolic compounds in plants is often part of the defense response against stress and pathogen attack, which can be triggered and activated by elicitors. Oomycetal proteinaceous elicitor, β-cryptogein, induces hypersensitive response and systemic acquired resistance against some pathogens. In order to test the effect of endogenously synthesized cryptogein protein on phenolic compounds accumulation in tissue, and secretion into the culture medium, Coleus blumei hairy roots were generated. Agrobacterium rhizogenes was employed to insert synthetic crypt gene, encoding β-cryptogein, under the control of alcohol-inducible promoter. The expression of β-cryptogein, in C. blumei hairy roots, was controlled by application of 1% and 2% ethanol, during 21 days induction period. Ethanol-induced expression of β-cryptogein caused significant decrease of soluble phenolics and rosmarinic acid (RA) in hairy root lines and increase of phenolics, RA and caffeic acid in culture medium. These data suggest that β-cryptogein might be a potential regulatory factor for phenolics secretion from the roots. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Anti-oxidant effects of pomegranate juice on Saccharomyces cerevisiae cell growth.

PubMed

Aslan, Abdullah; Can, Muhammed İsmail; Boydak, Didem

2014-01-01

Pomegranate juice has a number of positive effects on both human and animal subjects. Four groups were used in this study. i: Control group, ii: H2O2 group, iii: Pomegranate juice (PJ) group and iv: PJ + H2O2 group. Following the sterilization method for pomegranate juice (10%) and H2O2 (6% v/v), Saccharomyces cerevisiae cultures were added and the cultivation incubated at 35°C for 72 hours. Fatty acids and vitamin concentrations were measured using HPLC and GC and the total protein bands profile were determined by SDS-PAGE. According to our results statistically significant differences have been determined among the study groups in terms of fatty acids and vitamin (p<0,05). Fatty acid synthesis, vitamin control and cell density increased in groups to which PJ was given in comparison with the control group (p<0,05). Pomegranate juice increased vitamins, fatty acids and total protein expression in Saccharomyces cerevisiae in comparison with the control. Pomegranate juice has a positive effect on fatty acid, vitamin and protein synthesis by Saccharomyces cerevisiae. Accordingly, we believe that it has significantly decreased oxidative damage thereby making a positive impact on yeast development.

Skeletal muscle-specific eukaryotic translation initiation factor 2α phosphorylation controls amino acid metabolism and fibroblast growth factor 21-mediated non-cell-autonomous energy metabolism.

PubMed

Miyake, Masato; Nomura, Akitoshi; Ogura, Atsushi; Takehana, Kenji; Kitahara, Yoshihiro; Takahara, Kazuna; Tsugawa, Kazue; Miyamoto, Chinobu; Miura, Naoko; Sato, Ryosuke; Kurahashi, Kiyoe; Harding, Heather P; Oyadomari, Miho; Ron, David; Oyadomari, Seiichi

2016-02-01

The eukaryotic translation initiation factor 2α (eIF2α) phosphorylation-dependent integrated stress response (ISR), a component of the unfolded protein response, has long been known to regulate intermediary metabolism, but the details are poorly worked out. We report that profiling of mRNAs of transgenic mice harboring a ligand-activated skeletal muscle-specific derivative of the eIF2α protein kinase R-like ER kinase revealed the expected up-regulation of genes involved in amino acid biosynthesis and transport but also uncovered the induced expression and secretion of a myokine, fibroblast growth factor 21 (FGF21), that stimulates energy consumption and prevents obesity. The link between the ISR and FGF21 expression was further reinforced by the identification of a small-molecule ISR activator that promoted Fgf21 expression in cell-based screens and by implication of the ISR-inducible activating transcription factor 4 in the process. Our findings establish that eIF2α phosphorylation regulates not only cell-autonomous proteostasis and amino acid metabolism, but also affects non-cell-autonomous metabolic regulation by induced expression of a potent myokine. © FASEB.

The role of the megagametophyte in maintaining loblolly pine (Pinus taeda L.) seedling arginase gene expression in vitro.

PubMed

Todd, Christopher D; Gifford, David J

2002-05-01

Following loblolly pine (Pinus taeda L.) seed germination, storage-protein breakdown in the megagametophyte and in the seedling results in a large increase in the seedling's free amino acid pool. A substantial portion of both the storage proteins and the amino acid pool is arginine, a very efficient nitrogen-storage compound. Free arginine is hydrolyzed in the seedling by the enzyme arginase (EC 3.5.3.1), which is under strong developmental control. At present, regulation of arginase in conifers is not well understood. Here we report the utilization of an in vitro culture system to address the separate impacts of the seedling and megagametophyte tissues on arginase enzyme activity, protein levels and patterns of gene expression. We also describe the generation of an anti-arginase antibody prepared from a histidine-tagged loblolly pine arginase fusion protein expressed in Escherichia coli. Our results indicate that arginase gene expression in the seedling is initiated by the seedling itself and then maintained or up-regulated by the megagametophyte. The contribution of storage-protein breakdown and the free amino acid pool, particularly arginine, in this regulation is also addressed.

Transgenic expression of phytase in wheat endosperm increases bioavailability of iron and zinc in grains.

PubMed

Abid, Nabeela; Khatoon, Asia; Maqbool, Asma; Irfan, Muhammad; Bashir, Aftab; Asif, Irsa; Shahid, Muhammad; Saeed, Asma; Brinch-Pedersen, Henrik; Malik, Kauser A

2017-02-01

Phytate is a major constituent of wheat seeds and chelates metal ions, thus reducing their bioavailability and so the nutritional value of grains. Transgenic plants expressing heterologous phytase are expected to enhance degradation of phytic acid stored in seeds and are proposed to increase the in vitro bioavailability of mineral nutrients. Wheat transgenic plants expressing Aspergillus japonicus phytase gene (phyA) in wheat endosperm were developed till T 3 generation. The transgenic lines exhibited 18-99 % increase in phytase activity and 12-76 % reduction of phytic acid content in seeds. The minimum phytic acid content was observed in chapatti (Asian bread) as compared to flour and dough. The transcript profiling of phyA mRNA indicated twofold to ninefold higher expression as compared to non transgenic controls. There was no significant difference in grain nutrient composition of transgenic and non-transgenic seeds. In vitro bioavailability assay for iron and zinc in dough and chapatti of transgenic lines revealed a significant increase in iron and zinc contents. The development of nutritionally enhanced cereals is a step forward to combat nutrition deficiency for iron and zinc in malnourished human population, especially women and children.

Engineering biotin prototrophic Corynebacterium glutamicum strains for amino acid, diamine and carotenoid production.

PubMed

Peters-Wendisch, P; Götker, S; Heider, S A E; Komati Reddy, G; Nguyen, A Q; Stansen, K C; Wendisch, V F

2014-12-20

The Gram-positive Corynebacterium glutamicum is auxotrophic for biotin. Besides the biotin uptake system BioYMN and the transcriptional regulator BioQ, this bacterium possesses functional enzymes for the last three reactions of biotin synthesis starting from pimeloyl-CoA. Heterologous expression of bioF from the Gram-negative Escherichia coli enabled biotin synthesis from pimelic acid added to the medium, but expression of bioF together with bioC and bioH from E. coli did not entail biotin prototrophy. Heterologous expression of bioWAFDBI from Bacillus subtilis encoding another biotin synthesis pathway in C. glutamicum allowed for growth in biotin-depleted media. Stable growth of the recombinant was observed without biotin addition for eight transfers to biotin-depleted medium while the empty vector control stopped growth after the first transfer. Expression of bioWAFDBI from B. subtilis in C. glutamicum strains overproducing the amino acids l-lysine and l-arginine, the diamine putrescine, and the carotenoid lycopene, respectively, enabled formation of these products under biotin-depleted conditions. Thus, biotin-prototrophic growth and production by recombinant C. glutamicum were achieved. Copyright © 2014 Elsevier B.V. All rights reserved.

StearoylCoA Desaturase-5: A Novel Regulator of Neuronal Cell Proliferation and Differentiation

PubMed Central

Sinner, Debora I.; Kim, Gretchun J.; Henderson, Gregory C.; Igal, R. Ariel

2012-01-01

Recent studies have demonstrated that human stearoylCoA desaturase-1 (SCD1), a Δ9-desaturase that converts saturated fatty acids (SFA) into monounsaturated fatty acids, controls the rate of lipogenesis, cell proliferation and tumorigenic capacity in cancer cells. However, the biological function of stearoylCoA desaturase-5 (SCD5), a second isoform of human SCD that is highly expressed in brain, as well as its potential role in human disease, remains unknown. In this study we report that the constitutive overexpression of human SCD5 in mouse Neuro2a cells, a widely used cell model of neuronal growth and differentiation, displayed a greater n-7 MUFA-to-SFA ratio in cell lipids compared to empty-vector transfected cells (controls). De novo synthesis of phosphatidylcholine and cholesterolesters was increased whereas phosphatidylethanolamine and triacylglycerol formation was reduced in SCD5-expressing cells with respect to their controls, suggesting a differential use of SCD5 products for lipogenic reactions. We also observed that SCD5 expression markedly accelerated the rate of cell proliferation and suppressed the induction of neurite outgrowth, a typical marker of neuronal differentiation, by retinoic acid indicating that the desaturase plays a key role in the mechanisms of cell division and differentiation. Critical signal transduction pathways that are known to modulate these processes, such epidermal growth factor receptor (EGFR)Akt/ERK and Wnt, were affected by SCD5 expression. Epidermal growth factor-induced phosphorylation of EGFR, Akt and ERK was markedly blunted in SCD5-expressing cells. Furthermore, the activity of canonical Wnt was reduced whereas the non-canonical Wnt was increased by the presence of SCD5 activity. Finally, SCD5 expression increased the secretion of recombinant Wnt5a, a non-canonical Wnt, whereas it reduced the cellular and secreted levels of canonical Wnt7b. Our data suggest that, by a coordinated modulation of key lipogenic pathways and transduction signaling cascades, SCD5 participates in the regulation of neuronal cell growth and differentiation. PMID:22745828

Changes on lipid peroxidation,enzymatic activities and gene expression in planarian (Dugesia japonica) following exposure to perfluorooctanoic acid.

PubMed

Yuan, Zuoqing; Miao, Zili; Gong, Xiaoning; Zhao, Baoying; Zhang, Yuanyuan; Ma, Hongdou; Zhang, Jianyong; Zhao, Bosheng

2017-11-01

We investigated perfluorooctanoic acid (PFOA)-induced stress response in planarians. We administered different concentrations of PFOA to planarians for up to 10 d. PFOA exposure resulted in significant concentration-dependent elevations in lipid peroxidation, glutathione S-transferase and caspase-3 protease activities, and a significant decline in glutathione peroxidase activities compared with control groups. Exposure to PFOA significantly up-regulated the heat shock proteins hsp70 and hsp90, and p53, and down-regulated hsp40 compared with controls. PFOA exposure also increased HSP70 protein levels, as demonstrated by western blot analysis. These alterations indicated that PFOA exposure induced a stress response and affected the regulation of oxidative stress, enzymatic activities and gene expression. These results suggest that these sensitive parameters, together with other biomarkers, could be used for evaluating toxicity, for ecological risk assessment of PFOA in freshwaters. Copyright © 2017 Elsevier Inc. All rights reserved.

Characterization of the Candida albicans Amino Acid Permease Family: Gap2 Is the Only General Amino Acid Permease and Gap4 Is an S-Adenosylmethionine (SAM) Transporter Required for SAM-Induced Morphogenesis.

PubMed

Kraidlova, Lucie; Schrevens, Sanne; Tournu, Hélène; Van Zeebroeck, Griet; Sychrova, Hana; Van Dijck, Patrick

2016-01-01

Amino acids are key sources of nitrogen for growth of Candida albicans . In order to detect and take up these amino acids from a broad range of different and changing nitrogen sources inside the host, this fungus must be able to adapt via its expression of genes for amino acid uptake and further metabolism. We analyzed six C. albicans putative general amino acid permeases based on their homology to the Saccharomyces cerevisiae Gap1 general amino acid permease. We generated single- and multiple-deletion strains and found that, based on growth assays and transcriptional or posttranscriptional regulation, Gap2 is the functional orthologue to Sc Gap1, with broad substrate specificity. Expression analysis showed that expression of all GAP genes is under control of the Csy1 amino acid sensor, which is different from the situation in S. cerevisiae , where the expression of ScGAP1 is not regulated by Ssy1. We show that Gap4 is the functional orthologue of Sc Sam3, the only S -adenosylmethionine (SAM) transporter in S. cerevisiae , and we report that Gap4 is required for SAM-induced morphogenesis. IMPORTANCE Candida albicans is a commensal organism that can thrive in many niches in its human host. The environmental conditions at these different niches differ quite a bit, and this fungus must be able to sense these changes and adapt its metabolism to them. Apart from glucose and other sugars, the uptake of amino acids is very important. This is underscored by the fact that the C. albicans genome encodes 6 orthologues of the Saccharomyces. cerevisiae general amino acid permease Gap1 and many other amino acid transporters. In this work, we characterize these six permeases and we show that C. albicans Gap2 is the functional orthologue of Sc Gap1 and that C. albicans Gap4 is an orthologue of Sc Sam3, an S -adenosylmethionine (SAM) transporter. Furthermore, we show that Gap4 is required for SAM-induced morphogenesis, an important virulence factor of C. albicans .

The kynurenine pathway in schizophrenia and bipolar disorder.

PubMed

Erhardt, Sophie; Schwieler, Lilly; Imbeault, Sophie; Engberg, Göran

2017-01-01

The kynurenine pathway of tryptophan degradation generates several neuroactive compounds. Of those, kynurenic acid is an N-methyl-d-aspartate (NMDA) and alpha7 nicotinic receptor antagonist. The kynurenic acid hypothesis of schizophrenia is built upon the fact that kynurenic acid blocks glutamate receptors and is elevated in schizophrenia. Kynurenic acid tightly controls glutamatergic and dopaminergic neurotransmission and elevated brain levels appear related to psychotic symptoms and cognitive impairments. Contributing to enhanced production of kynurenic acid, the expression and enzyme activity of kynurenine 3-monooxygenase (KMO) are reduced in schizophrenia and in bipolar patients with a history of psychosis. The kynurenine pathway is also critically regulated by cytokines, and, indeed, the pro-inflammatory cytokines interleukin (IL)-1β and IL-6 are elevated in schizophrenia and bipolar disorder and stimulate the production of kynurenic acid. One physiological mechanism controlling the activity of the kynurenine pathway originates from the protein sorting nexin 7 (SNX7). This glial signaling pathway initiates a caspase-8-driven activation of IL-1β that induces tryptophan-2,3-dioxygenase 2 (TDO2), an enzyme in the kynurenine pathway. A recent study shows that a genetic variation resulting in decreased expression of SNX7 is linked to increased central levels of kynurenic acid and ultimately to psychosis and cognitive dysfunction in bipolar disorder. Experimental studies highlight the detrimental effects of increased synthesis of kynurenic acid during sensitive periods of early brain development. Furthermore, experimental studies strongly support inhibition of kynurenine aminotransferase (KAT) II as a novel target and a valuable pharmacological strategy in the treatment of psychosis and for improving cognitive performance relevant for schizophrenia. This article is part of the Special Issue entitled 'The Kynurenine Pathway in Health and Disease'. Copyright © 2016 Elsevier Ltd. All rights reserved.

Hypocholesterolaemic effect of whole-grain highland hull-less barley in rats fed a high-fat diet.

PubMed

Xia, Xuejuan; Li, Guannan; Song, Jiaxin; Zheng, Jiong; Kan, Jianquan

2018-05-01

Whole-grain highland hull-less barley (WHLB) contains high amounts of bioactive compounds that potentially exhibit cholesterol-lowering effects. This study investigated the hypocholesterolaemic effect of WHLB. A total of seventy-two male Sprague-Dawley rats were divided into four groups and were fed with the normal control diet, high-fat diet (HFD) and HFD containing low or high dose (10 or 48·95 %) of WHLB. High dose of WHLB significantly decreased the organ indexes of liver and abdominal fat and lipid levels of plasma and liver in HFD rats. The lipid regulation effect of WHLB, which was reconfirmed through hepatocyte morphologic observation, was accompanied by a large excretion of bile acids in the small intestinal contents and the faeces. Real-time PCR analyses, which were further reconfirmed through Western blot analyses, revealed that a high dose of WHLB significantly enhanced the hepatic expressions of AMP-activated protein kinase α, cholesterol 7α-hydroxylase, LDL receptor, liver X receptor, and PPARα and decreased the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase. It also enhanced the ileal expression of farnesoid X receptor and resulted in the decrease of expression of apical sodium-dependent bile acid transporter. WHLB exhibited hypocholesterolaemic effects mainly by inhibiting cholesterol synthesis, cholesterol accumulation in peripheral tissue, and bile acid reabsorption and by stimulating bile acid synthesis.

Fish Oil Supplementation and Fatty Acid Synthase Expression in the Prostate: A Randomized Controlled Trial

DTIC Science & Technology

2010-03-20

olive oil (placebo) capsules (treatment 2). Potential confounding variables are assessed through completion of a comprehensive diet history...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid...FORM TO THE ABOVE ADDRESS. 31-03-2010 1. REPORT DATE (DD-MM-YYYY) 2. REPORT TYPE 0 3. DATES COVERED (From - To) Fish Oil Supplementation and

Effect of Dietary Purified Xanthohumol from Hop (Humulus lupulus L.) Pomace on Adipose Tissue Mass, Fasting Blood Glucose Level, and Lipid Metabolism in KK-Ay Mice.

PubMed

Takahashi, Koki; Osada, Kyoichi

2017-05-01

We previously showed that xanthohumol-rich hop extract (XRHE, ~18% xanthohumol) exerts anti-obesity effects in rats fed a high-fat diet through regulation of fatty acid metabolism. In this study, we examined the effects of dietary purified xanthohumol from XRHE (PX, ~91.9% xanthohumol) in KK-Ay mice in order to understand the anti-obesity effects of xanthohumol alone because XRHE contains 82% unknown compounds. Dietary consumption of PX significantly inhibited an increase in the visceral fat weight of mice compared to those fed control diet without PX. Plasma leptin level was significantly lower in the PX-fed group than in the control group. Dietary PX lowered hepatic fatty acid synthesis by down-regulation of SREBP1c mRNA expression in the liver. On the other hand, fatty acid β-oxidation in the liver was promoted by dietary PX through the up-regulation of PPARα mRNA expression. Moreover, the fecal levels of fatty acids and carbohydrates increased by dietary PX. PX inhibited lipase or α-amylase activity in vitro. Thus, we found that PX may exert anti-obesity effects through the regulation of lipid metabolism and inhibition of intestinal fat and carbohydrate absorption, and that xanthohumol alone may exert anti-obesity effects.

d(-) Lactic Acid-Induced Adhesion of Bovine Neutrophils onto Endothelial Cells Is Dependent on Neutrophils Extracellular Traps Formation and CD11b Expression.

PubMed

Alarcón, Pablo; Manosalva, Carolina; Conejeros, Ivan; Carretta, María D; Muñoz-Caro, Tamara; Silva, Liliana M R; Taubert, Anja; Hermosilla, Carlos; Hidalgo, María A; Burgos, Rafael A

2017-01-01

Bovine ruminal acidosis is of economic importance as it contributes to reduced milk and meat production. This phenomenon is mainly attributed to an overload of highly fermentable carbohydrate, resulting in increased d(-) lactic acid levels in serum and plasma. Ruminal acidosis correlates with elevated acute phase proteins in blood, along with neutrophil activation and infiltration into various tissues leading to laminitis and aseptic polysynovitis. Previous studies in bovine neutrophils indicated that d(-) lactic acid decreased expression of L-selectin and increased expression of CD11b to concentrations higher than 6 mM, suggesting a potential role in neutrophil adhesion onto endothelia. The two aims of this study were to evaluate whether d(-) lactic acid influenced neutrophil and endothelial adhesion and to trigger neutrophil extracellular trap (NET) production (NETosis) in exposed neutrophils. Exposure of bovine neutrophils to 5 mM d(-) lactic acid elevated NET release compared to unstimulated neutrophil negative controls. Moreover, this NET contains CD11b and histone H 4 citrullinated, the latter was dependent on PAD4 activation, a critical enzyme in DNA decondensation and NETosis. Furthermore, NET formation was dependent on d(-) lactic acid plasma membrane transport through monocarboxylate transporter 1 (MCT1). d(-) lactic acid enhanced neutrophil adhesion onto endothelial sheets as demonstrated by in vitro neutrophil adhesion assays under continuous physiological flow conditions, indicating that cell adhesion was a NET- and a CD11b/ICAM-1-dependent process. Finally, d(-) lactic acid was demonstrated for the first time to trigger NETosis in a PAD4- and MCT1-dependent manner. Thus, d(-) lactic acid-mediated neutrophil activation may contribute to neutrophil-derived pro-inflammatory processes, such as aseptic laminitis and/or polysynovitis in animals suffering acute ruminal acidosis.

Intrarenal renin-angiotensin system mediates fatty acid-induced ER stress in the kidney

PubMed Central

Li, Chunling; Lin, Yu; Luo, Renfei; Chen, Shaoming; Zheng, Peili; Levi, Moshe; Yang, Tianxin; Wang, Weidong

2015-01-01

Obesity-related kidney disease is related to caloric excess promoting deleterious cellular responses. Accumulation of saturated free fatty acids in tubular cells produces lipotoxicity involving significant cellular dysfunction and injury. The objectives of this study were to elucidate the role of renin-angiotensin system (RAS) activation in saturated fatty acid-induced endoplasmic reticulum (ER) stress in cultured human proximal tubule epithelial cells (HK2) and in mice fed with a high-fat diet. Treatment with saturated fatty acid palmitic acid (PA; 0.8 mM) for 24 h induced ER stress in HK2, leading to an unfolded protein response as reflected by increased expressions of the ER chaperone binding immunoglobulin protein (BiP) and proapoptotic transcription factor C/EBP homologous protein (CHOP) protein as evaluated by immunoblotting. PA treatment also induced increased protein expression of inositol requiring protein 1α (IRE1α), phosphorylated eukaryotic initiation factor-α (eIF2α), and activating transcription factor 4 (ATF4) as well as activation of caspase-3. PA treatment was associated with increased angiotensin II levels in cultured medium. The angiotensin II type 1 receptor (AT1R) blocker valsartan or renin inhibitor aliskiren dramatically suppressed PA-induced upregulation of BiP, CHOP, IRE1α, p-eIF2α, and ATF4 in HK2 cells. In contrast, valsartan or aliskiren did not prevent ER stress induced by tunicamycin. C57BL/6 mice fed with a high-fat diet for 14 wk exhibited increased protein expressions of BiP and CHOP compared with control mice, which were significantly attenuated by the valsartan treatment. Increased angiotensin II levels in serum and urine were observed in mice fed with a high-fat diet when compared with controls. It is suggested that the intrarenal RAS activation may play an important role in diabetic kidney injury via mediating ER stress induced by saturated fatty acid. PMID:26672616

Dietary fish oil replacement by linseed oil: Effect on growth, nutrient utilization, tissue fatty acid composition and desaturase gene expression in silver barb (Puntius gonionotus) fingerlings.

PubMed

Nayak, Madhusmita; Saha, Ashis; Pradhan, Avinash; Samanta, Mrinal; Giri, Shiba Shankar

2017-03-01

Silver barb (Puntius gonionotus) is considered a promising medium carp species for freshwater aquaculture in Asia. This study in silver barb was carried out to evaluate the effects of total or partial substitution of dietary fish oil (FO) with linseed oil (LO) on growth, nutrient utilization, whole-body composition, muscle and liver fatty acid composition. Fish (12.1±0.4g of initial body weight) were fed for 60days with five experimental iso-proteinous, iso-lipidic and iso-caloric diets in which FO (control diet) was replaced by 33.3%, 50%, 66.7% and 100% LO. Final weight, weight gain, percent weight gain, SGR decreased linearly (p<0.001) with increasing LO levels in the diets. Dietary LO substitution levels did not significantly (p>0.05) affect the feed conversion ratio (FCR), protein efficiency ratio (PER) and whole body proximate composition. Furthermore, enhanced level of LO increased α-linolenic acid (ALA; 18:3n3) and linoleic acid (LA; 18:2n6) and decreased eicosapentaenoic acid (EPA; 20:5n3) and docosahexaenoic acid (DHA; 22:6n3) in muscle and liver. To understand the molecular mechanism of long chain-polyunsaturated fatty acid (LC-PUFA) biosynthesis, we cloned and characterized the fatty acyl Δ6 desaturase (Δ6 fad) cDNA and investigated its expression in various organs/tissues following replacement of FO with LO in the diet. The full-length Δ6 fad cDNA was 2056bp encoding 444 amino acids and was widely expressed in various organs/tissues. Replacement of FO with LO increased the expression of Δ6 fad mRNA in liver, muscle and intestine but no significant difference was found in the brain. Copyright © 2016 Elsevier Inc. All rights reserved.

Metabolomic Response to Huanglongbing: Role of Carboxylic Compounds in Citrus sinensis Response to 'Candidatus Liberibacter asiaticus' and Its Vector, Diaphorina citri.

PubMed

Killiny, Nabil; Nehela, Yasser

2017-08-01

Huanglongbing, a destructive disease of citrus, is caused by the fastidious bacterium 'Candidatus Liberibacter asiaticus' and transmitted by Asian citrus psyllid, Diaphorina citri. The impact of 'Ca. L. asiaticus' infection or D. citri infestation on Valencia sweet orange (Citrus sinensis) leaf metabolites was investigated using gas chromatography mass spectrometry, followed by gene expression analysis for 37 genes involved in jasmonic acid (JA), salicylic acid (SA), and proline-glutamine pathways. The total amino acid abundance increased after 'Ca. L. asiaticus' infection, while the total fatty acids increased dramatically after infestation with D. citri, compared with control plants. Seven amino acids (glycine, l-isoleucine, l-phenylalanine, l-proline, l-serine, l-threonine, and l-tryptophan) and five organic acids (benzoic acid, citric acid, fumaric acid, SA, and succinic acid) increased in 'Ca. L. asiaticus'-infected plants. On the other hand, the abundance of trans-JA and its precursor α-linolenic increased in D. citri-infested plants. Surprisingly, the double attack of both D. citri infestation and 'Ca. L. asiaticus' infection moderated the metabolic changes in all chemical classes studied. In addition, the gene expression analysis supported these results. Based on these findings, we suggest that, although amino acids such as phenylalanine are involved in citrus defense against 'Ca. L. asiaticus' infection through the activation of an SA-mediated pathway, fatty acids, especially α-linolenic acid, are involved in defense against D. citri infestation via the induction of a JA-mediated pathway.

Voluntary running exercise prevents β-cell failure in susceptible islets of the Zucker diabetic fatty rat.

PubMed

Delghingaro-Augusto, Viviane; Décary, Simon; Peyot, Marie-Line; Latour, Martin G; Lamontagne, Julien; Paradis-Isler, Nicolas; Lacharité-Lemieux, Marianne; Akakpo, Huguette; Birot, Olivier; Nolan, Christopher J; Prentki, Marc; Bergeron, Raynald

2012-01-15

Physical activity improves glycemic control in type 2 diabetes (T2D), but its contribution to preserving β-cell function is uncertain. We evaluated the role of physical activity on β-cell secretory function and glycerolipid/fatty acid (GL/FA) cycling in male Zucker diabetic fatty (ZDF) rats. Six-week-old ZDF rats engaged in voluntary running for 6 wk (ZDF-A). Inactive Zucker lean and ZDF (ZDF-I) rats served as controls. ZDF-I rats displayed progressive hyperglycemia with β-cell failure evidenced by falling insulinemia and reduced insulin secretion to oral glucose. Isolated ZDF-I rat islets showed reduced glucose-stimulated insulin secretion expressed per islet and per islet protein. They were also characterized by loss of the glucose regulation of fatty acid oxidation and GL/FA cycling, reduced mRNA expression of key β-cell genes, and severe reduction of insulin stores. Physical activity prevented diabetes in ZDF rats through sustaining β-cell compensation to insulin resistance shown in vivo and in vitro. Surprisingly, ZDF-A islets had persistent defects in fatty acid oxidation, GL/FA cycling, and β-cell gene expression. ZDF-A islets, however, had preserved islet insulin mRNA and insulin stores compared with ZDF-I rats. Physical activity did not prevent hyperphagia, dyslipidemia, or obesity in ZDF rats. In conclusion, islets of ZDF rats have a susceptibility to failure that is possibly due to altered β-cell fatty acid metabolism. Depletion of pancreatic islet insulin stores is a major contributor to islet failure in this T2D model, preventable by physical activity.

Arabidopsis MYC Transcription Factors Are the Target of Hormonal Salicylic Acid/Jasmonic Acid Cross Talk in Response to Pieris brassicae Egg Extract1[OPEN

PubMed Central

Schmiesing, André; Gouhier-Darimont, Caroline

2016-01-01

Arabidopsis (Arabidopsis thaliana) plants recognize insect eggs and activate the salicylic acid (SA) pathway. As a consequence, expression of defense genes regulated by the jasmonic acid (JA) pathway is suppressed and larval performance is enhanced. Cross talk between defense signaling pathways is common in plant-pathogen interactions, but the molecular mechanism mediating this phenomenon is poorly understood. Here, we demonstrate that egg-induced SA/JA antagonism works independently of the APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factor ORA59, which controls the ERF branch of the JA pathway. In addition, treatment with egg extract did not enhance expression or stability of JASMONATE ZIM-domain transcriptional repressors, and SA/JA cross talk did not involve JASMONATE ASSOCIATED MYC2-LIKEs, which are negative regulators of the JA pathway. Investigating the stability of MYC2, MYC3, and MYC4, three basic helix-loop-helix transcription factors that additively control jasmonate-related defense responses, we found that egg extract treatment strongly diminished MYC protein levels in an SA-dependent manner. Furthermore, we identified WRKY75 as a novel and essential factor controlling SA/JA cross talk. These data indicate that insect eggs target the MYC branch of the JA pathway and uncover an unexpected modulation of SA/JA antagonism depending on the biological context in which the SA pathway is activated. PMID:26884488

Arabidopsis MYC Transcription Factors Are the Target of Hormonal Salicylic Acid/Jasmonic Acid Cross Talk in Response to Pieris brassicae Egg Extract.

PubMed

Schmiesing, André; Emonet, Aurélia; Gouhier-Darimont, Caroline; Reymond, Philippe

2016-04-01

Arabidopsis (Arabidopsis thaliana) plants recognize insect eggs and activate the salicylic acid (SA) pathway. As a consequence, expression of defense genes regulated by the jasmonic acid (JA) pathway is suppressed and larval performance is enhanced. Cross talk between defense signaling pathways is common in plant-pathogen interactions, but the molecular mechanism mediating this phenomenon is poorly understood. Here, we demonstrate that egg-induced SA/JA antagonism works independently of the APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factor ORA59, which controls the ERF branch of the JA pathway. In addition, treatment with egg extract did not enhance expression or stability of JASMONATE ZIM-domain transcriptional repressors, and SA/JA cross talk did not involve JASMONATE ASSOCIATED MYC2-LIKEs, which are negative regulators of the JA pathway. Investigating the stability of MYC2, MYC3, and MYC4, three basic helix-loop-helix transcription factors that additively control jasmonate-related defense responses, we found that egg extract treatment strongly diminished MYC protein levels in an SA-dependent manner. Furthermore, we identified WRKY75 as a novel and essential factor controlling SA/JA cross talk. These data indicate that insect eggs target the MYC branch of the JA pathway and uncover an unexpected modulation of SA/JA antagonism depending on the biological context in which the SA pathway is activated. © 2016 American Society of Plant Biologists. All Rights Reserved.

DNA methylation of amino acid transporter genes in the human placenta.

PubMed

Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K

2017-12-01

Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.

Abietic acid isolated from pine resin (Resina Pini) enhances angiogenesis in HUVECs and accelerates cutaneous wound healing in mice.

PubMed

Park, Jun Yeon; Lee, Yun Kyung; Lee, Dong-Soo; Yoo, Jeong-Eun; Shin, Myoung-Sook; Yamabe, Noriko; Kim, Su-Nam; Lee, Seulah; Kim, Ki Hyun; Lee, Hae-Jeung; Roh, Seok Sun; Kang, Ki Sung

2017-05-05

Resin known as Resina Pini is listed in the Korean and Japanese pharmacopoeias and has been used for treating skin wounds and inflammation. Resin is composed of more than 50% abietic acid and 10% neutral substances. In the present study, the wound-healing effects of abietic acid and the possible underlying mechanism of action were investigated in various in vitro and in vivo models. The effects of abietic acid on tube formation and migration were measured in human umbilical vein vascular endothelial cells (HUVECs). Protein expression of mitogen-activated protein kinase (MAPK) activation was evaluated via Western blotting analysis. The wound-healing effects of abietic acid were assessed using a mouse model of cutaneous wounds. The results showed that abietic acid enhanced cell migration and tube formation in HUVECs. Abietic acid induced significant angiogenic potential, which is associated with upregulation of extracellular signal-regulated kinase (ERK) and p38 expression. Additionally, 0.8μM abietic acid-treated groups showed accelerated wound closure compared to the controls in a mouse model of cutaneous wounds. The current data indicate that abietic acid treatment elevated cell migration and tube formation in HUVECs by the activation of ERK and p38 MAPKs. We suggest that abietic acid can be developed as a wound-healing agent. Copyright © 2017 Elsevier Ltd. All rights reserved.

A new model of the mechanism underlying lead poisoning: SNPs in miRNA target region influence the δ-aminolevulinic acid dehydratase expression level.

PubMed

Li, Chunping; Wang, Miaomiao; Wang, Yiqing; Zhang, Jinlong; Sun, Na

2017-11-01

To determine if SNPs located within the 3'-UTR of δ-aminolevulinic acid dehydratase (ALAD) can alter the risk of lead poisoning and the ALAD gene expression. A case-control study was carried out to find the SNPs in miRNA target region. Luciferase reporter gene assay, qRT-PCR and Western blot was used to determine the relationship between miRNA and SNPs. We found a significant association between rs818708 and the risk of lead poisoning. miR-545-5p was influenced by rs818708 variant and might result in a significant change in ALAD expression. rs818708 T > C can weaken the binding capability between miR-545-5p and 3'-UTR of ALAD and thus may alter the risk of lead poisoning.

Simultaneous expression and transportation of insulin by supramolecular polysaccharide nanocluster

NASA Astrophysics Data System (ADS)

Zhang, Yu-Hui; Zhang, Ying-Ming; Zhao, Qi-Hui; Liu, Yu

2016-03-01

Drug/gene transportation systems with stimuli-responsive release behaviors are becoming research hotspots in biochemical and biomedical fields. In this work, a glucose-responsive supramolecular nanocluster was successfully constructed by the intermolecular complexation of phenylboronic acid modified β-cyclodextrin with adamantane modified polyethylenimine, which could be used as a biocompatible carrier for insulin and pCMV3-C-GFPSpark-Ins DNA which could express insulin co-delivery. Benefiting from the response capability of phenylboronic acid moiety toward glucose, the encapsulated insulin could be specifically released and the corresponding targeted DNA could efficiently express insulin in HepG2 cell, accompanied by the high-level insulin release in vitro. Our results demonstrate that the simultaneous insulin drug delivery and insulin gene transfection in a controlled mode may have great potential in the clinical diabetes treatments.

Contact lens care solutions downregulate membrane-associated mucins 1 and 16 in cultured human corneal epithelial cells and at the rat corneal surface in vivo.

PubMed

Tchedre, Kissaou; Imayasu, Masaki; Hori, Yuichi; Cavanagh, H Dwight

2013-11-01

The purpose of this study was first to evaluate the effect of multipurpose contact lens care solutions (MPSs) on the expression of membrane-associated mucins (MUC1 and MUC16) in SV40-transformed human corneal epithelial (HCE-T) cells and in vivo rat cornea. The second aim of this study was to determine the role of the common MPS additive boric acid in reducing mucin expression and release. The HCE-T cells were exposed to different concentrations of MPS-F, MPS-G, MPS-H, MPS-I, and MPS-J with 100% treatment for 30 minutes and 10% treatment for 24 hours. MUC1 and MUC16 expressions were subsequently analyzed by Western blotting. Wister rats were also subjected to MPS-A, MPS-B, MPS-C, MPS-D, and MPS-E and received phosphate-buffered saline exposure (1 drop in the right eye every 10 minutes for 1 hour). The left eye was used as control. Cornea sections and lysates were used for the immunohistochemical assay of MUC1 and MUC16 expressions. Conditioned media from treated HCE-T cells were also analyzed using Western blotting. The MPSs containing boric acid downregulated MUC1 and MUC16 in the rat cornea, whereas MPSs without boric acid had no effect as demonstrated by the Western blotting and immunohistochemical analysis. Conditioned media from MPS-containing boric acid revealed some trace of MUC16. The clinical use of MPSs containing boric acid that reduce MUC1 and MUC16 availability should be avoided. Additionally, the presence of MUC16 in the conditioned media suggests that boric acid may have enhanced cleavage of MUC16 at the cell membrane surface.

Obeticholic acid reduces bacterial translocation and inhibits intestinal inflammation in cirrhotic rats.

PubMed

Úbeda, María; Lario, Margaret; Muñoz, Leticia; Borrero, María-José; Rodríguez-Serrano, Macarena; Sánchez-Díaz, Ana-María; Del Campo, Rosa; Lledó, Lourdes; Pastor, Óscar; García-Bermejo, Laura; Díaz, David; Álvarez-Mon, Melchor; Albillos, Agustín

2016-05-01

In advanced cirrhosis, gut bacterial translocation is the consequence of intestinal barrier disruption and leads to bacterial infection. Bile acid abnormalities in cirrhosis could play a role in the integrity of the intestinal barrier and the control of microbiota, mainly through the farnesoid X receptor. We investigated the long-term effects of the farnesoid X receptor agonist, obeticholic acid, on gut bacterial translocation, intestinal microbiota composition, barrier integrity and inflammation in rats with CCl4-induced cirrhosis with ascites. Cirrhotic rats received a 2-week course of obeticholic acid or vehicle starting once ascites developed. We then determined: bacterial translocation by mesenteric lymph node culture, ileum expression of antimicrobial peptides and tight junction proteins by qPCR, fecal albumin loss, enteric bacterial load and microbiota composition by qPCR and pyrosequencing of ileum mucosa-attached contents, and intestinal inflammation by cytometry of the inflammatory infiltrate. Obeticholic acid reduced bacterial translocation from 78.3% to 33.3% (p<0.01) and upregulated the expression of the farnesoid X receptor-associated gene small heterodimer partner. Treatment improved ileum expression of antimicrobial peptides, angiogenin-1 and alpha-5-defensin, tight junction proteins zonulin-1 and occludin, and reduced fecal albumin loss and liver fibrosis. Enteric bacterial load normalized, and the distinctive mucosal microbiota of cirrhosis was reduced. Gut immune cell infiltration was reduced and inflammatory cytokine and Toll-like receptor 4 expression normalized. In ascitic cirrhotic rats, obeticholic acid reduces gut bacterial translocation via several complementary mechanisms at the intestinal level. This agent could be used as an alternative to antibiotics to prevent bacterial infection in cirrhosis. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Ascorbic acid supplementation enhances recovery from ethanol induced inhibition of Leydig cell steroidogenesis than abstention in male guinea pigs.

PubMed

Radhakrishnakartha, Harikrishnan; Appu, Abhilash Puthuvelvippel; Indira, Madambath

2014-01-15

The impact of ascorbic acid supplementation against ethanol induced Leydig cell toxicity was studied in guinea pigs. Male guinea pigs were exposed to ethanol (4g/kgb.wt.) for 90 days. After 90 days, ethanol administration was completely stopped and animals in the ethanol group were divided into abstention group and ascorbic acid supplemented group (25mg/100gb.wt.) and those in control group were maintained as control and control+ascorbic acid group. Ethanol administration reduced the serum testosterone and LH (luteinising hormone) levels and elevated estradiol levels. Cholesterol levels in Leydig cell were increased whereas the mRNA and protein expressions of StAR (steroidogenic acute regulatory) protein, cytochrome P450scc (cytochrome p450side chain cleavage enzyme), 3β-HSD (3β-hydroxysteroid dehydrogenase), 17β-HSD (17β-hydroxysteroid dehydrogenase) and LH receptor were drastically reduced. Administration of ascorbic acid resulted in alteration of all these parameters indicating enhanced recovery from ethanol induced inhibition of Leydig cell steroidogenesis. Although abstention could also reduce the inhibition of steroidogenesis, this was lesser in comparison with ascorbic acid supplemented group. © 2013 Published by Elsevier B.V.

Synthetic α-mangostin dilaurate strongly suppresses wide-spectrum organ metastasis in a mouse model of mammary cancer.

PubMed

Shibata, Masa-Aki; Hamaoka, Hitomi; Morimoto, Junji; Kanayama, Tadashi; Maemura, Kentaro; Ito, Yuko; Iinuma, Munekazu; Kondo, Yoichi

2018-03-30

We previously reported that, in a mouse model of mammary cancer, α-mangostin alone exhibits anti-metastatic properties. To enhance this anti-metastatic effect, we examined the efficacy of synthetic α-mangostin dilaurate (MGD), prepared by adding lauric acid to α-mangostin, in the same experimental system wherein mice bearing mammary tumors are exposed to dietary MGD at 0, 2000 and 4000 ppm. Lauric acid has a high propensity for lymphatic absorption, which is the most common pathway of initial dissemination of many solid malignancies. Both mammary tumor volumes and wide-spectrum organ metastasis were markedly reduced at 2000 and 4000 ppm: furthermore, survival in the 4000-ppm group was significantly greater than in control mice. Apoptosis in mammary carcinomas was also significantly increased in the 4000-ppm group, whereas blood microvessel density and lymphatic vessel invasion were markedly reduced. In real-time PCR analyses of tumor samples, increased p21 and decreased Pcna expression were observed with 4000 ppm but values were not statistically significant when compared to expression in control tumors. However, exposure to 4000 ppm significantly decreased expression of phospho-Akt (Ser473/Thr308) as compared to the control, indicating a role in the anti-tumorigenic effects of MGD. These findings suggest that MGD may be useful for adjuvant therapy and chemoprevention and that conjugated medium-chain fatty acids may enhance the efficacy of certain chemotherapeutic agents. © 2018 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Vanillylacetone up-regulates anthocyanin accumulation and expression of anthocyanin biosynthetic genes by inducing endogenous abscisic acid in grapevine tissues.

PubMed

Enoki, Shinichi; Hattori, Tomoki; Ishiai, Shiho; Tanaka, Sayumi; Mikami, Masachika; Arita, Kayo; Nagasaka, Shu; Suzuki, Shunji

2017-12-01

We investigated the effect of vanillylacetone (VA) on anthocyanin accumulation with aim of improving grape berry coloration. Spraying Vitis vinifera cv. Muscat Bailey A berries with VA at veraison increased sugar/acid ratio, an indicator of maturation and total anthocyanin accumulation. To elucidate the molecular mechanism underlying the effect of VA on anthocyanin accumulation, in vitro VA treatment of a grapevine cell culture was carried out. Endogenous abscisic acid (ABA) content was higher in the VA-treated cell cultures than in control at 3h after treatment. Consistent with this, the relative expression levels of anthocyanin-synthesis-related genes, including DFR, LDOX, MybA1 and UFGT, in VA-treated cell cultures were much higher than those in control, and high total anthocyanin accumulation was noted in the VA-treated cell cultures as well. These results suggest that VA up-regulates the expression of genes leading to anthocyanin accumulation by inducing endogenous ABA. In addition, VA increased total anthocyanin content in a dose-dependent manner. Although VA treatment in combination with exogenous ABA did not exhibit any synergistic effect, treatment with VA alone showed an equivalent effect to that with exogenous ABA alone on total anthocyanin accumulation. These findings point to the possibility of using VA for improving grape berry coloration. Copyright © 2017 Elsevier GmbH. All rights reserved.

4-Hydroxydocosahexaenoic acid, a potent peroxisome proliferator-activated receptor {gamma} agonist alleviates the symptoms of DSS-induced colitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamamoto, Keiko; Ninomiya, Yuichi; Iseki, Mioko

2008-03-14

(5E,7Z,10Z,13Z,16Z,19Z)-4-Hydroxy-5,7,10,13,16,19-docosahexaenoic acid (4-OHDHA) is a potential agonist of peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) and antidiabetic agent as has been previously reported. As PPAR{gamma} agonists may also have anti-inflammatory functions, in this study, we investigated whether 4-OHDHA has an inhibitory effect on expression of inflammatory genes in vitro and whether 4-OHDHA could relieve the symptoms of dextran sodium sulfate (DSS)-induced colitis in a murine model of inflammatory bowel disease. 4-OHDHA inhibited production of nitric oxide and expression of a subset of inflammatory genes including inducible nitric oxide synthase (Nos2/iNOS) and interleukin 6 (Il6) by lipopolysaccharide (LPS)-activated macrophages. In addition, 4-OHDHA-treated mice whenmore » compared to control mice not receiving treatment recovered better from the weight loss caused by DSS-induced colitis. Changes in disease activity index (DAI) of 4-OHDHA-treated mice were also more favorable than for control mice and were comparable with mice treated with a typical anti-inflammatory-drug, 5-aminosalichylic acid (5-ASA). These results suggest that 4-OHDHA has potentially clinically useful anti-inflammatory effects mediated by suppression of inflammatory gene expression.« less

Metabolic engineering of Saccharomyces cerevisiae for production of very long chain fatty acid-derived chemicals.

PubMed

Yu, Tao; Zhou, Yongjin J; Wenning, Leonie; Liu, Quanli; Krivoruchko, Anastasia; Siewers, Verena; Nielsen, Jens; David, Florian

2017-05-26

Production of chemicals and biofuels through microbial fermentation is an economical and sustainable alternative for traditional chemical synthesis. Here we present the construction of a Saccharomyces cerevisiae platform strain for high-level production of very-long-chain fatty acid (VLCFA)-derived chemicals. Through rewiring the native fatty acid elongation system and implementing a heterologous Mycobacteria FAS I system, we establish an increased biosynthesis of VLCFAs in S. cerevisiae. VLCFAs can be selectively modified towards the fatty alcohol docosanol (C 22 H 46 O) by expressing a specific fatty acid reductase. Expression of this enzyme is shown to impair cell growth due to consumption of VLCFA-CoAs. We therefore implement a dynamic control strategy for separating cell growth from docosanol production. We successfully establish high-level and selective docosanol production of 83.5 mg l -1 in yeast. This approach will provide a universal strategy towards the production of similar high value chemicals in a more scalable, stable and sustainable manner.

Sodium butyrate improved performance while modulating the cecal microbiota and regulating the expression of intestinal immune-related genes of broiler chickens.

PubMed

Bortoluzzi, C; Pedroso, A A; Mallo, J J; Puyalto, M; Kim, W K; Applegate, T J

2017-09-01

This study evaluated the effect of sodium butyrate (SB) on performance, expression of immune-related genes in the cecal tonsils, and cecal microbiota of broiler chickens when dietary energy and amino acids concentrations were reduced. Day-old male Ross 708 broiler chicks were fed dietary treatments in a 3 × 2 factorial design (8 pens per treatment) with 3 dietary formulations (control diet; reduction of 2.3% of amino acids and 60 kcal/kg; and reduction of 4.6% of amino acids and 120 kcal/kg) with or without the inclusion of 0.1% of SB. Feed intake (FI), body weight gain (BW gain), and feed conversion ratio (FCR) were recorded until 28 d of age. From 14 to 28 d, there was an interaction of nutrient density by SB (P = 0.003) wherein BW gain of birds fed SB was impaired less by the energy/amino acids reduction than unsupplemented birds. A similar result was obtained from 1 to 28 d (P = 0.004). No interaction (P < 0.05) between nutrient density by SB was observed for FCR. Nutritional density of the diets and SB modified the structure, composition, and predicted function of the cecal microbiota. The nutritionally reduced diet altered the imputed function performed by the microbiota and the SB supplementation reduced these variations, keeping the microbial function similar to that observed in chickens fed a control diet. The frequency of bacterial species presenting the butyryl-CoA: acetate CoA-transferase gene increased in the microbiota of chickens fed a nutritionally reduced diet without SB supplementation, and was not changed by nutrient density of the diet when supplemented with SB (interaction; P = 0.01). SB modulated the expression of immune related genes in the cecal tonsils; wherein SB upregulated the expression of A20 in broilers fed control diets (P < 0.05) and increased IL-6 expression (P < 0.05). These results show that SB had positive effects on the productive performance of broilers fed nutritionally reduced diets, partially by modulating the cecal microbiota and exerting immune-modulatory effects. © 2017 Poultry Science Association Inc.

78 FR 40186 - Proposed Aggregate Production Quotas for Schedule I and II Controlled Substances and Proposed...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-03

... phenylpropanolamine, expressed in grams of anhydrous acid or base, be established as follows: Proposed 2014 Basic... grams of levo-desoxyephedrine for use in a non-controlled, non-prescription product; 2,600,000 grams for methamphetamine mostly for conversion to a schedule III product; and 61,375 grams for methamphetamine (for sale...

Chlorogenic acid regulates apoptosis and stem cell marker-related gene expression in A549 human lung cancer cells.

PubMed

Yamagata, Kazuo; Izawa, Yuri; Onodera, Daiki; Tagami, Motoki

2018-04-01

Previous studies indicated that chlorogenic acid, a compound present in many fruits and vegetables, has anti-cancer activities. We report that chlorogenic acid regulates the expression of apoptosis-related genes and self-renewal-related stem cell markers in cancer cells. The lung cancer cell line A549 was cultured with or without chlorogenic acid. The presence of chlorogenic acid decreased cell proliferation as measured by MTT activity. Polymerase chain reaction (PCR) showed that treatment of cells with chlorogenic acid reduced the expression of BCL2 but increased that of both BAX and CASP3. Chlorogenic acid enhanced annexin V expression as measured using fluorescently labeled annexin V. Chlorogenic acid also induced p38 MAPK and JNK gene expression. Meanwhile, several agents, including SB203580 (p38 MAP kinase inhibitor), N-acetylcysteine (antioxidant inhibitor), dipyridamole (phosphodiesterase inhibitor), and apocynin (NADPH-oxidase inhibitor) blocked chlorogenic acid-induced BAX gene expression. Chlorogenic acid reduced gene expression levels of stem cell-associated markers NANOG, POU5F1, and SOX2. Together these results indicate that chlorogenic acid affects the expression of apoptosis-related genes that are part of oxidative stress and p38 MAP-dependent pathways, as well as genes encoding stem cell markers. In conclusion, chlorogenic acid may contribute to the polyphenolic anti-cancer effect associated with consumption of vegetables and fruits.

Effects of heat stress on the gene expression of nutrient transporters in the jejunum of broiler chickens ( Gallus gallus domesticus)

NASA Astrophysics Data System (ADS)

Sun, Xiaolei; Zhang, Haichao; Sheikhahmadi, Ardashir; Wang, Yufeng; Jiao, Hongchao; Lin, Hai; Song, Zhigang

2015-02-01

In broiler chickens, heat stress disrupts nutrient digestion and absorption. However, the underlying molecular mechanism is not clearly understood. Hence, to investigate the effects of high ambient temperatures on the expression levels of nutrient transporters in the jejunum of broiler chickens, seventy-two 35-day-old male broiler chickens with similar body weights were randomly allocated into two groups: control (24 ± 1 °C) and heat-stressed (32 ± 1 °C). The chickens in the heat-stressed group were exposed to 10 h of heat daily from 08:00 to 18:00 and then raised at 24 ± 1 °C. The rectal temperature and feed intake of the chickens were recorded daily. After 7 days, nine chickens per group were sacrificed by exsanguination, and the jejunum was collected. The results show that heat exposure significantly decreased the feed intake and increased the rectal temperature of the broiler chickens. The plasma concentrations of uric acid and triglyceride significantly increased and decreased, respectively, in the heat-stressed group. No significant differences in the levels of plasma glucose, total amino acids, and very low-density lipoprotein were observed between the heat-stressed and control groups. However, the plasma concentration of glucose tended to be higher ( P = 0.09) in the heat-stressed group than in the control group. Heat exposure did not significantly affect the mRNA levels of Na+-dependent glucose transporter 1 and amino acid transporters y + LAT1, CAT1, r-BAT, and PePT-1. However, the expression levels of GLUT-2, FABP1, and CD36 were significantly decreased by heat exposure. The results of this study provide new insights into the mechanisms by which heat stress affects nutrient absorption in broiler chickens. Our findings suggest that periodic heat exposure might alter the jejunal glucose and lipid transport rather than amino acid transport. However, intestinal epithelial damage and cell loss should be considered when interpreting the effects of heat stress on the expression of intestinal transporters.

Induction of hepatic ABC transporter expression is part of the PPARalpha-mediated fasting response in the mouse.

PubMed

Kok, Tineke; Wolters, Henk; Bloks, Vincent W; Havinga, Rick; Jansen, Peter L M; Staels, Bart; Kuipers, Folkert

2003-01-01

Fatty acids are natural ligands of the peroxisome proliferator-activated receptor alpha (PPARalpha). Synthetic ligands of this nuclear receptor, i.e., fibrates, induce the hepatic expression of the multidrug resistance 2 gene (Mdr2), encoding the canalicular phospholipid translocator, and affect hepatobiliary lipid transport. We tested whether fasting-associated fatty acid release from adipose tissues alters hepatic transporter expression and bile formation in a PPARalpha-dependent manner. A 24-hour fasting/48-hour refeeding schedule was used in wild-type and Pparalpha((-/-)) mice. Expression of genes involved in the control of bile formation was determined and related to secretion rates of biliary components. Expression of Pparalpha, farnesoid X receptor, and liver X receptor alpha genes encoding nuclear receptors that control hepatic bile salt and sterol metabolism was induced on fasting in wild-type mice only. The expression of Mdr2 was 5-fold increased in fasted wild-type mice and increased only marginally in Pparalpha((-/-)) mice, and it normalized on refeeding. Mdr2 protein levels and maximal biliary phospholipid secretion rates were clearly increased in fasted wild-type mice. Hepatic expression of the liver X receptor target genes ATP binding cassette transporter a1 (Abca1), Abcg5, and Abcg8, implicated in hepatobiliary cholesterol transport, was induced in fasted wild-type mice only. However, the maximal biliary cholesterol secretion rate was reduced by approximately 50%. Induction of Mdr2 expression and function is part of the PPARalpha-mediated fasting response in mice. Fasting also induces expression of the putative hepatobiliary cholesterol transport genes Abca1, Abcg5, and Abcg8, but, nonetheless, maximal biliary cholesterol excretion is decreased after fasting.

Regulated expression of a repressor protein: FadR activates iclR.

PubMed Central

Gui, L; Sunnarborg, A; LaPorte, D C

1996-01-01

The control of the glyoxylate bypass operon (aceBAK) of Escherichia coli is mediated by two regulatory proteins, IclMR and FadR. IclMR is a repressor protein which has previously been shown to bind to a site which overlaps the aceBAK promoter. FAR is a repressor/activator protein which participates in control of the genes of fatty acid metabolism. A sequence just upstream of the iclR promoter bears a striking resemblance to FadR binding sites found in the fatty acid metabolic genes. The in vitro binding specificity of FadR, determined by oligonucleotide selection, was in good agreement with the sequences of these sites. The ability of FadR to bind to the site associated with iclR was demonstrated by gel shift and DNase I footprint analyses. Disruption of FadR or inactivation of the FadR binding site of iclR decreased the expression of an iclR::lacZ operon fusion, indicating that FadR activates the expression of iclR. It has been reported that disruption of fadR increases the expression of aceBAK. We observed a similar increase when we inactivated the FadR binding site of an iclR+ allele. This result suggests that FadR regulates aceBAK indirectly by altering the expression of IclR. PMID:8755903

Effects of Alpha-Lipoic Acid on Oxidative Stress and Kinin Receptor Expression in Obese Zucker Diabetic Fatty Rats.

PubMed

Midaoui, Adil El; Talbot, Sébastien; Lahjouji, Karim; Dias, Jenny Pena; Fantus, I George; Couture, Réjean

2015-06-01

To investigate the impact of alpha-lipoic acid on superoxide anion production and NADPH oxidase activity as well as on the expression of kinin B1 and B2 receptors in key organs of obese Zucker Diabetic Fatty rats. Superoxide anion production was measured by lucigenin chemiluminescence. Kinin B1 and B2 receptors expression was measured at protein and mRNA levels by western blot and qRT-PCR in key organs of Zucker Diabetic Fatty and Zucker lean control rats treated for a period of 6 weeks with a standard diet or a diet containing the antioxidant α-lipoic acid (1 g/kg). Superoxide anion production and NADPH oxidase activity were significantly enhanced in aorta and adipose tissue of Zucker Diabetic Fatty rats. Kinin B1 and B2 receptors expression levels were also significantly increased in the liver and the gastrocnemius muscle of Zucker Diabetic Fatty rats. Expression of both receptors was not altered in the pancreas of Zucker Diabetic Fatty rats and was undetectable in white retroperitoneal adipose tissue. Alpha-lipoic acid prevented the rise in NADPH oxidase activity in aorta and epididymal adipose tissue of Zucker Diabetic Fatty rats and the upregulation of kinin B1 receptor in liver and gastrocnemius muscle and that of kinin B2 receptor in the liver. Alpha-lipoic acid treatment was found to prevent the final body weight increase without affecting significantly hyperglycemia, hyperinsulinemia and insulin resistance index in Zucker Diabetic Fatty rats. Findings support the hypothesis that oxidative stress is implicated in the induction of kinin B1 receptor in Zucker Diabetic Fatty rats. The ability of α-lipoic acid to blunt the body weight gain appears to be mediated in part by preventing NADPH oxidase activity rise in adipose tissue and reversing the hepatic upregulation of kinin B1 receptor in Zucker Diabetic Fatty rats.

Omega-3 fatty acids attenuate constitutive and insulin-induced CD36 expression through a suppression of PPAR α/γ activity in microvascular endothelial cells.

PubMed

Madonna, Rosalinda; Salerni, Sara; Schiavone, Deborah; Glatz, Jan F; Geng, Yong-Jian; De Caterina, Raffaele

2011-09-01

Microvascular dysfunction occurs in insulin resistance and/or hyperinsulinaemia. Enhanced uptake of free fatty acids (FFA) and oxidised low-density lipoproteins (oxLDL) may lead to oxidative stress and microvascular dysfunction interacting with CD36, a PPARα/γ-regulated scavenger receptor and long-chain FFA transporter. We investigated CD36 expression and CD36-mediated oxLDL uptake before and after insulin treatment in human dermal microvascular endothelial cells (HMVECs), ± different types of fatty acids (FA), including palmitic, oleic, linoleic, arachidonic, eicosapentaenoic (EPA), and docosahexaenoic (DHA) acids. Insulin (10(-8) and 10(-7) M) time-dependently increased DiI-oxLDL uptake and CD36 surface expression (by 30 ± 13%, p<0.05 vs. untreated control after 24 hours incubation), as assessed by ELISA and flow cytometry, an effect that was potentiated by the PI3-kinase inhibitor wortmannin and reverted by the ERK1/2 inhibitor PD98059 and the PPARα/γ antagonist GW9662. A ≥ 24 hour exposure to 50 μM DHA or EPA, but not other FA, blunted both the constitutive (by 23 ± 3% and 29 ± 2%, respectively, p<0.05 for both) and insulin-induced CD36 expressions (by 45 ± 27 % and 12 ± 3 %, respectively, p<0.05 for both), along with insulin-induced uptake of DiI-oxLDL and the downregulation of phosphorylated endothelial nitric oxide synthase (P-eNOS). At gel shift assays, DHA reverted insulin-induced basal and oxLDL-stimulated transactivation of PPRE and DNA binding of PPARα/γ and NF-κB. In conclusion, omega-3 fatty acids blunt the increased CD36 expression and activity promoted by high concentrations of insulin. Such mechanisms may be the basis for the use of omega-3 fatty acids in diabetic microvasculopathy.

Effects of over-expressing a native gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) on glyphosate resistance in Arabidopsis thaliana.

PubMed

Yang, Xiao; Beres, Zachery T; Jin, Lin; Parrish, Jason T; Zhao, Wanying; Mackey, David; Snow, Allison A

2017-01-01

Widespread overuse of the herbicide glyphosate, the active ingredient in RoundUp®, has led to the evolution of glyphosate-resistant weed biotypes, some of which persist by overproducing the herbicide's target enzyme, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). EPSPS is a key enzyme in the shikimic acid pathway for biosynthesis of aromatic amino acids, lignin, and defensive compounds, but little is known about how overproducing EPSPS affects downstream metabolites, growth, or lifetime fitness in the absence of glyphosate. We are using Arabidopsis as a model system for investigating phenotypic effects of overproducing EPSPS, thereby avoiding confounding effects of genetic background or other mechanisms of herbicide resistance in agricultural weeds. Here, we report results from the first stage of this project. We designed a binary vector expressing a native EPSPS gene from Arabidopsis under control of the CaMV35S promoter (labelled OX, for over-expression). For both OX and the empty vector (labelled EV), we obtained nine independent T3 lines. Subsets of these lines were used to characterize glyphosate resistance in greenhouse experiments. Seven of the nine OX lines exhibited enhanced glyphosate resistance when compared to EV and wild-type control lines, and one of these was discarded due to severe deformities. The remaining six OX lines exhibited enhanced EPSPS gene expression and glyphosate resistance compared to controls. Glyphosate resistance was correlated with the degree of EPSPS over-expression for both vegetative and flowering plants, indicating that glyphosate resistance can be used as a surrogate for EPSPS expression levels in this system. These findings set the stage for examination of the effects of EPSPS over-expression on fitness-related traits in the absence of glyphosate. We invite other investigators to contact us if they wish to study gene expression, downstream metabolic effects, and other questions with these particular lines.

Effects of over-expressing a native gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) on glyphosate resistance in Arabidopsis thaliana

PubMed Central

Beres, Zachery T.; Jin, Lin; Parrish, Jason T.; Zhao, Wanying; Mackey, David; Snow, Allison A.

2017-01-01

Widespread overuse of the herbicide glyphosate, the active ingredient in RoundUp®, has led to the evolution of glyphosate-resistant weed biotypes, some of which persist by overproducing the herbicide’s target enzyme, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). EPSPS is a key enzyme in the shikimic acid pathway for biosynthesis of aromatic amino acids, lignin, and defensive compounds, but little is known about how overproducing EPSPS affects downstream metabolites, growth, or lifetime fitness in the absence of glyphosate. We are using Arabidopsis as a model system for investigating phenotypic effects of overproducing EPSPS, thereby avoiding confounding effects of genetic background or other mechanisms of herbicide resistance in agricultural weeds. Here, we report results from the first stage of this project. We designed a binary vector expressing a native EPSPS gene from Arabidopsis under control of the CaMV35S promoter (labelled OX, for over-expression). For both OX and the empty vector (labelled EV), we obtained nine independent T3 lines. Subsets of these lines were used to characterize glyphosate resistance in greenhouse experiments. Seven of the nine OX lines exhibited enhanced glyphosate resistance when compared to EV and wild-type control lines, and one of these was discarded due to severe deformities. The remaining six OX lines exhibited enhanced EPSPS gene expression and glyphosate resistance compared to controls. Glyphosate resistance was correlated with the degree of EPSPS over-expression for both vegetative and flowering plants, indicating that glyphosate resistance can be used as a surrogate for EPSPS expression levels in this system. These findings set the stage for examination of the effects of EPSPS over-expression on fitness-related traits in the absence of glyphosate. We invite other investigators to contact us if they wish to study gene expression, downstream metabolic effects, and other questions with these particular lines. PMID:28426703

Lower weight gain and hepatic lipid content in hamsters fed high fat diets supplemented with white rice protein, brown rice protein, soy protein, and their hydrolysates.

PubMed

Zhang, Huijuan; Bartley, Glenn E; Mitchell, Cheryl R; Zhang, Hui; Yokoyama, Wallace

2011-10-26

The physiological effects of the hydrolysates of white rice protein (WRP), brown rice protein (BRP), and soy protein (SP) hydrolyzed by the food grade enzyme, alcalase2.4 L, were compared to the original protein source. Male Syrian Golden hamsters were fed high-fat diets containing either 20% casein (control) or 20% extracted proteins or their hydrolysates as the protein source for 3 weeks. The brown rice protein hydrolysate (BRPH) diet group reduced weight gain 76% compared with the control. Animals fed the BRPH supplemented diet also had lower final body weight, liver weight, very low density lipoprotein cholesterol (VLDL-C), and liver cholesterol, and higher fecal fat and bile acid excretion than the control. Expression levels of hepatic genes for lipid oxidation, PPARα, ACOX1, and CPT1, were highest for hamsters fed the BRPH supplemented diet. Expression of CYP7A1, the gene regulating bile acid synthesis, was higher in all test groups. Expression of CYP51, a gene coding for an enzyme involved in cholesterol synthesis, was highest in the BRPH diet group. The results suggest that BRPH includes unique peptides that reduce weight gain and hepatic cholesterol synthesis.

Regulation of Lipid Droplet Size in Mammary Epithelial Cells by Remodeling of Membrane Lipid Composition—A Potential Mechanism

PubMed Central

Cohen, Bat-Chen; Shamay, Avi; Argov-Argaman, Nurit

2015-01-01

Milk fat globule size is determined by the size of its precursors—intracellular lipid droplets—and is tightly associated with its composition. We examined the relationship between phospholipid composition of mammary epithelial cells and the size of both intracellular and secreted milk fat globules. Primary culture of mammary epithelial cells was cultured in medium without free fatty acids (control) or with 0.1 mM free capric, palmitic or oleic acid for 24 h. The amount and composition of the cellular lipids and the size of the lipid droplets were determined in the cells and medium. Mitochondrial quantity and expression levels of genes associated with mitochondrial biogenesis and polar lipid composition were determined. Cells cultured with oleic and palmitic acids contained similar quantities of triglycerides, 3.1- and 3.8-fold higher than in controls, respectively (P < 0.0001). When cultured with oleic acid, 22% of the cells contained large lipid droplets (>3 μm) and phosphatidylethanolamine concentration was higher by 23 and 63% compared with that in the control and palmitic acid treatments, respectively (P < 0.0001). In the presence of palmitic acid, only 4% of the cells contained large lipid droplets and the membrane phosphatidylcholine concentration was 22% and 16% higher than that in the control and oleic acid treatments, respectively (P < 0.0001). In the oleic acid treatment, approximately 40% of the lipid droplets were larger than 5 μm whereas in that of the palmitic acid treatment, only 16% of the droplets were in this size range. Triglyceride secretion in the oleic acid treatment was 2- and 12-fold higher compared with that in the palmitic acid and control treatments, respectively. Results imply that membrane composition of bovine mammary epithelial cells plays a role in controlling intracellular and secreted lipid droplets size, and that this process is not associated with cellular triglyceride content. PMID:25756421

Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs

PubMed Central

Shen, Xiulong; Corey, David R

2018-01-01

Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946

Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1.

PubMed

Hattori, T; Terada, T; Hamasuna, S

1995-06-01

Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression

NASA Astrophysics Data System (ADS)

Xiong, Li-Ping; Ma, Yu-Qiang; Tang, Lei-Han

2010-09-01

Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology.

Lithocholic bile acid inhibits lipogenesis and induces apoptosis in breast cancer cells.

PubMed

Luu, Trang H; Bard, Jean-Marie; Carbonnelle, Delphine; Chaillou, Chloé; Huvelin, Jean-Michel; Bobin-Dubigeon, Christine; Nazih, Hassan

2018-02-01

It has amply been documented that mammary tumor cells may exhibit an increased lipogenesis. Biliary acids are currently recognized as signaling molecules in the intestine, in addition to their classical roles in the digestion and absorption of lipids. The aim of our study was to evaluate the impact of lithocholic acid (LCA) on the lipogenesis of breast cancer cells. The putative cytotoxic effects of LCA on these cells were also examined. The effects of LCA on breast cancer-derived MCF-7 and MDA-MB-231 cells were studied using MTT viability assays, Annexin-FITC and Akt phosphorylation assays to evaluate anti-proliferative and pro-apoptotic properties, qRT-PCR and Western blotting assays to assess the expression of the bile acid receptor TGR5 and the estrogen receptor ERα, and genes and proteins involved in apoptosis (Bax, Bcl-2, p53) and lipogenesis (SREBP-1c, FASN, ACACA). Intracellular lipid droplets were visualized using Oil Red O staining. We found that LCA induces TGR5 expression and exhibits anti-proliferative and pro-apoptotic effects in MCF-7 and MDA-MB-231 cells. Also, an increase in pro-apoptotic p53 protein expression and a decrease in anti-apoptotic Bcl-2 protein expression were observed after LCA treatment of MCF-7 cells. In addition, we found that LCA reduced Akt phosphorylation in MCF-7 cells, but not in MDA-MB-231 cells. We also noted that LCA reduced the expression of SREBP-1c, FASN and ACACA in both breast cancer-derived cell lines and that cells treated with LCA contained low numbers of lipid droplets compared to untreated control cells. Finally, a decrease in ERα expression was observed in MCF-7 cells treated with LCA. Our data suggest a potential therapeutic role of lithocholic acid in breast cancer cells through a reversion of lipid metabolism deregulation.

Hepatic fatty acid biosynthesis is more responsive to protein than carbohydrate in rainbow trout during acute stimulations.

PubMed

Dai, Weiwei; Panserat, Stéphane; Kaushik, Sadasivam; Terrier, Frédéric; Plagnes-Juan, Elisabeth; Seiliez, Iban; Skiba-Cassy, Sandrine

2016-01-01

The link between dietary carbohydrate/protein and de novo lipogenesis (DNL) remains debatable in carnivorous fish. We aimed to evaluate and compare the response of hepatic lipogenic gene expression to dietary carbohydrate intake/glucose and dietary protein intake/amino acids (AAs) during acute stimulations using both in vivo and in vitro approaches. For the in vivo trial, three different diets and a controlled-feeding method were employed to supply fixed amount of dietary protein or carbohydrate in a single meal; for the in vitro trial, primary hepatocytes were stimulated with a low or high level of glucose (3 mM or 20 mM) and a low or high level of AAs (one-fold or four-fold concentrated AAs). In vitro data showed that a high level of AAs upregulated the expression of enzymes involved in DNL [fatty acid synthase (FAS) and ATP citrate lyase (ACLY)], lipid bioconversion [elongation of very long chain fatty acids like-5 (Elovl5), Elovl2, Δ6 fatty acyl desaturase (D6D) and stearoyl-CoA desaturase-1 (SCD1)], NADPH production [glucose-6-phosphate dehydrogenase (G6PDH) and malic enzyme (ME)], and transcriptional factor sterol regulatory element binding protein 1-like, while a high level of glucose only elevated the expression of ME. Data in trout liver also showed that high dietary protein intake induced higher lipogenic gene expression (FAS, ACLY, and Elovl2) regardless of dietary carbohydrate intake, while high carbohydrate intake markedly suppressed the expression of acetyl-CoA carboxylase (ACC) and Elovl5. Overall, we conclude that, unlike rodents or humans, hepatic fatty acid biosynthetic gene expression in rainbow trout is more responsive to dietary protein intake/AAs than dietary carbohydrate intake/glucose during acute stimulations. This discrepancy probably represents one important physiological and metabolic difference between carnivores and omnivores. Copyright © 2016 the American Physiological Society.

Selected lactic acid-producing bacterial isolates with the capacity to reduce Salmonella translocation and virulence gene expression in chickens.

PubMed

Yang, Xiaojian; Brisbin, Jennifer; Yu, Hai; Wang, Qi; Yin, Fugui; Zhang, Yonggang; Sabour, Parviz; Sharif, Shayan; Gong, Joshua

2014-01-01

Probiotics have been used to control Salmonella colonization/infection in chickens. Yet the mechanisms of probiotic effects are not fully understood. This study has characterized our previously-selected lactic acid-producing bacterial (LAB) isolates for controlling Salmonella infection in chickens, particularly the mechanism underlying the control. In vitro studies were conducted to characterize 14 LAB isolates for their tolerance to low pH (2.0) and high bile salt (0.3-1.5%) and susceptibility to antibiotics. Three chicken infection trials were subsequently carried out to evaluate four of the isolates for reducing the burden of Salmonella enterica serovar Typhimurium in the broiler cecum. Chicks were gavaged with LAB cultures (10(6-7) CFU/chick) or phosphate-buffered saline (PBS) at 1 day of age followed by Salmonella challenge (10(4) CFU/chick) next day. Samples of cecal digesta, spleen, and liver were examined for Salmonella counts on days 1, 3, or 4 post-challenge. Salmonella in the cecum from Trial 3 was also assessed for the expression of ten virulence genes located in its pathogenicity island-1 (SPI-1). These genes play a role in Salmonella intestinal invasion. Tested LAB isolates (individuals or mixed cultures) were unable to lower Salmonella burden in the chicken cecum, but able to attenuate Salmonella infection in the spleen and liver. The LAB treatments also reduced almost all SPI-1 virulence gene expression (9 out of 10) in the chicken cecum, particularly at the low dose. In vitro treatment with the extracellular culture fluid from a LAB culture also down-regulated most SPI-1 virulence gene expression. The possible correlation between attenuation of Salmonella infection in the chicken spleen and liver and reduction of Salmonella SPI-1 virulence gene expression in the chicken cecum by LAB isolates is a new observation. Suppression of Salmonella virulence gene expression in vivo can be one of the strategies for controlling Salmonella infection in chickens.

Generation of transgenic wheat (Triticum aestivum L.) accumulating heterologous endo-xylanase or ferulic acid esterase in the endosperm.

PubMed

Harholt, Jesper; Bach, Inga C; Lind-Bouquin, Solveig; Nunan, Kylie J; Madrid, Susan M; Brinch-Pedersen, Henrik; Holm, Preben B; Scheller, Henrik V

2010-04-01

Endo-xylanase (from Bacillus subtilis) or ferulic acid esterase (from Aspergillus niger) were expressed in wheat under the control of the endosperm-specific 1DX5 glutenin promoter. Constructs both with and without the endoplasmic reticulum retention signal (Lys-Asp-Glu-Leu) KDEL were used. Transgenic plants were recovered in all four cases but no qualitative differences could be observed whether KDEL was added or not. Endo-xylanase activity in transgenic grains was increased between two and threefold relative to wild type. The grains were shrivelled and had a 25%-33% decrease in mass. Extensive analysis of the cell walls showed a 10%-15% increase in arabinose to xylose ratio, a 50% increase in the proportion of water-extractable arabinoxylan, and a shift in the MW of the water-extractable arabinoxylan from being mainly larger than 85 kD to being between 2 and 85 kD. Ferulic acid esterase-expressing grains were also shrivelled, and the seed weight was decreased by 20%-50%. No ferulic acid esterase activity could be detected in wild-type grains whereas ferulic acid esterase activity was detected in transgenic lines. The grain cell walls had 15%-40% increase in water-unextractable arabinoxylan and a decrease in monomeric ferulic acid between 13% and 34%. In all the plants, the observed changes are consistent with a plant response that serves to minimize the effect of the heterologously expressed enzymes by increasing arabinoxylan biosynthesis and cross-linking.

Generation of transgenic wheat (Triticum aestivum L.) accumulating heterologous endo-xylanase or ferulic acid esterase in the endosperm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harholt, Jesper; Bach, Inga C; Lind-Bouquin, Solveig

2009-12-08

Endo-xylanase (from Bacillus subtilis) or ferulic acid esterase (from Aspergillus niger) were expressed in wheat under the control of the endosperm specific 1DX5 glutenin promoter. Constructs both with and without the endoplasmic reticulum retention signal KDEL were used. Transgenic plants were recovered in all four cases but no qualitative differences could be observed whether KDEL was added or not. Endo-xylanase activity in transgenic grains was increased between two and three fold relative to wild type. The grains were shriveled and had a 25-33% decrease in mass. Extensive analysis of the cell walls showed a 10-15% increase in arabinose to xylosemore » ratio, a 50% increase in the proportion of water extractable arabinoxylan, and a shift in the MW of the water extractable arabinoxylan from being mainly larger than 85 kD to being between 2 kD and 85 kD. Ferulic acid esterase expressing grains were also shriveled and the seed weight was decreased by 20-50%. No ferulic acid esterase activity could be detected in wild type grains whereas ferulic acid esterase activity was detected in transgenic lines. The grain cell walls had 15-40% increase in water unextractable arabinoxylan and a decrease in monomeric ferulic acid between 13 and 34%. In all the plants the observed changes are consistent with a plant response that serves to minimize the effect of the heterologously expressed enzymes by increasing arabinoxylan biosynthesis and cross-linking.« less

[Gallic acid inhibits inflammatory response of RAW264.7 macrophages by blocking the activation of TLR4/NF-κB induced by LPS].

PubMed

Huang, Lihua; Hou, Lin; Xue, Hainan; Wang, Chunjie

2016-12-01

Objective To observe the influence of gallic acid on Toll-like receptor 4/nuclear factor-κB (TLR4/NF-κB) pathway in the RAW264.7 macrophages stimulated by lipopolysaccharide (LPS). Methods RAW264.7 macrophages were divided into the following groups: control group, LPS group, LPS combined with gallic acid group, LPS combined with pyrrolidine dithiocarbamate (PDTC) group and LPS combined with dexamethasone (DM) group. RAW264.7 cells were cultured for 24 hours after corresponding treatments. The levels of tumor necrosis factor α (TNF-α), interleukin-1 (IL-1) and IL-6 were detected by ELISA. The levels of TLR4 and NF-κB mRNAs were tested by real-time PCR. The levels of p-IκBα, p65, p-p65 and TLR4 proteins were examined by Western blotting. Results The expression levels of TNF-α, IL-1 and IL-6 were up-regulated in the RAW264.7 macrophages after stimulated by LPS. Gallic acid could reduce the elevated expression levels of TNF-α, IL-1 and IL-6 induced by LPS. The expression of TLR4 significantly increased after stimulated by LPS and NF-κB was activated. Gallic acid could reverse the above changes and prevent the activation of NF-κB. Conclusion Gallic acid could inhibit LPS-induced inflammatory response in RAW264.7 macrophages via TLR4/NF-κB pathway.

Total fatty acid content of the plasma membrane of Saccharomyces cerevisiae is more responsible for ethanol tolerance than the degree of unsaturation.

PubMed

Kim, Hyun-Soo; Kim, Na-Rae; Choi, Wonja

2011-03-01

The effect of change in unsaturated fatty acid composition on ethanol tolerance in Saccharomyces cerevisiae overexpressing ScOLE1 (∆9 fatty acid desaturase gene of S. cerevisiae), CaFAD2 (∆12 fatty acid desaturase gene of Candida albicans), or CaFAD3 (ω3 fatty acid desaturase gene of C. albicans) was examined. ScOLE1 over-expression increased the total unsaturated fatty acid content and enhanced ethanol tolerance, compared with a control strain. In contrast, overexpression of CaFAD2 and CaFAD3, which led to production of linoleic acid (18:2) and α-linolenic acid (18:3), respectively, neither changed total unsaturated fatty acids nor enhanced ethanol tolerance. The total unsaturated fatty acid content rather than the degree of unsaturation is thus an important factor for ethanol tolerance.

PPARα signal pathway gene expression is associated with fatty acid content in yak and cattle longissimus dorsi muscle.

PubMed

Qin, W; Liang, C N; Guo, X; Chu, M; Pei, J; Bao, P J; Wu, X Y; Li, T K; Yan, P

2015-11-19

Intramuscular fatty acid (FA) is related to meat qualities such as juiciness, tenderness, palatability, and shear force. PPARα plays an important role in lipid metabolism in the liver and skeletal muscle. This study investigated FA composition in yaks and cattle, in order to ascertain whether a correlation between PPARα signal pathway genes as candidate genes and meat FA composition in yaks and cattle exists. Statistical analyses revealed that levels of monounsaturated fatty acid (MUFA) and polyunsaturated fatty acid (PUFA) in yaks were significantly higher than those in cattle (P < 0.01), whereas saturated fatty acid (SFA) levels were significantly lower than those in cattle (P < 0.05). The mRNA expression levels of FABP4 (P < 0.05), SCP2 (P < 0.05), and APOA1 (P < 0.01) in yaks were significantly lower than those in cattle. However, LPL expression in yaks was significantly higher than that in cattle (P < 0.05). In yaks, the expression levels of FABP3 (P < 0.05) and LPL (P < 0.01) were negatively correlated with MUFA, and those of FABP4 and SCD were positively correlated with PUFA (P < 0.01). In cattle, the mRNA level of PLTP was positively correlated with SFA (P < 0.05), and LPL was positively correlated with MUFA (P < 0.05). These results suggest that these genes may participate in the regulation and control of intramuscular FA metabolism in yaks, so they could be used as candidate markers to improve yak meat quality.

The numbers of individual mitochondrial DNA molecules and mitochondrial DNA nucleoids in yeast are co-regulated by the general amino acid control pathway.

PubMed

MacAlpine, D M; Perlman, P S; Butow, R A

2000-02-15

Mitochondrial DNA (mtDNA) is inherited as a protein-DNA complex (the nucleoid). We show that activation of the general amino acid response pathway in rho(+) and rho(-) petite cells results in an increased number of nucleoids without an increase in mtDNA copy number. In rho(-) cells, activation of the general amino acid response pathway results in increased intramolecular recombination between tandemly repeated sequences of rho(-) mtDNA to produce small, circular oligomers that are packaged into individual nucleoids, resulting in an approximately 10-fold increase in nucleoid number. The parsing of mtDNA into nucleoids due to general amino acid control requires Ilv5p, a mitochondrial protein that also functions in branched chain amino acid biosynthesis, and one or more factors required for mtDNA recombination. Two additional proteins known to function in mtDNA recombination, Abf2p and Mgt1p, are also required for parsing mtDNA into a larger number of nucleoids, although expression of these proteins is not under general amino acid control. Increased nucleoid number leads to increased mtDNA transmission, suggesting a mechanism to enhance mtDNA inheritance under amino acid starvation conditions.

Catalposide is a natural agonistic ligand of peroxisome proliferator-activated receptor-{alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ji Hae; Jun, Hee-jin; Hoang, Minh-Hien

2012-06-15

Highlights: Black-Right-Pointing-Pointer Catalposide is a novel ligand for PPAR{alpha}. Black-Right-Pointing-Pointer Cell stimulated with catalposide improved fatty acid uptake, regulated target genes in fatty acid {beta}-oxidation and synthesis. Black-Right-Pointing-Pointer Catalposdie reduces hepatic triacylglycerides. Black-Right-Pointing-Pointer Theses demonstrate catalposide could ameliorate hyperlipidemia and hepatic steatosis. -- Abstract: Peroxisome proliferator-activated receptor-alpha (PPAR{alpha}) is a nuclear receptor that regulates the expression of genes related to cellular lipid uptake and oxidation. Thus, PPAR{alpha} agonists may be important in the treatment of hypertriglyceridemia and hepatic steatosis. In this study, we demonstrated that catalposide is a novel natural PPAR{alpha} agonist, identified from reporter gene assay-based activity screening withmore » approximately 900 natural plant and seaweed extracts. Results of time-resolved fluorescence resonance energy transfer analyses suggested that the compound interacted directly with the ligand-binding domain of PPAR{alpha}. Cultured hepatocytes stimulated with catalposide exhibited significantly reduced cellular triglyceride concentrations, by 21%, while cellular uptake of fatty acids was increased, by 70% (P < 0.05). Quantitative PCR analysis revealed that the increase in cellular fatty acid uptake was due to upregulation of fatty acid transporter protein-4 (+19% vs. the control) in cells stimulated with catalposide. Additionally, expression of genes related to fatty acid oxidation and high-density lipoprotein metabolism were upregulated, while that of genes related to fatty acid synthesis were suppressed. In conclusion, catalposide is hypolipidemic by activation of PPAR{alpha} via a ligand-mediated mechanism that modulates the expression of in lipid metabolism genes in hepatocytes.« less

Differential regulation of placental amino acid transport by saturated and unsaturated fatty acids.

PubMed

Lager, Susanne; Jansson, Thomas; Powell, Theresa L

2014-10-15

Fatty acids are critical for normal fetal development but may also influence placental function. We have previously reported that oleic acid (OA) stimulates amino acid transport in primary human trophoblasts (PHTs). In other tissues, saturated and unsaturated fatty acids have distinct effects on cellular signaling, for instance, palmitic acid (PA) but not OA reduces IκBα expression. We hypothesized that saturated and unsaturated fatty acids differentially affect trophoblast amino acid transport and cellular signaling. To test this hypothesis, PHTs were cultured in docosahexaenoic acid (DHA; 50 μM), OA (100 μM), or PA (100 μM). DHA and OA were also combined to test whether DHA could counteract the OA stimulatory effect on amino acid transport. The effects of fatty acids were compared against a vehicle control. Amino acid transport was measured by isotope-labeled tracers. Activation of inflammatory-related signaling pathways and the mechanistic target of rapamycin (mTOR) pathway were determined by Western blot analysis. Exposure of PHTs to DHA for 24 h reduced amino acid transport and phosphorylation of p38 MAPK, STAT3, mTOR, eukaryotic initiation factor 4E-binding protein 1, and ribosomal protein (rp)S6. In contrast, OA increased amino acid transport and phosphorylation of ERK, mTOR, S6 kinase 1, and rpS6. The combination of DHA with OA increased amino acid transport and rpS6 phosphorylation. PA did not affect amino acid transport but reduced IκBα expression. In conclusion, these fatty acids differentially regulated placental amino acid transport and cellular signaling. Taken together, these findings suggest that dietary fatty acids could alter the intrauterine environment by modifying placental function, thereby having long-lasting effects on the developing fetus. Copyright © 2014 the American Physiological Society.

Effects of fish and krill oil on gene expression in peripheral blood mononuclear cells and circulating markers of inflammation: a randomised controlled trial.

PubMed

Rundblad, Amanda; Holven, Kirsten B; Bruheim, Inge; Myhrstad, Mari C; Ulven, Stine M

2018-01-01

Marine n -3 (omega-3) fatty acids alter gene expression by regulating the activity of transcription factors. Krill oil is a source of marine n -3 fatty acids that has been shown to modulate gene expression in animal studies; however, the effect in humans is not known. Hence, we aimed to compare the effect of intake of krill oil, lean and fatty fish with a similar content of n -3 fatty acids, and high-oleic sunflower oil (HOSO) with added astaxanthin on the expression of genes involved in glucose and lipid metabolism and inflammation in peripheral blood mononuclear cells (PBMC) as well as circulating inflammatory markers. In an 8-week trial, healthy men and women aged 18-70 years with fasting TAG of 1·3-4·0 mmol/l were randomised to receive krill oil capsules ( n 12), HOSO capsules ( n 12) or lean and fatty fish ( n 12). The weekly intakes of marine n -3 fatty acids from the interventions were 4654, 0 and 4103 mg, respectively. The mRNA expression of four genes, PPAR γ coactivator 1A ( PPARGC1A ), steaoryl-CoA desaturase ( SCD ), ATP binding cassette A1 ( ABCA1 ) and cluster of differentiation 40 ( CD40 ), were differently altered by the interventions. Furthermore, within-group analyses revealed that krill oil down-regulated the mRNA expression of thirteen genes, including genes involved in glucose and cholesterol metabolism and β-oxidation. Fish altered the mRNA expression of four genes and HOSO down-regulated sixteen genes, including several inflammation-related genes. There were no differences between the groups in circulating inflammatory markers after the intervention. In conclusion, the intake of krill oil and HOSO with added astaxanthin alter the PBMC mRNA expression of more genes than the intake of fish.

Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration-Resistant Prostate Cancer

DTIC Science & Technology

2015-03-01

interacts with bone extracellular matrix associated calcium and hydroxyapatite and deposited in the bone matrix. Some Osteocalcin is released into...fluorescence protein as control) Osteocalcin and mutant Osteocalcin using lentivirus mediated stable infections. 2. Determined the gene expression of Gprc61... used a lentiviral system for expressing Osteocalcin and mutated Osteocalcin. Osteocalcin is mutated at three positions where glutamic acid residue at

Jasmonic Acid Modulates the Physio-Biochemical Attributes, Antioxidant Enzyme Activity, and Gene Expression in Glycine max under Nickel Toxicity

PubMed Central

Sirhindi, Geetika; Mir, Mudaser Ahmad; Abd-Allah, Elsayed Fathi; Ahmad, Parvaiz; Gucel, Salih

2016-01-01

In present study, we evaluated the effects of Jasmonic acid (JA) on physio-biochemical attributes, antioxidant enzyme activity, and gene expression in soybean (Glycine max L.) plants subjected to nickel (Ni) stress. Ni stress decreases the shoot and root length and chlorophyll content by 37.23, 38.31, and 39.21%, respectively, over the control. However, application of JA was found to improve the chlorophyll content and length of shoot and root of Ni-fed seedlings. Plants supplemented with JA restores the chlorophyll fluorescence, which was disturbed by Ni stress. The present study demonstrated increase in proline, glycinebetaine, total protein, and total soluble sugar (TSS) by 33.09, 51.26, 22.58, and 49.15%, respectively, under Ni toxicity over the control. Addition of JA to Ni stressed plants further enhanced the above parameters. Ni stress increases hydrogen peroxide (H2O2) by 68.49%, lipid peroxidation (MDA) by 50.57% and NADPH oxidase by 50.92% over the control. Supplementation of JA minimizes the accumulation of H2O2, MDA, and NADPH oxidase, which helps in stabilization of biomolecules. The activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) increases by 40.04, 28.22, 48.53, and 56.79%, respectively, over the control in Ni treated seedlings and further enhancement in the antioxidant activity was observed by the application of JA. Ni treated soybean seedlings showed increase in expression of Fe-SOD by 77.62, CAT by 15.25, POD by 58.33, and APX by 80.58% over the control. Nevertheless, application of JA further enhanced the expression of the above genes in the present study. Our results signified that Ni stress caused negative impacts on soybean seedlings, but, co-application of JA facilitate the seedlings to combat the detrimental effects of Ni through enhanced osmolytes, activity of antioxidant enzymes and gene expression. PMID:27242811

The APETALA-2-like transcription factor OsAP2-39 controls key interactions between abscisic acid and gibberellin in rice.

PubMed

Yaish, Mahmoud W; El-Kereamy, Ashraf; Zhu, Tong; Beatty, Perrin H; Good, Allen G; Bi, Yong-Mei; Rothstein, Steven J

2010-09-09

The interaction between phytohormones is an important mechanism which controls growth and developmental processes in plants. Deciphering these interactions is a crucial step in helping to develop crops with enhanced yield and resistance to environmental stresses. Controlling the expression level of OsAP2-39 which includes an APETALA 2 (AP2) domain leads to phenotypic changes in rice. Overexpression of OsAP2-39 leads to a reduction in yield by decreasing the biomass and the number of seeds in the transgenic rice lines. Global transcriptome analysis of the OsAP2-39 overexpression transgenic rice revealed the upregulation of a key abscisic acid (ABA) biosynthetic gene OsNCED-I which codes for 9-cis-epoxycarotenoid dioxygenase and leads to an increase in the endogenous ABA level. In addition to OsNCED-1, the gene expression analysis revealed the upregulation of a gene that codes for the Elongation of Upper most Internode (EUI) protein, an enzyme that catalyzes 16α, 17-epoxidation of non-13-hydroxylated GAs, which has been shown to deactivate gibberellins (GAs) in rice. The exogenous application of GA restores the wild-type phenotype in the transgenic line and ABA application induces the expression of EUI and suppresses the expression of OsAP2-39 in the wild-type line. These observations clarify the antagonistic relationship between ABA and GA and illustrate a mechanism that leads to homeostasis of these hormones. In vivo and in vitro analysis showed that the expression of both OsNCED-1 and EUI are directly controlled by OsAP2-39. Together, these results reveal a novel mechanism for the control of the ABA/GA balance in rice which is regulated by OsAP2-39 that in turn regulates plant growth and seed production.

The APETALA-2-Like Transcription Factor OsAP2-39 Controls Key Interactions between Abscisic Acid and Gibberellin in Rice

PubMed Central

Yaish, Mahmoud W.; El-kereamy, Ashraf; Zhu, Tong; Beatty, Perrin H.; Good, Allen G.; Bi, Yong-Mei; Rothstein, Steven J.

2010-01-01

The interaction between phytohormones is an important mechanism which controls growth and developmental processes in plants. Deciphering these interactions is a crucial step in helping to develop crops with enhanced yield and resistance to environmental stresses. Controlling the expression level of OsAP2-39 which includes an APETALA 2 (AP2) domain leads to phenotypic changes in rice. Overexpression of OsAP2-39 leads to a reduction in yield by decreasing the biomass and the number of seeds in the transgenic rice lines. Global transcriptome analysis of the OsAP2-39 overexpression transgenic rice revealed the upregulation of a key Abscisic Acid (ABA) biosynthetic gene OsNCED-I which codes for 9-cis-epoxycarotenoid dioxygenase and leads to an increase in the endogenous ABA level. In addition to OsNCED-1, the gene expression analysis revealed the upregulation of a gene that codes for the Elongation of Upper most Internode (EUI) protein, an enzyme that catalyzes 16α, 17-epoxidation of non-13-hydroxylated GAs, which has been shown to deactivate gibberellins (GAs) in rice. The exogenous application of GA restores the wild-type phenotype in the transgenic line and ABA application induces the expression of EUI and suppresses the expression of OsAP2-39 in the wild-type line. These observations clarify the antagonistic relationship between ABA and GA and illustrate a mechanism that leads to homeostasis of these hormones. In vivo and in vitro analysis showed that the expression of both OsNCED-1 and EUI are directly controlled by OsAP2-39. Together, these results reveal a novel mechanism for the control of the ABA/GA balance in rice which is regulated by OsAP2-39 that in turn regulates plant growth and seed production. PMID:20838584

The effect of mepiquat chloride on elongation of cotton (Gossypium hirsutum L.) internode is associated with low concentration of gibberellic acid.

PubMed

Wang, Li; Mu, Chun; Du, Mingwei; Chen, Yin; Tian, Xiaoli; Zhang, Mingcai; Li, Zhaohu

2014-08-01

The growth regulator mepiquat chloride (MC) is globally used in cotton (Gossypium hirsutum L.) canopy manipulation to avoid excess growth and yield loss. However, little information is available as to whether the modification of plant architecture by MC is related to alterations in gibberellic acid (GA) metabolism and signaling. Here, the role of GA metabolism and signaling was investigated in cotton seedlings treated with MC. The MC significantly decreased endogenous GA3 and GA4 levels in the elongating internode, which inhibited cell elongation by downregulating GhEXP and GhXTH2, and then reducing plant height. Biosynthetic and metabolic genes of GA were markedly suppressed within 2-10d of MC treatment, which also downregulated the expression of DELLA-like genes. A remarkable feedback regulation was observed at the early stage of MC treatment when GA biosynthetic and metabolic genes expression was evidently upregulated. Mepiquat chloride action was controlled by temporal translocation and spatial accumulation which regulated GA biosynthesis and signal expression for maintaining GA homeostasis. The results suggested that MC application could reduce endogenous GA levels in cotton through controlled GA biosynthetic and metabolic genes expression, which might inhibit cell elongation, thereby shortening the internode and reducing plant height. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

ISOLATION AND CHARACTERIZATION OF AXOLOTL NPDC-1 AND ITS EFFECTS ON RETINOIC ACID RECEPTOR SIGNALING

PubMed Central

Theodosiou, Maria; Monaghan, James R; Spencer, Michael L; Voss, S Randal; Noonan, Daniel J

2009-01-01

Retinoic acid, a key morphogen in early vertebrate development and tissue regeneration, mediates its effects through the binding of receptors that act as ligand-induced transcription factors. These binding events function to recruit an array of transcription co-regulatory proteins to specific gene promoters. One such co-regulatory protein, neuronal proliferation and differentiation control-1 (NPDC-1), is broadly expressed during mammalian development and functions as an in vitro repressor of retinoic acid receptor (RAR)-mediated transcription. To obtain comparative and developmental insights about NPDC-1 function, we cloned the axolotl (Ambystoma mexicanum) orthologue and measured transcript abundances among tissues sampled during the embryonic and juvenile phases of development, and also during spinal cord regeneration. Structurally, the axolotl orthologue of NPDC-1 retained sequence identity to mammalian sequences in all functional domains. Functionally, we observed that axolotl NPDC-1 mRNA expression peaked late in embryogenesis, with highest levels of expression occurring during the time of limb development, a process regulated by retinoic acid signaling. Also similar to what has been observed in mammals, axolotl NPDC-1 directly interacts with axolotl RAR, modulates axolotl RAR DNA binding, and represses cell proliferation and axolotl RAR-mediated gene transcription. These data justify axolotl as a model to further investigate NPDC-1 and its role in regulating retinoic acid signaling. PMID:17331771

OXPHOS-Mediated Induction of NAD+ Promotes Complete Oxidation of Fatty Acids and Interdicts Non-Alcoholic Fatty Liver Disease.

PubMed

Akie, Thomas E; Liu, Lijun; Nam, Minwoo; Lei, Shi; Cooper, Marcus P

2015-01-01

OXPHOS is believed to play an important role in non-alcoholic fatty liver disease (NAFLD), however, precise mechanisms whereby OXPHOS influences lipid homeostasis are incompletely understood. We previously reported that ectopic expression of LRPPRC, a protein that increases cristae density and OXPHOS, promoted fatty acid oxidation in cultured primary hepatocytes. To determine the biological significance of that observation and define underlying mechanisms, we have ectopically expressed LRPPRC in mouse liver in the setting of NAFLD. Interestingly, ectopic expression of LRPPRC in mouse liver completely interdicted NAFLD, including inflammation. Consistent with mitigation of NAFLD, two markers of hepatic insulin resistance--ROS and PKCε activity--were both modestly reduced. As reported by others, improvement of NAFLD was associated with improved whole-body insulin sensitivity. Regarding hepatic lipid homeostasis, the ratio of NAD+ to NADH was dramatically increased in mouse liver replete with LRPPRC. Pharmacological activators and inhibitors of the cellular respiration respectively increased and decreased the [NAD+]/[NADH] ratio, indicating respiration-mediated control of the [NAD+]/[NADH] ratio. Supporting a prominent role for NAD+, increasing the concentration of NAD+ stimulated complete oxidation of fatty acids. Importantly, NAD+ rescued impaired fatty acid oxidation in hepatocytes deficient for either OXPHOS or SIRT3. These data are consistent with a model whereby augmented hepatic OXPHOS increases NAD+, which in turn promotes complete oxidation of fatty acids and protects against NAFLD.

The grapevine root-specific aquaporin VvPIP2;4N controls root hydraulic conductance and leaf gas exchange under well-watered conditions but not under water stress.

PubMed

Perrone, Irene; Gambino, Giorgio; Chitarra, Walter; Vitali, Marco; Pagliarani, Chiara; Riccomagno, Nadia; Balestrini, Raffaella; Kaldenhoff, Ralf; Uehlein, Norbert; Gribaudo, Ivana; Schubert, Andrea; Lovisolo, Claudio

2012-10-01

We functionally characterized the grape (Vitis vinifera) VvPIP2;4N (for Plasma membrane Intrinsic Protein) aquaporin gene. Expression of VvPIP2;4N in Xenopus laevis oocytes increased their swelling rate 54-fold. Northern blot and quantitative reverse transcription-polymerase chain reaction analyses showed that VvPIP2;4N is the most expressed PIP2 gene in root. In situ hybridization confirmed root localization in the cortical parenchyma and close to the endodermis. We then constitutively overexpressed VvPIP2;4N in grape 'Brachetto', and in the resulting transgenic plants we analyzed (1) the expression of endogenous and transgenic VvPIP2;4N and of four other aquaporins, (2) whole-plant, root, and leaf ecophysiological parameters, and (3) leaf abscisic acid content. Expression of transgenic VvPIP2;4N inhibited neither the expression of the endogenous gene nor that of other PIP aquaporins in both root and leaf. Under well-watered conditions, transgenic plants showed higher stomatal conductance, gas exchange, and shoot growth. The expression level of VvPIP2;4N (endogenous + transgene) was inversely correlated to root hydraulic resistance. The leaf component of total plant hydraulic resistance was low and unaffected by overexpression of VvPIP2;4N. Upon water stress, the overexpression of VvPIP2;4N induced a surge in leaf abscisic acid content and a decrease in stomatal conductance and leaf gas exchange. Our results show that aquaporin-mediated modifications of root hydraulics play a substantial role in the regulation of water flow in well-watered grapevine plants, while they have a minor role upon drought, probably because other signals, such as abscisic acid, take over the control of water flow.

Free phenolic acids from the seaweed Halimeda monile with antioxidant effect protecting against liver injury.

PubMed

Mancini-Filho, Jorge; Novoa, Alexis Vidal; González, Ana Elsa Batista; de Andrade-Wartha, Elma Regina S; de O e Silva, Ana Mara; Pinto, José Ricardo; Mancini, Dalva Assunção Portari

2009-01-01

Phenolic compounds are found in seaweed species together with other substances presenting antioxidant activity. The objective of this work was to evaluate the antioxidant activity of the free phenolic acids (FPA) fraction from the seaweed Halimeda monile, and its activity to protect the expression of hepatic enzymes in rats, under experimental CCl4 injury. The antioxidant activity was measured by the DPPH method. The FPA fraction (80 mg/kg, p.o.) was administered during 20 consecutive days to rats. The peroxidation was performed by thiobarbituric acid reactive substances (TBARS). The SOD and CAT enzymatic expressions were measured by RT/PCR. The histology technique was used to evaluate liver injuries. The expression of both, CAT and SOD genes, was more preserved by FPA. Only partial injury could be observed by histology in the liver of rats receiving FPA as compared with the control group; and CCl4 administration induced 60% more peroxidation as compared with the rats receiving FPA. These data suggest that FPA could modulate the antioxidant enzymes and oxidative status in the liver through protection against adverse effects induced by chemical agents.

Attenuation of TRPV1 by AMG-517 after nerve injury promotes peripheral axonal regeneration in rats.

PubMed

Bai, Juan; Liu, Fu; Wu, Li-Fei; Wang, Ya-Fang; Li, Xia-Qing

2018-01-01

Aims The main objective was to investigate the effects of the transient receptor potential cation channel subfamily V member 1 (TRPV1) on nerve regeneration following sciatic transection injury by functional blockage of TRPV1 using AMG-517, a specific blocker of TRPV1. Methods AMG-517 was injected into the area surrounding ipsilateral lumbar dorsal root ganglia 30 min after unilateral sciatic nerve transection. The number of sciatic axons and the expression of growth-associated protein-43 (GAP-43) and glial fibrillary acidic protein was examined using semithin sections, Western blot, and immunofluorescence analyses. Results Blockage of TRPV1 with AMG-517 markedly promoted axonal regeneration, especially at two weeks after sciatic injury; the number of axons was similar to the uninjured control group. After sciatic nerve transection, expression of glial fibrillary acidic protein was decreased and GAP-43 was increased at the proximal stump. However, the expression of both glial fibrillary acidic protein and GAP-43 increased significantly in AMG-517-treated groups. Conclusions TRPV1 may be an important therapeutic target to promote peripheral nerve regeneration after injury.

Effect of the ratios of unsaturated fatty acids on the expressions of genes related to fat and protein in the bovine mammary epithelial cells.

PubMed

Sheng, R; Yan, S M; Qi, L Z; Zhao, Y L

2015-04-01

The objective of this study was to evaluate the effects of the different ratios of unsaturated fatty acids (UFAs) (oleic acid, linoleic acid, and linolenic acid) on the cell viability and triacylglycerol (TAG) content, as well as the mRNA expression of the genes related to lipid and protein synthesis in bovine mammary epithelial cells (BMECs). Primary cells were isolated from the mammary glands of Holstein dairy cows and were passaged twice. Afterward, the cells were randomly allocated to six treatments, five UFA-treated groups, and one control group. For all of the treatments, the the fetal bovine serum in the culture solution was replaced with fatty acid-free BSA (1 g/L), and the cells were treated with different ratios of oleic, linoleic, and linolenic acids (0.75:4:1, 1.5:10:1, 2:13.3:1, 3:20:1, and 4:26.7:1) for 48 h, which were group 1 to group 5. The control culture solution contained only fatty acid-free BSA without UFAs (0 μM). The results indicated that the cell viability was not affected by adding different ratios of UFAs, but the accumulation of TAG was significantly influenced by supplementing with different ratios of UFAs. Adding different ratios of UFAs suppressed the expression of ACACA and FASN but had the opposite effect on the abundances of FABP3 and CD36 mRNA. The expression levels of PPARG, SPEBF1, CSN1S1, and CSN3 mRNA in the BMECs were affected significantly after adding different ratios of UFAs. Our results suggested that groups 1, 2, and 3 (0.75:4:1, 1.5:10:1, and 2:13.3:1) had stronger auxo-action on fat synthesis in the BMECs, where group 3 (2:13.3:1) was the best, followed by group 4 (3:20:1). However, group 5 (4:26.7:1) was the worst. Genes related to protein synthesis in the BMECs were better promoted in groups 2 and 3, and group 3 had the strongest auxo-action, whereas the present study only partly examined the regulation of protein synthesis at the transcriptional level; more studies on translation level are needed in the future. Therefore, when combining fat and protein synthesis, group 3 could be obviously fat and protein synthesis in the BMECs concurrently. However, further studies are necessary to elucidate the mechanism for regulating fat and protein synthesis in the BMECs.

Red grape leaf extract improves endurance capacity by facilitating fatty acid utilization in skeletal muscle in mice.

PubMed

Minegishi, Yoshihiko; Haramizu, Satoshi; Hase, Tadashi; Murase, Takatoshi

2011-09-01

Improving endurance capacity leads to increased athletic performance and active lifestyles. The aim of this study was to investigate the effect of the intake of red grape leaf extract (RGLE), used as a traditional herbal medicine in the Mediterranean area, on endurance capacity in mice. Male BALB/c mice were divided into three experimental groups with similar swimming times and body weights; control group, 0.2% (w/w) and 0.5% RGLE group. Swimming times were measured for evaluation of endurance capacity once a week during the 10-week experimental period. Blood and tissues were collected from anesthetized mice immediately after 30 min of swimming exercise, and analyzed blood component and fatty acid oxidation enzyme activity, and gene expression in soleus muscle and mesenteric adipose tissue. Endurance capacity was improved by RGLE in a dose-related manner, and was significantly longer in the 0.5% RGLE group than in the control group at week 10. Plasma lactate levels after exercise in the 0.5% RGLE group were significantly lower than that in the control group. RGLE induced the upregulation of hormone-sensitive lipase mRNA in mesenteric adipose tissue, increased the plasma free fatty acid concentration after exercise, and enhanced fatty acid oxidation enzyme activity in the soleus muscle. Furthermore, peroxisome proliferator-activated receptor-gamma coactivator 1α (Pgc1α) and its downstream target genes were also significantly upregulated in the soleus muscle in the 0.5% RGLE group. Intake of RGLE upregulated Pgc1α expression and facilitated fatty acid oxidation in skeletal muscle, and these effects contributed, in part, to improve endurance capacity.

Improved Acid Stress Survival of Lactococcus lactis Expressing the Histidine Decarboxylation Pathway of Streptococcus thermophilus CHCC1524*

PubMed Central

Trip, Hein; Mulder, Niels L.; Lolkema, Juke S.

2012-01-01

Degradative amino acid decarboxylation pathways in bacteria generate secondary metabolic energy and provide resistance against acid stress. The histidine decarboxylation pathway of Streptococcus thermophilus CHCC1524 was functionally expressed in the heterologous host Lactococcus lactis NZ9000, and the benefits of the newly acquired pathway for the host were analyzed. During growth in M17 medium in the pH range of 5–6.5, a small positive effect was observed on the biomass yield in batch culture, whereas no growth rate enhancement was evident. In contrast, a strong benefit for the engineered L. lactis strain was observed in acid stress survival. In the presence of histidine, the pathway enabled cells to survive at pH values as low as 3 for at least 2 h, conditions under which the host cells were rapidly dying. The flux through the histidine decarboxylation pathway in cells grown at physiological pH was under strict control of the electrochemical proton gradient (pmf) across the membrane. Ionophores that dissipated the membrane potential (ΔΨ) and/or the pH gradient (ΔpH) strongly increased the flux, whereas the presence of glucose almost completely inhibited the flux. Control of the pmf over the flux was exerted by both ΔΨ and ΔpH and was distributed over the transporter HdcP and the decarboxylase HdcA. The control allowed for a synergistic effect between the histidine decarboxylation and glycolytic pathways in acid stress survival. In a narrow pH range around 2.5 the synergism resulted in a 10-fold higher survival rate. PMID:22351775

Dietary Zinc Deficiency Affects Blood Linoleic Acid: Dihomo-γ-linolenic Acid (LA:DGLA) Ratio; a Sensitive Physiological Marker of Zinc Status in Vivo (Gallus gallus)

PubMed Central

Reed, Spenser; Qin, Xia; Ran-Ressler, Rinat; Brenna, James Thomas; Glahn, Raymond P.; Tako, Elad

2014-01-01

Zinc is a vital micronutrient used for over 300 enzymatic reactions and multiple biochemical and structural processes in the body. To date, sensitive and specific biological markers of zinc status are still needed. The aim of this study was to evaluate Gallus gallus as an in vivo model in the context of assessing the sensitivity of a previously unexplored potential zinc biomarker, the erythrocyte linoleic acid: dihomo-γ-linolenic acid (LA:DGLA) ratio. Diets identical in composition were formulated and two groups of birds (n = 12) were randomly separated upon hatching into two diets, Zn(+) (zinc adequate control, 42.3 μg/g zinc), and Zn(−) (zinc deficient, 2.5 μg/g zinc). Dietary zinc intake, body weight, serum zinc, and the erythrocyte fatty acid profile were measured weekly. At the conclusion of the study, tissues were collected for gene expression analysis. Body weight, feed consumption, zinc intake, and serum zinc were higher in the Zn(+) control versus Zn(−) group (p < 0.05). Hepatic TNF-α, IL-1β, and IL-6 gene expression were higher in the Zn(+) control group (p < 0.05), and hepatic Δ6 desaturase was significantly higher in the Zn(+) group (p < 0.001). The LA:DGLA ratio was significantly elevated in the Zn(−) group compared to the Zn(+) group (22.6 ± 0.5 and 18.5 ± 0.5, % w/w, respectively, p < 0.001). This study suggests erythrocyte LA:DGLA is able to differentiate zinc status between zinc adequate and zinc deficient birds, and may be a sensitive biomarker to assess dietary zinc manipulation. PMID:24658588

RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide.

PubMed

Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

2015-04-09

Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition.

Promiscuous Diffusible Signal Factor Production and Responsiveness of the Xylella fastidiosa Rpf System.

PubMed

Ionescu, Michael; Yokota, Kenji; Antonova, Elena; Garcia, Angelica; Beaulieu, Ellen; Hayes, Terry; Iavarone, Anthony T; Lindow, Steven E

2016-07-19

Cell density-dependent regulation of gene expression in Xylella fastidiosa that is crucial to its switching between plant hosts and insect vectors is dependent on RpfF and its production of 2-enoic acids known as diffusible signal factor (DSF). We show that X. fastidiosa produces a particularly large variety of similar, relatively long-chain-length 2-enoic acids that are active in modulating gene expression. Both X. fastidiosa itself and a Pantoea agglomerans surrogate host harboring X. fastidiosa RpfF (XfRpfF) is capable of producing a variety of both saturated and unsaturated free fatty acids. However, only 2-cis unsaturated acids were found to be biologically active in X. fastidiosa X. fastidiosa produces, and is particularly responsive to, a novel DSF species, 2-cis-hexadecanoic acid that we term XfDSF2. It is also responsive to other, even longer 2-enoic acids to which other taxa such as Xanthomonas campestris are unresponsive. The 2-enoic acids that are produced by X. fastidiosa are strongly affected by the cellular growth environment, with XfDSF2 not detected in culture media in which 2-tetradecenoic acid (XfDSF1) had previously been found. X. fastidiosa is responsive to much lower concentrations of XfDSF2 than XfDSF1. Apparently competitive interactions can occur between various saturated and unsaturated fatty acids that block the function of those agonistic 2-enoic fatty acids. By altering the particular 2-enoic acids produced and the relative balance of free enoic and saturated fatty acids, X. fastidiosa might modulate the extent of DSF-mediated quorum sensing. X. fastidiosa, having a complicated lifestyle in which it moves and multiplies within plants but also must be vectored by insects, utilizes DSF-based quorum sensing to partition the expression of traits needed for these two processes within different cells in this population based on local cellular density. The finding that it can produce a variety of DSF species in a strongly environmentally context-dependent manner provides insight into how it coordinates the many genes under the control of DSF signaling to successfully associate with its two hosts. Since the new DSF variant XfDSF2 described here is much more active than the previously recognized DSF species, it should contribute to plant disease control, given that the susceptibility of plants can be greatly reduced by artificially elevating the levels of DSF in plants, creating "pathogen confusion," resulting in lower virulence. Copyright © 2016 Ionescu et al.

Ethylene signaling triggered by low concentrations of ascorbic acid regulates biomass accumulation in Arabidopsis thaliana.

PubMed

Caviglia, M; Mazorra Morales, L M; Concellón, A; Gergoff Grozeff, G E; Wilson, M; Foyer, C H; Bartoli, C G

2018-02-02

Ascorbic acid (AA) is a major redox buffer in plant cells. The role of ethylene in the redox signaling pathways that influence photosynthesis and growth was explored in two independent AA deficient Arabidopsis thaliana mutants (vtc2-1 and vtc2-4). Both mutants, which are defective in the AA biosynthesis gene GDP-L-galactose phosphorylase, produce higher amounts of ethylene than wt plants. In contrast to the wt, the inhibition of ethylene signaling increased leaf conductance, photosynthesis and dry weight in both vtc2 mutant lines. The AA-deficient mutants showed altered expression of genes encoding proteins involved in the synthesis/responses to phytohormones that control growth, particularly auxin, cytokinins, abscisic acid, brassinosterioids, ethylene and salicylic acid. These results demonstrate that AA deficiency modifies hormone signaling in plants, redox-ethylene interactions providing a regulatory node controlling shoot biomass accumulation. Copyright © 2018 Elsevier Inc. All rights reserved.

Transgenic barley (Hordeum vulgare L.) expressing the wheat aluminium resistance gene (TaALMT1) shows enhanced phosphorus nutrition and grain production when grown on an acid soil.

PubMed

Delhaize, Emmanuel; Taylor, Phillip; Hocking, Peter J; Simpson, Richard J; Ryan, Peter R; Richardson, Alan E

2009-06-01

Barley (Hordeum vulgare L.), genetically modified with the Al(3+) resistance gene of wheat (TaALMT1), was compared with a non-transformed sibling line when grown on an acidic and highly phosphate-fixing ferrosol supplied with a range of phosphorus concentrations. In short-term pot trials (26 days), transgenic barley expressing TaALMT1 (GP-ALMT1) was more efficient than a non-transformed sibling line (GP) at taking up phosphorus on acid soil, but the genotypes did not differ when the soil was limed. Differences in phosphorus uptake efficiency on acid soil could be attributed not only to the differential effects of aluminium toxicity on root growth between the genotypes, but also to differences in phosphorus uptake per unit root length. Although GP-ALMT1 out-performed GP on acid soil, it was still not as efficient at taking up phosphorus as plants grown on limed soil. GP-ALMT1 plants grown in acid soil possessed substantially smaller rhizosheaths than those grown in limed soil, suggesting that root hairs were shorter. This is a probable reason for the lower phosphorus uptake efficiency. When grown to maturity in large pots, GP-ALMT1 plants produced more than twice the grain as GP plants grown on acid soil and 80% of the grain produced by limed controls. Expression of TaALMT1 in barley was not associated with a penalty in either total shoot or grain production in the absence of Al(3+), with both genotypes showing equivalent yields in limed soil. These findings demonstrate that an important crop species can be genetically engineered to successfully increase grain production on an acid soil.

Effect of temperature on fatty acid metabolism in skeletal muscle mitochondria of untrained and endurance-trained rats.

PubMed

Zoladz, Jerzy A; Koziel, Agnieszka; Broniarek, Izabela; Woyda-Ploszczyca, Andrzej M; Ogrodna, Karolina; Majerczak, Joanna; Celichowski, Jan; Szkutnik, Zbigniew; Jarmuszkiewicz, Wieslawa

2017-01-01

We studied the effects of various assay temperatures, representing hypothermia (25°C), normothermia (35°C), and hyperthermia (42°C), on the oxidation of lipid-derived fuels in rat skeletal muscle mitochondria of untrained and endurance-trained rats. Adult 4-month-old male Wistar rats were assigned to a training group (rats trained on a treadmill for 8 weeks) or a sedentary control group. In skeletal muscle mitochondria of both control and trained rats, an increase in the assay temperature from 25°C to 42°C was accompanied by a consistent increase in the oxidation of palmitoylcarnitine and glycerol-3-phosphate. Moreover, endurance training increased mitochondrial capacity to oxidize the lipid-derived fuels at all studied temperatures. The endurance training-induced increase in mitochondrial capacity to oxidize fatty acids was accompanied by an enhancement of mitochondrial biogenesis, as shown by the elevated expression levels of Nrf2, PGC1α, and mitochondrial marker and by the elevated expression levels of mitochondrial proteins involved in fatty acid metabolism, such as fatty acid transporter CD36, carnitine palmitoyltransferase 1A (CPT1A), and acyl-CoA dehydrogenase (ACADS). We conclude that hyperthermia enhances but hypothermia attenuates the rate of the oxidation of fatty acids and glycerol-3-phosphate in rat skeletal muscle mitochondria isolated from both untrained and trained rats. Moreover, our results indicate that endurance training up-regulates mitochondrial biogenesis markers, lipid-sustained oxidative capacity, and CD36 and CPT1A proteins involved in fatty acid transport, possibly via PGC1α and Nrf2 signaling pathways.

(Mechanisms of inhibition of viral replication in plants)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1991-01-01

During the last year we have made a number of important observations in the fields of virology and plant molecular biology. By directly sequencing Tomato Mosaic Virus (ToMV) movement genes, previously undetected sequence alterations common to specific viral strains were found. The difficulty in regenerating transgenic tomato plants containing the Tm-2 gene was overcome. Tobacco plants transformed with Cucumber Mosaic Virus (CMV) are being characterized. Analysis of transgenic tobacco plants expressing CMV coat protein have shown no correlation between coat protein expression and level of resistance. Specific amino acid changes have been found to correlate with CMV resistance breaking andmore » degree of pathogenicity. Satellite RNAs are shown to be too unstable for use as a biological control agent. The aphid transmission domain CMV has been localized to one (or more) of three amino acids; constructs have been made to determine the exact amino acids involved. 15 refs.« less

Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

PubMed Central

2012-01-01

Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

A Palmitic Acid Elongase Affects Eicosapentaenoic Acid and Plastidial Monogalactosyldiacylglycerol Levels in Nannochloropsis.

PubMed

Dolch, Lina-Juana; Rak, Camille; Perin, Giorgio; Tourcier, Guillaume; Broughton, Richard; Leterrier, Marina; Morosinotto, Tomas; Tellier, Frédérique; Faure, Jean-Denis; Falconet, Denis; Jouhet, Juliette; Sayanova, Olga; Beaudoin, Frédéric; Maréchal, Eric

2017-01-01

Nannochloropsis species are oleaginous eukaryotes containing a plastid limited by four membranes, deriving from a secondary endosymbiosis. In Nannochloropsis, thylakoid lipids, including monogalactosyldiacylglycerol (MGDG), are enriched in eicosapentaenoic acid (EPA). The need for EPA in MGDG is not understood. Fatty acids are de novo synthesized in the stroma, then converted into very-long-chain polyunsaturated fatty acids (FAs) at the endoplasmic reticulum (ER). The production of MGDG relies therefore on an EPA supply from the ER to the plastid, following an unknown process. We identified seven elongases and five desaturases possibly involved in EPA production in Nannochloropsis gaditana Among the six heterokont-specific saturated FA elongases possibly acting upstream in this pathway, we characterized the highly expressed isoform Δ0-ELO1 Heterologous expression in yeast (Saccharomyces cerevisiae) showed that NgΔ0-ELO1 could elongate palmitic acid. Nannochloropsis Δ0-elo1 mutants exhibited a reduced EPA level and a specific decrease in MGDG In NgΔ0-elo1 lines, the impairment of photosynthesis is consistent with a role of EPA-rich MGDG in nonphotochemical quenching control, possibly providing an appropriate MGDG platform for the xanthophyll cycle. Concomitantly with MGDG decrease, the level of triacylglycerol (TAG) containing medium chain FAs increased. In Nannochloropsis, part of EPA used for MGDG production is therefore biosynthesized by a channeled process initiated at the elongation step of palmitic acid by Δ0-ELO1, thus acting as a committing enzyme for galactolipid production. Based on the MGDG/TAG balance controlled by Δ0-ELO1, this study also provides novel prospects for the engineering of oleaginous microalgae for biotechnological applications. © 2017 American Society of Plant Biologists. All Rights Reserved.

A Palmitic Acid Elongase Affects Eicosapentaenoic Acid and Plastidial Monogalactosyldiacylglycerol Levels in Nannochloropsis1

PubMed Central

Dolch, Lina-Juana; Rak, Camille; Broughton, Richard; Leterrier, Marina; Tellier, Frédérique; Faure, Jean-Denis; Falconet, Denis; Jouhet, Juliette

2017-01-01

Nannochloropsis species are oleaginous eukaryotes containing a plastid limited by four membranes, deriving from a secondary endosymbiosis. In Nannochloropsis, thylakoid lipids, including monogalactosyldiacylglycerol (MGDG), are enriched in eicosapentaenoic acid (EPA). The need for EPA in MGDG is not understood. Fatty acids are de novo synthesized in the stroma, then converted into very-long-chain polyunsaturated fatty acids (FAs) at the endoplasmic reticulum (ER). The production of MGDG relies therefore on an EPA supply from the ER to the plastid, following an unknown process. We identified seven elongases and five desaturases possibly involved in EPA production in Nannochloropsis gaditana. Among the six heterokont-specific saturated FA elongases possibly acting upstream in this pathway, we characterized the highly expressed isoform Δ0-ELO1. Heterologous expression in yeast (Saccharomyces cerevisiae) showed that NgΔ0-ELO1 could elongate palmitic acid. Nannochloropsis Δ0-elo1 mutants exhibited a reduced EPA level and a specific decrease in MGDG. In NgΔ0-elo1 lines, the impairment of photosynthesis is consistent with a role of EPA-rich MGDG in nonphotochemical quenching control, possibly providing an appropriate MGDG platform for the xanthophyll cycle. Concomitantly with MGDG decrease, the level of triacylglycerol (TAG) containing medium chain FAs increased. In Nannochloropsis, part of EPA used for MGDG production is therefore biosynthesized by a channeled process initiated at the elongation step of palmitic acid by Δ0-ELO1, thus acting as a committing enzyme for galactolipid production. Based on the MGDG/TAG balance controlled by Δ0-ELO1, this study also provides novel prospects for the engineering of oleaginous microalgae for biotechnological applications. PMID:27895203

Effects of Phenolic Acids on the Growth and Production of T-2 and HT-2 Toxins by Fusarium langsethiae and F. sporotrichioides.

PubMed

Ferruz, Elena; Atanasova-Pénichon, Vessela; Bonnin-Verdal, Marie-Noëlle; Marchegay, Gisèle; Pinson-Gadais, Laëtitia; Ducos, Christine; Lorán, Susana; Ariño, Agustín; Barreau, Christian; Richard-Forget, Florence

2016-04-04

The effect of natural phenolic acids was tested on the growth and production of T-2 and HT-2 toxins by Fusarium langsethiae and F. sporotrichioides, on Mycotoxin Synthetic medium. Plates treated with 0.5 mM of each phenolic acid (caffeic, chlorogenic, ferulic and p-coumaric) and controls without phenolic acid were incubated for 14 days at 25 °C. Fungal biomass of F. langsethiae and F. sporotrichioides was not reduced by the phenolic acids. However, biosynthesis of T-2 toxin by F. langsethiae was significantly reduced by chlorogenic (23.1%) and ferulic (26.5%) acids. Production of T-2 by F. sporotrichioides also decreased with ferulic acid by 23% (p < 0.05). In contrast, p-coumaric acid significantly stimulated the production of T-2 and HT-2 toxins for both strains. A kinetic study of F. langsethiae with 1 mM ferulic acid showed a significant decrease in fungal biomass, whereas T-2 production increased after 10 days of incubation. The study of gene expression in ferulic supplemented cultures of F. langsethiae revealed a significant inhibition for Tri5, Tri6 and Tri12 genes, while for Tri16 the decrease in gene expression was not statistically significant. Overall, results indicated that phenolic acids had a variable effect on fungal growth and mycotoxin production, depending on the strain and the concentration and type of phenolic acid assayed.

Immunohistochemical analysis of cyclooxygenase-2 and brain fatty acid binding protein expression in grades I-II meningiomas: correlation with tumor grade and clinical outcome after radiotherapy.

PubMed

Kang, Hyun-Cheol; Kim, Il Han; Park, Charn Il; Park, Sung-Hye

2014-10-01

This study was done to evaluate the association of cyclooxygenase 2 (COX-2) and brain fatty acid binding protein (BFABP) with tumor grade and outcome of grades I-II meningiomas treated with radiotherapy. From 1996 to 2008, 40 patients with intracranial grades I-II meningiomas were treated with radiotherapy. Immunohistochemical staining for COX-2 and BFABP were performed on formalin-fixed paraffin-embedded tissues. COX-2 expression was significantly associated with BFABP status and both COX-2 (P < 0.01) and BFABP (P = 0.01) expression were stronger in the grade II meningiomas than in grade I tumors. Among the clinicopathologic factors, age and COX-2 status were prognostic in progression-free survival. Patients with moderate or strong COX-2 expression had worse outcome than those with negative or weak COX-2 expression (P = 0.03) after controlling for potential confounders. Our results suggest that the molecular biomarker COX-2 has prognostic significance in intracranial grades I-II meningiomas following radiotherapy. © 2014 Japanese Society of Neuropathology.

Enhancement of Chlorogenic Acid Production in Hairy Roots of Platycodon grandiflorum by Over-Expression of An Arabidopsis thaliana Transcription Factor AtPAP1

PubMed Central

Tuan, Pham Anh; Kwon, Do Yeon; Lee, Sanghyun; Arasu, Mariadhas Valan; Al-Dhabi, Naif Abdullah; Park, Nam Il; Park, Sang Un

2014-01-01

To improve the production of chlorogenic acid (CGA) in hairy roots of Platycodon grandiflorum, we induced over-expression of Arabidopsis thaliana transcription factor production of anthocyanin pigment (AtPAP1) using an Agrobacterium rhizogenes-mediated transformation system. Twelve hairy root lines showing over-expression of AtPAP1 were generated. In order to investigate the regulation of AtPAP1 on the activities of CGA biosynthetic genes, the expression levels of seven P. grandiflorum CGA biosynthetic genes were analyzed in the hairy root line that had the greatest accumulation of AtPAP1 transcript, OxPAP1-1. The introduction of AtPAP1 increased the mRNA levels of all examined CGA biosynthetic genes and resulted in a 900% up-regulation of CGA accumulation in OxPAP1-1 hairy roots relative to controls. This suggests that P. grandiflorum hairy roots that over-express the AtPAP1 gene are a potential alternative source of roots for the production of CGA. PMID:25153629

Fatty acid ω-hydroxylases from Solanum tuberosum.

PubMed

Bjelica, Anica; Haggitt, Meghan L; Woolfson, Kathlyn N; Lee, Daniel P N; Makhzoum, Abdullah B; Bernards, Mark A

2016-12-01

Potato StCYP86A33 complements the Arabidopsis AtCYP86A1 mutant, horst - 1. Suberin is a cell-wall polymer that comprises both phenolic and aliphatic components found in specialized plant cells. Aliphatic suberin is characterized by bi-functional fatty acids, typically ω-hydroxy fatty acids and α,ω-dioic acids, which are linked via glycerol to form a three-dimensional polymer network. In potato (Solanum tuberosum L.), over 65 % of aliphatics are either ω-hydroxy fatty acids or α,ω-dioic acids. Since the biosynthesis of α,ω-dioic acids proceeds sequentially through ω-hydroxy fatty acids, the formation of ω-hydroxy fatty acids represents a significant metabolic commitment during suberin deposition. Four different plant cytochrome P450 subfamilies catalyze ω-hydroxylation, namely, 86A, 86B, 94A, and 704B; though to date, only a few members have been functionally characterized. In potato, CYP86A33 has been identified and implicated in suberin biosynthesis through reverse genetics (RNAi); however, attempts to express the CYP86A33 protein and characterize its catalytic function have been unsuccessful. Herein, we describe eight fatty acid ω-hydroxylase genes (three CYP86As, one CYP86B, three CYP94As, and a CYP704B) from potato and demonstrate their tissue expression. We also complement the Arabidopsis cyp86A1 mutant horst-1 using StCYP86A33 under the control of the Arabidopsis AtCYP86A1 promoter. Furthermore, we provide preliminary analysis of the StCYP86A33 promoter using a hairy root transformation system to monitor pStCYP86A33::GUS expression constructs. These data confirm the functional role of StCYP86A33 as a fatty acid ω-hydroxylase, and demonstrate the utility of hairy roots in the study of root-specific genes.

Maternal high fat diet induces early cardiac hypertrophy and alters cardiac metabolism in Sprague Dawley rat offspring.

PubMed

De Jong, K A; Barrand, S; Wood-Bradley, R J; de Almeida, D L; Czeczor, J K; Lopaschuk, G D; Armitage, J A; McGee, S L

2018-06-01

Maternal high fat diets (mHFD) have been associated with an increased offspring cardiovascular risk. Recently we found that the class IIa HDAC-MEF2 pathway regulates gene programs controlling fatty acid oxidation in striated muscle. This same pathway controls hypertrophic responses in the heart. We hypothesized that mHFD is associated with activation of signal controlling class II a HDAC activity and activation of genes involved in fatty acid oxidation and cardiac hypertrophy in offspring. Female Sprague Dawley rats were fed either normal fat diet (12%) or high fat diet (43%) three weeks prior to mating, remaining on diets until study completion. Hearts of postnatal day 1 (PN1) and PN10 pups were collected. Bioenergetics and respiration analyses were performed in neonatal ventricular cardiomyocytes (NVCM). In offspring exposed to mHFD, body weight was increased at PN10 accompanied by increased body fat percentage and blood glucose. Heart weight and heart weight to body weight ratio were increased at PN1 and PN10, and were associated with elevated signalling through the AMPK-class IIa HDAC-MEF2 axis. The expression of the MEF2-regulated hypertrophic markers ANP and BNP were increased as were expression of genes involved in fatty acid oxidation. However this was only accompanied by an increased protein expression of fatty acid oxidation enzymes at PN10. NVCM isolated from these pups exhibited increased glycolysis and an impaired substrate flexibility. Combined, these results suggest that mHFD induces signalling and transcriptional events indicative of reprogrammed cardiac metabolism and of cardiac hypertrophy in Sprague Dawley rat offspring. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

Microarray-based gene expression profiling to elucidate effectiveness of fermented Codonopsis lanceolata in mice.

PubMed

Choi, Woon Yong; Kim, Ji Seon; Park, Sung Jin; Ma, Choong Je; Lee, Hyeon Yong

2014-04-08

In this study, the effect of Codonopsis lanceolata fermented by lactic acid on controlling gene expression levels related to obesity was observed in an oligonucleotide chip microarray. Among 8170 genes, 393 genes were up regulated and 760 genes were down regulated in feeding the fermented C. lanceolata (FCL). Another 374 genes were up regulated and 527 genes down regulated without feeding the sample. The genes were not affected by the FCL sample. It was interesting that among those genes, Chytochrome P450, Dmbt1, LOC76487, and thyroid hormones, etc., were mostly up or down regulated. These genes are more related to lipid synthesis. We could conclude that the FCL possibly controlled the gene expression levels related to lipid synthesis, which resulted in reducing obesity. However, more detailed protein expression experiments should be carried out.

Contribution of Sialic Acid to the Voltage Dependence of Sodium Channel Gating

PubMed Central

Bennett, Eric; Urcan, Mary S.; Tinkle, Sally S.; Koszowski, Adam G.; Levinson, Simon R.

1997-01-01

A potential role for sialic acid in the voltage-dependent gating of rat skeletal muscle sodium channels (rSkM1) was investigated using Chinese hamster ovary (CHO) cells stably transfected with rSkM1. Changes in the voltage dependence of channel gating were observed after enzymatic (neuraminidase) removal of sialic acid from cells expressing rSkM1 and through the expression of rSkM1 in a sialylation-deficient cell line (lec2). The steady-state half-activation voltages (Va) of channels under each condition of reduced sialylation were ∼10 mV more depolarized than control channels. The voltage dependence of the time constants of channel activation and inactivation were also shifted in the same direction and by a similar magnitude. In addition, recombinant deletion of likely glycosylation sites from the rSkM1 sequence resulted in mutant channels that gated at voltages up to 10 mV more positive than wild-type channels. Thus three independent means of reducing channel sialylation show very similar effects on the voltage dependence of channel gating. Finally, steady-state activation voltages for channels subjected to reduced sialylation conditions were much less sensitive to the effects of external calcium than those measured under control conditions, indicating that sialic acid directly contributes to the negative surface potential. These results are consistent with an electrostatic mechanism by which external, negatively charged sialic acid residues on rSkM1 alter the electric field sensed by channel gating elements. PMID:9089440

Erwinia amylovora Expresses Fast and Simultaneously hrp/dsp Virulence Genes during Flower Infection on Apple Trees

PubMed Central

Pester, Doris; Milčevičová, Renáta; Schaffer, Johann; Wilhelm, Eva; Blümel, Sylvia

2012-01-01

Background Pathogen entry through host blossoms is the predominant infection pathway of the Gram-negative bacterium Erwinia amylovora leading to manifestation of the disease fire blight. Like in other economically important plant pathogens, E. amylovora pathogenicity depends on a type III secretion system encoded by hrp genes. However, timing and transcriptional order of hrp gene expression during flower infections are unknown. Methodology/Principal Findings Using quantitative real-time PCR analyses, we addressed the questions of how fast, strong and uniform key hrp virulence genes and the effector dspA/E are expressed when bacteria enter flowers provided with the full defense mechanism of the apple plant. In non-invasive bacterial inoculations of apple flowers still attached to the tree, E. amylovora activated expression of key type III secretion genes in a narrow time window, mounting in a single expression peak of all investigated hrp/dspA/E genes around 24–48 h post inoculation (hpi). This single expression peak coincided with a single depression in the plant PR-1 expression at 24 hpi indicating transient manipulation of the salicylic acid pathway as one target of E. amylovora type III effectors. Expression of hrp/dspA/E genes was highly correlated to expression of the regulator hrpL and relative transcript abundances followed the ratio: hrpA>hrpN>hrpL>dspA/E. Acidic conditions (pH 4) in flower infections led to reduced virulence/effector gene expression without the typical expression peak observed under natural conditions (pH 7). Conclusion/Significance The simultaneous expression of hrpL, hrpA, hrpN, and the effector dspA/E during early floral infection indicates that speed and immediate effector transmission is important for successful plant invasion. When this delicate balance is disturbed, e.g., by acidic pH during infection, virulence gene expression is reduced, thus partly explaining the efficacy of acidification in fire blight control on a molecular level. PMID:22412891

Vanadium inhalation induces retinal Müller glial cell (MGC) alterations in a murine model.

PubMed

Cervantes-Yépez, Silvana; López-Zepeda, Lorena Sofía; Fortoul, Teresa I

2018-06-01

Vanadium (V) is a transition metal adhered to suspended particles. Previous studies demonstrated that V inhalation causes oxidative stress in the ependymal epithelium, the choroid plexus on brain lateral ventricles and in the retina. Inhaled-V reaches the eye´s retina through the systemic circulation; however, its effect on the retina has not been widely studied. The Müller glial cell provides support and structure to the retina, facilitates synapses and regulates the microenvironment and neuronal metabolism. Hence, it is of great interest to study the effect of V exposure on the expression and localization of specific biomarkers on this cell. Male CD-1 mice were exposed to V inhalation 1 h/twice/week for 4 and 8-Wk. Expression changes in the retina of Glial fibrillary acidic protein, highly expressed in Müller glial cell when retina is damaged, and Glutamine synthetase, important in preventing excitotoxicity in the retina, were analysed by immunohistochemistry. Glial fibrillary acidic protein expression increased at 4-Wk of V inhalation compared to the control and decreased at 8-Wk of exposure. A time-dependent gradual reduction in glutamine synthetase expression was observed. Changes in glial fibrillary acidic protein expression induced by V suggest retinal damage, whereas glutamine synthetase gradual reduction might indicate that photoreceptors, which produce most of the glutamine synthetase substrate in the retina, are degenerating, probably as a consequence of the oxidative stress induced by V.

Strand-specific RNA-seq analysis of the Lactobacillus delbrueckii subsp. bulgaricus transcriptome.

PubMed

Zheng, Huajun; Liu, Enuo; Shi, Tao; Ye, Luyi; Konno, Tomonobu; Oda, Munehiro; Ji, Zai-Si

2016-02-01

Lactobacillus delbrueckii subsp. bulgaricus 2038 (Lb. bulgaricus 2038) is an industrial bacterium that is used as a starter for dairy products. We proposed several hypotheses concerning its industrial features previously. Here, we utilized RNA-seq to explore the transcriptome of Lb. bulgaricus 2038 from four different growth phases under whey conditions. The most abundantly expressed genes in the four stages were mainly involved in translation (for the logarithmic stage), glycolysis (for control/lag stages), lactic acid production (all the four stages), and 10-formyl tetrahydrofolate production (for the stationary stage). The high expression of genes like d-lactate dehydrogenase was thought as a result of energy production, and consistent expression of EPS synthesis genes, the restriction-modification (RM) system and the CRISPR/Cas system were validated for explaining the advantage of this strain in yoghurt production. Several postulations, like NADPH production through GapN bypass, converting aspartate into carbon-skeleton intermediates, and formate production through degrading GTP, were proved not working under these culture conditions. The high expression of helicase genes and co-expressed amino acids/oligopeptides transporting proteins indicated that the helicase might mediate the strain obtaining nitrogen source from the environment. The transport system of Lb. bulgaricus 2038 was found to be regulated by antisense RNA, hinting the potential application of non-coding RNA in regulating lactic acid bacteria (LAB) gene expression. Our study has primarily uncovered Lb. bulgaricus 2038 transcriptome, which could gain a better understanding of the regulation system in Lb. bulgaricus and promote its industrial application.

Identification of the amino acids essential for LytSR-mediated signal transduction in Staphylococcus aureus and their roles in biofilm-specific gene expression

PubMed Central

Lehman, McKenzie K.; Bose, Jeffrey L.; Sharma-Kuinkel, Batu K.; Moormeier, Derek E.; Endres, Jennifer L.; Sadykov, Marat R.; Biswas, Indranil; Bayles, Kenneth W.

2015-01-01

Summary Recent studies have demonstrated that expression of the Staphylococcus aureus lrgAB operon is specifically expressed within tower structures during biofilm development. To gain a better understanding of the mechanisms underlying this spatial control of lrgAB expression, we carried out a detailed analysis of the LytSR two-component system. Specifically, a conserved aspartic acid (Asp53) of the LytR response regulator was shown to be the target of phosphorylation, which resulted in enhanced binding to the lrgAB promoter and activation of transcription. In addition, we identified His390 of the LytS histidine kinase as the site of autophosphorylation and Asn394 as a critical amino acid involved in phosphatase activity. Interestingly, LytS-independent activation of LytR was observed during planktonic growth, with acetyl phosphate acting as a phosphodonor to LytR. In contrast, mutations disrupting the function of LytS prevented tower-specific lrgAB expression, providing insight into the physiologic environment within these structures. In addition, over activation of LytR led to increased lrgAB promoter activity during planktonic and biofilm growth and a change in biofilm morphology. Overall, the results of this study are the first to define the LytSR signal transduction pathway, as well as determine the metabolic context within biofilm tower structures that triggers these signaling events. PMID:25491472

Overexpression of malic enzyme (ME) of Mucor circinelloides improved lipid accumulation in engineered Rhodotorula glutinis.

PubMed

Li, Zhi; Sun, Hanxiao; Mo, Xuemei; Li, Xiuying; Xu, Bo; Tian, Peng

2013-06-01

The oleaginous yeast Rhodotorula glutinis has been known to be a potential feedstock for lipid production. In the present study, we investigated the enhancement of expression of malic enzyme (ME; NADP(+) dependent; EC 1.1.1.40) from Mucor circinelloides as a strategy to improve lipid content inside the yeast cells. The 26S rDNA and 5.8S rDNA gene fragments isolated from Rhodotorula glutinis were used for homologous integration of ME gene into R. glutinis chromosome under the control of the constitutively highly expressed gene phosphoglycerate kinase 1 to achieve stable expression. We demonstrated that by increasing the expression of the foreign ME gene in R. glutinis, we successfully improved the lipid content by more than twofold. At the end of lipid accumulation phrase (96 h) in the transformants, activity of ME was increased by twofold and lipid content of the yeast cells was increased from 18.74 % of the biomass to 39.35 %. Simultaneously, there were no significant differences in fatty acid profiles between the wild-type strain and the recombinant strain. Over 94 % of total fatty acids were C16:0, C18:0, C16:1, C18:1, and C18:2. Our results indicated that heterologous expression of NADP(+)-dependent ME involved in fatty acid biosynthesis indeed increased the lipid accumulation in the oleaginous yeast R. glutinis.

Identification of influenza A nucleoprotein body domain residues essential for viral RNA expression expose antiviral target.

PubMed

Davis, Alicia M; Ramirez, Jose; Newcomb, Laura L

2017-02-07

Influenza A virus is controlled with yearly vaccination while emerging global pandemics are kept at bay with antiviral medications. Unfortunately, influenza A viruses have emerged resistance to approved influenza antivirals. Accordingly, there is an urgent need for novel antivirals to combat emerging influenza A viruses resistant to current treatments. Conserved viral proteins are ideal targets because conserved protein domains are present in most, if not all, influenza subtypes, and are presumed less prone to evolve viable resistant versions. The threat of an antiviral resistant influenza pandemic justifies our study to identify and characterize antiviral targets within influenza proteins that are highly conserved. Influenza A nucleoprotein (NP) is highly conserved and plays essential roles throughout the viral lifecycle, including viral RNA synthesis. Using NP crystal structure, we targeted accessible amino acids for substitution. To characterize the NP proteins, reconstituted viral ribonucleoproteins (vRNPs) were expressed in 293 T cells, RNA was isolated, and reverse transcription - quantitative PCR (RT-qPCR) was employed to assess viral RNA expressed from reconstituted vRNPs. Location was confirmed using cellular fractionation and western blot, along with observation of NP-GFP fusion proteins. Nucleic acid binding, oligomerization, and vRNP formation, were each assessed with native gel electrophoresis. Here we report characterization of an accessible and conserved five amino acid region within the NP body domain that plays a redundant but essential role in viral RNA synthesis. Our data demonstrate substitutions in this domain did not alter NP localization, oligomerization, or ability to bind nucleic acids, yet resulted in a defect in viral RNA expression. To define this region further, single and double amino acid substitutions were constructed and investigated. All NP single substitutions were functional, suggesting redundancy, yet different combinations of two amino acid substitutions resulted in a significant defect in RNA expression, confirming these accessible amino acids in the NP body domain play an important role in viral RNA synthesis. The identified conserved and accessible NP body domain represents a viable antiviral target to counter influenza replication and this research will contribute to the well-informed design of novel therapies to combat emerging influenza viruses.

Prenatal retinoic acid increases lipofibroblast expression in hypoplastic rat lungs with experimental congenital diaphragmatic hernia.

PubMed

Friedmacher, Florian; Fujiwara, Naho; Hofmann, Alejandro D; Takahashi, Hiromizu; Alvarez, Luis A J; Gosemann, Jan-Hendrik; Puri, Prem

2014-06-01

Prenatal administration of all-trans retinoic acid (ATRA) has been shown to stimulate alveolarization in nitrofen-induced pulmonary hypoplasia (PH) associated with congenital diaphragmatic hernia (CDH). Lipid-containing interstitial lipofibroblasts (LIFs), characterized by adipocyte differentiation-related protein (ADRP), play a critical role in alveolar development by coordinating lipid homeostasis. Previous studies have demonstrated that ATRA positively affects LIF expression in developing lungs. We hypothesized that pulmonary LIF expression is increased after prenatal ATRA treatment in the nitrofen model of CDH-associated PH. Timed-pregnant rats were treated with nitrofen or vehicle on E9.5, followed by injection of ATRA or placebo on E18.5, E19.5, and E20.5. Fetal lungs were dissected on E21.5 and divided into Control+Placebo, Control+ATRA, Nitrofen+Placebo, and Nitrofen+ATRA. Pulmonary gene expression levels of ADRP were analyzed by quantitative real-time polymerase chain reaction, and LIF expression was investigated by ADRP immunohistochemistry, oil-red-O-, and immunofluorescence-double-staining. Relative mRNA expression of pulmonary ADRP was significantly increased in Nitrofen+ATRA compared to Nitrofen+Placebo (0.31±0.02 vs. 0.08±0.01; P<0.0001). ADRP immunoreactivity and oil-red-O-staining were markedly increased in alveolar interstitium of Nitrofen+ATRA compared to Nitrofen+Placebo. Immunofluorescence-double-staining confirmed markedly increased LIF expression in alveolar walls of Nitrofen+ATRA compared to Nitrofen+Placebo. Increased LIF expression after prenatal treatment with ATRA in nitrofen-induced PH suggests that ATRA may have a therapeutic potential in attenuating CDH-associated PH by stimulating alveolar development. Copyright © 2014 Elsevier Inc. All rights reserved.

The modulating effect of Persea americana fruit extract on the level of expression of fatty acid synthase complex, lipoprotein lipase, fibroblast growth factor-21 and leptin--A biochemical study in rats subjected to experimental hyperlipidemia and obesity.

PubMed

Monika, Padmanabhan; Geetha, Arumugam

2015-09-15

Obesity is a multifactorial disorder which is closely associated with hyperlipidemia. Avocados are edible fruits traditionally consumed for various health benefits including body weight reduction. To determine the hypolipidemic and anti-obesity effect of hydro-alcoholic fruit extract of avocado (HFEA) in rats fed with high fat diet (HFD). Male Sprague Dawley rats were divided into four groups. Groups 1 and 2 rats were fed with normal diet. Groups 3 and 4 rats were fed with HFD for 14 weeks. In addition, Groups 2 and 4 rats were co-administered with 100 mg/kg body weight of HFEA from 3rd week onwards. The HFEA was subjected to HPLC to quantify the major phytonutrients. Body mass index (BMI), adiposity index (ADI), total fat pad mass (TFP), blood lipid levels were determined in all the groups of rats. The mRNA expression of fatty acid synthase (FASN), lipoprotein lipase (LPL), fibroblast growth factor 21 (FGF21) and leptin was also assessed. HFEA was found to contain flavonoids: rutin-141.79, quercetin-5.25, luteolin-165, phenolic compounds: gallic acid-198.57, ellagic acid-238.22, vanillic acid-4.79 and phytosterols: betasitosterol-70, stigmasterol-12.5 (mg/100 g). HFEA reduced BMI, ADI, TFP, blood cholesterol, triglycerides, and LDL in rats fed with HFD. Serum leptin was found reduced in HFEA co-administered rats. The mRNA expression of FASN, LPL, and leptin in subcutaneous and visceral adipose tissue was found to be significantly reduced in HFEA co-administered rats. The gene expression of fibroblast growth factor-21 (FGF21) was found to be significantly increased in HFEA treated rats when compared to HFD control rats. The hypolipidemic effect of HFEA may be partly due to its modulating effect on endogenous fat synthesis and adiponectin formation through the transcription factor FGF21. The results also show that avocado fruit extract has profound influence on leptin activity, which controls satiety and hunger to regulate the food intake. Copyright © 2015 Elsevier GmbH. All rights reserved.

Identification of the homolog of cell-counting factor in the cellular slime mold Dictyostelium discoideum.

PubMed

Okuwa, Takako; Katayama, Takahiro; Takano, Akinori; Yasukawa, Hiroo

2002-10-01

Genes for the cell-counting factors in Dictyostelium discoideum, countin and countin2, are considered to control the size of the multicellular structure of this organism. A novel gene, countin3, that is homologous to countin and countin2 genes (49 and 39% identity in amino acid sequence, respectively) was identified in the D. discoideum genome. The expression of countin3 was observed in the vegetatively growing cells, decreased in the aggregating stage, increased in the mid-developmental stage and decreased again in subsequent stages. This expression pattern is different from that of countin and countin2. The distinct expression kinetics of three genes suggests that they would have unique roles in size control of D. discoideum.

Optimatization of transient transformation methods to study gene expression in Musa acuminata (AAA group) cultivar Ambon Lumut

NASA Astrophysics Data System (ADS)

Prayuni, Kinasih; Dwivany, Fenny M.

2015-09-01

Banana is classified as a climateric fruit, whose ripening is regulated by ethylene. Ethylene is synthesized from ACC (1-aminocyclopropane-1-carboxylic acid) by ACC oxidase enzyme which is encoded by ACO gene. Controling an important gene expression in ethylene biosynthesis pathway has became a target to delay the ripening process. Therefore in the previous study we have designed a MaACO-RNAi construct to control MaACO gene expression. In this research, we study the effectiveness of different transient transformation methods to deliver the construct. Direct injection, with or no vaccum infiltration methods were used to deliver MaACO-RNAi construct. All of the methods succesfully deliver the construct into banana fruits based on RT-PCR result.

Activating glutamate decarboxylase activity by removing the autoinhibitory domain leads to hyper γ-aminobutyric acid (GABA) accumulation in tomato fruit.

PubMed

Takayama, Mariko; Matsukura, Chiaki; Ariizumi, Tohru; Ezura, Hiroshi

2017-01-01

The C-terminal extension region of SlGAD3 is likely involved in autoinhibition, and removing this domain increases GABA levels in tomato fruits. γ-Aminobutyric acid (GABA) is a ubiquitous non-protein amino acid with several health-promoting benefits. In many plants including tomato, GABA is synthesized via decarboxylation of glutamate in a reaction catalyzed by glutamate decarboxylase (GAD), which generally contains a C-terminal autoinhibitory domain. We previously generated transgenic tomato plants in which tomato GAD3 (SlGAD3) was expressed using the 35S promoter/NOS terminator expression cassette (35S-SlGAD3-NOS), yielding a four- to fivefold increase in GABA levels in red-ripe fruits compared to the control. In this study, to further increase GABA accumulation in tomato fruits, we expressed SlGAD3 with (SlGAD3 OX ) or without (SlGAD3ΔC OX ) a putative autoinhibitory domain in tomato using the fruit ripening-specific E8 promoter and the Arabidopsis heat shock protein 18.2 (HSP) terminator. Although the GABA levels in SlGAD3 OX fruits were equivalent to those in 35S-SlGAD3-NOS fruits, GABA levels in SlGAD3ΔC OX fruits increased by 11- to 18-fold compared to control plants, indicating that removing the autoinhibitory domain increases GABA biosynthesis activity. Furthermore, the increased GABA levels were accompanied by a drastic reduction in glutamate and aspartate levels, indicating that enhanced GABA biosynthesis affects amino acid metabolism in ripe-fruits. Moreover, SlGAD3ΔC OX fruits exhibited an orange-ripe phenotype, which was associated with reduced levels of both carotenoid and mRNA transcripts of ethylene-responsive carotenogenic genes, suggesting that over activation of GAD influences ethylene sensitivity. Our strategy utilizing the E8 promoter and HSP terminator expression cassette, together with SlGAD3 C-terminal deletion, would facilitate the production of tomato fruits with increased GABA levels.

Sea cucumber and blue mussel: new sources of phospholipid enriched omega-3 fatty acids with a potential role in 3T3-L1 adipocyte metabolism.

PubMed

Vaidya, Hitesh; Cheema, Sukhinder K

2014-12-01

Omega (n)-3 polyunsaturated fatty acids (PUFA), namely docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), are known to reduce the risk of insulin resistance and ameliorate obesity-associated disorders. DHA and EPA structured in the phospholipid form possess superior biological effects compared to the triglyceride form available in fish oil. In this study, we have found that sea cucumber (SC) and blue mussel (BM) from Newfoundland and Labrador are rich sources of n-3 PUFA structured in the phospholipid form. Treatment with SC and BM methanolic extracts (250 and 100 μg mL(-1), respectively) significantly (p < 0.01) increased triglyceride accumulation in 3T3-L1 adipocytes, along with an increase in the mRNA expression of the peroxisome proliferator-activated receptor-γ (37 and 39%, respectively) and adiponectin (57 and 56%, respectively) compared with control cells (p < 0.05). Only SC extracts (250 μg mL(-1)) increased the mRNA expression of sterol regulatory element-binding protein-1 (SREBP-1). Treatment with higher concentrations of SC and BM extracts (500 and 750 μg mL(-1), respectively) significantly (p < 0.01) decreased triglyceride accumulation in 3T3-L1 cells as opposed to an increase in triglyceride accumulation at lower concentrations. This was due to inhibition of acetyl-CoA carboxylase-1 and SREBP-1 mRNA expression compared to control cells (p < 0.05). There was no effect of the extracts on the mRNA expression of hormone sensitive lipase or lipolysis, suggesting that the decrease in triglyceride accumulation at higher concentrations is not due to breakdown and release of fat. This is the first report to show that SC and BM are new sources of phospholipid bonded n-3 PUFA, with the potential to target insulin resistance and obesity.

Expression of nutrient transporters in duodenum, jejunum, and ileum of Eimeria maxima-infected broiler chickens.

PubMed

Fetterer, Raymond H; Miska, Katarzyna B; Jenkins, Mark C; Wong, Eric A

2014-10-01

The uptake of amino acids is mediated by active transporters located on the basolateral and brush border membranes of intestinal epithelial cells. The current study investigated the expression of amino acid transporters (AAT) and other genes in the intestine of chicks infected with Eimeria maxima. At 7-day postinfection (PI), tissue from each intestinal segment (duodenum, jejunum, and ileum) was taken from birds inoculated with 3 × 10(3) oocysts/bird and processed to recover RNA. Analysis of gene expression was performed using real-time reverse transcription polymerase chain reaction (qRT-PCR). Results were given as relative expression using β₂-microglobulin as an endogenous control. All the genes studied were expressed in three segments of the intestines, and expression of the genes was altered by infection with E. maxima. Even though the jejunum is considered the parasite's primary predilection site, there was no segment-related difference in expression of most of the genes studied. The antimicrobial peptide (LEAP2) was downregulated in all three segments of the intestine. The results also demonstrate that transporters associated with brush border membranes were downregulated while transporters associated with the basolateral membranes were upregulated and that E. maxima alters the expression of AAT and LEAP2 throughout the small intestine.

Lipoic Acid Exerts Antioxidant and Anti-inflammatory Effects in Response to Heat Shock in C2C12 Myotubes.

PubMed

Lee, Cheng-Tse; Chang, Li-Ching; Wu, Pei-Fung

2016-06-01

This study explored that lipoic acid treatment for 24 h significantly upregulated and promoted heat shock-induced catalase expression and downregulated GPx1 messenger RNA (mRNA) expression, indicating that lipoic acid exhibits antioxidant activity in the decomposition of hydrogen peroxide by upregulating catalase expression. Moreover, lipoic acid treatment for 3 h increased and promoted heat shock-induced interleukin (IL)-6 mRNA and protein levels and that for 24 h downregulated IL-6 mRNA expression, suggesting a dual effect of lipoic acid on IL-6 regulation. Lipoic acid alone failed to increase or reduce tumor necrosis factor (TNF)-α mRNA and protein levels, whereas heat shock alone downregulated TNF-α mRNA and protein expression. These data suggest that lipoic acid does not have a proinflammatory role and that heat shock acts as an anti-inflammatory agent by downregulating TNF-α expression in C2C12 myotubes. Moreover, lipoic acid or heat shock alone upregulated the IL-6 receptor (IL-6R-α) and glycoprotein 130 (gp130) mRNA expression followed by IL-6 expression; these data indicate that the regulation of lipoic acid or heat shock is mediated by IL-6R signaling, thus suggesting that C2C12 myotubes possesses a mechanism for regulating IL-6R and gp130 expression following lipoic acid treatment or heat shock.

[Mechanism of Chlorogenic Acid in Apoptotic Regulation through Notch1 
Pathway in Non-small Cell Lung Carcinoma in Animal Level].

PubMed

Li, Wei; Liu, Xu; Zhang, Guoqian; Zhang, Linlin

2017-08-20

It has been proven that chlorogenic acids can produce anticancer effects by regulating cell cycle, inducing apoptosis, inhibiting cell growth, Notch signaling pathways are closely related to many human tumors. The aim of this study is to study the mechanism of chlorogenic acid on apoptosis of non-small lung cancer through Notch1 pathway in animal level, and hope to provide theory basis on clinical treatment and research aimed at targeting Notch1 signaling in non-small cell carcinoma (NSCLC). MTT assay was used to evaluate the A549 cell proliferation under the treatment of chlorogenic acid. The effect of chlorogenic acid on apoptotic and cell cycle were detected by flow cytometry. The animal model of A549 cell transplanted in nude was established, tumer size and weight were detected. The mRNA level of Notch1 signal pathway related facter were detected by RT-PCR; the expression of Notch1 signal pathway related facter in tumor tissue was detected by western blot. Chlorogenic acid inhibited the A549 cell proliferation. incresed cell apoptotic and cell percentagein G2/M (P<0.05), and in a dose-dependent manner. In animal model, tumer size and weight were lower than control group, the difference was statistically significant (P<0.05). The relative expression of mRNA of Notch1, VEGF, Delta4, HES1 and HEY1 were decreaced (P<0.05) in tumor tissue which treated with chlorogenic. The expression of Notch1 were decreaced, PTEN, p-PTEN, p-AKT were increced significantly in tumor tissue which treated with chlorogenic (P<0.05). Chlorogenic acid can regulate theapoptosis of non-small lung cancer through Notch pathway in animal level, which may be associated with the down-regulating the expression of VEGF and Delta4. Notch pathway may cross talk with PI3K/AKT pathway through PTEN in NSCLC.

Combinatorial control of gene expression in Aspergillus niger grown on sugar beet pectin.

PubMed

Kowalczyk, Joanna E; Lubbers, Ronnie J M; Peng, Mao; Battaglia, Evy; Visser, Jaap; de Vries, Ronald P

2017-09-27

Aspergillus niger produces an arsenal of extracellular enzymes that allow synergistic degradation of plant biomass found in its environment. Pectin is a heteropolymer abundantly present in the primary cell wall of plants. The complex structure of pectin requires multiple enzymes to act together. Production of pectinolytic enzymes in A. niger is highly regulated, which allows flexible and efficient capture of nutrients. So far, three transcriptional activators have been linked to regulation of pectin degradation in A. niger. The L-rhamnose-responsive regulator RhaR controls the production of enzymes that degrade rhamnogalacturonan-I. The L-arabinose-responsive regulator AraR controls the production of enzymes that decompose the arabinan and arabinogalactan side chains of rhamnogalacturonan-II. The D-galacturonic acid-responsive regulator GaaR controls the production of enzymes that act on the polygalacturonic acid backbone of pectin. This project aims to better understand how RhaR, AraR and GaaR co-regulate pectin degradation. For that reason, we constructed single, double and triple disruptant strains of these regulators and analyzed their growth phenotype and pectinolytic gene expression in A. niger grown on sugar beet pectin.

Roles of plant hormones and anti-apoptosis genes during drought stress in rice (Oryza sativa L.).

PubMed

Ubaidillah, Mohammad; Safitri, Fika Ayu; Jo, Jun-Hyeon; Lee, Sang-Kyu; Hussain, Adil; Mun, Bong-Gyu; Chung, Il Kyung; Yun, Byung-Wook; Kim, Kyung-Min

2016-12-01

We previously identified the rice (Oryza sativa) senescence-associated gene OsSAP which encodes a highly conserved protein involved in anti-apoptotic activity. This novel Bax suppressor-related gene regulates tolerance to multiple stresses in yeast. Here, we show the effects of drought stress on leaf and root tissues of plants over-expressing OsSAP in relation to the levels of phytohormones, abscisic acid (ABA), jasmonic acid (JA), indole-3-carboxylic acid (ICA), gibberellic acid (GA 3 ), and zeatin. Results showed that rice plants over-expressing SAP were tolerant to drought stress compared to wild type and the plants over-expressing AtBI-1, which is a homolog of the human Bax inhibitor-1 in Arabidopsis. ABA and JA levels in OsSAP and AtBI-1 transgenic plants consistently increased up to at least 3 days after drought treatment, whereas lower GA 3 levels were recorded during early drought period. Comparison between control and transgenic plants overexpressing anti-apoptosis genes OsSAP and AtBI-1 resulted in different patterns of hormone levels, indicating that these genes are involved in the plant responses to drought stress and present an opportunity for further study on drought stress tolerance in rice and other plant species.

Propolis Extracted from the Stingless Bee Trigona sirindhornae Inhibited S. mutans Activity In Vitro.

PubMed

Utispan, Kusumawadee; Chitkul, Bordin; Monthanapisut, Paopanga; Meesuk, Ladda; Pugdee, Kamolparn; Koontongkaew, Sittichai

The aim of this study was to determine the antimicrobial effects of propolis extracted from an endemic species of stingless bee, T. sirindhornae, on the cariogenic bacterium Streptococcus mutans. Dichloromethane extracts (DME) of propolis (DMEP) were prepared and analysed by reverse-phase high-performance liquid chromatography. The antibacterial growth and antibiofilm formation effects of DMEP on S. mutans were compared with those of apigenin, a commercial propolis product. The effects of DMEP and apigenin on glucosyltransferase (gtf) B expression in S. mutans were investigated using real-time polymerase chain reaction. Chlorhexidine (CHX) was used as a positive control in the experiments. Apigenin, pinocembrin, p-coumaric acid, and caffeic acid were not detected in the propolis extracts. DMEP and apigenin significantly inhibited S. mutans growth (IC50 = 43.5 and 17.36 mg/ml, respectively). DMEP and apigenin also exhibited antiadherence effects on S. mutans as shown by reduced biofilm formation. Furthermore, a significant inhibition in gtfB expression was observed in DMEP and apigenin treated S. mutans. Propolis produced by T. sirindhornae demonstrated antibacterial and antibiofilm effects, and reduced gtfB expression in S. mutans. The antibacterial activities of propolis observed were not due to apigenin, pinocembrin, p-coumaric acid, or caffeic acid.

CPT1{alpha} over-expression increases long-chain fatty acid oxidation and reduces cell viability with incremental palmitic acid concentration in 293T cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jambor de Sousa, Ulrike L.; Koss, Michael D.; Fillies, Marion

2005-12-16

To test the cellular response to an increased fatty acid oxidation, we generated a vector for an inducible expression of the rate-limiting enzyme carnitine palmitoyl-transferase 1{alpha} (CPT1{alpha}). Human embryonic 293T kidney cells were transiently transfected and expression of the CPT1{alpha} transgene in the tet-on vector was activated with doxycycline. Fatty acid oxidation was measured by determining the conversion of supplemented, synthetic cis-10-heptadecenoic acid (C17:1n-7) to C15:ln-7. CPT1{alpha} over-expression increased mitochondrial long-chain fatty acid oxidation about 6-fold. Addition of palmitic acid (PA) decreased viability of CPT1{alpha} over-expressing cells in a concentration-dependent manner. Both, PA and CPT1{alpha} over-expression increased cell death. Interestingly,more » PA reduced total cell number only in cells over-expressing CPT1{alpha}, suggesting an effect on cell proliferation that requires PA translocation across the mitochondrial inner membrane. This inducible expression system should be well suited to study the roles of CPT1 and fatty acid oxidation in lipotoxicity and metabolism in vivo.« less

A New Module in Neural Differentiation Control: Two MicroRNAs Upregulated by Retinoic Acid, miR-9 and -103, Target the Differentiation Inhibitor ID2

PubMed Central

Savino, Mauro; Laneve, Pietro; Caffarelli, Elisa; Nasi, Sergio

2012-01-01

The transcription factor ID2 is an important repressor of neural differentiation strongly implicated in nervous system cancers. MicroRNAs (miRNAs) are increasingly involved in differentiation control and cancer development. Here we show that two miRNAs upregulated on differentiation of neuroblastoma cells – miR-9 and miR-103 – restrain ID2 expression by directly targeting the coding sequence and 3′ untranslated region of the ID2 encoding messenger RNA, respectively. Notably, the two miRNAs show an inverse correlation with ID2 during neuroblastoma cell differentiation induced by retinoic acid. Overexpression of miR-9 and miR-103 in neuroblastoma cells reduces proliferation and promotes differentiation, as it was shown to occur upon ID2 inhibition. Conversely, an ID2 mutant that cannot be targeted by either miRNA prevents retinoic acid-induced differentiation more efficient than wild-type ID2. These findings reveal a new regulatory module involving two microRNAs upregulated during neural differentiation that directly target expression of the key differentiation inhibitor ID2, suggesting that its alteration may be involved in neural cancer development. PMID:22848373

A new module in neural differentiation control: two microRNAs upregulated by retinoic acid, miR-9 and -103, target the differentiation inhibitor ID2.

PubMed

Annibali, Daniela; Gioia, Ubaldo; Savino, Mauro; Laneve, Pietro; Caffarelli, Elisa; Nasi, Sergio

2012-01-01

The transcription factor ID2 is an important repressor of neural differentiation strongly implicated in nervous system cancers. MicroRNAs (miRNAs) are increasingly involved in differentiation control and cancer development. Here we show that two miRNAs upregulated on differentiation of neuroblastoma cells--miR-9 and miR-103--restrain ID2 expression by directly targeting the coding sequence and 3' untranslated region of the ID2 encoding messenger RNA, respectively. Notably, the two miRNAs show an inverse correlation with ID2 during neuroblastoma cell differentiation induced by retinoic acid. Overexpression of miR-9 and miR-103 in neuroblastoma cells reduces proliferation and promotes differentiation, as it was shown to occur upon ID2 inhibition. Conversely, an ID2 mutant that cannot be targeted by either miRNA prevents retinoic acid-induced differentiation more efficient than wild-type ID2. These findings reveal a new regulatory module involving two microRNAs upregulated during neural differentiation that directly target expression of the key differentiation inhibitor ID2, suggesting that its alteration may be involved in neural cancer development.

Melatonin enhances lipid production in Monoraphidium sp. QLY-1 under nitrogen deficiency conditions via a multi-level mechanism.

PubMed

Zhao, Yongteng; Li, Dafei; Xu, Jun-Wei; Zhao, Peng; Li, Tao; Ma, Huixian; Yu, Xuya

2018-07-01

In this study, melatonin (MT) promoted lipid accumulation in Monoraphidium sp. QLY-1 under nitrogen deficiency conditions. The lipid accumulation increased 1.22- and 1.36-fold compared with a nitrogen-starved medium and a normal BG-11 medium, respectively. The maximum lipid content was 51.38%. The reactive oxygen species (ROS) level in the presence of melatonin was lower than that in the control group, likely because of the high antioxidant activities. The application of melatonin upregulated the gibberellin acid (GA) production and rbcL and accD expression levels but downregulated the abscisic acid (ABA) content and pepc expression levels. These findings demonstrated that exogenous melatonin could further improve the lipid production in Monoraphidium sp. QLY-1 by regulating antioxidant systems, signalling molecules, and lipid biosynthesis-related gene expression under nitrogen deficiency conditions. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genetic incorporation of recycled unnatural amino acids.

PubMed

Ko, Wooseok; Kim, Sanggil; Jo, Kyubong; Lee, Hyun Soo

2016-02-01

The genetic incorporation of unnatural amino acids (UAAs) into proteins has been a useful tool for protein engineering. However, most UAAs are expensive, and the method requires a high concentration of UAAs, which has been a drawback of the technology, especially for large-scale applications. To address this problem, a method to recycle cultured UAAs was developed. The method is based on recycling a culture medium containing the UAA, in which some of essential nutrients were resupplemented after each culture cycle, and induction of protein expression was controlled with glucose. Under optimal conditions, five UAAs were recycled for up to seven rounds of expression without a decrease in expression level, cell density, or incorporation fidelity. This method can generally be applied to other UAAs; therefore, it is useful for reducing the cost of UAAs for genetic incorporation and helpful for expanding the use of the technology to industrial applications.

Accumulation of Phenolic Compounds and Expression Profiles of Phenolic Acid Biosynthesis-Related Genes in Developing Grains of White, Purple, and Red Wheat.

PubMed

Ma, Dongyun; Li, Yaoguang; Zhang, Jian; Wang, Chenyang; Qin, Haixia; Ding, Huina; Xie, Yingxin; Guo, Tiancai

2016-01-01

Polyphenols in whole grain wheat have potential health benefits, but little is known about the expression patterns of phenolic acid biosynthesis genes and the accumulation of phenolic acid compounds in different-colored wheat grains. We found that purple wheat varieties had the highest total phenolic content (TPC) and antioxidant activity. Among phenolic acid compounds, bound ferulic acid, vanillic, and caffeic acid levels were significantly higher in purple wheat than in white and red wheat, while total soluble phenolic acid, soluble ferulic acid, and vanillic acid levels were significantly higher in purple and red wheat than in white wheat. Ferulic acid and syringic acid levels peaked at 14 days after anthesis (DAA), whereas p-coumaric acid and caffeic acid levels peaked at 7 DAA, and vanillic acid levels gradually increased during grain filling and peaked near ripeness (35 DAA). Nine phenolic acid biosynthesis pathway genes (TaPAL1, TaPAL2, TaC3H1, TaC3H2, TaC4H, Ta4CL1, Ta4CL2, TaCOMT1, and TaCOMT2) exhibited three distinct expression patterns during grain filling, which may be related to the different phenolic acids levels. White wheat had higher phenolic acid contents and relatively high gene expression at the early stage, while purple wheat had the highest phenolic acid contents and gene expression levels at later stages. These results suggest that the expression of phenolic acid biosynthesis genes may be closely related to phenolic acids accumulation.

Accumulation of Phenolic Compounds and Expression Profiles of Phenolic Acid Biosynthesis-Related Genes in Developing Grains of White, Purple, and Red Wheat

PubMed Central

Ma, Dongyun; Li, Yaoguang; Zhang, Jian; Wang, Chenyang; Qin, Haixia; Ding, Huina; Xie, Yingxin; Guo, Tiancai

2016-01-01

Polyphenols in whole grain wheat have potential health benefits, but little is known about the expression patterns of phenolic acid biosynthesis genes and the accumulation of phenolic acid compounds in different-colored wheat grains. We found that purple wheat varieties had the highest total phenolic content (TPC) and antioxidant activity. Among phenolic acid compounds, bound ferulic acid, vanillic, and caffeic acid levels were significantly higher in purple wheat than in white and red wheat, while total soluble phenolic acid, soluble ferulic acid, and vanillic acid levels were significantly higher in purple and red wheat than in white wheat. Ferulic acid and syringic acid levels peaked at 14 days after anthesis (DAA), whereas p-coumaric acid and caffeic acid levels peaked at 7 DAA, and vanillic acid levels gradually increased during grain filling and peaked near ripeness (35 DAA). Nine phenolic acid biosynthesis pathway genes (TaPAL1, TaPAL2, TaC3H1, TaC3H2, TaC4H, Ta4CL1, Ta4CL2, TaCOMT1, and TaCOMT2) exhibited three distinct expression patterns during grain filling, which may be related to the different phenolic acids levels. White wheat had higher phenolic acid contents and relatively high gene expression at the early stage, while purple wheat had the highest phenolic acid contents and gene expression levels at later stages. These results suggest that the expression of phenolic acid biosynthesis genes may be closely related to phenolic acids accumulation. PMID:27148345

Improved Acetic Acid Resistance in Saccharomyces cerevisiae by Overexpression of the WHI2 Gene Identified through Inverse Metabolic Engineering

PubMed Central

Chen, Yingying; Stabryla, Lisa

2016-01-01

Development of acetic acid-resistant Saccharomyces cerevisiae is important for economically viable production of biofuels from lignocellulosic biomass, but the goal remains a critical challenge due to limited information on effective genetic perturbation targets for improving acetic acid resistance in the yeast. This study employed a genomic-library-based inverse metabolic engineering approach to successfully identify a novel gene target, WHI2 (encoding a cytoplasmatic globular scaffold protein), which elicited improved acetic acid resistance in S. cerevisiae. Overexpression of WHI2 significantly improved glucose and/or xylose fermentation under acetic acid stress in engineered yeast. The WHI2-overexpressing strain had 5-times-higher specific ethanol productivity than the control in glucose fermentation with acetic acid. Analysis of the expression of WHI2 gene products (including protein and transcript) determined that acetic acid induced endogenous expression of Whi2 in S. cerevisiae. Meanwhile, the whi2Δ mutant strain had substantially higher susceptibility to acetic acid than the wild type, suggesting the important role of Whi2 in the acetic acid response in S. cerevisiae. Additionally, overexpression of WHI2 and of a cognate phosphatase gene, PSR1, had a synergistic effect in improving acetic acid resistance, suggesting that Whi2 might function in combination with Psr1 to elicit the acetic acid resistance mechanism. These results improve our understanding of the yeast response to acetic acid stress and provide a new strategy to breed acetic acid-resistant yeast strains for renewable biofuel production. PMID:26826231

Improved Acetic Acid Resistance in Saccharomyces cerevisiae by Overexpression of the WHI2 Gene Identified through Inverse Metabolic Engineering.

PubMed

Chen, Yingying; Stabryla, Lisa; Wei, Na

2016-01-29

Development of acetic acid-resistant Saccharomyces cerevisiae is important for economically viable production of biofuels from lignocellulosic biomass, but the goal remains a critical challenge due to limited information on effective genetic perturbation targets for improving acetic acid resistance in the yeast. This study employed a genomic-library-based inverse metabolic engineering approach to successfully identify a novel gene target, WHI2 (encoding a cytoplasmatic globular scaffold protein), which elicited improved acetic acid resistance in S. cerevisiae. Overexpression of WHI2 significantly improved glucose and/or xylose fermentation under acetic acid stress in engineered yeast. The WHI2-overexpressing strain had 5-times-higher specific ethanol productivity than the control in glucose fermentation with acetic acid. Analysis of the expression of WHI2 gene products (including protein and transcript) determined that acetic acid induced endogenous expression of Whi2 in S. cerevisiae. Meanwhile, the whi2Δ mutant strain had substantially higher susceptibility to acetic acid than the wild type, suggesting the important role of Whi2 in the acetic acid response in S. cerevisiae. Additionally, overexpression of WHI2 and of a cognate phosphatase gene, PSR1, had a synergistic effect in improving acetic acid resistance, suggesting that Whi2 might function in combination with Psr1 to elicit the acetic acid resistance mechanism. These results improve our understanding of the yeast response to acetic acid stress and provide a new strategy to breed acetic acid-resistant yeast strains for renewable biofuel production. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

A necrosis-inducing elicitor domain encoded by both symptomatic and asymptomatic Plantago asiatica mosaic virus isolates, whose expression is modulated by virus replication.

PubMed

Komatsu, Ken; Hashimoto, Masayoshi; Maejima, Kensaku; Shiraishi, Takuya; Neriya, Yutaro; Miura, Chihiro; Minato, Nami; Okano, Yukari; Sugawara, Kyoko; Yamaji, Yasuyuki; Namba, Shigetou

2011-04-01

Systemic necrosis is the most destructive symptom induced by plant pathogens. We previously identified amino acid 1154, in the polymerase domain (POL) of RNA-dependent RNA polymerase (RdRp) of Plantago asiatica mosaic virus (PlAMV), which affects PlAMV-induced systemic necrosis in Nicotiana benthamiana. By point-mutation analysis, we show that amino acid 1,154 alone is not sufficient for induction of necrotic symptoms. However, PlAMV replicons that can express only RdRp, derived from a necrosis-inducing PlAMV isolate, retain their ability to induce necrosis, and transient expression of PlAMV-encoded proteins indicated that the necrosis-eliciting activity resides in RdRp. Moreover, inducible-overexpression analysis demonstrated that the necrosis was induced in an RdRp dose-dependent manner. In addition, during PlAMV infection, necrotic symptoms are associated with high levels of RdRp accumulation. Surprisingly, necrosis-eliciting activity resides in the helicase domain (HEL), not in the amino acid 1,154-containing POL, of RdRp, and this activity was observed even in HELs of PlAMV isolates of which infection does not cause necrosis. Moreover, HEL-induced necrosis had characteristics similar to those induced by PlAMV infection. Overall, our data suggest that necrotic symptoms induced by PlAMV infection depend on the accumulation of a non-isolate specific elicitor HEL (even from nonnecrosis isolates), whose expression is indirectly regulated by amino acid 1,154 that controls replication.

Induction of CYP2E1 in non-alcoholic fatty liver diseases

PubMed Central

Aljomah, Ghanim; Baker, Susan S.; Liu, Wensheng; Kozielski, Rafal; Oluwole, Janet; Lupu, Benita; Baker, Robert D.; Zhu, Lixin

2015-01-01

Mounting evidence supports a contribution of endogenous alcohol metabolism in the pathogenesis of non-alcoholic steatohepatitis (NASH). However, it is not known whether the expression of alcohol metabolism genes is altered in the livers of simple steatosis. There is also a current debate on whether fatty acids induce CYP2E1 in fatty livers. In this study, expression of alcohol metabolizing genes in the liver biopsies of simple steatosis patients was examined by quantitative real-time PCR (qRT-PCR), in comparison to biopsies of NASH livers and normal controls. Induction of alcohol metabolizing genes was also examined in cultured HepG2 cells treated with ethanol or oleic acid, by qRT-PCR and Western blots. We found that the mRNA expression of alcohol metabolizing genes including ADH1C, ADH4, ADH6, catalase and CYP2E1 were elevated in the livers of simple steatosis, to similar levels found in NASH livers. In cultured HepG2 cells, ethanol induced the expression of CYP2E1 mRNA and protein, but not ADH4 or ADH6; oleic acid did not induce any of these genes. These results suggest that elevated alcohol metabolism may contribute to the pathogenesis of NAFLD at the stage of simple steatosis as well as more severe stages. Our in vitro data support that CYP2E1 is induced by endogenous alcohol but not by fatty acids. PMID:26551085

Soybean (Glycine max) WRINKLED1 transcription factor, GmWRI1a, positively regulates seed oil accumulation.

PubMed

Chen, Liang; Zheng, Yuhong; Dong, Zhimin; Meng, Fanfan; Sun, Xingmiao; Fan, Xuhong; Zhang, Yunfeng; Wang, Mingliang; Wang, Shuming

2018-04-01

Soybean is the world's most important leguminous crop producing high-quality protein and oil. Elevating oil accumulation in soybean seed is always many researchers' goal. WRINKLED1 (WRI1) encodes a transcription factor of the APETALA2/ethylene responsive element-binding protein (AP2/EREBP) family that plays important roles during plant seed oil accumulation. In this study, we isolated and characterized three distinct orthologues of WRI1 in soybean (Glycine max) that display different organ-specific expression patterns, among which GmWRI1a was highly expressed in maturing soybean seed. Electrophoretic mobility shift assays and yeast one-hybrid experiments demonstrated that the GmWRI1a protein was capable of binding to AW-box, a conserved sequence in the proximal upstream regions of many genes involved in various steps of oil biosynthesis. Transgenic soybean seeds overexpressing GmWRI1a under the control of the seed-specific napin promoter showed the increased total oil and fatty acid content and the changed fatty acid composition. Furthermore, basing on the activated expressions in transgenic soybean seeds and existence of AW-box element in the promoter regions, direct downstream genes of GmWRI1a were identified, and their products were responsible for fatty acid production, elongation, desaturation and export from plastid. We conclude that GmWRI1a transcription factor can positively regulate oil accumulation in soybean seed by a complex gene expression network related to fatty acid biosynthesis.

The Arabidopsis GASA10 gene encodes a cell wall protein strongly expressed in developing anthers and seeds.

PubMed

Trapalis, Menelaos; Li, Song Feng; Parish, Roger W

2017-07-01

The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of dietary Rhodobacter capsulatus on cholesterol concentration and fatty acid composition in broiler meat.

PubMed

Salma, U; Miah, A G; Maki, T; Nishimura, M; Tsujii, H

2007-09-01

The study was designed to investigate the effects of dietary Rhodobacter capsulatus on cholesterol concentration and fatty acid composition in broiler meat. A total of 45 two-week-old male broiler chicks were randomly assigned into 3 treatment groups and fed ad libitum diets supplemented with 0 (control), 0.02, and 0.04% R. capsulatus for a 6-wk feeding period. The results of this study revealed that the supplementation of 0.04% R. capsulatus in diet reduced (P < 0.05) cholesterol and triglyceride concentrations in broiler meat. The concentrations (expressed as a percentage of total fatty acids) of oleic acid (18:1), linoleic acid (18:2), and linolenic (18:3) acid in thigh muscle and breast muscle were higher (P < 0.05) in the broilers fed the 0.04% R. capsulatus supplemented diet than in the broilers fed the control diet. The ratio of unsaturated fatty acids to saturated fatty acids was greater (P < 0.05) in both muscles of broilers fed the 0.04% R. capsulatus supplemented diet than the control diet. In addition, the concentrations of serum cholesterol and triglyceride, and hepatic cholesterol and triglyceride were also reduced (P < 0.05) by dietary R. capsulatus. Compared with the control diet, the 0.04% R. capsulatus supplemented diet reduced (P < 0.05) the ratio of low-density lipoprotein-cholesterol to high-density lipoprotein-cholesterol. Moreover, the supplementation of R. capsulatus in broiler diets did not show any adverse effect on production performance. Therefore, these results conclude that the application of R. capsulatus into diet may be feasible to reduce cholesterol concentration and improve the ratio of unsaturated fatty acids to saturated fatty acids in broiler meat.

Chemopreventive effects of rofecoxib and folic acid on gastric carcinogenesis induced by N-methyl-N'-nitro-N-nitrosoguanidine in rats.

PubMed

Fei, Su Juan; Xiao, Shu Dong; Peng, Yan Shen; Chen, Xiao Yu; Shi, Yao

2006-01-01

Epidemiological and experimental studies indicate that non-steroidal anti-inflammatory drugs (NSAIDs) are chemopreventive agents of gastrointestinal cancers, but few studies on gastric cancer have been carried out. A decrease in folic acid supplement and subsequent DNA hypomethylation are related to gastrointestinal cancers, and it has been shown that high-dose folic acid may interfere with gastric carcinogenesis in dogs. The objective of this study was to investigate the effects of rofecoxib, a selective cyclooxygenase-2 (COX-2) inhibitor, and folic acid on the chemoprevention of gastric cancer induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) in Wistar rats, and to evaluate the cell proliferation of gastric mucosa in different experimental groups. Eighty male Wistar rats were randomly divided into five groups (16 rats in each group). In the control group, the rats were given pure water and basal diet. In the MNNG group, the rats received MNNG in drinking water (100 mg/L) and basal diet. In the MNNG + low-dose rofecoxib group, the rats were given MNNG and rofecoxib 5 mg/kg per day with basal diet. In the MNNG + high-dose rofecoxib group, the rats were given MNNG and rofecoxib 15 mg/kg per day with basal diet. In the MNNG + folic acid group, the rats were given MNNG and folic acid 5 mg/kg per day with basal diet. The experiment was terminated at 50 weeks, and all rats were killed. Blood samples of 3 mL were obtained for measurement of serum folic acid concentrations in the control group, the MNNG group and the MNNG + folic acid group by using chemiluminescent method. The stomach was removed from all rats for histopathological examination and immunohistochemical study. Proliferating cell nuclear antigen (PCNA) expression in gastric epithelial cells was also determined. In the MNNG group, five of 11 rats (45.5%) developed gastric cancer, while in all other four groups no gastric cancer was found (P < 0.05). The positivity rate of PCNA expression in the cancerous tissues was significantly higher than that in the non-cancerous tissues (80.0%vs 14.1%, P < 0.05). The positivity rate of PCNA expression in the gastric mucosal cells of the MNNG group was significantly higher than that in the other four groups. The mean serum folic acid concentration of rats was significantly higher in the MNNG + folic acid group (193.70 +/- 60.73 ng/mL) than those in the control group (84.21 +/- 25.26 ng/mL) and the MNNG group (72.27 +/- 16.70 ng/mL, P < 0.05). It was shown that both low- and high-dose rofecoxib as well as folic acid interfered with the development of gastric cancer induced by MNNG in Wistar rats. The results indicate that rofecoxib as well as folic acid interferes with gastric carcinogenesis induced by MNNG in Wistar rats, and the suppression of gastric cell proliferation may play a crucial role in the chemoprevention of gastric cancer by rofecoxib and folic acid. The higher serum folic acid concentration of rats may play an important role in the prevention of gastric cancer.

Proteomic analysis of the intestinal adaptation response reveals altered expression of fatty acid binding proteins following massive small bowel resection.

PubMed

Stephens, Andrew N; Pereira-Fantini, Prue M; Wilson, Guineva; Taylor, Russell G; Rainczuk, Adam; Meehan, Katie L; Sourial, Magdy; Fuller, Peter J; Stanton, Peter G; Robertson, David M; Bines, Julie E

2010-03-05

Intestinal adaptation in response to the loss of the small intestine is essential to restore enteral autonomy in patients who have undergone massive small bowel resection (MSBR). In a proportion of patients, intestinal function is not restored, resulting in chronic intestinal failure (IF). Early referral of such patients for transplant provides the best prognosis; however, the molecular mechanisms underlying intestinal adaptation remain elusive and there is currently no convenient marker to predict whether patients will develop IF. We have investigated the adaptation response in a well-characterized porcine model of intestinal adaptation. 2D DIGE analysis of ileal epithelium from piglets recovering from massive small bowel resection (MSBR) identified over 60 proteins that changed specifically in MSBR animals relative to nonoperational or sham-operated controls. Three fatty acid binding proteins (L-FABP, FABP-6, and I-FABP) showed changes in MSBR animals. The expression changes and localization of each FABP were validated by immunoblotting and immunohistochemical analysis. FABP expression changes in MSBR animals occurred concurrently with altered triglyceride and bile acid metabolism as well as weight gain. The observed FABP expression changes in the ileal epithelium occur as part of the intestinal adaptation response and could provide a clinically useful marker to evaluate adaptation following MSBR.

Trans-10, cis-12-conjugated linoleic acid alters hepatic gene expression in a polygenic obese line of mice displaying hepatic lipidosis.

PubMed

Ashwell, Melissa S; Ceddia, Ryan P; House, Ralph L; Cassady, Joseph P; Eisen, Eugene J; Eling, Thomas E; Collins, Jennifer B; Grissom, Sherry F; Odle, Jack

2010-09-01

The trans-10, cis-12 isomer of conjugated linoleic acid (CLA) causes a rapid reduction of body and adipose mass in mice. In addition to changes in adipose tissue, numerous studies have reported alterations in hepatic lipid metabolism. Livers of CLA-fed mice gain mass, partly due to lipid accumulation; however, the precise molecular mechanisms are unknown. To elucidate these mechanisms, we examined fatty acid composition and gene expression profiles of livers from a polygenic obese line of mice fed 1% trans-10, cis-12-CLA for 14 days. Analysis of gene expression data led to the identification of 1393 genes differentially expressed in the liver of CLA-fed male mice at a nominal P value of .01, and 775 were considered significant using a false discovery rate (FDR) threshold of .05. While surprisingly few genes in lipid metabolism were impacted, pathway analysis found that protein kinase A (PKA) and cyclic adenosine monophosphate (cAMP) pathways signaling pathways were affected by CLA treatment and 98 of the 775 genes were found to be regulated by hepatocyte nuclear factor 4alpha, a transcription factor important in controlling liver metabolic status. Copyright 2010 Elsevier Inc. All rights reserved.

Gallic acid and p-coumaric acid attenuate type 2 diabetes-induced neurodegeneration in rats.

PubMed

Abdel-Moneim, Adel; Yousef, Ahmed I; Abd El-Twab, Sanaa M; Abdel Reheim, Eman S; Ashour, Mohamed B

2017-08-01

The brain of diabetics revealed deterioration in many regions, especially the hippocampus. Hence, the present study aimed to evaluate the effects of gallic acid and p-coumaric acid against the hippocampal neurodegeneration in type 2 diabetic rats. Adult male albino rats were randomly allocated into four groups: Group 1 served as control ones and others were induced with diabetes. Group 2 considered as diabetic, and groups 3 and 4 were further orally treated with gallic acid (20 mg/kg b.wt./day) and p-coumaric acid (40 mg/kg b.wt./day) for six weeks. Diabetic rats revealed significant elevation in the levels of serum glucose, blood glycosylated hemoglobin and serum tumor necrosis factor-α, while the level of serum insulin was significantly declined. Furthermore, the brain of diabetic rats showed a marked increase in oxidative stress and a decrease of antioxidant parameters as well as upregulation the protein expression of Bax and downregulation the protein expression of Bcl-2 in the hippocampus. Treatment of diabetic rats with gallic acid and p-coumaric acid significantly ameliorated glucose tolerance, diminished the brain oxidative stress and improved antioxidant status, declined inflammation and inhibited apoptosis in the hippocampus. The overall results suggested that gallic acid and p-coumaric acid may inhibit hippocampal neurodegeneration via their potent antioxidant, anti-inflammatory and anti-apoptotic properties. Therefore, both compounds can be recommended as hopeful adjuvant agents against brain neurodegeneration in diabetics.

Intestinal absorption of the bile acid analogue 75Se-homocholic acid-taurine is increased in primary biliary cirrhosis, and reverts to normal during ursodeoxycholic acid administration

PubMed Central

Lanzini, A; De Tavonatti, M G; Panarotto, B; Scalia, S; Mora, A; Benini, F; Baisini, O; Lanzarotto, F

2003-01-01

Background: Whether ileal absorption of bile acid is up or downregulated in chronic cholestasis is still debated, and most evidence has come from animal studies. Aims: To compare ileal bile acid absorption in patients with primary biliary cirrhosis (PBC) and in healthy control subjects, and to assess the effect of ursodeoxycholic acid (UDCA). Patients: We studied 14 PBC patients before and during (n=11) UDCA administration, 14 healthy control subjects, and 14 Crohn’s disease patients (as disease controls). Methods: We used cholescintigraphy to measure retention in the enterohepatic circulation over five successive days of the bile acid analogue 75Se-homocholic acid-taurine (75SeHCAT) as an index of ileal bile acid absorption. Results were expressed as 75SeHCAT fractional turnover rate (FTR) and t½12. Results: 75SeHCAT FTR was 0.19 (0.11)/day, 0.34 (0.11)/day (p<0.001), and 0.83 (0.32)/day in PBC patients, healthy controls (p<0.0001), and Crohn’s patients (p<0.001), respectively, which increased to 0.36 (0.16)/day in PBC patients during UDCA treatment (p<0.005). 75SeHCAT t½12 was 4.8 (2.1) days in PBC patients, 2.2 (0.5) days (p<0.001) in healthy controls, and 1.0 (0.5) days (p<0.001) in Crohn’s disease patients. 75SeHCAT t½12 decreased to 2.2 (0.93) days (p< 0.001) in PBC patients during UDCA treatment. Conclusions: Our results support the concept that ileal bile acid absorption is upregulated in PBC patients, and that this effect may contribute towards damaging the cholestatic liver. This upregulation of bile acid absorption is abolished by UDCA. PMID:12912872

Sodium-dependent Vitamin C transporter 2 deficiency impairs myelination and remyelination after injury: Roles of collagen and demethylation.

PubMed

Röhr, Dominik; Halfter, Hartmut; Schulz, Jörg B; Young, Peter; Gess, Burkhard

2017-07-01

Peripheral nerve myelination involves rapid production of tightly bound lipid layers requiring cholesterol biosynthesis and myelin protein expression, but also a collagen-containing extracellular matrix providing mechanical stability. In previous studies, we showed a function of ascorbic acid in peripheral nerve myelination and extracellular matrix formation in adult mice. Here, we sought the mechanism of action of ascorbic acid in peripheral nerve myelination using different paradigms of myelination in vivo and in vitro. We found impaired myelination and reduced collagen expression in Sodium-dependent Vitamin C Transporter 2 heterozygous mice (SVCT2 +/- ) during peripheral nerve development and after peripheral nerve injury. In dorsal root ganglion (DRG) explant cultures, hypo-myelination could be rescued by precoating with different collagen types. The activity of the ascorbic acid-dependent demethylating Ten-eleven-translocation (Tet) enzymes was reduced in ascorbic acid deprived and SVCT2 +/- DRG cultures. Further, in ascorbic acid-deprived DRG cultures, methylation of a CpG island in the collagen alpha1 (IV) and alpha2 (IV) bidirectional promoter region was increased compared to wild-type and ascorbic acid treated controls. Taken together, these results provide further evidence for the function of ascorbic acid in myelination and extracellular matrix formation in peripheral nerves and suggest a putative molecular mechanism of ascorbic acid function in Tet-dependent demethylation of collagen promoters. © 2017 Wiley Periodicals, Inc.

Influence of betaine and arginine supplementation of reduced protein diets on fatty acid composition and gene expression in the muscle and subcutaneous adipose tissue of cross-bred pigs.

PubMed

Madeira, Marta S; Rolo, Eva S; Alfaia, Cristina M; Pires, Virgínia R; Luxton, Richard; Doran, Olena; Bessa, Rui J B; Prates, José A M

2016-03-28

The isolated or combined effects of betaine and arginine supplementation of reduced protein diets (RPD) on fat content, fatty acid composition and mRNA levels of genes controlling lipid metabolism in pig m. longissimus lumborum and subcutaneous adipose tissue (SAT) were assessed. The experiment was performed on forty intact male pigs (Duroc×Large White×Landrace cross-breed) with initial and final live weights of 60 and 93 kg, respectively. Pigs were randomly assigned to one of the following five diets (n 8): 16·0 % of crude protein (control), 13·0 % of crude protein (RPD), RPD supplemented with 0·33 % of betaine, RPD supplemented with 1·5 % of arginine and RPD supplemented with 0·33 % of betaine and 1·5 % of arginine. Data confirmed that RPD increase intramuscular fat (IMF) content and total fat content in SAT. The increased total fat content in SAT was accompanied by higher GLUT type 4, lipoprotein lipase and stearoyl-CoA desaturase mRNA expression levels. In addition, the supplementation of RPD with betaine and/or arginine did not affect either IMF or total fat in SAT. However, dietary betaine supplementation slightly affected fatty acid composition in both muscle and SAT. This effect was associated with an increase of carnitine O-acetyltransferase mRNA levels in SAT but not in muscle, which suggests that betaine might be involved in the differential regulation of some key genes of lipid metabolism in pig muscle and SAT. Although the arginine-supplemented diet decreased the mRNA expression level of PPARG in muscle and SAT, it did not influence fat content or fatty acid composition in any of these pig tissues.

Modulation of visceral fat adipokine secretion by dietary fatty acids and ensuing changes in skeletal muscle inflammation.

PubMed

Tishinsky, Justine M; De Boer, Anna A; Dyck, David J; Robinson, Lindsay E

2014-01-01

Given the link between obesity and insulin resistance, the role of adipose-derived factors in communicating with skeletal muscle to affect its function is important. We sought to determine if high fat diets modulate visceral adipose tissue (VAT) adipokines with subsequent effects on skeletal muscle inflammation and insulin sensitivity. Rats were fed (i) low fat (LF), (ii) high saturated fatty acid (SFA), or (iii) high SFA with n-3 polyunsaturated fatty acid (SFA/n-3 PUFA) diets for 4 weeks. VAT-derived adipokines were measured in adipose conditioned medium (ACM) after 72 h. Next, skeletal muscles from LF-fed rats were incubated for 8 h in (i) control buffer (CON), (ii) CON with 2 mmol·L(-1) palmitate (PALM, positive control), (iii) ACM from LF, (iv) ACM from SFA, or (v) ACM from SFA/n-3 PUFA. ACM from rats fed SFA and SFA/n-3 PUFA had increased (P ≤ 0.05) interleukin-6 (IL-6) (+31%) and monocyte chemoattractant protein-1 (MCP-1) (+30%). Adiponectin was decreased (-29%, P ≤ 0.05) in ACM from SFA, and this was prevented in SFA/n-3 PUFA ACM. Toll-like receptor 4 (TLR4) gene expression was increased (P ≤ 0.05) in PALM soleus muscle (+356%) and all ACM groups (+175%-191%). MCP-1 gene expression was elevated (P ≤ 0.05) in PALM soleus muscle (+163%) and soleus muscle incubated in ACM from animals fed SFA (+159%) and SFA/n-3 PUFA (+151%). Glucose transport was impaired (P ≤ 0.05) in PALM muscles but preserved in ACM groups. Acute exposure of muscle to fatty acid modulated adipokines affects skeletal muscle inflammatory gene expression but not insulin sensitivity.

Fatty acid synthase affects expression of ErbB receptors in epithelial to mesenchymal transition of breast cancer cells and invasive ductal carcinoma

PubMed Central

Chen, Tingting; Zhou, Lan; Li, Hua; Tian, Yuan; Li, Junqin; Dong, Lihua; Zhao, Yuhua; Wei, Dapeng

2017-01-01

The aim of the present study was to investigate changes in the expression of ErbBs during epithelial-mesenchymal transition (EMT) of breast cancer cells and its association with the expression of fatty acid synthase (FASN). MCF-7-MEK5 cells were used as the experimental model, while MCF-7 cells were used as a control. Tumor cells were implanted into nude mice for in vivo analysis. Cerulenin was used as a FASN inhibitor. Reverse transcription-polymerase chain reaction and western blot analysis were used to detect expression levels of FASN and ErbB1-4. Immunohistochemistry was used to detect the expression of FASN and ErbB1-4 in 58 invasive ductal carcinomas (IDC), as well as their association with clinicopathological characteristics. The expression of FASN and ErbB1-4 in MCF-7-MEK5 cells and tumor tissues increased significantly compared with controls (P<0.001). Inhibition of FASN by cerulenin resulted in a significant decrease in expression of ErbB1, 2 and 4 (P<0.001), whereas there was no evident change in ErbB3. In IDC samples, the expression of FASN and ErbB1-4 increased considerably in lymph node metastases compared with non-lymph node metastases (P<0.05). ErbB2 expression increased in advanced clinical stages (II, III and IV) of IDC and in tumors with larger diameters (P<0.05). The expression of ErbB3 increased in ER-positive tumors (P<0.05). Additionally, a positive association between the expression of FASN and ErbB1, 2 and 4 was observed (P<0.05). FASN activates ErbB1, 2 and 4, and their dimers, which are polymerized via the microstructural domain of the cell membrane. This may initiate EMT and consequentlyincrease the invasion and migration of cancer cells. However, ErbB3 may also affect tumor progression via a FASN-independent pathway. PMID:29113229

Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

PubMed Central

Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

2011-01-01

Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

Identification of placental nutrient transporters associated with intrauterine growth restriction and pre-eclampsia.

PubMed

Huang, Xiao; Anderle, Pascale; Hostettler, Lu; Baumann, Marc U; Surbek, Daniel V; Ontsouka, Edgar C; Albrecht, Christiane

2018-03-02

Gestational disorders such as intrauterine growth restriction (IUGR) and pre-eclampsia (PE) are main causes of poor perinatal outcomes worldwide. Both diseases are related with impaired materno-fetal nutrient transfer, but the crucial transport mechanisms underlying IUGR and PE are not fully elucidated. In this study, we aimed to identify membrane transporters highly associated with transplacental nutrient deficiencies in IUGR/PE. In silico analyses on the identification of differentially expressed nutrient transporters were conducted using seven eligible microarray datasets (from Gene Expression Omnibus), encompassing control and IUGR/PE placental samples. Thereby 46 out of 434 genes were identified as potentially interesting targets. They are involved in the fetal provision with amino acids, carbohydrates, lipids, vitamins and microelements. Targets of interest were clustered into a substrate-specific interaction network by using Search Tool for the Retrieval of Interacting Genes. The subsequent wet-lab validation was performed using quantitative RT-PCR on placentas from clinically well-characterized IUGR/PE patients (IUGR, n = 8; PE, n = 5; PE+IUGR, n = 10) and controls (term, n = 13; preterm, n = 7), followed by 2D-hierarchical heatmap generation. Statistical evaluation using Kruskal-Wallis tests was then applied to detect significantly different expression patterns, while scatter plot analysis indicated which transporters were predominantly influenced by IUGR or PE, or equally affected by both diseases. Identified by both methods, three overlapping targets, SLC7A7, SLC38A5 (amino acid transporters), and ABCA1 (cholesterol transporter), were further investigated at the protein level by western blotting. Protein analyses in total placental tissue lysates and membrane fractions isolated from disease and control placentas indicated an altered functional activity of those three nutrient transporters in IUGR/PE. Combining bioinformatic analysis, molecular biological experiments and mathematical diagramming, this study has demonstrated systematic alterations of nutrient transporter expressions in IUGR/PE. Among 46 initially targeted transporters, three significantly regulated genes were further investigated based on the severity and the disease specificity for IUGR and PE. Confirmed by mRNA and protein expression, the amino acid transporters SLC7A7 and SLC38A5 showed marked differences between controls and IUGR/PE and were regulated by both diseases. In contrast, ABCA1 may play an exclusive role in the development of PE.

Transgenic soybean overexpressing GmSAMT1 exhibits resistance to multiple-HG types of soybean cyst nematode Heterodera glycines

DOE PAGES

Lin, Jingyu; Mazarei, Mitra; Zhao, Nan; ...

2016-05-23

Soybean ( Glycine max (L.) Merr.) salicylic acid methyl transferase (GmSAMT1) catalyses the conversion of salicylic acid to methyl salicylate. Prior results showed that when GmSAMT1 was overexpressed in transgenic soybean hairy roots, resistance is conferred against soybean cyst nematode (SCN), Heterodera glycines Ichinohe. In this study, we produced transgenic soybean overexpressing GmSAMT1 and characterized their response to various SCN races. Transgenic plants conferred a significant reduction in the development of SCN HG type 1.2.5.7 (race 2), HG type 0 (race 3) and HG type 2.5.7 (race 5). Among transgenic lines, GmSAMT1 expression in roots was positively associated with SCNmore » resistance. In some transgenic lines, there was a significant decrease in salicylic acid titer relative to control plants. No significant seed yield differences were observed between transgenics and control soybean plants grown in one greenhouse with 22 °C day/night temperature, whereas transgenic soybean had higher yield than controls grown a warmer greenhouse (27 °C day/23 °C night) temperature. In a 1-year field experiment in Knoxville, TN, there was no significant difference in seed yield between the transgenic and nontransgenic soybean under conditions with negligible SCN infection. We hypothesize that GmSAMT1 expression affects salicylic acid biosynthesis, which, in turn, attenuates SCN development, without negative consequences to soybean yield or other morphological traits. Furthermore, we conclude that GmSAMT1 overexpression confers broad resistance to multiple SCN races, which would be potentially applicable to commercial production.« less

Transgenic soybean overexpressing GmSAMT1 exhibits resistance to multiple-HG types of soybean cyst nematode Heterodera glycines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Jingyu; Mazarei, Mitra; Zhao, Nan

Soybean ( Glycine max (L.) Merr.) salicylic acid methyl transferase (GmSAMT1) catalyses the conversion of salicylic acid to methyl salicylate. Prior results showed that when GmSAMT1 was overexpressed in transgenic soybean hairy roots, resistance is conferred against soybean cyst nematode (SCN), Heterodera glycines Ichinohe. In this study, we produced transgenic soybean overexpressing GmSAMT1 and characterized their response to various SCN races. Transgenic plants conferred a significant reduction in the development of SCN HG type 1.2.5.7 (race 2), HG type 0 (race 3) and HG type 2.5.7 (race 5). Among transgenic lines, GmSAMT1 expression in roots was positively associated with SCNmore » resistance. In some transgenic lines, there was a significant decrease in salicylic acid titer relative to control plants. No significant seed yield differences were observed between transgenics and control soybean plants grown in one greenhouse with 22 °C day/night temperature, whereas transgenic soybean had higher yield than controls grown a warmer greenhouse (27 °C day/23 °C night) temperature. In a 1-year field experiment in Knoxville, TN, there was no significant difference in seed yield between the transgenic and nontransgenic soybean under conditions with negligible SCN infection. We hypothesize that GmSAMT1 expression affects salicylic acid biosynthesis, which, in turn, attenuates SCN development, without negative consequences to soybean yield or other morphological traits. Furthermore, we conclude that GmSAMT1 overexpression confers broad resistance to multiple SCN races, which would be potentially applicable to commercial production.« less