Science.gov

Sample records for acid dna ribonucleic

  1. Ribonucleic acid purification.

    PubMed

    Martins, R; Queiroz, J A; Sousa, F

    2014-08-15

    Research on RNA has led to many important biological discoveries and improvement of therapeutic technologies. From basic to applied research, many procedures employ pure and intact RNA molecules; however their isolation and purification are critical steps because of the easy degradability of RNA, which can impair chemical stability and biological functionality. The current techniques to isolate and purify RNA molecules still have several limitations and the requirement for new methods able to improve RNA quality to meet regulatory demands is growing. In fact, as basic research improves the understanding of biological roles of RNAs, the biopharmaceutical industry starts to focus on them as a biotherapeutic tools. Chromatographic bioseparation is a high selective unit operation and is the major option in the purification of biological compounds, requiring high purity degree. In addition, its application in biopharmaceutical manufacturing is well established. This paper discusses the importance and the progress of RNA isolation and purification, considering RNA applicability both in research and clinical fields. In particular and in view of the high specificity, affinity chromatography has been recently applied to RNA purification processes. Accordingly, recent chromatographic investigations based on biorecognition phenomena occurring between RNA and amino acids are focused. Histidine and arginine have been used as amino acid ligands, and their ability to isolate different RNA species demonstrated a multipurpose applicability in molecular biology analysis and RNA therapeutics preparation, highlighting the potential contribution of these methods to overcome the challenges of RNA purification. PMID:24951289

  2. Ribonucleic acid (RNA) biosynthesis in human cancer.

    PubMed

    Hajjawi, Omar S

    2015-01-01

    In many respects, the most remarkable chemical substances within the genome of eukaryotic cells are remarkable proteins which are the critical structural and functional units of living cells. The specifications for everything that goes in the cell are natural digital-to-digital decoding process in an archive sequence by deoxyribonucleic acid (DNA) and an articulate construction by ribonucleic acid (RNA). The products of DNA transcription are long polymers of ribonucleotides rather than deoxyribonucleotides and are termed ribonucleic acids. Certain deoxyribonucleotide sequences, or genes, give rise to transfer RNA (tRNA) and other ribosomal RNA (rRNA) when transcribed. The ribonucleotide sequences fold extensively and rRNA is associated with specific proteins to yield the essential cell components, ribosomes. Transcription of other special sequences yields messenger RNAs (mRNAs) that contain ribonucleotide sequences that will be ultimately translated into new types of amino acid sequences of functional cellular protein molecules. This switch to a different variety of cellular molecular sequences is complex, but each sequence of the three ribonucleotides specifies the insertion of one particular amino acid into the polypeptide chain under production. Whilst mRNA is considered the vehicle by which genetic information is transmitted from the genome and allocated in the appropriate cytoplasmic sites for translation into protein via cap-dependent mechanism, the actual translation depends also on the presence of other so-called household and luxury protein molecules. Recent evidence suggests RNA species are required at initiation, because treatment of cells with antibiotics or drugs that inhibit RNA synthesis cause a decrease in protein synthesis. The rRNA is necessary as a structural constituent of the ribosomes upon which translation takes place, whereas tRNA is necessary as an adaptor in amino acid activation and elongation protein chains to ribosomes. In this article

  3. Ribonucleic Acid Polymerase in Allomyces arbuscula

    PubMed Central

    Cain, Alice K.; Nester, Eugene W.

    1973-01-01

    Three distinct species of ribonucleic acid (RNA) polymerase were resolved from Allomyces arbuscula by diethylaminoethyl-cellulose chromatography and characterized as to ionic strength and divalent cation preference. α-Amanitin specifically inhibited enzyme II; neither rifampin nor cycloheximide had any effect on the three enzymes. RNA polymerase was isolated from three stages of the diploid life cycle: the hyphal growth stage, mycelia in the process of forming sporangia, and the mitospores. The same three enzyme species could be resolved from each stage. Thus, there is no evidence from this work that RNA polymerase plays a major role in the control of development. PMID:4728272

  4. Ribonucleic acid interference induced gene knockdown

    PubMed Central

    Gottumukkala, Sruthima N. V. S.; Dwarakanath, C. D.; Sudarsan, Sabitha

    2013-01-01

    Despite major advances in periodontal regeneration over the past three decades, complete regeneration of the lost periodontium on a regular and predictable basis in humans has still remained elusive. The identification of stem cells in the periodontal ligament together with the growing concept of tissue engineering has opened new vistas in periodontal regenerative medicine. In this regard, ribonucleic acid interference (RNAi) opens a new gate way for a novel RNA based approach in periodontal management. This paper aims to summarize the current opinion on the mechanisms underlying RNAi, in vitro and in vivo existing applications in the dental research, which could lead to their future use in periodontal regeneration. PMID:24174717

  5. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  6. Control of dihydrofolate reductase messenger ribonucleic acid production

    SciTech Connect

    Leys, E.J.; Kellems, R.E.

    1981-11-01

    The authors used methotrexate-resistant mouse cells in which dihydrofolate reductase levels are approximately 500 times normal to study the effect of growth stimulation on dihydrofolate reductase gene expression. As a result of growth stimulation, the relative rate of dihydrofolate reductase protein synthesis increased threefold, reaching a maximum between 25 and 30 h after stimulation. The relative rate of dihydrofolate reductase messenger ribonucleic acid production (i.e., the appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm) increased threefold after growth stimulation and was accompanied by a corresponding increase in the relative steady-state level of dihydrofolate reductase ribonucleic acid in the nucleus. However, the increase in the nuclear level of dihydrofolate reductase ribonucleic acid was not accompanied by a significant increase in the relative rate of transcription of the dihydrofolate reductase genes. These data indicated that the relative rate of appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm depends on the relative stability of the dihydrofolate reductase ribonucleic acid sequences in the nucleus and is not dependent on the relative rate of transcription of the dihydrofolate reductase genes.

  7. Inhibition of Influenza Virus Ribonucleic Acid Polymerase by Ribavirin Triphosphate

    PubMed Central

    Eriksson, Bertil; Helgstrand, Erik; Johansson, Nils Gunnar; Larsson, Alf; Misiorny, Alfons; Noren, Jan Olof; Philipson, Lennart; Stenberg, Kjell; Stening, Goran; Stridh, Stig; Öberg, Bo

    1977-01-01

    Ribavirin 5′-triphosphate (RTP), derived from the broad-spectrum antiviral compound ribavirin (Virazole), can selectively inhibit influenza virus ribonucleic acid polymerase in a cell-free assay. Ribavirin and its 5′-monophosphate have no effect on the polymerase. The inhibition is competitive with respect to adenosine 5′-triphosphate and guanosine 5′-triphosphate. RTP also inhibits ApG- and GpC-stimulated influenza virus ribonucleic acid polymerase. Since ribavirin is phosphorylated in the cell, the inhibition of influenza multiplication in the cell may also be caused by RTP. PMID:879760

  8. Saliva of Lygus lineolaris digests double stranded ribonucleic acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The prospects for development of highly specific pesticides based on double stranded ribonucleic acid have been a recent focus of scientific research. Creative applications have been proposed and demonstrated. However, not all insects are sensitive to double stranded RNA (dsRNA) gene knockdown effec...

  9. Towards the elements of successful insect Ribonucleic acid interference (RNAi)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that ...

  10. Isolation and Characterization of Simian Virus 40 Ribonucleic Acid

    PubMed Central

    Weinberg, R. A.; Warnaar, S. O.; Winocour, E.

    1972-01-01

    Deoxyribonucleic acid-ribonucleic acid (RNA) hybridization in formamide was used to isolate simian virus 40-specific RNA. Early in the lytic cycle, a 19S viral RNA species was observed. Late in the lytic cycle, 16S and 19S viral species were found. The 16S and 19S species of viral RNA were localized in the cytoplasm. High-molecular-weight heterogeneous RNA, containing viral sequences, was isolated from the nuclear fraction of infected cells late in the lytic cycle. This RNA may contain non-viral sequences linked to viral sequences. The formamide hybridization technique can be used to isolate intact late lytic viral RNA which is at least 99% pure. PMID:4342237

  11. Structure of the Ribonucleic Acid Bacteriophage R17

    PubMed Central

    Vasquez, Cesar; Granboulan, Nicole; Franklin, Richard M.

    1966-01-01

    Vasquez, Cesar (Institut de Recherches sur le Cancer, Villejuif, Seine, France), Nicole Granboulan, and Richard M. Franklin. Structure of the ribonucleic acid bacteriophage R17. J. Bacteriol. 92:1779–1786. 1966.—The morphology of bacteriophage R17 was studied by electron microscopy of negatively stained virions. The hexagonal shape, the presence of a maximum of 10 units at the periphery, and especially the observation of central fivefold points of symmetry with neighboring five and six coordinated units indicated icosahedral symmetry with 32 morphological units. Although the exact shape of the polyhedron could not be specified, the number of morphological units agreed with the chemically estimated number of structural units. Images PMID:5958109

  12. Ribonucleic acid interference (RNAi) Technology for control of Asian citrus psyllid - You Tube

    Technology Transfer Automated Retrieval System (TEKTRAN)

    RNAi, Ribonucleic acid interference, function and application are described to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry....

  13. Simian Virus 40 Deoxyribonucleic Acid Transcription In Vitro: Binding and Transcription Patterns with a Mammalian Ribonucleic Acid Polymerase 1

    PubMed Central

    Herzberg, Max; Winocour, Ernest

    1970-01-01

    The in vitro transcription pattern of simian virus 40 (SV40) deoxyribonucleic acid (DNA) by a mammalian ribonucleic acid (RNA) polymerase, was studied by electron microscopy and velocity sedimentation techniques. It was found that (i) the majority of supercoiled SV40 DNA molecules displayed a single binding site for the enzyme, (ii) the supercoiled structure of SV40 DNA was frequently retained during transcription, and (iii) the majority of RNA molecules synthesized from the supercoiled SV40 DNA template showed no self-complementarity and sedimented relatively homogeneously in the 15S to 16S region of a sucrose gradient (in contrast, the RNA product synthesized from the nicked-circular SV40 DNA template showed self-complementarity and sedimented heterogeneously). RNA polymerase preparations isolated from SV40-infected monkey cells were more active than those isolated from uninfected monkey cells. Images PMID:4320700

  14. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  15. Interaction of neomycin with ribosomes and ribosomal ribonucleic acid.

    PubMed

    Dahlberg, A E; Horodyski, F; Keller, P

    1978-02-01

    Neomycin binds ribosomes and ribosomal ribonucleic acid (rRNA) in vivo and in vitro producing changes detectable by increases in gel electrophoretic mobility. These changes were observed in gels that contain ethylenediaminetetraacetic acid or no added magnesium ion. The progressive increase in gel electrophoretic mobility with increasing antibiotic concentrations suggests that neomycin is binding at multiple sites on RNA. The binding was reversible but sufficiently stable to survive dialysis and electrophoresis. It is proposed that bound neomycin stabilizes the ribosome and RNA structures, restricting the unfolding of the particles during electrophoresis and thus allowing for a more rapid migration in the gel. Gentamicin produced an effect similar to that of neomycin. Paromomycin, differing from neomycin by only one amino group, had considerably less effect on ribosome and rRNA mobilities. The binding of neomycin to rRNA improved the linearity of the plot of log molecular weight versus mobility and thus may be of benefit in providing a more accurate estimation of molecular weights of large RNAs.

  16. Ribonucleic Acid Polymerases of the Yeast Phase of Histoplasma capsulatum

    PubMed Central

    Boguslawski, George; Schlessinger, David; Medoff, Gerald; Kobayashi, George

    1974-01-01

    Ribonucleic acid (RNA) polymerases of Histoplasma capsulatum (yeast phase) were fractionated by phosphocellulose chromatography and partially characterized. Three distinct, active fractions were seen. The major RNA polymerase species was inhibited strongly by α-amanitin, whereas the other two were resistant. When either slightly purified (HSE) extract or the major active component was assayed at 37 C, the incorporation of tritiated uridine monophosphate into RNA stopped after 10 to 15 min. In contrast, the synthesis continued for at least 1 h at 23 C. The other two RNA polymerase species exhibited higher rates of incorporation when tested at 37 C, and continued to synthesize RNA even after 60 min. However, by that time the levels of incorporation at 23 C were higher than at 37 C for all three enzymes. The temperature sensitivity was not affected by changing substrate concentration or employing either native or denatured calf thymus deoxyribonucleic acid as a template. These results are compared with the data obtained with RNA polymerases from different fungi and other organisms. A possible involvement of RNA polymerase(s) in morphological differentiation of H. capsulatum is discussed. PMID:4828308

  17. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  18. Inactivation of Encephalomyocarditis Virus in Aerosols: Fate of Virus Protein and Ribonucleic Acid

    PubMed Central

    De Jong, J. C.; Harmsen, M.; Trouwborst, T.; Winkler, K. C.

    1974-01-01

    After aerosolization at relative humidities of 50% or lower, encephalomyocarditis virus is rapidly inactivated. In this process the protein coat of the virion is damaged. This appears as a loss of hemagglutination activity and loss of affinity for hemagglutination inhibiting antibodies. The ribonucleic acid of the virus retains its infectivity but it becomes susceptible to ribonuclease. It sediments in sucrose gradients when centrifuged at high speed with the same velocity as free infectious ribonucleic acid extracted with phenol from intact encephalomyocarditis virus. PMID:4358862

  19. Characterization of the Subunit Structure of the Ribonucleic Acid Genome of Influenza Virus

    PubMed Central

    Lewandowski, L. J.; Content, J.; Leppla, S. H.

    1971-01-01

    Ribonucleic acid extracted from influenza virus was labeled at the 3′ termini with 3H and analyzed by polyacrylamide gel electrophoresis. Influenza virus was found to contain a minimum of seven and possibly as many as 10 polynucleotide chains, most of which appear to terminate at the 3′ end in uridine. PMID:4332140

  20. Ribonucleic Acid, Deoxyribonucleic Acid, and Protein Content of Cells of Different Ages of Mycobacterium tuberculosis and the Relationship to Immunogenicity

    PubMed Central

    Youmans, Anne S.; Youmans, Guy P.

    1968-01-01

    The amount of ribonucleic acid (RNA), protein, and deoxyribonucleic acid (DNA) was determined in pellicle cultures of different ages of the H37Ra strain of Mycobacterium tuberculosis, grown on a synthetic medium. We found that the highest content of RNA and protein was present in 2-week-old cultures, indicating that these cells were in the logarithmic phase of growth. DNA content was highest at 1 and 2 weeks. The amount of all three compounds then decreased about 50% during the following 6 weeks. Two-week-old cells should therefore be used for preparation of the immunogenic ribosomal fraction. The optimal concentration of zinc chloride increased RNA and protein synthesis, and also improved the appearance of the pellicle growth. Two-week-old cells, which contained the largest amount of RNA and protein, immunized mice significantly better than older cells. Since protein and DNA are not involved in the production of immunity, a correlation could be made between amount of RNA and the capacity of viable H37Ra cells to immunize mice. The immunizing capacity of these cells was not affected by ribonuclease, probably because the ribonuclease did not penetrate into the whole cells. PMID:4966539

  1. Control of larval and egg development in Aedes aegypti with Ribonucleic acid interference (RNAi) against juvenile hormone acid methyl transferase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference (RNAi) is a powerful approach for elucidating gene functions in a variety of organisms, including mosquitoes and many other insects. Little has been done, however, to harness this approach in order to control adult and larval mosquitoes. Juvenile hormone (JH) plays a pi...

  2. In Vitro Synthesis of Poliovirus Ribonucleic Acid: Role of the Replicative Intermediate

    PubMed Central

    Girard, Marc

    1969-01-01

    Poliovirus ribonucleic acid (RNA) polymerase crude extracts could be stored frozen in liquid nitrogen without loss of activity or specificity. The major in vitro product of these extracts was viral single-stranded RNA. However, after short periods of incubation with radioactive nucleoside triphosphates, most of the incorporated label was found in replicative intermediate. When excess unlabeled nucleoside triphosphate was added, the label was displaced from the replicative intermediate and accumulated as viral RNA. It is concluded from this experiment that the replicative intermediate is the precursor to viral RNA. In addition, some of the label was chased into double-stranded RNA. The implications of this finding are discussed. PMID:4306193

  3. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  4. The role of micro-ribonucleic acids in normal hematopoiesis and leukemic T-lymphogenesis.

    PubMed

    Slavov, S N; Gimenes Teixeira, H L; Rego, E M

    2010-07-01

    Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

  5. Factors Affecting Immunogenic Activity of Mycobacterial Ribosomal and Ribonucleic Acid Preparations

    PubMed Central

    Youmans, Anne S.; Youmans, Guy P.

    1969-01-01

    By following careful procedures, mycobacterial ribosomal fractions and ribonucleic acid (RNA) prepared by ethyl alcohol precipitation were obtained which have immunogenic activities similar to the viable attenuated H37Ra cells of Mycobacterium tuberculosis from which they were obtained. This comparison was based on the amount of ribonucleic acid (RNA) present. These preparations consisted of approximately 63% RNA and 37% protein; no deoxyribonucleic acid or polysaccharide was detected by chemical tests. A high correlation was found between the immunogenic activity of a preparation and the per cent increase in hyperchromicity at 260 nm of a ribonuclease-hydrolyzed portion. Final concentrations of sodium dodecyl sulfate higher than 0.25% when used for the preparation of the ribosomal fractions and RNA resulted in significantly lower immune responses and greater variation between experiments. This was not related to the amount of protein present. The stability of the ribosomal and RNA preparations was tested under a variety of conditions. The need for a good protective adjuvant again was shown since mouse serum readily hydrolyzed the RNA. Equal immunity was obtained after immunization by the intraperitoneal and subcutaneous routes; however, no immune response was obtained when the intravenous route was used. Preliminary results with RNA prepared with phenol showed that it was more easily degraded during preparation. This resulted in a lower immune response than was obtained with the RNA prepared with ethyl alcohol. PMID:4979447

  6. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

    SciTech Connect

    Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.

    1981-09-01

    The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

  7. Optical and electronic properties of polyaniline sulfonic acid-ribonucleic acid-gold nanobiocomposites.

    PubMed

    Routh, Parimal; Garai, Ashesh; Nandi, Arun K

    2011-08-14

    Finely fibrillar polyaniline sulfonic acid (PSA)/ribonucleic acid (RNA) hybrids are developed by wrapping PSA with RNA from a mixture of aqueous PSA (P) and RNA (R) solutions of different compositions. FTIR spectra suggest H-bonding and π-π interactions in the hybrids and dedoping of self doped PSA during hybrid formation. UV-vis spectra exhibit a blue shift of the π-band to polaron band transition of PSA from 870 to 581 nm due to dedoping. The PR hybrids show enhanced PL-properties when excited at 540 nm relative to PSA which also exhibits rectification behavior in current (I)-voltage (V) curves. Gold nanoparticles (Au NPs) grown on these PR hybrids by the reduction of Au(3+) by PSA show different morphologies with varying composition. FTIR spectra of the nanobiocomposites indicate that Au NPs are stabilized by the co-ordination of the nitrogen atoms of -N=Q=N- bonds of PSA (Q = quinonoid ring). The intensity of the Au plasmon band gradually decreases with time but the PL-intensities of the PAu/PRAu nanocomposites increase with time. The PL-intensity of the nanocomposites is higher than that of PSA and PR hybrids. The DC-conductivity of the PR hybrids increases by an order of magnitude on addition of Au NPs. I-V curves of the nanobiocomposites show negative differential resistance (NDR) in PSA rich systems with a stable NDR ratio of 7 in the PRAu21 and PRAu11 hybrids. Possible reasons from the accumulation of charges on the Au NPs and its stabilization through the π-clouds of RNA bases are discussed. The PRAu11 system also exhibits rectification properties with a rectification ratio of 14.

  8. Optical and electronic properties of polyaniline sulfonic acid-ribonucleic acid-gold nanobiocomposites.

    PubMed

    Routh, Parimal; Garai, Ashesh; Nandi, Arun K

    2011-08-14

    Finely fibrillar polyaniline sulfonic acid (PSA)/ribonucleic acid (RNA) hybrids are developed by wrapping PSA with RNA from a mixture of aqueous PSA (P) and RNA (R) solutions of different compositions. FTIR spectra suggest H-bonding and π-π interactions in the hybrids and dedoping of self doped PSA during hybrid formation. UV-vis spectra exhibit a blue shift of the π-band to polaron band transition of PSA from 870 to 581 nm due to dedoping. The PR hybrids show enhanced PL-properties when excited at 540 nm relative to PSA which also exhibits rectification behavior in current (I)-voltage (V) curves. Gold nanoparticles (Au NPs) grown on these PR hybrids by the reduction of Au(3+) by PSA show different morphologies with varying composition. FTIR spectra of the nanobiocomposites indicate that Au NPs are stabilized by the co-ordination of the nitrogen atoms of -N=Q=N- bonds of PSA (Q = quinonoid ring). The intensity of the Au plasmon band gradually decreases with time but the PL-intensities of the PAu/PRAu nanocomposites increase with time. The PL-intensity of the nanocomposites is higher than that of PSA and PR hybrids. The DC-conductivity of the PR hybrids increases by an order of magnitude on addition of Au NPs. I-V curves of the nanobiocomposites show negative differential resistance (NDR) in PSA rich systems with a stable NDR ratio of 7 in the PRAu21 and PRAu11 hybrids. Possible reasons from the accumulation of charges on the Au NPs and its stabilization through the π-clouds of RNA bases are discussed. The PRAu11 system also exhibits rectification properties with a rectification ratio of 14. PMID:21698302

  9. In vitro translation of cardiovirus ribonucleic acid by mammalian cell-free extracts.

    PubMed

    Eggen, K L; Shatkin, A J

    1972-04-01

    Cell-free extracts prepared from Ehrlich ascites and mouse L cells synthesize viral proteins in response to encephalomyocarditis virus, mouse Elberfeld virus, and mengovirus ribonucleic acid. Although HeLa cell extracts are inactive, their ribosomes are functional in the presence of heterologous supernatant fractions. Synthesis depends upon the addition of adenosine triphosphate, guanosine triphosphate, an energy-generating system, and 4 mm Mg(2+). Initiation is completed during the first 10 to 20 min of incubation, but chain elongation continues for 1 hr or more. The products are of higher molecular weight than virion structural proteins and resemble polypeptides formed in virus-infected cells during a short pulse. Tryptic peptides of virion proteins and in vitro products are similar for all three cardioviruses.

  10. Transcription In Vitro by Reovirus-Associated Ribonucleic Acid-Dependent Polymerase 1

    PubMed Central

    Banerjee, A. K.; Shatkin, A. J.

    1970-01-01

    Digestion of purified reovirus type 3 with chymotrypsin degrades 70% of the viral protein and converts the virions to subviral particles (SVP). The SVP contain 3 of the 6 viral structural proteins and all 10 double-stranded ribonucleic acid (RNA) genome segments but not adenine-rich, single-stranded RNA. An RNA polymerase which is structurally associated with SVP transcribes one strand of each genome segment by a conservative mechanism in vitro. The single-stranded products include large (1.2 × 106 daltons), medium (0.7 × 106 daltons), and small (0.4 × 106 daltons) molecules which hybridize exclusively with the corresponding genome segments. The enzyme obtained by heating virions at 60 C synthesizes similar products. Kinetic and pulse-chase studies indicate that the different-sized products are synthesized simultaneously but at rates which are in the order: small > medium > large. Images PMID:5529847

  11. Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

    SciTech Connect

    Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya

    2014-09-15

    Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitated lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.

  12. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  13. Reagentless measurement of aminoglycoside antibiotics in blood serum via an electrochemical, ribonucleic acid aptamer-based biosensor.

    PubMed

    Rowe, Aaron A; Miller, Erin A; Plaxco, Kevin W

    2010-09-01

    Biosensors built using ribonucleic acid (RNA) aptamers show promise as tools for point-of-care medical diagnostics, but they remain vulnerable to nuclease degradation when deployed in clinical samples. To explore methods for protecting RNA-based biosensors from such degradation we have constructed and characterized an electrochemical, aptamer-based sensor for the detection of aminoglycosidic antibiotics. We find that while this sensor achieves low micromolar detection limits and subminute equilibration times when challenged in buffer, it deteriorates rapidly when immersed directly in blood serum. In order to circumvent this problem, we have developed and tested sensors employing modified versions of the same aptamer. Our first effort to this end entailed the methylation of all of the 2'-hydroxyl groups outside of the aptamer's antibiotic binding pocket. However, while devices employing this modified aptamer are as sensitive as those employing an unmodified parent, the modification fails to confer greater stability when the sensor is challenged directly in blood serum. As a second potentially naive alternative, we replaced the RNA bases in the aptamer with their more degradation-resistant deoxyribonucleic acid (DNA) equivalents. Surprisingly and unlike control DNA-stem loops employing other sequences, this DNA aptamer retains the ability to bind aminoglycosides, albeit with poorer affinity than the parent RNA aptamer. Unfortunately, however, while sensors fabricated using this DNA aptamer are stable in blood serum, its lower affinity pushes their detection limits above the therapeutically relevant range. Finally, we find that ultrafiltration through a low-molecular-weight-cutoff spin column rapidly and efficiently removes the relevant nucleases from serum samples spiked with gentamicin, allowing the convenient detection of this aminoglycoside at clinically relevant concentrations using the original RNA-based sensor.

  14. Comparison of Two Serologically Distinct Ribonucleic Acid Bacteriophages II. Properties of the Nucleic Acids and Coat Proteins

    PubMed Central

    Overby, L. R.; Barlow, G. H.; Doi, R. H.; Jacob, Monique; Spiegelman, S.

    1966-01-01

    Overby, L. R. (University of Illinois, Urbana), G. H. Barlow, R. H. Doi, Monique Jacob, and S. Spiegelman. Comparison of two serologically distinct ribonucleic acid bacteriophages. II. Properties of the nucleic acids and coat proteins. J. Bacteriol. 92:739–745. 1966.—The ribonucleic acid (RNA) molecules and coat proteins of two RNA coliphages, MS-2 and Qβ, have been characterized. MS-2 RNA shows an S20,w of 25.8 and a molecular weight by light scattering of 106. The corresponding parameters for Qβ-RNA were 28.9 and 0.9 × 106. A difference in base composition was reflected in the adenine-uracil ratio, which was 0.95 for MS-2 and 0.75 for Qβ. The two RNA preparations are readily separated by chromatography on columns of methylated albumin. Both gave identical bouyant densities in cesium sulfate of 1.64 g/ml. The coat protein subunits were of similar molecular weights: 15,500 (Qβ) and 14,000 (MS-2). They differed, however, in that the Qβ-protein lacked tryptophan and histidine, whereas the MS-2 protein lacked only histidine. Images PMID:5922545

  15. In vitro evaluation of endothelial exosomes as carriers for small interfering ribonucleic acid delivery.

    PubMed

    Banizs, Anna B; Huang, Tao; Dryden, Kelly; Berr, Stuart S; Stone, James R; Nakamoto, Robert K; Shi, Weibin; He, Jiang

    2014-01-01

    Exosomes, one subpopulation of nanosize extracellular vesicles derived from multivesicular bodies, ranging from 30 to 150 nm in size, emerged as promising carriers for small interfering ribonucleic acid (siRNA) delivery, as they are capable of transmitting molecular messages between cells through carried small noncoding RNAs, messenger RNAs, deoxyribonucleic acids, and proteins. Endothelial cells are involved in a number of important biological processes, and are a major source of circulating exosomes. In this study, we prepared exosomes from endothelial cells and evaluated their capacity to deliver siRNA into primary endothelial cells. Exosomes were isolated and purified by sequential centrifugation and ultracentrifugation from cultured mouse aortic endothelial cells. Similar to exosome particles from other cell sources, endothelial exosomes are nanometer-size vesicles, examined by both the NanoSight instrument and transmission electron microscopy. Enzyme-linked immunosorbent assay analysis confirmed the expression of two exosome markers: CD9 and CD63. Flow cytometry and fluorescence microscopy studies demonstrated that endothelial exosomes were heterogeneously distributed within cells. In a gene-silencing study with luciferase-expressing endothelial cells, exosomes loaded with siRNA inhibited luciferase expression by more than 40%. In contrast, siRNA alone and control siRNA only suppressed luciferase expression by less than 15%. In conclusion, we demonstrated that endothelial exosomes have the capability to accommodate and deliver short foreign nucleic acids into endothelial cells.

  16. In vitro evaluation of endothelial exosomes as carriers for small interfering ribonucleic acid delivery

    PubMed Central

    Banizs, Anna B; Huang, Tao; Dryden, Kelly; Berr, Stuart S; Stone, James R; Nakamoto, Robert K; Shi, Weibin; He, Jiang

    2014-01-01

    Exosomes, one subpopulation of nanosize extracellular vesicles derived from multivesicular bodies, ranging from 30 to 150 nm in size, emerged as promising carriers for small interfering ribonucleic acid (siRNA) delivery, as they are capable of transmitting molecular messages between cells through carried small noncoding RNAs, messenger RNAs, deoxyribonucleic acids, and proteins. Endothelial cells are involved in a number of important biological processes, and are a major source of circulating exosomes. In this study, we prepared exosomes from endothelial cells and evaluated their capacity to deliver siRNA into primary endothelial cells. Exosomes were isolated and purified by sequential centrifugation and ultracentrifugation from cultured mouse aortic endothelial cells. Similar to exosome particles from other cell sources, endothelial exosomes are nanometer-size vesicles, examined by both the NanoSight instrument and transmission electron microscopy. Enzyme-linked immunosorbent assay analysis confirmed the expression of two exosome markers: CD9 and CD63. Flow cytometry and fluorescence microscopy studies demonstrated that endothelial exosomes were heterogeneously distributed within cells. In a gene-silencing study with luciferase-expressing endothelial cells, exosomes loaded with siRNA inhibited luciferase expression by more than 40%. In contrast, siRNA alone and control siRNA only suppressed luciferase expression by less than 15%. In conclusion, we demonstrated that endothelial exosomes have the capability to accommodate and deliver short foreign nucleic acids into endothelial cells. PMID:25214786

  17. Ribonucleic acid synthesis by Escherichia coli C3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of the coliphage-induced double-stranded ribonucleic acid

    PubMed Central

    Bishop, D. H. L.

    1966-01-01

    1. The efficiency of extracting nucleic acids from Escherichia coli after five methods of obtaining cell lysis was determined. 2. The recovery of various nucleic acid species isolated after chromatography on methylated albumin-coated kieselguhr was also examined. 3. Double-stranded coliphage-induced RNA was isolated from infected bacteria and its resistance to ribonuclease digestion under various conditions determined. 4. The involvement of double-stranded RNA during the infection process was demonstrated. 5. The time-course of the syntheses in infected cells of double-stranded RNA, DNA, single-stranded coliphage and 16s ribosomal RNA, transfer RNA and ribosomal 23s RNA was examined. 6. It was demonstrated that the syntheses of DNA, transfer RNA and ribosomal RNA decreased 10–15min. after infection. 7. Synthesis of coliphage RNA commenced 10–15min. after infection and double-stranded RNA was also synthesized from about 10min. after coliphage adsorption. PMID:5338876

  18. Ribonucleic acid synthesis by Escherichia coli C 3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of the coliphage-induced double-stranged ribonucleic acid.

    PubMed

    Bishop, D H

    1966-09-01

    1. The efficiency of extracting nucleic acids from Escherichia coli after five methods of obtaining cell lysis was determined. 2. The recovery of various nucleic acid species isolated after chromatography on methylated albumin-coated kieselguhr was also examined. 3. Double-stranded coliphage-induced RNA was isolated from infected bacteria and its resistance to ribonuclease digestion under various conditions determined. 4. The involvement of double-stranded RNA during the infection process was demonstrated. 5. The time-course of the syntheses in infected cells of double-stranded RNA, DNA, single-stranded coliphage and 16s ribosomal RNA, transfer RNA and ribosomal 23s RNA was examined. 6. It was demonstrated that the syntheses of DNA, transfer RNA and ribosomal RNA decreased 10-15min. after infection. 7. Synthesis of coliphage RNA commenced 10-15min. after infection and double-stranded RNA was also synthesized from about 10min. after coliphage adsorption.

  19. Characterization of hybrid plasmids carrying individual ribosomal ribonucleic acid transcription units of Escherichia coli.

    PubMed Central

    Kenerley, M E; Morgan, E A; Post, L; Lindahl, L; Nomura, M

    1977-01-01

    We have screened the strains with ColE1 hybrid plasmids constructed by Clarke and Carbon (Cell 9:91-99, 1976) for the presence of ribosomal ribonucleic acid (rRNA) genes on the plasmids and identified 16 strains whose plasmids carry rRNA genes. The structures of these 16 plasmids were compared by heteroduplex analysis, and the plasmids were classified into six groups on the basis of their chromosomal origins. Homology with known transducing-phage deoxyribonucleic acids and genetic mapping have assigned locations on the Escherichia coli chromosome to three of the six groups. These are rrnB near rif at 88 min, rrnC near ilvE at 83 min, and rrnD near aroE at 71 min. A fourth group is probably rrnA at 85 min (T. Ikemura and M. Nomura, Cell, 11:779-793, 1977). We conclude that the minimum number of rRNA transcription units per haploid chromosomes is seven, that is, the six groups identified in this work plus a known operon (rrnE near metA at 89 min) that we failed to find among the hybrid plasmids. This heteroduplex analysis also suggests that there are only two kinds of rRNA operons with respect to their spacer region; three of the six rRNA operon groups studied here have one kind, whereas the remaining three have the other kind. Images PMID:336613

  20. Effect of growth rate on the amounts of ribosomal and transfer ribonucleic acids in yeast.

    PubMed Central

    Waldron, C; Lacroute, F

    1975-01-01

    The steady-state growth rate of Saccharomyces cerevisiae was varied by growing the cells in different media. The total amount of ribonucleic acid (RNA) per cell was found to decrease as a nonlinear function of decreasing growh rate. The RNA from cells growing in different media was analyzed by polyacrylamide gel electrophoresis. Although the amounts of both ribosomal RNA and transfer RNA decreased with decreasing growth rate, the ratio of ribosomal to transfer RNA was not constant. As the growth rate was reduced the ribosomal RNA fraction decreased slightly, whereas the transfer RNA fraction increased slightly. Thus the levels of ribosomal and transfer RNA were regulated to similar yet different extents. The levels of the different ribosomal RNA species were more closely coordinated. At all growth rates the ribosomal RNAs (including 5S RNA) were present in equimolar amounts. The rate of protein synthesis in yeast cells also decreased with decreasing growth rate. The low rates of protein synthesis did not appear to be due to limiting numbers of ribosomes or transfer RNA molecules. PMID:1097403

  1. Rate of ribonucleic acid chain growth in Mycobacterium tuberculosis H37Rv.

    PubMed Central

    Harshey, R M; Ramakrishnan, T

    1977-01-01

    Two methods were employed to measure the rate of ribonucleic acid (RNA) chain growth in vivo in Mycobacterium tuberculosis H37Rv cultures growing in Sauton medium at 37 degrees C, with a generation time of 10 h. In the first, the bacteria were allowed to assimilate [3H]uracil or [3H]guanine into their RNA for short time periods. The RNA was then extracted and hydrolyzed with alkali, and the radioactivity in the resulting nucleotides and nucleosides was measured. The data obtained by this method allowed the calculation of the individual nucleotide step times during the growth of RNA chains, from which the average rate of RNA chain elongation was estimated to be about 4 nucleotides per s. The second method employed the antibiotic rifampin, which specifically inhibits the initiation of RNA synthesis without interfering with the elongation and completion of nascent RNA chains. Usint this method, the transcription time of the 16S, 23S, and 5S ribosomal RNA genes was estimated to be 7.6 min, which corresponds to a ribosomal RNA chain growth rate of 10 nucleotides per s. PMID:402354

  2. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.

    1979-01-01

    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  3. Aggregates of Small Nuclear Ribonucleic Acids (snRNAs) in Alzheimer’s Disease’

    PubMed Central

    Hales, Chadwick M.; Dammer, Eric B.; Diner, Ian; Yi, Hong; Seyfried, Nicholas T.; Gearing, Marla; Glass, Jonathan D.; Montine, Thomas J.; Levey, Allan I.; Lah, James J.

    2014-01-01

    We recently discovered that protein components of the ribonucleic acid (RNA) spliceosome form cytoplasmic aggregates in Alzheimer’s disease (AD) brain, resulting in widespread changes in RNA splicing. However, the involvement of small nuclear RNAs (snRNAs), also key components of the spliceosome complex, in the pathology of AD remains unknown. Using immunohistochemical staining of post-mortem human brain and spinal cord, we identified cytoplasmic tangle-shaped aggregates of snRNA in both sporadic and familial AD cases but not in aged controls or other neurodegenerative disorders. Immunofluorescence using antibodies reactive with the 2,2,7-trimethylguanosine cap of snRNAs and transmission electron microscopy demonstrated snRNA localization with tau and paired helical filaments, the main component of neurofibrillary tangles. Quantitative real-time polymerase chain reaction (PCR) showed U1 snRNA accumulation in the insoluble fraction of AD brains whereas other U snRNAs were not enriched. In combination with our previous results, these findings demonstrate that aggregates of U1 snRNA and U1 small nuclear ribonucleoproteins represent a new pathological hallmark of AD. PMID:24571648

  4. Human immunodeficiency virus trans-activator of transcription peptide detection via ribonucleic acid aptamer on aminated diamond biosensor

    NASA Astrophysics Data System (ADS)

    Rahim Ruslinda, A.; Wang, Xianfen; Ishii, Yoko; Ishiyama, Yuichiro; Tanabe, Kyosuke; Kawarada, Hiroshi

    2011-09-01

    The potential of ribonucleic acid (RNA) as both informational and ligand binding molecule have opened a scenario in the development of biosensors. An aminated diamond-based RNA aptasensor is presented for human immunodeficiency virus (HIV) trans-activator of transcription (Tat) peptide protein detection that not only gives a labeled or label-free detection method but also provides a reusable platform for a simple, sensitive, and selective detection of proteins. The immobilized procedure was based on the binding interaction between positively charged amine terminated diamond and the RNA aptamer probe molecules with the negatively charged surface carboxylic compound linker molecule such as terephthalic acid.

  5. Acoustic cavitation-mediated delivery of small interfering ribonucleic acids with phase-shift nanoemulsions

    PubMed Central

    Burgess, Mark T.; Porter, Tyrone M.

    2015-01-01

    Localized, targeted delivery of small interfering ribonucleic acid (siRNA) has been the foremost hurdle in the use of siRNA for the treatment of various diseases. Major advances have been achieved in the synthesis of siRNA, which has led to greater target messenger RNA (mRNA) silencing and stability in physiological conditions. Although numerous delivery strategies have shown promise, there are still limited options for targeted delivery and release of siRNA administered systemically. In this in vitro study, phase-shift nanoemulsions (PSNE) were explored as cavitation nuclei to facilitate free siRNA delivery to cancer cells via sonoporation. A cell suspension containing varying amounts of PSNE and siRNA was exposed to 5 MHz pulsed ultrasound at fixed settings (6.2 MPa peak negative pressure, 5 cycle pulses, 250 Hz pulse repetition frequency, and total exposure duration of 100 seconds). Inertial cavitation emissions were detected throughout the exposure using a passive cavitation detector. Successful siRNA delivery was achieved (i.e. > 50% cell uptake) with high viability (> 80% viability). The percentage of cells with siRNA uptake was correlated with the amount of inertial cavitation activity generated from vaporized PSNE. The siRNA remained functional after delivery, significantly reducing expression of green fluorescent protein (GFP) in a stably transfected cell line. These results show that vaporized PSNE can facilitate siRNA entry into the cytosol of a majority of sonicated cells and may provide a non-endosomal route for siRNA delivery. PMID:25979417

  6. Antibacterial Action of Primaquine: Effects In Vitro on Polypeptide Synthesis and In Vivo on Ribosomes and Ribosomal Ribonucleic Acid

    PubMed Central

    Olenick, John G.

    1975-01-01

    Primaquine inhibited polyphenylalanine formation directed by poly(U) in a cell-free system obtained from Bacillus megaterium only when the drug was preincubated with transfer ribonucleic acid (tRNA), poly(U), or ribosomes. Considerably less inhibition was produced when the ionic strength of the preincubation mixture of tRNA or poly(U) plus primaquine was increased; with ribosomes, the extent of inhibition was only slightly reduced. In cultures of B. megaterium, primaquine induced the breakdown of ribosomes and their RNA. PMID:813574

  7. Oligonucleotide-conjugated thiazole orange probes as "light-up" probes for messenger ribonucleic acid molecules in living cells.

    PubMed

    Privat, E; Melvin, T; Asseline, U; Vigny, P

    2001-10-01

    "Light-up" probes, icosa-alpha-thymidylate-thiazole orange conjugates, for the in situ time-resolved detection of messenger ribonucleic acid (mRNA) in living cells are evaluated. Upon annealing with polyA in aqueous solutions, the icosa-alpha-thymidylate-thiazole orange conjugates were shown to be up to 15 times more fluorescent. Microinjection of these probes into adherent fibroblasts resulted in high yields of hybridization and fluorescent signals. Incubation of cells in the presence of these probes resulted in facile internalization of the probe and similar painting of the messenger RNA in the nuclear and cytosolic regions.

  8. Tn9 and IS1 inserts in a ribosomal ribonucleic acid operon of Escherichia coli are incompletely polar.

    PubMed Central

    Brewster, J M; Morgan, E A

    1981-01-01

    Transcription is known to be coupled to translation in many or all bacterial operons which code for proteins. In these operons, nonsense codons which prevent normal translation often result in premature termination of transcription (polarity). However, efficient transcription of ribosomal ribonucleic acid operons (rrn operons) occurs, although rrn transcripts are not translated. It therefore seemed possible that insertion sequences and transposable elements which are polar in protein-coding operons might not be polar in rrn operons. Previously, it has been shown (E. A. Morgan, Cell 21:257-265, 1980) that Tn10 is incompletely polar in the rrnX operon. Here we show that the transposon Tn9 and the insertion sequence IS1 also incompletely polar in rrnX. In normal cells expression of sequences distal to the insertions can be detected by genetic methods. In ultraviolet-irradiated cells expression of distal sequences is about 80% of that observed in uninterrupted rrnX operons. These observations provide evidence that ribonucleic acid polymerase molecules beginning at rrnX promoters can read through Tn9 and IS1 and that, at least in ultraviolet-irradiated cells, read-through is very efficient. Images PMID:6171559

  9. Studies of Nondefective Adenovirus 2-Simian Virus 40 Hybrid Viruses IV. Characterization of the Simian Virus 40 Ribonucleic Acid Species Induced by Wild-Type Simian Virus 40 and by the Nondefective Hybrid Virus, Ad2+ND1

    PubMed Central

    Oxman, Michael N.; Levine, Arthur S.; Crumpacker, Clyde S.; Levin, Myron J.; Henry, Patrick H.; Lewis, Andrew M.

    1971-01-01

    Ad2+ND1, a nondefective adenovirus 2 (Ad2)-simian virus 40 (SV40) hybrid virus, has been previously shown to contain a small segment of the SV40 genome covalently linked to Ad2 deoxyribonucleic acid (DNA). The SV40 portion of this hybrid virus has been characterized by relating the SV40-specific ribonucleic acid (RNA) sequences transcribed from the Ad2+ND1 DNA to those transcribed from the DNA of SV40 itself. RNA-DNA hybridization-competition studies indicate that the SV40 component of Ad2+ND1 consists of some, but not all, of that part of the SV40 genome which is transcribed early, i.e., prior to viral DNA replication, in SV40 lytic infection. PMID:4329969

  10. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  11. Evidence for messenger ribonucleic acid of an ammonium-inducible glutamate dehydrogenase and synthesis, covalent modification, and degradation of enzyme subunits in uninduced Chlorella sorokiniana cells.

    PubMed Central

    Turner, K J; Bascomb, N F; Lynch, J J; Molin, W T; Thurston, C F; Schmidt, R R

    1981-01-01

    The cells of Chlorella sorokiniana cultured in nitrate medium contain no detectable catalytic activity of an ammonium-inducible nicotinamide adenine dinucleotide phosphate-specific glutamate dehydrogenase (NADP-GDH). However, several lines of experimental evidence indicated that the NADP-GDH messenger ribonucleic acid was present at high levels and was being translated in uninduced cells. First, binding studies with 125I-labeled anti-NADP-GDH immunoglobulin G and total polysomes isolated from uninduced and induced cells showed that NADP-GDH subunits were being synthesized on polysomes from both types of cells. Second, when polyadenylic acid-containing ribonucleic acid was extracted from polysomes from uninduced and induced cells and placed into a messenger ribonucleic acid-dependent in vitro translation system, NADP-GDH subunits were synthesized from the ribonucleic acid from both sources. Third, when ammonia was added to uninduced cells, NADP-GDH antigen accumulated without an apparent induction lag. Fourth, by use of a specific immunoprecipitation procedure coupled to pulse-chase studies with [35S]sulfate, it was shown that the NADP-GDH subunits are rapidly synthesized, covalently modified, and then degraded in uninduced cells. PMID:7217012

  12. Deoxyribonucleic acid-dependent ribonucleic acid polymerase activity in rat liver after protein restriction.

    PubMed Central

    Andersson, G M; von der Decken, A

    1975-01-01

    Rats were fed for 6 days on a diet containing either 3 or 20% high-quality protein. Nuclei were isolated from liver and DNA-dependent RNA polymerases (EC 2.7.7.6) extracted with 1 M-(NH4)2SO4. The proteins were then precipitated with 3.5 M-(NH4)2SO4 and after dialysis applied to a DEAE-Sephadex column. The column was developed with a gradient of (NH4)2SO4. Polymerase I separated well from alpha-amanitin-sensitive polymerase II. The enzyme activities were compared between the two dietary groups. Rats that had received 3% protein showed a lower polymerase I activity per g wet wt. of liver, per mg of DNA and per mg of protein. Polymerase II was lower in activity per g wet wt. of liver and per mg of DNA, but was higher per mg of protein. Polyacrylamide-gel electrophoretograms showed a higher proportion of contaminating proteins in polymerase II fractions isolated from 20%-protein-fed rats. The data explain the lower activity obtained per mg of protein in these rats. It is concluded that a decrease in dietary protein content from 20 to 3% induces a fall in content and specific activity of RNA polymerase I and II in liver. PMID:1156400

  13. Incorporation of Mevalonic Acid into Ribosylzeatin in Tobacco Callus Ribonucleic Acid Preparations 1

    PubMed Central

    Murai, Norimoto; Armstrong, Donald J.; Skoog, Folke

    1975-01-01

    The incorporation of 14C-2-mevalonic acid into transfer RNA and ribosomal RNA (high molecular weight RNA) in rapidly growing, cytokinin-dependent tobacco (Nicotiana tabacum var. Wisconsin No. 38) callus cultures has been investigated. Approximately 40% of the label incorporated into transfer RNA was present in a ribonucleoside with chromatographic properties identical to those of cis-ribosylzeatin. The remainder of the label in the transfer RNA appears to be nonspecific incorporation resulting from degradation and metabolism of 14C-2-mevalonic acid by the tobacco callus tissue. Although the total radioactivity incorporated into ribosomal RNA was roughly the same as in transfer RNA, the specific radioactivity of the transfer RNA was about four times higher than that of the ribosomal RNA, and the ribosomal RNA labeling could be distinguished from the cytokinin labeling observed in transfer RNA. The distributions of the 14C-2-mevalonic acid label and cytokinin activity in tobacco callus transfer RNA fractionated by benzoylated diethylaminoethylcellulose chromatography indicate that at least two cytokinin-containing transfer RNA species are present in this tissue. PMID:16659180

  14. Effect of Infection with Ribonucleic Acid Bacteriophage R23 on the Inducible Synthesis of β-Galactosidase in Escherichia coli

    PubMed Central

    Watanabe, Hiroko; Watanabe, Mamoru

    1968-01-01

    Infection by ribonucleic acid (RNA) bacteriophage R23 inhibited the synthesis of β-galactosidase in Escherichia coli. The inhibition, although not complete, was apparent shortly after infection and was maximal after the first 20 min of infection. R23 diminished the β-galactosidase-synthesizing capacity when inducer was added after phage infection, but not when infection followed inducer removal. These findings suggested that the primary effect of R23 on enzyme-forming capacity was limitation of synthesis of enzyme-specific messenger RNA. Studies with ultraviolet irradiated phage and amber mutants of R23 indicated that the inhibitory process could be separated into two phases. Early inhibition did not require the expression of the viral genome, whereas late inhibition required the expression of the viral RNA synthetase cistron. PMID:4910818

  15. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  16. A versatile method for the removal of melanin from ribonucleic acids in melanocytic cells.

    PubMed

    Satyamoorthy, K; Li, G; Van Belle, P A; Elder, D E; Herlyn, M

    2002-10-01

    Melanin pigments often co-purify during preparation of nucleic acids from cells or tissues of melanocytic origin. Contaminating melanin can severely impede subsequent analyses of RNA. We attempted to eliminate melanin in RNA preparations using selected gel matrices. We show here that co-purified melanin pigments can be largely eliminated from RNA samples after passing through polyacrylamide-based beads (Bio-Gel P-60). After isolation from the pigment-containing cells or tissues, RNA was subsequently processed through batch or column purification under acidic pH conditions. The resulting RNA was devoid of contaminating melanin pigments and amenable to molecular reactions such as polymerase chain reaction and cDNA synthesis by reverse transcriptase. Although the process results in some loss of input RNA, this purification procedure is simple, robust and can easily be adopted in any laboratory for the molecular analysis of RNA that requires removal of melanin contamination.

  17. Growth hormone and drug metabolism. Acute effects on nuclear ribonucleic acid polymerase activity and chromatin.

    PubMed Central

    Spelsberg, T C; Wilson, J T

    1976-01-01

    Adult male rats, subjected either to sham operation or to hypophysectomy and adrenalectomy were maintained for 10 days before treatment with growth hormone. Results of the acute effects of growth hormone on the rat liver nuclear RNA polymerase I (nucleolar) and II (nucleoplasmic) activities as well as the chromatin template capacity were then studied and compared with the growth-hormone effects on the drug metabolism described in the preceding paper (Wilson & Spelsberg, 1976). 2. Conditions for isolation and storage of nuclei for maintenance of optimal polymerase activities are described. It is verified that the assays for polymerase activities require a DNA template, all four nucleoside triphosphates, and a bivalent cation, and that the acid-insoluble radioactive product represents RNA. Proof is presented that under high-salt conditions DNA-like RNA (polymerase II) is synthesized, and that under low-salt conditions in the presence of alpha-amanitin, rRNA (polymerase I) is synthesized. 3. In the livers of hypophysectomized/adrenalectomized rats, growth hormone increases the activity of both RNA polymerase enzymes and the chromatin template capacity within 1h after treatment. The effects last for 12h in the case of polymerase II but for only 6h in the case of polymerase I. Sham-operated rats respond to growth hormone in a manner somewhat similar to that shown by hypophysectomized/adrenalectomized rats. These results, which demonstrate an enhancement of RNA polymerase I activity in response to growth hormone, support those from other laboratories. 4. Growth-hormone enhancement of the chromatin template capacity in the liver of hypophysectomized/adrenalectomized rats contrasts with previous reports. The growth-hormone-induced de-repression of the chromatin DNA could represent the basis of the growth-hormone-induced enhancement of RNA polymerase II activity in the hypophysectomized/adrenalectomized rats, although some effect of growth-hormone on the polymerase enzymes

  18. Label-free serum ribonucleic acid analysis for colorectal cancer detection by surface-enhanced Raman spectroscopy and multivariate analysis

    NASA Astrophysics Data System (ADS)

    Chen, Yanping; Chen, Gang; Feng, Shangyuan; Pan, Jianji; Zheng, Xiongwei; Su, Ying; Chen, Yan; Huang, Zufang; Lin, Xiaoqian; Lan, Fenghua; Chen, Rong; Zeng, Haishan

    2012-06-01

    Studies with circulating ribonucleic acid (RNA) not only provide new targets for cancer detection, but also open up the possibility of noninvasive gene expression profiling for cancer. In this paper, we developed a surface-enhanced Raman scattering (SERS), platform for detection and differentiation of serum RNAs of colorectal cancer. A novel three-dimensional (3-D), Ag nanofilm formed by dry MgSO4 aggregated silver nanoparticles, Ag NP, as the SERS-active substrate was presented to effectively enhance the RNA Raman signals. SERS measurements were performed on two groups of serum RNA samples. One group from patients, n=55 with pathologically diagnosed colorectal cancer and the other group from healthy controls, n=45. Tentative assignments of the Raman bands in the normalized SERS spectra demonstrated that there are differential expressions of cancer-related RNAs between the two groups. Linear discriminate analysis, based on principal component analysis, generated features can differentiate the colorectal cancer SERS spectra from normal SERS spectra with sensitivity of 89.1 percent and specificity of 95.6 percent. This exploratory study demonstrated great potential for developing serum RNA SERS analysis into a useful clinical tool for label-free, noninvasive screening and detection of colorectal cancers.

  19. Gradient enhanced-fluidity liquid hydrophilic interaction chromatography of ribonucleic acid nucleosides and nucleotides: A "green" technique.

    PubMed

    Beilke, Michael C; Beres, Martin J; Olesik, Susan V

    2016-03-01

    A "green" hydrophilic interaction liquid chromatography (HILIC) technique for separating the components of mixtures with a broad range of polarities is illustrated using enhanced-fluidity liquid mobile phases. Enhanced-fluidity liquid chromatography (EFLC) involves the addition of liquid CO2 to conventional liquid mobile phases. Decreased mobile phase viscosity and increased analyte diffusivity results when a liquefied gas is dissolved in common liquid mobile phases. The impact of CO2 addition to a methanol:water (MeOH:H2O) mobile phase was studied to optimize HILIC gradient conditions. For the first time a fast separation of 16 ribonucleic acid (RNA) nucleosides/nucleotides was achieved (16min) with greater than 1.3 resolution for all analyte pairs. By using a gradient, the analysis time was reduced by over 100% compared to similar separations conducted under isocratic conditions. The optimal separation using MeOH:H2O:CO2 mobile phases was compared to MeOH:H2O and acetonitrile:water (ACN:H2O) mobile phases. Based on chromatographic performance parameters (efficiency, resolution and speed of analysis) and an assessment of the environmental impact of the mobile phase mixtures, MeOH:H2O:CO2 mixtures are preferred over ACN:H2O or MeOH:H2O mobile phases for the separation of mixtures of RNA nucleosides and nucleotides.

  20. Regulation of Synthesis of the Branched-Chain Amino Acids and Cognate Aminoacyl-Transfer Ribonucleic Acid Synthetases of Escherichia coli: a Common Regulatory Element

    PubMed Central

    Jackson, Julius; Williams, L. S.; Umbarger, H. E.

    1974-01-01

    Regulation of isoleucine, valine, and leucine biosynthesis and isoleucyl-, valyl-, and leucyl-transfer ribonucleic acid (tRNA) synthetase formation was examined in two mutant strains of Escherichia coli. One mutant was selected for growth resistance to the isoleucine analogue, ketomycin, and the other was selected for growth resistance to both trifluoroleucine and valine. Control of the synthesis of the branched-chain amino acids by repression was altered in both of these mutants. They also exhibited altered control of formation of isoleucyl-tRNA synthetase (EC 6.1.15, isoleucine:sRNA ligase, AMP), valyl-tRNA synthetase (EC 6.1.1.9, valine:sRNA ligase, AMP), and leucyl-tRNA synthetase (EC 6.1.1.4, leucine:sRNA ligase, AMP). These results suggest the existence of a common element for the control of these two classes of enzymes in Escherichia coli. PMID:4612020

  1. Polyuridylic Acid-directed Phenylalanine Incorporation in Minicell Extracts

    PubMed Central

    Fralick, J. A.; Fisher, W. D.; Adler, H. I.

    1969-01-01

    Cell-free extracts of miniature Escherichia coli cells deficient in deoxyribonucleic acid (DNA) and DNA-dependent ribonucleic acid polymerase have been shown to be capable of polyuridylic acid-directed [14C]phenylalanine incorporation. PMID:4897117

  2. Prolactin messenger ribonucleic acid levels, prolactin synthesis, and radioimmunoassayable prolactin during the estrous cycle in the Golden Syrian hamster

    SciTech Connect

    Massa, J.S. ); Blask, D.E. )

    1990-01-01

    The purpose of this study was to observe the molecular dynamics of pituitary prolactin (PRL) gene expression during the estrous cycle of the Golden Syrian hamster. PRL messenger ribonucleic acid (mRNA) levels, PRL synthesis were measured in the morning on each day of the cycle. We observed that all of these PRL indices declined or did not change from Day 2 to Day 3 of the cycle. From Day 3 to Day 4 however, PRL mRNA levels increased 33-38% and media {sup 3}H-PRL increased 32-42%, while there were no significant changes in pituitary {sup 3}H-PRL, or RIA-PRL in the media or pituitary. From Day 4 to Day 1 (estrus) there was reciprocal change in the levels of {sup 3}H-PRL in the pituitary vs. the media, with the former increasing 37-50% and the latter decreasing 25-32%. Pituitary RIA-PRL did also increased 45-64% from Day 4 to Day 1 while media RIA-PRL did not change. These data are consistent with the following hypothesis: On the morning of proestrus(Day 4) in the hamster, PRL mRNA levels are elevated compared to those on Day 3, signaling an increase in PRL synthesis. This newly synthesized PRL is shunted into a readily releasable pool on the morning of Day 4 (contributing to the afternoon surge of serum PRL), and into a preferentially stored pool by the morning of Day 1.

  3. Short hairpin ribonucleic acid constructs targeting insulin-like growth factor binding protein-3 rehabilitated dyslipidaemia in diabetic rats.

    PubMed

    Zhou, Z-Y; Cheng, S-P; Huang, H; Wang, J; Pan, H; Liu, C-M; Xing, C; Sun, Y-L; Liu, R-H; Zhong, G-J

    2016-02-01

    It was investigated whether short hairpin ribonucleic acid constructs targeting insulin-like growth factor binding protein-3 (IGFBP-3 shRNA) can rehabilitate dyslipidaemia in streptozotocin-induced diabetic rats. After 12 weeks of intracavernous administration of IGFBP-3 shRNA, intracavernous pressure responses to electrical stimulation of cavernous nerves were evaluated. The concentrations of serum low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, triglyceride and cavernous cyclic guanosine monophosphate were all detected by enzyme-linked immunosorbent assay. The per cent of smooth muscle in corpus cavernous tissue was also evaluated. It was found that the cavernosal pressure was significantly increased in the IGFBP-3 shRNA treatment group compared to the diabetic control group after 12 weeks of intracavernous administration of IGFBP-3 shRNA (P < 0.01). The concentrations of serum low-density lipoprotein cholesterol and triglyceride were significantly decreased in the IGFBP-3 shRNA treatment group compared to the diabetic control group, while no significant changes of serum high-density lipoprotein cholesterol concentration were found (P < 0.01). At the same time, cavernous cyclic guanosine monophosphate concentrations and the percentage of cavernosal smooth muscle were both significantly increased in the IGFBP-3 shRNA treatment group compared to the diabetic control group (P < 0.01). This study indicated that IGFBP-3 shRNA might rehabilitate erectile function via a decrease in concentrations of serum low-density lipoprotein and triglyceride, an increase in the percentage of cavernosal smooth muscle and an improvement in the nitric oxide-cyclic guanosine monophosphate signalling activities in streptozotocin-induced diabetic rats.

  4. Transfer ribonucleic acid synthesis during sporulation and spore outgrowth in Bacillus subtilis studied by two-dimensional polyacrylamide gel electrophoresis.

    PubMed Central

    Henner, D J; Steinberg, W

    1979-01-01

    The synthesis of transfer ribonucleic acid (tRNA) was examined during spore formation and spore outgrowth in Bacillus subtilis by two-dimensional polyacrylamide gel electrophoresis of in vivo 32P-labeled RNA. The two-dimensional gel system separated the B. subtilis tRNA's into 32 well-resolved spots, with the relative abundances ranging from 0.9 to 17% of the total. There were several spots (five to six) resolved which were not quantitated due to their low abundance. All of the tRNA species resolved by this gel system were synthesized at every stage examined, including vegetative growth, different stages of sporulation, and different stages of outgrowth. Quantitation of the separated tRNA's showed that in general the tRNA species were present in approximately the same relative abundances at the different developmental periods. tRNA turnover and compartmentation occurring during sporulation were examined by labeling during vegetative growth followed by the addition of excess phosphate to block further 32P incorporation. The two-dimensional gels of these samples showed the same tRNA's seen during vegetative growth, and they were in approximately the same relative abundances, indicating minimal differences in the rates of turnover of individual tRNA's. Vegetatively labeled samples, chased with excess phosphate into mature spores, also showed all of the tRNA species seen during vegetative growth, but an additional five to six minor spots were also observed. These are hypothesized to arise from the loss of 3'-terminal residues from preexisting tRNA's. Images PMID:115846

  5. Heterogeneity of the 5' terminus of hen ovalbumin messenger ribonucleic acid.

    PubMed Central

    Malek, L T; Eschenfeldt, W H; Munns, T W; Rhoads, R E

    1981-01-01

    The 5'-terminal sequence of hen ovalbumin mRNA was investigated using a novel labeling method. Ovalbumin mRNA was purified by hybridization to complementary DNA coupled to cellulose. The mRNA thus purified was shown to be 97.9% pure by hybridization with plasmid DNA containing sequences to the messengers coding for conalbumin and ovomucoid, the next two most abundant messengers of oviduct. After digestion with RNase T1 and alkaline phosphatase, 5'-terminal capped oligonucleotides were selected by binding to anti-m7G-Sepharose. These were then labeled using RNA ligase and [5'-32P]pCp, separated by two-dimensional gel electrophoresis, and sequenced by partial digestion with base-specific ribonucleases. A nested set of three capped oligonucleotides was identified. Their structures and relative abundances were m7GpppAUACAG, 3% m7GpppACAUACAG, 61+; and m7GpppGUACAUACAG, 36%. Images PMID:6785728

  6. Taxonomy of the Clostridia: ribosomal ribonucleic acid homologies among the species.

    PubMed

    Johnson, J L; Francis, B S

    1975-06-01

    rRNA homologies have been determined on reference strains representing 56 species of Clostridium. Competition experiments using tritium-labelled 23S rRNA were employed. The majority of the species had DNA with 27 to 28% guanine plus cytosine (%GC). These fell into rRNA homology groups I and II, which were well defined, and a third group which consisted of species which did not belong in groups I and II. Species whose DNA was 41 to 45% GC comprised a fourth group. Thirty species were placed into rRNA homology group I on the basis of having 50% or greater homology with Clostridium butyricum, C. perfringens, C. carnis, C. sporogenes, C. novyi or C. pasteurianum. Ten subgroups were delineated in homology group I. Species in each subgroup either had high homology with a particular reference species or a similar pattern of homologies to all of the reference organisms. The eleven species in rRNA homology group II had 69% or greater homology to C. lituseburense. Species in groups I and II had intergroup homologies of 20 to 40%. The six species in group II had very low homologies with groups I and II. Negligible homology also resulted when five of the species were tested against the sixth, C. ramosum. The five species having DNA with 41 to 45% GC were C. innocuum, C. sphenoides, C. indolis, C. barkeri and C. orotic um. Little rRNA homology was apparent between C. innocuum and the other high % GC species or with several Bacillus species having similar %GC DNA. Correlations between homology results and phenotypic characteristics are discussed.

  7. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  8. Determination of /sup 35/S-aminoacyl-transfer ribonucleic acid specific radioactivity in small tissue samples

    SciTech Connect

    Samarel, A.M.; Ogunro, E.A.; Ferguson, A.G.; Lesch, M.

    1981-11-15

    Rate determination of protein synthesis utilizing tracer amino acid incorporation requires accurate assessment of the specific radioactivity of the labeled precursor aminoacyl-tRNA pool. Previously published methods presumably useful for the measurement of any aminoacyl-tRNA were unsuccessful when applied to (/sup 35/S)methionine, due to the unique chemical properties of this amino acid. Herein we describe modifications of these methods necessary for the measurement of /sup 35/S-aminoacyl-tRNA specific radioactivity from small tissue samples incubated in the presence of (/sup 35/S)methionine. The use of (/sup 35/S)methionine of high specific radioactivity enables analysis of the methionyl-tRNA from less than 100 mg of tissue. Conditions for optimal recovery of /sup 35/S-labeled dansyl-amino acid derivatives are presented and possible applications of this method are discussed.

  9. Separation and Partial Characterization of Two Ribonucleic Acid Polymerases from Pea Seedlings 1

    PubMed Central

    Glicklich, Daniel; Jendrisak, Jerome J.; Becker, Wayne M.

    1974-01-01

    Two DNA-dependent RNA polymerases (ribonucleoside triphosphate:RNA nucleotidyl transferase, EC 2.7.7.6) have been isolated from pea (Pisum sativum) seedlings. The enzymes were solubilized by sonication in high salt buffer and were separated by chromatography on diethylaminoethyl cellulose using a linear salt gradient. Polymerase I eluted at 0.10 m (NH4)2SO4, accounted for about 10% of the recovered activity and was completely insensitive to α-amanitin. Polymerase II eluted at 0.14 m (NH4)2SO4, accounted for the remaining 90% of recovered activity and was strongly inhibited by α-amanitin. Both enzymes preferred denatured to native DNA as template, both showed an absolute requirement of divalent cation, and both were sensitive to the ionic strength of the assay medium. The developing pea seedling seems a promising system for studies of possible changes in relative activities and roles of multiple RNA polymerases during eukaryotic development. PMID:16658887

  10. Polyacrylamide gel analysis of high molecular weight ribonucleic Acid from etiolated and green cucumber cotyledons.

    PubMed

    Vedel, F; D'Aoust, M J

    1970-07-01

    Cucumis sativus L. seeds and 5-day-old dark-grown cotyledons contain 25 and 18 S cytoplasmic ribosomal RNAs as main components. The major increase in nucleic acid content in both green and etiolated cotyledons occurs between days 5 and 7 of germination. This increase is characterized by an important synthesis of 23 and 16 S plastid (chloroplast and proplastid) ribosomal RNAs. Proplastid RNA synthesis appears to continue for a longer period in the dark-grown cotyledons, despite a total RNA content considerably less than in the light-grown cotyledons.The nonribosomal distribution of the chloroplast and proplastid ribosomal RNAs observed in all cases (after extraction and fractionation) results from the lability of the 23 S component. This degradation increases if the chloroplasts and proplastids are isolated prior to extraction of their nucleic acid.

  11. Affinity chromatography of aminoacyl-transfer ribonucleic acid synthetases. Small organic ligands.

    PubMed Central

    Clarke, C M; Knowles, J R

    1977-01-01

    The usefulness of affinity chromatography for the purification of aminoacyl-tRNA synthetases was explored by using column ligands derived from the corresponding amino acid and aminoalkyladenylate, a non-labile analogue of the aminoacyladenylate reaction intermediate. Four modes of attachment of the aminoalkyladenylate to Sepharose were studied. The interaction between amino acid derivatives and the corresponding aminoacyl-tRNA synthetases is too weak to allow their use as ligands for affinity chromatography. Attachment of the aminoalkyladenylate via the alpha-nitrogen atom of the amino acid or via C-8 of the nucleotide abolishes synthetase binding, and immobilization via the oxidized ribose ring is only marginally useful. However, attachment of the aminoalkyladenylate to the matrix via N-6 of the nucleotide allows strong and specific synthetase binding, and the use of such columns permits the isolation of homogeneous synthetase from crude mixtures. The effect of non-specific adsorption and the utility of pre-columns and of specific substrate elution are investigated and discussed. Images Fig. 4. Fig. 7. PMID:597251

  12. Purification and subunit analysis of wheat-germ ribonucleic acid polymerase II

    PubMed Central

    Jendrisak, Jerome J.; Becker, Wayne M.

    1974-01-01

    A procedure is described for the purification of the α-amanitin-sensitive DNA-dependent RNA polymerase [EC 2.7.7.6] from wheat germ. Solubilization of the enzyme activity was achieved by sonication of a crude extract in a high-salt buffer. Purification involved precipitation with protamine sulphate and (NH4)2SO4, chromatography on DEAE-cellulose and phosphocellulose, and sucrose gradient centrifugation. Under denaturing conditions the enzyme dissociated into five polypeptides with molecular weights and molar ratios of 220000 (0.9), 170000 (0.1), 140000 (1.0), 45000 (0.2), and 40000 (0.4). Approx. 1mg of purified RNA polymerase was obtained as a routine from 100g of starting material. ImagesPLATE 1PLATE 2 PMID:4853970

  13. Sub-unit structure and specificity of methionyl-transfer-ribonucleic acid synthetase from Escherichia coli

    PubMed Central

    Bruton, C. J.; Hartley, B. S.

    1968-01-01

    1. The purification of methionyl-transfer-RNA synthetase from Escherichia coli by a modified technique gives a 16% yield of a protein that appears homogeneous by the criteria of disc gel electrophoresis, ultracentrifugation and end-group analysis. 2. The molecular weight is 96000 and the protein consists of two sub-units of 48000, which appear to be identical. The amino acid composition and thiol content are reported. 3. Kinetic data are reported for analogues of methionine and for pure t-RNAF and t-RNAM, which are respectively the methionine transfer RNA that can exist in the formylmethionyl form and the one that can exist only in the methionyl form. The enzyme binds and acylates both species of transfer RNA identically. PMID:4874971

  14. Polymeric Cryogel-Based Boronate Affinity Chromatography for Separation of Ribonucleic Acid from Bacterial Extracts.

    PubMed

    Shakya, Akhilesh Kumar; Srivastava, Akshay; Kumar, Ashok

    2015-01-01

    Three-dimensional monolithic columns are preferred stationary phase in column chromatography. Conventional columns based on silica or particles are efficient in bioseparation though associated with limitations of nonspecific interaction and uneven porosity that causes high mass transfer resistance for the movement of big molecules. Cryogels as a monolith column have shown promising application in bioseparation. Cryogels column can be synthesized in the form of a monolith at sub-zero temperature through gelation of pre-synthesized polymers or polymerization of monomers. Cryogels are macroporous and mechanically stable materials. They have open interconnected micron-sized pores with a wide range of porosity (10-200 μm). Current protocol demonstrated the ability of poly(hydroxymethyl methacrylate)-co-vinylphenyl boronic acid p(HEMA-co-VPBA) cryogel matrix for selective separation of RNA from the bacterial crude extract. PMID:26623972

  15. Stability of polyadenylic and polyadenylated ribonucleic acids in radish (Raphanus sativus) seedlings.

    PubMed

    Aspart, L; Cooke, R; Delseny, M

    1979-08-29

    The stability of polyadenylic acid and polyadenylated RNA was investigated in young radish (Raphanus sativus) seedlings. We first studied the decay of poly(A) content, using a [3H]poly(U) assay, following a complete block of transcription by cordycepin (200 microgram/ml). Two lifetime classes of polyadenylic acid have been determined in these seedlings: a short-lived component with a half-life of 30 min which represents 60% of poly(A) and a more stable component with varying half-lives of which the majority range from 4-10 h and a few are considerably longer. During this period rRNA was shown to decay linearly, taking about 41 h for half of this RNA to disappear. The life-time of the other moiety of polyadenylated-RNA was analysed by continuous labelling with [3H]uridine. We have been able to demonstrate that a significant part of the mRNA molecules turns over with a half-life similar to that of the more slowly turning-over poly(A). No evidence could be obtained for rapidly turning-over messenger RNA. Thus the rapidly turning over poly(A) could correspond to a poly(A) turn-over independent of the remainder of the sequence. When labelling was very long, an apparent steady-state was reached and we determined the polyadenylated RNA content of seedlings to be 2.2% of whole cell RNA. Finally, these results were compared with those previously obtained in studying early germination of radish embryo axes. In contrast with stored mRNA which is rapidly degraded following imbibition, part of the mRNA present in 22 h old seedlings is stable for several hours.

  16. Studies on independent synthesis of cytoplasmic ribonucleic acids in Acetabularia mediterranea.

    PubMed

    NAORA, H; BRACHET, J

    1960-07-01

    1. The RNA content of anucleate and nucleate fragments of Acetabularia has been measured. It was found that there is a net synthesis of RNA in nucleate fragments. On the other hand, the RNA content of anucleate fragments did not change significantly after enucleation. 2. Anucleate fragments, however, can readily incorporate (14)C-labeled adenine, orotic acid, and carbon dioxide into their cytoplasmic RNA. 3. The results of experiments on (14)CO(2) incorporation into the RNA of anucleate and nucleate fragments suggest that there is a mechanism for de novo synthesis of RNA in anucleate cytoplasm. 4. In Acetabularia, 81 per cent of the cytoplasmic RNA is bound to a large granule fraction, consisting mainly of chloroplasts. Even after removal of the nucleus, RNA is synthesized in this "chloroplast" fraction. The chloroplasts are thus a major site of RNA synthesis in the cytoplasm of these algae. Synthesis of "chloroplastic" RNA, in anucleate fragments, possibly occurs at the expense of the RNA present in other fractions (microsomes and supernatant). 5. 8-Azaguanine stimulates regeneration and cap formation in anucleate fragments and does not inhibit RNA synthesis in these fragments.

  17. Accumulation of methyl-deficient rat liver messenger ribonucleic acid on ethionine administration

    SciTech Connect

    Goswami, B.B.; Sharma, O.K.

    1980-01-01

    Highly purified poly(adenylic acid)-containing RNA isolated from livers of rats fed 0.25% DL-etionine in the diet for 7 days accepted methyl groups from S-adenosyl(methyl-/sup 3/H)methionine, when incubated in vitro with mRNA methyltransferases from vaccinia virus or Ehrlich ascites cells, whereas RNA from control rats had no such activity. Nuclease digestion followed by chromatographic analyses of mRNA methylated in vitro revealed that the methyl groups were incorporated at the 5' end into cap 1 structures (m/sup 7/GpppNmp...) by the viral enzyme, whereas both cap 0 (m/sup 7/GpppNp...) and cap 1 (m/sup 7/Gpppm/sup 6/Am...) structures were formed by the Ehrlich ascites cell enzymes. the methyl-deficient mRNA isolated from the liver of ethionine-fed rats differed in its translational properties from mRNA isolated from control animals in an in vitro protein synthesizing system from wheat germ.

  18. Evidence for defective transfer ribonucleic acid in polymyopathic hamsters and its inhibitory effect on protein synthesis

    PubMed Central

    Bester, André J.; Gevers, Wieland

    1973-01-01

    1. Different reaction steps involved in protein synthesis were studied in skeletal muscles from control and myopathic hamsters. 2. There was no difference between partially purified aminoacyl-tRNA synthetases from myopathic and control animals in yield or catalytic activity, as tested with exogenous deacylated tRNA. 3. However, isolated deacylated tRNA from myopathic muscle was aminoacylated by these synthetases to a lesser extent than that derived from control muscle. 4. Addition of deacylated tRNA isolated from control muscle improved the performance of pH5 enzymes from myopathic muscle in polypeptide synthesis on homologous polyribosomes; tRNA isolated from myopathic animals did not. 5. Preparation of extracts from both types of animals in the presence of the ribonuclease-absorbent bentonite led to an increased capacity of endogenous tRNA to accept amino acids in pH5 enzymes prepared from normal and abnormal tissue, but the difference between the two systems remained the same. 6. Total tRNA nucleotidyltransferase activity, tested with twice-pyrophosphorolysed rat liver tRNA, was identical in both extracts. 7. Added tRNA nucleotidyltransferase incorporated more AMP and CMP into endogenous tRNA with the pH5 enzyme from myopathic muscle than with that from control muscle. 8. Preincubation of deacylated tRNA from myopathic muscle with ATP, CTP and tRNA nucleotidyltransferase more than doubled its subsequent aminoacyl-acceptor activity, and halved the extent of the defect relative to aminoacylation of control tRNA similarly treated. Endogenous tRNA in pH5 enzyme preparations behaved likewise. 9. It is suggested that a 3′-exonuclease in myopathic muscles attacks tRNA molecules in such a way that some of them remain substrates for tRNA nucleotidyltransferase, which may incorporate into RNA not only AMP and CMP, but also GMP. 10. Cell-free protein synthesis in preparations from myopathic hamster muscles is limited by the supply of intact tRNA molecules. PMID:4725037

  19. THE RELATION BETWEEN THE INTRACELLULAR RIBONUCLEIC ACID DISTRIBUTION AND AMINO ACID INCORPORATION IN THE LIVER OF THE DEVELOPING CHICK EMBRYO

    PubMed Central

    Duck-Chong, Coral; Pollak, J. K.; North, R. J.

    1964-01-01

    The RNA-P and DNA-P content of the nucleus and the RNA-P content of the whole cell of the livers of 8- to 20-day chick embryos and of adult fowls have been determined. The DNA-P content of the liver nuclei was slightly higher in the 8- and 10-day embryo than in all the other stages examined. A significant decrease in the RNA content of the cell occurred during embryonic development. The RNA content of the adult cell was the same as that of the 14- to 16-day embryo. The proportion of the cellular RNA contributed by the nucleus also decreased during development. In respect to both nuclear RNA content and distribution of RNA between nucleus and cytoplasm, the adult resembled the 8- to 12-day embryo. Examination of the fine structure of the cell showed that, as development progressed, free ribosomes decreased in number and the rough membranes increased. Slices of 8-, 14-, and 20-day embryonic livers and of adult livers were incubated with 14C-leucine, and the amount of labeled amino acid incorporated into whole tissue protein and into the proteins of the subcellular fractions was measured. Embryonic liver incorporated 14C-leucine 15 to 30 times more rapidly than adult liver. The microsomal protein was always more highly labelled than the protein in any other subcellular fraction; however, in the 8-day embryonic and the adult liver the proportion of total counts found in the nuclear fraction was considerably higher than in the 14- or 20-day embryonic liver. The significance of an apparent correlation between the proportion of the cell's RNA contributed by the nucleus and the proportion of total counts in the nuclear fraction is discussed. PMID:14105214

  20. Bone marrow mononuclear cells from patients with Paget's disease contain measles virus nucleocapsid messenger ribonucleic acid that has mutations in a specific region of the sequence.

    PubMed

    Reddy, S V; Singer, F R; Roodman, G D

    1995-07-01

    Ultrastructural, immunocytochemical, and in situ hybridization studies have suggested that paramyxoviruses, such as measles virus (MV), are present in Pagetic osteoclasts and may contribute to the abnormality in osteoclast function. However, little additional information is known about potential viruses present in Pagetic osteoclasts. As there are increased numbers of osteoclast precursors among the marrow mononuclear cells of Paget's patients, we used the reverse transcriptase-polymerase chain reaction to amplify the nucleocapsid sequence of MV from freshly isolated bone marrow-derived mononuclear cells to examine the potential role of these viruses in cells in the osteoclast lineage. We detected MV nucleocapsid transcripts in 5 of 6 individual Paget's patients' marrow samples. MV transcripts were not detected in marrow samples from 10 normal subjects. Sequence analysis of the PCR products revealed that 1 patient had the same sequence as the Edmonston strain of MV. The remaining 4 patients had point mutations clustered between position 1360-1371 base pairs. Two of the patients exhibited identical mutations at this region. In total, 3 different point mutations were identified that resulted in amino acid substitutions. These data show that 1) unlike those from normal subjects, marrow mononuclear cells from Paget's patients express MV nucleocapsid messenger ribonucleic acid; and 2) mutations of a specific region of the MV nucleocapsid gene were present in 4 of 5 patients and suggest a persistent MV infection in Pagetic osteoclast precursors. These data further suggest that osteoclasts are infected by fusion with infected precursors.

  1. Encapsulation of ribonucleic acid in human red blood cells for use as a reticulocyte quality control material for flow cytometric analysis.

    PubMed

    Ebrahim, A; Ryan, W L

    1996-10-01

    The osmotic lysis procedure was employed to encapsulate ribonucleic acid (RNA) in human red blood cells in order to prepare a reticulocyte reference control. The procedure required the hypotonic dialysis of erythrocytes in the presence of RNA and cytosolic components of red blood cells followed by a short hypertonic dialysis to restore isotonicity and reseal the pores formed on the cell membrane during the hypotonic swelling. The procedure was monitored by a dedicated flow cytometer for reticulocyte counting and required 120 min. Approximately 20% of the erythrocytes undergoing the reversible osmotic lysis were encapsulated with various amounts of RNA. The morphology of the RNA-loaded erythrocytes were similar to those of normal erythrocytes and reticulocytes, however, their mean cell volume (MCV) was slightly smaller than normal cells. RNA-loaded erythrocytes prepared by this method were stable for several months as a reference control for identification and enumeration of reticulocytes using flow cytometric as well as manual analysis methods and resulted in a high correlation coefficient between these counting techniques. PMID:8891445

  2. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA)

    PubMed Central

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S.; Harlow, Mark L.

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5′ ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  3. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

    PubMed

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.

  4. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

    PubMed

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  5. Mengovirus Replication in Novikoff Rat Hepatoma and Mouse L Cells: Effects on Synthesis of Host-Cell Macromolecules and Virus-specific Synthesis of Ribonucleic Acid

    PubMed Central

    Plagemann, Peter G. W.

    1968-01-01

    Novikoff cells (strain N1S1-67) and L-67 cells, a nutritional mutant of the common strain of mouse L cells which grows in the same medium as N1S1-67 cells, were infected with mengovirus under identical experimental conditions. The synthesis of host-cell ribonucleic acid (RNA) by either type of cell was not affected quantitatively or qualitatively until about 2 hr after infection, when viral RNA synthesis rapidly displaced the synthesis of cellular RNA. The rate of synthesis of protein by both types of cells continued at the same rate as in uninfected cells until about 3 hr after infection, and a disintegration of polyribosomes occurred only towards the end of the replicative cycle, between 5 and 6 hr. The time courses and extent of synthesis of single-stranded and double-stranded viral RNA and of the production of virus were very similar in both types of cells, in spite of the fact that the normal rate of RNA synthesis and the growth rate of uninfected N1S1-67 cells are about three times greater than those of L-67 cells. In both cells, the commencement of viral RNA synthesis coincided with the induction of viral RNA polymerase, as measured in cell-free extracts. Viral RNA polymerase activity disappeared from infected L-67 cells during the period of production of mature virus, but there was a secondary increase in activity in both types of cells coincidental with virus-induced disintegration of the host cells. Infected L-67 cells, however, disintegrated and released progeny virus much more slowly than N1S1-67 cells. The two strains of cells also differed in that replication of the same strain of mengovirus was markedly inhibited by treating N1S1-67 cells with actinomycin D prior to infection; the same treatment did not affect replication in L-67 cells. PMID:4176992

  6. Physicochemical properties and interactions of Escherichia coli ribonucleic acid polymerase holoenzyme, core enzyme, subunits, and subassembly alpha 2 beta.

    PubMed

    Levine, B J; Orphanos, P D; Fischmann, B S; Beychok, S

    1980-10-14

    We have investigated several physicochemical properties of Escherichia coli DNA-dependent RNa polymerase, its constituent subunits alpha, beta, beta', and sigma, and the subassembly alpha 2 beta. These included ultraviolet (UV) absorption, isoelectric points, sulfhydryl content, extinction coefficients, and circular dichroism (CD). Among the most notable results is the observation, based on CD measurements, that the sigma subunit, free and combined in holoenzyme, is a highly structured protein with approximately 75% of its residues folded in alpha-helical conformation and little or no detectable beta sheet. No secondary structure changes in either sigma or core accompany formation of holoenzyme. In contrast to the conformational independence of the subunits in assembly of holoenzyme, the protein and its components exhibit conformational flexibility as glycerol concentration is varied and in their interaction with DNA. The effect of glycerol on the conformation of sigma, core, and holoenzyme was monitored by circular dichroism measurements. In the far-ultraviolet, the residue ellipticity at 220 nm ([theta]220) increased approximately 15% from 0 to 10% glycerol for both core and holoenzyme. In the near-ultraviolet, the residue ellipticity at a peak near 280 nm also varied with glycerol concentration, decreasing in intensity by about 50% with holoenzyme, when glycerol was raised from 5 to 10%, then increasing at still higher glycerol contents. Electrophoretic and molecular sieve anaysis showed core and sigma to have greater affinity for each other in 50% glycerol than in 10% glycerol. The presence of 10% glycerol in the assay buffer increased the activity of the enzyme. The effect of various DNA templates on the conformations of core, holoenzyme, alpha 2 beta subassembly, and beta' subunit was also monitored by far-ultraviolet circular dichroism. All the protein samples showed between 10 and 20% decrease in secondary structure upon the addition of the DNA. PMID

  7. Influence of nucleotides, cations and nucleoside triphosphatase inhibitors on the release of ribonucleic acid from isolated rat liver nuclei.

    PubMed Central

    Agutter, P S

    1980-01-01

    The reasons underlying reported discrepancies in the effects of ATP, ADP, adenosine 5'-[beta gamma-methylene]triphosphate, AMP + PPi, P-chloromercuribenzoate and F- on RNA efflux from isolated rat liver nuclei and on nuclear envelope nucleoside triphosphatase activity were investigated. The stimulatory effect of ADP was attributed to myokinase activity associated with the nuclei; this activity was eluted on repeated washing with nuclear incubation medium. In the absence of Ca2+ and Mn2+, ATP, adenosine 5'[beta gamma-methylene]triphosphate and AMP +PPi were found to promote release of both DNA and RNA. In the presence of 0.5 mM-Ca2+ and 9.3 mM-Mn2+, only ATP promoted RNA efflux to a significant extent. In the absence of spermidine, Ca2+ and Mn2+, nuclei released large quantities of DNA and RNA into the medium; this effect was promoted by p-chloromereuribenzoate. In the presence of the three cations, however, p-chloromercuribenzoate inhibited RNA efflux. F- caused a slight leakage of DNA from nuclei. The results are discussed in terms of models for the effects of ATP and analogues on RNA efflux and nuclear stability. PMID:6157391

  8. Influence of nucleotides, cations and nucleoside triphosphatase inhibitors on the release of ribonucleic acid from isolated rat liver nuclei.

    PubMed

    Agutter, P S

    1980-04-15

    The reasons underlying reported discrepancies in the effects of ATP, ADP, adenosine 5'-[beta gamma-methylene]triphosphate, AMP + PPi, P-chloromercuribenzoate and F- on RNA efflux from isolated rat liver nuclei and on nuclear envelope nucleoside triphosphatase activity were investigated. The stimulatory effect of ADP was attributed to myokinase activity associated with the nuclei; this activity was eluted on repeated washing with nuclear incubation medium. In the absence of Ca2+ and Mn2+, ATP, adenosine 5'[beta gamma-methylene]triphosphate and AMP +PPi were found to promote release of both DNA and RNA. In the presence of 0.5 mM-Ca2+ and 9.3 mM-Mn2+, only ATP promoted RNA efflux to a significant extent. In the absence of spermidine, Ca2+ and Mn2+, nuclei released large quantities of DNA and RNA into the medium; this effect was promoted by p-chloromereuribenzoate. In the presence of the three cations, however, p-chloromercuribenzoate inhibited RNA efflux. F- caused a slight leakage of DNA from nuclei. The results are discussed in terms of models for the effects of ATP and analogues on RNA efflux and nuclear stability.

  9. Regulation of insulin-like growth factor-binding protein messenger ribonucleic acid levels in sheep thyroid cells.

    PubMed

    Bachrach, L K; Eggo, M C; Burrow, G N; Liu, F; Tram, T; Powell, D R

    1991-04-01

    The insulin-like growth factors (IGFs) exist primarily bound to cell surface receptors or complexed to specific binding proteins (IGFBPs). The IGFBPs modulate the bioavailability of the IGFs and may enhance or inhibit IGF actions. Several distinct forms of IGFBPs have been described on the basis of size, immunological determinants, and distribution in biological fluids; the IGFBPs may differ as well in their biological function. Sheep thyroid cells produce IGFBPs under hormonal regulation. Cells grown in basal medium or with six-hormone (6H) medium supplements (transferrin, glycyl-histidyl-lysine, hydrocortisone, somatostatin, insulin, and TSH) release nonglycosylated BPs that migrate at 24, 27, 29, and 32 kDa on Western ligand blot. Cells cultured with the thyroid mitogens epidermal growth factor and phorbol ester release additional glycosylated IGFBPs of 40-44 kDa. Immunoprecipitation experiments indicate that 29- and 32-kDa IGFBPs are antigenically related to IGFBP-2, and the 40- to 44-kDa proteins are related to IGFBP-3. Using specific cDNA probes IGFBP-1, -2, and -3, we examined the regulation of IGFBP mRNA levels in sheep thyroid cultures. The rat IGFBP-2 cDNA probe hybridized to an approximately 1.6-kilobase mRNA species in cells under all culture conditions. However, IGFBP-3 mRNA was detectable only in epidermal growth factor- or phorbol ester-treated cells and appeared within 4 h, preceding the release of IGFBP-3 protein into the medium. The 6H additives, which stimulate differentiated function in thyroid cells, inhibited the mRNA levels of both IGFBP-2 and IGFBP-3. IGFBP-1 mRNA was not detectable. The distinct regulation of these IGFBPs suggest that they may play different biological roles in modulating thyroid physiology. PMID:1706262

  10. The identification by affinity chromatography of the rat liver ribosomal proteins that bind to elongator and initiator transfer ribonucleic acids.

    PubMed

    Ulbrich, N; Wool, I G; Ackerman, E; Sigler, P B

    1980-07-25

    Mixed yeast elongator-tRNAs (bulk tRNA lacking fRNAm,fMet), pure isoaccepting species of elongator-tRNAs (tRNAmMet and tRNAPhe), and purified initiator-tRNA (tRNAfMet) were each oxidized with periodate and the 3' terminus was coupled to Sepharose 4B through an adipic acid dihydrazide spacer. The rat liver ribosomal proteins that associated with the tRNAs were isolated by affinity chromatography and identified by electrophoresis in polyacrylamide gels. The rat liver ribosomal proteins that were bound to the elongator-tRNA preparations were L6, L35a, and S15; small amounts of a number of other proteins also associated with the nucleic acid. When initiator-tRNA (tRNAfMet) was immobilized on Sepharose, only L6 and L35a were bound; no 40 S subunit proteins associated with initiator-tRNA. No Escherichia coli proteins formed a complex with either eukaryotic initiator- or elongator-tRNAs. PMID:7391064

  11. Ribonucleic acid stimulation of mammalian liver nuclear-envelope nucleoside triphosphatase. A possible enzymic marker for the nuclear envelope.

    PubMed Central

    Agutter, P S; Harris, J R; Stevenson, I

    1977-01-01

    1. The specific activity of rat and pig liver nuclear-envelope nucleoside triphosphatase (EC 3.6.1.3) decreases when the system is depleted of RNA. The activity can be restored by adding high concentrations of yeast RNA to the assay medium. 2. Exogenous RNA also increases the activity of the enzyme in control envelopes (not RNA-depleted). The effect appears to be largely specific for poly(A) and poly(G); it is not stimulated by rRNA or tRNA preparations, ribonuclease-hydrolysed RNA, AMP, or double- or single-stranded DNA. 3. Inhibitors of the enzyme, in concentrations at which half-maximal inhibition of the enzyme is achieved, do not affect the percentage stimulation of the enzyme by yeast RNA. 4. The simulation is abolished by the inclusion of 150 mM-KCl or -NaCl in the assay medium, but not by increasing the assay pH to 8.5. 5. The results are discussed in the light of the possible role of the nucleoside triphosphatase in vivo in nucleo-cytoplasmic ribonucleoprotein translocation. 6. It is proposed that poly(G)-stimulated Mg2+-activated adenosine triphosphatase activity should be adopted as an enzymic marker for the nuclear envelope. Images PLATE 1 PMID:141276

  12. Ribonucleic acid stimulation of mammalian liver nuclear-envelope nucleoside triphosphatase. A possible enzymic marker for the nuclear envelope.

    PubMed

    Agutter, P S; Harris, J R; Stevenson, I

    1977-03-15

    1. The specific activity of rat and pig liver nuclear-envelope nucleoside triphosphatase (EC 3.6.1.3) decreases when the system is depleted of RNA. The activity can be restored by adding high concentrations of yeast RNA to the assay medium. 2. Exogenous RNA also increases the activity of the enzyme in control envelopes (not RNA-depleted). The effect appears to be largely specific for poly(A) and poly(G); it is not stimulated by rRNA or tRNA preparations, ribonuclease-hydrolysed RNA, AMP, or double- or single-stranded DNA. 3. Inhibitors of the enzyme, in concentrations at which half-maximal inhibition of the enzyme is achieved, do not affect the percentage stimulation of the enzyme by yeast RNA. 4. The simulation is abolished by the inclusion of 150 mM-KCl or -NaCl in the assay medium, but not by increasing the assay pH to 8.5. 5. The results are discussed in the light of the possible role of the nucleoside triphosphatase in vivo in nucleo-cytoplasmic ribonucleoprotein translocation. 6. It is proposed that poly(G)-stimulated Mg2+-activated adenosine triphosphatase activity should be adopted as an enzymic marker for the nuclear envelope.

  13. Reduction in plasma human immunodeficiency virus ribonucleic acid after dideoxynucleoside therapy as determined by the polymerase chain reaction.

    PubMed

    Holodniy, M; Katzenstein, D A; Israelski, D M; Merigan, T C

    1991-11-01

    Cell-free HIV RNA in plasma was detected and quantitated after antiviral therapy by the polymerase chain reaction. RNA was extracted from plasma, reverse transcribed to cDNA, amplified by polymerase chain reaction, and quantitated by absorbance based on an enzyme-linked affinity assay. 72 HIV antibody-positive subjects had one plasma sample taken. 39 who were not receiving antiretroviral therapy at the time had a mean plasma HIV RNA copy number of 690 +/- 360 (mean +/- SEM) per 200 microliters of plasma, while 33 subjects who had been receiving zidovudine therapy for a minimum of 3 mo had a mean copy number of 134 +/- 219 (P less than 0.05). 27 additional HIV antibody-positive patients had two plasma samples taken before and 1 mo after initiating dideoxynucleoside therapy. Plasma HIV RNA copy number fell from 540 +/- 175 to 77 +/- 35 (P less than 0.05). Finally, nine of these subjects had two baseline samples obtained before initiating therapy and two posttreatment samples 1 and 2 mo after therapy was begun. Mean plasma RNA copy number declined from 794 +/- 274 to less than 40 (below the lower limit of sensitivity) after 1 mo of therapy, with suppression maintained after 2 mo of therapy. These results suggest that gene amplification can be used to detect and quantitate changes in plasma HIV RNA after dideoxynucleoside therapy. Plasma HIV polymerase chain reaction may be a more sensitive marker to monitor antiviral therapy, particularly in asymptomatic patients where measurement of p24 antigen or quantitative plasma cultures are negative.

  14. Field-deployable real-time polymerase chain reaction detection of bluetongue and epizootic haemorrhagic disease viral ribonucleic acid.

    PubMed

    Wilson, W C; Stallknecht, D E; Mecham, J O

    2004-01-01

    Nucleic acid sequence information from molecular evolution studies of bluetongue virus (BTV) and related epizootic haemorrhagic disease virus (EHDV) strains has resulted in a large database of genomic information. Published sequence data and sequence data from our laboratory were used to design real-time field-deployable reverse transcriptase-polymerase chain reaction assays for the detection of BTV or EHDV viral RNA. The assays used standard RNA extraction and TaqMan chemistries and the entire process was completed in

  15. Effects of gamma-irradiation on biosynthesis of different types of ribonucleic acids in normal and regenerating rat liver.

    PubMed Central

    Markov, G G; Dessev, G N; Russev, G C; Tsanev, R G

    1975-01-01

    1. The effect of gamma-irradiation (4000rd) on the synthesis of ribosomal (pre-rRNA) and heterogeneous nuclear RNA (pre-mRNA) in normal and in regenerating rat liver was studied by using 40 min labelling with [6(-14)C]orotic acid. 2. Partial hepatectomy caused a sharp transient increase in the specific radioactivity of the endogenous low-molecular-weight RNA precursors in the livers of both normal and irradiated rats. Irradiation of intact animals did not affect the pool. 3. Irradiation enhanced the synthesis of pre-rRNA for at least 12h. The synthesis of pre-mRNA was also enhanced, but only in the first 3h after irradiation. 4. Partial hepatectomy strongly stimulated the synthesis of both pre-rRNA and pre-mRNA. 5. The synthesis of pre-rRNA was enhanced also in regenerating liver of animals irradiated before or after the operation. The conclusion can be drawn that the early increase in the synthesis of ribosomal RNA is a non-specific cellular response to different injuring factors. 6. The only case where irradiation caused an early inhibition of RNA synthesis was that of pre-mRNA in regenerating liver. This supports the hypothesis that ionizing radiation does not suppress the transcription per se but affects the mechanisms of activation of new genes (cellular programming). PMID:1147904

  16. Junk DNA: Prospects for Oral Cancer Research.

    PubMed

    Sarode, Gargi S; Sarode, Sachin C; Patil, Shankargouda; Anand, Rahul

    2016-01-01

    About 98% of human genes are transcribed into noncoding ribonucleic acid (RNA), which is known by the name of "junk DNA." Unlike its name, it has been proved by now that junk deoxyribonucleic acid (DNA) can have some functional activities. PMID:27207194

  17. Molecular cloning of otoconin-22 complementary deoxyribonucleic acid in the bullfrog endolymphatic sac: effect of calcitonin on otoconin-22 messenger ribonucleic acid levels.

    PubMed

    Yaoi, Yuichi; Suzuki, Masakazu; Tomura, Hideaki; Sasayama, Yuichi; Kikuyama, Sakae; Tanaka, Shigeyasu

    2003-08-01

    Anuran amphibians have a special organ called the endolymphatic sac (ELS), containing many calcium carbonate crystals, which is believed to have a calcium storage function. The major protein of aragonitic otoconia, otoconin-22, which is considered to be involved in the formation of calcium carbonate crystals, has been purified from the saccule of the Xenopus inner ear. In this study, we cloned a cDNA encoding otoconin-22 from the cDNA library constructed for the paravertebral lime sac (PVLS) of the bullfrog, Rana catesbeiana, and sequenced it. The bullfrog otoconin-22 encoded a protein consisting of 147 amino acids, including a signal peptide of 20 amino acids. The protein had cysteine residues identical in a number and position to those conserved among the secretory phospholipase A(2) family. The mRNA of bullfrog otoconin-22 was expressed in the ELS, including the PVLS and inner ear. This study also revealed the presence of calcitonin receptor-like protein in the ELS, with the putative seven-transmembrane domains of the G protein-coupled receptors. The ultimobranchialectomy induced a prominent decrease in the otoconin-22 mRNA levels of the bullfrog PVLS. Supplementation of the ultimobranchialectomized bullfrogs with synthetic salmon calcitonin elicited a significant increase in the mRNA levels of the sac. These findings suggest that calcitonin secreted from the ultimobranchial gland, regulates expression of bullfrog otoconin-22 mRNA via calcitonin receptor-like protein on the ELS, thereby stimulating the formation of calcium carbonate crystals in the lumen of the ELS. PMID:12865304

  18. Effect of an exotoxin from Bacillus thuringiensis on deoxyribonucleic acid-dependent ribonucleic acid polymerase in nuclei from adult Sarcophaga bullata. Unusual behaviour of eukaryotic polymerases to inhibitors.

    PubMed

    Beebee, T J; Bond, R P

    1973-09-01

    The DNA-dependent RNA polymerase activities in nuclei isolated from adult Sarcophaga bullata are unusual in their responses to metal ions, ionic strength and inhibitors. There is an activity that is sensitive both to rifamycin and to alpha-amanitin. The activity is less sensitive to Bacillus thuringiensis exotoxin than is larval polymerase, and low concentration of exotoxin provoke a slight stimulation.

  19. Transcription of fractionated mammalian chromatin by mammalian ribonucleic acid polymerase. Demonstration of temperature-dependent rifampicin-resistant initiation sites in euchromatin deoxyribonucleic acid

    PubMed Central

    Chesterton, C. James; Coupar, Barbara E. H.; Butterworth, Peter H. W.

    1974-01-01

    The chromatin fractionation method of Frenster et al. (1963) as modified by Leake et al. (1972) was used to prepare fragments of euchromatin from rat liver nuclei. These remain soluble in 5mm-MgCl2, and contain DNA of maximum mol.wt. 1×106–2×106. The fragments were separated from condensable chromatin on a sucrose gradient. Euchromatin contains endogenous DNA-dependent RNA polymerase, and most of the nascent RNA labelled in vivo or in vitro. Euchromatin fragments allow initiation of transcription by added purified rat liver form-B RNA polymerase and contain temperature-dependent rifampicin-resistant initiation sites for the form-B enzyme. These findings indicate that transcription of the euchromatin regions of interphase chromosomes is not initiated in condensed chromatin, but is initiated within the euchromatin stretches. Condensable chromatin also contains most of these activities, but is not associated with nascent RNA. PMID:4464858

  20. Effect of Bacteriophage R17 Infection on Hostdirected Synthesis of Ribosomal Ribonucleates

    PubMed Central

    Hudson, James B.; Paranchych, William

    1967-01-01

    Studies were performed on the synthesis of ribosomal ribonucleates in cells of Escherichia coli K-12 infected by the ribonucleic acid (RNA) bacteriophage R17. Host-specific RNA was measured in the presence of phage RNA by in vitro hybridization of the purified ribonucleates with E. coli deoxyribonucleic acid. The results showed that, although the overall rate of RNA synthesis was only slightly affected by phage infection, the level of host RNA synthesis was decreased by 70 to 80%. Fractionation of the purified ribonucleates by sucrose gradient sedimentation, followed by hybridization of fractions sedimenting in the 23S and 16S regions, revealed that the level of ribosomal RNA synthesis was also decreased by 70 to 80%, and that this inhibition occurred during the first 15 to 20 min after infection. These findings are discussed in light of what is known about the inhibition of host RNA synthesis by other virus systems. PMID:4918239

  1. Inhibition of hepatic deoxyribonucleic acid-dependent ribonucleic acid polymerases by the exotoxin of Bacillus thuringiensis in comparison with the effects of α-amanitin and cordycepin

    PubMed Central

    Smuckler, Edward A.; Hadjiolov, Asen A.

    1972-01-01

    The action of Bacillus thuringiensis exotoxin, a structural analogue of ATP, on mouse liver DNA-dependent RNA polymerases was studied and its effects were compared with those of α-amanitin and cordycepin. (1) Administration of exotoxin in vivo caused a marked decrease in RNA polymerase activity of isolated nuclei at various concentrations of Mg2+, Mn2+ and (NH4)2SO4. A similar action was recorded after addition of exotoxin to isolated nuclei from control or exotoxin-treated mice. (2) Chromatographic separation of nuclear RNA polymerases from mice treated in vivo with exotoxin showed a drastic decrease of the peak of nucleoplasmic RNA polymerase, whereas the peak of nucleolar RNA polymerase remained unaltered. The same effect was observed after administration of α-amanitin in vivo, but cordycepin did not alter the relative amounts of the two main RNA polymerase peaks. (3) Administration of exotoxin in vivo did not alter the template activity of isolated DNA or chromatin tested with different fractions of RNA polymerase from control or exotoxin-treated mice. (4) Addition of exotoxin to isolated liver RNA polymerases inhibited both enzyme fractions. However, the α-amanitin-sensitive RNA polymerase was also 50–100-fold more sensitive to exotoxin inhibition than was the α-amanitin-insensitive RNA polymerase. Kinetic analysis indicated the exotoxin produces a competitive inhibition with ATP on the nucleolar enzyme, but a mixed type of inhibition with nucleoplasmic enzyme. The results obtained indicate that the B. thuringiensis exotoxin inhibits liver RNA synthesis by affecting nuclear RNA polymerases, showing a preferential inhibition of the nucleoplasmic α-amanitin-sensitive RNA polymerase. ImagesFig. 7. PMID:4539593

  2. Down-regulation of messenger ribonucleic acid encoding an importer of sulfoconjugated steroids during human chorionic gonadotropin-induced follicular luteinization in vivo.

    PubMed

    Brown, Kristy A; Bouchard, Nadine; Lussier, Jacques G; Sirois, Jean

    2007-01-01

    Members of the organic anion transporting polypeptide (SLCO/OATP) superfamily are capable of importing anionic compounds across the lipid bilayer in a sodium-independent manner. Member 2B1 has been shown to transport few substrates, two of which are dihydroepiandrosterone-3-sulfate (DHEA-S) and estrone-3-sulfate. Steroid sulfatase (STS) catalyses the hydrolysis of these steroids into their unconjugated counterparts. The objective of this study was to investigate the regulation of SLCO2B1 and STS mRNAs during human chorionic gonadotropin (hCG)-induced ovulation/luteinization. The equine SLCO2B1 cDNA was cloned and shown to encode a 709-amino acid protein (OATP2B1) that is highly conserved when compared to mammalian orthologs. RT-PCR/Southern blot analyses were performed to study the regulation of SLCO2B1 and STS transcripts in equine preovulatory follicles isolated between 0 and 39h after hCG treatment. Results showed high levels of SLCO2B1 mRNA expression before hCG, with a marked decrease observed in follicles obtained 24-39h post-hCG (P<0.05). Analyses of isolated granulosa and theca interna cells identified high mRNA expression in both cell types prior to hCG treatment, with granulosa cells showing a more rapid SLCO2B1 mRNA down-regulation. No significant change in STS mRNA was observed in intact follicle walls. However, when both cell types were isolated, a significant decrease in STS mRNA was observed in granulosa cells 24-39h post-hCG. Collectively, these results demonstrate that the hCG-dependent induction of follicular luteinization is accompanied by the down-regulation of SLCO2B1 and STS transcripts. Considering that OATP2B1 can import sulfoconjugated DHEA and estrogens, and that STS can remove the sulfonate moiety from these steroids, their down-regulation in luteinizing preovulatory follicles may provide an additional biochemical basis for the decrease in ovarian 17beta-estradiol biosynthesis after the LH surge.

  3. Technical Report: Triple-Colour Staining Flow Cytometry for Co-Distribution of Thrombospondin Receptor (CD36), Ribonucleic Acid (RNA) and Fetal Haemoglobin (HbF) in Sickle Red Blood Cells.

    PubMed

    Mundee, Y; Bigelow, N C; Davis, B H; Porter, J B

    2001-01-01

    Red blood cells (RBCs) from sickle cell patients (SS) express thrombospondin receptor (CD36), contain ribonucleic acid (RNA, recognised as reticulocytes) and fetal haemoglobin (HbF, defined as F cells) in a higher proportion than RBCs from healthy individuals. The co-distribution of CD36, RNA and HbF on the same RBCs has not been demonstrated due to a lack of detection methods. A triple-colour staining flow cytometry for the co-distribution of CD36, RNA and HbF was developed. The method can simultaneously determine CD36-expressing RBCs (CD36 cells), RNA-bearing RBCs (reticulocytes), HbF-bearing RBCs (F cells), CD36-expressing reticulocytes (CD36 reticulocytes), CD36-expressing-F cells (CD36-F cells), HbF-bearing reticulocytes (F reticulocytes) and CD36-expressing-F reticulocjrtes (CD36-F reticulocytes). Mouse monoclonal antibody against CD36 (MoAb-CD36), antibodagainst mouse-immunoglobulin conjugated to biotin (Ab-Molg-Bi), streptavidin conjugated to rhodamine phycoerythrin (StA-RFE), MoAb against HbF conjugated to Tri-Colour® (MoAb-HbF-TC), Thiazole orange (TO), Glutaraldehyde and Triton X-100 were used. The procedure takes approximately 7 hours. The numbers of CD36 cells, reticulocytes and F cells obtaining from single and triple staining were well correlated and not significantly different. Intra- and inter-assay coefficient of variation percents (%CVs) of the triple-colour staining were less than 10 and 15% respectively. EDTA blood samples stored at 4°C for less than 3 days are suitable. The method trial was then employed on blood samples from SS and healthy individuals. The method is reproducible, objective and applicable for determination of co-distribution of other membrane and intracellular markers in RBCs.

  4. Characterization of ribonucleic acids from the venom glands of Crotalus durissus terrificus (Ophidia, Reptilia) after manual extraction of the venom. Studies on template activity and base composition

    PubMed Central

    De Lucca, F. L.; Imaizumi, M. T.; Haddad, A.

    1974-01-01

    RNA synthesis in the venom glands of Crotalus durissus terrificus was stimulated by the manual extraction of the venom (milking). RNA was extracted from venom glands activated by milking and fractionated by centrifugation through sucrose density gradients. Template activity for protein synthesis and base composition of the RNA fractions were studied. RNA fractions that sediment between 18S and 4S had the highest template activity. The base composition analysis indicated that the 28S and 18S rRNA have a C+G content of 65.4 and 58% respectively. The `melting' temperature (Tm) of DNA in 0.15m-NaCl–0.015m-trisodium citrate, pH7.0, was 85°C, corresponding to a C+G content of 38%. The base ratio of the RNA fractions that showed a high template activity was intermediate between that of rRNA and homologous DNA. The possible role of these fractions in the synthesis of the two main toxins (crotoxin and crotamine) of the South American rattlesnake's venom is discussed. ImagesPLATE 1 PMID:4463939

  5. Qualitative and quantitative aspects of the biosynthesis of ribonucleic acid and of protein in the liver and the lung of the Syrian golden hamster

    PubMed Central

    Witschi, Hanspeter

    1973-01-01

    1. The incorporation of orotic acid and of uridine into total RNA was measured in vivo in liver and lung of the Syrian golden hamster. Specific activities of total acid-soluble UMP were measured in both organs. An estimation of the rate of RNA biosynthesis showed that hamster lung synthesizes RNA at about one-half of the rate of that of hamster liver. 2. The apparent Km and Vmax. values of a few enzymes involved in pyrimidine biosynthesis were measured in the 100000g supernatants of liver and lung. The apparent Km values were very similar in both organs. From the estimated Vmax., it was concluded that hamster lung cells have less capacity to metabolize orotic acid than have liver cells. 3. A time–response and a dose–response study showed that actinomycin D inhibits pulmonary RNA synthesis as efficiently as hepatic RNA synthesis. 4. Protein synthesis, measured as the incorporation of leucine, was inhibited in both organs 30min after a dose of 2mg of cycloheximide/kg. The dose–response patterns were similar in both liver and lung 3h after cycloheximide. 5. It is concluded that RNA and protein synthesis in vivo in hamster lung are very similar to the corresponding reactions in liver. Alterations of RNA and protein synthesis by toxic agents can therefore be evaluated in lung with a similar approach to that used to study the pathological biochemistry of liver. PMID:4780700

  6. Differential localization of type I and type III procollagen messenger ribonucleic acids in inflamed periodontal and periapical connective tissues by in situ hybridization.

    PubMed

    Larjava, H; Sandberg, M; Happonen, R P; Vuorio, E

    1990-01-01

    Inflammatory lesions of periodontal and periapical connective tissue were studied by in situ hybridization to detect cells responsible for type I and type III collagen production. Formalin-fixed and paraffin-embedded tissue specimens from patients with oral lesions of various stages of inflammation were hybridized with cDNA probes specific for human pro alpha 1(I) and pro alpha 1(III) collagen mRNAs, and with bacteriophage lambda DNA as a control probe. This technique permitted us to localize fibroblasts active in type I collagen synthesis in the vicinity of inflammatory infiltrates in all the samples studied. Cells containing high levels of type III collagen mRNA were seen in early abscess formation and they were particularly abundant in pyogenic granuloma and irritation fibroma. Type I collagen mRNA was prominent in gingival fibrosis. In the infrabony lesions with active inflammatory infiltrations the production of collagen was confined mostly to the periphery of the lesions. These findings give indirect evidence that cytokines liberated during the early stages of the inflammatory process stimulate expression of the type III collagen gene by fibroblasts. In chronic lesions a gradual switch from type III to type I collagen gene expression occurs. The change in collagen types appears to underlie the observed isolation of the inflammation by a collagenous capsule. In all the samples studied fibroblasts exhibited marked variation in their levels of procollagen mRNAs, supporting previous views about their heterogeneity in connective tissues. The approach presented here offers new possibilities to study cellular interactions and metabolic activities in inflammatory lesions. PMID:2296161

  7. Fractionation of nuclei from brain by zonal centrifugation and a study of the ribonucleic acid polymerase activity in the various classes of nuclei

    PubMed Central

    Austoker, J.; Cox, D.; Mathias, A. P.

    1972-01-01

    1. The nuclei of the cells of the whole rat brain have been fractionated in a B-XIV zonal rotor with a discontinuous gradient of sucrose. Five fractions were obtained. Zone (I) contained neuronal nuclei (70%) and astrocytic nuclei (23%). Zone (II) contained astrocytic nuclei (81%) and neuronal nuclei (15%). Zone (III) contained astrocytic nuclei (84%) and oligodendrocytic nuclei (15%). Zone (IV) contained oligodendrocytic nuclei (92%) and zone (V) contained only oligodendrocytic nuclei. 2. The content of DNA, RNA and protein per nucleus was determined for each zone. Although the amount of DNA per nucleus is constant (7pg) the RNA varies from 4.5 to 2.5pg/nucleus and the protein from 38 to 17.6pg/nucleus. The neuronal nuclei have the greatest amounts of protein. The oligodendrocytic nuclei have the least content of RNA and protein. 3. The effects of pH, ionic strength, and Mg2+ and Mn2+ concentration on the activity of the nuclear system for synthesis in vitro of RNA have been investigated for unfractionated nuclei. From these studies a standard set of conditions for the assay of nuclear RNA polymerase has been established. 4. The activity of the RNA polymerase in each of the zonal fractions has been determined in the presence and in the absence of α-amanitin. Zone (II) is the most active, followed by zone (I). The nuclei of zones (IV) and (V) have comparable activity, which is 40% of that of zone (II). 5. The extent of incorporation of each of the four labelled nucleoside triphosphates by the nuclei from each zone has been measured. These values have been used to calculate the base composition of the RNA synthesized in vitro in each class of nucleus. 6. The effect of changes in the condition of assay of RNA polymerase in the different classes of nuclei has been investigated. Significant differences in the response to concentrations of metal ions and ammonium sulphate have been observed. 7. Homopolymer formation in each zone of brain nuclei has been determined. The

  8. Dexamethasone reduces steady state insulin-like growth factor I messenger ribonucleic acid levels in rat neuronal and glial cells in primary culture.

    PubMed

    Adamo, M; Werner, H; Farnsworth, W; Roberts, C T; Raizada, M; LeRoith, D

    1988-11-01

    Insulin-like growth factor I (IGF-I) mRNA was demonstrated in primary cultures of neuronal and glial cells from rat brain. On Northern blots, a rat IGF-I cDNA probe hybridized to RNA species of 7.5, 1.7, and 0.8-1.2 kilobases in total and poly(A)+ RNA from both cell types. Solution hybridization/RNase protection assays were performed using an antisense riboprobe complementary to the 5'-untranslated region as well as part of the coding region of rat IGF-I mRNA. These studies indicated that two of the previously described three possible alternative 5'-untranslated splicing variants (classes A and C) were expressed in neuronal and glial cells, with class C transcripts predominating. Neuronal cells also possessed extremely low levels of class B transcripts. Treatment of neuronal cell cultures with the synthetic glucocorticoid dexamethasone reduced IGF-I mRNA levels by 60%. Glial cell IGF-I mRNA levels were reduced by dexamethasone by up to 40%. These results suggest that glucocorticoid-induced reductions in IGF-I production could occur at the level of transcription and may underlie some of the actions of glucocorticoids in causing growth retardation and inhibition of cell proliferation. PMID:2458916

  9. Properties of the ribonucleic acid bacteriophage ZIK-1 coat protein and its synthesis in an Escherichia coli cell-free system.

    PubMed

    Robinson, J W

    1972-07-01

    The coat protein subunit of the RNA bacteriophage ZIK/1 has a molecular weight of 12100 and does not contain histidine, methionine and cysteine. The amino acid composition of the coat protein is different from that of other RNA bacteriophage coat proteins. Bacteriophage ZIK/1 belongs to a class of RNA bacteriophages distinct from the f2 type, which lack histidine in their coat proteins, and the Qbeta type, which lack histidine and methionine. Bacteriophage ZIK/1 RNA is an efficient template in the Escherichia coli cell-free system producing coat protein as the major product and a number of non-coat proteins. This result is similar to that obtained with RNA from f2-type bacteriophages. It is probable that the genomes of RNA bacteriophages are structurally similar and that differences between the types of RNA bacteriophage arise from minor differences in RNA sequence.

  10. Properties of the ribonucleic acid bacteriophage ZIK/1 coat protein and its synthesis in an Escherichia coli cell-free system

    PubMed Central

    Robinson, J. W.

    1972-01-01

    The coat protein subunit of the RNA bacteriophage ZIK/1 has a molecular weight of 12100 and does not contain histidine, methionine and cysteine. The amino acid composition of the coat protein is different from that of other RNA bacteriophage coat proteins. Bacteriophage ZIK/1 belongs to a class of RNA bacteriophages distinct from the f2 type, which lack histidine in their coat proteins, and the Qβ type, which lack histidine and methionine. Bacteriophage ZIK/1 RNA is an efficient template in the Escherichia coli cell-free system producing coat protein as the major product and a number of non-coat proteins. This result is similar to that obtained with RNA from f2-type bacteriophages. It is probable that the genomes of RNA bacteriophages are structurally similar and that differences between the types of RNA bacteriophage arise from minor differences in RNA sequence. PMID:4564257

  11. Comparison of hepatic transcription profiles of locked ribonucleic acid antisense oligonucleotides: evidence of distinct pathways contributing to non-target mediated toxicity in mice.

    PubMed

    Kakiuchi-Kiyota, Satoko; Koza-Taylor, Petra H; Mantena, Srinivasa R; Nelms, Linda F; Enayetallah, Ahmed E; Hollingshead, Brett D; Burdick, Andrew D; Reed, Lori A; Warneke, James A; Whiteley, Lawrence O; Ryan, Anne M; Mathialagan, Nagappan

    2014-03-01

    Development of LNA gapmers, antisense oligonucleotides used for efficient inhibition of target RNA expression, is limited by non-target mediated hepatotoxicity issues. In the present study, we investigated hepatic transcription profiles of mice administered non-toxic and toxic LNA gapmers. After repeated administration, a toxic LNA gapmer (TS-2), but not a non-toxic LNA gapmer (NTS-1), caused hepatocyte necrosis and increased serum alanine aminotransferase levels. Microarray data revealed that, in addition to gene expression patterns consistent with hepatotoxicity, 17 genes in the clathrin-mediated endocytosis (CME) pathway were altered in the TS-2 group. TS-2 significantly down-regulated myosin 1E (Myo1E), which is involved in release of clathrin-coated pits from plasma membranes. To map the earliest transcription changes associated with LNA gapmer-induced hepatotoxicity, a second microarray analysis was performed using NTS-1, TS-2, and a severely toxic LNA gapmer (HTS-3) at 8, 16, and 72 h following a single administration in mice. The only histopathological change observed was minor hepatic hypertrophy in all LNA groups across time points. NTS-1, but not 2 toxic LNA gapmers, increased immune response genes at 8 and 16 h but not at 72 h. TS-2 significantly perturbed the CME pathway only at 72 h, while Myo1E levels were decreased at all time points. In contrast, HTS-3 modulated DNA damage pathway genes at 8 and 16 h and also modulated the CME pathway genes (but not Myo1E) at 16 h. Our results may suggest that different LNAs modulate distinct transcriptional genes and pathways contributing to non-target mediated hepatotoxicity in mice. PMID:24336348

  12. Comparison of hepatic transcription profiles of locked ribonucleic acid antisense oligonucleotides: evidence of distinct pathways contributing to non-target mediated toxicity in mice.

    PubMed

    Kakiuchi-Kiyota, Satoko; Koza-Taylor, Petra H; Mantena, Srinivasa R; Nelms, Linda F; Enayetallah, Ahmed E; Hollingshead, Brett D; Burdick, Andrew D; Reed, Lori A; Warneke, James A; Whiteley, Lawrence O; Ryan, Anne M; Mathialagan, Nagappan

    2014-03-01

    Development of LNA gapmers, antisense oligonucleotides used for efficient inhibition of target RNA expression, is limited by non-target mediated hepatotoxicity issues. In the present study, we investigated hepatic transcription profiles of mice administered non-toxic and toxic LNA gapmers. After repeated administration, a toxic LNA gapmer (TS-2), but not a non-toxic LNA gapmer (NTS-1), caused hepatocyte necrosis and increased serum alanine aminotransferase levels. Microarray data revealed that, in addition to gene expression patterns consistent with hepatotoxicity, 17 genes in the clathrin-mediated endocytosis (CME) pathway were altered in the TS-2 group. TS-2 significantly down-regulated myosin 1E (Myo1E), which is involved in release of clathrin-coated pits from plasma membranes. To map the earliest transcription changes associated with LNA gapmer-induced hepatotoxicity, a second microarray analysis was performed using NTS-1, TS-2, and a severely toxic LNA gapmer (HTS-3) at 8, 16, and 72 h following a single administration in mice. The only histopathological change observed was minor hepatic hypertrophy in all LNA groups across time points. NTS-1, but not 2 toxic LNA gapmers, increased immune response genes at 8 and 16 h but not at 72 h. TS-2 significantly perturbed the CME pathway only at 72 h, while Myo1E levels were decreased at all time points. In contrast, HTS-3 modulated DNA damage pathway genes at 8 and 16 h and also modulated the CME pathway genes (but not Myo1E) at 16 h. Our results may suggest that different LNAs modulate distinct transcriptional genes and pathways contributing to non-target mediated hepatotoxicity in mice.

  13. Assessing delivery and quantifying efficacy of small interfering ribonucleic acid therapeutics in the skin using a dual-axis confocal microscope

    NASA Astrophysics Data System (ADS)

    Ra, Hyejun; Gonzalez-Gonzalez, Emilio; Smith, Bryan R.; Gambhir, Sanjiv S.; Kino, Gordon S.; Solgaard, Olav; Kaspar, Roger L.; Contag, Christopher H.

    2010-05-01

    Transgenic reporter mice and advances in imaging instrumentation are enabling real-time visualization of cellular mechanisms in living subjects and accelerating the development of novel therapies. Innovative confocal microscope designs are improving their utility for microscopic imaging of fluorescent reporters in living animals. We develop dual-axis confocal (DAC) microscopes for such in vivo studies and create mouse models where fluorescent proteins are expressed in the skin for the purpose of advancing skin therapeutics and transdermal delivery tools. Three-dimensional image volumes, through the different skin compartments of the epidermis and dermis, can be acquired in several seconds with the DAC microscope in living mice, and are comparable to histologic analyses of reporter protein expression patterns in skin sections. Intravital imaging with the DAC microscope further enables visualization of green fluorescent protein (GFP) reporter gene expression in the skin over time, and quantification of transdermal delivery of small interfering RNA (siRNA) and therapeutic efficacy. Visualization of transdermal delivery of nucleic acids will play an important role in the development of innovative strategies for treating skin pathologies.

  14. Luteinizing hormone releasing hormone (LHRH) neurons maintained in nasal explants decrease LHRH messenger ribonucleic acid levels after activation of GABA(A) receptors.

    PubMed

    Fueshko, S M; Key, S; Wray, S

    1998-06-01

    Inhibition of the LHRH system appears to play an important role in preventing precocious activation of the hypothalamic-pituitary-gonadal axis. Evidence points to gamma-aminobutyric acid (GABA) as the major negative regulator of postnatal LHRH neuronal activity. Changes in LHRH messenger RNA (mRNA) levels after alterations of GABAergic activity have been reported in vivo. However, the extent to which GABA acts directly on LHRH neurons to effect LHRH mRNA levels has been difficult to ascertain. The present work evaluates the effect of GABAergic activity, via GABA(A) receptors, on LHRH neuropeptide gene expression in LHRH neurons maintained in olfactory explants generated from E11.5 mouse embryos. These explants maintain large numbers of primary LHRH neurons that migrate from bilateral olfactory pits in a directed manner. Using in situ hybridization histochemistry and single cell analysis, we report dramatic alterations in LHRH mRNA levels. Inhibition of spontaneous synaptic activity by GABA(A) antagonists, bicuculline (10(-5) M) or picrotoxin (10(-4) M), or of electrical activity by tetrodotoxin (TTX, 10(-6) M) significantly increased LHRH mRNA levels. In contrast, LHRH mRNA levels decreased in explants cultured with the GABA(A) receptor agonist, muscimol (10(-4) M), or KCl (50 mM). The observed responses suggest that LHRH neurons possess functional pathways linking GABA(A) receptors to repression of neuropeptide gene expression and indicate that gene expression in embryonic LHRH neurons, outside the CNS, is highly responsive to alterations in neuronal activity.

  15. Comparing the effects of tetrabromobisphenol-A, bisphenol A, and their potential replacement alternatives, TBBPA-bis(2,3-dibromopropyl ether) and bisphenol S, on cell viability and messenger ribonucleic acid expression in chicken embryonic hepatocytes.

    PubMed

    Ma, Melissa; Crump, Doug; Farmahin, Reza; Kennedy, Sean W

    2015-02-01

    A market for alternative brominated flame retardants (BFRs) has emerged recently due to the phase out of persistent and inherently toxic BFRs. Several of these replacement compounds have been detected in environmental matrices, including wild birds. A chicken embryonic hepatocyte (CEH) assay was utilized to assess the effects of the BFR, tetrabromobisphenol-A (TBBPA), and its replacement alternative, tetrabromobisphenol A bis(2,3-dibromopropyl ether [TBBPA-DBPE]) on cell viability and messenger ribonucleic acid (mRNA) expression. Bisphenol A (BPA) and 1 of its replacement alternatives, bisphenol S (BPS), were also screened for effects. Both TBBPA and BPA decreased CEH viability with calculated median lethal concentration (LC50) values of 40.6 μM and 61.7 μM, respectively. However, the replacement alternatives, TBBPA-DBPE and BPS, did not affect cell viability (up to 300 μM). Effects on mRNA expression were determined using an Avian ToxChip polymerse chain reaction (PCR) array and a real-time (RT)-PCR assay for the estrogen-responsive genes, apolipoproteinII (ApoII) and vitellogenin (Vtg). A luciferase reporter gene assay was used to assess dioxin-like effects. Tetrabromobisphenol-A altered mRNA levels of 4 genes from multiple toxicity pathways and increased luciferase activity in the luciferase reporter gene assay, whereas its alternative, TBBPA-DBPE, only altered 1 gene on the array, Cyp1a4, and increased luciferase activity. At 300 μM, a concentration that decreased cell viability for TBBPA and BPA, the BPA replacement, BPS, altered the greatest number of transcripts, including both ApoII and Vtg. Bisphenol A exposure did not alter any genes on the array but did up-regulate Vtg at 10 μM. Characterization of the potential toxicological and molecular-level effects of these compounds will ideally be useful to chemical regulators tasked with assessing the risk of new and existing chemicals. PMID:25470364

  16. Enhanced downregulation of transforming growth factor‑β2 in rat retinal pigment epithelium cells by adeno‑associated virus‑mediated ribonucleic acid interference combined with ultrasound or microbubbles.

    PubMed

    Li, Hongli; Wan, Caifeng; Du, Lianfang; Li, Fenghua

    2015-02-01

    The present study was designed to determine the efficiency and safety of ultrasound (US) and/or US contrast agent microbubbles (MBs) in the delivery of type 2 recombinant adeno-associated virus‑delivered transforming growth factor‑β2 short hairpin ribonucleic acid encoding the enhanced green fluorescent protein gene (rAAV2‑TGFβ2 shRNA‑EGFP) and the downregulation of TGFβ2 in rat retinal pigment epithelium (RPE‑J) cells. The effects of US and/or MBs on the delivery of rAAV2‑EGFP and rAAV2‑TGFβ2 shRNA‑EGFP were evaluated by fluorescence microscopy and flow cytometry. The potential toxicity of cell viability under various US or MB conditions was assessed by CellTiter 96® AQueous One solution cell proliferation assay. The level of TGFβ2 mRNA in RPE‑J cells under various conditions was estimated by reverse transcription‑quantitative polymerase chain reaction analysis. The results obtained demonstrated that low-intensity US (0.5 W/cm2 and 30 sec) or SonoVue (MB:cell ratio, 40:1) increased the delivery efficiency of rAAV2‑EGFP and rAAV2‑TGFβ2 shRNA‑EGFP to RPE‑J cells, whereas the combination of US with MBs did not further increase but instead decreased rAAV transfection. Under the optimal conditions of rAAV delivery, enhanced TGFβ2 gene silencing with a combination of US or SonoVue with rAAV2‑TGFβ2 shRNA resulted in a significant decrease in mRNA levels compared with rAAV2‑TGFβ2 shRNA alone. US or SonoVue was used safely to enhance the delivery of rAAV2‑TGFβ2 shRNA to RPE‑J cells. A combination of the biological (rAAV2‑TGFβ2 shRNA) and physical (US or SonoVue) approaches downregulated the mRNA level of TGFβ2 more effectively.

  17. Comparing the effects of tetrabromobisphenol-A, bisphenol A, and their potential replacement alternatives, TBBPA-bis(2,3-dibromopropyl ether) and bisphenol S, on cell viability and messenger ribonucleic acid expression in chicken embryonic hepatocytes.

    PubMed

    Ma, Melissa; Crump, Doug; Farmahin, Reza; Kennedy, Sean W

    2015-02-01

    A market for alternative brominated flame retardants (BFRs) has emerged recently due to the phase out of persistent and inherently toxic BFRs. Several of these replacement compounds have been detected in environmental matrices, including wild birds. A chicken embryonic hepatocyte (CEH) assay was utilized to assess the effects of the BFR, tetrabromobisphenol-A (TBBPA), and its replacement alternative, tetrabromobisphenol A bis(2,3-dibromopropyl ether [TBBPA-DBPE]) on cell viability and messenger ribonucleic acid (mRNA) expression. Bisphenol A (BPA) and 1 of its replacement alternatives, bisphenol S (BPS), were also screened for effects. Both TBBPA and BPA decreased CEH viability with calculated median lethal concentration (LC50) values of 40.6 μM and 61.7 μM, respectively. However, the replacement alternatives, TBBPA-DBPE and BPS, did not affect cell viability (up to 300 μM). Effects on mRNA expression were determined using an Avian ToxChip polymerse chain reaction (PCR) array and a real-time (RT)-PCR assay for the estrogen-responsive genes, apolipoproteinII (ApoII) and vitellogenin (Vtg). A luciferase reporter gene assay was used to assess dioxin-like effects. Tetrabromobisphenol-A altered mRNA levels of 4 genes from multiple toxicity pathways and increased luciferase activity in the luciferase reporter gene assay, whereas its alternative, TBBPA-DBPE, only altered 1 gene on the array, Cyp1a4, and increased luciferase activity. At 300 μM, a concentration that decreased cell viability for TBBPA and BPA, the BPA replacement, BPS, altered the greatest number of transcripts, including both ApoII and Vtg. Bisphenol A exposure did not alter any genes on the array but did up-regulate Vtg at 10 μM. Characterization of the potential toxicological and molecular-level effects of these compounds will ideally be useful to chemical regulators tasked with assessing the risk of new and existing chemicals.

  18. Ribonucleic acids of Machupo and Lassa viruses.

    PubMed

    Lukashevich, I S; Stelmakh, T A; Golubev, V P; Stchesljenok, E P; Lemeshko, N N

    1984-01-01

    Sucrose gradient velocity centrifugation, polyacrylamide gel electrophoresis and RNA-RNA hybridization were used to characterize Lassa and Machupo virion RNAs as well as virus-specific RNAs from cells infected with Pichinde and Machupo viruses. Five RNA species: 30-31S, 28S, 22-24S, 18S and 4-6S have been detected in Lassa, Machupo, and Pichinde virion RNAs. Among them 28S, 18S and 4-6S RNAs cosediment and comigrate with respectively cell RNAs. RNase resistance analyses suggest the presence of extensive secondary structures and complementary RNAs in Lassa, Machupo, and Pichinde virion RNAs. Annealing with poly(A)-containing RNA from infected cells has revealed that the bulk of "minus" strands of Machupo virion RNA is located in 22-24S and 28-31S fractions of sucrose gradient. Thus Machupo and Lassa viruses as well as Pichinde virus contain two genomic RNA fragments: "large" (molecular weight of about 2.2 X 10(6] and "small" (molecular weight of about 1.3 X 10(6]. In the cells infected with Pichinde virus and treated with actinomycin D (1.0 microgram/ml) synthesis of 18S, 22-24S and 30-31S RNAs has been registered. At least 22-24S and 30-31S classes comprise "plus" and "minus" strands. In cells infected with Machupo virus in the presence of actinomycin D the synthesis of similar sedimentation classes of RNAs and certain amounts of 28S RNA have been detected.

  19. Amino Acid Racemization and the Preservation of Ancient DNA

    NASA Technical Reports Server (NTRS)

    Poinar, Hendrik N.; Hoss, Matthias

    1996-01-01

    The extent of racemization of aspartic acid, alanine, and leucine provides criteria for assessing whether ancient tissue samples contain endogenous DNA. In samples in which the D/L ratio of aspartic acid exceeds 0.08, ancient DNA sequences could not be retrieved. Paleontological finds from which DNA sequences purportedly millions of years old have been reported show extensive racemization, and the amino acids present are mainly contaminates. An exception is the amino acids in some insects preserved in amber.

  20. Affinity chromatography of aminoacyl-transfer ribonucleic acid synthetases. Cognate transfer ribonucleic acid as a ligand.

    PubMed Central

    Clarke, C M; Knowles, J R

    1977-01-01

    The use of tRNA affinity columns for the purification of aminoacyl-tRNA synthetases was investigated. A purification method for valyl-tRNA synthetase from Bacillus stearothermophilus is described that uses two affinity columns, one containing the pure cognate tRNA, and the other containing all tRNA species except the cognate tRNA. A method for the rapid preparation of the two columns was developed, which does not require prior isolation of cognate tRNA but makes use of the ability of the target synthetase to select its cognate tRNA. The usefulness of tRNA columns is compared with that of affinity columns derived from the aminoalkyladenylate reported in the preceding paper [Clarke & Knowles (1977) Biochem J. 167, 405-417]. PMID:23108

  1. Ribosomal ribonucleic acid and ribosomal precursor ribonucleic acid in Anacystis nidulans.

    PubMed

    Szalay, A; Munsche, D; Wolligiehn, R; Parthier, B

    1972-08-01

    The RNA of the blue-green alga Anacystis nidulans contains three ribosomal RNA species with molecular weights of 0.56x10(6), 0.9x10(6), and 1.1x10(6) if the RNA is extracted in the absence of Mg(2+). The 0.9x10(6)mol.wt. rRNA is extremely slowly labelled in (32)P-incorporation experiments. This rRNA may be a cleavage product of the 1.1x10(6)mol.wt. rRNA from the ribosomes of cells in certain physiological states (e.g. light-deficiency during growth). The cleavage of the 1.1x10(6)mol.wt. rRNA during the extraction procedure can be prevented by the addition of 10mm-MgCl(2). (32)P-pulse-labelling studies demonstrate the rapid synthesis of two ribosomal precursor RNA species. One precursor RNA migrating slightly slower than the 1.1x10(6)mol.wt. rRNA appears much less stable than the other precursor RNA, which shows the electrophoretic behaviour of the 0.7x10(6)mol.wt. rRNA. Our observations support the close relationship between bacteria and blue-green algae also with respect to rRNA maturation. The conversion of the ribosomal precursor RNA species into 0.56x10(6)- and 1.1x10(6)-mol.wt. rRNA species requires Mg(2+) in the incubation medium.

  2. Nitrous acid induced damage in T7 DNA and phage

    SciTech Connect

    Scearce, L.M.; Masker, W.E.

    1986-05-01

    The response of bacteriophage T7 to nitrous acid damage was investigated. The T7 system allows in vitro mimicry of most aspects of in vivo DNA metabolism. Nitrous acid is of special interest since it has been previously shown to induce deletions and point mutations as well as novel adducts in DNA. T7 phage was exposed to 56 mM nitrous acid at pH 4.6 in vivo, causing a time dependent 98% decrease in survival for each 10 min duration of exposure to nitrous acid. These studies were extended to include examination of pure T7 DNA exposed in vitro to nitrous acid conditions identical to those used in the in vivo survival studies. The treated DNA was dialyzed to remove the nitrous acid and the DNA was encapsulated into empty phage heads. These in vitro packaged phage showed a survival curve analogous to the in vivo system. There was no change in survival when either in vitro or in vivo exposed phage were grown on wild type E. coli or on E. coli strains deficient in DNA repair due to mutations in DNA polymerase I, exonuclease III or a uvrA mutation. Survival was not increased when nitrous acid treated T7 were grown on E. coli induced for SOS repair. In vitro replication of nitrous acid treated DNA showed a time dependent decrease in the total amount of DNA synthesized.

  3. The interaction of amino acids, peptides, and proteins with DNA.

    PubMed

    Solovyev, Andrey Y; Tarnovskaya, Svetlana I; Chernova, Irina A; Shataeva, Larisa K; Skorik, Yury A

    2015-01-01

    Amino acids that carry charges on their side groups can bind to double stranded DNA (dsDNA) and change the strength of the double helix. Measurement of the DNA melting temperature (Tm) confirmed that acidic amino acids (Glu, Asp) weaken the H-bonds between DNA strands, whereas basic amino acids (Arg, Lys) strengthen the interaction between the strands. A rank correlation exists between the amino acid isoelectric points and the observed changes in Tm. A similar dependence of the hyperchromic effect on the isoelectric point of a protein (pepsin, insulin, cortexin, and protamine) was observed for DNA-protein complexes at room temperature. Short peptides (KE, AEDG, and KEDP) containing a mixture of acidic and basic amino acid residues also affect Tm and the stability of the double helix. A model for binding Glu and Lys to dsDNA was explored by a docking simulation. The model shows that Glu, in an untwisted shape, binds to dsDNA in its major groove and disrupts three H-bonds between the strands, thereby destabilizing the double helix. Lys, in an untwisted shape, binds to the external side of the dsDNA and forms two bonds with O atoms of neighboring phosphodiester groups, thereby strengthening the DNA helix.

  4. Folic acid binds DNA and RNA at different locations.

    PubMed

    Bourassa, P; Tajmir-Riahi, H A

    2015-03-01

    We located multiple binding sites for folic acid on DNA and tRNA at physiological conditions, using FTIR, CD, fluorescence spectroscopic methods and molecular modeling. Structural analysis revealed that folic acid binds DNA and tRNA at multiple sites via hydrophilic, hydrophobic and H-bonding contacts with overall binding constants of Kfolic acid-DNA=1.1 (±0.3)×10(4) M(-1) and Kfolic acid-tRNA=6.4 (±0.5)×10(3) M(-1). Molecular modeling showed the participation of several nucleobases in folic acid complexes with DNA and tRNA, stabilized by H-bonding network. Two types of complexes were located for folic acid-tRNA adducts, one at the major groove and the other with TΨC loop, while acid binding occurs at major and minor grooves of DNA duplex. Folic acid complexation induced more alterations of DNA structure than tRNA.

  5. Femtosecond spectroscopic study of carminic acid DNA interactions

    NASA Astrophysics Data System (ADS)

    Comanici, Radu; Gabel, Bianca; Gustavsson, Thomas; Markovitsi, Dimitra; Cornaggia, Christian; Pommeret, Stanislas; Rusu, Catalin; Kryschi, Carola

    2006-06-01

    Photo-excited carminic acid and carminic acid-DNA complexes in a buffer solution at pH 7 have been examined using a variety of spectroscopy techniques, that are in particular, the femtosecond resolved fluorescence upconversion and transient absorption spectroscopy. The observation of dual fluorescence emission, one peaks at 470 nm and the other at 570 nm, indicates to an excited-state (S 1) intramolecular proton transfer (ESIPT). A detailed analysis of the transient absorption measurements of an aqueous carminic-acid solution at pH 7 yielded four lifetimes for the excited-state (S 1): 8, 15, 33 and 46 ps. On the other hand, only two lifetimes, 34 and 47 ps, were observed by fluorescence upconversion spectroscopy because of the detection limitation to the long wavelength edge of the carminic-acid spectrum. The four S 1 lifetimes were ascribed to the coexistence of respectively two tautomer (normal and tautomer) forms of carminic acid, in the non-dissociated state (CAH) and in the deprotonated state (CA -). The fluorescence upconversion measurements of carminic acid-DNA complexes exhibited a prolongation of the fluorescence lifetimes. This effect was accepted as evidence for the formation of intercalation complexes between the carminic acid and the DNA. The intercalative binding of the carminic acid to DNA was confirmed by the fluorescence titration experiments resulting to a binding constant of 2 × 10 5 M -1 that is typical for anthracycline-DNA complexes.

  6. Antioxidant and DNA damage protection potentials of selected phenolic acids.

    PubMed

    Sevgi, Kemal; Tepe, Bektas; Sarikurkcu, Cengiz

    2015-03-01

    In this study, ten different phenolic acids (caffeic, chlorogenic, cinnamic, ferulic, gallic, p-hydroxybenzoic, protocatechuic, rosmarinic, syringic, and vanillic acids) were evaluated for their antioxidant and DNA damage protection potentials. Antioxidant activity was evaluated by using four different test systems named as β-carotene bleaching, DPPH free radical scavenging, reducing power and chelating effect. In all test systems, rosmarinic acid showed the maximum activity potential, while protocatechuic acid was determined as the weakest antioxidant in β-carotene bleaching, DPPH free radical scavenging, and chelating effect assays. Phenolic acids were also screened for their protective effects on pBR322 plasmid DNA against the mutagenic and toxic effects of UV and H2O2. Ferulic acid was found as the most active phytochemical among the others. Even at the lowest concentration value (0.002 mg/ml), ferulic acid protected all of the bands in the presence of H2O2 and UV. It is followed by caffeic, rosmarinic, and vanillic acids. On the other hand, cinnamic acid (at 0.002 mg/ml), gallic acid (at 0.002 mg/ml), p-hydroxybenzoic acid (at 0.002 and 0.004 mg/ml), and protocatechuic acid (at 0.002 and 0.004 mg/ml) could not protect plasmid DNA. PMID:25542528

  7. Gibberellic Acid enhancement of DNA turnover in barley aleurone cells.

    PubMed

    Taiz, L; Starks, J E

    1977-08-01

    When imbibed, deembryonated halfseeds from barley (Hordeum vulgare L., var. Himalaya) are incubated in buffer, the DNA content of the aleurone layer increases 25 to 40% over a 24-hour period. In contrast, the DNA of isolated aleurone layers declines by 20% over the same time period. Gibberellic acid (GA) causes a reduction in DNA levels in both halfseed aleurone layers and isolated aleurone layers. GA also increases the specific radioactivity of [(3)H]thymidine-labeled halfseed aleurone layer DNA during the first 12 hours of treatment. Pulse-chase studies demonstrated that the newly synthesized DNA is metabolically labile.The buoyant density on CsCl density gradients of hormone-treated aleurone DNA is identical with that of DNA extracted from whole seedlings. After density-labeling halfseed DNA with 5-bromodeoxyuridine, a bimodal absorption profile is obtained in neutral CsCl. The light band (1.70 g/ml) corresponds to unsubstituted DNA, while the heavy band (1.725-1.74 g/ml) corresponds to a hybrid density-labeled species. GA increases the relative amount of the heavy (hybrid) peak in halfseed aleurone layer DNA, further suggesting that the hormone enhances semiconservative replication in halfseeds.DNA methylation was also demonstrated. Over 60% of the radioactivity from [(3)H-Me]methionine is incorporated into 5-methylcytosine. GA has no effect on the percentage distribution of label among the bases.It was concluded that GA enhances the rate of DNA degradation and DNA synthesis (turnover) in halfseeds, but primarily DNA degradation in isolated aleurone layers. Incorporation by isolated aleurone layers is due to DNA repair. Semiconservative replication apparently plays no physiological role in the hormone response, since both isolated aleurone layers and gamma-irradiated halfseeds respond normally. The hypothesis was advanced that endoreduplication and DNA degradation are means by which the seed stores and mobilizes deoxyribonucleotides for the embryo during

  8. Nucleic Acid Engineering: RNA Following the Trail of DNA.

    PubMed

    Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2016-02-01

    The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.

  9. Probing the Influence of Stereoelectronic Effects on the Biophysical Properties of Oligonucleotides: Comprehensive Analysis of the RNA Affinity, Nuclease Resistance, and Crystal Structure of Ten 2'-O-Ribonucleic Acid Modifications

    SciTech Connect

    Egli, Martin; Minasov, George; Tereshko, Valentina; Pallan, Pradeep S.; Teplova, Marianna; Inamati, Gopal B.; Lesnik, Elena A.; Owens, Steve R.; Ross, Bruce S.; Prakash, Thazha P.; Manoharan, Muthiah

    2010-03-05

    The syntheses of 10 new RNA 2'-O-modifications, their incorporation into oligonucleotides, and an evaluation of their properties such as RNA affinity and nuclease resistance relevant to antisense activity are presented. All modifications combined with the natural phosphate backbone lead to significant gains in terms of the stability of hybridization to RNA relative to the first-generation DNA phosphorothioates (PS-DNA). The nuclease resistance afforded in particular by the 2'-O-modifications carrying a positive charge surpasses that of PS-DNA. However, small electronegative 2'-O-substituents, while enhancing the RNA affinity, do not sufficiently protect against degradation by nucleases. Similarly, oligonucleotides containing 3'-terminal residues modified with the relatively large 2'-O-[2-(benzyloxy)ethyl] substituent are rapidly degraded by exonucleases, proving wrong the assumption that steric bulk will generally improve protection against nuclease digestion. To analyze the factors that contribute to the enhanced RNA affinity and nuclease resistance we determined crystal structures of self-complementary A-form DNA decamer duplexes containing single 2'-O-modified thymidines per strand. Conformational preorganization of substituents, favorable electrostatic interactions between substituent and sugar-phosphate backbone, and a stable water structure in the vicinity of the 2'-O-modification all appear to contribute to the improved RNA affinity. Close association of positively charged substituents and phosphate groups was observed in the structures with modifications that protect most effectively against nucleases. The promising properties exhibited by some of the analyzed 2'-O-modifications may warrant a more detailed evaluation of their potential for in vivo antisense applications. Chemical modification of RNA can also be expected to significantly improve the efficacy of small interfering RNAs (siRNA). Therefore, the 2'-O-modifications introduced here may benefit the

  10. Simplified Identification of mRNA or DNA in Whole Cells

    NASA Technical Reports Server (NTRS)

    Almeida, Eduardo; Kadambi, Geeta

    2007-01-01

    A recently invented method of detecting a selected messenger ribonucleic acid (mRNA) or deoxyribonucleic acid (DNA) sequence offers two important advantages over prior such methods: it is simpler and can be implemented by means of compact equipment. The simplification and miniaturization achieved by this invention are such that this method is suitable for use outside laboratories, in field settings in which space and power supplies may be limited. The present method is based partly on hybridization of nucleic acid, which is a powerful technique for detection of specific complementary nucleic acid sequences and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes.

  11. Laccaic Acid A Is a Direct, DNA-competitive Inhibitor of DNA Methyltransferase 1*

    PubMed Central

    Fagan, Rebecca L.; Cryderman, Diane E.; Kopelovich, Levy; Wallrath, Lori L.; Brenner, Charles

    2013-01-01

    Methylation of cytosines in CpG dinucleotides is the predominant epigenetic mark on vertebrate DNA. DNA methylation is associated with transcriptional repression. The pattern of DNA methylation changes during development and with disease. Human DNA methyltransferase 1 (Dnmt1), a 1616-amino acid multidomain enzyme, is essential for maintenance of DNA methylation in proliferating cells and is considered an important cancer drug target. Using a fluorogenic, endonuclease-coupled DNA methylation assay with an activated form of Dnmt1 engineered to lack the replication foci targeting sequence domain, we discovered that laccaic acid A (LCA), a highly substituted anthraquinone natural product, is a direct inhibitor with a 310 nm Ki. LCA is competitive with the DNA substrate in in vitro methylation assays and alters the expression of methylated genes in MCF-7 breast cancer cells synergistically with 5-aza-2′-deoxycytidine. LCA represents a novel class of Dnmt-targeted molecular probes, with biochemical properties that allow it to distinguish between non DNA-bound and DNA-bound Dnmt1. PMID:23839987

  12. Ribonucleic acid synthesis by Escherichia coli C3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of coliphage-ZIK/1 ribonucleic acid.

    PubMed

    Bishop, D H

    1965-10-01

    1. A method is described for the preparation and purification of the RNA from the RNA coliphage ZIK/1. 2. Some of the physical characteristics and infective properties of coliphage-ZIK/1 RNA were examined. 3. A method is also described for examining the type and quantity of RNA synthesized after bacteriophage infection. 4. Ribosome synthesis was decreased 15min. after bacteriophage adsorption, bacteriophage RNA was synthesized from 15min. to 120min. after adsorption and intracellular bacteriophages appeared 40min. after adsorption. Cell lysis commenced 60min. after adsorption, and was half complete 20min. later and 90-95% complete 120min. after adsorption. 5. Cell division continued until 40min. after bacteriophage adsorption. 6. Bacterial ribosomes were conserved during the infective process. 7. Intracellular bacteriophage RNA has sedimentation coefficient 28s but after cell lysis it has sedimentation coefficient 10-5s.

  13. Investigation of perfluorooctanoic acid induced DNA damage using electrogenerated chemiluminescence associated with charge transfer in DNA.

    PubMed

    Lu, Liping; Guo, Linqing; Li, Meng; Kang, Tianfang; Cheng, Shuiyuan; Miao, Wujian

    2016-10-01

    An electrogenerated chemiluminescence (ECL)-DNA sensor was designed and fabricated for the investigation of DNA damage by a potential environmental pollutant, perfluorooctanoic acid (PFOA). The ECL-DNA sensor consisted of a Au electrode that had a self-assembled monolayer of 15 base-pair double-stranded (ds) DNA oligonucleotides with covalently attached semiconductor CdSe quantum dots (QDs) at the distal end of the DNA. Characterization of the ECL-DNA sensor was conducted with X-ray photoelectron spectroscopy (XPS), electrochemical impedance spectroscopy (EIS), ECL, and cyclic voltammetry before and after the exposure of the sensor to PFOA. Consistent data revealed that the dsDNA on Au was severely damaged upon the incubation of the electrode in PFOA, causing significant increase in charge (or electron) transfer (CT) resistance within DNA strands. Consequently, the cathodic coreactant ECL responses of the Au/dsDNA-QDs electrode in the presence of K2S2O8 were markedly decreased. The strong interaction between DNA and PFOA via the hydrophobic interaction, especially the formation of F···H hydrogen bonds by insertion of the difluoro-methylene group of PFOA into the DNA base pairs, was believed to be responsible for the dissociation or loosening of dsDNA structure, which inhibited the CT through DNA. A linear relationship between the ECL signal of the sensor and the logarithmical concentration of PFOA displayed a dynamic range of 1.00 × 10(-14)-1.00 × 10(-4) M, with a limit of detection of 1.00 × 10(-15) M at a signal-to-noise ratio of 3. Graphical Abstract Illustration of ECL detection of PFOA on a Au/dsDNA-QDs ECL-DNA sensor.

  14. Investigation of perfluorooctanoic acid induced DNA damage using electrogenerated chemiluminescence associated with charge transfer in DNA.

    PubMed

    Lu, Liping; Guo, Linqing; Li, Meng; Kang, Tianfang; Cheng, Shuiyuan; Miao, Wujian

    2016-10-01

    An electrogenerated chemiluminescence (ECL)-DNA sensor was designed and fabricated for the investigation of DNA damage by a potential environmental pollutant, perfluorooctanoic acid (PFOA). The ECL-DNA sensor consisted of a Au electrode that had a self-assembled monolayer of 15 base-pair double-stranded (ds) DNA oligonucleotides with covalently attached semiconductor CdSe quantum dots (QDs) at the distal end of the DNA. Characterization of the ECL-DNA sensor was conducted with X-ray photoelectron spectroscopy (XPS), electrochemical impedance spectroscopy (EIS), ECL, and cyclic voltammetry before and after the exposure of the sensor to PFOA. Consistent data revealed that the dsDNA on Au was severely damaged upon the incubation of the electrode in PFOA, causing significant increase in charge (or electron) transfer (CT) resistance within DNA strands. Consequently, the cathodic coreactant ECL responses of the Au/dsDNA-QDs electrode in the presence of K2S2O8 were markedly decreased. The strong interaction between DNA and PFOA via the hydrophobic interaction, especially the formation of F···H hydrogen bonds by insertion of the difluoro-methylene group of PFOA into the DNA base pairs, was believed to be responsible for the dissociation or loosening of dsDNA structure, which inhibited the CT through DNA. A linear relationship between the ECL signal of the sensor and the logarithmical concentration of PFOA displayed a dynamic range of 1.00 × 10(-14)-1.00 × 10(-4) M, with a limit of detection of 1.00 × 10(-15) M at a signal-to-noise ratio of 3. Graphical Abstract Illustration of ECL detection of PFOA on a Au/dsDNA-QDs ECL-DNA sensor. PMID:27108285

  15. Ribonucleic acid-protein cross-linking within the intact Escherichia coli ribosome, utilizing ethylene glycol bis[3-(2-ketobutyraldehyde) ether], a reversible, bifunctional reagent: identification of 30S proteins.

    PubMed

    Brewer, L A; Noller, H F

    1983-08-30

    To obtain detailed topographical information concerning the spatial arrangement of the multitude of ribosomal proteins with respect to specific sequences in the three RNA chains of intact ribosomes, a reagent capable of covalently and reversibly joining RNA to protein has been synthesized [Brewer, L.A., Goelz, S., & Noller, H. F. (1983) Biochemistry (preceding paper in this issue)]. This compound, ethylene glycol bis[3-(2-ketobutyraldehyde) ether] which we term "bikethoxal", possesses two reactive ends similar to kethoxal. Accordingly, it reacts selectively with guanine in single-stranded regions of nucleic acid and with arginine in protein. The cross-linking is reversible in that the arginine- and guanine-bikethoxal linkage can be disrupted by treatment with mild base, allowing identification of the linked RNA and protein components by standard techniques. Further, since the sites of kethoxal modification within the RNA sequences of intact subunits are known, the task of identifying the components of individual ribonucleoprotein complexes should be considerably simplified. About 15% of the ribosomal protein was covalently cross-linked to 16S RNA by bikethoxal under our standard reaction conditions, as monitored by comigration of 35S-labeled protein with RNA on Sepharose 4B in urea. Cross-linked 30S proteins were subsequently removed from 16S RNA by treatment with T1 ribonuclease and/or mild base cleavage of the reagent and were identified by two-dimensional polyacrylamide gel electrophoresis. The major 30S proteins found in cross-linked complexes are S4, S5, S6, S7, S8, S9 (S11), S16, and S18. The minor ones are S2, S3, S12, S13, S14, S15, and S17.

  16. Label-free potentiometry for detecting DNA hybridization using peptide nucleic acid and DNA probes.

    PubMed

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-02-07

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry.

  17. DNA Tetrominoes: The Construction of DNA Nanostructures Using Self-Organised Heterogeneous Deoxyribonucleic Acids Shapes

    PubMed Central

    Ong, Hui San; Rahim, Mohd Syafiq; Firdaus-Raih, Mohd; Ramlan, Effirul Ikhwan

    2015-01-01

    The unique programmability of nucleic acids offers alternative in constructing excitable and functional nanostructures. This work introduces an autonomous protocol to construct DNA Tetris shapes (L-Shape, B-Shape, T-Shape and I-Shape) using modular DNA blocks. The protocol exploits the rich number of sequence combinations available from the nucleic acid alphabets, thus allowing for diversity to be applied in designing various DNA nanostructures. Instead of a deterministic set of sequences corresponding to a particular design, the protocol promotes a large pool of DNA shapes that can assemble to conform to any desired structures. By utilising evolutionary programming in the design stage, DNA blocks are subjected to processes such as sequence insertion, deletion and base shifting in order to enrich the diversity of the resulting shapes based on a set of cascading filters. The optimisation algorithm allows mutation to be exerted indefinitely on the candidate sequences until these sequences complied with all the four fitness criteria. Generated candidates from the protocol are in agreement with the filter cascades and thermodynamic simulation. Further validation using gel electrophoresis indicated the formation of the designed shapes. Thus, supporting the plausibility of constructing DNA nanostructures in a more hierarchical, modular, and interchangeable manner. PMID:26258940

  18. Flexibility of nucleic acids: From DNA to RNA

    NASA Astrophysics Data System (ADS)

    Lei, Bao; Xi, Zhang; Lei, Jin; Zhi-Jie, Tan

    2016-01-01

    The structural flexibility of nucleic acids plays a key role in many fundamental life processes, such as gene replication and expression, DNA-protein recognition, and gene regulation. To obtain a thorough understanding of nucleic acid flexibility, extensive studies have been performed using various experimental methods and theoretical models. In this review, we will introduce the progress that has been made in understanding the flexibility of nucleic acids including DNAs and RNAs, and will emphasize the experimental findings and the effects of salt, temperature, and sequence. Finally, we will discuss the major unanswered questions in understanding the flexibility of nucleic acids. Project supported by the National Basic Research Program of China (Grant No. 2011CB933600), the National Natural Science Foundation of China (Grant Nos. 11175132, 11575128, and 11374234), and the Program for New Century Excellent Talents, China (Grant No. NCET 08-0408).

  19. Associations between Serum Perfluoroalkyl Acids and LINE-1 DNA Methylation

    PubMed Central

    Watkins, Deborah J.; Wellenius, Gregory A.; Butler, Rondi A.; Bartell, Scott M.; Fletcher, Tony; Kelsey, Karl T.

    2014-01-01

    Perfluoroalkyl acids (PFAAs) are persistent, synthetic compounds that are used in a number of consumer products. Perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS) have been associated with cardiovascular risk factors, and changes in gene expression and DNA methylation in animals and cellular systems. However, whether PFAA exposure is associated with LINE-1 DNA methylation, a potential marker of cardiovascular risk, in humans remains unknown. We sought to evaluate the cross-sectional associations between serum PFAAs and LINE-1 DNA methylation in a population highly exposed to PFOA. We measured serum PFAAs twice four to five years apart in 685 adult participants (47% male, mean age ± SD=42 ± 11 years). We measured percent LINE-1 DNA methylation in peripheral blood leukocytes at the second time point (follow-up), and estimated absolute differences in LINE-1 methylation associated with an interquartile (IQR) shift in mean PFAA serum levels. IQR increases in mean serum PFOA, PFOS, perfluorononanoic acid (PFNA), and perfluorohexane sulfonate (PFHxS) were associated with differences of −0.04 (p=0.16), 0.20 (p=0.001), 0.06 (p=0.19), and 0.02 (p=0.57), respectively, in % LINE-1 methylation at follow-up after adjustment for potential confounders. We observed a monotonic increase in LINE-1 DNA methylation across tertiles of PFOS and PFNA (ptrend=0.02 for both associations), but not across tertiles of PFOA or PFHxS (ptrend=0.71 and 0.44, respectively). In summary, serum PFOS was associated with LINE-1 methylation, while serum PFOA, PFHxS, and PFNA were not. Additional research is needed to more precisely determine whether these compounds are epigenetically active. PMID:24263140

  20. Cytoplasmic incorporation of a ribonucleic acid precursor in Amoeba proteus.

    PubMed

    PLAUT, W; RUSTAD, R C

    1957-07-25

    The question of RNA synthesis in enucleate cytoplasm of Amoeba has been approached experimentally by incubating enucleate amoebae in a labelled RNA precursor and determining the incorporation into RNA autoradiographically. The results indicate that there is a cytoplasmic incorporation mechanism which can operate in the absence of the nucleus. A comparison is made between Acetabularia and Amoeba with respect to the origins of cytoplasmic RNA. It is concluded that the existing data are consistent with the assumption that some cytoplasmic RNA is of nuclear origin in both organisms.

  1. Nucleic Acid-Peptide Complex Phase Controlled by DNA Hybridization

    NASA Astrophysics Data System (ADS)

    Vieregg, Jeffrey; Lueckheide, Michael; Leon, Lorraine; Marciel, Amanda; Tirrell, Matthew

    When polyanions and polycations are mixed, counterion release drives formation of polymer-rich complexes that can either be solid (precipitates) or liquid (coacervates) depending on the properties of the polyelectrolytes. These complexes are important in many fields, from encapsulation of industrial polymers to membrane-free segregation of biomolecules such as nucleic acids and proteins. Condensation of long double-stranded DNA has been studied for several decades, but comparatively little attention has been paid to the polyelectrolyte behavior of oligonucleotides. We report here studies of DNA oligonucleotides (10 - 88 nt) complexed with polylysine (10 - 100 aa). Unexpectedly, we find that the phase of the resulting complexes is controlled by the hybridization state of the nucleic acid, with double-stranded DNA forming precipitates and single-stranded DNA forming coacervates. Stability increases with polyelectrolyte length and decreases with solution salt concentration, with complexes of the longer double-stranded polymers undergoing precipitate/coacervate/soluble transitions as ionic strength is increased. Mixing coacervates formed by complementary single-stranded oligonucleotides results in precipitate formation, raising the possibility of stimulus-responsive material design.

  2. Characterization of DNA Binding and Retinoic Acid Binding Properties of Retinoic Acid Receptor

    NASA Astrophysics Data System (ADS)

    Yang, Na; Schule, Roland; Mangelsdorf, David J.; Evans, Ronald M.

    1991-05-01

    High-level expression of the full-length human retinoic acid receptor (RAR) α and the DNA binding domain of the RAR in Escherichia coli was achieved by using a T7 RNA polymerase-directed expression system. After induction, full-length RAR protein was produced at an estimated level of 20% of the total bacterial proteins. Both intact RAR molecules and the DNA binding domain bind to the cognate DNA response element with high specificity in the absence of retinoic acid. However, this binding is enhanced to a great extent upon the addition of eukaryotic cell extracts. The factor responsible for this enhancement is heat-sensitive and forms a complex with RAR that binds to DNA and exhibits a distinct migration pattern in the gel-mobility-shift assay. The interaction site of the factor with RAR is localized in the 70-amino acid DNA binding region of RAR. The hormone binding ability of the RARα protein was assayed by a charcoal absorption assay and the RAR protein was found to bind to retinoic acid with a K_d of 2.1 x 10-10 M.

  3. Complexing of amino acids to DNA by chromate in intact cells.

    PubMed Central

    Voitkun, V; Zhitkovich, A; Costa, M

    1994-01-01

    Using o-pthaldialdehyde (OPT) fluorescence, the amino acids associated with DNA were studied following exposure of intact Chinese hamster ovary cells to chromate. Rigorous extraction with EDTA, acid, or base was required to release the amino acids cross-linked to the DNA isolated from control or chromate-treated cells by standard procedures (i.e., proteinase K, phenol, etc.). Amino acids resisting extraction from DNA were not studied since analysis was limited to those that could be released by these procedures. There was a chromate dose-dependent increase in amino acids complexed with the DNA that could be released by EDTA, acid, and base, and these amino acids were separated by HPLC and identified. Substantial increases in cysteine, glutamine, glutamic acid, histidine, threonine, and tyrosine were found as a function of increasing concentrations of chromate. There was also a time-dependent increase in complexing of these amino acids to the DNA by chromate. The amino acids found complexed to DNA in intact cells by chromate were thought to originate from reactions of free amino acids or small peptides with the DNA rather than being proteolytic products derived from larger proteins that were cross-linked to the DNA. This was supported by a number of experiments: a) free amino acids or bovine serum albumin (BSA) were cross-linked by chromium to DNA in vitro and the DNA was isolated by standard procedures.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7843108

  4. Interaction of photosensitive surfactant with DNA and poly acrylic acid

    SciTech Connect

    Zakrevskyy, Yuriy Paasche, Jens; Lomadze, Nino; Santer, Svetlana; Cywinski, Piotr; Cywinska, Magdalena; Reich, Oliver; Löhmannsröben, Hans-Gerd

    2014-01-28

    In this paper, we investigate interactions and phase transitions in polyelectrolyte-surfactant complexes formed between a cationic azobenzene-containing surfactant and two types of polyelectrolytes: natural (DNA) or synthetic (PAA: poly acrylic acid). The construction of a phase diagram allowed distancing between four major phases: extended coil conformation, colloidally stable compacted globules, colloidal instability range, and surfactant-stabilized compact state. Investigation on the complexes’ properties in different phases and under irradiation with UV light provides information about the role of the surfactant's hydrophobic trans isomers both in the formation and destruction of DNA and PAA globules as well as in their colloidal stabilization. The trans isomer shows much stronger affinity to the polyelectrolytes than the hydrophilic cis counterpart. There is no need for complete compensation of the polyelectrolyte charges to reach the complete compaction. On contrary to the findings previously reported in the literature, we demonstrate – for the first time – complete polyelectrolyte compaction which occurs already at 20% of DNA (and at 50% of PAA) charge compensation. The trans isomer plays the main role in the compaction. The aggregation between azobenzene units in the photosensitive surfactant is a driving force of this process. The decompaction can be realized during UV light irradiation and is strongly influenced by the interplay between surfactant-surfactant and surfactant-DNA interactions in the compacted globules.

  5. Interaction of photosensitive surfactant with DNA and poly acrylic acid.

    PubMed

    Zakrevskyy, Yuriy; Cywinski, Piotr; Cywinska, Magdalena; Paasche, Jens; Lomadze, Nino; Reich, Oliver; Löhmannsröben, Hans-Gerd; Santer, Svetlana

    2014-01-28

    In this paper, we investigate interactions and phase transitions in polyelectrolyte-surfactant complexes formed between a cationic azobenzene-containing surfactant and two types of polyelectrolytes: natural (DNA) or synthetic (PAA: poly acrylic acid). The construction of a phase diagram allowed distancing between four major phases: extended coil conformation, colloidally stable compacted globules, colloidal instability range, and surfactant-stabilized compact state. Investigation on the complexes' properties in different phases and under irradiation with UV light provides information about the role of the surfactant's hydrophobic trans isomers both in the formation and destruction of DNA and PAA globules as well as in their colloidal stabilization. The trans isomer shows much stronger affinity to the polyelectrolytes than the hydrophilic cis counterpart. There is no need for complete compensation of the polyelectrolyte charges to reach the complete compaction. On contrary to the findings previously reported in the literature, we demonstrate - for the first time - complete polyelectrolyte compaction which occurs already at 20% of DNA (and at 50% of PAA) charge compensation. The trans isomer plays the main role in the compaction. The aggregation between azobenzene units in the photosensitive surfactant is a driving force of this process. The decompaction can be realized during UV light irradiation and is strongly influenced by the interplay between surfactant-surfactant and surfactant-DNA interactions in the compacted globules. PMID:25669583

  6. Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.

    PubMed

    Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay

    2014-05-01

    The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.

  7. A DNA origami nanorobot controlled by nucleic acid hybridization.

    PubMed

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators.

  8. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  9. DNA adsorption to and elution from silica surfaces: influence of amino acid buffers.

    PubMed

    Vandeventer, Peter E; Mejia, Jorge; Nadim, Ali; Johal, Malkiat S; Niemz, Angelika

    2013-09-19

    Solid phase extraction and purification of DNA from complex samples typically requires chaotropic salts that can inhibit downstream polymerase amplification if carried into the elution buffer. Amino acid buffers may serve as a more compatible alternative for modulating the interaction between DNA and silica surfaces. We characterized DNA binding to silica surfaces, facilitated by representative amino acid buffers, and the subsequent elution of DNA from the silica surfaces. Through bulk depletion experiments, we found that more DNA adsorbs to silica particles out of positively compared to negatively charged amino acid buffers. Additionally, the type of the silica surface greatly influences the amount of DNA adsorbed and the final elution yield. Quartz crystal microbalance experiments with dissipation monitoring (QCM-D) revealed multiphasic DNA adsorption out of stronger adsorbing conditions such as arginine, glycine, and glutamine, with DNA more rigidly bound during the early stages of the adsorption process. The DNA film adsorbed out of glutamate was more flexible and uniform throughout the adsorption process. QCM-D characterization of DNA elution from the silica surface indicates an uptake in water mass during the initial stage of DNA elution for the stronger adsorbing conditions, which suggests that for these conditions the DNA film is partly dehydrated during the prior adsorption process. Overall, several positively charged and polar neutral amino acid buffers show promise as an alternative to methods based on chaotropic salts for solid phase DNA extraction.

  10. Protective Effect of Folic Acid on Oxidative DNA Damage

    PubMed Central

    Guo, Xiaojuan; Cui, Huan; Zhang, Haiyang; Guan, Xiaoju; Zhang, Zheng; Jia, Chaonan; Wu, Jia; Yang, Hui; Qiu, Wenting; Zhang, Chuanwu; Yang, Zuopeng; Chen, Zhu; Mao, Guangyun

    2015-01-01

    Abstract Although previous reports have linked DNA damage with both transmissions across generations as well as our own survival, it is unknown how to reverse the lesion. Based on the data from a Randomized, Double-blind, Placebo Controlled Clinical Trial, this study aimed to assess the efficacy of folic acid supplementation (FAS) on DNA oxidative damage reversal. In this randomized clinical trial (RCT), a total of 450 participants were enrolled and randomly assigned to 3 groups to receive folic acid (FA) 0.4 mg/day (low-FA), 0.8 mg/day (high-FA), or placebo (control) for 8 weeks. The urinary 8-hydroxy-2’-deoxyguanosine (8-OHdG) and creatinine (Cr) concentration at pre- and post-FAS were measured with modified enzyme-linked immunosorbent assay (ELISA) and high-performance liquid chromatography (HPLC), respectively. A multivariate general linear model was applied to assess the individual effects of FAS and the joint effects between FAS and hypercholesterolemia on oxidative DNA damage improvement. This clinical trial was registered with ClinicalTrials.gov, number NCT02235948. Of the 438 subjects that received FA fortification or placebo, the median (first quartile, third quartile) of urinary 8-OHdG/Cr for placebo, low-FA, and high-FA groups were 58.19 (43.90, 82.26), 53.51 (38.97, 72.74), 54.73 (39.58, 76.63) ng/mg at baseline and 57.77 (44.35, 81.33), 51.73 (38.20, 71.30), and 50.65 (37.64, 76.17) ng/mg at the 56th day, respectively. A significant decrease of urinary 8-OHdG was observed after 56 days FA fortification (P < 0.001). Compared with the placebo, after adjusting for some potential confounding factors, including the baseline urinary 8-OHdG/Cr, the urinary 8-OHdG/Cr concentration significantly decreased after 56 days FAS [β (95% confidence interval) = −0.88 (−1.62, −0.14) and P = 0.020 for low-FA; and β (95% confidence interval) = −2.68 (−3.42, −1.94) and P < 0.001 for high-FA] in a dose-response fashion (Ptrend

  11. PLASMID DNA DAMAGE CAUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN

    EPA Science Inventory

    PLASMID DNA DAMAGE CAOUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN

    ABSTRACT

    Both dimethylarsinic acid (DMA(V)) and dimethylarsinous acid (DMA(III)) release iron from human liver ferritin (HLF) with or without the presence of ascorbic acid. ...

  12. Inhibition of DNA methylation by caffeic acid and chlorogenic acid, two common catechol-containing coffee polyphenols.

    PubMed

    Lee, Won Jun; Zhu, Bao Ting

    2006-02-01

    We studied the modulating effects of caffeic acid and chlorogenic acid (two common coffee polyphenols) on the in vitro methylation of synthetic DNA substrates and also on the methylation status of the promoter region of a representative gene in two human cancer cells lines. Under conditions that were suitable for the in vitro enzymatic methylation of DNA and dietary catechols, we found that the presence of caffeic acid or chlorogenic acid inhibited in a concentration-dependent manner the DNA methylation catalyzed by prokaryotic M.SssI DNA methyltransferase (DNMT) and human DNMT1. The IC50 values of caffeic acid and chlorogenic acid were 3.0 and 0.75 microM, respectively, for the inhibition of M.SssI DNMT-mediated DNA methylation, and were 2.3 and 0.9 microM, respectively, for the inhibition of human DNMT1-mediated DNA methylation. The maximal in vitro inhibition of DNA methylation was approximately 80% when the highest concentration (20 microM) of caffeic acid or chlorogenic acid was tested. Kinetic analyses showed that DNA methylation catalyzed by M.SssI DNMT or human DNMT1 followed the Michaelis-Menten curve patterns. The presence of caffeic acid or chlorogenic acid inhibited DNA methylation predominantly through a non-competitive mechanism, and this inhibition was largely due to the increased formation of S-adenosyl-L-homocysteine (SAH, a potent inhibitor of DNA methylation), resulting from the catechol-O-methyltransferase (COMT)-mediated O-methylation of these dietary catechols. Using cultured MCF-7 and MAD-MB-231 human breast cancer cells, we also demonstrated that treatment of these cells with caffeic acid or chlorogenic acid partially inhibited the methylation of the promoter region of the RARbeta gene. The findings of our present study provide a general mechanistic basis for the notion that a variety of dietary catechols can function as inhibitors of DNA methylation through increased formation of SAH during the COMT-mediated O-methylation of these dietary

  13. Molecular beacons: a novel DNA probe for nucleic acid and protein studies.

    PubMed

    Tan, W; Fang, X; Li, J; Liu, X

    2000-04-01

    A new concept has been introduced for molecular beacon DNA molecules. Molecular beacons are a new class of oligonucleotides that can report the presence of specific nucleic acids in both homogeneous solutions and at the liquid-solid interface. They emit an intense fluorescent signal only when hybridized to their target DNA or RNA molecules. Biotinylated molecular beacons have been designed and used for the development of ultrasensitive DNA sensors and for DNA molecular interaction studies at a solid-liquid interface. Molecular beacons have also been used to study protein-DNA interactions. They have provided a variety of exciting opportunities in DNA/RNA/protein studies.

  14. Chimeric RNA-DNA molecular beacons for quantification of nucleic acids, single nucleotide polymophisms, and nucleic acid damage.

    PubMed

    El-Yazbi, Amira F; Loppnow, Glen R

    2013-05-01

    Single nucleotide polymorphisms (SNPs) are the main cause for variations in the human genome. DNA lesions, such as cyclobutane pyrimidine dimers (CPDs), [6-4] pyrimidine-pyrimidinones, dewar pyrimidinones, and photohydrates, can subsequently lead to mutagenesis, carcinogenesis, and cell death. Much effort has focused on methods for detecting DNA, SNPs, or damaged nucleic acids. However, almost all of the proposed methods consist of multistep procedures, are limited to specific types of damage, some of these methods require expensive instruments, and some suffer from a high level of interferences. In this paper, we present a novel, simple, mix-and-read assay for the detection of nucleic acids that is general for all types of SNPs and nucleic acid damage. This method uses a chimeric RNA-DNA molecular beacon (chMB). The calibration curve of the chMB for detecting single base mismatch and ultraviolet (UV)-induced DNA damage shows good linearity (R(2) = 0.981 and 0.996, respectively) and limits of detection of 10.4 ± 2.2 and 8.64 ± 1.2 nM, respectively. The chimeric RNA-DNA MB proves to be a more sensitive and selective tool for the quantification of nucleic acids, DNA mismatches, and UV-induced DNA damage than DNA MBs.

  15. Human liver apolipoprotein B-100 cDNA: complete nucleic acid and derived amino acid sequence.

    PubMed Central

    Law, S W; Grant, S M; Higuchi, K; Hospattankar, A; Lackner, K; Lee, N; Brewer, H B

    1986-01-01

    Human apolipoprotein B-100 (apoB-100), the ligand on low density lipoproteins that interacts with the low density lipoprotein receptor and initiates receptor-mediated endocytosis and low density lipoprotein catabolism, has been cloned, and the complete nucleic acid and derived amino acid sequences have been determined. ApoB-100 cDNAs were isolated from normal human liver cDNA libraries utilizing immunoscreening as well as filter hybridization with radiolabeled apoB-100 oligodeoxynucleotides. The apoB-100 mRNA is 14.1 kilobases long encoding a mature apoB-100 protein of 4536 amino acids with a calculated amino acid molecular weight of 512,723. ApoB-100 contains 20 potential glycosylation sites, and 12 of a total of 25 cysteine residues are located in the amino-terminal region of the apolipoprotein providing a potential globular structure of the amino terminus of the protein. ApoB-100 contains relatively few regions of amphipathic helices, but compared to other human apolipoproteins it is enriched in beta-structure. The delineation of the entire human apoB-100 sequence will now permit a detailed analysis of the conformation of the protein, the low density lipoprotein receptor binding domain(s), and the structural relationship between apoB-100 and apoB-48 and will provide the basis for the study of genetic defects in apoB-100 in patients with dyslipoproteinemias. PMID:3464946

  16. Target Biological Structures: The Cell, Organelles, DNA and RNA

    NASA Astrophysics Data System (ADS)

    van Holst, Marcelis; Grant, Maxine P.; Aldrich-Wright, Janice

    Living organisms are self replicating molecular factories of staggering complexity [1]. As a result, we are often overwhelmed when trying to identify potential targets for therapeutics. Water, inorganic ions and a large array of relatively small organic molecules (e.g., sugars, vitamins and fatty acids) account for approximately 80% of living matter, with water being the most abundant. Macromolecules such as proteins, polysaccharides, ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) constitute the rest. The majority of potential therapeutic targets are found within the cell. Small molecules which are vital for cellular function are imported into the cell by a variety of mechanisms but unlike smaller molecules, macromolecules are assembled within the cell itself. Drugs are usually designed to target cellular macromolecules, as they perform very specific roles in the metabolic processes.

  17. Oligonucleotide-based systems: DNA, microRNAs, DNA/RNA aptamers

    PubMed Central

    Jolly, Pawan; Estrela, Pedro

    2016-01-01

    There are an increasing number of applications that have been developed for oligonucleotide-based biosensing systems in genetics and biomedicine. Oligonucleotide-based biosensors are those where the probe to capture the analyte is a strand of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or a synthetic analogue of naturally occurring nucleic acids. This review will shed light on various types of nucleic acids such as DNA and RNA (particularly microRNAs), their role and their application in biosensing. It will also cover DNA/RNA aptamers, which can be used as bioreceptors for a wide range of targets such as proteins, small molecules, bacteria and even cells. It will also highlight how the invention of synthetic oligonucleotides such as peptide nucleic acid (PNA) or locked nucleic acid (LNA) has pushed the limits of molecular biology and biosensor development to new perspectives. These technologies are very promising albeit still in need of development in order to bridge the gap between the laboratory-based status and the reality of biomedical applications. PMID:27365033

  18. Oligonucleotide-based systems: DNA, microRNAs, DNA/RNA aptamers.

    PubMed

    Jolly, Pawan; Estrela, Pedro; Ladomery, Michael

    2016-06-30

    There are an increasing number of applications that have been developed for oligonucleotide-based biosensing systems in genetics and biomedicine. Oligonucleotide-based biosensors are those where the probe to capture the analyte is a strand of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or a synthetic analogue of naturally occurring nucleic acids. This review will shed light on various types of nucleic acids such as DNA and RNA (particularly microRNAs), their role and their application in biosensing. It will also cover DNA/RNA aptamers, which can be used as bioreceptors for a wide range of targets such as proteins, small molecules, bacteria and even cells. It will also highlight how the invention of synthetic oligonucleotides such as peptide nucleic acid (PNA) or locked nucleic acid (LNA) has pushed the limits of molecular biology and biosensor development to new perspectives. These technologies are very promising albeit still in need of development in order to bridge the gap between the laboratory-based status and the reality of biomedical applications. PMID:27365033

  19. Method for nucleic acid hybridization using single-stranded DNA binding protein

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1996-01-01

    Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.

  20. Nucleic acid chemistry in the organic phase: from functionalized oligonucleotides to DNA side chain polymers.

    PubMed

    Liu, Kai; Zheng, Lifei; Liu, Qing; de Vries, Jan Willem; Gerasimov, Jennifer Y; Herrmann, Andreas

    2014-10-01

    DNA-incorporating hydrophobic moieties can be synthesized by either solid-phase or solution-phase coupling. On a solid support the DNA is protected, and hydrophobic units are usually attached employing phosphoramidite chemistry involving a DNA synthesizer. On the other hand, solution coupling in aqueous medium results in low yields due to the solvent incompatibility of DNA and hydrophobic compounds. Hence, the development of a general coupling method for producing amphiphilic DNA conjugates with high yield in solution remains a major challenge. Here, we report an organic-phase coupling strategy for nucleic acid modification and polymerization by introducing a hydrophobic DNA-surfactant complex as a reactive scaffold. A remarkable range of amphiphile-DNA structures (DNA-pyrene, DNA-triphenylphosphine, DNA-hydrocarbon, and DNA block copolymers) and a series of new brush-type DNA side-chain homopolymers with high DNA grafting density are produced efficiently. We believe that this method is an important breakthrough in developing a generalized approach to synthesizing functional DNA molecules for self-assembly and related technological applications.

  1. Site-Selective Binding of Nanoparticles to Double-Stranded DNA via Peptide Nucleic Acid "Invasion"

    SciTech Connect

    Stadler, A.L.; van der Lelie, D.; Sun, D.; Maye, M. M.; Gang, O.

    2011-04-01

    We demonstrate a novel method for by-design placement of nano-objects along double-stranded (ds) DNA. A molecular intercalator, designed as a peptide nucleic acid (PNA)-DNA chimera, is able to invade dsDNA at the PNA-side due to the hybridization specificity between PNA and one of the duplex strands. At the same time, the single-stranded (ss) DNA tail of the chimera, allows for anchoring of nano-objects that have been functionalized with complementary ssDNA. The developed method is applied for interparticle attachment and for the fabrication of particle clusters using a dsDNA template. This method significantly broadens the molecular toolbox for constructing nanoscale systems by including the most conventional not yet utilized DNA motif, double helix DNA.

  2. Oxidative DNA damage induced by aminoacetone, an amino acid metabolite.

    PubMed

    Hiraku, Y; Sugimoto, J; Yamaguchi, T; Kawanishi, S

    1999-05-01

    We investigated DNA damage induced by aminoacetone, a metabolite of threonine and glycine. Pulsed-field gel electrophoresis revealed that aminoacetone caused cellular DNA cleavage. Aminoacetone increased the amount of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) in human cultured cells in a dose-dependent manner. The formation of 8-oxodG in calf thymus DNA increased due to aminoacetone only in the presence of Cu(II). DNA ladder formation was observed at higher concentrations of aminoacetone than those causing DNA cleavage. Flow cytometry showed that aminoacetone enhanced the generation of hydrogen peroxide (H2O2) in cultured cells. Aminoacetone caused damage to 32P-5'-end-labeled DNA fragments, obtained from the human c-Ha-ras-1 and p53 genes, at cytosine and thymine residues in the presence of Cu(II). Catalase and bathocuproine inhibited DNA damage, suggesting that H2O2 and Cu(I) were involved. Analysis of the products generated from aminoacetone revealed that aminoacetone underwent Cu(II)-mediated autoxidation in two different pathways: the major pathway in which methylglyoxal and NH+4 are generated and the minor pathway in which 2,5-dimethylpyrazine is formed through condensation of two molecules of aminoacetone. These findings suggest that H2O2 generated by the autoxidation of aminoacetone reacts with Cu(I) to form reactive species capable of causing oxidative DNA damage.

  3. DNA Diagnostics: Nanotechnology-enhanced Electrochemical Detection of Nucleic Acids

    PubMed Central

    Wei, Fang; Lillehoj, Peter B.; Ho, Chih-Ming

    2010-01-01

    The detection of mismatched base pairs in DNA plays a crucial role in the diagnosis of genetic-related diseases and conditions, especially for early stage treatment. Among the various biosensors that have been employed for DNA detection, electrochemical sensors show great promise since they are capable of precise DNA recognition and efficient signal transduction. Advancements in micro- and nanotechnologies, specifically fabrication techniques and new nanomaterials, have enabled for the development of highly sensitive, highly specific sensors making them attractive for the detection of small sequence variations. Furthermore, the integration of sensors with sample preparation and fluidic processes enables for rapid, multiplexed DNA detection for point-of-care (POC) clinical diagnostics. PMID:20075759

  4. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells.

    PubMed

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells' molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  5. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  6. Synthesis of nucleoside and nucleotide conjugates of bile acids, and polymerase construction of bile acid-functionalized DNA.

    PubMed

    Ikonen, Satu; Macícková-Cahová, Hana; Pohl, Radek; Sanda, Miloslav; Hocek, Michal

    2010-03-01

    Aqueous Sonogashira cross-coupling reactions of 5-iodopyrimidine or 7-iodo-7-deazaadenine nucleosides with bile acid-derived terminal acetylenes linked via an ester or amide tether gave the corresponding bile acid-nucleoside conjugates. Analogous reactions of halogenated nucleoside triphosphates gave directly bile acid-modified dNTPs. Enzymatic incorporation of these modified nucleotides to DNA was successfully performed using Phusion polymerase for primer extension. One of the dNTPs (dCTP bearing cholic acid) was also efficient for PCR amplification. PMID:20165813

  7. Superior structure stability and selectivity of hairpin nucleic acid probes with an L-DNA stem.

    PubMed

    Kim, Youngmi; Yang, Chaoyong James; Tan, Weihong

    2007-01-01

    Hairpin nucleic acid probes have been highly useful in many areas, especially for intracellular and in vitro nucleic acid detection. The success of these probes can be attributed to the ease with which their conformational change upon target binding can be coupled to a variety of signal transduction mechanisms. However, false-positive signals arise from the opening of the hairpin due mainly to thermal fluctuations and stem invasions. Stem invasions occur when the stem interacts with its complementary sequence and are especially problematic in complex biological samples. To address the problem of stem invasions in hairpin probes, we have created a modified molecular beacon that incorporates unnatural enantiomeric l-DNA in the stem and natural d-DNA or 2'-O-Me-modified RNA in the loop. l-DNA has the same physical characteristics as d-DNA except that l-DNA cannot form stable duplexes with d-DNA. Here we show that incorporating l-DNA into the stem region of a molecular beacon reduces intra- and intermolecular stem invasions, increases the melting temperature, improves selectivity to its target, and leads to enhanced bio-stability. Our results suggest that l-DNA is useful for designing functional nucleic acid probes especially for biological applications.

  8. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  9. Biodegradable DNA-Brush Block Copolymer Spherical Nucleic Acids Enable Transfection Agent-Free Intracellular Gene Regulation.

    PubMed

    Zhang, Chuan; Hao, Liangliang; Calabrese, Colin M; Zhou, Yu; Choi, Chung Hang J; Xing, Hang; Mirkin, Chad A

    2015-10-28

    By grafting multiple DNA strands onto one terminus of a polyester chain, a DNA-brush block copolymer that can assemble into micelle structure is constructed. These micelle spherical nucleic acids have a density of nucleic acids that is substantively higher than linear DNA block copolymer structures, which makes them effective cellular transfection and intracellular gene regulation agents.

  10. Amino acid racemization in amber-entombed insects: implications for DNA preservation

    NASA Technical Reports Server (NTRS)

    Bada, J. L.; Wang, X. S.; Poinar, H. N.; Paabo, S.; Poinar, G. O.

    1994-01-01

    DNA depurination and amino acid racemization take place at similar rates in aqueous solution at neutral pH. This relationship suggests that amino acid racemization may be useful in accessing the extent of DNA chain breakage in ancient biological remains. To test this suggestion, we have investigated the amino acids in insects entombed in fossilized tree resins ranging in age from <100 years to 130 million years. The amino acids present in 40 to 130 million year old amber-entombed insects resemble those in a modern fly and are probably the most ancient, unaltered amino acids found so far on Earth. In comparison to other geochemical environments on the surface of the Earth, the amino acid racemization rate in amber insect inclusions is retarded by a factor of >10(4). These results suggest that in amber insect inclusions DNA depurination rates would also likely be retarded in comparison to aqueous solution measurements, and thus DNA fragments containing many hundreds of base pairs should be preserved. This conclusion is consistent with the reported successful retrieval of DNA sequences from amber-entombed organisms.

  11. End invasion of peptide nucleic acids (PNAs) with mixed-base composition into linear DNA duplexes.

    PubMed

    Smolina, Irina V; Demidov, Vadim V; Soldatenkov, Viatcheslav A; Chasovskikh, Sergey G; Frank-Kamenetskii, Maxim D

    2005-01-01

    Peptide nucleic acid (PNA) is a synthetic DNA mimic with valuable properties and a rapidly growing scope of applications. With the exception of recently introduced pseudocomplementary PNAs, binding of common PNA oligomers to target sites located inside linear double-stranded DNAs (dsDNAs) is essentially restricted to homopurine-homopyrimidine sequence motifs, which significantly hampers some of the PNA applications. Here, we suggest an approach to bypass this limitation of common PNAs. We demonstrate that PNA with mixed composition of ordinary nucleobases is capable of sequence-specific targeting of complementary dsDNA sites if they are located at the very termini of DNA duplex. We then show that such targeting makes it possible to perform capturing of designated dsDNA fragments via the DNA-bound biotinylated PNA as well as to signal the presence of a specific dsDNA sequence, in the case a PNA beacon is employed. We also examine the PNA-DNA conjugate and prove that it can initiate the primer-extension reaction starting from the duplex DNA termini when a DNA polymerase with the strand-displacement ability is used. We thus conclude that recognition of duplex DNA by mixed-base PNAs via the end invasion has a promising potential for site-specific and sequence-unrestricted DNA manipulation and detection.

  12. Evaluation of DNA/RNAshells for room temperature nucleic acids storage.

    PubMed

    Liu, Xiaopan; Li, Qiyuan; Wang, Xian; Zhou, Xiaolin; He, Xuheng; Liao, Qiuyan; Zhu, Fengqin; Cheng, Le; Zhang, Yong

    2015-02-01

    Traditional nucleic acids preservation methods rely on maintaining samples in cold environments, which are costly to operate and time sensitive. Recent work validated that using room temperature for the storage of nucleic acids is possible if the samples are completely protected from water and oxygen. Here, we conducted accelerated aging and real-time degradation studies to evaluate the new technology DNAshell and RNAshell, which preserves DNA and RNA at room temperature, including the DNA and RNA yield, purity, and integrity. DNA and RNA solutions are dried in the presence of stabilizers in stainless steel minicapsules, then redissolved after different time points of heating and storing at room temperature. Results show that DNAshell and RNAshell ensure the safe storage of nucleic acids at room temperature for long periods of time, and that the quality of these nucleic acids is suitable for common downstream analysis.

  13. Uracil misincorporation into DNA and folic acid supplementation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BACKGROUND: Folate deficiency decreases thymidylate synthesis from deoxyuridylate, which results in an imbalance of deoxyribonucleotide that may lead to excessive uracil misincorporation (UrMis) into DNA during replication and repair. OBJECTIVE: We evaluated the relation between UrMis in different ...

  14. Single molecule DNA interaction kinetics of retroviral nucleic acid chaperone proteins

    NASA Astrophysics Data System (ADS)

    Williams, Mark

    2010-03-01

    Retroviral nucleocapsid (NC) proteins are essential for several viral replication processes including specific genomic RNA packaging and reverse transcription. The nucleic acid chaperone activity of NC facilitates the latter process. In this study, we use single molecule biophysical methods to quantify the DNA interactions of wild type and mutant human immunodeficiency virus type 1 (HIV-1) NC and Gag and human T-cell leukemia virus type 1 (HTLV-1) NC. We find that the nucleic acid interaction properties of these proteins differ significantly, with HIV-1 NC showing rapid protein binding kinetics, significant duplex destabilization, and strong DNA aggregation, all properties that are critical components of nucleic acid chaperone activity. In contrast, HTLV-1 NC exhibits significant destabilization activity but extremely slow DNA interaction kinetics and poor aggregating capability, which explains why HTLV-1 NC is a poor nucleic acid chaperone. To understand these results, we developed a new single molecule method for quantifying protein dissociation kinetics, and applied this method to probe the DNA interactions of wild type and mutant HIV-1 and HTLV-1 NC. We find that mutations to aromatic and charged residues strongly alter the proteins' nucleic acid interaction kinetics. Finally, in contrast to HIV-1 NC, HIV-1 Gag, the nucleic acid packaging protein that contains NC as a domain, exhibits relatively slow binding kinetics, which may negatively impact its ability to act as a nucleic acid chaperone.

  15. Switchable reconfiguration of nucleic acid nanostructures by stimuli-responsive DNA machines.

    PubMed

    Liu, Xiaoqing; Lu, Chun-Hua; Willner, Itamar

    2014-06-17

    CONSPECTUS: The base sequence in DNA dictates structural and reactivity features of the biopolymer. These properties are implemented to use DNA as a unique material for developing the area of DNA nanotechnology. The design of DNA machines represents a rapidly developing research field in the area of DNA nanotechnology. The present Account discusses the switchable reconfiguration of nucleic acid nanostructures by stimuli-responsive DNA machines, and it highlights potential applications and future perspectives of the area. Programmed switchable DNA machines driven by various fuels and antifuels, such as pH, Hg(2+) ions/cysteine, or nucleic acid strands/antistrands, are described. These include the assembly of DNA tweezers, walkers, a rotor, a pendulum, and more. Using a pH-oscillatory system, the oscillatory mechanical operation of a DNA pendulum is presented. Specifically, the synthesis and "mechanical" properties of interlocked DNA rings are described. This is exemplified with the preparation of interlocked DNA catenanes and a DNA rotaxane. The dynamic fuel-driven reconfiguration of the catenane/rotaxane structures is followed by fluorescence spectroscopy. The use of DNA machines as functional scaffolds to reconfigurate Au nanoparticle assemblies and to switch the fluorescence features within fluorophore/Au nanoparticle conjugates between quenching and surface-enhanced fluorescence states are addressed. Specifically, the fluorescence features of the different DNA machines are characterized as a function of the spatial separation between the fluorophore and Au nanoparticles. The experimental results are supported by theoretical calculations. The future development of reconfigurable stimuli-responsive DNA machines involves fundamental challenges, such as the synthesis of molecular devices exhibiting enhanced complexities, the introduction of new fuels and antifuels, and the integration of new payloads being reconfigured by the molecular devices, such as enzymes or

  16. Affinity purification of DNA and RNA from environmental samples with peptide nucleic acid clamps.

    PubMed

    Chandler, D P; Stults, J R; Cebula, S; Schuck, B L; Weaver, D W; Anderson, K K; Egholm, M; Brockman, F J

    2000-08-01

    Bispeptide nucleic acids (bis-PNAs; PNA clamps), PNA oligomers, and DNA oligonucleotides were evaluated as affinity purification reagents for subfemtomolar 16S ribosomal DNA (rDNA) and rRNA targets in soil, sediment, and industrial air filter nucleic acid extracts. Under low-salt hybridization conditions (10 mM NaPO(4), 5 mM disodium EDTA, and 0.025% sodium dodecyl sulfate [SDS]) a PNA clamp recovered significantly more target DNA than either PNA or DNA oligomers. The efficacy of PNA clamps and oligomers was generally enhanced in the presence of excess nontarget DNA and in a low-salt extraction-hybridization buffer. Under high-salt conditions (200 mM NaPO(4), 100 mM disodium EDTA, and 0.5% SDS), however, capture efficiencies with the DNA oligomer were significantly greater than with the PNA clamp and PNA oligomer. Recovery and detection efficiencies for target DNA concentrations of > or =100 pg were generally >20% but depended upon the specific probe, solution background, and salt condition. The DNA probe had a lower absolute detection limit of 100 fg of target (830 zM [1 zM = 10(-21) M]) in high-salt buffer. In the absence of exogenous DNA (e.g., soil background), neither the bis-PNA nor the PNA oligomer achieved the same absolute detection limit even under a more favorable low-salt hybridization condition. In the presence of a soil background, however, both PNA probes provided more sensitive absolute purification and detection (830 zM) than the DNA oligomer. In varied environmental samples, the rank order for capture probe performance in high-salt buffer was DNA > PNA > clamp. Recovery of 16S rRNA from environmental samples mirrored quantitative results for DNA target recovery, with the DNA oligomer generating more positive results than either the bis-PNA or PNA oligomer, but PNA probes provided a greater incidence of detection from environmental samples that also contained a higher concentration of nontarget DNA and RNA. Significant interactions between probe

  17. DNA fingerprinting of lactic acid bacteria in sauerkraut fermentations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous studies using traditional biochemical methods to study the ecology of commercial sauerkraut fermentations revealed that four lactic acid bacteria species, Leuconostoc mesenteroides, Lactobacillus plantarum, Pediococcus pentosaceus, and Lactobacillus brevis were the primary microorganisms in...

  18. The nitrosated bile acid DNA lesion O6-carboxymethylguanine is a substrate for the human DNA repair protein O6-methylguanine-DNA methyltransferase

    PubMed Central

    Senthong, Pattama; Millington, Christopher L.; Wilkinson, Oliver J.; Marriott, Andrew S.; Watson, Amanda J.; Reamtong, Onrapak; Eyers, Claire E.; Williams, David M.; Margison, Geoffrey P.; Povey, Andrew C.

    2013-01-01

    The consumption of red meat is a risk factor in human colorectal cancer (CRC). One hypothesis is that red meat facilitates the nitrosation of bile acid conjugates and amino acids, which rapidly convert to DNA-damaging carcinogens. Indeed, the toxic and mutagenic DNA adduct O6-carboxymethylguanine (O6-CMG) is frequently present in human DNA, increases in abundance in people with high levels of dietary red meat and may therefore be a causative factor in CRC. Previous reports suggested that O6-CMG is not a substrate for the human version of the DNA damage reversal protein O6-methylguanine-DNA methyltransferase (MGMT), which protects against the genotoxic effects of other O6-alkylguanine lesions by removing alkyl groups from the O6-position. We now show that synthetic oligodeoxyribonucleotides containing the known MGMT substrate O6-methylguanine (O6-MeG) or O6-CMG effectively inactivate MGMT in vitro (IC50 0.93 and 1.8 nM, respectively). Inactivation involves the removal of the O6-alkyl group and its transfer to the active-site cysteine residue of MGMT. O6-CMG is therefore an MGMT substrate, and hence MGMT is likely to be a protective factor in CRC under conditions where O6-CMG is a potential causative agent. PMID:23335782

  19. Calcium-activated gene transfection from DNA/poly(amic acid-co-imide) complexes.

    PubMed

    Wu, Szu-Yuan; Chang, Li-Ting; Peng, Sydeny; Tsai, Hsieh-Chih

    2015-01-01

    In this study, we synthesized a water-soluble poly(amic acid-co-imide) (PA-I) from ethylenediaminetetraacetic dianhydride (EDTA) and 2,2'-(ethylenedioxy)bis(ethylamine) that possesses comparable transfection efficiency to that of polyethylenimine (PEI), when prepared in combination with divalent calcium cations. The polycondensation of monomers afforded poly(amic acid) (PA) precursors, and subsequent thermal imidization resulted in the formation of PA-I. At a polymer/DNA ratio (indicated by the molar ratio of nitrogen in the polymer to phosphate in DNA) of 40, complete retardation of the DNA band was observed by gel electrophoresis, indicating the strong association of DNA with PA-I. A zeta potential of -22 mV was recorded for the PA-I polymer solution, and no apparent cytotoxicity was observed at concentrations up to 500 μg·mL(-1). In the presence of divalent Ca(2+), the transfection efficiency of PA-I was higher than that of PA, due to the formation of a copolymer/Ca(2+)/DNA polyplex and the reduction in negative charge due to thermal cyclization. Interestingly, a synergistic effect of Ca(2+) and the synthesized copolymer on DNA transfection was observed. The use of Ca(2+) or copolymer alone resulted in unsatisfactory delivery, whereas the formation of three-component polyplexes synergistically increased DNA transfection. Our findings demonstrated that a PA-I/Ca(2+)/DNA polyplex could serve as a promising candidate for gene delivery.

  20. Role of amino acid insertions on intermolecular forces between arginine peptide condensed DNA helices: implications for protamine-DNA packaging in sperm.

    PubMed

    DeRouchey, Jason E; Rau, Donald C

    2011-12-01

    In spermatogenesis, chromatin histones are replaced by arginine-rich protamines to densely compact DNA in sperm heads. Tight packaging is considered necessary to protect the DNA from damage. To better understand the nature of the forces condensing protamine-DNA assemblies and their dependence on amino acid content, the effect of neutral and negatively charged amino acids on DNA-DNA intermolecular forces was studied using model peptides containing six arginines. We have previously observed that the neutral amino acids in salmon protamine decrease the net attraction between protamine-DNA helices compared with the equivalent homo-arginine peptide. Using osmotic stress coupled with x-ray scattering, we have investigated the component attractive and repulsive forces that determine the net attraction and equilibrium interhelical distance as a function of the chemistry, position, and number of the amino acid inserted. Neutral amino acids inserted into hexa-arginine increase the short range repulsion while only slightly affecting longer range attraction. The amino acid content alone of salmon protamine is enough to rationalize the forces that package DNA in sperm heads. Inserting a negatively charged amino acid into hexa-arginine dramatically weakens the net attraction. Both of these observations have biological implications for protamine-DNA packaging in sperm heads.

  1. Switchable mechanical DNA ``arms'' operating on nucleic acid scaffolds associated with electrodes or semiconductor quantum dots

    NASA Astrophysics Data System (ADS)

    Pelossof, Gilad; Tel-Vered, Ran; Liu, Xiaoqing; Willner, Itamar

    2013-09-01

    Functional footholds linked to DNA scaffolds associated with surfaces provide nano-engineered assemblies acting as switching devices. By the assembly of a β-cyclodextrin receptor on one foothold, and a ferrocene-modified nucleic acid on a second foothold, the switchable and reversible, fuel-driven activation of ``molecular arms'' proceeds, transduced by electrochemical or optical signals.Functional footholds linked to DNA scaffolds associated with surfaces provide nano-engineered assemblies acting as switching devices. By the assembly of a β-cyclodextrin receptor on one foothold, and a ferrocene-modified nucleic acid on a second foothold, the switchable and reversible, fuel-driven activation of ``molecular arms'' proceeds, transduced by electrochemical or optical signals. Electronic supplementary information (ESI) available: Experimental procedures, time-dependent deactivation of a DNA ``arm'' using a DNA anti-fuel, and control experiments, excluding β-cyclodextrin from the systems. See DOI: 10.1039/c3nr02653a

  2. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  3. Genomewide expression analysis in amino acid-producing bacteria using DNA microarrays.

    PubMed

    Polen, Tino; Wendisch, Volker F

    2004-01-01

    DNA microarray technology has become an important research tool for biotechnology and microbiology. It is now possible to characterize genetic diversity and gene expression in a genomewide manner. DNA microarrays have been applied extensively to study the biology of many bacteria including Escherichia coli, but only recently have they been developed for the Gram-positive Corynebacterium glutamicum. Both bacteria are widely used for biotechnological amino acid production. In this article, in addition to the design and generation of microarrays as well as their use in hybridization experiments and subsequent data analysis, we describe recent applications of DNA microarray technology regarding amino acid production in C. glutamicum and E. coli. We also discuss the impact of functional genomics studies on fundamental as well as applied aspects of amino acid production with C. glutamicum and E. coli. PMID:15304751

  4. Beyond DNA origami: A look on the bright future of nucleic acid nanotechnology

    PubMed Central

    Michelotti, Nicole; Johnson-Buck, Alexander; Manzo, Anthony J.

    2012-01-01

    Nucleic acid nanotechnology exploits the programmable molecular recognition properties of natural and synthetic nucleic acids to assemble structures with nanometer-scale precision. In 2006, DNA origami transformed the field by providing a versatile platform for self-assembly of arbitrary shapes from one long DNA strand held in place by hundreds of short, site-specific (spatially addressable) DNA ”staples”. This revolutionary approach has led to the creation of a multitude of 2D and 3D scaffolds that form the basis for functional nanodevices. Not limited to nucleic acids, these nanodevices can incorporate other structural and functional materials, such as proteins and nanoparticles, making them broadly useful for current and future applications in emerging fields such as nanomedicine, nanoelectronics, and alternative energy. PMID:22131292

  5. Associations between whole peripheral blood fatty acids and DNA methylation in humans.

    PubMed

    de la Rocha, Carmen; Pérez-Mojica, J Eduardo; León, Silvia Zenteno-De; Cervantes-Paz, Braulio; Tristán-Flores, Fabiola E; Rodríguez-Ríos, Dalia; Molina-Torres, Jorge; Ramírez-Chávez, Enrique; Alvarado-Caudillo, Yolanda; Carmona, F Javier; Esteller, Manel; Hernández-Rivas, Rosaura; Wrobel, Katarzyna; Wrobel, Kazimierz; Zaina, Silvio; Lund, Gertrud

    2016-01-01

    Fatty acids (FA) modify DNA methylation in vitro, but limited information is available on whether corresponding associations exist in vivo and reflect any short-term effect of the diet. Associations between global DNA methylation and FAs were sought in blood from lactating infants (LI; n = 49) and adult males (AMM; n = 12) equally distributed across the three conventional BMI classes. AMM provided multiple samples at 2-hour intervals during 8 hours after either a single Western diet-representative meal (post-prandial samples) or no meal (fasting samples). Lipid/glucose profile, HDAC4 promoter and PDK4 5'UTR methylation were determined in AMM. Multiple regression analysis revealed that global (in LI) and both global and PDK4-specific DNA methylation (in AMM) were positively associated with eicosapentaenoic and arachidonic acid. HDAC4 methylation was inversely associated with arachidonic acid post-prandially in AMM. Global DNA methylation did not show any defined within-day pattern that would suggest a short-term response to the diet. Nonetheless, global DNA methylation was higher in normal weight subjects both post-prandially and in fasting and coincided with higher polyunsaturated relative to monounsaturated and saturated FAs. We show for the first time strong associations of DNA methylation with specific FAs in two human cohorts of distinct age, diet and postnatal development stage. PMID:27181711

  6. Associations between whole peripheral blood fatty acids and DNA methylation in humans

    PubMed Central

    de la Rocha, Carmen; Pérez-Mojica, J. Eduardo; León, Silvia Zenteno-De; Cervantes-Paz, Braulio; Tristán-Flores, Fabiola E.; Rodríguez-Ríos, Dalia; Molina-Torres, Jorge; Ramírez-Chávez, Enrique; Alvarado-Caudillo, Yolanda; Carmona, F. Javier; Esteller, Manel; Hernández-Rivas, Rosaura; Wrobel, Katarzyna; Wrobel, Kazimierz; Zaina, Silvio; Lund, Gertrud

    2016-01-01

    Fatty acids (FA) modify DNA methylation in vitro, but limited information is available on whether corresponding associations exist in vivo and reflect any short-term effect of the diet. Associations between global DNA methylation and FAs were sought in blood from lactating infants (LI; n = 49) and adult males (AMM; n = 12) equally distributed across the three conventional BMI classes. AMM provided multiple samples at 2-hour intervals during 8 hours after either a single Western diet-representative meal (post-prandial samples) or no meal (fasting samples). Lipid/glucose profile, HDAC4 promoter and PDK4 5’UTR methylation were determined in AMM. Multiple regression analysis revealed that global (in LI) and both global and PDK4-specific DNA methylation (in AMM) were positively associated with eicosapentaenoic and arachidonic acid. HDAC4 methylation was inversely associated with arachidonic acid post-prandially in AMM. Global DNA methylation did not show any defined within-day pattern that would suggest a short-term response to the diet. Nonetheless, global DNA methylation was higher in normal weight subjects both post-prandially and in fasting and coincided with higher polyunsaturated relative to monounsaturated and saturated FAs. We show for the first time strong associations of DNA methylation with specific FAs in two human cohorts of distinct age, diet and postnatal development stage. PMID:27181711

  7. Binding of retinoic acid receptor heterodimers to DNA. A role for histones NH2 termini.

    PubMed

    Lefebvre, P; Mouchon, A; Lefebvre, B; Formstecher, P

    1998-05-15

    The retinoic acid signaling pathway is controlled essentially through two types of nuclear receptors, RARs and RXRs. Ligand dependent activation or repression of retinoid-regulated genes is dependent on the binding of retinoic acid receptor (RAR)/9-cis-retinoic acid receptor (RXR) heterodimers to retinoic acid response element (RARE). Although unliganded RXR/RAR heterodimers bind constitutively to DNA in vitro, a clear in vivo ligand-dependent occupancy of the RARE present in the RARbeta2 gene promoter has been reported (Dey, A., Minucci, S., and Ozato, K. (1994) Mol. Cell. Biol. 14, 8191-8201). Nucleosomes are viewed as general repressors of the transcriptional machinery, in part by preventing the access of transcription factors to DNA. The ability of hRXRalpha/hRARalpha heterodimers to bind to a nucleosomal template in vitro has therefore been examined. The assembly of a fragment from the RARbeta2 gene promoter, which contains a canonical DR5 RARE, into a nucleosome core prevented hRXRalpha/hRARalpha binding to this DNA, in conditions where a strong interaction is observed with a linear DNA template. However, histone tails removal by limited proteolysis and histone hyperacetylation yielded nucleosomal RAREs able to bind to hRXRalpha/hRARalpha heterodimers. These data establish therefore the role of histones NH2 termini as a major impediment to retinoid receptors access to DNA, and identify histone hyperacetylation as a potential physiological regulator of retinoid-induced transcription.

  8. Complete cDNA and derived amino acid sequence of human factor V.

    PubMed Central

    Jenny, R J; Pittman, D D; Toole, J J; Kriz, R W; Aldape, R A; Hewick, R M; Kaufman, R J; Mann, K G

    1987-01-01

    cDNA clones encoding human factor V have been isolated from an oligo(dT)-primed human fetal liver cDNA library prepared with vector Charon 21A. The cDNA sequence of factor V from three overlapping clones includes a 6672-base-pair (bp) coding region, a 90-bp 5' untranslated region, and a 163-bp 3' untranslated region within which is a poly(A) tail. The deduced amino acid sequence consists of 2224 amino acids inclusive of a 28-amino acid leader peptide. Direct comparison with human factor VIII reveals considerable homology between proteins in amino acid sequence and domain structure: a triplicated A domain and duplicated C domain show approximately equal to 40% identity with the corresponding domains in factor VIII. As in factor VIII, the A domains of factor V share approximately 40% amino acid-sequence homology with the three highly conserved domains in ceruloplasmin. The B domain of factor V contains 35 tandem and approximately 9 additional semiconserved repeats of nine amino acids of the form Asp-Leu-Ser-Gln-Thr-Thr/Asn-Leu-Ser-Pro and 2 additional semiconserved repeats of 17 amino acids. Factor V contains 37 potential N-linked glycosylation sites, 25 of which are in the B domain, and a total of 19 cysteine residues. Images PMID:3110773

  9. Complete cDNA and derived amino acid sequence of human factor V

    SciTech Connect

    Jenny, R.J.; Pittman, D.D.; Toole, J.J.; Kriz, R.W.; Aldape, R.A.; Hewick, R.M.; Kaufman, R.J.; Mann, K.G.

    1987-07-01

    cDNA clones encoding human factor V have been isolated from an oligo(dT)-primed human fetal liver cDNA library prepared with vector Charon 21A. The cDNA sequence of factor V from three overlapping clones includes a 6672-base-pair (bp) coding region, a 90-bp 5' untranslated region, and a 163-bp 3' untranslated region within which is a poly(A)tail. The deduced amino acid sequence consists of 2224 amino acids inclusive of a 28-amino acid leader peptide. Direct comparison with human factor VIII reveals considerable homology between proteins in amino acid sequence and domain structure: a triplicated A domain and duplicated C domain show approx. 40% identity with the corresponding domains in factor VIII. As in factor VIII, the A domains of factor V share approx. 40% amino acid-sequence homology with the three highly conserved domains in ceruloplasmin. The B domain of factor V contains 35 tandem and approx. 9 additional semiconserved repeats of nine amino acids of the form Asp-Leu-Ser-Gln-Thr-Thr/Asn-Leu-Ser-Pro and 2 additional semiconserved repeats of 17 amino acids. Factor V contains 37 potential N-linked glycosylation sites, 25 of which are in the B domain, and a total of 19 cysteine residues.

  10. DNA methylation in Folbp1 knockout mice supplemented with folic acid during gestation.

    PubMed

    Finnell, Richard H; Spiegelstein, Ofer; Wlodarczyk, Bogdan; Triplett, Aleata; Pogribny, Igor P; Melnyk, Stepan; James, Jill S

    2002-08-01

    Periconceptional folic acid supplementation has been shown to prevent up to 70% of neural tube and other birth defects in humans; however, the mechanism is still unknown. In this study, we tested whether defective intracellular folate transport, as achieved by inactivation of the murine folate-binding protein 1 (Folbp1), affects global DNA methylation in the liver and brain from gestational day (GD) 15 embryos. Complete Folbp1 inactivation is embryolethal but can be reversed by maternal folinic acid (FA) supplementation, and thus we also tested the effect of FA supplementation on DNA methylation in Folbp1 fetuses. Overall, the extent of global DNA methylation seems to be similar across all genotypes in unsupplemented control Folbp1 mice; however, explicit conclusions regarding Folbp1(-/-) fetuses were not possible because only a single living unsupplemented fetus was viable at GD 15. FA supplementation induced global DNA hypomethylation across all genotypes. FA-induced hypomethylation is most likely due to its ability to inhibit the enzyme glycine hydroxymethyltransferase, thereby inhibiting the homocysteine remethylation cycle necessary to regenerate S-adenosylmethionine, the methyl donor for DNA methyltransferases. Our hypothesis was that due to defective folate transport in Folbp1(-/-) embryos and fetuses, DNA would be hypomethylated, thereby altering the temporal expression of critical genes necessary for normal embryonic development. However, these results suggest that an extended examination of changes in DNA methylation prior to GD 15 is required to unequivocally prove or disprove the hypothesis. PMID:12163711

  11. Is amino acid racemization a useful tool for screening for ancient DNA in bone?

    PubMed Central

    Collins, Matthew J.; Penkman, Kirsty E. H.; Rohland, Nadin; Shapiro, Beth; Dobberstein, Reimer C.; Ritz-Timme, Stefanie; Hofreiter, Michael

    2009-01-01

    Many rare and valuable ancient specimens now carry the scars of ancient DNA research, as questions of population genetics and phylogeography require larger sample sets. This fuels the demand for reliable techniques to screen for DNA preservation prior to destructive sampling. Only one such technique has been widely adopted: the extent of aspartic acid racemization (AAR). The kinetics of AAR are believed to be similar to the rate of DNA depurination and therefore a good measure of the likelihood of DNA survival. Moreover, AAR analysis is only minimally destructive. We report the first comprehensive test of AAR using 91 bone and teeth samples from temperate and high-latitude sites that were analysed for DNA. While the AAR range of all specimens was low (0.02–0.17), no correlation was found between the extent of AAR and DNA amplification success. Additional heating experiments and surveys of the literature indicated that d/l Asx is low in bones until almost all the collagen is lost. This is because aspartic acid is retained in the bone within the constrained environment of the collagen triple helix, where it cannot racemize for steric reasons. Only if the helix denatures to soluble gelatin can Asx racemize readily, but this soluble gelatine is readily lost in most burial environments. We conclude that Asx d/l is not a useful screening technique for ancient DNA from bone. PMID:19493899

  12. Improved algorithm for analysis of DNA sequences using multiresolution transformation.

    PubMed

    Inbamalar, T M; Sivakumar, R

    2015-01-01

    Bioinformatics and genomic signal processing use computational techniques to solve various biological problems. They aim to study the information allied with genetic materials such as the deoxyribonucleic acid (DNA), the ribonucleic acid (RNA), and the proteins. Fast and precise identification of the protein coding regions in DNA sequence is one of the most important tasks in analysis. Existing digital signal processing (DSP) methods provide less accurate and computationally complex solution with greater background noise. Hence, improvements in accuracy, computational complexity, and reduction in background noise are essential in identification of the protein coding regions in the DNA sequences. In this paper, a new DSP based method is introduced to detect the protein coding regions in DNA sequences. Here, the DNA sequences are converted into numeric sequences using electron ion interaction potential (EIIP) representation. Then discrete wavelet transformation is taken. Absolute value of the energy is found followed by proper threshold. The test is conducted using the data bases available in the National Centre for Biotechnology Information (NCBI) site. The comparative analysis is done and it ensures the efficiency of the proposed system.

  13. Improved algorithm for analysis of DNA sequences using multiresolution transformation.

    PubMed

    Inbamalar, T M; Sivakumar, R

    2015-01-01

    Bioinformatics and genomic signal processing use computational techniques to solve various biological problems. They aim to study the information allied with genetic materials such as the deoxyribonucleic acid (DNA), the ribonucleic acid (RNA), and the proteins. Fast and precise identification of the protein coding regions in DNA sequence is one of the most important tasks in analysis. Existing digital signal processing (DSP) methods provide less accurate and computationally complex solution with greater background noise. Hence, improvements in accuracy, computational complexity, and reduction in background noise are essential in identification of the protein coding regions in the DNA sequences. In this paper, a new DSP based method is introduced to detect the protein coding regions in DNA sequences. Here, the DNA sequences are converted into numeric sequences using electron ion interaction potential (EIIP) representation. Then discrete wavelet transformation is taken. Absolute value of the energy is found followed by proper threshold. The test is conducted using the data bases available in the National Centre for Biotechnology Information (NCBI) site. The comparative analysis is done and it ensures the efficiency of the proposed system. PMID:26000337

  14. Sequence-specific DNA damage induced by ultraviolet A-irradiated folic acid via its photolysis product.

    PubMed

    Hirakawa, Kazutaka; Suzuki, Hiroyuki; Oikawa, Shinji; Kawanishi, Shosuke

    2003-02-15

    DNA damage mediated by photosensitizers participates in solar carcinogenesis. Fluorescence measurement and high-performance liquid chromatography analysis demonstrated that photoirradiated folic acid, one of the photosensitizers in cells, generates pterine-6-carboxylic acid (PCA). Experiments using 32P-labeled DNA fragments obtained from a human gene showed that ultraviolet A-irradiated folic acid or PCA caused DNA cleavage specifically at consecutive G residues in double-stranded DNA after Escherichia coli formamidopyrimidine-DNA glycosylase or piperidine treatment. The amount of 8-oxo-7,8-dihydro-2(')-deoxyguanosine formed through this DNA photoreaction in double-stranded DNA exceeded that in single-stranded DNA. Kinetic studies suggested that DNA damage is caused mainly by photoexcited PCA generated from folic acid rather than by folic acid itself. In conclusion, photoirradiated folic acid generates PCA, which induces DNA photooxidation specifically at consecutive G residues through electron transfer. Excess intake of folic acid supplements may increase a risk of skin cancer by solar ultraviolet light. PMID:12573286

  15. Detection of methylglyoxal as a degradation product of DNA and nucleic acid components treated with strong acid.

    PubMed

    Chaplen, F W; Fahl, W E; Cameron, D C

    1996-05-01

    The 1,2-diaminobenzene derivation assay for methylglyoxal in biological systems involves the use of perchloric acid, both as a deproteinizing agent and to prevent the spontaneous formation of methylglyoxal from glycolytic pathway intermediates. However, while using a modification of the standard literature assay to measure methylglyoxal in Chinese hamster ovary cells, we found that oxidation of nucleic acids and related compounds by perchloric or trichloroacetic acid results in the formation of methylglyoxal. Compounds containing 2-deoxyribose gave higher levels of methylglyoxal than those containing ribose; purine nucleotides and deoxynucleotides gave more methylglyoxal than did the pyrimidines. Nucleic acids were the most susceptible to degradation, with 12-fold more methylglyoxal being formed from DNA than RNA. Oxidation of nucleic acids increased with higher temperatures and with decreasing nucleic acid fragment size. Another product of nucleic acid oxidation was 2,3-butanedione, the 1,2-diaminobenzene derivative of which is sometimes used as an internal standard during methylglyoxal measurement. Unless accounted for during the assay procedure, the generation of methylglyoxal and 2,3-butanedione due to the oxidation of nucleic acids may lead to substantial errors in the determination of methylglyoxal concentrations in biological systems.

  16. Immobilization-free electrochemical DNA detection with anthraquinone-labeled pyrrolidinyl peptide nucleic acid probe.

    PubMed

    Kongpeth, Jutatip; Jampasa, Sakda; Chaumpluk, Piyasak; Chailapakul, Orawon; Vilaivan, Tirayut

    2016-01-01

    Electrochemical detection provides a simple, rapid, sensitive and inexpensive method for DNA detection. In traditional electrochemical DNA biosensors, the probe is immobilized onto the electrode. Hybridization with the DNA target causes a change in electrochemical signal, either from the intrinsic signal of the probe/target or through a label or a redox indicator. The major drawback of this approach is the requirement for probe immobilization in a controlled fashion. In this research, we take the advantage of different electrostatic properties between PNA and DNA to develop an immobilization-free approach for highly sequence-specific electrochemical DNA sensing on a screen-printed carbon electrode (SPCE) using a square-wave voltammetric (SWV) technique. Anthraquinone-labeled pyrrolidinyl peptide nucleic acid (AQ-PNA) was employed as a probe together with an SPCE that was modified with a positively-charged polymer (poly quaternized-(dimethylamino-ethyl)methacrylate, PQDMAEMA). The electrostatic attraction between the negatively-charged PNA-DNA duplex and the positively-charged modified SPCE attributes to the higher signal of PNA-DNA duplex than that of the electrostatically neutral PNA probe, resulting in a signal change. The calibration curve of this proposed method exhibited a linear range between 0.35 and 50 nM of DNA target with a limit of detection of 0.13 nM (3SD(blank)/Slope). The sub-nanomolar detection limit together with a small sample volume required (20 μL) allowed detection of <10 fmol (<1 ng) of DNA. With the high specificity of the pyrrolidinyl PNA probe used, excellent discrimination between complementary and various single-mismatched DNA targets was obtained. An application of this new platform for a sensitive and specific detection of isothermally-amplified shrimp's white spot syndrome virus (WSSV) DNA was successfully demonstrated. PMID:26695270

  17. Immobilization-free electrochemical DNA detection with anthraquinone-labeled pyrrolidinyl peptide nucleic acid probe.

    PubMed

    Kongpeth, Jutatip; Jampasa, Sakda; Chaumpluk, Piyasak; Chailapakul, Orawon; Vilaivan, Tirayut

    2016-01-01

    Electrochemical detection provides a simple, rapid, sensitive and inexpensive method for DNA detection. In traditional electrochemical DNA biosensors, the probe is immobilized onto the electrode. Hybridization with the DNA target causes a change in electrochemical signal, either from the intrinsic signal of the probe/target or through a label or a redox indicator. The major drawback of this approach is the requirement for probe immobilization in a controlled fashion. In this research, we take the advantage of different electrostatic properties between PNA and DNA to develop an immobilization-free approach for highly sequence-specific electrochemical DNA sensing on a screen-printed carbon electrode (SPCE) using a square-wave voltammetric (SWV) technique. Anthraquinone-labeled pyrrolidinyl peptide nucleic acid (AQ-PNA) was employed as a probe together with an SPCE that was modified with a positively-charged polymer (poly quaternized-(dimethylamino-ethyl)methacrylate, PQDMAEMA). The electrostatic attraction between the negatively-charged PNA-DNA duplex and the positively-charged modified SPCE attributes to the higher signal of PNA-DNA duplex than that of the electrostatically neutral PNA probe, resulting in a signal change. The calibration curve of this proposed method exhibited a linear range between 0.35 and 50 nM of DNA target with a limit of detection of 0.13 nM (3SD(blank)/Slope). The sub-nanomolar detection limit together with a small sample volume required (20 μL) allowed detection of <10 fmol (<1 ng) of DNA. With the high specificity of the pyrrolidinyl PNA probe used, excellent discrimination between complementary and various single-mismatched DNA targets was obtained. An application of this new platform for a sensitive and specific detection of isothermally-amplified shrimp's white spot syndrome virus (WSSV) DNA was successfully demonstrated.

  18. DNA immobilization on a polypyrrole nanofiber modified electrode and its interaction with salicylic acid/aspirin.

    PubMed

    Yousef Elahi, M; Bathaie, S Z; Kazemi, S H; Mousavi, M F

    2011-04-15

    A double-stranded calf thymus DNA (dsDNA) was physisorbed onto a polypyrrole (PPy) nanofiber film that had been electrochemically deposited onto a Pt electrode. The surface morphology of the polymeric film was characterized using scanning electron microscopy (SEM). The electrochemical characteristics of the PPy film and the DNA deposited onto the PPy modified electrode were investigated by cyclic voltammetry (CV), differential pulse voltammetry (DPV), and electrochemical impedance spectroscopy (EIS). Then the interaction of DNA with salicylic acid (SA) and acetylsalicylic acid (ASA), or aspirin, was studied on the electrode surface with DPV. An increase in the DPV current was observed due to the oxidation of guanine, which decreased with the increasing concentrations of the ligands. The interactions of SA and ASA with the DNA follow the saturation isotherm behavior. The binding constants of these interactions were 1.15×10(4)M for SA and 7.46×10(5)M for ASA. The numbers of binding sites of SA and ASA on DNA were approximately 0.8 and 0.6, respectively. The linear dynamic ranges of the sensors were 0.1-2μM (r(2)=0.996) and 0.05-1mM (r(2)=0.996) with limits of detection of 8.62×10(-1) and 5.24×10(-6)μM for SA and ASA, respectively.

  19. PLASMID DNA DAMAGE CAUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN

    EPA Science Inventory

    Plasmid DNA damage caused by methylated arsenicals, ascorbic acid and human liver ferritin.

    Arsenic causes cancer in human skin, urinary bladder, lung, liver and kidney and is a significant world-wide public health problem. Although the metabolism of inorganic arsenic is ...

  20. Characterization of single- and double-stranded DNA on gold surfaces.

    PubMed

    Moses, Selina; Brewer, Scott H; Lowe, Lisa B; Lappi, Simon E; Gilvey, Lauren B G; Sauthier, Marc; Tenent, Robert C; Feldheim, Daniel L; Franzen, Stefan

    2004-12-01

    Single- and double-stranded deoxy ribonucleic acid (DNA) molecules attached to self-assembled monolayers (SAMs) on gold surfaces were characterized by a number of optical and electronic spectroscopic techniques. The DNA-modified gold surfaces were prepared through the self-assembly of 6-mercapto-1-hexanol and 5'-C(6)H(12)SH -modified single-stranded DNA (ssDNA). Upon hybridization of the surface-bound probe ssDNA with its complimentary target, formation of double-stranded DNA (dsDNA) on the gold surface is observed and in a competing process, probe ssDNA is desorbed from the gold surface. The competition between hybridization of ssDNA with its complimentary target and ssDNA probe desorption from the gold surface has been investigated in this paper using X-ray photoelectron spectroscopy, chronocoulometry, fluorescence, and polarization modulation-infrared reflection absorption spectroscopy (PM-IRRAS). The formation of dsDNA on the surface was identified by PM-IRRAS by a dsDNA IR signature at approximately 1678 cm(-)(1) that was confirmed by density functional theory calculations of the nucleotides and the nucleotides' base pairs. The presence of dsDNA through the specific DNA hybridization was additionally confirmed by atomic force microscopy through colloidal gold nanoparticle labeling of the target ssDNA. Using these methods, strand loss was observed even for DNA hybridization performed at 25 degrees C for the DNA monolayers studied here consisting of attachment to the gold surfaces by single Au-S bonds. This finding has significant consequence for the application of SAM technology in the detection of oligonucleotide hybridization on gold surfaces.

  1. DNA tetrahedron and star trigon nanostructures for target recycling detection of nucleic acid.

    PubMed

    Li, Yueran; Chen, Xifeng; Wang, Bidou; Liu, Guangxing; Tang, Yuguo; Miao, Peng

    2016-06-01

    Human immunodeficiency virus (HIV) is a retrovirus which attacks the human body's immune system and further leads to acquired immunodeficiency syndrome (AIDS). Nucleic acid detection is of great importance in the medical diagnosis of such diseases. Herein, we develop a simple and enzyme-free electrochemical method for the target recycling detection of nuclei acid. DNA tetrahedron and star trigon nanostructures are designed and constructed on the electrode interface for target capture and signal enrichment. This strategy is convenient and sensitive, with a limit of detection as low as 1 fM, and can also successfully distinguish single-base mismatched DNA. Therefore, the proposed method has a promising potential application for HIV DNA detection. PMID:27170090

  2. Biological characterization of liver fatty acid binding gene from miniature pig liver cDNA library.

    PubMed

    Gao, Y H; Wang, K F; Zhang, S; Fan, Y N; Guan, W J; Ma, Y H

    2015-01-01

    Liver fatty acid binding proteins (L-FABP) are a family of small, highly conserved, cytoplasmic proteins that bind to long-chain fatty acids and other hydrophobic ligands. In this study, a full-length enriched cDNA library was successfully constructed from Wuzhishan miniature pig, and then the L-FABP gene was cloned from this cDNA library and an expression vector (pEGFP-N3-L-FABP) was constructed in vitro. This vector was transfected into hepatocytes to test its function. The results of western blotting analysis demonstrated that the L-FABP gene from our full-length enriched cDNA library regulated downstream genes, including the peroxisome proliferator-activated receptor family in hepatocytes. This study provides a theoretical basis and experimental evidence for the application of L-FABP for the treatment of liver injury. PMID:26345909

  3. DNA tetrahedron and star trigon nanostructures for target recycling detection of nucleic acid.

    PubMed

    Li, Yueran; Chen, Xifeng; Wang, Bidou; Liu, Guangxing; Tang, Yuguo; Miao, Peng

    2016-06-01

    Human immunodeficiency virus (HIV) is a retrovirus which attacks the human body's immune system and further leads to acquired immunodeficiency syndrome (AIDS). Nucleic acid detection is of great importance in the medical diagnosis of such diseases. Herein, we develop a simple and enzyme-free electrochemical method for the target recycling detection of nuclei acid. DNA tetrahedron and star trigon nanostructures are designed and constructed on the electrode interface for target capture and signal enrichment. This strategy is convenient and sensitive, with a limit of detection as low as 1 fM, and can also successfully distinguish single-base mismatched DNA. Therefore, the proposed method has a promising potential application for HIV DNA detection.

  4. A Concentrated Hydrochloric Acid-based Method for Complete Recovery of DNA from Bone.

    PubMed

    Huynen, Leon; Lambert, David M

    2015-11-01

    The successful extraction of DNA from historical or ancient animal bone is important for the analysis of discriminating genetic markers. Methods used currently rely on the digestion of bone with EDTA and proteinase K, followed by purification with phenol/chloroform and silica bed binding. We have developed a simple concentrated hydrochloric acid-based method that precludes the use of phenol/chloroform purification and can lead to a several-fold increase in DNA yield when compared to other commonly used methods. Concentrated hydrochloric acid was shown to dissolve most of the undigested bone and allowed the efficient recovery of DNA fragments <100 bases in length. This method should prove useful for the recovery of DNAs from highly degraded animal bone, such as that found in historical or ancient samples.

  5. Biological characterization of liver fatty acid binding gene from miniature pig liver cDNA library.

    PubMed

    Gao, Y H; Wang, K F; Zhang, S; Fan, Y N; Guan, W J; Ma, Y H

    2015-01-01

    Liver fatty acid binding proteins (L-FABP) are a family of small, highly conserved, cytoplasmic proteins that bind to long-chain fatty acids and other hydrophobic ligands. In this study, a full-length enriched cDNA library was successfully constructed from Wuzhishan miniature pig, and then the L-FABP gene was cloned from this cDNA library and an expression vector (pEGFP-N3-L-FABP) was constructed in vitro. This vector was transfected into hepatocytes to test its function. The results of western blotting analysis demonstrated that the L-FABP gene from our full-length enriched cDNA library regulated downstream genes, including the peroxisome proliferator-activated receptor family in hepatocytes. This study provides a theoretical basis and experimental evidence for the application of L-FABP for the treatment of liver injury.

  6. Oxidative phosphorylation differences between mitochondrial DNA haplogroups modify the risk of Leber's hereditary optic neuropathy.

    PubMed

    Gómez-Durán, Aurora; Pacheu-Grau, David; Martínez-Romero, Iñigo; López-Gallardo, Ester; López-Pérez, Manuel J; Montoya, Julio; Ruiz-Pesini, Eduardo

    2012-08-01

    Leber's hereditary optic neuropathy is a maternally inherited optic atrophy caused by mitochondrial DNA point mutations. Previous epidemiological studies have shown that individuals from mitochondrial genetic backgrounds (haplogroups) J/Uk and H have a higher and a lower risk, respectively, of suffering this disorder. To analyze the bases of these associations at cellular and molecular levels, functional studies with cybrids provide high quality evidence. Cybrids from haplogroup J contain less mitochondrial deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) and synthesize a smaller amount of mitochondrial DNA-encoded polypeptides than those from haplogroup H. Haplogroup J cybrids also display lower oxygen consumption, mitochondrial inner membrane potential and total adenosine-5'-triphosphate (ATP) levels. Moreover, mitochondrial DNA levels correlate with many parameters of the oxidative phosphorylation system. These results suggest that the mitochondrial DNA amount determines oxidative phosphorylation capacity and, along with other recently published observations, support the possibility that mitochondrial DNA levels may be responsible for the bias of the disorder toward males, for the incomplete penetrance of mutations causing Leber's hereditary optic neuropathy and for the association of the disease with particular mitochondrial DNA haplogroups.

  7. A universal molecular translator for non-nucleic acid targets that enables dynamic DNA assemblies and logic operations.

    PubMed

    Tang, Wei; Hu, Shichao; Wang, Huaming; Zhao, Yan; Li, Na; Liu, Feng

    2014-11-28

    A universal molecular translator based on the target-triggered DNA strand displacement was developed, which was able to convert various kinds of non-nucleic acid targets into a unique output DNA. This translation strategy was successfully applied in directing dynamic DNA assemblies and in realizing three-input logic gate operations. PMID:25295484

  8. Intelligent DNA machine for the ultrasensitive colorimetric detection of nucleic acids.

    PubMed

    Xu, Jianguo; Qian, Jun; Li, Hongling; Wu, Zai-Sheng; Shen, Weiyu; Jia, Lee

    2016-01-15

    As DNA is employed to serve as a smart building block, an increasing interest has been devoted to the development of different DNA-based machines for the specific purpose, for example, the exploration of inter- or intramolecular interaction. In the current contribution, we developed an intelligent DNA machine and its operation can be designed to execute the ultrasensitive colorimetric detection of target nucleic acids. The DNA machine consists of a hairpin probe (HP) and an assistant template (AT). Using p53 gene as the target model to trigger the molecular machine operation, cyclic nucleic acid strand displacement polymerization (CNDP) was specifically induced, leading to the DNAzyme mediated catalytic reaction for signal readout. Specifically, with the help of polymerase and nickase, one target molecule was able to drive DNA nano-mechanical devices one-by-one through the hybridization/polymerization displacement cycles, and every initiated machine continued to operate, causing the dramatic accumulation of G-quadruplex-contained products. The G-quadruplex structure after binding to hemin could act as a horseradish peroxidase (HRP)-mimicking DNAzyme and catalyzed the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) by H2O2. As a result, an enhanced color change could be detected because of the generation of oxidation product ABTS•(+). In this way, the DNA machine has no any signal loss and enables the quantitative measurement of p53 DNA with a detection limit of 10fM, indicating great promise for unique application in biomedical research and early clinical diagnosis.

  9. Efficient in vivo gene transfection by stable DNA/PEI complexes coated by hyaluronic acid.

    PubMed

    Ito, Tomoko; Iida-Tanaka, Naoko; Koyama, Yoshiyuki

    2008-05-01

    Plasmid DNA was mixed with polyethyleneimine (PEI) and hyaluronic acid (HA) to afford ternary complexes with negative surface charge regardless of the mixing order. They showed reduced non-specific interactions with blood components. When DNA and PEI were mixed at a high concentration such as that used in in vivo experiments, they soon aggregated, and large particles were formed. On the other hand, pre-addition of HA to DNA prior to PEI effectively diminished the aggregation, and 10% (in volume) of the complexes remained as small particles with a diameter below 80 nm. Those negatively charged small ternary complexes induced a much stronger extra-gene expression in tumor than binary DNA/PEI complex after intratumoral or intravenous injection into the mice bearing B16 cells. PMID:18446606

  10. DNA detection using water-soluble conjugated polymers and peptide nucleic acid probes

    NASA Astrophysics Data System (ADS)

    Gaylord, Brent S.; Heeger, Alan J.; Bazan, Guillermo C.

    2002-08-01

    The light-harvesting properties of cationic conjugated polymers are used to sensitize the emission of a dye on a specific peptide nucleic acid (PNA) sequence for the purpose of homogeneous, "real-time" DNA detection. Signal transduction is controlled by hybridization of the neutral PNA probe and the negative DNA target. Electrostatic interactions bring the hybrid complex and cationic polymer within distances required for Förster energy transfer. Conjugated polymer excitation provides fluorescein emission >25 times higher than that obtained by exciting the dye, allowing detection of target DNA at concentrations of 10 pM with a standard fluorometer. A simple and highly sensitive assay with optical amplification that uses the improved hybridization behavior of PNA/DNA complexes is thus demonstrated.

  11. cDNA-derived amino acid sequences of myoglobins from nine species of whales and dolphins.

    PubMed

    Iwanami, Kentaro; Mita, Hajime; Yamamoto, Yasuhiko; Fujise, Yoshihiro; Yamada, Tadasu; Suzuki, Tomohiko

    2006-10-01

    We determined the myoglobin (Mb) cDNA sequences of nine cetaceans, of which six are the first reports of Mb sequences: sei whale (Balaenoptera borealis), Bryde's whale (Balaenoptera edeni), pygmy sperm whale (Kogia breviceps), Stejneger's beaked whale (Mesoplodon stejnegeri), Longman's beaked whale (Indopacetus pacificus), and melon-headed whale (Peponocephala electra), and three confirm the previously determined chemical amino acid sequences: sperm whale (Physeter macrocephalus), common minke whale (Balaenoptera acutorostrata) and pantropical spotted dolphin (Stenella attenuata). We found two types of Mb in the skeletal muscle of pantropical spotted dolphin: Mb I with the same amino acid sequence as that deposited in the protein database, and Mb II, which differs at two amino acid residues compared with Mb I. Using an alignment of the amino acid or cDNA sequences of cetacean Mb, we constructed a phylogenetic tree by the NJ method. Clustering of cetacean Mb amino acid and cDNA sequences essentially follows the classical taxonomy of cetaceans, suggesting that Mb sequence data is valid for classification of cetaceans at least to the family level. PMID:16962803

  12. Calcium-activated gene transfection from DNA/poly(amic acid-co-imide) complexes

    PubMed Central

    Wu, Szu-Yuan; Chang, Li-Ting; Peng, Sydeny; Tsai, Hsieh-Chih

    2015-01-01

    In this study, we synthesized a water-soluble poly(amic acid-co-imide) (PA-I) from ethylenediaminetetraacetic dianhydride (EDTA) and 2,2′-(ethylenedioxy)bis(ethylamine) that possesses comparable transfection efficiency to that of polyethylenimine (PEI), when prepared in combination with divalent calcium cations. The polycondensation of monomers afforded poly(amic acid) (PA) precursors, and subsequent thermal imidization resulted in the formation of PA-I. At a polymer/DNA ratio (indicated by the molar ratio of nitrogen in the polymer to phosphate in DNA) of 40, complete retardation of the DNA band was observed by gel electrophoresis, indicating the strong association of DNA with PA-I. A zeta potential of −22 mV was recorded for the PA-I polymer solution, and no apparent cytotoxicity was observed at concentrations up to 500 μg·mL−1. In the presence of divalent Ca2+, the transfection efficiency of PA-I was higher than that of PA, due to the formation of a copolymer/Ca2+/DNA polyplex and the reduction in negative charge due to thermal cyclization. Interestingly, a synergistic effect of Ca2+ and the synthesized copolymer on DNA transfection was observed. The use of Ca2+ or copolymer alone resulted in unsatisfactory delivery, whereas the formation of three-component polyplexes synergistically increased DNA transfection. Our findings demonstrated that a PA-I/Ca2+/DNA polyplex could serve as a promising candidate for gene delivery. PMID:25767385

  13. Strand displacement and duplex invasion into double-stranded DNA by pyrrolidinyl peptide nucleic acids.

    PubMed

    Bohländer, Peggy R; Vilaivan, Tirayut; Wagenknecht, Hans-Achim

    2015-09-21

    The so-called acpcPNA system bears a peptide backbone consisting of 4'-substituted proline units with (2'R,4'R) configuration in an alternating combination with (2S)-amino-cyclopentane-(1S)-carboxylic acids. acpcPNA forms exceptionally stable hybrids with complementary DNA. We demonstrate herein (i) strand displacements by single-stranded DNA from acpcPNA-DNA hybrids, and by acpcPNA strands from DNA duplexes, and (ii) strand invasions by acpcPNA into double-stranded DNA. These processes were studied in vitro using synthetic oligonucleotides and by means of our concept of wavelength-shifting fluorescent nucleic acid probes, including fluorescence lifetime measurements that allow quantifying energy transfer efficiencies. The strand displacements of preannealed 14mer acpcPNA-7mer DNA hybrids consecutively by 10mer and 14mer DNA strands occur with rather slow kinetics but yield high fluorescence color ratios (blue : yellow or blue : red), fluorescence intensity enhancements, and energy transfer efficiencies. Furthermore, 14mer acpcPNA strands are able to invade into 30mer double-stranded DNA, remarkably with quantitative efficiency in all studied cases. These processes can also be quantified by means of fluorescence. This remarkable behavior corroborates the extraordinary versatile properties of acpcPNA. In contrast to conventional PNA systems which require 3 or more equivalents PNA, only 1.5 equivalents acpcPNA are sufficient to get efficient double duplex invasion. Invasions also take place even in the presence of 250 mM NaCl which represents an ionic strength nearly twice as high as the physiological ion concentration. These remarkable results corroborate the extraordinary properties of acpcPNA, and thus acpcPNA represents an eligible tool for biological analytics and antigene applications.

  14. The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.

    PubMed

    Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L

    2003-11-01

    Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.

  15. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.

    PubMed

    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely

    2014-08-01

    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna.

  16. Comparison of commercial systems for extraction of nucleic acids from DNA/RNA respiratory pathogens.

    PubMed

    Yang, Genyan; Erdman, Dean E; Kodani, Maja; Kools, John; Bowen, Michael D; Fields, Barry S

    2011-01-01

    This study compared six automated nucleic acid extraction systems and one manual kit for their ability to recover nucleic acids from human nasal wash specimens spiked with five respiratory pathogens, representing Gram-positive bacteria (Streptococcus pyogenes), Gram-negative bacteria (Legionella pneumophila), DNA viruses (adenovirus), segmented RNA viruses (human influenza virus A), and non-segmented RNA viruses (respiratory syncytial virus). The robots and kit evaluated represent major commercially available methods that are capable of simultaneous extraction of DNA and RNA from respiratory specimens, and included platforms based on magnetic-bead technology (KingFisher mL, Biorobot EZ1, easyMAG, KingFisher Flex, and MagNA Pure Compact) or glass fiber filter technology (Biorobot MDX and the manual kit Allprep). All methods yielded extracts free of cross-contamination and RT-PCR inhibition. All automated systems recovered L. pneumophila and adenovirus DNA equivalently. However, the MagNA Pure protocol demonstrated more than 4-fold higher DNA recovery from the S. pyogenes than other methods. The KingFisher mL and easyMAG protocols provided 1- to 3-log wider linearity and extracted 3- to 4-fold more RNA from the human influenza virus and respiratory syncytial virus. These findings suggest that systems differed in nucleic acid recovery, reproducibility, and linearity in a pathogen specific manner.

  17. Mitochondrial DNA Fragmentation to Monitor Processing Parameters in High Acid, Plant-Derived Foods.

    PubMed

    Caldwell, Jane M; Pérez-Díaz, Ilenys M; Harris, Keith; Hassan, Hosni M; Simunovic, Josip; Sandeep, K P

    2015-12-01

    Mitochondrial DNA (mtDNA) fragmentation was assessed in acidified foods. Using quantitative polymerase chain reaction, Ct values measured from fresh, fermented, pasteurized, and stored cucumber mtDNA were determined to be significantly different (P > 0.05) based on processing and shelf-life. This indicated that the combination of lower temperature thermal processes (hot-fill at 75 °C for 15 min) and acidified conditions (pH = 3.8) was sufficient to cause mtDNA fragmentation. In studies modeling high acid juices, pasteurization (96 °C, 0 to 24 min) of tomato serum produced Ct values which had high correlation to time-temperature treatment. Primers producing longer amplicons (approximately 1 kb) targeting the same mitochondrial gene gave greater sensitivity in correlating time-temperature treatments to Ct values. Lab-scale pasteurization studies using Ct values derived from the longer amplicon differentiated between heat treatments of tomato serum (95 °C for <2 min). MtDNA fragmentation was shown to be a potential new tool to characterize low temperature (<100 °C) high acid processes (pH < 4.6), nonthermal processes such as vegetable fermentation and holding times of acidified, plant-derived products. PMID:26556214

  18. Mitochondrial DNA Fragmentation to Monitor Processing Parameters in High Acid, Plant-Derived Foods.

    PubMed

    Caldwell, Jane M; Pérez-Díaz, Ilenys M; Harris, Keith; Hassan, Hosni M; Simunovic, Josip; Sandeep, K P

    2015-12-01

    Mitochondrial DNA (mtDNA) fragmentation was assessed in acidified foods. Using quantitative polymerase chain reaction, Ct values measured from fresh, fermented, pasteurized, and stored cucumber mtDNA were determined to be significantly different (P > 0.05) based on processing and shelf-life. This indicated that the combination of lower temperature thermal processes (hot-fill at 75 °C for 15 min) and acidified conditions (pH = 3.8) was sufficient to cause mtDNA fragmentation. In studies modeling high acid juices, pasteurization (96 °C, 0 to 24 min) of tomato serum produced Ct values which had high correlation to time-temperature treatment. Primers producing longer amplicons (approximately 1 kb) targeting the same mitochondrial gene gave greater sensitivity in correlating time-temperature treatments to Ct values. Lab-scale pasteurization studies using Ct values derived from the longer amplicon differentiated between heat treatments of tomato serum (95 °C for <2 min). MtDNA fragmentation was shown to be a potential new tool to characterize low temperature (<100 °C) high acid processes (pH < 4.6), nonthermal processes such as vegetable fermentation and holding times of acidified, plant-derived products.

  19. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways

    PubMed Central

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C.; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-01-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP–DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly different conditions. Employing single-pair fluorescence resonance energy transfer, we monitored DNA bending by eukaryotic and archaeal TBPs in the absence and presence of TFB in real-time. We observed that the lifetime of the TBP–DNA interaction differs significantly between the archaeal and eukaryotic system. We show that the eukaryotic DNA-TBP interaction is characterized by a linear, stepwise bending mechanism with an intermediate state distinguished by a distinct bending angle. TF(II)B specifically stabilizes the fully bent TBP–promoter DNA complex and we identify this step as a regulatory checkpoint. In contrast, the archaeal TBP–DNA interaction is extremely dynamic and TBP from the archaeal organism Sulfolobus acidocaldarius strictly requires TFB for DNA bending. Thus, we demonstrate that transcription initiation follows diverse pathways on the way to the formation of the pre-initiation complex. PMID:24744242

  20. Spermidine-Deoxyribonucleic acid interaction in vitro and in Escherichia coli.

    PubMed Central

    Rubin, R L

    1977-01-01

    The binding of spermidine to deoxyribonucleic acid (DNA) was studied by equilibrium dialysis in a wide range of salt concentrations. The association constants ranged from 6 x 10(5) M-1 in 1 mM sodium cacodylate, pH 7.5, to 3 x 10(2) M-1 in 0.3 M NaCl. MgCl2 reduced spermidine-DNA interaction even more than NaCl so that in moderate-ionic-strength solutions (0.3 M NaCl, 0.002 M MgCl2) there was little detectable binding. Low-ionic-strength media were used to isolate DNA from Escherichia coli by a method shown to minimize loss of spermidine from the DNA. Considerable spermidine was associated with E. coli DNA, but control experiments indicated that complex formation had taken place during or after lysis of the cells. Exogenous DNA or ribonucleic acid added to spheroplasts at the time of their lysis caused most of the cellular spermidine to be scavenged by the extra nucleic acid. The data suggest that spermidine is relatively free in the cell and thereby capable of strong (high-affinity) associations with nucleic acids only after the ionic strength of the cell environment is lowered. PMID:320196

  1. One-stop genomic DNA extraction by salicylic acid-coated magnetic nanoparticles.

    PubMed

    Zhou, Zhongwu; Kadam, Ulhas S; Irudayaraj, Joseph

    2013-11-15

    Salicylic acid-coated magnetic nanoparticles were prepared via a modified one-step synthesis and used for a one-stop extraction of genomic DNA from mammalian cells. The synthesized magnetic particles were used for magnetic separation of cells from the media by nonspecific binding of the particles as well as extraction of genomic DNA from the lysate. The quantity and quality were confirmed by agarose gel electrophoresis and polymerase chain reaction. The entire process of extraction and isolation can be completed within 30 min. Compared with traditional methods based on centrifugation and filtration, the established method is fast, simple, reliable, and environmentally friendly.

  2. Sequence selective double strand DNA cleavage by peptide nucleic acid (PNA) targeting using nuclease S1.

    PubMed Central

    Demidov, V; Frank-Kamenetskii, M D; Egholm, M; Buchardt, O; Nielsen, P E

    1993-01-01

    A novel method for sequence specific double strand DNA cleavage using PNA (peptide nucleic acid) targeting is described. Nuclease S1 digestion of double stranded DNA gives rise to double strand cleavage at an occupied PNA strand displacement binding site, and under optimized conditions complete cleavage can be obtained. The efficiency of this cleavage is more than 10 fold enhanced when a tandem PNA site is targeted, and additionally enhanced if this site is in trans rather than in cis orientation. Thus in effect, the PNA targeting makes the single strand specific nuclease S1 behave like a pseudo restriction endonuclease. Images PMID:8502550

  3. Immobilization of DNA via oligonucleotides containing an aldehyde or carboxylic acid group at the 5' terminus.

    PubMed Central

    Kremsky, J N; Wooters, J L; Dougherty, J P; Meyers, R E; Collins, M; Brown, E L

    1987-01-01

    A general method for the immobilization of DNA through its 5'-end has been developed. A synthetic oligonucleotide, modified at its 5'-end with an aldehyde or carboxylic acid, was attached to latex microspheres containing hydrazide residues. Using T4 polynucleotide ligase and an oligonucleotide splint, a single stranded 98mer was efficiently joined to the immobilized synthetic fragment. After impregnation of the latex microspheres with the fluorescent dye, Nile Red and attachment of an aldehyde 16mer, 5 X 10(5) bead-DNA conjugates could be detected with a conventional fluorimeter. Images PMID:3562241

  4. Acetylsalicylic acid, aging and coronary artery disease are associated with ABCA1 DNA methylation in men

    PubMed Central

    2014-01-01

    Background Previous studies have suggested that DNA methylation contributes to coronary artery disease (CAD) risk variability. DNA hypermethylation at the ATP-binding cassette transporter A1 (ABCA1) gene, an important modulator of high-density lipoprotein cholesterol and reverse cholesterol transport, has been previously associated with plasma lipid levels, aging and CAD, but the association with CAD has yet to be replicated. Results ABCA1 DNA methylation levels were measured in leucocytes of 88 men using bis-pyrosequencing. We first showed that DNA methylation at the ABCA1 gene promoter locus is associated with aging and CAD occurrence in men (P < 0.05). The latter association is stronger among older men with CAD (≥61 years old; n = 19), who showed at least 4.7% higher ABCA1 DNA methylation levels as compared to younger men with CAD (<61 years old; n = 19) or men without CAD (n = 50; P < 0.001). Higher ABCA1 DNA methylation levels in older men were also associated with higher total cholesterol (r = 0.34, P = 0.03), low-density lipoprotein cholesterol (r = 0.32, P = 0.04) and triglyceride levels (r = 0.26, P = 0.09). Furthermore, we showed that acetylsalicylic acid therapy is associated with 3.6% lower ABCA1 DNA methylation levels (P = 0.006), independent of aging and CAD status of patients. Conclusions This study provides new evidence that the ABCA1 epigenetic profile is associated with CAD and aging, and highlights that epigenetic modifications might be a significant molecular mechanism involved in the pathophysiological processes associated with CAD. Acetylsalicylic acid treatment for CAD prevention might involve epigenetic mechanisms. PMID:25093045

  5. RNA:DNA Ratio and Other Nucleic Acid Derived Indices in Marine Ecology

    PubMed Central

    Chícharo, Maria Alexandra; Chícharo, Luis

    2008-01-01

    Some of most used indicators in marine ecology are nucleic acid-derived indices. They can be divided by target levels in three groups: 1) at the organism level as ecophysiologic indicators, indicators such as RNA:DNA ratios, DNA:dry weight and RNA:protein, 2) at the population level, indicators such as growth rate, starvation incidence or fisheries impact indicators, and 3) at the community level, indicators such as trophic interactions, exergy indices and prey identification. The nucleic acids derived indices, especially RNA:DNA ratio, have been applied with success as indicators of nutritional condition, well been and growth in marine organisms. They are also useful as indicators of natural or anthropogenic impacts in marine population and communities, such as upwelling or dredge fisheries, respectively. They can help in understanding important issues of marine ecology such as trophic interactions in marine environment, fish and invertebrate recruitment failure and biodiversity changes, without laborious work of counting, measuring and identification of small marine organisms. Besides the objective of integrate nucleic acid derived indices across levels of organization, the paper will also include a general characterization of most used nucleic acid derived indices in marine ecology and also advantages and limitations of them. We can conclude that using indicators, such RNA:DNA ratios and other nucleic acids derived indices concomitantly with organism and ecosystems measures of responses to climate change (distribution, abundance, activity, metabolic rate, survival) will allow for the development of more rigorous and realistic predictions of the effects of anthropogenic climate change on marine systems. PMID:19325815

  6. Binding-Induced DNA Nanomachines Triggered by Proteins and Nucleic Acids.

    PubMed

    Zhang, Hongquan; Lai, Maode; Zuehlke, Albert; Peng, Hanyong; Li, Xing-Fang; Le, X Chris

    2015-11-23

    We introduce the concept and operation of a binding-induced DNA nanomachine that can be activated by proteins and nucleic acids. This new type of nanomachine harnesses specific target binding to trigger assembly of separate DNA components that are otherwise unable to spontaneously assemble. Three-dimensional DNA tracks of high density are constructed on gold nanoparticles functionalized with hundreds of single-stranded oligonucleotides and tens of an affinity ligand. A DNA swing arm, free in solution, is linked to a second affinity ligand. Binding of a target molecule to the two ligands brings the swing arm to AuNP and initiates autonomous, stepwise movement of the swing arm around the AuNP surface. The movement of the swing arm, powered by enzymatic cleavage of conjugated oligonucleotides, cleaves hundreds of oligonucleotides in response to a single binding event. We demonstrate three nanomachines that are specifically activated by streptavidin, platelet-derived growth factor, and the Smallpox gene. Substituting the ligands enables the nanomachine to respond to other molecules. The new nanomachines have several unique and advantageous features over DNA nanomachines that rely on DNA self-assembly.

  7. Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

    PubMed

    Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

    2008-12-01

    A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety. PMID:19244904

  8. Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

    PubMed

    Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

    2008-12-01

    A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

  9. Persistence of DNA damage following exposure of human bladder cells to chronic monomethylarsonous acid

    SciTech Connect

    Wnek, S.M.; Medeiros, M.K.; Eblin, K.E.; Gandolfi, A.J.

    2009-12-01

    Malignant transformation was demonstrated in UROtsa cells following 52-weeks of exposure to 50 nM monomethylarsonous acid (MMA{sup III}); the result was the malignantly transformed cell line, URO-MSC. URO-MSC cells were used to study the induction of DNA damage and the alteration of DNA repair enzymes in both the presence of MMA{sup III} [URO-MSC(+)] and after subsequent removal of MMA{sup III} [URO-MSC(-)] following chronic, low-level exposure. In the presence of MMA{sup III}, URO-MSC(+) cells demonstrated a sustained increase in DNA damage following 12-weeks of exposure; in particular, a significant increase in DNA single-strand breaks at 12-weeks of exposure consistently elevated through 52 weeks. The persistence of DNA damage in URO-MSC cells was assessed after a 2-week removal of MMA{sup III}. URO-MSC(-) cells demonstrated a decrease in DNA damage compared to URO-MSC(+); however, DNA damage in URO-MSC(-) remained significantly elevated when compared to untreated UROtsa and increased in a time-dependent manner. Reactive oxygen species (ROS) were demonstrated to be a critical component in the generation of DNA damage determined through the incubation of ROS scavengers with URO-MSC cells. Poly (ADP-ribose) polymerase (PARP) is a key repair enzyme in DNA single-strand break repair. URO-MSC(+) resulted in a slight increase in PARP activity after 36-weeks of MMA{sup III} exposure, suggesting the presence of MMA{sup III} is inhibiting the increase in PARP activity. In support, PARP activity in URO-MSC(-) increased significantly, coinciding with a subsequent decrease in DNA damage demonstrated in URO-MSC(-) compared to URO-MSC(+). These data demonstrate that chronic, low-level exposure of UROtsa cells to 50 nM MMA{sup III} results in: the induction of DNA damage that remains elevated upon removal of MMA{sup III}; increased levels of ROS that play a role in MMA{sup III} induced-DNA damage; and decreased PARP activity in the presence of MMA{sup III}.

  10. Effect of nucleic acid binding dyes on DNA extraction, amplification, and STR typing.

    PubMed

    Haines, Alicia M; Tobe, Shanan S; Kobus, Hilton J; Linacre, Adrian

    2015-10-01

    We report on the effects of six dyes used in the detection of DNA on the process of DNA extraction, amplification, and detection of STR loci. While dyes can be used to detect the presence of DNA, their use is restricted if they adversely affect subsequent DNA typing processes. Diamond™ Nucleic Acid Dye, GelGreen™, GelRed™, RedSafe™, SYBR(®) Green I, and EvaGreen™ were evaluated in this study. The percentage of dye removed during the extraction process was determined to be: 70.3% for SYBR(®) Green I; 99.6% for RedSafe™; 99.4% for EvaGreen™; 52.7% for Diamond™ Dye; 50.6% for GelRed™, and; could not be determined for GelGreen™. It was then assumed that the amount of dye in the fluorescent quantification assay had no effect on the DNA signal. The presence of all six dyes was then reviewed for their effect on DNA extraction. The t-test showed no significant difference between the dyes and the control. These extracts were then STR profiled and all dyes and control produced full DNA profiles. STR loci in the presence of GelGreen(TM) at 1X concentration showed increased amplification products in comparison to the control samples. Full STR profiles were detected in the presence of EvaGreen™ (1X), although with reduced amplification products. RedSafe™ (1X), Diamond™ Dye (1X), and SYBR(®) Green I (1X) all exhibited varying degrees of locus drop-out with GelRed™ generating no loci at all. We provide recommendations for the best dye to visualize the presence of DNA profile as a biological stain and its subsequent amplification and detection. PMID:26202628

  11. Amino acid and cDNA sequences of lysozyme from Hyalophora cecropia

    PubMed Central

    Engström, Å.; Xanthopoulos, K. G.; Boman, H. G.; Bennich, H.

    1985-01-01

    The amino acid and cDNA sequences of lysozyme from the giant silk moth Hyalophora cecropia have been determined. This enzyme is one of several immune proteins produced by the diapausing pupae after injection of bacteria. Cecropia lysozyme is composed of 120 amino acids, has a mol. wt. of 13.8 kd and shows great similarity with vertebrate lysozymes of the chicken type. The amino acid residues responsible for the catalytic activity and for the binding of substrate are essentially conserved. Three allelic variants of the Cecropia enzyme are identified. A comparison of the chicken and the Cecropia lysozymes shows that there is a 40% identity at both the amino acid and the nucleotide level. Some evolutionary aspects of the sequence data are discussed. PMID:16453632

  12. Gibberellic-acid-induced cell elongation in pea epicotyls: Effect on polyploidy and DNA content.

    PubMed

    Boeken, G; Van Oostveldt, P

    1977-01-01

    In gibberellic-acid(GA3)-treated epicotyls of dwarf peas (Pisum sativum L.) grown in the light, DNA (per cell and per epicotyl) is followed. Histofluorometric DNA determinations show that GA3-promoted cell elongation is not accompanied by increased endomitosis, but chemical estimations show an increased DNA content per epicotyl. This difference must therefore be the result of increased mitotic activity in the GA3-treated tissue. Epicotyls of seedlings grown with or without cotyledons under continuous light with GA3 are tetraploid, as are those of ecotylized embryos grown in darkness. These epicotyls reach no more than half the length of octaploid epicotyls of seedlings grown in darkness. This result provides evidence for a relationship between polyploidy and final possible cell length. PMID:24419898

  13. Hyaluronic acid and fibrin hydrogels with concentrated DNA/PEI polyplexes for local gene delivery.

    PubMed

    Lei, Yuguo; Rahim, Maha; Ng, Quinn; Segura, Tatiana

    2011-08-10

    Local delivery of DNA through a hydrogel scaffold would increase the applicability of gene therapy in tissue regeneration and cancer therapy. However, the delivery of DNA/cationic polymer nanoparticles (polyplexes) using hydrogels is challenging due to the aggregation and inactivation of polyplexes during their incorporation into hydrogel scaffolds. We developed a novel process (termed caged nanoparticle encapsulation or CnE) to load concentrated and unaggregated non-viral gene delivery nanoparticles into various hydrogels. Previously, we showed that PEG hydrogels loaded with DNA/PEI polyplexes through this process were able to deliver genes both in vitro and in vivo. In this study, we found that hyaluronic acid and fibrin hydrogels with concentrated and unaggregated polyplexes loaded through CnE were able to deliver genes in vivo as well, demonstrating the universality of the process.

  14. Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.

    PubMed

    El-Diasty, Fouad; Abdel-Wahab, Fathy

    2015-10-01

    The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy.

  15. DNA methylation landscape of fat deposits and fatty acid composition in obese and lean pigs

    PubMed Central

    Zhang, Shunhua; Shen, Linyuan; Xia, Yudong; Yang, Qiong; Li, Xuewei; Tang, Guoqing; Jiang, Yanzhi; Wang, Jinyong; Li, Mingzhou; Zhu, Li

    2016-01-01

    Obese and lean type pig breeds exhibit differences in their fat deposits and fatty acid composition. Here, we compared the effect of genome-wide DNA methylation on fatty acid metabolism between Landrace pigs (LP, leaner) and Rongchang pigs (RP, fatty). We found that LP backfat (LBF) had a higher polyunsaturated fatty acid content but a lower adipocyte volume than RP backfat (RBF). LBF exhibited higher global DNA methylation levels at the genome level than RBF. A total of 483 differentially methylated regions (DMRs) were located in promoter regions, mainly affecting olfactory and sensory activity and lipid metabolism. In LBF, the promoters of genes related to ATPase activity had significantly stronger methylation. This fact may suggest lower energy metabolism levels, which may result in less efficient lipid synthesis in LBF. Furthermore, we identified a DMR in the miR-4335 and miR-378 promoters and validated their methylation status by bisulfite sequencing PCR. The hypermethylation of the promoters of miR-4335 and miR-378 in LBF and the resulting silencing of the target genes may result in LBF’s low content in saturated fatty acids and fat deposition capacity. This study provides a solid basis for exploring the epigenetic mechanisms affecting fat deposition and fatty acid composition. PMID:27721392

  16. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  17. DNA nanotechnology for nucleic acid analysis: DX motif-based sensor.

    PubMed

    Kolpashchikov, Dmitry M; Gerasimova, Yulia V; Khan, Mohammad S

    2011-11-25

    A light on the tiles: A sensor that fluoresces in the presence of specific nucleic acids was designed and characterized. The sensor uses a molecular beacon probe and three adaptor strands to form a five-stranded assembly, a DX-tile, with a specific analyte. This sensor is a highly selective and affordable tool for the real-time analysis of DNA and RNA.

  18. Information transfer from DNA to peptide nucleic acids by template-directed syntheses

    NASA Technical Reports Server (NTRS)

    Schmidt, J. G.; Christensen, L.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1997-01-01

    Peptide nucleic acids (PNAs) are analogs of nucleic acids in which the ribose-phosphate backbone is replaced by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. Oligocytidylates have been shown to act as templates for formation of longer oligomers of G from PNA G2 dimers. In this paper we show that information can be transferred from DNA to PNA. DNA C4T2C4 is an efficient template for synthesis of PNA G4A2G4 using G2 and A2 units as substrates. The corresponding synthesis of PNA G4C2G4 on DNA C4G2C4 is less efficient. Incorporation of PNA T2 into PNA products on DNA C4A2C4 is the least efficient of the three reactions. These results, obtained using PNA dimers as substrates, parallel those obtained using monomeric activated nucleotides.

  19. Inhibition of N-nitrosamine carcinogenesis and aflatoxin DNA damage by ellagic acid

    SciTech Connect

    Mandal-Chaudhuri, S.

    1988-01-01

    The effect of ellagic acid (EA), on the tumorigenicity of N-nitrosobenzylmethylamine (NBMA) in the rat esophagus was investigated. Groups of 30 male F-344 rats were fed a semipurified diet containing EA for 27 weeks. N-nitrosobenzylmethylamine was administered subcutaneously, once a week for 18 weeks. Ellagic acid produced a significant inhibition in the average number of esophageal tumors at both 20 weeks and 27 weeks. To investigate the mechanism(s) of this inhibition, EA was tested for its effect on the metabolism, DNA-binding and DNA-adduct formation of NBMA in cultured explants of rat esophagus. Explants were incubated in medium containing EA at concentrations of 10, 50, and 100 {mu}M for 16 hours, followed by the addition of 1{mu}M ({sup 3}H)NBMA and EA for 12 hours. Explant DNA was isolated by phenol extraction and hydroxylapatite chromatography, and benzaldehyde formation was determined by h.p.l.c. analysis of the culture medium. Finally, EA was examined for its ability to inhibit DNA damage induced by aflatoxin B{sub 1} (AFB{sub 1}) in cultured explants of rat trachea and esophagus, and human tracheobronchus.

  20. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  1. Effects of altered maternal folic acid, vitamin B12 and docosahexaenoic acid on placental global DNA methylation patterns in Wistar rats.

    PubMed

    Kulkarni, Asmita; Dangat, Kamini; Kale, Anvita; Sable, Pratiksha; Chavan-Gautam, Preeti; Joshi, Sadhana

    2011-01-01

    Potential adverse effects of excess maternal folic acid supplementation on a vegetarian population deficient in vitamin B(12) are poorly understood. We have previously shown in a rat model that maternal folic acid supplementation at marginal protein levels reduces brain omega-3 fatty acid levels in the adult offspring. We have also reported that reduced docosahexaenoic acid (DHA) levels may result in diversion of methyl groups towards DNA in the one carbon metabolic pathway ultimately resulting in DNA methylation. This study was designed to examine the effect of normal and excess folic acid in the absence and presence of vitamin B(12) deficiency on global methylation patterns in the placenta. Further, the effect of maternal omega 3 fatty acid supplementation on the above vitamin B(12) deficient diets was also examined. Our results suggest maternal folic acid supplementation in the absence of vitamin B(12) lowers plasma and placental DHA levels (p<0.05) and reduces global DNA methylation levels (p<0.05). When this group was supplemented with omega 3 fatty acids there was an increase in placental DHA levels and subsequently DNA methylation levels revert back to the levels of the control group. Our results suggest for the first time that DHA plays an important role in one carbon metabolism thereby influencing global DNA methylation in the placenta. PMID:21423696

  2. Relatedness Among Rhizobium and Agrobacterium Species Determined by Three Methods of Nucleic Acid Hybridization

    PubMed Central

    Gibbins, Ann M.; Gregory, K. F.

    1972-01-01

    Deoxyribonucleic acid (DNA) was isolated from 20 strains of Rhizobium and Agrobacterium and from one strain of Serratia marcescens; the guanine plus cytosine content of each DNA sample was determined by thermal denaturation. Radioactive DNA was isolated from three reference strains following the uptake of [2-14C]thymidine in the presence of deoxyadenosine. Ribonucleic acid (RNA) polymerase was used to synthesize radioactive RNA on DNA templates from the three reference strains. Radioactive DNA and RNA from the three reference strains were each hybridized with filter-bound DNA from all of the 21 test strains in 6 × SSC (standard saline citrate) and 50% formamide at 43 C for 40 hr. DNA/DNA relatedness was also determined by spectrophotometric measurement of the rates of association of single-stranded DNA. The order of relatedness between strains was similar by each method. Overall standard deviations for the DNA/DNA and DNA/RNA membrane filter techniques were ±0.87 and ±1.03%, respectively; that for the spectrophotometric technique was ±4.11%. The DNA/DNA membrane technique gave higher absolute values of hybridization than did the DNA/RNA technique. R. leguminosarum and R. trifolii could not be distinguished from each other by these techniques. These results also indicated close relationships between R. lupini and R. japonicum, and (with less certainty) between R. meliloti and R. phaseoli. Of all the rhizobia tested against the A. tumefaciens 371 reference strain, the R. japonicum strains were the most unrelated. The three Agrobacterium strains used were as related to the R. lupini and R. leguminosarum references as were several rhizobium strains. PMID:4591471

  3. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    PubMed

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-01-01

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets. PMID:27583575

  4. DNA delivery from hyaluronic acid-collagen hydrogels via a substrate-mediated approach

    PubMed Central

    Segura, Tatiana; Chung, Peter H.; Shea, Lonnie D.

    2008-01-01

    Efficient and controlled gene delivery from biodegradable materials can be employed to stimulate cellular processes that lead to tissue regeneration. In this report, a substrate-mediated approach was developed to deliver DNA from hyaluronic acid-collagen hydrogels. The hydrogels were formed by crosslinking HA with poly(ethylene glycol) diglycidyl ether. Poly(ethylene imine)(PEI)/DNA complexes were immobilized to the substrate using either biotin/neutravidin or non-specific adsorption. Complexes were formed in the presence or absence of salt to regulate complex size, and resulted in complexes with z-average diameters of 1221.7±152.3 and 139.4±1.3 nm, respectively. During 48-h incubation in PBS or hyaluronidase, DNA was released slowly from the hydrogel substrate (<30% of immobilized DNA), which was enhanced by incubation with conditioned media (≈50% of immobilized DNA). Transgene expression mediated by immobilized, large diameter complexes was 3 to 7-fold greater than for small diameter complexes. However, the percentage of cells expressing the transgene was greater for small diameter complexes (48.7%) than for large diameter complexes (22.3%). Spatially controlled gene transfer was achieved by topographically patterning the hydrogel to pattern cell adhesion. Biomaterial-based gene delivery can be applicable to numerous tissue engineering applications, or as a tool to examine tissue formation. PMID:15522759

  5. Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid

    PubMed Central

    Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena

    2013-01-01

    The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905

  6. Studies of Nondefective Adenovirus 2-Simian Virus 40 Hybrid Viruses II. Relationship of Adenovirus 2 Deoxyribonucleic Acid and Simian Virus 40 Deoxyribonucleic Acid in the Ad2+ND1 Genome

    PubMed Central

    Levin, Myron J.; Crumpacker, Clyde S.; Lewis, Andrew M.; Oxman, Michael N.; Henry, Patrick H.; Rowe, Wallace P.

    1971-01-01

    A nondefective adenovirus 2 (Ad2)-simian virus 40 (SV40) hybrid virus, Ad2+ND1, has been plaque-isolated from an Ad2-SV40 hybrid population. This virus, unlike the defective Ad-SV40 hybrid populations previously described, replicates without the aid of nonhybrid adenovirus helper. Consequently, the hybrid virus deoxyribonucleic acid (DNA) can be obtained free of nonhybrid adenovirus DNA. The DNA of the Ad2+ND1 virus was shown by ribonucleic acid (RNA)-DNA hybridization to consist of nucleotide sequences complementary to Ad2- and SV40-specific RNA. Techniques of equilibrium density and rate zonal centrifugation were employed to demonstrate that these Ad2 and SV40 nucleotide sequences were linked together in the same DNA molecules by alkali-resistant bonds. Calibration curves were established relating the amount of tritium-labeled SV40-specific RNA (prepared in vitro or in vivo) bound to given amounts of SV40 DNA in a hybridization reaction, and these curves were employed to determine the equivalent amount of SV40 DNA in the Ad2+ND1 molecule. From the results obtained, it was estimated that 1% of the Ad2+ND1 DNA consists of SV40 nucleotide sequences. PMID:4323709

  7. Boswellic acid induces epigenetic alterations by modulating DNA methylation in colorectal cancer cells

    PubMed Central

    Shen, Yan; Takahashi, Masanobu; Byun, Hyang-Min; Link, Alexander; Sharma, Nupur; Balaguer, Francesc; Leung, Hon-Chiu; Boland, C. Richard; Goel, Ajay

    2012-01-01

    Accumulating evidence suggests that chemopreventive effects of some dietary polyphenols may in part be mediated by their ability to influence epigenetic mechanisms in cancer cells. Boswellic acids, derived from the plant Boswellia serrata, have long been used for the treatment of various inflammatory diseases due to their potent anti-inflammatory activities. Recent preclinical studies have also suggested that this compound has anti-cancer potential against various malignancies. However, the precise molecular mechanisms underlying their anti-cancer effects remain elusive. Herein, we report that boswellic acids modulate DNA methylation status of several tumor suppressor genes in colorectal cancer (CRC) cells. We treated RKO, SW48 and SW480 CRC cell lines with the active principle present in boswellic acids, acetyl-keto-β-boswellic acid (AKBA). Using genome-wide DNA methylation and gene expression microarray analyses, we discovered that AKBA induced a modest genome-wide demethylation that permitted simultaneous re-activation of the corresponding tumor suppressor genes. The quantitative methylation-specific PCR and RT-PCR validated the gene demethylation and re-expression in several putative tumor suppressor genes including SAMD14 and SMPD3. Furthermore, AKBA inhibited DNMT activity in CRC cells. Taken together, these results lend further support to the growing notion that anti-cancer effect of boswellic acids may in part be due to its ability to demethylate and reactivate methylation-silenced tumor suppressor genes. These results suggest that not only boswellic acid might be a promising epigenetic modulator in the chemoprevention and treatment of CRC, but also provide a rationale for future investigations on the usefulness of such botanicals for epigenetic therapy in other human malignancies. PMID:22415137

  8. Molecular docking study investigating the possible mode of binding of C.I. Acid Red 73 with DNA.

    PubMed

    Guo, Yumei; Yue, Qinyan; Gao, Baoyu

    2011-07-01

    C.I. Acid Red 73 is a reactive azo dye with a variable potential carcinogenicity. The mechanism mediating interactions that occur between the dye and DNA have not been completely understood thus far. In this study, molecular docking techniques were applied to describe the most probable mode of DNA binding as well as the sequence selectivity of the C.I. Acid Red 73 dye. These docking experiments revealed that the dye is capable of interacting with the minor groove of the DNA on the basis of its curved shape, which fits well with the topology of double-stranded DNA. In addition, the dye can bind selectively to the minor groove of the DNA by applying CGT sequence selectivity. Further, the minor groove can be recognized although DNA targets present intercalation gaps. However, intercalative binding can also occur when the DNA target possesses an appropriate intercalation gap. Compared with the other eight DNA sequences that were studied, the DNA dodecamer d(CGCGATATCGCG)(2) (PDB ID: 1DNE) presents a very favorable target for the binding of C.I. Acid Red 73 to the minor groove, with the lowest binding free energy -9.19 kcal/mol. Results reported from this study are expected to provide useful information for research involving further simulations of molecular dynamics and toxicology investigations of the dye.

  9. The cytotoxicity, DNA crosslinking ability and DNA sequence selectivity of the aniline mustards melphalan, chlorambucil and 4-[bis(2-chloroethyl)amino] benzoic acid.

    PubMed

    Sunters, A; Springer, C J; Bagshawe, K D; Souhami, R L; Hartley, J A

    1992-07-01

    Three aniline derivatives melphalan (L-PAM), chlorambucil (CHL) and 4-[bis(2-chloroethyl)amino] benzoic acid (BAM) have been compared on the basis of their in vitro cytotoxicities, DNA interstrand crosslinking ability and DNA sequence selectivity. Cytotoxicity was assessed in the human colonic adenocarcinoma LS174T and leukaemic K562 cell lines using the sulpho-rhodamine B and tetrazolium dye reduction assays. The order of cytotoxicities was L-PAM greater than CHL greater than BAM in both cell lines with K562 being less sensitive than LS174T. This was different from the order CHL greater than L-PAM greater than BAM which would be predicted from simple chemical reactivity or rate of hydrolysis, parameters which have been used previously as indicators of biological potency for aromatic nitrogen mustards. DNA interstrand crosslinking in cells as determined by alkaline elution showed a correlation with IC50 values. The ranking order of activity was further predicted by the ability of the agents to produce interstrand crosslinks in isolated DNA. The extent of guanine N-7 alkylation, assessed using a modified DNA sequencing technique, mirrored cytotoxicity and crosslinking ability, but at equivalent levels of alkylation there was no significant difference in DNA sequence selectivity. These data demonstrates that simple chemical reactivity or hydrolysis rate is not a good indicator of DNA reactivity or cytotoxicity for a number of aniline mustards, whereas DNA interstrand crosslinking ability either measured directly in cells or in isolated DNA, gives a good indication of biological activity.

  10. Technical approaches for efficient high-precision nucleic acid analysis using DNA microarrays

    NASA Astrophysics Data System (ADS)

    Pinkel, Daniel; Hamilton, Gregory; Brown, Nils; Segraves, Richard; Huey, Bing; Snijders, Anoine; Blackwood, Stephanie; Hindle, Kate; Law, Sindy; Gray, Joe W.; Jain, Ajay; Hanson, John; Nordmeyer, Robert; Albertson, Donna

    2002-06-01

    Microarray measurements offer the potential to compare the abundances of numerous nucleic acid sequences in parallel. Using linker-adapter PCR products from mapped BAC clones we have made arrays that permit scanning the human genome for single copy gains and losses of DNA sequence, which requires reliable detection of 50 percent changes. The DNA is printed at high concentration on amino-silane or chromium coated surface using a custom-built capillary pin printing system. Spots are printed on 130 micrometers centers or closer to minimize the size of the arrays. Hybridization occurs in a dextran sulfate/formamide buffer at 37 degrees C, using slow rocking to mix the reaction. The entire array is imaged in a single CCD frame using a custom built system that employs mercury arc illumination. Up to four fluorochromes can be imaged from a single array with adequate spectral separation. Typically we use DAPI to stain the DNA in the array spots to facilitate automatic image segmentation during analysis, and fluorescein, Cy3, and Cy5 or their spectral equivalents, for labeling specimen nucleic acids. Array spots are segmented and quantitative fluorescence intensities and intensity ratios are automatically calculated in < 1 minute per approximately 8000 element array using the custom software UCSF SPOT.

  11. Unsaturated fatty acids bind Myc-Max transcription factor and inhibit Myc-Max-DNA complex formation.

    PubMed

    Chung, Sunah; Park, Seyeon; Yang, Chul Hak

    2002-12-15

    Oncoprotein Myc, hetero-dimerized with Max through a b/HLH/Zip region, is a transcription factor that governs important cellular processes such as cell cycle entry, proliferation and differentiation. We found that linoleic acid, isolated from Pollen Typhae, and other unsaturated fatty acids have strong inhibitory effects on the binding of Myc-Max heterodimer to an E-box DNA site (CA(C/T)GTG). The interaction of a fatty acid with a protein dimer, not with DNA, is assumed to block the entire Myc-Max-DNA complex formation. Unsaturated fatty acids also showed cytotoxicity against a SNU16 human stomach cancer cell line and conjugated linoleic acid suppressed mRNA expression of several myc-target genes; ornithine decarboxylase, p53, cdc25a in the SNU16 cells.

  12. [Classification of amino acids based on a comparative analysis of contacts in DNA-protein complexes and specific DNA-protein interactions].

    PubMed

    Anashkina, A A; Kuznetsov, E N; Batianovskiĭ, A V; Gnuchev, N V; Tumanian, V G; Esipova, N G

    2013-01-01

    The classification of amino acid residues based on the events of contact formation between distinct amino acid and selected nucleotides was constructed. Thus, the most integral properties, that characterize interactions in organization of DNA-protein complexes, were used. We applied the Voronoi-Delaunay tessellation to draw statistics of contacts and area of contacts for the set included 1937 DNA-protein complexes. Similarities of amino acid residues have been searched for based on the comparison of corresponded rows and matrixes of contacts and areas of contacts. Nine measures of distance were used for estimation of rows similarity degree. The procedure of clustering amino acids in groups included three hierarchical and two nonhierarchical methods. A total tree was built using nine techniques of estimating distance with three hierarchical clustering methods. It was shown that clustering centers in the main groups are always constant while other relationships between objects vary. Clustering of binary associations was found for the most amino acids. Major classes of up to six amino acids correspond to the certain local structures of the polypeptide chain in the context of amino acid composition. These data should be taken into account when designing DNA-protein ligands. PMID:25486755

  13. [Classification of amino acids based on a comparative analysis of contacts in DNA-protein complexes and specific DNA-protein interactions].

    PubMed

    2013-01-01

    The classification of amino acid residues based on the events of contact formation between distinct amino acid and selected nucleotides was constructed. Thus, the most integral properties, that characterize interactions in organization of DNA-protein complexes, were used. We applied the Voronoi-Delaunay tessellation to draw statistics of contacts and area of contacts for the set included 1937 DNA-protein complexes. Similarities of amino acid residues have been searched for based on the comparison of corresponded rows and matrixes of contacts and areas of contacts. Nine measures of distance were used for estimation of rows similarity degree. The procedure of clustering amino acids in groups included three hierarchical and two nonhierarchical methods. A total tree was built using nine techniques of estimating distance with three hierarchical clustering methods. It was shown that clustering centers in the main groups are always constant while other relationships between objects vary. Clustering of binary associations was found for the most amino acids. Major classes of up to six amino acids correspond to the certain local structures of the polypeptide chain in the context of amino acid composition. These data should be taken into account when designing DNA-protein ligands. PMID:25508886

  14. Evaluation of DNA typing as a positive identification method for soft and hard tissues immersed in strong acids.

    PubMed

    Robino, C; Pazzi, M; Di Vella, G; Martinelli, D; Mazzola, L; Ricci, U; Testi, R; Vincenti, M

    2015-11-01

    Identification of human remains can be hindered by several factors (e.g., traumatic mutilation, carbonization or decomposition). Moreover, in some criminal cases, offenders may purposely adopt various expedients to thwart the victim's identification, including the dissolution of body tissues by the use of corrosive reagents, as repeatedly reported in the past for Mafia-related murders. By means of an animal model, namely porcine samples, we evaluated standard DNA typing as a method for identifying soft (muscle) and hard (bone and teeth) tissues immersed in strong acids (hydrochloric, nitric and sulfuric acid) or in mixtures of acids (aqua regia). Samples were tested at different time intervals, ranging between 2 and 6h (soft tissues) and 2-28 days (hard tissues). It was shown that, in every type of acid, complete degradation of the DNA extracted from soft tissues preceded tissue dissolution and could be observed within 4h of immersion. Conversely, high molecular weight DNA amenable to STR analysis could be isolated from hard tissues as long as cortical bone fragments were still present (28 days for sulfuric acid, 7 days for nitric acid, 2 days for hydrochloric acid and aqua regia), or the integrity of the dental pulp chamber was preserved (7 days, in sulfuric acid only). The results indicate that DNA profiling of acid-treated body parts (in particular, cortical bone) is still feasible at advanced stages of corrosion, even when the morphological methods used in forensic anthropology and odontology can no longer be applied for identification purposes.

  15. DNA/polyethyleneimine/hyaluronic acid small complex particles and tumor suppression in mice.

    PubMed

    Ito, Tomoko; Yoshihara, Chieko; Hamada, Katsuyuki; Koyama, Yoshiyuki

    2010-04-01

    The highest barriers for non-viral vectors to an efficient in vivo gene transfection would be (1) non-specific interaction with biological molecules, and (2) large size of the DNA complex particles. Protective coating of the DNA/polyethyleneimine (PEI) complexes by hyaluronic acid (HA) effectively diminished the adverse interactions with biological molecules. Here we found HA also protected the DNA/PEI complexes against aggregation and inactivation through lyophilization-and-rehydration procedures. It allows us to prepare the concentrated very small DNA complex particles (<70 nm) suspension by preparing the complexes at highly diluted conditions, followed by lyophilized-and-rehydrated to a small volume. In vivo gene expression efficiency of the small complex was examined with mice subcutaneously inoculated with B16 melanoma cells. These formulations showed high reporter-gene expression level in tumor after intravenous injection into tumor-bearing mice. Small complex was then made of the plasmid encoding GM-CSF gene, and injected into the mice bearing subcutaneous solid B16 tumor. After intravenous injection, it induced apparent tumor growth suppression in 50% of the mice. Notably, significant therapeutic effect was detected in the mice that received intratumoral injection, and 75% of the mice were completely cured with disappearance of tumor. PMID:20047759

  16. Hybrid polymeric hydrogels via peptide nucleic acid (PNA)/DNA complexation.

    PubMed

    Chu, Te-Wei; Feng, Jiayue; Yang, Jiyuan; Kopeček, Jindřich

    2015-12-28

    This work presents a new concept in hybrid hydrogel design. Synthetic water-soluble N-(2-hydroxypropyl)methacrylamide (HPMA) polymers grafted with multiple peptide nucleic acids (PNAs) are crosslinked upon addition of the linker DNA. The self-assembly is mediated by the PNA-DNA complexation, which results in the formation of hydrophilic polymer networks. We show that the hydrogels can be produced through two different types of complexations. Type I hydrogel is formed via the PNA/DNA double-helix hybridization. Type II hydrogel utilizes a unique "P-form" oligonucleotide triple-helix that comprises two PNA sequences and one DNA. Microrheology studies confirm the respective gelation processes and disclose a higher critical gelation concentration for the type I gel when compared to the type II design. Scanning electron microscopy reveals the interconnected microporous structure of both types of hydrogels. Type I double-helix hydrogel exhibits larger pore sizes than type II triple-helix gel. The latter apparently contains denser structure and displays greater elasticity as well. The designed hybrid hydrogels have potential as novel biomaterials for pharmaceutical and biomedical applications.

  17. Determination of the dissociation constants for recombinant c-Myc, Max, and DNA complexes: The inhibitory effect of linoleic acid on the DNA-binding step

    SciTech Connect

    Jung, Kyung Chae; Rhee, Ho Sung; Park, Chi Hoon; Yang, Chul-Hak . E-mail: chulyang@plaza.snu.ac.kr

    2005-08-19

    c-Myc, the protein product of protooncogene c-myc, functions in cell proliferation, differentiation, and neoplastic disease. In this study, recombinant c-Myc and Max proteins, encompassing DNA binding (basic region) and dimerization (helix-loop-helix/leucine zipper) domain of human origin, were expressed in bacteria as Myc87 and Max85. Myc87 was purified under denatured conditions and was renatured again. The dissociation constant for the protein dimers and for dimer/DNA complexes were not detectable by isothermal titration calorimetry because of the low degree of solubility of Myc87 and Max85. Therefore, we set up equations which were used to determine the dissociation constants from the proportion of protein-DNA complexes. The dimer dissociation constants in TBS were 5.90({+-}0.54) x 10{sup -7} M for Max85/Max85 homodimer, 6.85({+-}0.25) x 10{sup -3} M for Myc87/Myc87 homodimer, and 2.55({+-}0.29) x 10{sup -8} M for Myc87/Max85 heterodimer, and the DNA-binding dissociation constants in TBS were 1.33({+-}0.21) x 10{sup -9} M for Max85/Max85/DNA, 2.27({+-}0.08) x 10{sup -12} M for Myc87/Myc87/DNA, and 4.43({+-}0.37) x 10{sup -10} M for Myc87/Max85/DNA. In addition, we revealed that linoleic acid which is known as an inhibitor for the formation of Max/Max/DNA complex reduced the affinity of Max homodimer for DNA. This result indicates that linoleic acid may bind to the DNA-binding region of Max homodimer.

  18. Quantification of false positive reduction in nucleic acid purification on hemorrhagic fever DNA.

    SciTech Connect

    James, Conrad D.; Pohl, Kenneth Roy; Derzon, Mark Steven; McClain, Jaime; Achyuthan, Komandoor

    2006-11-01

    Columbia University has developed a sensitive highly multiplexed system for genetic identification of nucleic acid targets. The primary obstacle to implementing this technology is the high rate of false positives due to high levels of unbound reporters that remain within the system after hybridization. The ability to distinguish between free reporters and reporters bound to targets limits the use of this technology. We previously demonstrated a new electrokinetic method for binary separation of kb pair long DNA molecules and oligonucleotides. The purpose of this project 99864 is to take these previous demonstrations and further develop the technique and hardware for field use. Specifically, our objective was to implement separation in a heterogeneous sample (containing target DNA and background oligo), to perform the separation in a flow-based device, and to develop all of the components necessary for field testing a breadboard prototype system.

  19. MicroRNA and DNA methylation alterations mediating retinoic acid induced neuroblastoma cell differentiation.

    PubMed

    Stallings, Raymond L; Foley, Niamh H; Bray, Isabella M; Das, Sudipto; Buckley, Patrick G

    2011-10-01

    Many neuroblastoma cell lines can be induced to differentiate into a mature neuronal cell type with retinoic acid and other compounds, providing an important model system for elucidating signalling pathways involved in this highly complex process. Recently, it has become apparent that miRNAs, which act as regulators of gene expression at a post-transcriptional level, are differentially expressed in differentiating cells and play important roles governing many aspects of this process. This includes the down-regulation of DNA methyltransferases that cause the de-methylation and transcriptional activation of numerous protein coding gene sequences. The purpose of this article is to review involvement of miRNAs and DNA methylation alterations in the process of neuroblastoma cell differentiation. A thorough understanding of miRNA and genetic pathways regulating neuroblastoma cell differentiation potentially could lead to targeted therapies for this disease.

  20. Circulating nucleic acids damage DNA of healthy cells by integrating into their genomes.

    PubMed

    Mittra, Indraneel; Khare, Naveen Kumar; Raghuram, Gorantla Venkata; Chaubal, Rohan; Khambatti, Fatema; Gupta, Deepika; Gaikwad, Ashwini; Prasannan, Preeti; Singh, Akshita; Iyer, Aishwarya; Singh, Ankita; Upadhyay, Pawan; Nair, Naveen Kumar; Mishra, Pradyumna Kumar; Dutt, Amit

    2015-03-01

    Whether nucleic acids that circulate in blood have any patho-physiological functions in the host have not been explored.We report here that far from being inert molecules, circulating nucleic acids have significant biological activities of their own that are deleterious to healthy cells of the body. Fragmented DNA and chromatin (DNAfs and Cfs) isolated from blood of cancer patients and healthy volunteers are readily taken up by a variety of cells in culture to be localized in their nuclei within a few minutes. The intra-nuclear DNAfs and Cfs associate themselves with host cell chromosomes to evoke a cellular DNA-damage-repair-response (DDR) followed by their incorporation into the host cell genomes. Whole genome sequencing detected the presence of tens of thousands of human sequence reads in the recipient mouse cells. Genomic incorporation of DNAfs and Cfs leads to dsDNA breaks and activation of apoptotic pathways in the treated cells. When injected intravenously into Balb/C mice, DNAfs and Cfs undergo genomic integration into cells of their vital organs resulting in activation of DDR and apoptotic proteins in the recipient cells. Cfs have significantly greater activity than DNAfs with respect to all parameters examined, while both DNAfs and Cfs isolated from cancer patients are more active than those from normal volunteers. All the above pathological actions of DNAfs and Cfs described above can be abrogated by concurrent treatment with DNase I and/or anti-histone antibody complexed nanoparticles both in vitro and in vivo. Taken together, our results suggest that circulating DNAfs and Cfs are physiological, continuously arising, endogenous DNA damaging agents with implications to ageing and a multitude of human pathologies including initiation of cancer.

  1. Distinct Z-DNA binding mode of a PKR-like protein kinase containing a Z-DNA binding domain (PKZ)

    PubMed Central

    Kim, Doyoun; Hur, Jeonghwan; Park, Kwangsoo; Bae, Sangsu; Shin, Donghyuk; Ha, Sung Chul; Hwang, Hye-Yeon; Hohng, Sungchul; Lee, Joon-Hwa; Lee, Sangho; Kim, Yang-Gyun; Kim, Kyeong Kyu

    2014-01-01

    Double-stranded ribonucleic acid-activated protein kinase (PKR) downregulates translation as a defense mechanism against viral infection. In fish species, PKZ, a PKR-like protein kinase containing left-handed deoxyribonucleic acid (Z-DNA) binding domains, performs a similar role in the antiviral response. To understand the role of PKZ in Z-DNA recognition and innate immune response, we performed structural and functional studies of the Z-DNA binding domain (Zα) of PKZ from Carassius auratus (caZαPKZ). The 1.7-Å resolution crystal structure of caZαPKZ:Z-DNA revealed that caZαPKZ shares the overall fold with other Zα, but has discrete structural features that differentiate its DNA binding mode from others. Functional analyses of caZαPKZ and its mutants revealed that caZαPKZ mediates the fastest B-to-Z transition of DNA among Zα, and the minimal interaction for Z-DNA recognition is mediated by three backbone phosphates and six residues of caZαPKZ. Structure-based mutagenesis and B-to-Z transition assays confirmed that Lys56 located in the β-wing contributes to its fast B-to-Z transition kinetics. Investigation of the DNA binding kinetics of caZαPKZ further revealed that the B-to-Z transition rate is positively correlated with the association rate constant. Taking these results together, we conclude that the positive charge in the β-wing largely affects fast B-to-Z transition activity by enhancing the DNA binding rate. PMID:24682817

  2. DNA Three Way Junction Core Decorated with Amino Acids-Like Residues-Synthesis and Characterization.

    PubMed

    Addamiano, Claudia; Gerland, Béatrice; Payrastre, Corinne; Escudier, Jean-Marc

    2016-01-01

    Construction and physico-chemical behavior of DNA three way junction (3WJ) functionalized by protein-like residues (imidazole, alcohol and carboxylic acid) at unpaired positions at the core is described. One 5'-C(S)-propargyl-thymidine nucleotide was specifically incorporated on each strand to react through a post synthetic CuACC reaction with either protected imidazolyl-, hydroxyl- or carboxyl-azide. Structural impacts of 5'-C(S)-functionalization were investigated to evaluate how 3WJ flexibility/stability is affected. PMID:27563857

  3. Effect of alpha-ketoglutarate and oxaloacetate on brain mitochondrial DNA damage and seizures induced by kainic acid in mice.

    PubMed

    Yamamoto, Hiro-aki; Mohanan, Parayanthala V

    2003-07-20

    The effects of alpha-ketoglutarate and oxaloacetate on brain mitochondrial DNA (mtDNA) damage and seizures induced by kainic acid were examined both in vivo and in vitro. An intraperitoneal (ip) injection of kainic acid (45 mg/kg) produced broad-spectrum limbic and severe sustained seizures in all of the treated mice. The seizures were abolished when alpha-ketoglutarate (2 g/kg) or oxaloacetate (1 g/kg) was injected intraperitoneally in the animals 1 min before kainic acid administration. In addition, the administration of kainic acid caused damage to mtDNA in brain frontal and middle cortex of mice. These effects were completely abolished by the ip preinjection of alpha-ketoglutarate (2 g/kg) or oxaloacetate (1 g/kg). In vitro exposure of kainic acid (0.25, 0.5 or 1.0 mM) to brain homogenate inflicted damage to mtDNA in a concentration-dependent manner. The damage of mtDNA induced by 1.0 mM kainic acid was attenuated by the co-treatment with alpha-ketoglutarate (2.5 or 5.0 mM) or oxaloacetate (0.75 or 1.0 mM). Furthermore, in vivo and in vitro exposure of kainic acid elicited an increase in lipid peroxidation. However, the increased lipid peroxidation was completely inhibited by cotreatment of alpha-ketoglutarate or oxaloacetate. These results suggest that alpha-keto acids such as alpha-ketoglutarate and oxaloacetate play a role in the inhibition of seizures and subsequent mtDNA damage induced by the excitotoxic/neurotoxic agent, kainic acid.

  4. Impact of boric acid exposure at different concentrations on testicular DNA and male rats fertility.

    PubMed

    El-Dakdoky, Mai H; Abd El-Wahab, Hanan M F

    2013-06-01

    The aim of this study was to investigate the consequences of exposure to three levels of boric acid (BA) on male rats reproduction, fertility and progeny outcome, with emphasis on testicular DNA level and quality. Adult male rats (12 weeks old) were treated orally with 125, 250 and 500 mg/kg bwt/d of BA for 60 d. The results indicated that BA administration at 125 mg/kg bwt had no adverse effects on fertility, sperm characteristics or prenatal development of the impregnated females. However, at dose 250 mg, BA treatment significantly increased serum nitric oxide, testosterone, estradiol levels and testicular boron and calcium levels and also significantly reduced serum arginase activity, sperm quality and testicular DNA content with minor DNA fragmentation. The impact of BA exposure at dose 250 mg on male rats fertility was translated into increases in pre-implantation loss with a resulting decrease in the number of live fetuses/litter. In addition to the significant alteration of biochemical measurements, observed at dose 250 mg, administration of BA at 500 mg caused testicular atrophy, severe damage of spermatogenesis, spermiation failure and significant reduction of Mg and Zn testicular levels. None of the male rats, treated with 500 mg/kg bwt, could impregnate untreated females, suggesting the occurrence of definitive loss of fertility. In conclusion, BA impaired fertility, in a dose-dependant manner, by targeting the highly proliferative cells, the germ cells, through decreasing DNA synthetic rate rather than the induction of DNA damage. PMID:23301826

  5. Impact of boric acid exposure at different concentrations on testicular DNA and male rats fertility.

    PubMed

    El-Dakdoky, Mai H; Abd El-Wahab, Hanan M F

    2013-06-01

    The aim of this study was to investigate the consequences of exposure to three levels of boric acid (BA) on male rats reproduction, fertility and progeny outcome, with emphasis on testicular DNA level and quality. Adult male rats (12 weeks old) were treated orally with 125, 250 and 500 mg/kg bwt/d of BA for 60 d. The results indicated that BA administration at 125 mg/kg bwt had no adverse effects on fertility, sperm characteristics or prenatal development of the impregnated females. However, at dose 250 mg, BA treatment significantly increased serum nitric oxide, testosterone, estradiol levels and testicular boron and calcium levels and also significantly reduced serum arginase activity, sperm quality and testicular DNA content with minor DNA fragmentation. The impact of BA exposure at dose 250 mg on male rats fertility was translated into increases in pre-implantation loss with a resulting decrease in the number of live fetuses/litter. In addition to the significant alteration of biochemical measurements, observed at dose 250 mg, administration of BA at 500 mg caused testicular atrophy, severe damage of spermatogenesis, spermiation failure and significant reduction of Mg and Zn testicular levels. None of the male rats, treated with 500 mg/kg bwt, could impregnate untreated females, suggesting the occurrence of definitive loss of fertility. In conclusion, BA impaired fertility, in a dose-dependant manner, by targeting the highly proliferative cells, the germ cells, through decreasing DNA synthetic rate rather than the induction of DNA damage.

  6. Transcription of exogenous and endogenous deoxyribonucleic acid templates in cold-shocked Bacillus subtilis.

    PubMed Central

    Kuhl, S J; Brown, L R

    1980-01-01

    Ribonucleic acid (RNA) synthesis was examined in cold-shocked Bacillus subtilis cells. The cells were grown to mid-log stage, harvested, and cold shocked. RNA synthesis was monitored by the incorporation of [3H]uridine triphosphate or [alpha 32P]adenosine triphosphate into trichloroacetic acid-precipitable material in the presence of all four nucleoside triphosphates. The inhibition of RNA synthesis in cold-shocked cells by lipiarmycin, ethidium bromide, rifampin. or streptolydigin was analyzed using mutant or wild-type cells. Also examined were the effects of temperature, salt concentration, and the addition of polyamines or highly phosphorylated nucleotides. In ultraviolet-irradiated and cold-shocked cells, RNA wynthesis decreased to low levels. The addition of exogenous phi 29 or TSP-1 template to these cells caused a 13- to 20-fold increase in RNA synthesis, as monitored by trichloroacetic acid-precipitable counts. RNA synthesized in the presence of phi 29 deoxyribonucleic acid (DNA) hybridizes mainly to EcoRI fragments A and C of phi 29 DBA, These two fragments direct transcription by purified RNA polymerase in vitro and hybridize to early phi 29 DNA produced in vivo. Our results with TSP-1 DNA in this system indicated that the RNA produced hybridizes to the same fragments as early RNA produced in vivo. Plasmic pUB110 DNA was not transcribed in this system. Images PMID:6157674

  7. Antibacterial Nitroacridine, Nitroakridin 3582: Binding to Nucleic Acids In Vitro and Effects on Selected Cell-Free Model Systems of Macromolecular Biosynthesis

    PubMed Central

    Wolfe, Alan D.; Cook, Thomas M.; Hahn, Fred E.

    1971-01-01

    Nitroakridin 3582 (NA) formed complexes with native deoxyribonucleic acid (DNA) and with transfer ribonucleic acid (tRNA) species from Escherichia coli. Spectrophotometric titrations of NA with these nucleic acids produced numerical results from which nonlinear adsorption isotherms were derived. These curves indicated the existence of more than one class of binding sites on the polymers to which NA was bound by more than one process. The stoichiometry of strong binding of NA to double helical DNA was in agreement with a conventional value (1 ligand molecule per 4.2 component nucleotides) for complete intercalation binding. NA inhibited the DNA-dependent DNA polymerase I and RNA polymerase reactions, the first strongly and the second appreciably. These inhibitions corresponded to the extents to which NA inhibits DNA and RNA biosyntheses in vivo. Evidently, NA interferes with the template function of DNA. The drug also inhibited the polymerization of phenylalanine in a cell-free E. coli ribosome-polyuridylic acid [poly (U)] system. The effect paralleled an inhibition of the poly (U)-directed binding of phenylalanyl tRNA to ribosomes. Ethidium bromide acted similarly. The antimalarial drug, chloroquine, stimulated polyphenylalanine synthesis, apparently as a result of stimulating the poly (U)-directed binding of phenylalanyl tRNA to ribosomes. PMID:4945180

  8. Characterization of a novel inhibitor of human DNA polymerases: 3,4,5-tri-O-galloylquinic acid.

    PubMed

    Parker, W B; Nishizawa, M; Fisher, M H; Ye, N; Lee, K H; Cheng, Y C

    1989-11-01

    Various galloyl derivatives of quinic acid were found to be inhibitors of human DNA polymerases. Among them, 3,4,5-tri-O-galloylquinic acid (TGQA) was the most potent inhibitor of DNA polymerase alpha. Under identical conditions, this compound was 60-fold more potent than aphidicolin as an inhibitor of DNA polymerase alpha. The inhibition of DNA polymerase alpha by this compound was not competitive with either the template or any of the deoxynucleoside triphosphates with a Ki of 0.28 microM. Under similar reaction conditions, DNA polymerases beta and gamma were much less sensitive to the effects of these compounds and, in contrast to the effect seen with DNA polymerase alpha, the inhibition of DNA polymerases beta and gamma by TGQA was competitive with respect to the template with Ki values of 44.4 and 7.5 microM respectively. The potency of these compounds against DNA polymerase gamma varied according to the assay conditions used. The inhibition of DNA polymerase gamma by TGQA could be increased substantially by using MnCl2 in place of MgCl2 and by including 50 mM potassium phosphate, pH 7.5, in the assay mixture. DNA polymerase beta was also more sensitive to TGQA when measured with MnCl2. However, potassium phosphate had little, if any, effect on the inhibition by TGQA of either DNA polymerase alpha or beta. DNA polymerase alpha was less sensitive to TGQA when assayed with MnCl2. TGQA was not a potent inhibitor of human KB cell growth in culture, which could be due to its degradation or poor uptake. Nevertheless, this compound could serve as a model for developing antitumor drugs targeted at DNA polymerases.

  9. Determination of DNA adducts by combining acid-catalyzed hydrolysis and chromatographic analysis of the carcinogen-modified nucleobases.

    PubMed

    Leung, Elvis M K; Deng, Kailin; Wong, Tin-Yan; Chan, Wan

    2016-01-01

    The commonly used method of analyzing carcinogen-induced DNA adducts involves the hydrolysis of carcinogen-modified DNA samples by using a mixture of enzymes, followed by (32)P-postlabeling or liquid chromatography (LC)-based analyses of carcinogen-modified mononucleotides/nucleosides. In the present study, we report the development and application of a new approach to DNA adduct analysis by combining the H(+)/heat-catalyzed release of carcinogen-modified nucleobases and the use of LC-based methods to analyze DNA adducts. Results showed that heating the carcinogen-modified DNA samples at 70 °C for an extended period of 4 to 6 h in the presence of 0.05% HCl can efficiently induce DNA depurination, releasing the intact carcinogen-modified nucleobases for LC analyses. After optimizing the hydrolysis conditions, DNA samples with C8- and N (2) -modified 2'-deoxyguanosine, as well as N (6) -modified 2'-deoxyadenosine, were synthesized by reacting DNA with 1-nitropyrene, acetaldehyde, and aristolochic acids, respectively. These samples were then hydrolyzed, and the released nucleobase adducts were analyzed using LC-based analytical methods. Analysis results demonstrated a dose-dependent release of target DNA adducts from carcinogen-modified DNA samples, indicating that the developed H(+)/heat-catalyzed hydrolysis method was quantitative. Comparative studies with enzymatic digestion method on carcinogen-modified DNA samples revealed that the two hydrolysis methods did not yield systematically different results.

  10. Molecular cloning of a cDNA encoding a novel fatty acid-binding protein from rat skin.

    PubMed

    Watanabe, R; Fujii, H; Odani, S; Sakakibara, J; Yamamoto, A; Ito, M; Ono, T

    1994-04-15

    A novel skin-type fatty acid-binding protein, termed cutaneous(C)-FABP, has been purified from rat skin and a cDNA clone for this protein has been identified. The purified protein had the ability to bind long chain fatty acids like other rat FABPs. The deduced amino acid sequence of the cDNA clone comprises residues yielding a molecular mass for the polypeptide of 15.1 kDa and exhibits around 50% identity to myelin P2 protein, adipocyte FABP and heart FABP. Our results propose that C-FABP is a new member of the FABP family.

  11. Theoretical study of the adsorption of DNA bases on the acidic external surface of montmorillonite.

    PubMed

    Mignon, Pierre; Sodupe, Mariona

    2012-01-14

    In the present study, DFT periodic plane wave calculations, at the PBE-D level of theory, were carried out to investigate the interaction of DNA nucleobases with acidic montmorillonite. The surface model was considered in its octahedral (Osub) and tetrahedral (Tsub) substituted forms, known to have different acidic properties. The adsorption of adenine, guanine and cytosine was considered in both orthogonal and coplanar orientations with the surface, interacting with the proton via a given heteroatom. In almost all considered cases, adsorption involved the spontaneous proton transfer to the nucleobase, with a more pronounced character in the Osub structures. The binding energy is about 10 kcal mol(-1) larger for Osub than for Tsub complexes mainly due to the larger acidity in Osub surfaces and due to the better stabilization by H-bond contacts between the negatively charged surface and the protonated base. The binding energy of coplanar orientations of the base is observed to be as large as the orthogonal ones due to a balance between electrostatic and dispersion contributions. Finally the binding of guanine and adenine on the acidic surface amounts to 50 kcal mol(-1) while that of cytosine rises to 44 kcal mol(-1).

  12. Homodinuclear lanthanide complexes of phenylthiopropionic acid: synthesis, characterization, cytotoxicity, DNA cleavage, and antimicrobial activity.

    PubMed

    Shiju, C; Arish, D; Kumaresan, S

    2013-03-15

    Lanthanide complexes of La(III), Pr(III), Nd(III), Sm(III), and Ho(III) with phenylthiopropionic acid were synthesized and characterized by elemental analysis, mass, IR, electronic spectra, molar conductance, TGA, and powder XRD. The results show that the lanthanide complexes are homodinuclear in nature. The two lanthanide ions are bridged by eight oxygen atoms from four carboxylate groups. Thermal decomposition profiles are consistent with the proposed formulations. Powder XRD studies show that all the complexes are amorphous in nature. Antimicrobial studies indicate that these complexes exhibit more activity than the ligand itself. The DNA cleavage activity of the ligand and its complexes were assayed on Escherichia coli DNA using gel electrophoresis in the presence of H(2)O(2). The result shows that the Pr(III) and Nd(III) complexes have completely cleaved the DNA. The anticancer activities of the complexes have also been studied towards human cervical cancer cell line (HeLa) and colon cancer cells (HCT116) and it was found that the La(III) and Nd(III) complexes are more active than the corresponding Pr(III), Sm(III), Ho(III) complexes, and the free ligand on both the cancer cells.

  13. Homodinuclear lanthanide complexes of phenylthiopropionic acid: Synthesis, characterization, cytotoxicity, DNA cleavage, and antimicrobial activity

    NASA Astrophysics Data System (ADS)

    Shiju, C.; Arish, D.; Kumaresan, S.

    2013-03-01

    Lanthanide complexes of La(III), Pr(III), Nd(III), Sm(III), and Ho(III) with phenylthiopropionic acid were synthesized and characterized by elemental analysis, mass, IR, electronic spectra, molar conductance, TGA, and powder XRD. The results show that the lanthanide complexes are homodinuclear in nature. The two lanthanide ions are bridged by eight oxygen atoms from four carboxylate groups. Thermal decomposition profiles are consistent with the proposed formulations. Powder XRD studies show that all the complexes are amorphous in nature. Antimicrobial studies indicate that these complexes exhibit more activity than the ligand itself. The DNA cleavage activity of the ligand and its complexes were assayed on Escherichia coli DNA using gel electrophoresis in the presence of H2O2. The result shows that the Pr(III) and Nd(III) complexes have completely cleaved the DNA. The anticancer activities of the complexes have also been studied towards human cervical cancer cell line (HeLa) and colon cancer cells (HCT116) and it was found that the La(III) and Nd(III) complexes are more active than the corresponding Pr(III), Sm(III), Ho(III) complexes, and the free ligand on both the cancer cells.

  14. Porous hyaluronic acid hydrogels for localized nonviral DNA delivery in a diabetic wound healing model.

    PubMed

    Tokatlian, Talar; Cam, Cynthia; Segura, Tatiana

    2015-05-01

    The treatment of impaired wounds requires the use of biomaterials that can provide mechanical and biological queues to the surrounding environment to promote angiogenesis, granulation tissue formation, and wound closure. Porous hydrogels show promotion of angiogenesis, even in the absence of proangiogenic factors. It is hypothesized that the added delivery of nonviral DNA encoding for proangiogenic growth factors can further enhance this effect. Here, 100 and 60 μm porous and nonporous (n-pore) hyaluronic acid-MMP hydrogels with encapsulated reporter (pGFPluc) or proangiogenic (pVEGF) plasmids are used to investigate scaffold-mediated gene delivery for local gene therapy in a diabetic wound healing mouse model. Porous hydrogels allow for significantly faster wound closure compared with n-pore hydrogels, which do not degrade and essentially provide a mechanical barrier to closure. Interestingly, the delivery of pDNA/PEI polyplexes positively promotes granulation tissue formation even when the DNA does not encode for an angiogenic protein. And although transfected cells are present throughout the granulation tissue surrounding, all hydrogels at 2 weeks, pVEGF delivery does not further enhance the angiogenic response. Despite this, the presence of transfected cells shows promise for the use of polyplex-loaded porous hydrogels for local gene delivery in the treatment of diabetic wounds.

  15. DNA binding mode of novel tetradentate amino acid based 2-hydroxybenzylidene-4-aminoantipyrine complexes

    NASA Astrophysics Data System (ADS)

    Raman, N.; Sobha, S.; Selvaganapathy, M.; Mahalakshmi, R.

    2012-10-01

    Few transition metal complexes of tetradentate N2O2 donor Schiff base ligands containing 2-hydroxybenzylidene-4-aminoantipyrine and amino acids (alanine/valine) abbreviated to KHL1/KHL2 have been synthesized. All the metal complexes have been fully characterized with the help of elemental analyses, molecular weights, molar conductance values, magnetic moments and spectroscopic data. The Schiff bases KHL1/KHL2 are found to act as tetradentate ligands using N2O2 donor set of atoms leading to a square-planar geometry for the complexes around the metal ions. The binding behaviors of the complexes to calf thymus DNA have been investigated by absorption spectra, viscosity measurements and cyclic voltammetry. The DNA binding constants reveal that all these complexes interact with DNA through minor groove binding mode. The studies on mechanism of photocleavage reveal that singlet oxygen (1O2) and superoxide anion radical (O2rad -) may play an important role in the photocleavage. The Schiff bases and their metal complexes have been screened for their in vitro antibacterial activities against Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Staphylococcus epidermidis, Klebsiella pneumoniae and antifungal activities against Aspergillus niger, Fusarium solani, Culvularia lunata, Rhizoctonia bataicola and Candida albicans by MIC method.

  16. DNA binding mode of novel tetradentate amino acid based 2-hydroxybenzylidene-4-aminoantipyrine complexes.

    PubMed

    Raman, N; Sobha, S; Selvaganapathy, M; Mahalakshmi, R

    2012-10-01

    Few transition metal complexes of tetradentate N(2)O(2) donor Schiff base ligands containing 2-hydroxybenzylidene-4-aminoantipyrine and amino acids (alanine/valine) abbreviated to KHL(1)/KHL(2) have been synthesized. All the metal complexes have been fully characterized with the help of elemental analyses, molecular weights, molar conductance values, magnetic moments and spectroscopic data. The Schiff bases KHL(1)/KHL(2) are found to act as tetradentate ligands using N(2)O(2) donor set of atoms leading to a square-planar geometry for the complexes around the metal ions. The binding behaviors of the complexes to calf thymus DNA have been investigated by absorption spectra, viscosity measurements and cyclic voltammetry. The DNA binding constants reveal that all these complexes interact with DNA through minor groove binding mode. The studies on mechanism of photocleavage reveal that singlet oxygen ((1)O(2)) and superoxide anion radical (O(2)(-)) may play an important role in the photocleavage. The Schiff bases and their metal complexes have been screened for their in vitro antibacterial activities against Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Staphylococcus epidermidis, Klebsiella pneumoniae and antifungal activities against Aspergillus niger, Fusarium solani, Culvularia lunata, Rhizoctonia bataicola and Candida albicans by MIC method. PMID:22885083

  17. Enzymatic amplification of DNA/RNA hybrid molecular beacon signaling in nucleic acid detection.

    PubMed

    Jacroux, Thomas; Rieck, Daniel C; Cui, Rong; Ouyang, Yexin; Dong, Wen-Ji

    2013-01-15

    A rapid assay operable under isothermal or nonisothermal conditions is described, where the sensitivity of a typical molecular beacon (MB) system is improved by using thermostable RNase H to enzymatically cleave an MB composed of a DNA stem and an RNA loop (R/D-MB). On hybridization of the R/D-MB to target DNA, there was a modest increase in fluorescence intensity (~5.7× above background) due to an opening of the probe and a concomitant reduction in the Förster resonance energy transfer efficiency. The addition of thermostable RNase H resulted in the cleavage of the RNA loop, which eliminated energy transfer. The cleavage step also released bound target DNA, enabling it to bind to another R/D-MB probe and rendering the approach a cyclic amplification scheme. Full processing of R/D-MBs maximized the fluorescence signal to the fullest extent possible (12.9× above background), resulting in an approximately 2- to 2.8-fold increase in the signal-to-noise ratio observed isothermally at 50 °C following the addition of RNase H. The probe was also used to monitor real-time polymerase chain reactions by measuring enhancement of donor fluorescence on R/D-MB binding to amplified pUC19 template dilutions. Hence, the R/D-MB-RNase H scheme can be applied to a broad range of nucleic acid amplification methods.

  18. Entropy Beacon: A Hairpin-Free DNA Amplification Strategy for Efficient Detection of Nucleic Acids.

    PubMed

    Lv, Yifan; Cui, Liang; Peng, Ruizi; Zhao, Zilong; Qiu, Liping; Chen, Huapei; Jin, Cheng; Zhang, Xiao-Bing; Tan, Weihong

    2015-12-01

    Here, we propose an efficient strategy for enzyme- and hairpin-free nucleic acid detection called an entropy beacon (abbreviated as Ebeacon). Different from previously reported DNA hybridization/displacement-based strategies, Ebeacon is driven forward by increases in the entropy of the system, instead of free energy released from new base-pair formation. Ebeacon shows high sensitivity, with a detection limit of 5 pM target DNA in buffer and 50 pM in cellular homogenate. Ebeacon also benefits from the hairpin-free amplification strategy and zero-background, excellent thermostability from 20 °C to 50 °C, as well as good resistance to complex environments. In particular, based on the huge difference between the breathing rate of a single base pair and two adjacent base pairs, Ebeacon also shows high selectivity toward base mutations, such as substitution, insertion, and deletion and, therefore, is an efficient nucleic acid detection method, comparable to most reported enzyme-free strategies.

  19. In vitro study of DNA damage induced by acid orange 52 and its biodegradation derivatives.

    PubMed

    Ben Mansour, Hedi; Barillier, Daniel; Corroler, David; Ghedira, Kamel; Chekir-Ghedira, Leila; Mosrati, Ridha

    2009-03-01

    Mutagenicity of acid orange 52 (AO52) and its degradation products by Pseudomonas putida mt-2 was evaluated with the use of Salmonella Typhimurium TA102 and TA104 with and without the metabolic activation system (S9). No mutagenicity was observed in the absence of S9 and in the presence of S9 for biodegradation under shaking conditions, but it increased significantly in the presence of S9 after biodegradation under static conditions. In addition, the ability of tested compounds to induce DNA damage in vitro was evaluated with the DNA strand scission assay. The toxicity generated by the pure azo dye and the corresponding azoreduction products (4-aminobenzenesulfonic acid and N,N'-dimethyl-p-phenylenediamine) were compared. We suggest that the mutagenicity mechanism of these molecules occurs through free radical generation processes. In this study, we demonstrate that P. putida mt-2 incubated under aerobic conditions undergoes catabolism that enables it to degrade AO52 completely and, especially, to detoxify the dye mixtures.

  20. Arginine as a general acid catalyst in serine recombinase-mediated DNA cleavage.

    PubMed

    Keenholtz, Ross A; Mouw, Kent W; Boocock, Martin R; Li, Nan-Sheng; Piccirilli, Joseph A; Rice, Phoebe A

    2013-10-01

    Members of the serine family of site-specific DNA recombinases use an unusual constellation of amino acids to catalyze the formation and resolution of a covalent protein-DNA intermediate. A recent high resolution structure of the catalytic domain of Sin, a particularly well characterized family member, provided a detailed view of the catalytic site. To determine how the enzyme might protonate and stabilize the 3'O leaving group in the strand cleavage reaction, we examined how replacing this oxygen with a sulfur affected the cleavage rate by WT and mutant enzymes. To facilitate direct comparison of the cleavage rates, key experiments used suicide substrates that prevented religation after cleavage. The catalytic defect associated with mutation of one of six highly conserved arginine residues, Arg-69 in Sin, was partially rescued by a 3' phosphorothiolate substrate. We conclude that Arg-69 has an important role in stabilizing the 3'O leaving group and is the prime candidate for the general acid that protonates the 3'O, in good agreement with the position it occupies in the high resolution structure of the active site of Sin.

  1. Incorporation of Ribonucleic Acid Bases into the Metabolic Pool and RNA of E. coli

    PubMed Central

    Buchwald, M.; Britten, R. J.

    1963-01-01

    Labeled cytosine, adenine, and guanine are rapidly incorporated by E. coli. A fraction of the radioactivity passes directly into RNA with very little delay. The remainder enters a pool before being incorporated into RNA. The fractions entering the pool and the time constants for equilibration of the specific activity of the pool are widely different for the four RNA bases. PMID:14016541

  2. Mesenchymal stem cells as novel micro-ribonucleic acid delivery vehicles in kidney disease.

    PubMed

    Yao, Kevin; Ricardo, Sharon D

    2016-05-01

    MicroRNAs (miRNAs) are short single strands of RNA responsible for post-transcriptional regulation of gene expression and have been implicated in the pathogenesis of chronic kidney disease (CKD). Emerging evidence reports that miRNAs can reduce kidney fibrosis through regulation of targets associated with collagen and extracellular matrix accumulation. However, the development of miRNA therapies has been hampered by the lack of targeted and sustainable methods of systemic miRNA delivery. Mesenchymal stem cells (MSCs) provide a promising miRNA delivery platform to overcome toxicity, the potential for insertional mutations and the low efficiency of previous methods. MSCs are endogenously immunoprivileged and home to sites of inflammation. They also release trophic growth factors to modulate the immune system, alter the polarization of macrophages and provide renal protection and repair. The potential to engineer MSCs to express or overexpress miRNAs, released by exosomes, may enhance their natural functions. Clinical studies are already being conducted individually for the use of miRNAs in cancer and MSCs in diseases associated with CKD. Hence, the combination of miRNAs and MSCs may provide an unparalleled cell-based therapy for treating CKD.

  3. Physical properties of single- and double-stranded coliphage ribonucleic acid

    PubMed Central

    Bishop, D. H. L.

    1966-01-01

    1. The physical characteristics of single- and double-stranded coliphage RNA with regard to their sedimentation behaviour in gradients of sucrose in high or low ionic conditions were examined. The effect of heat on their sedimentation characteristics was also determined. 2. Single-stranded coliphage RNA was found to exist in three different forms having sedimentation coefficients 28s, 20s and 12s. The latter two were interchangeable, depending on ionic strength. All three were almost equally infectious to spheroplasts. 3. Double-stranded coliphage RNA was found to be non-infectious to spheroplasts and had sedimentation coefficients 15s and 12s. Thermal denaturation gave rise to infectious single-stranded 12s RNA. 4. Four possible hypotheses on the mechanism of replication of coliphage RNA are discussed. PMID:4165511

  4. The effect of reaction with formaldehyde on the sedimentation rates of ribonucleic acids

    PubMed Central

    Fenwick, M. L.

    1968-01-01

    It has been reported that the RNA of several bacteriophages and that of the larger ribosomal sub-units of mammalian cells sediment faster in the presence of 0·1m-sodium chloride than is expected from their estimated molecular weights. The effect of blocking the hydrogen-bonding amino groups of these and other types of RNA was studied. The RNA of phage R17 no longer sedimented anomalously fast after treatment with formaldehyde. In contrast, the larger ribosomal RNA of HeLa cells appeared more aberrant than before, sedimenting faster than tobacco-mosaic-virus RNA (mol.wt. 2×106) in the presence of formaldehyde. The rapidly labelled nuclear 45s RNA of HeLa cells still sedimented faster than the larger ribosomal RNA after reaction with formaldehyde, showing no evidence of disaggregation. It is suggested that both the large ribosomal RNA and the 45s RNA of HeLa cells may have a non-linear structure. PMID:16742611

  5. Determination of base ratios of six ribonucleic acid bacteriophages specific to Escherichia coli

    PubMed Central

    Bishop, D. H. L.; Bradley, D. E.

    1965-01-01

    1. A method is described for the isolation of single-stranded-RNA coliphages. Two of the six RNA coliphages investigated were new strains. 2. The base ratios of six RNA coliphages were determined by labelling the host bacterium with [32P]-phosphate, purification of the radioactive coliphages and separation of 2′,3′-ribonucleotides liberated by alkaline hydrolysis of the coliphage RNA. 3. All six of the coliphages were morphologically similar, contained single-stranded RNA, and had sedimentation coefficient 80±5s. 4. The six RNA coliphages fell into two distinct groups, both serologically and in terms of their RNA base ratios. PMID:14333571

  6. Structural proteins of ribonucleic acid tumor viruses. Purification of envelope, core, and internal components.

    PubMed

    Strand, M; August, J T

    1976-01-25

    Murine type C virus structural proteins, the envelope glycopeptides, 30,000 dalton major core protein, and 15,000 dalton internal protein have each been purified to near homogeneity and in high yield from the smae batch of virus by use of phosphocellulose column chromatography and gel filtration procedures. Evidence that these proteins are specified by the viral genome was obtained by competition radioimmunoassay analysis, comparing these polypeptides from Rauscher virus cultivated in a variety of mammalian cell lines; all of the reactive antigenic determinants of these proteins appeared to be virus-specific.

  7. Multimeric small interfering ribonucleic acid for highly efficient sequence-specific gene silencing

    NASA Astrophysics Data System (ADS)

    Mok, Hyejung; Lee, Soo Hyeon; Park, Ji Won; Park, Tae Gwan

    2010-03-01

    Small interfering RNA (siRNA) with 19-21 base pairs has been recently recognized as a new therapeutic agent for effectively silencing a specific gene on a post-transcription level. For siRNA therapeutics, safe and efficient delivery issues are significant hurdles to clinical applications. Here we present a new class of biologically active siRNA structure based on chemically self-crosslinked and multimerized siRNA through cleavable disulphide linkages. The multimerized siRNA can produce more stable and compact polyelectrolyte complexes with less cytotoxic cationic carriers than naked siRNA because of substantially increased charge densities and the presence of flexible chemical linkers in the backbone. The cleavable and multimerized siRNA shows greatly enhanced gene-silencing efficiencies in vitro and in vivo through a target-messenger-RNA-specific RNA interference processing without significantly eliciting immune induction. This study demonstrates that the multimerized siRNA structure complexed with selected cationic condensing agents can serve as potential gene-silencing therapeutics for treating various diseases.

  8. Decreased ribonucleic acid synthesis in isolated rat liver nuclei during starvation

    PubMed Central

    Rickwood, D.; Klemperer, H. G.

    1970-01-01

    1. Isolated nuclei from starved rats showed a lowered incorporation of [14C]UMP into RNA. 2. The Mg2+-dependent incorporation was decreased by 30% after 1 day of starvation, but incorporation in the presence of Mn2+ and ammonium sulphate decreased only after longer periods of starvation. 3. RNA synthesis by nuclei in the presence of excess of added RNA polymerase was unchanged after 1 day of starvation and was inhibited by 20% after 4 days. 4. The capacity of nuclei to bind actinomycin D was unchanged after 1 day and was decreased by 20% after 4 days of starvation. PMID:5493859

  9. The effects of oestradiol-17beta on the ribonucleic acid polymerases of immature rabbit uterus.

    PubMed Central

    Borthwick, N M; Smellie, R M

    1975-01-01

    Measurements of the endogenous RNA polymerase activities of nuclei isolated from immature rabbit uteri have shown that prior treatment of the animals with oestradiol-17beta has a profound effect on the apparent activities of both RNA polymerases A and B. Within 1 h of hormone treatment, the activity of RNA polymerase A is increased and continues to rise until about 4h when it reaches a plateau and remains steady until at least 8h. The activity of RNA polymerase B increases sharply after oestradiol treatment reaching an early maximum at 30-45 min. Thereafter this activity declines until by 1-2h it approaches control values but a second increase in activity then occurs with a maximum at 3-4h. Treatment of the rabbits with alpha-amanitin before the administration of oestradiol inhibits the hormone-induced stimulation of RNA polymerase A activity in isolated nuclei but when the administration of alpha-amanitin is delayed until after the early rise of RNA polymerase B activity, the oestradiol-induced stimulation of RNA polymerase A is retained. Similar results have been obtained in experiments with cycloheximide suggesting that the stimulation of RNA polymerase A activity by oestradiol is dependent on the hormone-induced stimulation of RNA polymerase B and the subsequent synthesis of protein using the RNA product of the early increase in RNA polymerase B activity. Measurement of the activities of RNA polymerases A and B after isolation of the enzymes from immature rabbit uterine nuclei before and after oestradiol treatment failed to show any differences. Therefore it would appear that the changes in the observed activities of RNA polymerases A and B in isolated nuclei are consequences of changes in the structure and function of chromatin rather than the results of modifications in the RNA polymerases themselves. PMID:1156388

  10. Ontogeny and pituitary regulation of testicular growth hormone-releasing hormone-like messenger ribonucleic acid.

    PubMed

    Berry, S A; Pescovitz, O H

    1990-09-01

    The testis is rich in central nervous system-type neuropeptides, including a GH-releasing hormone (GHRH)-like substance. We examined the ontogeny and pituitary regulation of testicular GHRH-like mRNA (t-GHRH mRNA) and compared this to expression of insulin-like growth factor-I (IGF-I) and IGF-II mRNA in developing testis. t-GHRH mRNA was measured by dot blot hybridization and quantitated using a hypothalamic GHRH cRNA standard. t-GHRH mRNA was not detectable in Northern blots in fetal testis on day 19 of gestation, but was present in low but detectable amounts in testicular dot blots on day 2 of life (0.44 pg/micrograms total RNA). Levels of the RNA increased beginning on day 21 (1.72 +/- 0.23 pg/micrograms total RNA) and reached adult levels by day 30 (4.96 +/- 0.84 pg/micrograms total RNA). The GHRH species on Northern analysis was about 1750 nucleotides at all ages examined; there was a larger species of about 3350 nucleotides seen on days 65 and 90. There was no correlation between the ontogeny of t-GHRH mRNA and either IGF-I or IGF-II mRNAs, which were maximally expressed in the testes of day 2 animals and decreased with age. To examine the influence of the pituitary gland on t-GHRH mRNA, levels of the mRNA were measured in the tests of hypophysectomized animals and age-matched controls. In animals hypophysectomized on day 21 and killed on day 42 and in animals hypophysectomized on day 42 and killed on day 63, there was marked diminution of t-GHRH mRNA (19 +/- 5% and 9 +/- 2% of age-matched controls, respectively). In contrast, in animals hypophysectomized on day 65 and killed on either day 80 or 90, there was a much smaller difference in levels of t-GHRH mRNA compared to values in control animals (73 +/- 20%). This was unlike the effect of hypophysectomy on testicular IGF-I mRNA, where uniform diminution was seen in all three groups. Because GH is important in the regulation of hypothalamic GHRH mRNA, we examined the effects of administration of recombinant human GH on the reinduction of t-GHRH mRNA after hypophysectomy and compared this to the reinduction of IGF-I mRNA. Neither t-GHRH mRNA nor testicular IGF-I mRNA increased in hypophysectomized animals treated with GH. Our results indicate that t-GHRH mRNA is developmentally regulated, and that the hypothalamic-pituitary axis is important in its expression.(ABSTRACT TRUNCATED AT 400 WORDS)

  11. Hormonal regulation of type II glucocorticoid receptor messenger ribonucleic acid in rat brain.

    PubMed

    Peiffer, A; Lapointe, B; Barden, N

    1991-10-01

    Differences in the regulation of type II glucocorticoid receptor (GR) mRNA levels in female rat brain regions involved in the control of the hypothalamic-pituitary-adrenal axis were studied by Northern blot analysis after chronic administration of corticosterone or dexamethasone to adrenalectomized (ADX), ovariectomized (OVX), and ADX/OVX animals. The effect of chronic estradiol or progesterone treatment of intact animals was also studied. Our results show that type II GR mRNA levels of ADX animals were significantly increased above control values in amygdala (140%) and hippocampus (196%), but not in hypothalamus. These increased transcript levels were down-regulated by corticosterone or dexamethasone, with the exception of those in the amygdala, where corticosterone had no effect. Ovariectomy significantly increased hypothalamic GR mRNA content (174%) over control values, and this increase was sensitive to dexamethasone. The combined effect of adrenalectomy/ovariectomy on GR mRNA levels was greater than that of adrenalectomy only in amygdala. Corticosterone increased amygdala transcript levels in OVX and ADX/OVX animals. Estradiol administration to intact animals raised the GR mRNA content of amygdala, while progesterone treatment had no effect on any of the brain regions studied. We conclude that there exists heterogeneity with respect to type II GR mRNA regulation by corticosterone and dexamethasone in brain regions of ADX female rats, and that certain limbic structures show greater sensitivity to these hormonal manipulations, suggesting a more prominent role in the regulation of the hypothalamic-pituitary-adrenal axis. Our results also suggest that circulating estrogens can influence the sensitivity of brain structures (i.e. hypothalamus and amygdala) to glucocorticoids by altering GR mRNA levels. These regions may represent integration sites at which gonadal steroids are able to alter stress hormone secretion.

  12. Evolution of early life inferred from protein and ribonucleic acid sequences

    NASA Technical Reports Server (NTRS)

    Dayhoff, M. O.; Schwartz, R. M.

    1978-01-01

    The chemical structures of ferredoxin, 5S ribosomal RNA, and c-type cytochrome sequences have been employed to construct a phylogenetic tree which connects all major photosynthesizing organisms: the three types of bacteria, blue-green algae, and chloroplasts. Anaerobic and aerobic bacteria, eukaryotic cytoplasmic components and mitochondria are also included in the phylogenetic tree. Anaerobic nonphotosynthesizing bacteria similar to Clostridium were the earliest organisms, arising more than 3.2 billion years ago. Bacterial photosynthesis evolved nearly 3.0 billion years ago, while oxygen-evolving photosynthesis, originating in the blue-green algal line, came into being about 2.0 billion years ago. The phylogenetic tree supports the symbiotic theory of the origin of eukaryotes.

  13. Calcium and potassium ion binding by tobacco mosaic virus ribonucleic acid.

    PubMed

    Gastfriend, H H; Lauffer, M A

    1983-11-15

    Calcium and potassium ion titration experiments were performed on solutions of tobacco mosaic virus RNA using ion-specific electrodes. The data obtained were analyzed using Scatchard and Klotz plots for the number of binding sites per nucleotide (n), and the apparent stability constant for complex formation, beta Me. The experimental design also allowed for the determination of the number of protons released per metal ion bound, chi. The calcium ion titration in water yielded values of 0.45 for n, 6.03 for log beta Ca and 0.24 for chi. When this titration was repeated in 0.01 M-KCl, the values were found to be 0.11 for n, 5.08 for log beta Ca and zero for chi. An aqueous potassium titration was also performed, with values for n, log beta K and chi of 0.25, 2.96 and less than 0.10, respectively.

  14. Prostanoid-induced expression of matrix metalloproteinase-1 messenger ribonucleic acid in rat osteosarcoma cells

    NASA Technical Reports Server (NTRS)

    Clohisy, J. C.; Connolly, T. J.; Bergman, K. D.; Quinn, C. O.; Partridge, N. C.

    1994-01-01

    Individual prostanoids have distinct potencies in activating intracellular signaling pathways and regulating gene expression in osteoblastic cells. The E-series prostaglandins (PGs) are known to stimulate matrix metalloproteinase-1 (MMP-1) synthesis and secretion in certain rodent and human osteoblastic cells, yet the intracellular events involved remain unclear. To further characterize this response and its signal transduction pathway(s), we examined prostanoid-induced expression of the MMP-1 gene in the rat osteoblastic osteosarcoma cell line UMR 106-01. Northern blot analysis demonstrated that prostaglandin E2 (PGE2) and PGE1 were very potent stimulators (40-fold) of MMP-1 transcript abundance, PGF2 alpha and prostacyclin were weak stimulators (4-fold), and thromboxane-B2 had no effect. The marked increase in MMP-1 transcript abundance after PGE2 treatment was first detected at 2 h, became maximal at 4 h, and persisted beyond 24 h. This response was dose dependent and elicited maximal and half-maximal effects with concentrations of 10(-6) and 0.6 x 10(-7) M, respectively. Cycloheximide, a protein synthesis inhibitor, completely blocked this effect of PGE2, suggesting that the expression of other genes is required. Nuclear run-on experiments demonstrated that PGE2 rapidly activates MMP-1 gene transcription, with a maximal increase at 2-4 h. The second messenger analog, 8-bromo-cAMP, mimicked the effects of PGE2 by stimulating a dose-dependent increase in MMP-1 messenger RNA (mRNA) levels, with a maximal effect quantitatively similar to that observed with PGE2. Thus, in UMR 106-01 cells, different prostanoids have distinct potencies in stimulating MMP-1 mRNA abundance. Our data suggest that PGE2 stimulation of MMP-1 synthesis is due to activation of MMP-1 gene transcription and a subsequent marked increase in MMP-1 mRNA abundance. This effect is dependent on de novo protein synthesis and is mimicked by protein kinase-A activation.

  15. The Coding Properties of Lysine-accepting Transfer Ribonucleic Acids from Black-eyed Peas 1

    PubMed Central

    Hague, Donald R.; Kofoid, Eric C.

    1971-01-01

    Lysine-accepting transfer RNA from ungerminated and germinated embryo axes of black-eyed peas (Vigna sinensis L. Savi) was fractionated on benzoylated diethylaminoethyl cellulose and reverse phase Freon columns. Cochromatography indicated the presence of two similar lysyl transfer RNA fractions in each tissue. Ribosome binding studies revealed that the larger of the two fractions in each case is specific for the AAG codon, while the smaller one recognizes AAA and AAG. Possible implications of this difference in quantities of isoacceptors in translation of genetic information are discussed. PMID:16657787

  16. Discovery of huanglongbing (HLB) pre-symptomatic Ribonucleic acid (RNA) biomarkers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Huanglongbing (HLB) is the most devastating citrus disease and is associated with vector-borne Liberibacter. Currently there is no cure for huanglongbing. Visual disease symptoms appear in only a few leaves months after initial Liberibacter exposure compromising disease management by tree removal. S...

  17. Estrogen-induced decrease of glucocorticoid receptor messenger ribonucleic acid concentration in rat anterior pituitary gland.

    PubMed

    Peiffer, A; Barden, N

    1987-06-01

    Using Northern blots and hybridization techniques, we have identified an approximately 6.5 kilobase glucocorticoid receptor mRNA species in rat anterior pituitary gland. Ovariectomy resulted in an approximately 2-fold increase in glucocorticoid receptor mRNA concentrations. This effect was maximal 8 days after surgery and glucocorticoid receptor mRNA levels remained elevated for at least up to 4 weeks. Administration of 17-beta-estradiol completely reversed the ovariectomy-induced increase in glucocorticoid receptor mRNA content of pituitary gland. Treatment of rats with corticosterone did not influence the ovariectomy-induced increase in glucocorticoid receptor mRNA content, indicating that this increase is not mediated via effects on circulating glucocorticoid levels or availability. In situ hybridization experiments confirmed the ovariectomy-induced increase in glucocorticoid receptor mRNA content and indicated that this action is widely distributed throughout the anterior pituitary gland.

  18. The nucleotide sequences of some large ribonuclease T1 products from bacteriophage R17 ribonucleic acid

    PubMed Central

    Jeppesen, Peter G. N.

    1971-01-01

    A method of `fingerprinting' high-molecular-weight 32P-labelled RNA species, using a two-dimensional thin-layer-chromatographic separation of ribonuclease T1 digestion products, has been applied to RNA from the Escherichia coli bacteriophage R17. The `fingerprinting' technique, besides giving a unique pattern that can be used as a characterization of the RNA, has made it possible to isolate a number of the larger oligonucleotides and to determine their nucleotide sequences. ImagesPLATE 1 PMID:5158505

  19. Mesenchymal stem cells as novel micro-ribonucleic acid delivery vehicles in kidney disease.

    PubMed

    Yao, Kevin; Ricardo, Sharon D

    2016-05-01

    MicroRNAs (miRNAs) are short single strands of RNA responsible for post-transcriptional regulation of gene expression and have been implicated in the pathogenesis of chronic kidney disease (CKD). Emerging evidence reports that miRNAs can reduce kidney fibrosis through regulation of targets associated with collagen and extracellular matrix accumulation. However, the development of miRNA therapies has been hampered by the lack of targeted and sustainable methods of systemic miRNA delivery. Mesenchymal stem cells (MSCs) provide a promising miRNA delivery platform to overcome toxicity, the potential for insertional mutations and the low efficiency of previous methods. MSCs are endogenously immunoprivileged and home to sites of inflammation. They also release trophic growth factors to modulate the immune system, alter the polarization of macrophages and provide renal protection and repair. The potential to engineer MSCs to express or overexpress miRNAs, released by exosomes, may enhance their natural functions. Clinical studies are already being conducted individually for the use of miRNAs in cancer and MSCs in diseases associated with CKD. Hence, the combination of miRNAs and MSCs may provide an unparalleled cell-based therapy for treating CKD. PMID:26437381

  20. The Coding Properties of Lysine-accepting Transfer Ribonucleic Acids from Black-eyed Peas.

    PubMed

    Hague, D R; Kofoid, E C

    1971-09-01

    Lysine-accepting transfer RNA from ungerminated and germinated embryo axes of black-eyed peas (Vigna sinensis L. Savi) was fractionated on benzoylated diethylaminoethyl cellulose and reverse phase Freon columns. Cochromatography indicated the presence of two similar lysyl transfer RNA fractions in each tissue. Ribosome binding studies revealed that the larger of the two fractions in each case is specific for the AAG codon, while the smaller one recognizes AAA and AAG. Possible implications of this difference in quantities of isoacceptors in translation of genetic information are discussed.

  1. The Occurrence and Distribution of Poly(A) Ribonucleic Acid in Soybean

    PubMed Central

    Key, Joe L.; Silflow, Carolyn

    1975-01-01

    The occurrence and distribution of poly(A) sequences in the RNA of soybean (Glycine max var. Wayne) have been studied. Only one of the two species of AMP-rich RNA contains poly(A). D-RNA does not contain detectable poly(A) sequences. The TB-RNA is the poly(A) RNA in this system. At least a part (up to 50% or more) of the mRNA in polyribosomes contains a poly(A) sequence. The poly(A) RNA is heterodisperse in size but has a mean size of approximately 18S (2,000 nucleotides) in urea and formamide gels. The poly(A) fragment resulting from ribonuclease A and T1 digestion migrates as a broad band overlapping the 4 to 5.8S regions of the gels with a mean size of somewhat greater than 5S. No evidence was found for the occurrence of a discrete oligo(A) fragment in the poly(A) RNA; however, oligonucleotides which migrate faster than the poly(A) fraction were observed in preparations which were not bound to oligo(dT) cellulose prior to electrophoresis. This oligonucleotide region was enriched in AMP (up to about 65%) as would be expected after ribonuclease A and T1 digestion. PMID:16659304

  2. Ligand-activated PPARα-dependent DNA demethylation regulates the fatty acid β-oxidation genes in the postnatal liver.

    PubMed

    Ehara, Tatsuya; Kamei, Yasutomi; Yuan, Xunmei; Takahashi, Mayumi; Kanai, Sayaka; Tamura, Erina; Tsujimoto, Kazutaka; Tamiya, Takashi; Nakagawa, Yoshimi; Shimano, Hitoshi; Takai-Igarashi, Takako; Hatada, Izuho; Suganami, Takayoshi; Hashimoto, Koshi; Ogawa, Yoshihiro

    2015-03-01

    The metabolic function of the liver changes sequentially during early life in mammals to adapt to the marked changes in nutritional environment. Accordingly, hepatic fatty acid β-oxidation is activated after birth to produce energy from breast milk lipids. However, how it is induced during the neonatal period is poorly understood. Here we show DNA demethylation and increased mRNA expression of the fatty acid β-oxidation genes in the postnatal mouse liver. The DNA demethylation does not occur in the fetal mouse liver under the physiologic condition, suggesting that it is specific to the neonatal period. Analysis of mice deficient in the nuclear receptor peroxisome proliferator-activated receptor α (PPARα) and maternal administration of a PPARα ligand during the gestation and lactation periods reveal that the DNA demethylation is PPARα dependent. We also find that DNA methylation of the fatty acid β-oxidation genes are reduced in the adult human liver relative to the fetal liver. This study represents the first demonstration that the ligand-activated PPARα-dependent DNA demethylation regulates the hepatic fatty acid β-oxidation genes during the neonatal period, thereby highlighting the role of a lipid-sensing nuclear receptor in the gene- and life-stage-specific DNA demethylation of a particular metabolic pathway.

  3. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus.

  4. Folic acid, polymorphism of methyl-group metabolism genes, and DNA methylation in relation to GI carcinogenesis.

    PubMed

    Fang, Jing Yuan; Xiao, Shu Dong

    2003-01-01

    DNA methylation is the main epigenetic modification after replication in humans. DNA (cytosine-5)-methyltransferase (DNMT) catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to C5 of cytosine within CpG dinucleotide sequences in the genomic DNA of higher eukaryotes. There is considerable evidence that aberrant DNA methylation plays an integral role in carcinogenesis. Folic acid or folate is crucial for normal DNA synthesis and can regulate DNA methylation, and through this, it affects cellular SAM levels. Folate deficiency results in DNA hypomethylation. Epidemiological studies have indicated that folic acid protects against gastrointestinal (GI) cancers. Methylene-tetrahydrofolate reductase (MTHFR) and methionine synthase (MS) are the enzymes involved in folate metabolism and are thought to influence DNA methylation. MTHFR is highly polymorphic, and the variant genotypes result in decreased MTHFR enzyme activity and lower plasma folate level. Two common MTHFR polymorphisms, 677CT (or 677TT) and A1298C, and an MS polymorphism, A-->G at 2756, have been identified. Most studies support an inverse association between folate status and the rate of colorectal adenomas and carcinomas. During human GI carcinogenesis, MTHFR is highly polymorphic, and the variant genotypes result in decreased MTHFR enzyme activity and lower plasma folate level, as well as aberrant methylation.

  5. Evaluating the effects of galbanic acid on hydrogen peroxide-induced oxidative DNA damage in human lymphocytes

    PubMed Central

    Shirani, Kobra; Behravan, Javad; Mosaffa, Fatemeh; Iranshahi, Mehrdad; Mehmankhah, Babak; Razavi-Azarkhiavi, Kamal; Karimi, Gholamreza

    2014-01-01

    Objective: Ferula szowitsiana has been widely used for medicinal purposes around the world. The anti-oxidant effect of F. szowitsiana had been proved. The current study aims to determine the protective effects of galbanic acid, a sesquiterpene coumarin from F. szowitsiana, against hydrogen peroxide (H2O2) - induced oxidative DNA damage in human lymphocytes. Materials and Methods: Human lymphocytes were incubated with H2O2 (0, 25, 50, 100, and 200 µM), galbanic acid (200 and 400 µM) and a combination of galbanic acid (200 and 400 µM) and H2O2 (25 µM) at 4 C for 30 minutes. Solvents of galbanic acid without H2O2 were used as negative controls. Results: The findings of this study demonstrated that H2O2 exposure leads to a significant concentration-dependent increase in DNA damage. Galbanic acid did not cause DNA damage compared with the control cells. Data showed that galbanic acid does not have a protective effect against H2O2-induced oxidative DNA damage in human lymphocytes. Conclusion: According to the results, it is concluded that the capability of F. szowitsiana in reducing reactive oxygen species and the anti-inflammatory property of its methanolic extract may be due to its other ingredients. PMID:25386396

  6. Channel Size Conversion of Phi29 DNA-Packaging Nanomotor for Discrimination of Single- and Double-Stranded Nucleic Acids

    PubMed Central

    Geng, Jia; Wang, Shaoying; Fang, Huaming; Guo, Peixuan

    2013-01-01

    Nanopores have been utilized to detect the conformation and dynamics of polymers, including DNA and RNA. Biological pores are extremely reproducible at the atomic level with uniform channel sizes. The channel of the bacterial virus phi29 DNA packaging motor is a natural conduit for the transportation of double-stranded DNA (dsDNA), and has the largest diameter among the well-studied biological channels. The larger channel facilitates translocation of dsDNA, and offers more space for further channel modification and conjugation. Interestingly, the relatively large wild type channel, which translocates dsDNA, cannot detect single-stranded nucleic acids (ssDNA or ssRNA) under the current experimental conditions. Herein, we reengineered this motor channel by removing the internal loop segment of the channel. The modification resulted in two classes of channels. One class was the same size as the wild type channel, while the other class had a cross-sectional area about 60% of the wild type. This smaller channel was able to detect the real-time translocation of single stranded nucleic acids at single-molecule level. While the wild type connector exhibited a one-way traffic property with respect to dsDNA translocation, the loop deleted connector was able to translocate ssDNA and ssRNA with equal competencies from both termini. This finding of size alterations in reengineered motor channels expands the potential application of the phi29 DNA packaging motor in nanomedicine, nanobiotechnology, and high-throughput single pore DNA sequencing. PMID:23488809

  7. Alkylation of nucleic acids by DNA-targeted 4-anilinoquinolinium aniline mustards: kinetic studies.

    PubMed

    O'Connor, C J; Denny, W A; Fan, J Y

    1991-01-01

    The rate of constant for hydrolysis of a series of 4-substituted aniline mustards Ar-X-pC6H4-N(CH2CH2Cl)2, where Ar is 4-anilinoquinolinium and X = O, CH2, CONH and CO, have been measured in water and 0.02 M imidazole buffer at 37 degrees C and in 50% aqueous acetone at 66 degrees C. The equilibrium binding constants of the compounds and their hydrolysis products to nucleic acids of differing base composition have been determined at varying ionic strengths, and the results are consistent with the compounds binding as expected in the DNA minor groove. The alkylating reactivity of the mustards towards these nucleic acids has been measured in water at 37 degrees C and in 0.01 M HEPES buffer over a range of temperatures from 25 degrees C to 60 degrees C. Evaluation of the thermodynamic parameters for these kinetic and equilibrium studies suggests that the interaction with nucleic acids is via an internal SN2 mechanism involving an aziridinium ion.

  8. Effect of tannic acid on benzo[a]pyrene-DNA adduct formation in mouse epidermis: comparison with synthetic gallic acid esters.

    PubMed

    Baer-Dubowska, W; Gnojkowski, J; Fenrych, W

    1997-01-01

    Tannic acid, a naturally occurring plant phenol, was shown to inhibit the mutagenicity and/or tumorigenicity of several polycyclic aromatic hydrocarbons in mouse skin. In this study the effect of topical application of tannic acid on epidermal aryl hydrocarbon hydroxylase, glutathione S-transferase, and binding of benzo[a]pyrene (B[a]P) to epidermal DNA was compared with the activity of synthetic gallic acid esters. Single topical application of 8 mumol octyl and dodecyl gallate had no effect on the induction of aryl hydrocarbon hydroxylase, whereas propyl gallate and tannic acid increased the enzyme activity by nearly 200%. Application of the phenolics one hour before 0.2 mumol of B[a]P enhanced the enzyme activity, but the observed differences were not significant in comparison with a B[a]P-treated group of mice. Application of dodecyl and octyl gallates to mouse skin resulted in three- and twofold increases, respectively, in the activity of glutathione S-transferase. Combined treatment with dodecyl gallate and B[a]P also resulted in significant enhancement of this enzyme activity. Application of the same dose of tannic acid to mouse skin one hour before the application of 0.2 or 1 mumol of B[a]P afforded 60% inhibition of covalent benzo[a]pyrene-diol-epoxide binding to epidermal DNA. Gallic acid esters with the exception of dodecyl gallate were less effective inhibitors of benzo[a]pyrene-diol-epoxide binding, especially when the higher dose of B[a]P was used. These results indicate that the antitumorigenic activity of tannic acid involves the interaction of the ultimate carcinogen with DNA rather than an altered metabolism. The linkage between gallic acid and glucose in natural plant phenols is also more effective at inhibiting B[a]P binding to epidermal DNA than the linkage with the alkyl group in synthetic gallates.

  9. DNA curtains: novel tools for imaging protein-nucleic acid interactions at the single-molecule level.

    PubMed

    Collins, Bridget E; Ye, Ling F; Duzdevich, Daniel; Greene, Eric C

    2014-01-01

    Interactions between proteins and nucleic acids are at the molecular foundations of most key biological processes, including DNA replication, genome maintenance, the regulation of gene expression, and chromosome segregation. A complete understanding of these types of biological processes requires tackling questions with a range of different techniques, such as genetics, cell biology, molecular biology, biochemistry, and structural biology. Here, we describe a novel experimental approach called "DNA curtains" that can be used to complement and extend these more traditional techniques by providing real-time information about protein-nucleic acid interactions at the level of single molecules. We describe general features of the DNA curtain technology and its application to the study of protein-nucleic acid interactions in vitro. We also discuss some future developments that will help address crucial challenges to the field of single-molecule biology.

  10. Acute acidic exposure induces p53-mediated oxidative stress and DNA damage in tilapia (Oreochromis niloticus) blood cells.

    PubMed

    Mai, Wei-jun; Yan, Jun-lun; Wang, Lei; Zheng, Ying; Xin, Yu; Wang, Wei-na

    2010-11-01

    Acid rain and inputs of acidic effluent can result in increased acidity in aquatic ecosystems, where it is known to have a significant impact and possibly, to cause the decline of some populations of aquatic organisms. In previous studies, intracellular acid-induced oxidative stress has been shown to cause DNA damage, and cooperatively activate the expression of the p53 gene. The acute effects of acidic environments on shrimp and fish have been widely studied. However, the molecular mechanism of acid-induced injury remains largely unknown. In this study, we examined the cellular responses of tilapia to acidic exposure-induced oxidative stress and antioxidant enzyme gene expression. Furthermore, we determined how acute acid stress activates the ATM-p53 signal pathway. We measured the upregulation of reactive oxygen species (ROS) production, the intracellular Ca(2)(+) concentration ([Ca(2)(+)](i)), the tail DNA values, the malondialdehyde (MDA) level in the blood cells and the percentage of dead and damaged blood cells. Our results suggest that oxidative stress and DNA damage occurred in tilapia in conditions where the pH was 5.3. Apoptosis was detected by Hoechst staining, which was mainly associated with changes in cell viability. The parameters that we measured were related to acid-induced DNA damage, and all parameters changed in the blood cells through time. The effects of acute acid exposure (pH 5.3) on the expression of ATM, p53, p21, Bax, manganese superoxide dismutase (MnSOD), glutathione peroxidase (GPx) were investigated in tilapia blood cells. The results showed that acute acid stress induced upregulation of ATM, p53 and p21, associated with increasing of DNA damage and apoptosis in blood cells. Additionally, the expression of Bax was slightly increased. Moreover, consensus p53-binding sequences were identified in tilapia MnSOD and GPx gene promoter regions and increased levels of ROS in the blood cells coincided with increased mRNA expression of p53, Mn

  11. Cytoprotection against Cr(6+)-induced DNA damage by alpha-lipoic acid: implications in reducing occupational cancer risk.

    PubMed

    Kumar, Sushil; Budhwar, Roli; Nigam, Akanksha; Priya, Shivam

    2009-11-01

    Alpha-lipoic acid (LA), the metabolic antioxidant, was evaluated for its potential to protect against Cr(6+)-induced DNA damage. Potassium dichromate was administered to Swiss albino mice orally ad libitum at the doses of 5, 10 or 25 mg/kg body weight in drinking water to set DNA damage in cells, which was characterized in mouse peripheral blood mononuclear cells and bone marrow cells using single-cell gel electrophoresis and analyses of generated comets for Tail moment, Tail DNA and Tail length. DNA damage was dose dependent. Cytoprotection by LA was remarkable. LA (5, 10 and 25 mg/kg body weight intraperitoneally) in pre-, co- and post-toxicant administration schedule abrogated DNA damage substantially in both cell types. Protection by LA was also dose dependent. LA annulled DNA damage by Cr(6+) in plasmid relaxation assay. A negligible DNA damage resulted during interaction of Cr(6+) and LA. Compared to ascorbate, LA emerged as a better antioxidant and least DNA damaging. In conclusion, our study advocated an experimental therapeutic research potential in LA against Cr(6+)-induced DNA damage for reduction of occupational cancer risk in humans. PMID:19710206

  12. Enzyme-free translation of DNA into sequence-defined synthetic polymers structurally unrelated to nucleic acids

    NASA Astrophysics Data System (ADS)

    Niu, Jia; Hili, Ryan; Liu, David R.

    2013-04-01

    The translation of DNA sequences into corresponding biopolymers enables the production, function and evolution of the macromolecules of life. In contrast, methods to generate sequence-defined synthetic polymers with similar levels of control have remained elusive. Here, we report the development of a DNA-templated translation system that enables the enzyme-free translation of DNA templates into sequence-defined synthetic polymers that have no necessary structural relationship with nucleic acids. We demonstrate the efficiency, sequence-specificity and generality of this translation system by oligomerizing building blocks including polyethylene glycol, α-(D)-peptides, and β-peptides in a DNA-programmed manner. Sequence-defined synthetic polymers with molecular weights of 26 kDa containing 16 consecutively coupled building blocks and 90 densely functionalized β-amino acid residues were translated from DNA templates using this strategy. We integrated the DNA-templated translation system developed here into a complete cycle of translation, coding sequence replication, template regeneration and re-translation suitable for the iterated in vitro selection of functional sequence-defined synthetic polymers unrelated in structure to nucleic acids.

  13. An Investigation into the Association between DNA Damage and Dietary Fatty Acid in Men with Prostate Cancer

    PubMed Central

    Bishop, Karen S.; Erdrich, Sharon; Karunasinghe, Nishi; Han, Dug Yeo; Zhu, Shuotun; Jesuthasan, Amalini; Ferguson, Lynnette R.

    2015-01-01

    Prostate cancer is a growing problem in New Zealand and worldwide, as populations adopt a Western style dietary pattern. In particular, dietary fat is believed to be associated with oxidative stress, which in turn may be associated with cancer risk and development. In addition, DNA damage is associated with the risk of various cancers, and is regarded as an ideal biomarker for the assessment of the influence of foods on cancer. In the study presented here, 20 men with prostate cancer adhered to a modified Mediterranean style diet for three months. Dietary records, blood fatty acid levels, prostate specific antigen, C-reactive protein and DNA damage were assessed pre- and post-intervention. DNA damage was inversely correlated with dietary adherence (p = 0.013) and whole blood monounsaturated fatty acids (p = 0.009) and oleic acid (p = 0.020). DNA damage was positively correlated with the intake of dairy products (p = 0.043), red meat (p = 0.007) and whole blood omega-6 polyunsaturated fatty acids (p = 0.015). Both the source and type of dietary fat changed significantly over the course of the dietary intervention. Levels of DNA damage were correlated with various dietary fat sources and types of dietary fat. PMID:25580814

  14. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates.

    PubMed

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

    2016-01-15

    A simple and elegant method for inhibition of non-templated nucleotide addition by DNA polymerases and for following DNA 3'-heterogeneity in enzymatic DNA synthesis by primer extension (PEX) is described. When template bearing ortho-twisted intercalating nucleic acid (ortho-TINA) at the 5'-end is used, non-templated nucleotide addition is reduced in both the A- and B-family DNA polymerases (KOD XL, KOD (exo-), Bst 2.0, Therminator, Deep Vent (exo-) and Taq). Formation of a single oligonucleotide product was observed with ortho-TINA modified template and KOD XL, KOD (exo-), Bst 2.0, Deep Vent (exo-) and Taq DNA polymerases. This approach can be applied to the synthesis of both unmodified and base-modified oligonucleotides. PMID:26707394

  15. In vitro study of damaging effects of 2,4-dichlorophenoxyacetic acid on DNA structure by spectroscopic and voltammetric techniques.

    PubMed

    Ahmadi, Farhad; Bakhshandeh, Fatemeh

    2009-10-01

    2,4-Dichlorophenoxyacetic acid (2,4-D) is a genotoxic organochlorinated herbicide, and its interaction with DNA was studied by UV/Vis, fluorescence, circular dichroism viscosity measurements, and alternative current voltammetry techniques. Using these analyses, the binding constant of 2,4-D to DNA has been calculated by two different techniques. The binding constant of 2,4-D to DNA calculated by fluorescence and circular dichroism spectra was found to be 3.5 x 10(3) M(-1) and 5.02 x 10(3) M(-1), respectively. Analyses of fluorescence spectra, viscosity measurements, and alternative current voltammetry interactions indicated that 2,4-D is a groove binder of DNA. Ethidium bromide displacement studies revealed that 2,4-D does not have any effect on ethidium bromide-bound DNA, which is indicative of groove binding.

  16. Combined treatment with vitamin B12b and ascorbic acid causes in vitro DNA degradation in tumor cells.

    PubMed

    Medvedev, A I; Akatov, V S; Kreshchenko, N D; Solov'eva, M E; Leshchenko, V V; Lezhnev, E I; Yakubovskaya, R I

    2001-04-01

    Incubation of Ehrlich ascites carcinoma and HEp-2 human epidermoid laryngeal carcinoma cells with hydroxycobalamin (vitamin B12b) and ascorbic acid induced generation and accumulation of double-stranded DNA fragments (23,000 b.p. and longer) in cells. The same vitamins alone in the same concentrations produced no such effects. DNA degradation in HEp-2 cells caused by long-term (4 h) incubation with 5-25 microM hydroxycobalamin and ascorbic acid (1:10-1:40 molar ratio) at 37 degrees C was comparable with that induced by gamma-irradiation in a dose of 150 Gy at 4 degrees C.

  17. Effect of pollution on DNA damage and essential fatty acid profile in Cirrhinus mrigala from River Chenab

    NASA Astrophysics Data System (ADS)

    Hussain, Bilal; Sultana, Tayyaba; Sultana, Salma; Al-Ghanim, K. A.; Mahboob, Shahid

    2016-05-01

    The objective of this study was to evaluate the effect of anthropogenic pollution on DNA damage and the fatty acid profile of the bottom dweller fish (Cirrhinus mrigala), collected from the River Chenab, in order to assess the effect of the toxicants on the quality of the fish meat. The levels of Cd, Hg, Cu, Mn, Zn, Pb, Cr and Sn and of phenols from this river were significantly higher than the permissible limits set by the USEPA. Comet assays showed DNA damage in Cirrhinus mrigala collected from three different sampling sites in the polluted area of the river. Significant differences were observed for DNA damage through comet assay in fish collected from polluted compared to control sites. No significant differences were observed for DNA damage between farmed and fish collected from upstream. The micronucleus assay showed similar trends. Fish from the highly polluted sites showed less number of fatty acids and more saturated fatty acids in their meat compared to fish from less polluted areas. Several fatty acids were missing in fish with higher levels of DNA in comet tail and micronucleus induction. Long-chain polyunsaturated fatty acids, eicosapentaenoic acid (20:5n-3) was found missing in the fish from polluted environment while it was found in considerable amount in farmed fish 7.8±0.4%. Docosahexaenoic acid (22:6n-3) also showed significant differences as 0.1±0.0 and 7.0±0.1% respectively, in wild polluted and farmed fishes.

  18. Highly sensitive fluorescence quantitative detection of specific DNA sequences with molecular beacons and nucleic acid dye SYBR Green I.

    PubMed

    Xiang, Dongshan; Zhai, Kun; Xiang, Wenjun; Wang, Lianzhi

    2014-11-01

    A highly sensitive fluorescence method of quantitative detection for specific DNA sequence is developed based on molecular beacon (MB) and nucleic acid dye SYBR Green I by synchronous fluorescence analysis. It is demonstrated by an oligonucleotide sequence of wild-type HBV (target DNA) as a model system. In this strategy, the fluorophore of MB is designed to be 6-carboxyfluorescein group (FAM), and the maximum excitation wavelength and maximum emission wavelength are both very close to that of SYBR Green I. In the presence of targets DNA, the MBs hybridize with the targets DNA and form double-strand DNA (dsDNA), the fluorophore FAM is separated from the quencher BHQ-1, thus the fluorophore emit fluorescence. At the same time, SYBR Green I binds to dsDNA, the fluorescence intensity of SYBR Green I is significantly enhanced. When targets DNA are detected by synchronous fluorescence analysis, the fluorescence peaks of FAM and SYBR Green I overlap completely, so the fluorescence signal of system will be significantly enhanced. Thus, highly sensitive fluorescence quantitative detection for DNA can be realized. Under the optimum conditions, the total fluorescence intensity of FAM and SYBR Green I exhibits good linear dependence on concentration of targets DNA in the range from 2×10(-11) to 2.5×10(-9)M. The detection limit of target DNA is estimated to be 9×10(-12)M (3σ). Compared with previously reported methods of detection DNA with MB, the proposed method can significantly enhance the detection sensitivity.

  19. DNA methylation patterns are associated with n-3 fatty acid intake in Yup'ik people.

    PubMed

    Aslibekyan, Stella; Wiener, Howard W; Havel, Peter J; Stanhope, Kimber L; O'Brien, Diane M; Hopkins, Scarlett E; Absher, Devin M; Tiwari, Hemant K; Boyer, Bert B

    2014-04-01

    A large body of evidence links a high dietary intake of n-3 (ω-3) polyunsaturated fatty acids (PUFAs) with improved cardiometabolic outcomes. Recent studies suggested that the biologic processes underlying the observed associations may involve epigenetic changes, specifically DNA methylation. To evaluate changes in methylation associated with n-3 PUFA intake, we conducted an epigenome-wide methylation association study of long-chain n-3 PUFA intake and tested associations between the diabetes- and cardiovascular disease-related traits. We assessed DNA methylation at ∼470,000 cytosine-phosphate-guanine (CpG) sites in a cross-sectional study of 185 Yup'ik Alaska Native individuals representing the top and bottom deciles of PUFA intake. Linear regression models were used to test for the associations of interest, adjusting for age, sex, and community group. We identified 27 differentially methylated CpG sites at biologically relevant regions that reached epigenome-wide significance (P < 1 × 10⁻⁷). Specifically, regions on chromosomes 3 (helicase-like transcription factor), 10 (actin α 2 smooth muscle/Fas cell surface death receptor), and 16 (protease serine 36/C16 open reading frame 67) each harbored 2 significant correlates of n-3 PUFA intake. In conclusion, we present promising evidence of association between several biologically relevant epigenetic markers and long-term intake of marine-derived n-3 PUFAs. PMID:24477300

  20. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  1. Direct detection of circulating free DNA extracted from serum samples of breast cancer using locked nucleic acid molecular beacon.

    PubMed

    Gui, Zhen; Wang, Quanbo; Li, Jinchang; Zhu, Mingchen; Yu, Lili; Xun, Tang; Yan, Feng; Ju, Huangxian

    2016-07-01

    As an emerging noninvasive blood biomarker, circulating free DNA (cfDNA) can be utilized to assess diagnosis, progression and evaluate prognosis of cancer. However, cfDNAs are not "naked", they can be part of complexes, or are bound to the surface of the cells via proteins, which make the detection more challenging. Here, a simple method for the detection of Ubiquitin-like with PHD and ring finger domains 1 (UHRF1) DNA exacted from serum of breast cancer (BC) has been developed using a novel locked nucleic acid molecular beacon (LNA-MB). In order to enhance the stability and detection efficiency of the probe in biofluids, we design a shared-stem molecular beacon containing a 27-mer loop and a 4-mer stem with DNA/LNA alternating bases. The fluorescence is released in the presence of target. The detection procedure is simple and can be completed within 1h. This method shows a sensitive response to UHRF1 DNA with a dynamic range of 3 orders of magnitude. The limit of detection is 11nM (S/N=3) with excellent selectivity. It can discriminate UHRF1 DNA from three-base mismatched DNA with a high specificity. More importantly, this method can distinguish the expression of serum UHRF1 DNA among 5 breast cancer patients and 5 healthy controls. The mentioned superiority may suggest that this assay can be served as a promising noninvasive detection tool for early BC diagnosis and monitoring. PMID:27154709

  2. Direct detection of circulating free DNA extracted from serum samples of breast cancer using locked nucleic acid molecular beacon.

    PubMed

    Gui, Zhen; Wang, Quanbo; Li, Jinchang; Zhu, Mingchen; Yu, Lili; Xun, Tang; Yan, Feng; Ju, Huangxian

    2016-07-01

    As an emerging noninvasive blood biomarker, circulating free DNA (cfDNA) can be utilized to assess diagnosis, progression and evaluate prognosis of cancer. However, cfDNAs are not "naked", they can be part of complexes, or are bound to the surface of the cells via proteins, which make the detection more challenging. Here, a simple method for the detection of Ubiquitin-like with PHD and ring finger domains 1 (UHRF1) DNA exacted from serum of breast cancer (BC) has been developed using a novel locked nucleic acid molecular beacon (LNA-MB). In order to enhance the stability and detection efficiency of the probe in biofluids, we design a shared-stem molecular beacon containing a 27-mer loop and a 4-mer stem with DNA/LNA alternating bases. The fluorescence is released in the presence of target. The detection procedure is simple and can be completed within 1h. This method shows a sensitive response to UHRF1 DNA with a dynamic range of 3 orders of magnitude. The limit of detection is 11nM (S/N=3) with excellent selectivity. It can discriminate UHRF1 DNA from three-base mismatched DNA with a high specificity. More importantly, this method can distinguish the expression of serum UHRF1 DNA among 5 breast cancer patients and 5 healthy controls. The mentioned superiority may suggest that this assay can be served as a promising noninvasive detection tool for early BC diagnosis and monitoring.

  3. A Magnetic Nanoparticle Based Nucleic Acid Isolation and Purification Instrument for DNA Extraction of Escherichia Coli O157: H7.

    PubMed

    Chen, Yahui; Lin, Jianhan; Jiang, Qin; Chen, Qi; Zhang, Shengjun; Li, Li

    2016-03-01

    The objective of this study was to evaluate the performance of a nucleic acid isolation and purification instrument using Escherichia coli O157:H7 as the model. The instrument was developed with magnetic nanoparticles for efficiently capturing nucleic acids and an intelligent mechanical unit for automatically performing the whole nucleic acid extraction process. A commercial DNA extraction kit from Huier Nano Company was used as reference. Nucleic acids in 1 ml of E. coli O157: H7 at a concentration of 5 x 10(8) CFU/mL were extracted by using this instrument and the kit in parallel and then detected by an ultraviolet spectrophotometer to obtain A260 values and A260/A280 values for the determination of the extracted DNA's quantity and purity, respectively. The A260 values for the instrument and the kit were 0.78 and 0.61, respectively, and the A260/A280 values were 1.98 and 1.93. The coefficient of variations of these parallel tests ranged from 10.5% to 16.7%. The results indicated that this nucleic acid isolation and purification instrument could extract a comparable level of nucleic acid within 50 min compared to the commercial DNA extraction kit.

  4. DNA Methylation Perturbations in Genes Involved in Polyunsaturated Fatty Acid Biosynthesis Associated with Depression and Suicide Risk

    PubMed Central

    Haghighi, Fatemeh; Galfalvy, Hanga; Chen, Sean; Huang, Yung-yu; Cooper, Thomas B.; Burke, Ainsley K.; Oquendo, Maria A.; Mann, J. John; Sublette, M. Elizabeth

    2015-01-01

    Polyunsaturated fatty acid (PUFA) status has been associated with neuropsychiatric disorders, including depression and risk of suicide. Long-chain PUFAs (LC-PUFAs) are obtained in the diet or produced by sequential desaturation and elongation of shorter-chain precursor fatty acids linoleic acid (LA, 18:2n-6) and α-linolenic acid (ALA, 18:3n-3). We compared DNA methylation patterns in genes involved in LC-PUFA biosynthesis in major depressive disorder (MDD) with (n = 22) and without (n = 39) history of suicide attempt, and age- and sex-matched healthy volunteers (n = 59). Plasma levels of selected PUFAs along the LC-PUFA biosynthesis pathway were determined by transesterification and gas chromatography. CpG methylation levels for the main human LC-PUFA biosynthetic genes, fatty acid desaturases 1 (Fads1) and 2 (Fads2), and elongation of very long-chain fatty acids protein 5 (Elovl5), were assayed by bisulfite pyrosequencing. Associations between PUFA levels and diagnosis or suicide attempt status did not survive correction for multiple testing. However, MDD diagnosis and suicide attempts were significantly associated with DNA methylation in Elovl5 gene regulatory regions. Also the relative roles of PUFA levels and DNA methylation with respect to diagnostic and suicide attempt status were determined by least absolute shrinkage and selection operator logistic regression analyses. We found that PUFA associations with suicide attempt status were explained by effects of Elovl5 DNA methylation within the regulatory regions. The observed link between plasma PUFA levels, DNA methylation, and suicide risk may have implications for modulation of disease-associated epigenetic marks by nutritional intervention. PMID:25972837

  5. Effect of human polymorphonuclear and mononuclear leukocytes on chromosomal and plasmid DNA of Escherichia coli. Role of acid DNase

    SciTech Connect

    Rozenberg-Arska, M.; van Strijp, J.A.; Hoekstra, W.P.; Verhoef, J.

    1984-05-01

    Phagocytosis and killing by polymorphonuclear and mononuclear leukocytes are important host resistance factors against invading microorganisms. Evidence showing that killing is rapidly followed by degradation of bacterial components is limited. Therefore, we studied the fate of Escherichia coli DNA following phagocytosis of E. coli by polymorphonuclear and mononuclear leukocytes. (/sup 3/H)Thymidine-labeled, unencapsulated E. coli PC2166 and E. coli 048K1 were incubated in serum, washed, and added to leukocytes. Uptake and killing of the bacteria and degradation of DNA were measured. Although phagocytosis and killing by mononuclear leukocytes was less efficient than that by polymorphonuclear leukocytes, only mononuclear leukocytes were able to degrade E. coli PC2166 DNA. Within 2 h, 60% of the radioactivity added to mononuclear leukocytes was released into the supernate, of which 40% was acid soluble. DNA of E. coli 048K1 was not degraded. To further analyze the capacity of mononuclear leukocytes to degrade E. coli DNA, chromosomal and plasmid DNA was isolated from ingested bacteria and subjected to agarose gel-electrophoresis. Only chromosomal DNA was degraded after phagocytosis. Plasmid DNA of E. coli carrying a gene coding for ampicillin resistance remained intact for a 2-h period after ingestion, and was still able to transform recipient E. coli cells after this period. Although we observed no DNA degradation during phagocytosis by polymorphonuclear leukocytes, lysates of both polymorphonuclear and mononuclear leukocytes contained acid-DNase activity with a pH optimum of 4.9. However, the DNase activity of mononuclear leukocytes was 20 times higher than that of polymorphonuclear leukocytes. No difference was observed between DNase activity from polymorphonuclear and mononuclear leukocytes from a chronic granulomatous disease patient with DNase activity from control polymorphonuclear and mononuclear leukocytes.

  6. In silico comparative analysis of DNA and amino acid sequences for prion protein gene.

    PubMed

    Kim, Y; Lee, J; Lee, C

    2008-01-01

    Genetic variability might contribute to species specificity of prion diseases in various organisms. In this study, structures of the prion protein gene (PRNP) and its amino acids were compared among species of which sequence data were available. Comparisons of PRNP DNA sequences among 12 species including human, chimpanzee, monkey, bovine, ovine, dog, mouse, rat, wallaby, opossum, chicken and zebrafish allowed us to identify candidate regulatory regions in intron 1 and 3'-untranslated region (UTR) in addition to the coding region. Highly conserved putative binding sites for transcription factors, such as heat shock factor 2 (HSF2) and myocite enhancer factor 2 (MEF2), were discovered in the intron 1. In 3'-UTR, the functional sequence (ATTAAA) for nucleus-specific polyadenylation was found in all the analysed species. The functional sequence (TTTTTAT) for maturation-specific polyadenylation was identically observed only in ovine, and one or two nucleotide mismatches in the other species. A comparison of the amino acid sequences in 53 species revealed a large sequence identity. Especially the octapeptide repeat region was observed in all the species but frog and zebrafish. Functional changes and susceptibility to prion diseases with various isoforms of prion protein could be caused by numeric variability and conformational changes discovered in the repeat sequences.

  7. Isolation of acetylated bile acids from the sponge Siphonochalina fortis and DNA damage evaluation by the comet assay.

    PubMed

    Patiño Cano, Laura P; Bartolotta, Susana A; Casanova, Natalia A; Siless, Gastón E; Portmann, Erika; Schejter, Laura; Palermo, Jorge A; Carballo, Marta A

    2013-10-01

    From the organic extracts of the sponge Siphonochalina fortis, collected at Bahía Bustamante, Chubut, Argentina, three major compounds were isolated and identified as deoxycholic acid 3, 12-diacetate (1), cholic acid 3, 7, 12-triacetate (2) and cholic acid, 3, 7, 12-triacetate. (3). This is the first report of acetylated bile acids in sponges and the first isolation of compound 3 as a natural product. The potential induction of DNA lesions by the isolated compounds was investigated using the comet assay in lymphocytes of human peripheral blood as in vitro model. The results showed that the administration of the bile acid derivatives would not induce DNA damages, indicating that acetylated bile acids are nontoxic metabolites at the tested concentrations. Since the free bile acids were not detected, it is unlikely that the acetylated compounds may be part of the sponge cells detoxification mechanisms. These results may suggest a possible role of acetylated bile acids as a chemical defense mechanism, product of a symbiotic relationship with microorganisms, which would explain their seasonal and geographical variation, and their influence on the previously observed genotoxicity of the organic extract of S. fortis.

  8. Multilayered Polyelectrolyte Assemblies as Platforms for the Delivery of DNA and Other Nucleic Acid-Based Therapeutics

    PubMed Central

    Jewell, Christopher M.; Lynn, David M.

    2008-01-01

    Materials that provide spatial and temporal control over the delivery of DNA and other nucleic acid-based agents from surfaces play important roles in the development of localized gene-based therapies. This review focuses on a relatively new approach to the immobilization and release of DNA from surfaces: methods based on the layer-by-layer assembly of thin multilayered films (or polyelectrolyte multilayers, PEMs). Layer-by-layer methods provide convenient, nanometer-scale control over the incorporation of DNA, RNA, and oligonucleotide constructs into thin polyelectrolyte films. Provided that these assemblies can be designed in ways that permit controlled film disassembly under physiological conditions, this approach can contribute new methods for spatial and/or temporal control over the delivery of nucleic acid-based therapeutics in vitro and in vivo. We describe applications of layer-by-layer assembly to the fabrication of DNA-containing films that can be used to provide control over the release of plasmid DNA from the surfaces of macroscopic objects and promote surface-mediated cell transfection. We also highlight the application of these methods to the coating of colloidal substrates and the fabrication of hollow micrometer-scale capsules that can be used to encapsulate and control the release or delivery of DNA and oligonucleotides. Current challenges, gaps in knowledge, and new opportunities for the development of these methods in the general area of gene delivery are discussed. PMID:18395291

  9. Homo-DNA templated chemistry and its application to nucleic acid sensing.

    PubMed

    Stoop, Matthias; Leumann, Christian J

    2011-07-14

    We have investigated the homo-DNA templated Staudinger reduction of the profluorophore rhodamine azide and have applied this reaction to the detection of natural DNA with a hybrid homo-DNA/DNA molecular beacon. In this system the sensing and the reporting unit are bioorthogonal to each other which facilitates sequence design and increases fidelity.

  10. The Effects of Topically Applied Glycolic Acid and Salicylic Acid on Ultraviolet Radiation-Induced Erythema, DNA Damage and Sunburn Cell Formation in Human Skin

    PubMed Central

    Kornhauser, Andrija; Wei, Rong-Rong; Yamaguchi, Yuji; Coelho, Sergio G.; Kaidbey, Kays; Barton, Curtis; Takahashi, Kaoruko; Beer, Janusz Z.; Miller, Sharon A.; Hearing, Vincent J.

    2009-01-01

    Background α-Hydroxy acids (αHA) are reported to reduce signs of aging in the skin and are widely used cosmetic ingredients. Several studies suggest that αHA can increase the sensitivity of skin to ultraviolet radiation. More recently, β-hydroxy acids (βHA), or combinations of αHA and βHA have also been incorporated into antiaging skin care products. Concerns have also arisen about increased sensitivity to ultraviolet radiation following use of skin care products containing β-HA. Objective To determine whether topical treatment with glycolic acid, a representative αHA, or with salicylic acid, a βHA, modifies the short-term effects of solar simulated radiation (SSR) in human skin. Methods Fourteen subjects participated in this study. Three of the four test sites on the mid-back of each subject were treated daily Monday - Friday, for a total of 3.5 weeks, with glycolic acid (10%), salicylic acid (2%), or vehicle (control). The fourth site received no treatment. After the last treatment, each site was exposed to SSR, and shave biopsies from all 4 sites were obtained. The endpoints evaluated in this study were erythema (assessed visually and instrumentally), DNA damage and sunburn cell formation. Results Treatment with glycolic acid resulted in increased sensitivity of human skin to SSR, measured as an increase in erythema, DNA damage and sunburn cell formation. Salicylic acid did not produce significant changes in any of these biomarkers. Conclusions Short-term topical application of glycolic acid in a cosmetic formulation increased the sensitivity of human skin to SSR, while a comparable treatment with salicylic acid did not. PMID:19411163

  11. Automated microfluidic DNA/RNA extraction with both disposable and reusable components

    NASA Astrophysics Data System (ADS)

    Kim, Jungkyu; Johnson, Michael; Hill, Parker; Sonkul, Rahul S.; Kim, Jongwon; Gale, Bruce K.

    2012-01-01

    An automated microfluidic nucleic extraction system was fabricated with a multilayer polydimethylsiloxane (PDMS) structure that consists of sample wells, microvalves, a micropump and a disposable microfluidic silica cartridge. Both the microvalves and micropump structures were fabricated in a single layer and are operated pneumatically using a 100 µm PDMS membrane. To fabricate the disposable microfluidic silica cartridge, two-cavity structures were made in a PDMS replica to fit the stacked silica membranes. A handheld controller for the microvalves and pumps was developed to enable system automation. With purified ribonucleic acid (RNA), whole blood and E. coli samples, the automated microfluidic nucleic acid extraction system was validated with a guanidine-based solid phase extraction procedure. An extraction efficiency of ~90% for deoxyribonucleic acid (DNA) and ~54% for RNA was obtained in 12 min from whole blood and E. coli samples, respectively. In addition, the same quantity and quality of extracted DNA was confirmed by polymerase chain reaction (PCR) amplification. The PCR also presented the appropriate amplification and melting profiles. Automated, programmable fluid control and physical separation of the reusable components and the disposable components significantly decrease the assay time and manufacturing cost and increase the flexibility and compatibility of the system with downstream components.

  12. Breaking the dogma: PCB-derived semiquinone free radicals do not form covalent adducts with DNA, GSH, and amino acids.

    PubMed

    Wangpradit, Orarat; Rahaman, Asif; Mariappan, S V Santhana; Buettner, Garry R; Robertson, Larry W; Luthe, Gregor

    2016-02-01

    Covalent bond formations of free radical metabolites with biomolecules like DNA and proteins are thought to constitute a major mechanism of toxicity and carcinogenesis. Glutathione (GSH) is generally accepted as a radical scavenger protecting the cell. In the present study, we investigated a semiquinone radical (SQ(●-)) metabolite of the semivolatile 4-chlorobiphenyl, using electron paramagnetic resonance spectroscopy, and oxygen consumption. Proton nuclear magnetic resonance ((1)H NMR) and liquid chromatography-mass spectrometry (LC-MS) were also employed to elucidate the radical interaction with DNA, amino acids, and GSH. We found that DNA and oligonucleotides stabilized SQ(●-) by electron delocalization in the π-stacking system, resulting in persistent radical intercalated, rather than forming a covalent bond with SQ(●-). This finding was strongly supported by the semiempirical calculation of the semioccupied molecular orbital and the linear combination of the atomic orbitals, indicating 9.8 kcal mol(-1) energy gain. The insertion of SQ(●-) into the DNA strand may result in DNA strand breaks and interruption of DNA replication process or even activate radical mediated secondary reactions. The presence of amino acids resulted in a decrease of the electron paramagnetic resonance (EPR) signal of SQ(●-) and correlated with their isoelectric points. The pH shifts the equilibrium of the dianions of hydroquinone and influenced indirectly the formation of SQ(●-). Similar findings were observed with GSH and Cys. GSH and Cys functioned as indirect radical scavengers; their activities depend on their chemical equilibria with the corresponding quinones, and their further reaction via Michael addition. The generally accepted role of GSH as radical scavenger in biological systems should be reconsidered based upon these findings, questioning the generally accepted view of radical interaction of semiquinones with biologically active compounds, like DNA, amino acids

  13. A mushroom-derived amino acid, ergothioneine, is a potential inhibitor of inflammation-related DNA halogenation.

    PubMed

    Asahi, Takashi; Wu, Xiaohong; Shimoda, Hiroshi; Hisaka, Shinsuke; Harada, Etsuko; Kanno, Tomomi; Nakamura, Yoshimasa; Kato, Yoji; Osawa, Toshihiko

    2016-01-01

    Myeloperoxidase (MPO)-generated halogenating molecules, such as hypochlorous acid and hypobromous acid (HOBr), in inflammatory regions are postulated to contribute to disease progression. In this study, we showed that ergothioneine (EGT), derived from an edible mushroom, inhibited MPO activity as well as the formation of 8-bromo-2'-deoxyguanosine in vitro. The HOBr scavenging effect of EGT is higher than those of ascorbic acid and glutathione. We initially observed that the administration of Coprinus comatus, an edible mushroom containing a high amount of EGT, inhibited the UV-B-induced inflammatory responses and DNA halogenation, suggesting that EGT is a promising anti-inflammatory agent from mushrooms.

  14. Computational investigation of locked nucleic acid (LNA) nucleotides in the active sites of DNA polymerases by molecular docking simulations.

    PubMed

    Poongavanam, Vasanthanathan; Madala, Praveen K; Højland, Torben; Veedu, Rakesh N

    2014-01-01

    Aptamers constitute a potential class of therapeutic molecules typically selected from a large pool of oligonucleotides against a specific target. With a scope of developing unique shorter aptamers with very high biostability and affinity, locked nucleic acid (LNA) nucleotides have been investigated as a substrate for various polymerases. Various reports showed that some thermophilic B-family DNA polymerases, particularly KOD and Phusion DNA polymerases, accepted LNA-nucleoside 5'-triphosphates as substrates. In this study, we investigated the docking of LNA nucleotides in the active sites of RB69 and KOD DNA polymerases by molecular docking simulations. The study revealed that the incoming LNA-TTP is bound in the active site of the RB69 and KOD DNA polymerases in a manner similar to that seen in the case of dTTP, and with LNA structure, there is no other option than the locked C3'-endo conformation which in fact helps better orienting within the active site. PMID:25036012

  15. Crystallization of bFGF-DNA Aptamer Complexes Using a Sparse Matrix Designed for Protein-Nucleic Acid Complexes

    NASA Technical Reports Server (NTRS)

    Cannone, Jaime J.; Barnes, Cindy L.; Achari, Aniruddha; Kundrot, Craig E.; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    The Sparse Matrix approach for obtaining lead crystallization conditions has proven to be very fruitful for the crystallization of proteins and nucleic acids. Here we report a Sparse Matrix developed specifically for the crystallization of protein-DNA complexes. This method is rapid and economical, typically requiring 2.5 mg of complex to test 48 conditions. The method was originally developed to crystallize basic fibroblast growth factor (bFGF) complexed with DNA sequences identified through in vitro selection, or SELEX, methods. Two DNA aptamers that bind with approximately nanomolar affinity and inhibit the angiogenic properties of bFGF were selected for co-crystallization. The Sparse Matrix produced lead crystallization conditions for both bFGF-DNA complexes.

  16. Fluorescence determination of DNA with 1-pyrenebutyric acid nanoparticles coated with β-cyclodextrin as a fluorescence probe

    NASA Astrophysics Data System (ADS)

    Wang, Lun; Bian, Guirong; Wang, Leyu; Dong, Ling; Chen, Hongqi; Xia, Tingting

    2005-04-01

    A novel ultrasonication method has been successfully developed for the preparation of 1-pyrenebutyric acid (PBAC)/β-cyclodextrin(β-CD) complex nanoparticles. The as-prepared nanoparticles are characterized by transmission electron microscopy (TEM), fluorescence excitation and emission spectroscopy. Complex nanoparticles prepared with ultrasonication are smaller and better dispersed than single PBAC nanoparticles. At pH 3.0, the relative fluorescence intensity of complex nanoparticles of PBAC/β-CD can be quenched by the concentration of DNA. Based on this, a novel fluorimetric method has been developed for rapid determination of DNA. In comparison with single organic fluorophores, these nanoparticle probes are better water-solubility, more stable and do not suffer from blinking. Under optimum conditions, the calibration graphs are linear over the range 0.2-15 μg mL -1 for calf thymus DNA (ct-DNA) and 0.3-12 μg mL -1 for fish sperm DNA (fs-DNA). The corresponding detection limit is 0.01 μg mL -1 for ct-DNA and 0.02 μg mL -1 for fs-DNA. The relative standard deviation of seven replicate measurements is 1.2% for 2.0 μg mL -1 ct-DNA and 1.4% for 2.0 μg mL -1 fs-DNA, respectively. The method is simple and sensitive. The recovery and relative standard deviation are very satisfactory. A mechanism proposed to explain the process also has been studied.

  17. Effects of trace elements and pesticides on dephosphorylation of RNA and DNA added to soils

    SciTech Connect

    Frankenberger, W.T. Jr.; Johanson, J.B.; Lund L.J.

    1986-01-01

    This study was carried out to assess the effects of 14 trace elements, 12 herbicides, and two fungicides on dephosphorylation of yeast ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) added to soils (Xerollic Calciorthids and Typic Haploxeralfs). The cumulative amount of ortho phosphate (Pi) released from nucleic acids increased linearly with time of incubation (up to 72 h), decreased with profile depth, and was highly influenced by soil pH. When trace elements were applied and compared by using 2.5 mmol kg/sup -1/ of soil, the average inhibition in dephosphorylation of RNA and DNA in two soils ranged from 17% with Co(II) to 52% with Cu(II). The most effective inhibitors of nucleic acid dephosphorylation were Ag(I), Cu(I), Cd(II), Cu(II), Mn(II), Ni(II), and Pb(II) (avg inhibition greater than or equal to 35%). Other elements that inhibited dephosphorylation of RNA and DNA added to soils included Ba(II), Co(II), Hg(II), Zn(II), Ti(IV), V(IV), and W(VI). When the pesticides were compared by using 5 mg of active ingredient kg/sup -1/ of soil, the average inhibition in nucleic acid dephosphorylation ranged from 14% with butylate to 39% with chloramben. The most effective inhibitors (> 25%) were atrazine, naptalam, chloramben, dicamba, trifluralin, and maneb. Other pesticides that inhibited RNA and DNA dephosphorylation in soils included cyanazine, 2,4-D, dinitroamine, EPTC plus R-25788, alachlor, paraquat, butylate, and captan.

  18. Products of ozonized arachidonic acid potentiate the formation of DNA single strand breaks in cultured human lung cells

    SciTech Connect

    Kozumbo, W.J.; Hanley, N.M.; Agarwal, S.

    1996-12-31

    In this study we examined the potential for environmental levels of ozone (O{sub 3}) to degrade arachidonic acid (AA), a polyunsaturated fatty acid abundantly present in the lung, into products that can produce DNA single strand breaks (ssb) in cultured human lung cells. Human lung fibroblasts were incubated with 60 {mu}M AA that had been previously exposed to an degraded by 0.4 ppm O{sub 3} (1 hr). Incubation of the cells with O{sub 3}-exposed AA (but not with vehicle alone) for 1 hr at 4{degrees}C and 37{degrees}C produced 555 and 245 rad-equivalents of DNA ssb, respectively, as determined by the DNA alkaline elution technique. These breaks were completely eliminated when the ozonized AA solution was incubated with catalase prior to cell treatment, indicating that H{sub 2}O{sub 2} was solely responsible for damaging DNA. Superoxide dismutase, bovine serum albumin, or heat-inactivated catalase showed little, if any, inhibitory activity. The H{sub 2}O{sub 2} content for only about 40% of the observed breaks. Potentiation of the H{sub 2}O{sub 2}-induced DNA ssb persisted after removal of the carbonyl substances by chromatographic procedures, suggesting that the non-carbonyl component of ozonized AA was the responsible component for inducing augmentation of the observed increases in DNA ssb. Ozonized AA also induced DNA ssb in cultures of the human bronchial epithelial cell line BEAS-2B. Again, these breaks were shown to exceed levels that could be attributed to the presence of H{sub 2}O{sub 2} alone. These results indicate that products of ozonized AA can interact to potentiate DNA ssb in human lung cells. 42 refs., 6 figs., 3 tabs.

  19. Evaluation of a facile method of template DNA preparation for PCR-based detection and typing of lactic acid bacteria.

    PubMed

    Singh, Atul Kumar; Ramesh, Aiyagari

    2009-08-01

    The objective of our investigation was to develop a convenient and reliable method of generating template DNA for routine PCR-based detection and typing of lactic acid bacteria (LAB). Template DNA extracted from Lactobacillus, Lactococcus, Pediococcus and Leuconostoc using a combination of urea, SDS and NaOH yielded amplicons of expected size in PCR with genus-specific primers. Apart from LAB, the proposed method could also be adopted to generate PCR-compatible template DNA from a number of Gram-positive and Gram-negative bacterial strains. DNA template prepared by the proposed method from various standard strains of Lactobacillus sp. also generated discriminating fingerprints with BOXA1R primer in rep-PCR. A significant finding of the investigation was that a comparable banding profile of LAB strains was obtained in rep-PCR using template DNA prepared by urea-SDS-NaOH method and a commercially available DNA isolation kit. This was further evidenced by high dice coefficient values obtained in the range of 81.8-96.7 when cluster analysis was performed by UPGAMA method. The application potential of this DNA extraction method for PCR-based direct detection of LAB in fermented food samples such as dahi, idli batter and salt-fermented cucumber was validated by detecting specific amplicons of LAB genera in the fermented samples. The applicability of the proposed template DNA extraction method was further substantiated when 29 bacteriocinogenic LAB strains (Bac+) previously detected in salt-fermented cucumber by PCR [Singh, A.K., Ramesh, A., 2008. Succession of dominant and antagonistic lactic acid bacteria in fermented cucumber: Insights from a PCR-based approach. Food. Microbiol. 25, 278-287] generated differentiating fingerprints in BOX element based rep-PCR and formed clusters with reference LAB strains. PMID:19465247

  20. Target-catalyzed autonomous assembly of dendrimer-like DNA nanostructures for enzyme-free and signal amplified colorimetric nucleic acids detection.

    PubMed

    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Meng, Yan; Zhou, Cuisong; Long, Yuyin; Zheng, Baozhan; Du, Juan; Guo, Yong; Xiao, Dan

    2016-12-15

    Self-assembly of DNA nanostructures is of great importance in nanomedicine, nanotechnology and biosensing. Herein, a novel target-catalyzed autonomous assembly pathway for the formation of dendrimer-like DNA nanostructures that only employing target DNA and three hairpin DNA probes was proposed. We use the sticky-ended Y shape DNA (Y-DNA) as the assembly monomer and it was synthesized by the catalyzed hairpin assembly (CHA) instead of the DNA strand annealing method. The formed Y-DNA was equipped with three ssDNA sticky ends and two of them were predesigned to be complementary to the third one, then the dendrimer-like DNA nanostructures can be obtained via an autonomous assembly among these sticky-ended Y-DNAs. The resulting nanostructure has been successfully applied to develop an enzyme-free and signal amplified gold nanoparticle (AuNP)-based colorimetric nucleic acids assay. PMID:27498325

  1. A new antifungal peptide from the seeds of Phytolacca americana: characterization, amino acid sequence and cDNA cloning.

    PubMed

    Shao, F; Hu, Z; Xiong, Y M; Huang, Q Z; WangCG; Zhu, R H; Wang, D C

    1999-03-19

    An antifungal peptide from seeds of Phytolacca americana, designated PAFP-s, has been isolated. The peptide is highly basic and consists of 38 residues with three disulfide bridges. Its molecular mass of 3929.0 was determined by mass spectrometry. The complete amino acid sequence was obtained from automated Edman degradation, and cDNA cloning was successfully performed by 3'-RACE. The deduced amino acid sequence of a partial cDNA corresponded to the amino acid sequence from chemical sequencing. PAFP-s exhibited a broad spectrum of antifungal activity, and its activities differed among various fungi. PAFP-s displayed no inhibitory activity towards Escherichia coli. PAFP-s shows significant sequence similarities and the same cysteine motif with Mj-AMPs, antimicrobial peptides from seeds of Mirabilis jalapa belonging to the knottin-type antimicrobial peptide.

  2. Non-Viral DNA Delivery from Porous Hyaluronic Acid Hydrogels in Mice

    PubMed Central

    Tokatlian, Talar; Cam, Cynthia; Segura, Tatiana

    2013-01-01

    The lack of vascularization within tissue-engineered constructs remains the primary cause of construct failure following implantation. Porous constructs have been successful in allowing for vessel infiltration without requiring extensive matrix degradation. We hypothesized that the rate and maturity of infiltrating vessels could be enhanced by complementing the open pore structure with the added delivery of DNA encoding for angiogenic growth factors. Both 100 and 60 μm porous and non-porous hyaluronic acid hydrogels loaded with pro-angiogenic (pVEGF) or reporter (pGFPluc) plasmid nanoparticles were used to study the effects of pore size and DNA delivery on angiogenesis in a mouse subcutaneous implant model. GFP-expressing transfected cells were found inside all control hydrogels over the course of the study, although transfection levels peaked by week 3 for 100 and 60 μm porous hydrogels. Transfection in non-porous hydrogels continued to increase over time corresponding with continued surface degradation. pVEGF transfection levels were not high enough to enhance angiogenesis by increasing vessel density, maturity, or size, although by 6 weeks for all pore size hydrogels more hydrogel implants were positive for vascularization when pVEGF polyplexes were incorporated compared to control hydrogels. Pore size was found to be the dominant factor in determining the angiogenic response with 60 μm porous hydrogels having more vessels/area present than 100 μm porous hydrogels at the initial onset of angiogenesis at 3 weeks. The results of this study show promise for the use of polyplex loaded porous hydrogels to transfect infiltrating cells in vivo and guide tissue regeneration and repair. PMID:24210142

  3. DNA-LCEB: a high-capacity and mutation-resistant DNA data-hiding approach by employing encryption, error correcting codes, and hybrid twofold and fourfold codon-based strategy for synonymous substitution in amino acids.

    PubMed

    Hafeez, Ibbad; Khan, Asifullah; Qadir, Abdul

    2014-11-01

    Data-hiding in deoxyribonucleic acid (DNA) sequences can be used to develop an organic memory and to track parent genes in an offspring as well as in genetically modified organism. However, the main concerns regarding data-hiding in DNA sequences are the survival of organism and successful extraction of watermark from DNA. This implies that the organism should live and reproduce without any functional disorder even in the presence of the embedded data. Consequently, performing synonymous substitution in amino acids for watermarking becomes a primary option. In this regard, a hybrid watermark embedding strategy that employs synonymous substitution in both twofold and fourfold codons of amino acids is proposed. This work thus presents a high-capacity and mutation-resistant watermarking technique, DNA-LCEB, for hiding secret information in DNA of living organisms. By employing the different types of synonymous codons of amino acids, the data storage capacity has been significantly increased. It is further observed that the proposed DNA-LCEB employing a combination of synonymous substitution, lossless compression, encryption, and Bose-Chaudary-Hocquenghem coding is secure and performs better in terms of both capacity and robustness compared to existing DNA data-hiding schemes. The proposed DNA-LCEB is tested against different mutations, including silent, miss-sense, and non-sense mutations, and provides substantial improvement in terms of mutation detection/correction rate and bits per nucleotide. A web application for DNA-LCEB is available at http://111.68.99.218/DNA-LCEB.

  4. Structure and DNA Hybridization Properties of Mixed Nucleic Acid/Maleimide-Ethylene Glycol Monolayers

    SciTech Connect

    Lee,C.; Nguyen, P.; Grainger, D.; Gamble, L.; Castner, D.

    2007-01-01

    The surface structure and DNA hybridization performance of thiolated single-strand DNA (HS-ssDNA) covalently attached to a maleimide-ethylene glycol disulfide (MEG) monolayer on gold have been investigated. Monolayer immobilization chemistry and surface coverage of reactive ssDNA probes were studied by X-ray photoelectron spectroscopy and time-of-flight secondary ion mass spectrometry. Orientation of the ssDNA probes was determined by near-edge X-ray absorption fine structure (NEXAFS). Target DNA hybridization on the DNA-MEG probe surfaces was measured by surface plasmon resonance (SPR) to demonstrate the utility of these probe surfaces for detection of DNA targets from both purified target DNA samples and complex biological mixtures such as blood serum. Data from complementary techniques showed that immobilized ssDNA density is strongly dependent on the spotted bulk DNA concentration and buffer ionic strength. Variation of the immobilized ssDNA density had a profound influence on the DNA probe orientation at the surface and subsequent target hybridization efficiency. With increasing surface probe density, NEXAFS polarization dependence results (followed by monitoring the N 1s {yields} {pi}* transition) indicate that the immobilized ssDNA molecules reorient toward a more upright position on the MEG monolayer. SPR assays of DNA targets from buffer and serum showed that DNA hybridization efficiency increased with decreasing surface probe density. However, target detection in serum was better on the 'high-density' probe surface than on the 'high-efficiency' probe surface. The amounts of target detected for both ssDNA surfaces were several orders of magnitude poorer in serum than in purified DNA samples due to nonspecific serum protein adsorption onto the sensing surface.

  5. Folic Acid Inhibits Amyloid β-Peptide Production through Modulating DNA Methyltransferase Activity in N2a-APP Cells.

    PubMed

    Li, Wen; Jiang, Mingyue; Zhao, Shijing; Liu, Huan; Zhang, Xumei; Wilson, John X; Huang, Guowei

    2015-10-20

    Alzheimer's disease (AD) is a common neurodegenerative disease resulting in progressive dementia, and is a principal cause of dementia among older adults. Folate acts through one-carbon metabolism to support the methylation of multiple substrates. We hypothesized that folic acid supplementation modulates DNA methyltransferase (DNMT) activity and may alter amyloid β-peptide (Aβ) production in AD. Mouse Neuro-2a cells expressing human APP695 were incubated with folic acid (2.8-40 μmol/L), and with or without zebularine (the DNMT inhibitor). DNMT activity, cell viability, Aβ and DNMTs expression were then examined. The results showed that folic acid stimulated DNMT gene and protein expression, and DNMT activity. Furthermore, folic acid decreased Aβ protein production, whereas inhibition of DNMT activity by zebularine increased Aβ production. The results indicate that folic acid induces methylation potential-dependent DNMT enzymes, thereby attenuating Aβ production.

  6. DNA interaction with octahedral and square planar Ni(II) complexes of aspartic-acid Schiff-bases

    NASA Astrophysics Data System (ADS)

    Sallam, S. A.; Orabi, A. S.; Abbas, A. M.

    2011-12-01

    Ni(II) complexes of (S,E)-2-(2-OHbenzilydene)aspartic acid; (S,E)-2-(2,3-diOHbenzilydene)aspartic acid-; (S,E)-2-(2,4-diOH-benzilydene)aspartic acid; (S,E)-2-(2,5-diOHbenzilydene)aspartic acid and (S,E)-2-((2-OHnaphthalene-1-yl)methylene)aspartic acid Schiff-bases have been synthesized by template method in ethanol or ammonia media. They were characterized by elemental analyses, conductivity measurements, magnetic moment, UV, IR and 1H nmr spectra as well as thermal analysis (TG, DTG, DTA). The Schiff-bases are dibasic tridentate or tetradentate donors and the complexes have square planar and octahedral structures. The complexes decompose in two or three steps where kinetic and thermodynamic parameters of the decomposition steps were computed. The interactions of the formed complexes with FM-DNA were monitored by UV and fluorescence spectroscopy.

  7. Synthesis, physicochemical studies, embryos toxicity and DNA interaction of some new Iron(II) Schiff base amino acid complexes

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; El-Khatib, Rafat M.; Nassr, Lobna A. E.; Abu-Dief, Ahmed M.

    2013-05-01

    New Fe(II) Schiff base amino acid complexes derived from the condensation of o-hydroxynaphthaldehyde with L-alanine, L-phenylalanine, L-aspartic acid, L-histidine and L-arginine were synthesized and characterized by elemental analysis, IR, electronic spectra, and conductance measurements. The stoichiometry and the stability constants of the complexes were determined spectrophotometrically. The investigated Schiff bases exhibited tridentate coordination mode with the general formulae [Fe(HL)2]·nH2O for all amino acids except L-histidine. But in case of L-histidine, the ligand acts as tetradentate ([FeL(H2O)2]·2H2O), where HL = mono anion and L = dianion of the ligand. The structure of the prepared complexes is suggested to be octahedral. The prepared complexes were tested for their toxicity on chick embryos and found to be safe until a concentration of 100 μg/egg with full embryos formation. The interaction between CT-DNA and the investigated complexes were followed by spectrophotometry and viscosity measurements. It was found that, the prepared complexes bind to DNA via classical intercalative mode and showed a different DNA cleavage activity with the sequence: nhi > nari > nali > nasi > nphali. The thermodynamic Profile of the binding of nphali complex and CT-DNA was constructed by analyzing the experimental data of absorption titration and UV melting studies with the McGhee equation, van't Hoff's equation, and the Gibbs-Helmholtz equation.

  8. Primers and a specific DNA probe for detecting lactic acid bacteria producing 3-hydroxypropionaldehyde from glycerol in spoiled ciders.

    PubMed

    Claisse, O; Lonvaud-Funel, A

    2001-06-01

    Of the 40 strains isolated from several spoiled ciders where glycerol was degraded, 36 were identified as Lactobacillus collinoides, three were Lactobacillus hilgardii, and one was Lactobacillus mali. However, only 30 L. collinoides and two L. hilgardii could degrade glycerol. The glycerol dehydratase activity was shown. The main product of the transformation was 1.3 propanediol. Two DNA primers GD1 and GD2 were chosen in the region encoding one of the subunits of glycerol dehydratase of Citrobacter freundii, Klebsiella pneumoniae, Klebsiella oxytoca, Salmonella Typhimurium, and Clostridium pasteurianum. A 279-bp amplicon in polymerase chain reaction amplification was obtained with the genomic L. collinoides IOEB 9527 DNA as template. The amino acid sequence deduced from the amplicon DNA sequence showed a very high similarity and identity with the gene of gram-negative and C. pasteurianum species. After labeling, the amplicon was used as DNA probe in dot-blot hybridization with the genomic DNA of all the tested strains. Only strains that could degrade glycerol hybridized. Moreover, polymerase chain reactions using GDI and GD2 revealed only glycerol dehydratase genes of positive L. collinoides and L. hilgardii strains. The primers and the amplicon proved to be suitable and reliable tools to detect the lactic acid bacteria involved in the deterioration of cider. PMID:11403134

  9. Dominant negative mutant of retinoic acid receptor alpha inhibits retinoic acid-induced P19 cell differentiation by binding to DNA.

    PubMed

    Costa, S L; McBurney, M W

    1996-05-25

    Retinoic acid (RA) is a potent inducer of P19 cell differentiation. RA activity is thought to be mediated by nuclear RA receptors (RARs), transcription factors whose activity is dependent on RA. There are three RARs called alpha, beta, and gamma. We created truncated versions of the three RARs and compared their activities as inhibitors of RA-mediated gene transcription and of P19 cell differentiation. Only mutants of the RAR alpha were inhibitory in these assays. A mutant of RAR alpha carrying a 10-amino-acid insert was able to heterodimerize with RXRbeta or with the normal RAR alpha and the inhibitory activity of this mutant was dependent on an intact DNA binding domain. We conclude that dominant negative mutants of RAR alpha act by heterodimerizing with RXRs or RARs and binding to RA response elements on DNA, thereby preventing binding of the normal receptors to those sites. PMID:8635515

  10. Folic acid or combination of folic acid and vitamin B(12) prevents short-term arsenic trioxide-induced systemic and mitochondrial dysfunction and DNA damage.

    PubMed

    Majumdar, Sangita; Mukherjee, Sandip; Maiti, Anasuya; Karmakar, Subhra; Das, Asankur Sekhar; Mukherjee, Maitrayee; Nanda, Arunabha; Mitra, Chandan

    2009-08-01

    The effect of folic acid and folic acid + vitamin B(12) supplementation upon short-term arsenic-induced systemic and pancreatic islet cell mitochondria oxidative stress was investigated in male rats. Arsenic trioxide was administered orally at a dose of 3 mg kg body weight(-1) day(-1) for 30 days, and folic acid and vitamin B(12) were administered at a dose of 36 and 0.63 microg kg body weight(-1) day(-1), respectively, for 30 days. Compared to control, arsenic-treated group showed a significant increase in the levels of systemic oxidative markers, malondialdehyde (MDA), nitric oxide (NO), and hydroxyl radical (OH(-)) formation, which were found decreased significantly after supplementation either with folic acid or a combination of folic acid + vitamin B(12). Similar supplementations were found effective against arsenic-induced oxidative marker changes (MDA, NO, and OH(-)) in pancreatic islet cell mitochondria. Also, low activities of antioxidant defense enzymes such as superoxide dismutase and catalase, and level of antioxidant glutathione, all could regain significantly on supplementations both against systemic and islet cell mitochondria oxidative stress. Results of agarose-gel electrophoresis of DNA from lymphocytes and islet cells of arsenic-exposed rats showed DNA smearing, which could be reduced with simultaneous administration either with folic acid or a combination of folic acid + vitamin B(12). Significantly, similar supplementations were found effective in increasing the urinary clearance of arsenic. Together, these results indicate that folic acid and vitamin B(12) may be effective to reduce the arsenic-induced damage at molecular target level.

  11. Possible role of mtDNA depletion and respiratory chain defects in aristolochic acid I-induced acute nephrotoxicity

    SciTech Connect

    Jiang, Zhenzhou Bao, Qingli Sun, Lixin Huang, Xin Wang, Tao Zhang, Shuang Li, Han Zhang, Luyong

    2013-01-15

    This report describes an investigation of the pathological mechanism of acute renal failure caused by toxic tubular necrosis after treatment with aristolochic acid I (AAI) in Sprague–Dawley (SD) rats. The rats were gavaged with AAI at 0, 5, 20, or 80 mg/kg/day for 7 days. The pathologic examination of the kidneys showed severe acute tubular degenerative changes primarily affecting the proximal tubules. Supporting these results, we detected significantly increased concentrations of blood urea nitrogen (BUN) and creatinine (Cr) in the rats treated with AAI, indicating damage to the kidneys. Ultrastructural examination showed that proximal tubular mitochondria were extremely enlarged and dysmorphic with loss and disorientation of their cristae. Mitochondrial function analysis revealed that the two indicators for mitochondrial energy metabolism, the respiratory control ratio (RCR) and ATP content, were reduced in a dose-dependent manner after AAI treatment. The RCR in the presence of substrates for complex I was reduced more significantly than in the presence of substrates for complex II. In additional experiments, the activity of respiratory complex I, which is partly encoded by mitochondrial DNA (mtDNA), was more significantly impaired than that of respiratory complex II, which is completely encoded by nuclear DNA (nDNA). A real-time PCR assay revealed a marked reduction of mtDNA in the kidneys treated with AAI. Taken together, these results suggested that mtDNA depletion and respiratory chain defects play critical roles in the pathogenesis of kidney injury induced by AAI, and that the same processes might contribute to aristolochic acid-induced nephrotoxicity in humans. -- Highlights: ► AAI-induced acute renal failure in rats and the proximal tubule was the target. ► Tubular mitochondria were morphologically aberrant in ultrastructural examination. ► AAI impair mitochondrial bioenergetic function and mtDNA replication.

  12. Amplification of fluorescently labelled DNA within gram-positive and acid-fast bacteria.

    PubMed

    Vaid, A; Bishop, A H

    1999-10-01

    Representative organisms from a variety of Gram-positive genera were subjected to varying regimes in order to optimise the intracellular amplification of DNA. The bacteria were subjected to treatments with paraformaldehyde, muramidases and mild acid hydrolysis to discover which regime made each organism permeable to the amplification reagents yet allowed retention of the fluorescein-labelled amplified products within the cell. Scanning electron micrographs were used to corroborate the effectiveness of the treatments, as seen by fluorescent photomicrographs, with the damage caused to the bacterial walls. A combination of mutanolysin and lysozyme was found most effective for Bacillus cereus, whereas permeabilisation of Streptomyces coelicolor, Lactococcus lactis and Clostridium sporogenes was most effective when exposed to lysozyme only. Surprisingly, direct amplification with no pre-treatment gave the brightest fluorescence in Mycobacterium phlei. Comparing the techniques of whole cell PCR, primed in situ labelling (PRINS), and cycle PRINS showed that under the conditions used the strongest intensity of fluorescence was obtained with in situ PCR; only L. lactis and M. phlei produced signals with cycle PRINS, fluorescence was not seen for any of the organisms with PRINS.

  13. Domoic acid induces direct DNA damage and apoptosis in Caco-2 cells: recent advances.

    PubMed

    Pinto-Silva, C R Carvalho; Moukha, S; Matias, W G; Creppy, E E

    2008-12-01

    Domoic acid (DA) is a neurotoxin produced by sea-water phytoplankton. Shellfish feeding on the phytoplankton can bioconcentrate DA, leading to a potentially serious health hazard for people consuming the contaminated shellfish. DA is the principal toxin responsible for amnesic shellfish poisoning (ASP). The toxic mechanism of DA is believed to be mediated at the level of the mitochondria, where uncoupling of oxidative phosphorylation decreases membrane permeability, causing cell swelling and ultimately lysis. Literature is poor concerning data on the possible genotoxicity and cytotoxicity of DA. In the present study, we have evaluated the cytotoxicity and genotoxicity of DA on a human colorectal adenocarcinoma cell line (Caco-2). Our results clearly demonstrate that DA decreased cell viability (IC(50) about 70 ng/mL), induced direct DNA damage from 15 ng/mL, and apoptosis in Caco-2 cells at 100 ng/mL. This apoptosis is likely bax-dependent and occurred only at high concentrations of DA, while lower concentrations upregulated both bax and bcl-2 at an apparent constant ratio until a sudden decrease of bcl-2 at 100 ng/mL and increase of bax. PMID:18293405

  14. Deoxyribonucleic acid of Cancer pagurus. II. Tempiate activity for a DNA-dependent DNA polymerase of eukaryotic cells

    PubMed Central

    De Recondo, Anne-Marie; Londos-Gagliardi, Danielle; Aubel-Sadron, Geneviève

    1974-01-01

    The template activity of Cancer pagurus DNA and its two components (poly d(A-T) and main component) in response to a DNA polymerase purified from regenerating rat liver has been studied and compared to the results previously obtained with synthetic templates. In the double-stranded native state, whole crab DNA and the main component were poor templates. Their replication was increased by thermal denaturation and inhibited by actinomycin. Like the synthetic copolymer poly[d(A-T)·d(T-A)], native crab poly d(A-T) could be copied and its duplication was not inhibited by actinomycin. The structural difference between native poly d(A-T) Form I, isolated on a density gradient, and partially renatured poly d(A-T) Form II, isolated on hydroxylapatite, resulted in a modification of their template activity. The kinetic studies of [3H] dGMP and [3H] dAMP incorporation confirmed the importance of single-stranded regions (particulary dC regions) in the initiation of the in vitro duplication. PMID:10793685

  15. Genoprotective effect of hyaluronic acid against benzalkonium chloride-induced DNA damage in human corneal epithelial cells

    PubMed Central

    Wu, Han; Zhang, Huina; Wang, Changjun; Wu, Yihua; Xie, Jiajun; Jin, Xiuming; Yang, Jun

    2011-01-01

    Purpose The aim of this study was to investigate hyaluronic acid (HA) protection on cultured human corneal epithelial cells (HCEs) against benzalkonium chloride (BAC)-induced DNA damage and intracellular reactive oxygen species (ROS) increase. Methods Cells were incubated with different concentrations of BAC with or without the presence of 0.2% HA for 30 min. DNA damage to HCEs was examined by alkaline comet assay and by immunofluorescence microscopic detection of the phosphorylated form of histone variant H2AX (γH2AX) foci. ROS production was assessed by the fluorescent probe, 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). Cell apoptosis was determined with annexin V staining by flow cytometry. Results HA significantly reduced BAC-induced DNA damage as indicated by the tail length (TL) and tail moment (TM) of alkaline comet assay and by γH2AX foci formation, respectively. Moreover, HA significantly decreased BAC-induced ROS increase and cell apoptosis. However, exposure to HA alone did not produce any significant change in DNA damage, ROS generation, or cell apoptosis. Conclusions BAC could induce DNA damage and cell apoptosis in HCEs, probably through increasing oxidative stress. Furthermore, HA was an effective protective agent that had antioxidant properties and could decrease DNA damage and cell apoptosis induced by BAC. PMID:22219631

  16. High-performance method for specific effect on nucleic acids in cells using TiO2~DNA nanocomposites

    NASA Astrophysics Data System (ADS)

    Levina, Asya S.; Repkova, Marina N.; Ismagilov, Zinfer R.; Shikina, Nadezhda V.; Malygin, Ernst G.; Mazurkova, Natalia A.; Zinov'ev, Victor V.; Evdokimov, Alexei A.; Baiborodin, Sergei I.; Zarytova, Valentina F.

    2012-10-01

    Nanoparticles are used to solve the current drug delivery problem. We present a high-performance method for efficient and selective action on nucleic acid target in cells using unique TiO2.PL-DNA nanocomposites (polylysine-containing DNA fragments noncovalently immobilized onto TiO2 nanoparticles capable of transferring DNA). These nanocomposites were used for inhibition of human influenza A (H3N2) virus replication in infected MDCK cells. They showed a low toxicity (TC50 ~ 1800 μg/ml) and a high antiviral activity (>99.9% inhibition of the virus replication). The specificity factor (antisense effect) appeared to depend on the delivery system of DNA fragments. This factor for nanocomposites is ten-times higher than for DNA in the presence of lipofectamine. IC50 for nanocomposites was estimated to be 1.5 μg/ml (30 nM for DNA), so its selectivity index was calculated as ~1200. Thus, the proposed nanocomposites are prospective for therapeutic application.

  17. Molecular sled is an eleven-amino acid vehicle facilitating biochemical interactions via sliding components along DNA

    DOE PAGES

    Mangel, Walter F.; McGrath, William J.; Xiong, Kan; Graziano, Vito; Blainey, Paul C.

    2016-02-02

    Recently, we showed the adenovirus proteinase interacts productively with its protein substrates in vitro and in vivo in nascent virus particles via one-dimensional diffusion along the viral DNA. The mechanism by which this occurs has heretofore been unknown. We show sliding of these proteins along DNA occurs on a new vehicle in molecular biology, a ‘molecular sled’ named pVIc. This 11-amino acid viral peptide binds to DNA independent of sequence. pVIc slides on DNA, exhibiting the fastest one-dimensional diffusion constant, 26±1.8 × 106 (bp)2 s−1. pVIc is a ‘molecular sled,’ because it can slide heterologous cargos along DNA, for example, amore » streptavidin tetramer. Similar peptides, for example, from the C terminus of β-actin or NLSIII of the p53 protein, slide along DNA. Finally, characteristics of the ‘molecular sled’ in its milieu (virion, nucleus) have implications for how proteins in the nucleus of cells interact and imply a new form of biochemistry, one-dimensional biochemistry.« less

  18. Ultra-sensitive detection of zinc oxide nanowires using a quartz crystal microbalance and phosphoric acid DNA

    NASA Astrophysics Data System (ADS)

    Jang, Kuewhan; You, Juneseok; Park, Chanhoo; Park, Hyunjun; Choi, Jaeyeong; Choi, Chang-Hwan; Park, Jinsung; Lee, Howon; Na, Sungsoo

    2016-09-01

    Recent advancements of nanomaterials have inspired numerous scientific and industrial applications. Zinc oxide nanowires (ZnO NWs) is one of the most important nanomaterials due to their extraordinary properties. However, studies performed over the past decade have reported toxicity of ZnO NWs. Therefore, there has been increasing demand for effective detection of ZnO NWs. In this study, we propose a method for the detection of ZnO NW using a quartz crystal microbalance (QCM) and DNA probes. The detection method is based on the covalent interaction between ZnO NWs and the phosphoric acid group of single-stranded DNA (i.e., linker DNA), and DNA hybridization between the linker DNA and the probe DNA strand on the QCM electrode. Rapid, high sensitivity, in situ detection of ZnO NWs was demonstrated for the first time. The limit of detection was 10‑4 μg ml‑1 in deionized water, which represents a sensitivity that is 100000 times higher than the toxic ZnO NW concentration level. Moreover, the selectivity of the ZnO NW detection method was demonstrated by comparison with other types of nanowires and the method was able to detect ZnO NWs in tap water sensitively even after stored for 14 d in a refrigerator. The performance of our proposed method was sufficient to achieve detection of ZnO NW in the ‘real-world’ environment.

  19. Ultra-sensitive detection of zinc oxide nanowires using a quartz crystal microbalance and phosphoric acid DNA

    NASA Astrophysics Data System (ADS)

    Jang, Kuewhan; You, Juneseok; Park, Chanhoo; Park, Hyunjun; Choi, Jaeyeong; Choi, Chang-Hwan; Park, Jinsung; Lee, Howon; Na, Sungsoo

    2016-09-01

    Recent advancements of nanomaterials have inspired numerous scientific and industrial applications. Zinc oxide nanowires (ZnO NWs) is one of the most important nanomaterials due to their extraordinary properties. However, studies performed over the past decade have reported toxicity of ZnO NWs. Therefore, there has been increasing demand for effective detection of ZnO NWs. In this study, we propose a method for the detection of ZnO NW using a quartz crystal microbalance (QCM) and DNA probes. The detection method is based on the covalent interaction between ZnO NWs and the phosphoric acid group of single-stranded DNA (i.e., linker DNA), and DNA hybridization between the linker DNA and the probe DNA strand on the QCM electrode. Rapid, high sensitivity, in situ detection of ZnO NWs was demonstrated for the first time. The limit of detection was 10-4 μg ml-1 in deionized water, which represents a sensitivity that is 100000 times higher than the toxic ZnO NW concentration level. Moreover, the selectivity of the ZnO NW detection method was demonstrated by comparison with other types of nanowires and the method was able to detect ZnO NWs in tap water sensitively even after stored for 14 d in a refrigerator. The performance of our proposed method was sufficient to achieve detection of ZnO NW in the ‘real-world’ environment.

  20. Efficient interrupting skills of amino acid metallointercalators with DNA at physiological pH: Evaluation of biological assays

    NASA Astrophysics Data System (ADS)

    Raman, Natarajan; Selvaganapathy, Muthusamy; Radhakrishnan, Srinivasan

    2014-06-01

    The 4-aminoantipyrine derivatives (sbnd NO2, sbnd OCH3) and their mixed-ligand complexes with amino acids have been synthesized and investigated for their binding with CT DNA using UV-visible spectroscopy, cyclic voltammetry, and viscosity measurements under physiological conditions of pH (stomach 4.7; blood 7.4). The results from all techniques i.e. binding constant (Kb), and free energy change (ΔG) were in good agreement and inferred spontaneous compound-DNA complexes formation via intercalation. Among all the compounds 1 and 4 showed comparatively greater binding at pH 7.4 as evident from its greater Kb values. All the complexes exhibit oxidative cleavage of supercoiled (SC) pBR322 plasmid DNA in the presence of H2O2 as an activator. It is remarkable that at 25 μM concentration 1 and 4 completely degrade SC DNA into undetectable minor fragments and thus they act as efficient chemical nucleases. Among the new complexes, complexes 1 and 4 have highest potential against all the microorganisms tested. The results of the above biological experiments also reveal that the choice of different metal ions has little influence on the DNA binding, DNA cleavage and antimicrobial assay.

  1. Ultra-sensitive detection of zinc oxide nanowires using a quartz crystal microbalance and phosphoric acid DNA.

    PubMed

    Jang, Kuewhan; You, Juneseok; Park, Chanhoo; Park, Hyunjun; Choi, Jaeyeong; Choi, Chang-Hwan; Park, Jinsung; Lee, Howon; Na, Sungsoo

    2016-09-01

    Recent advancements of nanomaterials have inspired numerous scientific and industrial applications. Zinc oxide nanowires (ZnO NWs) is one of the most important nanomaterials due to their extraordinary properties. However, studies performed over the past decade have reported toxicity of ZnO NWs. Therefore, there has been increasing demand for effective detection of ZnO NWs. In this study, we propose a method for the detection of ZnO NW using a quartz crystal microbalance (QCM) and DNA probes. The detection method is based on the covalent interaction between ZnO NWs and the phosphoric acid group of single-stranded DNA (i.e., linker DNA), and DNA hybridization between the linker DNA and the probe DNA strand on the QCM electrode. Rapid, high sensitivity, in situ detection of ZnO NWs was demonstrated for the first time. The limit of detection was 10(-4) μg ml(-1) in deionized water, which represents a sensitivity that is 100000 times higher than the toxic ZnO NW concentration level. Moreover, the selectivity of the ZnO NW detection method was demonstrated by comparison with other types of nanowires and the method was able to detect ZnO NWs in tap water sensitively even after stored for 14 d in a refrigerator. The performance of our proposed method was sufficient to achieve detection of ZnO NW in the 'real-world' environment.

  2. Molecular sled is an eleven-amino acid vehicle facilitating biochemical interactions via sliding components along DNA.

    PubMed

    Mangel, Walter F; McGrath, William J; Xiong, Kan; Graziano, Vito; Blainey, Paul C

    2016-02-02

    Recently, we showed the adenovirus proteinase interacts productively with its protein substrates in vitro and in vivo in nascent virus particles via one-dimensional diffusion along the viral DNA. The mechanism by which this occurs has heretofore been unknown. We show sliding of these proteins along DNA occurs on a new vehicle in molecular biology, a 'molecular sled' named pVIc. This 11-amino acid viral peptide binds to DNA independent of sequence. pVIc slides on DNA, exhibiting the fastest one-dimensional diffusion constant, 26±1.8 × 10(6) (bp)(2) s(-1). pVIc is a 'molecular sled,' because it can slide heterologous cargos along DNA, for example, a streptavidin tetramer. Similar peptides, for example, from the C terminus of β-actin or NLSIII of the p53 protein, slide along DNA. Characteristics of the 'molecular sled' in its milieu (virion, nucleus) have implications for how proteins in the nucleus of cells interact and imply a new form of biochemistry, one-dimensional biochemistry.

  3. Evaluation of DNA encoding acidic ribosomal protein P2 of Cryptosporidium parvum as a potential vaccine candidate for cryptosporidiosis.

    PubMed

    Benitez, Alvaro; Priest, Jeffrey W; Ehigiator, Humphrey N; McNair, Nina; Mead, Jan R

    2011-11-15

    The Cryptosporidium parvum acidic ribosomal protein P2 (CpP2) is an important immunodominant marker in C. parvum infection. In this study, the CpP2 antigen was evaluated as a vaccine candidate using a DNA vaccine model in adult C57BL/6 IL-12 knockout (KO) mice, which are susceptible to C. parvum infection. Our data show that subcutaneous immunization in the ear with DNA encoding CpP2 (CpP2-DNA) cloned into the pUMVC4b vector induced a significant anti-CpP2 IgG antibody response that was predominantly of the IgG1 isotype. Compared to control KO mice immunized with plasmid alone, CpP2-immunized mice demonstrated specific in vitro spleen cell proliferation as well as enhanced IFN-γ production to recombinant CpP2. Further, parasite loads in CpP2 DNA-immunized mice were compared to control mice challenged with C. parvum oocysts. Although a trend in reduction of infection was observed in the CpP2 DNA-immunized mice, differences between groups were not statistically significant. These results suggest that a DNA vaccine encoding the C. parvum P2 antigen is able to provide an effective means of eliciting humoral and cellular responses and has the potential to generate protective immunity against C. parvum infection but may require using alternative vectors or adjuvant to generate a more potent and balanced response.

  4. Ultra-sensitive detection of zinc oxide nanowires using a quartz crystal microbalance and phosphoric acid DNA.

    PubMed

    Jang, Kuewhan; You, Juneseok; Park, Chanhoo; Park, Hyunjun; Choi, Jaeyeong; Choi, Chang-Hwan; Park, Jinsung; Lee, Howon; Na, Sungsoo

    2016-09-01

    Recent advancements of nanomaterials have inspired numerous scientific and industrial applications. Zinc oxide nanowires (ZnO NWs) is one of the most important nanomaterials due to their extraordinary properties. However, studies performed over the past decade have reported toxicity of ZnO NWs. Therefore, there has been increasing demand for effective detection of ZnO NWs. In this study, we propose a method for the detection of ZnO NW using a quartz crystal microbalance (QCM) and DNA probes. The detection method is based on the covalent interaction between ZnO NWs and the phosphoric acid group of single-stranded DNA (i.e., linker DNA), and DNA hybridization between the linker DNA and the probe DNA strand on the QCM electrode. Rapid, high sensitivity, in situ detection of ZnO NWs was demonstrated for the first time. The limit of detection was 10(-4) μg ml(-1) in deionized water, which represents a sensitivity that is 100000 times higher than the toxic ZnO NW concentration level. Moreover, the selectivity of the ZnO NW detection method was demonstrated by comparison with other types of nanowires and the method was able to detect ZnO NWs in tap water sensitively even after stored for 14 d in a refrigerator. The performance of our proposed method was sufficient to achieve detection of ZnO NW in the 'real-world' environment. PMID:27479871

  5. DNA Before Proteins? Recent Discoveries in Nucleic Acid Catalysis Strengthen the Case

    NASA Astrophysics Data System (ADS)

    Burton, Aaron S.; Lehman, Niles

    2009-02-01

    An RNA-DNA World could arise from an all-RNA system with the development of as few as three ribozymes -- a DNA-dependent RNA polymerase, an RNA-dependent DNA polymerase, and a catalyst for the production of DNA nucleotides. A significant objection to DNA preceding proteins is that RNA has not been shown to catalyze the production of DNA. However, RNA- and DNAzymes have been recently discovered that catalyze chemical reactions capable of forming deoxyribose, such as mixed aldol condensation of 5'-glyceryl- and 3'-glycoaldehyde-terminated DNA strands. Thus, the only remaining obstacles to RNA-catalyzed in vitro DNA synthesis are alterations of substrate and template specificities of known ribozymes. The RNA-DNA World lessens genomic size constraints through a relaxed error threshold, affording the evolutionary time needed to develop protein synthesis. Separation of information from catalyst enables genotype and phenotype to be readily discriminated by absence or presence, respectively, of the 2'-OH. Novel ribozymes that arise through mutation can be preserved in DNA by reverse transcription, which makes them much more likely to be retained than in an RNA-genome milieu. The extra degree of separation between protein and mRNA, in terms of identifying and then retaining a useful enzyme, may have in fact necessitated storing information in DNA prior to the advent of translation.

  6. Adsorption of DNA/RNA nucleobases on hexagonal boron nitride sheet: an ab initio study.

    PubMed

    Lin, Qing; Zou, Xiaolong; Zhou, Gang; Liu, Rui; Wu, Jian; Li, Jia; Duan, Wenhui

    2011-07-14

    Our ab initio calculations indicate that the interaction of deoxyribonucleic/ribonucleic acid (DNA/RNA) nucleobases [guanine (G), adenine (A), thymine (T), cytosine (C), and uracil (U)] with the hexagonal boron nitride (h-BN) sheet, a polar but chemically inert surface, is governed by mutual polarization. Unlike the case of graphene, all nucleobases exhibit the same stacking arrangement on the h-BN sheet due to polarization effects: the anions (N and O atoms) of nucleobases prefer to stay on top of cations (B) of the substrate as far as possible, regardless of the biological properties of nucleobases. The adsorption energies, ranging from 0.5 eV to 0.69 eV, increase in the order of U, C, T, A and G, which can be attributed to different side groups or atoms of nucleobases. The fundamental nature of DNA/RNA nucleobases and h-BN sheet remains unchanged upon adsorption, suggesting that the h-BN sheet is a promising template for DNA/RNA-related research, such as self-assembly. PMID:21637870

  7. Tricolour fluorescence detection of sequence-specific DNA with a new molecular beacon and a nucleic acid dye TOTO-3.

    PubMed

    Xiang, Dongshan; Zhang, Cuiling; Chen, Lu; Ji, Xinghu; He, Zhike

    2012-12-21

    We have developed a tricolor fluorescence quantitative method for sequence-specific DNA detection using a new molecular beacon (MB) and a nucleic acid dye TOTO-3. This new MB is designed with two fluorophores of FAM and TAMRA instead of one fluorophore and one quencher of traditional MB, and a nucleotide with guanine base is attached directly to FAM as a quencher. In the absence of target DNA, MBs are in the stem-loop state. The fluorescence of FAM is absorbed by TAMRA, and the fluorescence of TAMRA is quenched by guanine base. Meanwhile, the interaction between TOTO-3 and MBs is very weak. In the presence of target DNA, MBs hybridize with target DNA to form a double-stranded structure. TAMRA is separated from FAM and guanine base, and the fluorescence of FAM and TAMRA recovers simultaneously. At the same time TOTO-3 binds to double-stranded DNA, the fluorescence of TOTO-3 significantly enhances. In this strategy, the false-positive signals of MBs caused by non-specific interactions can be distinguished by the change of the ratio of the total fluorescence intensities of FAM and TAMRA to that of TOTO-3 at different concentrations of target DNA. In the simple sample, the detection of target DNA can be achieved with the total fluorescence intensity of three dyes, which results in a significant improvement of the detection sensitivity. In the complex sample, the detection of target DNA can be achieved with the fluorescence intensity of TOTO-3 which can overcome the false-positive signals of MBs and improve the detection accuracy.

  8. A beta-D-allopyranoside-grafted Ru(II) complex: synthesis and acid-base and DNA-binding properties.

    PubMed

    Ma, Yan-Zi; Yin, Hong-Ju; Wang, Ke-Zhi

    2009-08-01

    A new ruthenium(II) complex grafted with beta-d-allopyranoside, Ru(bpy)(2)(Happip)(ClO(4))(2) (where bpy = 2,2'-bipyridine; Happip = 2-(4-(beta-d-allopyranoside)phenyl)imidazo[4,5-f][1,10]phenanthroline), has been synthesized and characterized by elemental analysis, (1)H NMR spectroscopy, and mass spectrometry. The acid-base properties of the complex have been studied by UV-visible and luminescence spectrophotometric pH titrations, and ground- and excited-state ionization constants have been derived. The Ru(II) complex functions as a DNA intercalator as revealed by UV-visible and emission titrations, salt effects, steady-state emission quenching by [Fe(CN)(6)](4-), DNA competitive binding with ethidium bromide, DNA melting experiment, and viscosity measurements.

  9. Amino acid sequence of rabbit kidney neutral endopeptidase 24.11 (enkephalinase) deduced from a complementary DNA.

    PubMed Central

    Devault, A; Lazure, C; Nault, C; Le Moual, H; Seidah, N G; Chrétien, M; Kahn, P; Powell, J; Mallet, J; Beaumont, A

    1987-01-01

    Neutral endopeptidase (EC 3.4.24.11) is a major constituent of kidney brush border membranes. It is also present in the brain where it has been shown to be involved in the inactivation of opioid peptides, methionine- and leucine-enkephalins. For this reason this enzyme is often called 'enkephalinase'. In order to characterize the primary structure of the enzyme, oligonucleotide probes were designed from partial amino acid sequences and used to isolate clones from kidney cDNA libraries. Sequencing of the cDNA inserts revealed the complete primary structure of the enzyme. Neutral endopeptidase consists of 750 amino acids. It contains a short N-terminal cytoplasmic domain (27 amino acids), a single membrane-spanning segment (23 amino acids) and an extracellular domain that comprises most of the protein mass. The comparison of the primary structure of neutral endopeptidase with that of thermolysin, a bacterial Zn-metallopeptidase, indicates that most of the amino acid residues involved in Zn coordination and catalytic activity in thermolysin are found within highly honmologous sequences in neutral endopeptidase. Images Fig. 1. Fig. 3. PMID:2440677

  10. The ATPase domain but not the acidic region of Cockayne syndrome group B gene product is essential for DNA repair.

    PubMed

    Brosh, R M; Balajee, A S; Selzer, R R; Sunesen, M; Proietti De Santis, L; Bohr, V A

    1999-11-01

    Cockayne syndrome (CS) is a human genetic disorder characterized by UV sensitivity, developmental abnormalities, and premature aging. Two of the genes involved, CSA and CSB, are required for transcription-coupled repair (TCR), a subpathway of nucleotide excision repair that removes certain lesions rapidly and efficiently from the transcribed strand of active genes. CS proteins have also been implicated in the recovery of transcription after certain types of DNA damage such as those lesions induced by UV light. In this study, site-directed mutations have been introduced to the human CSB gene to investigate the functional significance of the conserved ATPase domain and of a highly acidic region of the protein. The CSB mutant alleles were tested for genetic complementation of UV-sensitive phenotypes in the human CS-B homologue of hamster UV61. In addition, the CSB mutant alleles were tested for their ability to complement the sensitivity of UV61 cells to the carcinogen 4-nitroquinoline-1-oxide (4-NQO), which introduces bulky DNA adducts repaired by global genome repair. Point mutation of a highly conserved glutamic acid residue in ATPase motif II abolished the ability of CSB protein to complement the UV-sensitive phenotypes of survival, RNA synthesis recovery, and gene-specific repair. These data indicate that the integrity of the ATPase domain is critical for CSB function in vivo. Likewise, the CSB ATPase point mutant failed to confer cellular resistance to 4-NQO, suggesting that ATP hydrolysis is required for CSB function in a TCR-independent pathway. On the contrary, a large deletion of the acidic region of CSB protein did not impair the genetic function in the processing of either UV- or 4-NQO-induced DNA damage. Thus the acidic region of CSB is likely to be dispensable for DNA repair, whereas the ATPase domain is essential for CSB function in both TCR-dependent and -independent pathways. PMID:10564257

  11. Protection of DNA against low-energy electrons by amino acids: a first-principles molecular dynamics study.

    PubMed

    Gu, Bin; Smyth, Maeve; Kohanoff, Jorge

    2014-11-28

    Using first-principles molecular dynamics simulations, we have investigated the notion that amino acids can play a protective role when DNA is exposed to excess electrons produced by ionizing radiation. In this study we focus on the interaction of glycine with the DNA nucleobase thymine. We studied thymine-glycine dimers and a condensed phase model consisting of one thymine molecule solvated in amorphous glycine. Our results show that the amino acid acts as a protective agent for the nucleobase in two ways. If the excess electron is initially captured by the thymine, then a proton is transferred in a barrier-less way from a neighboring hydrogen-bonded glycine. This stabilizes the excess electron by reducing the net partial charge on the thymine. In the second mechanism the excess electron is captured by a glycine, which acts as a electron scavenger that prevents electron localization in DNA. Both these mechanisms introduce obstacles to further reactions of the excess electron within a DNA strand, e.g. by raising the free energy barrier associated with strand breaks.

  12. DNA Methylation Profiling at Single-Base Resolution Reveals Gestational Folic Acid Supplementation Influences the Epigenome of Mouse Offspring Cerebellum

    PubMed Central

    Barua, Subit; Kuizon, Salomon; Brown, W. Ted; Junaid, Mohammed A.

    2016-01-01

    It is becoming increasingly more evident that lifestyle, environmental factors, and maternal nutrition during gestation can influence the epigenome of the developing fetus and thus modulate the physiological outcome. Variations in the intake of maternal nutrients affecting one-carbon metabolism may influence brain development and exert long-term effects on the health of the progeny. In this study, we investigated whether supplementation with high maternal folic acid during gestation alters DNA methylation and gene expression in the cerebellum of mouse offspring. We used reduced representation bisulfite sequencing to analyze the DNA methylation profile at the single-base resolution level. The genome-wide DNA methylation analysis revealed that supplementation with higher maternal folic acid resulted in distinct methylation patterns (P < 0.05) of CpG and non-CpG sites in the cerebellum of offspring. Such variations of methylation and gene expression in the cerebellum of offspring were highly sex-specific, including several genes of the neuronal pathways. These findings demonstrate that alterations in the level of maternal folic acid during gestation can influence methylation and gene expression in the cerebellum of offspring. Such changes in the offspring epigenome may alter neurodevelopment and influence the functional outcome of neurologic and psychiatric diseases. PMID:27199632

  13. DNA Methylation Profiling at Single-Base Resolution Reveals Gestational Folic Acid Supplementation Influences the Epigenome of Mouse Offspring Cerebellum.

    PubMed

    Barua, Subit; Kuizon, Salomon; Brown, W Ted; Junaid, Mohammed A

    2016-01-01

    It is becoming increasingly more evident that lifestyle, environmental factors, and maternal nutrition during gestation can influence the epigenome of the developing fetus and thus modulate the physiological outcome. Variations in the intake of maternal nutrients affecting one-carbon metabolism may influence brain development and exert long-term effects on the health of the progeny. In this study, we investigated whether supplementation with high maternal folic acid during gestation alters DNA methylation and gene expression in the cerebellum of mouse offspring. We used reduced representation bisulfite sequencing to analyze the DNA methylation profile at the single-base resolution level. The genome-wide DNA methylation analysis revealed that supplementation with higher maternal folic acid resulted in distinct methylation patterns (P < 0.05) of CpG and non-CpG sites in the cerebellum of offspring. Such variations of methylation and gene expression in the cerebellum of offspring were highly sex-specific, including several genes of the neuronal pathways. These findings demonstrate that alterations in the level of maternal folic acid during gestation can influence methylation and gene expression in the cerebellum of offspring. Such changes in the offspring epigenome may alter neurodevelopment and influence the functional outcome of neurologic and psychiatric diseases. PMID:27199632

  14. DNA adducts of aristolochic acid II: total synthesis and site-specific mutagenesis studies in mammalian cells

    PubMed Central

    Attaluri, Sivaprasad; Bonala, Radha R.; Yang, In-Young; Lukin, Mark A.; Wen, Yujing; Grollman, Arthur P.; Moriya, Masaaki; Iden, Charles R.; Johnson, Francis

    2010-01-01

    Aristolochic acids I and II (AA-I, AA-II) are found in all Aristolochia species. Ingestion of these acids either in the form of herbal remedies or as contaminated wheat flour causes a dose-dependent chronic kidney failure characterized by renal tubulointerstitial fibrosis. In ∼50% of these cases, the condition is accompanied by an upper urinary tract malignancy. The disease is now termed aristolochic acid nephropathy (AAN). AA-I is largely responsible for the nephrotoxicity while both AA-I and AA-II are genotoxic. DNA adducts derived from AA-I and AA-II have been isolated from renal tissues of patients suffering from AAN. We describe the total synthesis, de novo, of the dA and dG adducts derived from AA-II, their incorporation site-specifically into DNA oligomers and the splicing of these modified oligomers into a plasmid construct followed by transfection into mouse embryonic fibroblasts. Analysis of the plasmid progeny revealed that both adducts blocked replication but were still partly processed by DNA polymerase(s). Although the majority of coding events involved insertion of correct nucleotides, substantial misincorporation of bases also was noted. The dA adduct is significantly more mutagenic than the dG adduct; both adducts give rise, almost exclusively, to misincorporation of dA, which leads to AL-II-dA→T and AL-II-dG→T transversions. PMID:19854934

  15. Methylarsonous acid causes oxidative DNA damage in cells independent of the ability to biomethylate inorganic arsenic

    PubMed Central

    Tokar, Erik J.; Kojima, Chikara; Waalkes, Michael P.

    2013-01-01

    Inorganic arsenic (iAs) and its toxic methylated metabolite, methylarsonous acid (MMAIII), both have carcinogenic potential. Prior study shows iAs induced malignant transformation in both arsenic methylation-proficient (liver) and methylation-deficient (prostate) cells, but only methylation-proficient cells show oxidative DNA damage (ODD) during this transformation. To further define if arsenic methylation is necessary for transformation or ODD induction, here we chronically exposed these same liver or prostate cell lines to MMAIII (0.25–1.0 μM) and tested for acquired malignant phenotype. Various metrics of oncogenic transformation were periodically assessed along with ODD during chronic MMAIII exposure. Methylation-deficient and methylation-proficient cells both acquired a cancer phenotype with MMAIII exposure at about 20 weeks, based on increased matrix metalloproteinase secretion, colony formation and invasion. In contrast, prior work showed iAs-induced transformation took longer in biomethylation-deficient cells (~30 weeks) than in biomethylation-proficient cells (~18 weeks). In the present study, MMAIII caused similar peak ODD levels at similar concentrations and at similar exposure times (18–22 weeks) in both cell types. At the approximate peak of ODD production both cell types showed similar alterations in arsenic and oxidative stress adaptation factors (i.e. ABCC1, ABCC2, GST-π, SOD-1). Thus, MMAIII causes oncogenic transformation associated with ODD in methylation-deficient cells, indicating further methylation is not required to induce ODD. Together, these results show that, MMAIII and iAs cause an acquired malignant phenotype in methylation-deficient cells, yet iAs does not induce ODD. This indicates iAs likely has both genotoxic and non-genotoxic mechanisms dictated by the target cell’s ability to methylate arsenic. PMID:24091636

  16. Methylarsonous acid causes oxidative DNA damage in cells independent of the ability to biomethylate inorganic arsenic.

    PubMed

    Tokar, Erik J; Kojima, Chikara; Waalkes, Michael P

    2014-02-01

    Inorganic arsenic (iAs) and its toxic methylated metabolite, methylarsonous acid (MMA(III)), both have carcinogenic potential. Prior study shows iAs-induced malignant transformation in both arsenic methylation-proficient (liver) and methylation-deficient (prostate) cells, but only methylation-proficient cells show oxidative DNA damage (ODD) during this transformation. To further define whether arsenic methylation is necessary for transformation or ODD induction, here we chronically exposed these same liver or prostate cell lines to MMA(III) (0.25-1.0 μM) and tested for acquired malignant phenotype. Various metrics of oncogenic transformation were periodically assessed along with ODD during chronic MMA(III) exposure. Methylation-deficient and methylation-proficient cells both acquired a cancer phenotype with MMA(III) exposure at about 20 weeks, based on increased matrix metalloproteinase secretion, colony formation, and invasion. In contrast, prior work showed iAs-induced transformation took longer in biomethylation-deficient cells (~30 weeks) than in biomethylation-proficient cells (~18 weeks). In the present study, MMA(III) caused similar peak ODD levels at similar concentrations and at similar exposure times (18-22 weeks) in both cell types. At the approximate peak of ODD production, both cell types showed similar alterations in arsenic and oxidative stress adaptation factors (i.e., ABCC1, ABCC2, GST-π, SOD-1). Thus, MMA(III) causes oncogenic transformation associated with ODD in methylation-deficient cells, indicating that further methylation is not required to induce ODD. Together, these results show that MMA(III) and iAs cause an acquired malignant phenotype in methylation-deficient cells, yet iAs does not induce ODD. This indicates iAs likely has both genotoxic and non-genotoxic mechanisms dictated by the target cell's ability to methylate arsenic. PMID:24091636

  17. Methylarsonous acid causes oxidative DNA damage in cells independent of the ability to biomethylate inorganic arsenic.

    PubMed

    Tokar, Erik J; Kojima, Chikara; Waalkes, Michael P

    2014-02-01

    Inorganic arsenic (iAs) and its toxic methylated metabolite, methylarsonous acid (MMA(III)), both have carcinogenic potential. Prior study shows iAs-induced malignant transformation in both arsenic methylation-proficient (liver) and methylation-deficient (prostate) cells, but only methylation-proficient cells show oxidative DNA damage (ODD) during this transformation. To further define whether arsenic methylation is necessary for transformation or ODD induction, here we chronically exposed these same liver or prostate cell lines to MMA(III) (0.25-1.0 μM) and tested for acquired malignant phenotype. Various metrics of oncogenic transformation were periodically assessed along with ODD during chronic MMA(III) exposure. Methylation-deficient and methylation-proficient cells both acquired a cancer phenotype with MMA(III) exposure at about 20 weeks, based on increased matrix metalloproteinase secretion, colony formation, and invasion. In contrast, prior work showed iAs-induced transformation took longer in biomethylation-deficient cells (~30 weeks) than in biomethylation-proficient cells (~18 weeks). In the present study, MMA(III) caused similar peak ODD levels at similar concentrations and at similar exposure times (18-22 weeks) in both cell types. At the approximate peak of ODD production, both cell types showed similar alterations in arsenic and oxidative stress adaptation factors (i.e., ABCC1, ABCC2, GST-π, SOD-1). Thus, MMA(III) causes oncogenic transformation associated with ODD in methylation-deficient cells, indicating that further methylation is not required to induce ODD. Together, these results show that MMA(III) and iAs cause an acquired malignant phenotype in methylation-deficient cells, yet iAs does not induce ODD. This indicates iAs likely has both genotoxic and non-genotoxic mechanisms dictated by the target cell's ability to methylate arsenic.

  18. Hydration of nucleic acid fragments: comparison of theory and experiment for high-resolution crystal structures of RNA, DNA, and DNA-drug complexes.

    PubMed

    Hummer, G; García, A E; Soumpasis, D M

    1995-05-01

    A computationally efficient method to describe the organization of water around solvated biomolecules is presented. It is based on a statistical mechanical expression for the water-density distribution in terms of particle correlation functions. The method is applied to analyze the hydration of small nucleic acid molecules in the crystal environment, for which high-resolution x-ray crystal structures have been reported. Results for RNA [r(ApU).r(ApU)] and DNA [d(CpG).d(CpG) in Z form and with parallel strand orientation] and for DNA-drug complexes [d(CpG).d(CpG) with the drug proflavine intercalated] are described. A detailed comparison of theoretical and experimental data shows positional agreement for the experimentally observed water sites. The presented method can be used for refinement of the water structure in x-ray crystallography, hydration analysis of nuclear magnetic resonance structures, and theoretical modeling of biological macromolecules such as molecular docking studies. The speed of the computations allows hydration analyses of molecules of almost arbitrary size (tRNA, protein-nucleic acid complexes, etc.) in the crystal environment and in aqueous solution.

  19. Substitution of DNA-Contacting Amino Acids with Functional Variants in the Gata-1 Zinc Finger: A Structurally and Phylogenetically Guided Mutagenesis

    PubMed Central

    Vonderfecht, Tyson R.; Schroyer, Daniel L.; Schenck, Brandy L.; McDonough, Virginia M.; Pikaart, Michael J.

    2008-01-01

    DNA binding functionality among transcription factor proteins is afforded by a number of structural motifs, such as the helix-turn-helix, helix-loop-helix, and zinc finger domains. The common thread among these diverse structures is their sequence-specific binding to essential promoter or other genetic regulatory sequences with high selectivity and affinity. One such motif, present in a wide range of organisms from bacteria to vertebrates, is the Gata-type zinc finger. This family of DNA-binding proteins is characterized by the presence of one or two (Cys)4 metal binding sites which recognize the protein’s eponymous binding site, GATA. Unlike other conserved DNA binding domains, Gata proteins appear to be restricted to binding consensus GATA sequences, or near variations, in DNA. Since the architecture of the Gata finger seems built around recognizing this particular sequence, we set out to define the allowable range of amino acid substitutions along the DNA-binding surface of a Gata finger that could continue to support sequence specific DNA binding activity. Accordingly, we set up a one-hybrid screen in yeast based on the chicken Gata-1 C-terminal zinc finger. Mutant libraries were generated at five amino acids identified in the Gata-DNA structure as likely to mediate sequence-specific contacts between the Gata finger and DNA. These libraries were designed to give as exhaustive amino acid coverage as possible such that almost all alternative amino acids were screened at each of the five probed positions. Screening and characterization of these libraries revealed several functional amino acid substitutions at two leucines which contact the DNA at the 3’ and 5’ flanks of the GATA binding site, but no functional substituents for amino acids near the core of the binding site. This pattern is consistent with amino acid sequences of known DNA-binding Gata fingers. PMID:18328814

  20. Genomic DNA Methylation Changes in Response to Folic Acid Supplementation in a Population-Based Intervention Study among Women of Reproductive Age

    PubMed Central

    Berry, Robert J.; Hao, Ling; Li, Zhu; Maneval, David; Yang, Thomas P.; Rasmussen, Sonja A.; Yang, Quanhe; Zhu, Jiang-Hui; Hu, Dale J.; Bailey, Lynn B.

    2011-01-01

    Folate is a source of one-carbons necessary for DNA methylation, a critical epigenetic modification necessary for genomic structure and function. The use of supplemental folic acid is widespread however; the potential influence on DNA methylation is unclear. We measured global DNA methylation using DNA extracted from samples from a population-based, double-blind randomized trial of folic acid supplementation (100, 400, 4000 µg per day) taken for 6 months; including a 3 month post-supplementation sample. We observed no changes in global DNA methylation in response to up to 4,000 µg/day for 6 months supplementation in DNA extracted from uncoagulated blood (approximates circulating blood). However, when DNA methylation was determined in coagulated samples from the same individuals at the same time, significant time, dose, and MTHFR genotype-dependent changes were observed. The baseline level of DNA methylation was the same for uncoagulated and coagulated samples; marked differences between sample types were observed only after intervention. In DNA from coagulated blood, DNA methylation decreased (−14%; P<0.001) after 1 month of supplementation and 3 months after supplement withdrawal, methylation decreased an additional 23% (P<0.001) with significant variation among individuals (max+17%; min-94%). Decreases in methylation of ≥25% (vs. <25%) after discontinuation of supplementation were strongly associated with genotype: MTHFR CC vs. TT (adjusted odds ratio [aOR] 12.9, 95%CI 6.4, 26.0). The unexpected difference in DNA methylation between DNA extracted from coagulated and uncoagulated samples in response to folic acid supplementation is an important finding for evaluating use of folic acid and investigating the potential effects of folic acid supplementation on coagulation. PMID:22163281

  1. Influence of amino acids Shiff bases on irradiated DNA stability in vivo.

    PubMed

    Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G

    2013-01-01

    To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.

  2. A modified acidic approach for DNA extraction from plant species containing high levels of secondary metabolites.

    PubMed

    Cavallari, M M; Siqueira, M V B M; Val, T M; Pavanelli, J C; Monteiro, M; Grando, C; Pinheiro, J B; Zucchi, M I; Gimenes, M A

    2014-08-25

    Purified genomic DNA can be difficult to obtain from some plant species because of the presence of impurities such as polysaccharides, which are often co-extracted with DNA. In this study, we developed a fast, simple, and low-cost protocol for extracting DNA from plants containing high levels of secondary metabolites. This protocol does not require the use of volatile toxic reagents such as mercaptoethanol, chloroform, or phenol and allows the extraction of high-quality DNA from wild and cultivated tropical species.

  3. The impact of α-hydrazino acids embedded in short fluorescent peptides on peptide interactions with DNA and RNA.

    PubMed

    Suć, Josipa; Tumir, Lidija-Marija; Glavaš-Obrovac, Ljubica; Jukić, Marijana; Piantanida, Ivo; Jerić, Ivanka

    2016-06-01

    A series of novel hydrazino-based peptidomimetics and analogues comprising N-terminal lysine and C-terminal phenanthridinyl-l-alanine were prepared. The presented results demonstrate the up to now unknown possibility to finely modulate peptide interactions with DNA/RNA by α-hydrazino group insertion and how the different positioning of two α-hydrazino groups in peptides controls binding to various double stranded and single stranded DNA and RNA. All peptidomimetics bind with 1-10 micromolar affinity to ds-DNA/RNA, whereby the binding mode is a combination of electrostatic interactions and hydrophobic interactions within DNA/RNA grooves. Insertion of the α-hydrazino group into the peptide systematically decreased its fluorimetric response to DNA/RNA binding in the order: mono-hydrazino < alternating-hydrazino < sequential-hydrazino group. Binding studies of ss-polynucleotides suggest intercalation of phenanthridine between polynucleotide bases, whereby affinity and fluorimetric response decrease with the number of α-hydrazino groups in the peptide sequence. Particularly interesting was the interaction of two sequential α-hydrazino acids-peptidomimetic with poly rG, characterised by a specific strong increase of CD bands, while all other peptide/ssRNA combinations gave only a CD-band decrease. All mentioned interactions could also be reversibly controlled by adjusting the pH, due to the protonation of the fluorophore. PMID:27161341

  4. Could humic acid relieve the biochemical toxicities and DNA damage caused by nickel and deltamethrin in earthworms (Eisenia foetida)?

    PubMed

    Shen, Chen-Chao; Shen, Dong-Sheng; Shentu, Jia-Li; Wang, Mei-Zhen; Wan, Ming-Yang

    2015-12-01

    The aim of the study was to determine whether humic acid (HA) prevented gene and biochemical toxic effects in earthworms (Eisenia foetida) exposed to nickel and deltamethrin (at 100 and 1 mg kg(-1), respectively) in soil. Cellular- and molecular-level toxic effects of nickel and deltamethrin in earthworms were evaluated by measuring damage to lipid membranes and DNA and the production of protein carbonyls over 42 days of exposure. Nickel and deltamethrin induced significant levels of oxidative stress in earthworms, increasing the production of peroxidation products (malondialdehyde and protein carbonyls) and increasing the comet assay tail DNA% (determined by single-cell gel electrophoresis). DNA damage was the most sensitive of the three indices because it gave a higher sample/control ratio than did the other indices. The presence of HA alleviated (in decreasing order of effectiveness) damage to DNA, proteins, and lipid membranes caused by nickel and deltamethrin. A low HA dose (0.5-1% HA in soil) prevented a great deal of lipid membrane damage, but the highest HA dose (3% HA in soil) prevented still more DNA damage. However, the malondialdehyde concentrations in earthworms were higher at the highest HA dose than at the lower HA doses. The amounts of protein carbonyls produced at different HA doses were not significantly different. The toxic effects to earthworms caused by increased oxidizable nickel concentrations could be relieved by adding HA.

  5. The impact of α-hydrazino acids embedded in short fluorescent peptides on peptide interactions with DNA and RNA.

    PubMed

    Suć, Josipa; Tumir, Lidija-Marija; Glavaš-Obrovac, Ljubica; Jukić, Marijana; Piantanida, Ivo; Jerić, Ivanka

    2016-06-01

    A series of novel hydrazino-based peptidomimetics and analogues comprising N-terminal lysine and C-terminal phenanthridinyl-l-alanine were prepared. The presented results demonstrate the up to now unknown possibility to finely modulate peptide interactions with DNA/RNA by α-hydrazino group insertion and how the different positioning of two α-hydrazino groups in peptides controls binding to various double stranded and single stranded DNA and RNA. All peptidomimetics bind with 1-10 micromolar affinity to ds-DNA/RNA, whereby the binding mode is a combination of electrostatic interactions and hydrophobic interactions within DNA/RNA grooves. Insertion of the α-hydrazino group into the peptide systematically decreased its fluorimetric response to DNA/RNA binding in the order: mono-hydrazino < alternating-hydrazino < sequential-hydrazino group. Binding studies of ss-polynucleotides suggest intercalation of phenanthridine between polynucleotide bases, whereby affinity and fluorimetric response decrease with the number of α-hydrazino groups in the peptide sequence. Particularly interesting was the interaction of two sequential α-hydrazino acids-peptidomimetic with poly rG, characterised by a specific strong increase of CD bands, while all other peptide/ssRNA combinations gave only a CD-band decrease. All mentioned interactions could also be reversibly controlled by adjusting the pH, due to the protonation of the fluorophore.

  6. Development of bis-locked nucleic acid (bisLNA) oligonucleotides for efficient invasion of supercoiled duplex DNA

    PubMed Central

    Moreno, Pedro M. D.; Geny, Sylvain; Pabon, Y. Vladimir; Bergquist, Helen; Zaghloul, Eman M.; Rocha, Cristina S. J.; Oprea, Iulian I.; Bestas, Burcu; Andaloussi, Samir EL; Jørgensen, Per T.; Pedersen, Erik B.; Lundin, Karin E.; Zain, Rula; Wengel, Jesper; Smith, C. I. Edvard

    2013-01-01

    In spite of the many developments in synthetic oligonucleotide (ON) chemistry and design, invasion into double-stranded DNA (DSI) under physiological salt and pH conditions remains a challenge. In this work, we provide a new ON tool based on locked nucleic acids (LNAs), designed for strand invasion into duplex DNA (DSI). We thus report on the development of a clamp type of LNA ON—bisLNA—with capacity to bind and invade into supercoiled double-stranded DNA. The bisLNA links a triplex-forming, Hoogsteen-binding, targeting arm with a strand-invading Watson–Crick binding arm. Optimization was carried out by varying the number and location of LNA nucleotides and the length of the triplex-forming versus strand-invading arms. Single-strand regions in target duplex DNA were mapped using chemical probing. By combining design and increase in LNA content, it was possible to achieve a 100-fold increase in potency with 30% DSI at 450 nM using a bisLNA to plasmid ratio of only 21:1. Although this first conceptual report does not address the utility of bisLNA for the targeting of DNA in a chromosomal context, it shows bisLNA as a promising candidate for interfering also with cellular genes. PMID:23345620

  7. Investigation of irradiated rats DNA in the presence of Cu(II) chelates of amino acids Schiff bases.

    PubMed

    Karapetyan, N H; Torosyan, A L; Malakyan, M; Bajinyan, S A; Haroutiunian, S G

    2016-01-01

    The new synthesized Cu(II) chelates of amino acids Schiff bases were studied as a potential radioprotectors. Male albino rats of Wistar strain were exposed to X-ray whole-body irradiation at 4.8 Gy. This dose caused 30% mortality of the animals (LD30). The survival of animals exposed to radiation after preliminary administration of 10 mg/kg Cu(II)(Nicotinyl-L-Tyrosinate)2 or Cu(II)(Nicotinyl-L-Tryptophanate)2 prior to irradiation was registered about 80 and 100% correspondingly. Using spectrophotometric melting and agarose gel electrophoresis methods, the differences between the DNA isolated from irradiated rats and rats pretreated with Cu(II) chelates were studied. The fragments of DNA with different breaks were revealed in DNA samples isolated from irradiated animals. While, the repair of the DNA structure was observed for animals pretreated with the Cu(II) chelates. The results suggested that pretreatment of the irradiated rats with Cu(II)(Nicotinyl-L-Tyrosinate)2 and Cu(II)(Nicotinyl-L-Tryptophanate)2 compounds improves the liver DNA characteristics.

  8. Label-free DNA biosensor based on a peptide nucleic acid-functionalized microstructured optical fiber-Bragg grating

    NASA Astrophysics Data System (ADS)

    Candiani, Alessandro; Bertucci, Alessandro; Giannetti, Sara; Konstantaki, Maria; Manicardi, Alex; Pissadakis, Stavros; Cucinotta, Annamaria; Corradini, Roberto; Selleri, Stefano

    2013-05-01

    We describe a novel sensing approach based on a functionalized microstructured optical fiber-Bragg grating for specific DNA target sequences detection. The inner surface of a microstructured fiber, where a Bragg grating was previously inscribed, has been functionalized by covalent linking of a peptide nucleic acid probe targeting a DNA sequence bearing a single point mutation implicated in cystic fibrosis (CF) disease. A solution of an oligonucleotide (ON) corresponding to a tract of the CF gene containing the mutated DNA has been infiltrated inside the fiber capillaries and allowed to hybridize to the fiber surface according to the Watson-Crick pairing. In order to achieve signal amplification, ON-functionalized gold nanoparticles were then infiltrated and used in a sandwich-like assay. Experimental measurements show a clear shift of the reflected high order mode of a Bragg grating for a 100 nM DNA solution, and fluorescence measurements have confirmed the successful hybridization. Several experiments have been carried out on the same fiber using the identical concentration, showing the same modulation trend, suggesting the possibility of the reuse of the sensor. Measurements have also been made using a 100 nM mismatched DNA solution, containing a single nucleotide mutation and corresponding to the wild-type gene, and the results demonstrate the high selectivity of the sensor.

  9. Could humic acid relieve the biochemical toxicities and DNA damage caused by nickel and deltamethrin in earthworms (Eisenia foetida)?

    PubMed

    Shen, Chen-Chao; Shen, Dong-Sheng; Shentu, Jia-Li; Wang, Mei-Zhen; Wan, Ming-Yang

    2015-12-01

    The aim of the study was to determine whether humic acid (HA) prevented gene and biochemical toxic effects in earthworms (Eisenia foetida) exposed to nickel and deltamethrin (at 100 and 1 mg kg(-1), respectively) in soil. Cellular- and molecular-level toxic effects of nickel and deltamethrin in earthworms were evaluated by measuring damage to lipid membranes and DNA and the production of protein carbonyls over 42 days of exposure. Nickel and deltamethrin induced significant levels of oxidative stress in earthworms, increasing the production of peroxidation products (malondialdehyde and protein carbonyls) and increasing the comet assay tail DNA% (determined by single-cell gel electrophoresis). DNA damage was the most sensitive of the three indices because it gave a higher sample/control ratio than did the other indices. The presence of HA alleviated (in decreasing order of effectiveness) damage to DNA, proteins, and lipid membranes caused by nickel and deltamethrin. A low HA dose (0.5-1% HA in soil) prevented a great deal of lipid membrane damage, but the highest HA dose (3% HA in soil) prevented still more DNA damage. However, the malondialdehyde concentrations in earthworms were higher at the highest HA dose than at the lower HA doses. The amounts of protein carbonyls produced at different HA doses were not significantly different. The toxic effects to earthworms caused by increased oxidizable nickel concentrations could be relieved by adding HA. PMID:26511644

  10. Ascorbic acid mobilizes endogenous copper in human peripheral lymphocytes leading to oxidative DNA breakage: a putative mechanism for anticancer properties.

    PubMed

    Bhat, Showket Hussain; Azmi, Asfar Sohail; Hanif, Sarmad; Hadi, S M

    2006-01-01

    Several decades back ascorbic acid was proposed as an effective anticancer agent. However, this idea remained controversial and the mechanism of action unclear. In this paper, we show that ascorbic acid at a concentration reported to be achievable through high doses of oral consumption is capable of cytotoxic action against normal cells. Several antioxidants of both animal as well as plant origin including ascorbic acid also possess prooxidant properties. Copper is an essential component of chromatin and can take part in redox reactions. Previously we have proposed a mechanism for the cytotoxic action of plant antioxidants against cancer cells that involves mobilization of endogenous copper ions and the consequent generation of reactive oxygen species. Using human peripheral lymphocytes and Comet assay we show here that ascorbic acid is able to cause oxidative DNA breakage in normal cells at a concentration of 100-200 microM. Neocuproine, a Cu(I) specific sequestering agent inhibited DNA breakage in a dose dependent manner indicating that Cu(I) is an intermediate in the DNA cleavage reaction. The results are in support of our above hypothesis that involves events that lead to a prooxidant action by antioxidants. The results would support the idea that even a plasma concentration of around 200 microM. would be sufficient to cause pharmacological tumor cell death particularly when copper levels are elevated. This would account for the observation of several decades back by Pauling and co-workers where oral doses of ascorbic acid in gram quantities were found to be effective in treating some cancers.

  11. DNA single strand breaks in peripheral lymphocytes associated with urinary thiodiglycolic acid levels in polyvinyl chloride workers.

    PubMed

    Lei, Yu-Chen; Yang, Huei-Ting; Ma, Yee-Chung; Huang, Ming-Feng; Chang, Wushou P; Cheng, Tsun-Jen

    2004-07-11

    The association between vinyl chloride monomer (VCM) exposure and DNA damage has been established. However, the relationship between individual exposure and DNA single strand breaks was limited. Since environmental monitoring may not reflect the actual exposure, a useful marker of exposure is needed to assess the individual exposure. In our previous study, we have found a high correlation between air VCM level and urinary thiodiglycolic acid (TdGA) at the commencement of the next shift. Here, we further used comet assay to evaluate the relationship between urinary TdGA levels and DNA single strand breaks in polyvinyl chloride monomer (PVC) workers. Urinary TdGA levels (n=26) at the commencement of the following shift were analyzed. Ten of the 26 workers also had personal air sampling for air VCM exposure. Questionnaires were administered to obtain epidemiological information including detailed history of occupation and lifestyles. Workers experiencing air VCM level greater than 5 ppm had higher tail moment and tail intensity (%) than those experiencing VCM exposure between 1 and 5, or <1 ppm, respectively (P < 0.05). The results also revealed that level of DNA single strand breaks, including tail moment and tail intensity, were increased with urinary TdGA level. The dose-response relationship of urinary TdGA level and DNA single strand breaks was particularly significant among the workers with 4 mg/g Cr of urinary TdGA level, which is equivalent to 5 ppm air VCM level. We concluded that air VCM exposure greater than 5 ppm could induce DNA damage. Further sensitive assay should be developed for the diction of DNA damage when air VCM exposure below 5 ppm.

  12. No difference in high-magnification morphology and hyaluronic acid binding in the selection of euploid spermatozoa with intact DNA

    PubMed Central

    Mongkolchaipak, Suchada; Vutyavanich, Teraporn

    2013-01-01

    In this study, we compared conventional sperm selection with high-magnification morphology based on the motile sperm organellar morphology examination (MSOME) criteria, and hyaluronic acid (HA) binding for sperm chromosome aneuploidy and DNA fragmentation rates. Semen from 50 severe male factor cases was processed through density gradient centrifugation, and subjected to sperm selection by using the conventional method (control), high magnification at ×6650 or HA binding. Aneuploidy was detected by fluorescence in situ hybridization with probes for chromosomes 13, 18, 21, X and Y, and DNA fragmentation by the terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) method. Spermatozoa selected under high-magnification had a lower DNA fragmentation rate (2.6% vs. 1.7% P=0.032), with no significant difference in aneuploidy rate (0.8% vs 0.7% P=0.583), than those selected by the HA binding method. Spermatozoa selected by both methods had much lower aneuploidy and DNA fragmentation rate than the controls (7% aneuploidy and 26.8% DNA fragmentation rates, respectively). In the high-magnification group, the aneuploidy rate was lower when the best spermatozoa were selected than when only the second-best spermatozoa were available for selection, but the DNA fragmentation rate was not different. In conclusion, sperm selection under high magnification was more effective than under HA binding in selecting spermatozoa with low DNA fragmentation rate, but the small difference (0.9%) might not be clinically meaningful. Both methods were better than the conventional method of sperm selection. PMID:23435468

  13. DNA-templated native chemical ligation of functionalized peptide nucleic acids: a versatile tool for single base-specific detection of nucleic acids.

    PubMed

    Roloff, Alexander; Ficht, Simon; Dose, Christian; Seitz, Oliver

    2014-01-01

    Single base-specific detection of DNA/RNA sequences is of importance in the diagnosis of disease-associated genetic disorders or early stage cancer. This chapter introduces DNA-templated native chemical PNA ligation as a potentially useful tool for the sequence specific detection of nucleic acids. The template-induced alignment of PNA-thioesters and 1,2-aminothiol-PNAs in close proximity leads to an increase in their effective molarities. This facilitates PNA ligation to proceed at concentrations where no reaction would be possible in absence of the template. Moreover, hybridization of the rather short PNA conjugates with non-complementary DNA/RNA is disfavored, which prevents PNA ligation to occur on single base-mismatched templates. Different readout strategies of the ligation reaction such as HPLC, MALDI-TOF-MS and fluorecence monitoring are discussed, and examples for the detection of a point mutation within single stranded and PCR-amplified double stranded DNA are provided.

  14. Poly(lactic acid)-poly(ethylene glycol) nanoparticles as new carriers for the delivery of plasmid DNA.

    PubMed

    Perez, C; Sanchez, A; Putnam, D; Ting, D; Langer, R; Alonso, M J

    2001-07-10

    The purpose of the present work was to produce and characterize poly(lactic acid)-poly(ethylene glycol) (PLA-PEG) nanoparticles (size lower than 300 nm) containing a high loading of plasmid DNA in a free form or co-encapsulated with either poly(vinyl alcohol) (PVA) or poly(vinylpyrrolidone) (PVP). The plasmid alone or with PVA or PVP was encapsulated by two different techniques: an optimized w/o/w emulsion-solvent evaporation technique as well as by a new w/o emulsion-solvent diffusion technique. Particle size, zeta potential, plasmid DNA loading and in vitro release were determined for the three plasmid-loaded formulations. The influence of the initial plasmid loadings (5, 10, 20 microg plasmid DNA/mg PLA-PEG) on those parameters was also investigated. The plasmid loaded into the nanoparticles and released in vitro was quantified by fluorimetry and the different molecular forms were identified by gel electrophoresis. PLA-PEG nanoparticles containing plasmid DNA in a free form or co-encapsulated with PVA or PVP were obtained in the range size of 150-300 nm and with a negative zeta potential, both parameters being affected by the preparation technique. Encapsulation efficiencies were high irrespective of the presence of PVA or PVP (60-90%) and were slightly affected by the preparation technique and by the initial loading. The final plasmid DNA loading in the nanoparticles was up to 10-12 microg plasmid DNA/mg polymer. Plasmid DNA release kinetics varied depending on the plasmid incorporation technique: nanoparticles prepared by the w/o diffusion technique released their content rapidly whereas those obtained by the w/o/w showed an initial burst followed by a slow release for at least 28 days. No significant influence of the plasmid DNA loading and of the co-encapsulation of PVP or PVA on the in vitro release rate was observed. In all cases the conversion of the supercoiled form to the open circular and linear forms was detected. In conclusion, plasmid DNA can be

  15. Many amino acid substitution variants identified in DNA repair genes during human population screenings are predicted to impact protein function

    SciTech Connect

    Xi, T; Jones, I M; Mohrenweiser, H W

    2003-11-03

    Over 520 different amino acid substitution variants have been previously identified in the systematic screening of 91 human DNA repair genes for sequence variation. Two algorithms were employed to predict the impact of these amino acid substitutions on protein activity. Sorting Intolerant From Tolerant (SIFT) classified 226 of 508 variants (44%) as ''Intolerant''. Polymorphism Phenotyping (PolyPhen) classed 165 of 489 amino acid substitutions (34%) as ''Probably or Possibly Damaging''. Another 9-15% of the variants were classed as ''Potentially Intolerant or Damaging''. The results from the two algorithms are highly associated, with concordance in predicted impact observed for {approx}62% of the variants. Twenty one to thirty one percent of the variant proteins are predicted to exhibit reduced activity by both algorithms. These variants occur at slightly lower individual allele frequency than do the variants classified as ''Tolerant'' or ''Benign''. Both algorithms correctly predicted the impact of 26 functionally characterized amino acid substitutions in the APE1 protein on biochemical activity, with one exception. It is concluded that a substantial fraction of the missense variants observed in the general human population are functionally relevant. These variants are expected to be the molecular genetic and biochemical basis for the associations of reduced DNA repair capacity phenotypes with elevated cancer risk.

  16. NDI and DAN DNA: Nucleic Acid-Directed Assembly of NDI and DAN

    PubMed Central

    2015-01-01

    Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI–DAN–NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A–T base pairs. PMID:24502543

  17. Optimal Arrangement of Four Short DNA Strands for Delivery of Immunostimulatory Nucleic Acids to Immune Cells.

    PubMed

    Ohtsuki, Shozo; Matsuzaki, Noriyuki; Mohri, Kohta; Endo, Masayuki; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Takahashi, Yuki; Ishiyama, Kenichi; Kadowaki, Norimitsu; Takakura, Yoshinobu; Nishikawa, Makiya

    2015-10-01

    Nanosized DNA assemblies are useful for delivering immunostimulatory cytosine-phosphate-guanine (CpG) DNA to immune cells, but little is known about the optimal structure for such delivery. In this study, we designed three different DNA nanostructures using four 55-mer oligodeoxynucleotides (ODNs), that is, tetrapod-like structured DNA (tetrapodna), tetrahedral DNA (tetrahedron), and tetragonal DNA (tetragon), and compared their potencies. Electrophoresis showed that tetrapodna was obtained with high yield and purity, whereas tetrahedron formed multimers at high ODN concentrations. Atomic force microscopy revealed that all preparations were properly constructed under optimal conditions. The thermal stability of tetrapodna was higher than those of the others. Dynamic light scattering analysis showed that all of the assemblies were about 8 nm in diameter. Upon addition to mouse macrophage-like RAW264.7 cells, tetrahedron was most efficiently taken up by the cells. Then, a CpG DNA, a ligand for toll-like receptor 9, was linked to these DNA nanostructures and added to RAW264.7 cells. CpG tetrahedron induced the largest amount of tumor necrosis factor-α, followed by CpG tetrapodna. Similar results were obtained using human peripheral blood mononuclear cells. Taken together, these results indicate that tetrapodna is the best assembly with the highest yield and high immunostimulatory activity, and tetrahedron can be another useful assembly for cellular delivery if its preparation yield is improved.

  18. The reactivation of DnaA(L366K) requires less acidic phospholipids supporting their role in the initiation of chromosome replication in Escherichia coli.

    PubMed

    Aranovich, Alexander; Parola, Abraham H; Fishov, Itzhak

    2007-09-18

    DnaA(L366K), in concert with a wild-type DnaA (wtDnaA) protein, restores the growth of Escherichia coli cells arrested in the absence of adequate levels of cellular acidic phospholipids. In vitro and in vivo studies showed that DnaA(L366K) alone does not induce the initiation of replication, and wtDnaA must also be present. Hitherto the different behavior of wt and mutant DnaA were not understood. We now demonstrate that this mutant may be activated at significantly lower concentrations of acidic phospholipids than the wild-type protein, and this may explain the observed growth restoration in vivo. PMID:17719583

  19. "Nano-oddities": unusual nucleic acid assemblies for DNA-based nanostructures and nanodevices.

    PubMed

    Yatsunyk, Liliya A; Mendoza, Oscar; Mergny, Jean-Louis

    2014-06-17

    CONSPECTUS: DNA is an attractive polymer building material for nanodevices and nanostructures due to its ability for self-recognition and self-assembly. Assembly relies on the formation of base-specific interactions that allow strands to adopt structures in a controllable fashion. Most DNA-based higher order structures such as DNA cages, 2D and 3D DNA crystals, or origamis are based on DNA double helices stabilized by Watson-Crick complementarity. A number of nonclassical pairing patterns are possible between or among DNA strands; these interactions result in formation of unusual structures that include, but are not limited to, G-quadruplexes, i-motifs, triplexes, and parallel-stranded duplexes. These structures create greater diversity of DNA-based building blocks for nanomaterials and have certain advantages over conventional duplex DNA, such as enhanced thermal stability and sensitivity to chemical stimuli. In this Account, we briefly introduce these alternative DNA structures and describe in detail their utilization in a variety of nanomaterials and nanomachines. The field of DNA "nano-oddities" emerged in the late 1990s when for the first time a DNA nanomachine was designed based on equilibrium between B-DNA and noncanonical, left-handed Z-DNA. Soon after, "proof-of-principle" DNA nanomachines based on several DNA "oddities" were reported. These machines were set in motion by the addition of complementary strands (a principle used by many B-DNA-based nanodevices), by the addition of selected cations, small molecules, or proteins, or by a change in pH or temperature. Today, we have fair understanding of the mechanism of action of these devices, excellent control over their performance, and knowledge of basic principles of their design. pH sensors and pH-controlled devices occupy a central niche in the field. They are usually based on i-motifs or triplex DNA, are amazingly simple, robust, and reversible, and create no waste apart from salt and water. G

  20. Canine amino acid transport system Xc(-): cDNA sequence, distribution and cystine transport activity in lens epithelial cells.

    PubMed

    Maruo, Takuya; Kanemaki, Nobuyuki; Onda, Ken; Sato, Reiichiro; Ichihara, Nobuteru; Ochiai, Hideharu

    2014-04-01

    The cystine transport activity of a lens epithelial cell line originated from a canine mature cataract was investigated. The distinct cystine transport activity was observed, which was inhibited to 28% by extracellular 1 mM glutamate. The cDNA sequences of canine cysteine/glutamate exchanger (xCT) and 4F2hc were determined. The predicted amino acid sequences were 527 and 533 amino acid polypeptides, respectively. The amino acid sequences of canine xCT and 4F2hc showed high similarities (>80%) to those of humans. The expression of xCT in lens epithelial cell line was confirmed by western blot analysis. RT-PCR analysis revealed high level expression only in the brain, and it was below the detectable level in other tissues.

  1. [Composites of peptide nucleic acids with titanium dioxide nanoparticles. II+. Dissociation of DNA/PNA duplexes within TiO2 x polylysine x DNA/PNA nanocomposites and in solution. Effect of polylysine].

    PubMed

    Amirkhanov, R N; Zarytova, V F; Amirkhanov, N F

    2013-01-01

    When creating effective drugs it is important not only to transport them into the cells, but also important to have the possibility of release them from the "transporter" after delivery into the cell. It was shown that peptide nucleic acids (PNA) in nanocomposite TiO2 x PL x DNA/PNA dissociate with typical shape of the thermal denaturation curve, and polylysine (PL) in the nanocomposite has practically no effect on the dissociation of the DNA/PNA duplexes. These data suggest that the PNA in the nanocomposite TiO2 x PL x DNA/PNA have been immobilized reversible and able to dissociate and be released from TiO2-carrier into solution. In contrast that, the dissociation of DNA/DNA and DNA/PNA duplexes in physiological solution at the presence of PL--was not observed. PL in solution abnormally strong influences on the nature of the optical density dependence on temperature and time for D-duplexes and in a less degree--for P-duplexes. It has been suggested, that PL with DNA/DNA duplexes in physiological solution forms triple polycomplexes (-DNA/DNA x PL)m, consisting of several (m) chains of PL connected with DNA/DNA duplexes. And such polycomplexes able to aggregate and precipitate. PL in solution can interact with DNA/PNA duplexes to form monocomplexes PL x (DNA/PNA)n consisting of one chain PL and one or more (n) DNA/PNA duplexes that do not precipitate, however the dissociation of DNA/PNA duplexes from such monocomplexes is difficult.

  2. Analysis of several methods for the extraction of high quality DNA from acetic acid bacteria in wine and vinegar for characterization by PCR-based methods.

    PubMed

    Jara, C; Mateo, E; Guillamón, J M; Torija, M J; Mas, A

    2008-12-10

    Acetic acid bacteria (AAB) are fastidious microorganisms with poor recovery in culture. Culture-independent methods are currently under examination. Good DNA extraction is a strict requirement of these methods. We compared five methods for extracting the DNA of AAB directly from wine and vinegar samples. Four matrices (white wine, red wine, superficial vinegar and submerged vinegar) contaminated with two AAB strains belonging to Acetobacter pasteurianus and Gluconacetobacter hansenii were assayed. To improve the yield and quality of the extracted DNA, a sample treatment (washing with polyvinyl pyrrolidone or NaCl) was also tested. DNA quality was measured by amplification of the 16S rRNA gene with conventional PCR. DNA recovery rate was assessed by real-time PCR. DNA amplification was always successful with the Wizard method though DNA recovery was poor. A CTAB-based method and NucleoSpin protocol extracted the highest DNA recoveries from wine and vinegar samples. Both of these methods require treatment to recover suitable DNA for amplification with maximum recovery. Both may therefore be good solutions for DNA extraction in wine and vinegar samples. DNA extraction of Ga hansenii was more effective than that of A. pasteurianus. The fastest and cheapest method we evaluated (the Thermal shock protocol) produced the worst results both for DNA amplification and DNA recovery.

  3. [Effects of cinnamic acid on bacterial DNA polymorphism in rhizosphere soil of cucumber under NaCl stress].

    PubMed

    Liu, Jing; Wu, Feng-Zhi; Yang, Yang; Liu, Shou-Wei; Pan, Kai

    2010-03-01

    By using PCR-DGGE technique, this paper studied the effects of different concentration (0, 25, 50, 100, and 200 mg x kg(-1) soil) cinnamic acid on the bacterial DNA polymorphism in rhizosphere soil of cucumber seedlings under the stress of 292.5 and 585 mg NaCl x kg(-1) soil. At all growth stages of cucumber seedlings, treatment 50 mg x kg(-1) of cinnamic acid had the similar band numbers and band gray scales in DGGE profiles to treatment 0 mg x kg(-1) of cinnamic acid, but the diversity index, richness index, and evenness index were the highest; while in treatments 100 and 200 mg x kg(-1) soil of cinnamic acid, the band numbers and band gray scales decreased, and the diversity index, richness index, and evenness index were lower. Our results demonstrated that low concentration cinnamic acid relieved the salt stress on soil microbes, while high concentration cinnamic acid aggravated the stress. The cloning and sequencing results showed that the main bacterial groups affected by salt stress were uncultured bacterial species, alpha-Proteobacteria, beta-proteobacteria, and gamma-proteobacteria, and a few were Firmicutes, Acidobacteria, and Actinobacteria.

  4. Identification of genes expressed in response to acid stress in Synechocystis sp. PCC 6803 using DNA microarrays.

    PubMed

    Ohta, Hisataka; Shibata, Yousuke; Haseyama, Youhei; Yoshino, Yuka; Suzuki, Takehiro; Kagasawa, Tsuyoshi; Kamei, Ayako; Ikeuchi, Masahiko; Enami, Isao

    2005-06-01

    Plant cells are always exposed to various environmental stresses such as high light, low temperature and acid rain, and thus have to respond in order to survive these stresses. Although some mechanisms of responses to high light and low temperature etc., have been clarified, there is little information about the acclimation process to acid stress. In this study, the gene expression changes of Synechocystis sp. PCC 6803 in response to acid stress were examined using DNA microarrays (CyanoCHIP). We compared gene expression profiles of the cells treated at pH 8 (control) and pH 3 for 0.5, 1, 2 or 4 h. As a result, we found that 32 genes were upregulated by more than 3-fold, and 29 genes were downregulated by at least 3-fold after the acid treatment. Among these upregulated genes, expressions of slr0967 and sll0939 kept-increasing until 4 h under the acid stress and increased by 7 to 16-fold after the 4 h treatment. This suggests that the products of these two genes play important roles in the acid acclimation process.

  5. Molecular aspects on the interaction of phenosafranine to deoxyribonucleic acid: Model for intercalative drug DNA binding

    NASA Astrophysics Data System (ADS)

    Das, Suman; Kumar, Gopinatha Suresh

    2008-01-01

    The mode, mechanism and energetics of interaction of phenosafranine, the planar, cationic and rigid phenazium dye to calf thymus DNA was investigated from absorption, fluorescence, circular dichroism, isothermal titration calorimetry, thermal melting, and viscosity. The study revealed non-cooperative binding of the dye to DNA with an affinity in the range (3.81-4.22) × 10 5 M -1 as observed from diverse techniques and obeying neighbor exclusion principle. The stoichiometry of binding was characterized to be one phenosafranine molecule per two base pairs. The binding was characterized by strong stabilization of DNA against thermal strand separation, large intrinsic circular dichroic changes of DNA by itself and the generation of induced circular dichroism for the optically inactive phenosafranine molecules. Hydrodynamic and fluorescence quenching studies revealed strong evidence that the phenosafranine molecules are intercalated between every alternate base pairs of calf thymus DNA. Isothermal titration calorimetry studies suggested that the binding was exothermic and favoured by both negative enthalpy and positive entropy changes. This study for the first time presents the complete molecular aspects and energetics of phenosafranine complexation to DNA as model for intercalative drug-DNA interaction.

  6. Perfluorooctanoic acid (PFOA) but not perfluorooctane sulfonate (PFOS) showed DNA damage in comet assay on Paramecium caudatum.

    PubMed

    Kawamoto, Kosuke; Oashi, Takahiro; Oami, Kazunori; Liu, Wei; Jin, Yihe; Saito, Norimitsu; Sato, Itaru; Tsuda, Shuji

    2010-12-01

    Persistent perfluorinated organic compounds such as perfluorooctane sulfonate (PFOS) and perfluorooctanoic acid (PFOA) are distributed widely in the global environment including wildlife and human. In this study, we investigated the genotoxicity of PFOS and PFOA using the novel in vivo comet assay developed for Paramecium caudatum. For the comet assay, large nuclei squeezed out of the paramecia with 0.25 M sucrose containing 0.6% Triton X-100 were embedded in a layer of agarose gel placed over the slide glass. N-methyl-N´-nitro-N-nitrosoguanidine (MNNG) and 2-aminoanthracene (2-AA) were successfully used for positive controls. Productions of 8-hydroxydeoxyguanosine (8-OH-dG) and intracellular reactive oxygen species (ROS) were also measured in paramecia. PFOS did not cause DNA damage on any conditions examined. On the other hand, 12 and 24 hr exposure to PFOA (100 µM) increased DNA migration in electrophoresis condition at pH 13, but not at pH 12.1, suggesting that the DNA damage may be alkali labile site (such as apurinic/apyrimidinic (AP) site). Exposure of paramecia to 100 µM PFOA for 1, 3 and 24 hr and to 10 µM PFOA for 24 hr significantly increased intracellular ROS. Under the same condition, however, 8-OH-dG level was not affected by PFOA. The PFOA-induced DNA damage was not abolished by the application of 100 µM GSH which completely inhibited the increase of intracellular ROS. In conclusion, the PFOA-induced in vivo DNA damage was first shown in paramecia, and the DNA damage might not be directly attributable to increase in intracellular ROS.

  7. Punicalagin and Ellagic Acid Demonstrate Antimutagenic Activity and Inhibition of Benzo[a]pyrene Induced DNA Adducts

    PubMed Central

    Zahin, Maryam; Ahmad, Iqbal; Gupta, Ramesh C.; Aqil, Farrukh

    2014-01-01

    Punicalagin (PC) is an ellagitannin found in the fruit peel of Punica granatum. We have demonstrated antioxidant and antigenotoxic properties of Punica granatum and showed that PC and ellagic acid (EA) are its major constituents. In this study, we demonstrate the antimutagenic potential, inhibition of BP-induced DNA damage, and antiproliferative activity of PC and EA. Incubation of BP with rat liver microsomes, appropriate cofactors, and DNA in the presence of vehicle or PC and EA showed significant inhibition of the resultant DNA adducts, with essentially complete inhibition (97%) at 40 μM by PC and 77% inhibition by EA. Antimutagenicity was tested by Ames test. PC and EA dose-dependently and markedly antagonized the effect of tested mutagens, sodium azide, methyl methanesulfonate, benzo[a]pyrene, and 2-aminoflourine, with maximum inhibition of mutagenicity up to 90 percent. Almost all the doses tested (50–500 μM) exhibited significant antimutagenicity. A profound antiproliferative effect on human lung cancer cells was also shown with PC and EA. Together, our data show that PC and EA are pomegranate bioactives responsible for inhibition of BP-induced DNA adducts and strong antimutagenic, antiproliferative activities. However, these compounds are to be evaluated in suitable animal model to assess their therapeutic efficacy against cancer. PMID:24949451

  8. Signal amplification architecture for electrochemical aptasensor based on network-like thiocyanuric acid/gold nanoparticle/ssDNA.

    PubMed

    Chen, Zhengbo; Li, Lidong; Tian, Yu; Mu, Xiaojiao; Guo, Lin

    2012-01-01

    In this work, we described signal amplification architecture for electronic aptamer-based sensor (E-AB), which is applicable to a wide range of aptamers. Herein, we only take lysozyme as the representative sensing target. The amplification method was based on the network of thiocyanuric acid (TCA)/gold nanoparticles (AuNPs) modified with ssDNA. The binding event can be detected by a decrease in the integrated charge of the surface-bound [Ru(NH(3))(6)](3+) which electrostatically absorbed onto the negatively charged phosphate backbones of DNA. In the presence of target molecules, a large amount of TCA/AuNP/ssDNA network associated with [Ru(NH(3))(6)](3+) would be removed from the electrode surface, leading to a significant decrease of redox current. Cyclic voltammetry (CV) signals of [Ru(NH(3))(6)](3+) provides quantitative measures of the concentrations of lysozyme, with a linear calibration ranging from 5 pM to 1 nM and a detection limit is 0.1 pM. The detection limit of the proposed sensor is one order of magnitude and three orders of magnitude more sensitive than the detection limits in the absence of TCA (5 pM) and in the absence of TCA/AuNP/ssDNA network (0.5 nM). This amplification method is promising for broad potential application in clinic assay and various protein analysis.

  9. Computational Investigation of Locked Nucleic Acid (LNA) Nucleotides in the Active Sites of DNA Polymerases by Molecular Docking Simulations

    PubMed Central

    Poongavanam, Vasanthanathan; Madala, Praveen K.; Højland, Torben; Veedu, Rakesh N.

    2014-01-01

    Aptamers constitute a potential class of therapeutic molecules typically selected from a large pool of oligonucleotides against a specific target. With a scope of developing unique shorter aptamers with very high biostability and affinity, locked nucleic acid (LNA) nucleotides have been investigated as a substrate for various polymerases. Various reports showed that some thermophilic B-family DNA polymerases, particularly KOD and Phusion DNA polymerases, accepted LNA-nucleoside 5′-triphosphates as substrates. In this study, we investigated the docking of LNA nucleotides in the active sites of RB69 and KOD DNA polymerases by molecular docking simulations. The study revealed that the incoming LNA-TTP is bound in the active site of the RB69 and KOD DNA polymerases in a manner similar to that seen in the case of dTTP, and with LNA structure, there is no other option than the locked C3′-endo conformation which in fact helps better orienting within the active site. PMID:25036012

  10. Crosslink Mapping at Amino Acid-Base Resolution Reveals the Path of Scrunched DNA in Initial Transcribing Complexes.

    PubMed

    Winkelman, Jared T; Winkelman, Bradford T; Boyce, Julian; Maloney, Michael F; Chen, Albert Y; Ross, Wilma; Gourse, Richard L

    2015-09-01

    RNA polymerase binds tightly to DNA to recognize promoters with high specificity but then releases these contacts during the initial stage of transcription. We report a site-specific crosslinking approach to map the DNA path in bacterial transcription intermediates at amino acid and nucleotide resolution. After validating the approach by showing that the DNA path in open complexes (RPO) is the same as in high-resolution X-ray structures, we define the path following substrate addition in "scrunched" complexes (RPITC). The DNA bulges that form within the transcription bubble in RPITC are positioned differently on the two strands. Our data suggest that the non-template strand bulge is extruded into solvent in complexes containing a 5-mer RNA, whereas the template strand bulge remains within the template strand tunnel, exerting stress on interactions between the β flap, β' clamp, and σ3.2. We propose that this stress contributes to σ3.2 displacement from the RNA exit channel, facilitating promoter escape. PMID:26257284

  11. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett’s Esophageal Adenocarcinoma Cells

    PubMed Central

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett’s patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  12. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett's Esophageal Adenocarcinoma Cells.

    PubMed

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett's esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett's patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  13. A structure-specific nucleic acid-binding domain conserved among DNA repair proteins

    PubMed Central

    Mason, Aaron C.; Rambo, Robert P.; Greer, Briana; Pritchett, Michael; Tainer, John A.; Cortez, David; Eichman, Brandt F.

    2014-01-01

    SMARCAL1, a DNA remodeling protein fundamental to genome integrity during replication, is the only gene associated with the developmental disorder Schimke immuno-osseous dysplasia (SIOD). SMARCAL1-deficient cells show collapsed replication forks, S-phase cell cycle arrest, increased chromosomal breaks, hypersensitivity to genotoxic agents, and chromosomal instability. The SMARCAL1 catalytic domain (SMARCAL1CD) is composed of an SNF2-type double-stranded DNA motor ATPase fused to a HARP domain of unknown function. The mechanisms by which SMARCAL1 and other DNA translocases repair replication forks are poorly understood, in part because of a lack of structural information on the domains outside of the common ATPase motor. In the present work, we determined the crystal structure of the SMARCAL1 HARP domain and examined its conformation and assembly in solution by small angle X-ray scattering. We report that this domain is conserved with the DNA mismatch and damage recognition domains of MutS/MSH and NER helicase XPB, respectively, as well as with the putative DNA specificity motif of the T4 phage fork regression protein UvsW. Loss of UvsW fork regression activity by deletion of this domain was rescued by its replacement with HARP, establishing the importance of this domain in UvsW and demonstrating a functional complementarity between these structurally homologous domains. Mutation of predicted DNA-binding residues in HARP dramatically reduced fork binding and regression activities of SMARCAL1CD. Thus, this work has uncovered a conserved substrate recognition domain in DNA repair enzymes that couples ATP-hydrolysis to remodeling of a variety of DNA structures, and provides insight into this domain’s role in replication fork stability and genome integrity. PMID:24821763

  14. Solution Preserves Nucleic Acids in Body-Fluid Specimens

    NASA Technical Reports Server (NTRS)

    Pierson, Duane L.; Stowe, Raymond P.

    2004-01-01

    A solution has been formulated to preserve deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) in specimens of blood, saliva, and other bodily fluids. Specimens of this type are collected for diagnostic molecular pathology, which is becoming the method of choice for diagnosis of many diseases. The solution makes it possible to store such specimens at room temperature, without risk of decomposition, for subsequent analysis in a laboratory that could be remote from the sampling location. Thus, the solution could be a means to bring the benefits of diagnostic molecular pathology to geographic regions where refrigeration equipment and diagnostic laboratories are not available. The table lists the ingredients of the solution. The functions of the ingredients are the following: EDTA chelates divalent cations that are necessary cofactors for nuclease activity. In so doing, it functionally removes these cations and thereby retards the action of nucleases. EDTA also stabilizes the DNA helix. Tris serves as a buffering agent, which is needed because minor contaminants in an unbuffered solution can exert pronounced effects on pH and thereby cause spontaneous degradation of DNA. SDS is an ionic detergent that inhibits ribonuclease activity. SDS has been used in some lysis buffers and as a storage buffer for RNA after purification. The use of the solution is straightforward. For example, a sample of saliva is collected by placing a cotton roll around in the subject's mouth until it becomes saturated, then the cotton is placed in a collection tube. Next, 1.5 mL of the solution are injected directly into the cotton and the tube is capped for storage at room temperature. The effectiveness of the solution has been demonstrated in tests on specimens of saliva containing herpes simplex virus. In the tests, the viral DNA, as amplified by polymerase chain reaction, was detected even after storage for 120 days.

  15. Transcriptional activation by TFIIB mutants that are severely impaired in interaction with promoter DNA and acidic activation domains.

    PubMed Central

    Chou, S; Struhl, K

    1997-01-01

    Biochemical experiments indicate that the general transcription factor IIB (TFIIB) can interact directly with acidic activation domains and that activators can stimulate transcription by increasing recruitment of TFIIB to promoters. For promoters at which recruitment of TFIIB to promoters is limiting in vivo, one would predict that transcriptional activity should be particularly sensitive to TFIIB mutations that decrease the association of TFIIB with promoter DNA and/or with activation domains; i.e., such TFIIB mutations should exacerbate a limiting step that occurs in wild-type cells. Here, we describe mutations on the DNA-binding surface of TFIIB that severely affect both TATA-binding protein (TBP)-TFIIB-TATA complex formation and interaction with the VP16 activation domain in vitro. These TFIIB mutations affect the stability of the TBP-TFIIB-TATA complex in vivo because they are synthetically lethal in combination with TBP mutants impaired for TFIIB binding. Interestingly, these TFIIB derivatives support viability, and they efficiently respond to Gal4-VP16 and natural acidic activators in different promoter contexts. These results suggest that in vivo, recruitment of TFIIB is not generally a limiting step for acidic activators. However, one TFIIB derivative shows reduced transcription of GAL4, suggesting that TFIIB may be limiting at a subset of promoters in vivo. PMID:9372910

  16. DNA from uncultured organisms as a source of 2,5-diketo-L-gluconic acid reductases.

    SciTech Connect

    Eschenfeldt, W. H.; Stols, L.; Rosenbaum, H.; Khambatta, Z. S.; Quaite, E. R.; Wu, S.; Kilgore, D. C.; Trent, J. D.; Donnelly, M. I.; Genencor International; Eastman Chemical Company

    2001-09-01

    Total DNA of a population of uncultured organisms was extracted from soil samples, and by using PCR methods, the genes encoding two different 2,5-diketo-D-gluconic acid reductases (DKGRs) were recovered. Degenerate PCR primers based on published sequence information gave internal gene fragments homologous to known DKGRs. Nested primers specific for the internal fragments were combined with random primers to amplify flanking gene fragments from the environmental DNA, and two hypothetical full-length genes were predicted from the combined sequences. Based on these predictions, specific primers were used to amplify the two complete genes in single PCRs. These genes were cloned and expressed in Escherichia coli. The purified gene products catalyzed the reduction of 2,5-diketo-D-gluconic acid to 2-keto-L-gulonic acid. Compared to previously described DKGRs isolated from Corynebacterium spp., these environmental reductases possessed some valuable properties. Both exhibited greater than 20-fold-higher k{sub cat}/K{sub m} values than those previously determined, primarily as a result of better binding of substrate. The K{sub m} values for the two new reductases were 57 and 67 {mu}M, versus 2 and 13 mM for the Corynebacterium enzymes. Both environmental DKGRs accepted NADH as well as NADPH as a cosubstrate; other DKGRs and most related aldo-keto reductases use only NADPH. In addition, one of the new reductases was more thermostable than known DKGRs.

  17. A Spherical Nucleic Acids Platform Based on Self-Assembled DNA Biopolymer for High Performance Cancer Therapy

    PubMed Central

    Zheng, Jing; Zhu, Guizhi; Li, Yinhui; Li, Chunmei; You, Mingxu; Chen, Tao; Song, Erqun

    2013-01-01

    Based on their enhanced cellular uptake, stability, biocompatibility, and versatile surface functionalization, spherical nucleic acids (SNAs) have become a potentially useful platform in biological application. It still remains important to expand the SNAs “toolbox”, especially given the current interest in multimodal or theranostic nanomaterials, that is, composites capable of multiple simultaneous applications such as imaging, sensing, and drug delivery. In this paper, we have engineered a nanoparticle-conjugated initiator that triggers a cascade of hybridization reaction resulting in the formation of a long DNA polymer as the nanoparticle shell. By employing different DNA fragments, self-assembled multifunctional SNAs can be constructed. Therefore, using one capped ligand, these SNAs can combine imaging fluorescent tags, target recognition element, and targeted delivery molecules together. Since these SNAs possess high drug loading capacity and high specificity by the incorporation of an aptamer, our approach might find potential applications in new drug development, existing drug improvement, and drug delivery for cancer therapy. PMID:23841478

  18. Evaluation of deoxyribonucleic acid (DNA) isolated from human bloodstains exposed to ultraviolet light, heat, humidity, and soil contamination

    SciTech Connect

    McNally, L.; Shaler, R.C.; Baird, M.; Balazs, I.; De Forest, P.; Kobilinsky, L. )

    1989-09-01

    This study was designed to analyze the effects of common environmental insults on the ability to obtain deoxyribonucleic acid (DNA) restriction fragment-length polymorphisms (RFLP) patterns from laboratory prepared specimens. The environmental conditions studied include the exposure of dried bloodstains to varying amounts of relative humidity (0, 33, 67, and 98%), heat (37{degree}C), and ultraviolet light for periods of up to five days. In addition, the effect of drying over a four-day period in whole blood collected with and without ethylenediaminetetraacetate (EDTA) was examined. The results of the study showed that, under the conditions studied, the integrity of DNA is not altered such that false RFLP patterns are obtained. The only effect observed was that the overall RFLP pattern becomes weaker, but individual RFLP fragments are neither created nor destroyed.

  19. Fabrication, characterization, and biological assessment of multilayer DNA coatings on sandblasted-dual acid etched titanium surface.

    PubMed

    Liu, Li; Song, Li-Na; Yang, Guo-Li; Zhao, Shi-Fang; He, Fu-Ming

    2011-06-01

    As local gene therapy has received attention, immobilizing functional gene onto irregular oral implant surface has become an advanced challenge. Electrostatic layer-by-layer (LBL) assembly technique could achieve this goal and allow local and efficient administration of genes to the target cells. In this study, multilayers of cationic lipid/plasmid DNA (pEGFP-C1) complex (LDc) and anionic hyaluronic acid were assembled onto sandblasted-dual acid etched titanium disks by the LBL technique. Surface characteristics of the coatings were performed by x-ray photospectroscopy (XPS), contact angle measurements, and scanning electron microscopy (SEM). The cell biological characteristics of the coatings were evaluated by in vitro experiments. SEM results demonstrated that the porous titanium surface was gradually flattened with the increase of the multilayer. The XPS survey indicated that the N element was found from the coating. The coating degradation and pEGFP-C1 releasing kinetics showed that the more assembled layer numbers were, the larger the amount of DNA released in the first 30 h. MC3T3-E1 cells were cultured directly on the DNA-loaded surface. Higher enhanced green fluorescent protein (EGFP) expression efficiency was achieved by increasing the number of layers when cells were cultured after 24 or 72 h. The MC3T3-E1 cell viability on the surface of multilayer DNA coatings was significantly higher than that on control porous titanium surface. It was concluded that the approach established by the LBL technique had great potential in immobilizing gene coatings onto the porous titanium surface and subsequently influenced the function of the cultured cell. PMID:21448994

  20. Disentangling the perturbational effects of amino acid substitutions in the DNA-binding domain of p53.

    PubMed

    Wacey, A I; Cooper, D N; Liney, D; Hovig, E; Krawczak, M

    1999-01-01

    The spectrum of somatic cancer-associated missense mutations in the human TP53 gene was studied in order to assess the potential structural and functional importance of various intra-molecular properties associated with these substitutions. Relating the observed frequency of particular amino acid substitutions in the p53 DNA-binding domain to their expected frequency, as calculated from DNA sequence-dependent mutation rates, yielded estimates of their relative clinical observation likelihood (RCOL). Several biophysical properties were found to display significant covariation with RCOL values. Thus RCOL values were observed to decrease with increasing solvent accessibility of the substituted residue and with increasing distance from the p53 DNA-binding and Zn2+ -binding sites. The number of adverse steric interactions introduced by an amino acid replacement was found to be positively correlated with its RCOL value, irrespective of the magnitude of the interactions. A gain in hydrogen bond number was found to be only half as likely to come to clinical attention as mutations involving either a reduction or no change in hydrogen bond number. When the difference in potential energy between the wild-type and mutant DNA-binding domains was considered, RCOL values exhibited a minimum around changes of zero. Finally, classification of mutated residues in terms of their protein/solvent environment yielded, for somatic p53 mutations, RCOL values that resembled those previously determined for inherited mutations of human factor IX causing haemophilia B, suggesting that similar mechanisms may be responsible for the mutation-related perturbation of biological function in different protein folds.

  1. Natural DNA-modified graphene/Pd nanoparticles as highly active catalyst for formic acid electro-oxidation and for the Suzuki reaction.

    PubMed

    Qu, Konggang; Wu, Li; Ren, Jinsong; Qu, Xiaogang

    2012-09-26

    Natural DNA has been considered as a building block for developing novel functional materials. It is abundant, renewable, and biodegradable and has a well-defined structure and conformation with many unique features, which are difficult to find in other polymers. Herein, calf thymus DNA modified graphene/Pd nanoparticle (DNA-G-Pd) hybrid materials are constructed for the first time using DNA as a mediator, and the prepared DNA-G-Pd hybrid shows high catalytic activity for fuel cell formic acid electro-oxidation and for organic Suzuki reaction. The main advantages of using DNA are not only because the aromatic nucleobases in DNA can interact through π-π stacking with graphene basal surface but also because they can chelate Pd via dative bonding in such defined sites along the DNA lattice. Our results indicate that isolated, homogeneous, and ultrafine spherical Pd nanoparticles are densely in situ decorated on DNA-modified graphene surfaces with high stability and dispersibility. The prepared DNA-G-Pd hybrid has much greater activity and durability for formic acid electro-oxidation than the commercial Pd/C catalyst and polyvinylpyrrolidone-mediated graphene/Pd nanoparticle (PVP-G-Pd) hybrid used for direct formic acid fuel cells (DFAFCs). Besides, the DNA-G-Pd hybrid can also be an efficient and recyclable catalyst for the organic Suzuki reaction in aqueous solution under aerobic conditions without any preactivation. Since DNA can chelate various transition metal cations, this proof-of-concept protocol provides the possibility for the tailored design of other novel catalytic materials based on graphene with full exploitation of their properties.

  2. Natural DNA-modified graphene/Pd nanoparticles as highly active catalyst for formic acid electro-oxidation and for the Suzuki reaction.

    PubMed

    Qu, Konggang; Wu, Li; Ren, Jinsong; Qu, Xiaogang

    2012-09-26

    Natural DNA has been considered as a building block for developing novel functional materials. It is abundant, renewable, and biodegradable and has a well-defined structure and conformation with many unique features, which are difficult to find in other polymers. Herein, calf thymus DNA modified graphene/Pd nanoparticle (DNA-G-Pd) hybrid materials are constructed for the first time using DNA as a mediator, and the prepared DNA-G-Pd hybrid shows high catalytic activity for fuel cell formic acid electro-oxidation and for organic Suzuki reaction. The main advantages of using DNA are not only because the aromatic nucleobases in DNA can interact through π-π stacking with graphene basal surface but also because they can chelate Pd via dative bonding in such defined sites along the DNA lattice. Our results indicate that isolated, homogeneous, and ultrafine spherical Pd nanoparticles are densely in situ decorated on DNA-modified graphene surfaces with high stability and dispersibility. The prepared DNA-G-Pd hybrid has much greater activity and durability for formic acid electro-oxidation than the commercial Pd/C catalyst and polyvinylpyrrolidone-mediated graphene/Pd nanoparticle (PVP-G-Pd) hybrid used for direct formic acid fuel cells (DFAFCs). Besides, the DNA-G-Pd hybrid can also be an efficient and recyclable catalyst for the organic Suzuki reaction in aqueous solution under aerobic conditions without any preactivation. Since DNA can chelate various transition metal cations, this proof-of-concept protocol provides the possibility for the tailored design of other novel catalytic materials based on graphene with full exploitation of their properties. PMID:22973944

  3. DNA Sequence and Expression Variation of Hop (Humulus lupulus) Valerophenone Synthase (VPS), a Key Gene in Bitter Acid Biosynthesis

    PubMed Central

    Castro, Consuelo B.; Whittock, Lucy D.; Whittock, Simon P.; Leggett, Grey; Koutoulis, Anthony

    2008-01-01

    Background The hop plant (Humulus lupulus) is a source of many secondary metabolites, with bitter acids essential in the beer brewing industry and others having potential applications for human health. This study investigated variation in DNA sequence and gene expression of valerophenone synthase (VPS), a key gene in the bitter acid biosynthesis pathway of hop. Methods Sequence variation was studied in 12 varieties, and expression was analysed in four of the 12 varieties in a series across the development of the hop cone. Results Nine single nucleotide polymorphisms (SNPs) were detected in VPS, seven of which were synonymous. The two non-synonymous polymorphisms did not appear to be related to typical bitter acid profiles of the varieties studied. However, real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of VPS expression during hop cone development showed a clear link with the bitter acid content. The highest levels of VPS expression were observed in two triploid varieties, ‘Symphony’ and ‘Ember’, which typically have high bitter acid levels. Conclusions In all hop varieties studied, VPS expression was lowest in the leaves and an increase in expression was consistently observed during the early stages of cone development. PMID:18519445

  4. Maternal folic acid supplementation modulates DNA methylation and gene expression in the rat offspring in a gestation period-dependent and organ-specific manner.

    PubMed

    Ly, Anna; Ishiguro, Lisa; Kim, Denise; Im, David; Kim, Sung-Eun; Sohn, Kyoung-Jin; Croxford, Ruth; Kim, Young-In

    2016-07-01

    Maternal folic acid supplementation can alter DNA methylation and gene expression in the developing fetus, which may confer disease susceptibility later in life. We determined which gestation period and organ were most sensitive to the modifying effect of folic acid supplementation during pregnancy on DNA methylation and gene expression in the offspring. Pregnant rats were randomized to a control diet throughout pregnancy; folic acid supplementation at 2.5× the control during the 1st, 2nd or 3rd week of gestation only; or folic acid supplementation throughout pregnancy. The brain, liver, kidney and colon from newborn pups were analyzed for folate concentrations, global DNA methylation and gene expression of the Igf2, Er-α, Gr, Ppar-α and Ppar-γ genes. Folic acid supplementation during the 2nd or 3rd week gestation or throughout pregnancy significantly increased brain folate concentrations (P<.001), while only folic acid supplementation throughout pregnancy significantly increased liver folate concentrations (P=.005), in newborn pups. Brain global DNA methylation incrementally decreased from early to late gestational folic acid supplementation and was the lowest with folic acid supplementation throughout pregnancy (P=.026). Folic acid supplementation in late gestation or throughout pregnancy significantly decreased Er-α, Gr and Ppar-α gene expression in the liver (P<.05). The kidney and colon were resistant to the effect of folic acid supplementation. Maternal folic acid supplementation affects tissue folate concentrations, DNA methylation and gene expression in the offspring in a gestation-period-dependent and organ-specific manner. PMID:27152636

  5. Maternal folic acid supplementation modulates DNA methylation and gene expression in the rat offspring in a gestation period-dependent and organ-specific manner.

    PubMed

    Ly, Anna; Ishiguro, Lisa; Kim, Denise; Im, David; Kim, Sung-Eun; Sohn, Kyoung-Jin; Croxford, Ruth; Kim, Young-In

    2016-07-01

    Maternal folic acid supplementation can alter DNA methylation and gene expression in the developing fetus, which may confer disease susceptibility later in life. We determined which gestation period and organ were most sensitive to the modifying effect of folic acid supplementation during pregnancy on DNA methylation and gene expression in the offspring. Pregnant rats were randomized to a control diet throughout pregnancy; folic acid supplementation at 2.5× the control during the 1st, 2nd or 3rd week of gestation only; or folic acid supplementation throughout pregnancy. The brain, liver, kidney and colon from newborn pups were analyzed for folate concentrations, global DNA methylation and gene expression of the Igf2, Er-α, Gr, Ppar-α and Ppar-γ genes. Folic acid supplementation during the 2nd or 3rd week gestation or throughout pregnancy significantly increased brain folate concentrations (P<.001), while only folic acid supplementation throughout pregnancy significantly increased liver folate concentrations (P=.005), in newborn pups. Brain global DNA methylation incrementally decreased from early to late gestational folic acid supplementation and was the lowest with folic acid supplementation throughout pregnancy (P=.026). Folic acid supplementation in late gestation or throughout pregnancy significantly decreased Er-α, Gr and Ppar-α gene expression in the liver (P<.05). The kidney and colon were resistant to the effect of folic acid supplementation. Maternal folic acid supplementation affects tissue folate concentrations, DNA methylation and gene expression in the offspring in a gestation-period-dependent and organ-specific manner.

  6. A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

    PubMed

    Lassner, M W; Lardizabal, K; Metz, J G

    1996-02-01

    beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.

  7. α,β-D-Constrained Nucleic Acids Are Strong Terminators of Thermostable DNA Polymerases in Polymerase Chain Reaction

    PubMed Central

    Mahéo, Sabrina; Gross, Grégori; Bodin, Pierre; Teissié, Justin; Escudier, Jean-Marc; Paquereau, Laurent

    2011-01-01

    (SC5′, RP) α,β-D- Constrained Nucleic Acids (CNA) are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5′C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases. PMID:21991314

  8. Plant flavone apigenin binds to nucleic acid bases and reduces oxidative DNA damage in prostate epithelial cells.

    PubMed

    Sharma, Haripaul; Kanwal, Rajnee; Bhaskaran, Natarajan; Gupta, Sanjay

    2014-01-01

    Oxidative stress has been linked to prostate carcinogenesis as human prostate tissue is vulnerable to oxidative DNA damage. Apigenin, a dietary plant flavone, possesses anti-proliferative and anticancer effects; however, its antioxidant properties have not been fully elucidated. We investigated sub-cellular distribution of apigenin, it's binding to DNA and protective effects against H2O2-induced DNA damage using transformed human prostate epithelial RWPE-1 cells and prostate cancer LNCaP, PC-3 and DU145 cells. Exposure of cells to apigenin exhibited higher accumulation in RWPE-1 and LNCaP cells, compared to PC-3 and DU145 cells. The kinetics of apigenin uptake in LNCaP cells was estimated with a Km value of 5 µmole/L and Vmax of 190 pmoles/million cells/h. Sub-cellular fractionation demonstrated that nuclear matrix retains the highest concentration of apigenin (45.3%), followed by cytosol (23.9%), nuclear membranes (17.9%) and microsomes (12.9%), respectively. Spectroscopic analysis of apigenin with calf-thymus DNA exhibited intercalation as the dominant binding mode to DNA duplex. Apigenin exposure resulted in significant genoprotective effects in H2O2-stressed RWPE-1 cells by reduction in reactive oxygen species levels. In addition, apigenin exposure suppressed the formation of 8-hydroxy-2' deoxyguanosine and protected exposed cells from apoptosis. Our studies demonstrate that apigenin is readily taken up by normal prostatic epithelial cells and prostate cancer cells, and is incorporated into their nuclei, where its intercalation with nucleic acid bases may account for its antioxidant and chemopreventive activities. PMID:24614817

  9. DNA binding protein identification by combining pseudo amino acid composition and profile-based protein representation

    NASA Astrophysics Data System (ADS)

    Liu, Bin; Wang, Shanyi; Wang, Xiaolong

    2015-10-01

    DNA-binding proteins play an important role in most cellular processes. Therefore, it is necessary to develop an efficient predictor for identifying DNA-binding proteins only based on the sequence information of proteins. The bottleneck for constructing a useful predictor is to find suitable features capturing the characteristics of DNA binding proteins. We applied PseAAC to DNA binding protein identification, and PseAAC was further improved by incorporating the evolutionary information by using profile-based protein representation. Finally, Combined with Support Vector Machines (SVMs), a predictor called iDNAPro-PseAAC was proposed. Experimental results on an updated benchmark dataset showed that iDNAPro-PseAAC outperformed some state-of-the-art approaches, and it can achieve stable performance on an independent dataset. By using an ensemble learning approach to incorporate more negative samples (non-DNA binding proteins) in the training process, the performance of iDNAPro-PseAAC was further improved. The web server of iDNAPro-PseAAC is available at http://bioinformatics.hitsz.edu.cn/iDNAPro-PseAAC/.

  10. Self-assembling DNA hydrogel-based delivery of immunoinhibitory nucleic acids to immune cells.

    PubMed

    Nishida, Yu; Ohtsuki, Shozo; Araie, Yuki; Umeki, Yuka; Endo, Masayuki; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Takahashi, Yuki; Takakura, Yoshinobu; Nishikawa, Makiya

    2016-01-01

    Immunoinhibitory oligodeoxynucleotides (INH-ODNs) are promising inhibitors of Toll-like receptor 9 (TLR9) activation. To efficiently deliver INH-ODNs to TLR9-positive cells, we designed a Takumi-shaped DNA (Takumi) consisting of two partially complementary ODNs as the main component of a DNA hydrogel. Polyacrylamide gel electrophoresis showed that Takumi-containing INH-ODNs (iTakumi) and iTakumi-based DNA hydrogel (iTakumiGel) were successfully generated. Their activity was examined in murine macrophage-like RAW264.7 cells and DC2.4 dendritic cells by measuring tumor necrosis factor-α and interleukin-6 release after the addition of a TLR9 ligand (CpG ODN). Cytokine release was efficiently inhibited by the iTakumiGel. Flow cytometry analysis and confocal microscopy showed that cellular uptake of INH-ODN was greatly increased by the iTakumiGel. These results indicate that a Takumi-based DNA hydrogel is useful for the delivery of INH-ODNs to immune cells to inhibit TLR9-mediated hyperinduction of proinflammatory cytokines. From the Clinical Editor: Toll-like receptor 9 activation has been reported to be associated with many autoimmune diseases. DNA inhibition using oligodeoxynucleotides is one of the potential treatments. In this article, the authors described hydrogel-based platform for the delivery of the inhibitory oligodeoxynucleotides for enhanced efficacy. The positive findings could indicate a way for the future.

  11. Nucleic acid (DNA) immunization as a platform for dengue vaccine development.

    PubMed

    Porter, Kevin R; Raviprakash, Kanakatte

    2015-12-10

    Since the early 1990s, DNA immunization has been used as a platform for developing a tetravalent dengue vaccine in response to the high priority need for protecting military personnel deployed to dengue endemic regions of the world. Several approaches have been explored ranging from naked DNA immunization to the use of live virus vectors to deliver the targeted genes for expression. Pre-clinical animal studies were largely successful in generating anti-dengue cellular and humoral immune responses that were protective either completely or partially against challenge with live dengue virus. However, Phase 1 clinical evaluation of a prototype monovalent dengue 1 DNA vaccine expressing prM and E genes revealed anti-dengue T cell IFNγ responses, but poor neutralizing antibody responses. These less than optimal results are thought to be due to poor uptake and expression of the DNA vaccine plasmids. Because DNA immunization as a vaccine platform has the advantages of ease of manufacture, flexible genetic manipulation and enhanced stability, efforts continue to improve the immunogenicity of these vaccines using a variety of methods. PMID:26458805

  12. DNA (deoxyribonucleic acid) synthesis following microinjection of heterologous sperm and somatic cell nuclei into hamster oocytes

    SciTech Connect

    Naish, S.J.; Perreault, S.D.; Zirkin, B.R.

    1987-01-01

    The authors investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in /sup 3/H-thymidine after being parthenogenetically activated by sham microinjection, or microinjected with hamster, mouse, rabbit, or fish sperm nuclei, or hamster hepatocyte nuclei. Within 6 hr of sham or nucleus microinjection, nuclei of each type underwent transformation into pronuclei and synthesized DNA. These results demonstrated that the hamster egg can access and utilize its own and each type of template provided, whether homologous or heterologous. However, pronuclei derived from hamster sperm nuclei were more likely to be synthesizing DNA at 6 hr than pronuclei derived from sperm nuclei of other species. The authors conclude that the mechanisms employed by the hamster oocyte to transform hamster sperm nuclei into pronuclei and to effect DNA synthesis in these nuclei are not specific for the hamster sperm nucleus. Nevertheless, these mechanisms apparently operate more efficiently when the hamster sperm nucleus, rather than a heterologous sperm nucleus, is present.

  13. An Unprecedented Nucleic Acid Capture Mechanism for Excision of DNA Damage

    PubMed Central

    Rubinson, Emily H.; Gowda, A.S. Prakasha; Spratt, Thomas E.; Gold, Barry; Eichman, Brandt F.

    2014-01-01

    DNA glycosylases that remove alkylated and deaminated purine nucleobases are essential DNA repair enzymes that protect the genome, and at the same time confound cancer alkylation therapy, by excising cytotoxic N3-methyladenine bases formed by DNA targeting anticancer compounds. The basis for glycosylase specificity toward N3- and N7-alkylpurines is believed to result from intrinsic instability of the modified bases and not from direct enzyme functional group chemistry. Here, we present crystal structures of the recently discovered Bacillus cereus AlkD glycosylase in complex with DNAs containing alkylated, mismatched, and abasic nucleotides. Unlike other glycosylases, AlkD captures the extrahelical lesion in a solvent-exposed orientation, providing the first illustration for how hydrolysis of N3- and N7-alkylated bases may be facilitated by increased lifetime out of the DNA helix. The structures and supporting biochemical analysis of base flipping and catalysis reveal how AlkD’s HEAT-repeats distort the DNA backbone to detect non-Watson-Crick base pairs without duplex intercalation. PMID:20927102

  14. An unprecedented nucleic acid capture mechanism for excision of DNA damage

    SciTech Connect

    Rubinson, Emily H.; Prakasha Gowda, A.S.; Spratt, Thomas E.; Gold, Barry; Eichmanbrand, Brandt F.

    2010-11-18

    DNA glycosylases that remove alkylated and deaminated purine nucleobases are essential DNA repair enzymes that protect the genome, and at the same time confound cancer alkylation therapy, by excising cytotoxic N3-methyladenine bases formed by DNA-targeting anticancer compounds. The basis for glycosylase specificity towards N3- and N7-alkylpurines is believed to result from intrinsic instability of the modified bases and not from direct enzyme functional group chemistry. Here we present crystal structures of the recently discovered Bacillus cereus AlkD glycosylase in complex with DNAs containing alkylated, mismatched and abasic nucleotides. Unlike other glycosylases, AlkD captures the extrahelical lesion in a solvent-exposed orientation, providing an illustration for how hydrolysis of N3- and N7-alkylated bases may be facilitated by increased lifetime out of the DNA helix. The structures and supporting biochemical analysis of base flipping and catalysis reveal how the HEAT repeats of AlkD distort the DNA backbone to detect non-Watson-Crick base pairs without duplex intercalation.

  15. Nucleic acid (DNA) immunization as a platform for dengue vaccine development.

    PubMed

    Porter, Kevin R; Raviprakash, Kanakatte

    2015-12-10

    Since the early 1990s, DNA immunization has been used as a platform for developing a tetravalent dengue vaccine in response to the high priority need for protecting military personnel deployed to dengue endemic regions of the world. Several approaches have been explored ranging from naked DNA immunization to the use of live virus vectors to deliver the targeted genes for expression. Pre-clinical animal studies were largely successful in generating anti-dengue cellular and humoral immune responses that were protective either completely or partially against challenge with live dengue virus. However, Phase 1 clinical evaluation of a prototype monovalent dengue 1 DNA vaccine expressing prM and E genes revealed anti-dengue T cell IFNγ responses, but poor neutralizing antibody responses. These less than optimal results are thought to be due to poor uptake and expression of the DNA vaccine plasmids. Because DNA immunization as a vaccine platform has the advantages of ease of manufacture, flexible genetic manipulation and enhanced stability, efforts continue to improve the immunogenicity of these vaccines using a variety of methods.

  16. Mechanism of action of nalidixic acid: Purification of Escherichia coli nalA gene product and its relationship to DNA gyrase and a novel nicking-closing enzyme

    PubMed Central

    Sugino, Akio; Peebles, Craig L.; Kreuzer, Kenneth N.; Cozzarelli, Nicholas R.

    1977-01-01

    A target protein for nalidixic and oxolinic acids in Escherichia coli, the nalA gene product (Pnal), was purified to homogeneity as judged by gel electrophoresis, using an in vitro complementation assay. It is a dimer of identical 110,000-dalton subunits. A polypeptide of this molecular weight is uniquely induced by a λ nalA transducing phage, thereby showing that the purified Pnal is a product of the nalA gene. Nalidixic and oxolinic acids inhibit DNA gyrase activity and induce formation of a relaxation complex analogue. Treatment of the complex with sodium dodecyl sulfate causes a doublestrand break in the DNA substrate and the resulting linear molecule seems covalently bound to protein. Complex formation, unlike the introduction of supertwists, does not require ATP or relaxed circular DNA and is insensitive to novobiocin. DNA gyrase from a strain with a nalA mutation conferring drug resistance (nalAr) is 1/100 as sensitive to oxolinic and nalidixic acids with respect to inhibition of supertwisting and induction of the pre-linearization complex. Addition of Pnal restores drug sensitivity and stimulates DNA gyrase activity. DNA gyrase preparations and Pnal catalyze a third reaction sensitive to nalidixic and oxolinic acids, the ATP-independent relaxation of supertwister DNA. Relaxation by gyrase from nalAr cells is drug resistant. The nicking-closing activity is distinct from E. coli ω protein in several properties, including the ability to relax positively supertwisted DNA. We postulate that the nalA gene product occurs in two molecular forms, as Pnal and as a gyrase component. Both forms catalyze nicking-closing, and inhibition of this activity by nalidixic and oxolinic acids may account for the inhibition of DNA synthesis by these drugs. Images PMID:200930

  17. Green tea constituents (-)-epigallocatechin-3-gallate (EGCG) and gallic acid induce topoisomerase I- and topoisomerase II-DNA complexes in cells mediated by pyrogallol-induced hydrogen peroxide.

    PubMed

    López-Lázaro, Miguel; Calderón-Montaño, José Manuel; Burgos-Morón, Estefanía; Austin, Caroline A

    2011-07-01

    Green tea and its major active constituent, (-)-epigallocatechin-3-gallate (EGCG), are in clinical trials for the prevention and treatment of several diseases such as cancer. DNA topoisomerase (topo) poisons are commonly prescribed anticancer drugs that kill cancer cells by inducing topo-DNA complexes. Using purified topoisomerases, previous in vitro studies have shown that EGCG induces the formation of topo-DNA complexes. Because the activity of a drug on purified topoisomerases does not always represent the activity in a cell, we have used an immunofluorescence technique that allows the visualisation of topo I- and topo II-DNA complexes produced in individual cells to evaluate the activity of EGCG on both enzymes. High levels of topo I- and topo II-DNA complexes were observed in K562 leukaemia cells exposed to EGCG. Similar levels of topo I- and topo II-DNA complexes were visualised in cells treated with gallic acid (GA) (the acid part of the EGCG ester). Pyrogallol (PG) also induced topo-DNA complexes with both enzymes, therefore suggesting that the activity of EGCG and GA is mediated by their PG moieties. Catalase prevented both the cytotoxicity and the formation of topo I- and topo II-DNA complexes induced by EGCG, GA, PG and myricetin (a PG-containing flavonoid recently shown to induce topo I- and topo II-DNA complexes in cells), indicating that hydrogen peroxide mediates these activities. Hydrogen peroxide induced topo I- and topo II (α and β)-DNA complexes in a time- and dose-dependent manner. The formation of topo I- and topo II-DNA complexes in cells exposed to hydrogen peroxide correlated well with the induction of apoptosis, suggesting that the topo-DNA complexes induced at long exposure times by the compounds tested in our study may be apoptotic topo-DNA complexes. Finally, we report results suggesting that PG-containing drugs may selectively kill tumour cells by generating hydrogen peroxide.

  18. Histidine-Based Lipopeptides Enhance Cleavage of Nucleic Acids: Interactions with DNA and Hydrolytic Properties.

    PubMed

    Bélières, M; Déjugnat, C; Chouini-Lalanne, N

    2015-12-16

    Interaction studies and cleavage activity experiments were carried out between plasmid DNA and a series of histidine-based lipopeptides. Specific fluorescent probes (ethidium bromide, Hoechst 33342, and pyrene) were used to monitor intercalation, minor groove binding, and self-assembly of lipopeptides, respectively. Association between DNA and lipopeptides was thus evidenced, highlighting the importance of both histidine and hydrophobic tail in the interaction process. DNA cleavage in the presence of lipopeptides was then detected by gel electrophoresis and quantified, showing the importance of histidine and the involvement of its side-chain imidazole in the hydrolysis mechanism. These systems could then be developed as synthetic nucleases while raising concern of introducing histidine in the design of lipopeptide-based transfection vectors.

  19. Dissociative Electron Attachment to Phosphoric Acid Esters: The Direct Mechanism for Single Strand Breaks in DNA

    SciTech Connect

    Koenig, Constanze; Kopyra, Janina; Bald, Ilko; Illenberger, Eugen

    2006-07-07

    We use dibutyl phosphate to simulate the behavior of the phosphate group in DNA towards the attack of low energy electrons. We find that the compound undergoes effective dissociative electron attachment within a low energy resonant feature at 1 eV and a further resonance peaking at 8 eV. The dissociative electron attachment (DEA) reactions are associated with the direct cleavage of the C-O and the P-O bond but also the excision of the PO{sup -}, PO{sub 3}{sup -}, H{sub 2}PO{sub 3}{sup -} units. For the phosphate group coupled in the DNA network these reactions represent single strand breaks. We hence propose that the most direct mechanism of single strand breaks occurring in DNA at subexcitation energies (<4 eV) is due to DEA directly to the phosphate group.

  20. Effect of the amino acid substitution in the DNA-binding domain of the Fur regulator on production of pyoverdine.

    PubMed

    Valešová, Renáta; Palyzová, Andrea; Marešová, Helena; Stěpánek, Václav; Babiak, Peter; Kyslík, Pavel

    2013-07-01

    The ferric uptake regulator gene (fur), its promoter region and Fur box of pvdS gene involved in siderophore-mediated iron uptake system were sequenced in the parent strain Pseudomonas aeruginosa PAO1 and in the fur mutant FPA121 derived from the strain PAO1. We identified the gene fur 179 bearing a novel, single-point mutation that changed the amino acid residue Gln60Pro in the DNA-binding domain of the Fur protein. The synthesis of pyoverdine was studied in cultures of the strains PAO1 and FPA121 grown in iron-deplete and iron-replete (60 μmol/L FeIII) medium. The amino acid replacement in the regulatory Fur protein is responsible for the overproduction of pyoverdine in iron-deplete and iron-replete medium. No mutation was identified in the Fur box of the gene pvdS.

  1. Impedimetric DNA-biosensor for the study of anti-cancer action of mitomycin C: comparison between acid and electroreductive activation.

    PubMed

    Ensafi, Ali A; Amini, Maryam; Rezaei, Behzad

    2014-09-15

    An electrochemical protocol is described for direct monitoring of anti-cancer properties of MMC. Using electrochemical impedance spectroscopy, a pretreated pencil graphite electrode (PGE) modified with multiwall carbon nanotubes (MWCNTs) and poly(diallyldimethylmmonium chloride), PDDA, decorated with ds-DNA was employed in this study to identify DNA damages induced by MMC. The change in charge transfer resistance after incubation of the DNA-biosensor in MMC solution for a known time was used as indication of DNA damage. It was found that MMC did not interact with DNA. As MMC does not inherently possess any anti-cancer activity, it is, therefore, necessary to activate it by either of two ways: activation in acidic media or electrochemical activation. Incubation of DNA-modified electrode in activated MMC led to alterations in DNA and changes in its electrochemical properties (which forms the theme of the present study). Acid and electroreductive MMC activations were compared and different adducts were subsequently generated, suggesting that the drug can bind to DNA in more than one way. Impedance spectroscopy was used for the first time as a novel technique for detecting DNA-drug adducts. PMID:24747202

  2. [Composites of peptide nucleic acids with titanium dioxide nanoparticles. III. Kinetics of PNA dissociation from nanocomposites containing DNA/PNA duplexes].

    PubMed

    Amirkhanov, R N; Zarytova, V F; Amirkhanov, N V

    2014-01-01

    When delivering peptide nucleic acids (PNA) to the cells in the nanocomposites TiO2 · PL · DNA/PNA, containing titanium dioxide nanoparticles coated with polylysine (PL) and immobilized DNA/PNA duplexes, it is important not only to transport them to the cell, but also ability to control the release rate of the PNA-drug from the carrier. PNA desorption from TiO2 · PL · DNA/PNA nanocomposite in time has been shown. Desorption is caused by dissociation of immobilized DNA/PNA duplex while the DNA remains on the carrier and PNA goes away in solution. It has been found that the half-retention times of PNA on TiO2 · PL · DNA/PNA nanocomposites containing DNA/PNA duplexes with overlapping complementary base pairs equal to 10, 12, 14, and 16 are 10, 14, 22 and 70 minutes, respectively. Thus, it has been shown that the release rate of the PNA-drug from nanocomposites can be adjusted by varying the overlap of complementary base pairs in the immobilized DNA/PNA duplex. This method of PNA immobilization may be used for designing of nanocomposites with optimum release time of the PNA-drugs. Created TiO2 · PL · DNA/PNA nanocomposites can be used to efficiently deliver therapeutically significant drug PNA and their selective effect on the pathogenic nucleic acid in the cell.

  3. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    SciTech Connect

    Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Shikazono, Naoya; Yokoya, Akinari; Katsumura, Yosuke

    2013-05-03

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems.

  4. Development of PCR-Based DNA markers flanking three low phytic acid mutant loci in barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phytic acid (PA) is the most abundant form of phosphorus (P) in cereal grains. PA chelates mineral cations to form an indigestible salt, and is thus regarded as an antinutritional agent and a contributor to water pollution. Grain with low phytic acid (lpa) genotypes could aid in mitigating this prob...

  5. Genetic and epigenetic transgenerational implications related to omega-3 fatty acids. Part I: maternal FADS2 genotype and DNA methylation correlate with polyunsaturated fatty acid status in toddlers: an exploratory analysis.

    PubMed

    Lupu, Daniel S; Cheatham, Carol L; Corbin, Karen D; Niculescu, Mihai D

    2015-11-01

    Polyunsaturated fatty acid metabolism in toddlers is regulated by a complex network of interacting factors. The contribution of maternal genetic and epigenetic makeup to this milieu is not well understood. In a cohort of mothers and toddlers 16 months of age (n = 65 mother-child pairs), we investigated the association between maternal genetic and epigenetic fatty acid desaturase 2 (FADS2) profiles and toddlers' n-6 and n-3 fatty acid metabolism. FADS2 rs174575 variation and DNA methylation status were interrogated in mothers and toddlers, as well as food intake and plasma fatty acid concentrations in toddlers. A multivariate fit model indicated that maternal rs174575 genotype, combined with DNA methylation, can predict α-linolenic acid plasma concentration in all toddlers and arachidonic acid concentrations in boys. Arachidonic acid intake was predictive for its plasma concentration in girls, whereas intake of 3 major n-3 species (eicosapentaenoic, docosapentaenoic, and docosahexaenoic acids) were predictive for their plasma concentrations in boys. FADS2 genotype and DNA methylation in toddlers were not related to plasma concentrations or food intakes, except for CpG8 methylation. Maternal FADS2 methylation was a predictor for the boys' α-linolenic acid intakes. This exploratory study suggests that maternal FADS2 genetic and epigenetic status could be related to toddlers' polyunsaturated fatty acid metabolism.

  6. Identification of PCR-amplified genetically modified organisms (GMOs) DNA by peptide nucleic acid (PNA) probes in anion-exchange chromatographic analysis.

    PubMed

    Rossi, Stefano; Lesignoli, Francesca; Germini, Andrea; Faccini, Andrea; Sforza, Stefano; Corradini, Roberto; Marchelli, Rosangela

    2007-04-01

    PCR products obtained by selective amplification of transgenic DNA derived from food samples containing Roundup Ready soybean or Bt-176 maize have been analyzed by anion-exchange HPLC. Peptide nucleic acids (PNAs), oligonucleotide analogues known to bind to complementary single-stranded DNA with high affinity and specificity, have been used as specific probes in order to assess the identity of the peaks observed. Two different protocols were adopted in order to obtain single-stranded DNA: amplification with an excess of one primer or digestion of one DNA strand. The single-stranded DNA was mixed with the PNA probe, and the presence of a specific sequence was revealed through detection of the corresponding PNA:DNA peak with significantly different retention time. Advantages and limits of this approach are discussed. The method was tested with reference materials and subsequently applied to commercial samples.

  7. Understanding the interaction of DNA-RNA nucleobases with different ZnO nanomaterials.

    PubMed

    Saha, Supriya; Sarkar, Pranab

    2014-08-01

    Due to the potential application of different nanostructure materials in biomedical nanotechnologies, understanding the interaction between the inorganic nanoparticles and biological molecules at the atomic level is of paramount importance. We present here the results of our theoretical investigation of the interaction of different nucleotide bases--adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)--with different ZnO nanoparticles, such as ZnO nanowires (NWs), nanotubes (NTs), surfaces and quantum dots (QDs). As the size of the systems we studied is relatively large, we have used the self-consistent-charge density-functional tight-binding (SCC-DFTB) method to optimize the complex systems. We have studied in detail the site-specific binding nature and the adsorption strength of these nucleobases with different ZnO nanoparticles. The calculated binding energy order and the interaction strength of nucleobases are very much dependent on the nature of the nanoparticle surfaces and are different for different nanostructures. In most of the cases ZnO prefers to bind either through the top site of the nucleobases or with the ring nitrogen atom having a lone pair relative to other binding sites of the bases. PMID:24942064

  8. The DNA replication inhibitor microcin B17 is a forty-three-amino-acid protein containing sixty percent glycine.

    PubMed

    Davagnino, J; Herrero, M; Furlong, D; Moreno, F; Kolter, R

    1986-11-01

    Microcin B17 is a low-molecular-weight protein that inhibits DNA replication in a number of enteric bacteria. It is produced by bacterial strains which harbor a 70-kilobase plasmid called pMccB17. Four plasmid genes (named mcbABCD) are required for its production. The product of the mcbA gene was identified by labelling minicells. The mcbA gene product was slightly larger when a mutation in any of the other three production genes was present. This indicates that these genes are involved in processing the primary mcbA product to yield the active molecule. The mcbA gene product predicted from the nucleotide sequence has 69 amino acids including 28 glycine residues. Microcin B17 was extracted from the cells by boiling in 100 mM acetic acid, 1 mM EDTA, and purified to homogeneity in a single step by high-performance liquid chromatography through a C18 column. The N-terminal amino acid sequence and amino acid composition demonstrated that mcbA is the structural gene for microcin B17. The active molecule is a processed product lacking the first 26 N-terminal residues. The 43 remaining residues include 26 glycines. While microcin B17 is an exported protein, the cleaved N-terminal peptide does not have the characteristic properties of a "signal sequence", which suggests that it is secreted by a mechanism different from that used by most secreted proteins of E. coli.

  9. Running DNA Mini-Gels in 20 Minutes or Less Using Sodium Boric Acid Buffer

    ERIC Educational Resources Information Center

    Jenkins, Kristin P.; Bielec, Barbara

    2006-01-01

    Providing a biotechnology experience for students can be challenging on several levels, and time is a real constraint for many experiments. Many DNA based methods require a gel electrophoresis step, and although some biotechnology procedures have convenient break points, gel electrophoresis does not. In addition to the time required for loading…

  10. Effective DNA binding and cleaving tendencies of malonic acid coupled transition metal complexes

    NASA Astrophysics Data System (ADS)

    Pravin, Narayanaperumal; Utthra, Ponnukalai Ponya; Kumaravel, Ganesan; Raman, Natarajan

    2016-11-01

    Eight transition metal complexes were designed to achieve maximum biological efficacy. They were characterized by elemental analysis and various other spectroscopic techniques. The monomeric complexes were found to espouse octahedral geometry and non-electrolytic nature. The DNA interaction propensity of the complexes with calf thymus DNA (CT-DNA), studied at physiological pH by spectrophotometric, spectrofluorometric, cyclic voltammetry, and viscometric techniques revealed intercalation as the possible binding mode. Fascinatingly, the complexes were found to exhibit greater binding strength than that of the free ligands. A strong hypochromism and a slight red shift were exhibited by complex 5 among the other complexes. The intrinsic binding constant values of all the complexes compared to cisplatin reveal that they are excellent metallonucleases than that of cisplatin. The complexes were also shown to reveal displacement of the ethidium bromide, a strong intercalator using fluorescence titrations. Gel electrophoresis was used to divulge the competence of the complexes in cleaving the supercoiled pBR322 plasmid DNA. From the results, it is concluded that the complexes, especially 5, are excellent chemical nucleases in the presence of H2O2. Furthermore, the in vitro antimicrobial screening of the complexes exposes that these complexes are excellent antimicrobial agents. Overall the effect of coligands is evident from the results of all the investigations.

  11. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(A)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of know chemical and physical mutagens. Neither retinol or retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 ..mu..M to 50 ..mu..M. Retinol and retinoic acid did not significantly affect 200..mu..g/mL ethyl methanesulfonate (EMS)- or 32 J/m/sup 2/ ultraviolet light (UV)-induced UDS at concentrations ranging from 1..mu..M to 50 ..mu..M. In contrast, retinol and retinoic acid significantly inhibited 2.5 ..mu..g/mL and 5.0 ..mu..g/mL 7,12-dimethyl-benz(a)-anthracene(DMBA)-induced UDS at concentrations of 1..mu..M or greater. Retinol-and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 ..mu..M and 100 ..mu..M. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  12. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(a)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of known chemical and physical mutagens. Neither retinol nor retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 microM to 50 microM. Retinol and retinoic acid did not significantly affect 200 micrograms/mL ethyl methanesulfonate(EMS)- or 32 J/m2 ultraviolet light(UV)-induced UDS at concentrations ranging from 1 microM to 50 microM. In contrast, retinol and retinoic acid significantly inhibited 2.5 micrograms/mL and 5.0 micrograms/mL 7,12-dimethyl-benz(a)anthracene(DMBA)-induced UDS at concentrations of 1 microM or greater. Retinol- and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 microM and 100 microM. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  13. Cationic Lipid-Nucleic Acid Complexes for Gene Delivery And Silencing: Pathways And Mechanisms for Plasmid Dna And Sirna

    SciTech Connect

    Ewert, K.K.; Zidovska, A.; Ahmad, A.; Bouxsein, N.F.; Evans, H.M.; McAllister, C.S.; Samuel, C.E.; Safinya, C.R.; /SLAC

    2012-07-17

    Motivated by the promises of gene therapy, there is great interest in developing non-viral lipid-based vectors for therapeutic applications due to their low immunogenicity, low toxicity, ease of production, and the potential of transferring large pieces of DNA into cells. In fact, cationic liposome (CL) based vectors are among the prevalent synthetic carriers of nucleic acids (NAs) currently used in gene therapy clinical trials worldwide. These vectors are studied both for gene delivery with CL-DNA complexes and gene silencing with CL-siRNA (short interfering RNA) complexes. However, their transfection efficiencies and silencing efficiencies remain low compared to those of engineered viral vectors. This reflects the currently poor understanding of transfection-related mechanisms at the molecular and self-assembled levels, including a lack of knowledge about interactions between membranes and double stranded NAs and between CL-NA complexes and cellular components. In this review we describe our recent efforts to improve the mechanistic understanding of transfection by CL-NA complexes, which will help to design optimal lipid-based carriers of DNA and siRNA for therapeutic gene delivery and gene silencing.

  14. Histone Modification Is Involved in Okadaic Acid (OA) Induced DNA Damage Response and G2-M Transition Arrest in Maize

    PubMed Central

    Zhang, Hao; Wang, Pu; Hou, Haoli; Wen, Huan; Zhou, Hong; Gao, Fei; Wu, Jinping; Qiu, Zhengming; Li, Lijia

    2016-01-01

    Histone modifications are involved in regulation of chromatin structure. To investigate the relationship between chromatin modification and cell cycle regulation during plant cell proliferation, Okadaic acid (OA), a specific inhibitor of serine/threonine protein phosphatase, was applied in this study. The results showed that OA caused the cell cycle arrest at preprophase, leading to seedling growth inhibition. Western blotting assay revealed that the spatial distribution of phosphorylation of Ser10 histone H3 tails (H3S10ph) signals was altered under OA treatment. Reactive oxygen species (ROS) was found to be at higher levels and TdT-mediated dUTP nick end labeling (TUNEL) assay displayed DNA breaks happened at the chromatin after treatment with OA, companied with an increase in the acetylation of histone H4 at lysine 5 (H4K5ac) level. From these observations, we speculated that the alteration of the spatial distribution of H3S10ph and the level of H4K5ac was involved in the procedure that OA induced DNA breaks and G2-M arrested by the accumulation of ROS, and that the histone H3S10ph and H4K5ac might facilitate DNA repair by their association with the chromatin decondensation. PMID:27196101

  15. Porous Hyaluronic Acid Hydrogels for Localized Non-Viral DNA Delivery in a Diabetic Wound Healing Model

    PubMed Central

    Tokatlian, Talar; Cam, Cynthia; Segura, Tatiana

    2015-01-01

    The treatment of impaired wounds requires the use of biomaterials that can provide mechanical and biological queues to the surrounding environment to promote angiogenesis, granulation tissue formation, and wound closure. Porous hydrogels have previously been shown to promote angiogenesis even in the absence of pro-angiogenic factors. We hypothesized that the added delivery of non-viral DNA encoding for pro-angiogenic growth factors could further enhance this effect. Here, 100 and 60 μm porous and non-porous (n-pore) hyaluronic acid-MMP hydrogels with encapsulated reporter (pGFPluc) or pro-angiogenic (pVEGF) plasmids were used to investigate scaffold-mediated gene delivery for local gene therapy in a diabetic wound healing mouse model. Porous hydrogels allowed for significantly faster wound closure compared to n-pore hydrogels, which did not degrade and essentially provided a mechanical barrier to closure. Interestingly, the delivery of pDNA/PEI polyplexes positively promoted granulation tissue formation even when the DNA did not encode for an angiogenic protein. And although transfected cells were present throughout the granulation tissue surrounding all hydrogels at 2 weeks, pVEGF delivery did not further enhance the angiogenic response. Despite this, the presence of transfected cells shows promise for the use of polyplex-loaded porous hydrogels for local gene delivery in the treatment of diabetic wounds. PMID:25694196

  16. Involvement of aberrant DNA methylation on reduced expression of lysophosphatidic acid receptor-1 gene in rat tumor cell lines

    SciTech Connect

    Tsujiuchi, Toshifumi . E-mail: ttujiuch@life.kindai.ac.jp; Shimizu, Kyoko; Onishi, Mariko; Sugata, Eriko; Fujii, Hiromasa; Mori, Toshio; Honoki, Kanya; Fukushima, Nobuyuki

    2006-10-27

    Lysophosphatidic acid (LPA) is a bioactive phospholipid that stimulates cell proliferation, migration, and protects cells from apoptosis. It interacts with specific G protein-coupled transmembrane receptors. Recently, it has been reported that alterations of LPA receptor expression might be important in the malignant transformation of tumor cells. Therefore, to assess an involvement of DNA methylation in reduced expression of the LPA receptor-1 (lpa1) gene, we investigated the expression of the lpa1 gene and its DNA methylation patterns in rat tumor cell lines. Both rat brain-derived neuroblastoma B103 and liver-derived hepatoma RH7777 cells used in this study indicated no expression of lpa1. For the analysis of methylation status, bisulfite sequencing was performed with B103 and RH7777 cells, comparing with other lpa1 expressed cells and normal tissues of brain and liver. The lpa1 expressed cells and tissues were all unmethylated in this region of lpa1. In contrast, both B103 and RH7777 cells were highly methylated, correlating with reduced expression of the lpa1. Treatment with 5-aza 2'-deoxycytidine induced expression of lpa1 gene in B103 and RH7777 cells after 24 h. In RH7777 cells treated with 5-aza 2'-deoxycytidine, stress fiber formation was also observed in response to LPA in RH7777 cells, but not in untreated RH7777 cells. These results suggest that aberrant DNA methylation of the lpa1 gene may be involved in its reduced expression in rat tumor cells.

  17. Ursolic acid attenuates temozolomide resistance in glioblastoma cells by downregulating O6-methylguanine-DNA methyltransferase (MGMT) expression

    PubMed Central

    Zhu, Zhongling; Du, Shuangshuang; Ding, Fengxia; Guo, Shanshan; Ying, Guoguang; Yan, Zhao

    2016-01-01

    The DNA-alkylating agent temozolomide (TMZ) is an effective chemotherapeutic agent against malignant glioma, including glioblastoma multiforme (GBM). However, the clinical efficacy of TMZ is limited in many patients because of O6-methylguanine-DNA methyltransferase (MGMT)-driven resistance. Thus, new strategies to overcome TMZ resistance are urgently needed. Ursolic acid (UA) is a naturally derived pentacyclic triterpene acid that exerts broad anticancer effects, and shows capability to cross the blood-brain barrier. In this study, we evaluated the possible synergistic effect of TMZ and UA in resistant GBM cell lines. The results showed that UA prevented the proliferation of resistant GBM cells in a concentration-dependent manner. Compared with TMZ or UA treatment alone, the combination treatment of TMZ and UA synergistically enhanced cytotoxicity and senescence in TMZ-resistant GBM cells. This effect was correlated with the downregulation of MGMT. Moreover, experimental results with an in vivo mouse xenograft model showed that the combination treatment of UA and TMZ reduced tumor volumes by depleting MGMT. Therefore, UA as both a monotherapy and a resensitizer, might be a candidate agent for patients with refractory malignant gliomas. PMID:27508051

  18. The effects of dietary boric acid and borax supplementation on lipid peroxidation, antioxidant activity, and DNA damage in rats.

    PubMed

    Ince, Sinan; Kucukkurt, Ismail; Cigerci, Ibrahim Hakki; Fatih Fidan, A; Eryavuz, Abdullah

    2010-07-01

    The aims of this study were to clarify the effects of high dietary supplementation with boric acid and borax, called boron (B) compounds, on lipid peroxidation (LPO), antioxidant activity, some vitamin levels, and DNA damage in rats. Thirty Sprague Dawley male rats were divided into three equal groups: the animals in the first group (control) were fed with a standard rodent diet containing 6.4 mg B/kg, and the animals in the experimental group were fed with a standard rodent diet added with a supra-nutritional amount of boric acid and borax (100 mg B/kg) throughout the experimental period of 28 days. The B compounds decreased malondialdehyde (MDA), DNA damage, the protein carbonyl content (PCO) level in blood, and glutathione (GSH) concentration in the liver, Cu-Zn superoxide dismutase (SOD), and catalase (CAT) activity in the kidney. The B compounds increased GSH concentration in blood and the vitamin C level in plasma. Consequently, our results demonstrate that B supplementation (100 mg/kg) in diet decreases LPO, and enhances the antioxidant defense mechanism and vitamin status. There are no differences in oxidant/antioxidant balance and biochemical parameters except for serum vitamin A and liver GSH concentration, between the boron compounds used in this study.

  19. A novel cationic microbubble coated with stearic acid-modified polyethylenimine to enhance DNA loading and gene delivery by ultrasound.

    PubMed

    Jin, Qiaofeng; Wang, Zhiyong; Yan, Fei; Deng, Zhiting; Ni, Fei; Wu, Junru; Shandas, Robin; Liu, Xin; Zheng, Hairong

    2013-01-01

    A novel cationic microbubble (MB) for improvement of the DNA loading capacity and the ultrasound-mediated gene delivery efficiency has been developed; it has been prepared with commercial lipids and a stearic acid modified polyethylenimine 600 (Stearic-PEI600) polymer synthesized via acylation reaction of branched PEI600 and stearic acid mediated by N, N'-carbonyldiimidazole (CDI). The MBs' concentration, size distribution, stability and zeta potential (ζ-potential) were measured and the DNA loading capacity was examined as a function of the amount of Stearic-PEI600. The gene transfection efficiency and cytotoxicity were also examined using breast cancer MCF-7 cells via the reporter plasmid pCMV-Luc, encoding the firefly luciferase gene. The results showed that the Stearic-PEI600 polymer caused a significant increase in magnitude of ζ-potential of MBs. The addition of DNA into cationic MBs can shift ζ-potentials from positive to negative values. The DNA loading capacity of the MBs grew linearly from (5±0.2) ×10⁻³ pg/µm² to (20±1.8) ×10⁻³ pg/µm² when Stearic-PEI600 was increased from 5 mol% to 30 mol%. Transfection of MCF-7 cells using 5% PEI600 MBs plus ultrasound exposure yielded 5.76±2.58×10³ p/s/cm²/sr average radiance intensity, was 8.97- and 7.53-fold higher than those treated with plain MBs plus ultrasound (6.41±5.82) ×10² p/s/cm²/sr, (P<0.01) and PEI600 MBs without ultrasound (7.65±6.18) ×10² p/s/cm²/sr, (P<0.01), respectively. However, the PEI600 MBs showed slightly higher cytotoxicity than plain MBs. The cells treated with PEI600-MBs and plain MBs plus ultrasound showed 59.5±6.1% and 71.4±7.1% cell viability, respectively. In conclusion, our study demonstrated that the novel cationic MBs were able to increase DNA loading capacity and gene transfection efficiency and could be potentially applied in targeted gene delivery and therapy.

  20. A Novel Cationic Microbubble Coated with Stearic Acid-Modified Polyethylenimine to Enhance DNA Loading and Gene Delivery by Ultrasound

    PubMed Central

    Jin, Qiaofeng; Wang, Zhiyong; Yan, Fei; Deng, Zhiting; Ni, Fei; Wu, Junru; Shandas, Robin; Liu, Xin; Zheng, Hairong

    2013-01-01

    A novel cationic microbubble (MB) for improvement of the DNA loading capacity and the ultrasound-mediated gene delivery efficiency has been developed; it has been prepared with commercial lipids and a stearic acid modified polyethylenimine 600 (Stearic-PEI600) polymer synthesized via acylation reaction of branched PEI600 and stearic acid mediated by N, N'-carbonyldiimidazole (CDI). The MBs’ concentration, size distribution, stability and zeta potential (ζ-potential) were measured and the DNA loading capacity was examined as a function of the amount of Stearic-PEI600. The gene transfection efficiency and cytotoxicity were also examined using breast cancer MCF-7 cells via the reporter plasmid pCMV-Luc, encoding the firefly luciferase gene. The results showed that the Stearic-PEI600 polymer caused a significant increase in magnitude of ζ-potential of MBs. The addition of DNA into cationic MBs can shift ζ-potentials from positive to negative values. The DNA loading capacity of the MBs grew linearly from (5±0.2) ×10−3 pg/µm2 to (20±1.8) ×10−3 pg/µm2 when Stearic-PEI600 was increased from 5 mol% to 30 mol%. Transfection of MCF-7 cells using 5% PEI600 MBs plus ultrasound exposure yielded 5.76±2.58×103 p/s/cm2/sr average radiance intensity, was 8.97- and 7.53-fold higher than those treated with plain MBs plus ultrasound (6.41±5.82) ×102 p/s/cm2/sr, (P<0.01) and PEI600 MBs without ultrasound (7.65±6.18) ×102 p/s/cm2/sr, (P<0.01), respectively. However, the PEI600 MBs showed slightly higher cytotoxicity than plain MBs. The cells treated with PEI600-MBs and plain MBs plus ultrasound showed 59.5±6.1% and 71.4±7.1% cell viability, respectively. In conclusion, our study demonstrated that the novel cationic MBs were able to increase DNA loading capacity and gene transfection efficiency and could be potentially applied in targeted gene delivery and therapy. PMID:24086748

  1. Identification of amino acids in lac repressor protein cross-linked to operator DNA specifically substituted with bromodeoxyuridine.

    PubMed

    Allen, T D; Wick, K L; Matthews, K S

    1991-04-01

    Amino acids in lac repressor protein which form cross-links to lac operator DNA specifically substituted with bromodeoxyuridine (BrdU) have been identified. Five sites of cross-linking in BrdU-substituted operator DNA were found at positions +3, +4, +14, +18, and +19 relative to the initiation site for transcription (Wick, K.L., and Matthews, K.S. (1991) J. Biol. Chem. 266, 6106-6112). Irradiation of complexes of repressor and each of these five singly substituted operator DNAs was executed under large scale conditions to generate sufficient complex for proteolysis, separation of the peptide-DNA, and peptide sequencing. The DNAs substituted with BrdU for thymidine at positions +3, +18, and +19 yielded cross-links to the peptide spanning residues 23-33, with the cross-link identified at His-29. Substitution at position +14 resulted in a cross-link to Tyr-17 within the peptide containing amino acids 13-22. These results are consistent with the structure determined by NMR and molecular dynamics calculations of the NH2-terminal headpiece-symmetric operator complex (Lamerichs, R.M.J.N., Boelens, R., van der Marel, G.A., van Boom, J.H., Kaptein, R., Buck, F., Fera, B., and Rüterjans, H. (1989) Biochemistry 28, 2895-2991; de Vlieg, J., Berendsen, H.J.C., and van Gunsteren, W.F. (1989) Proteins 6, 104-127). This structure indicates proximity of His-29 in the major groove to thymidines at positions +3 and +4. Since base pairs at positions +18 and +19 occupy symmetrical positions to +3 and +4 in the promoter distal region of the operator, it would be anticipated that cross-links similar to the +3 and +4 positions would form at these sites; this prediction is not borne out by the behavior at +4/+18, as no peptide could be identified cross-linked to DNA substituted at +4. Molecular dynamics simulations and the NMR data indicate that Tyr-17 interacts with the thymine at position +8, which is symmetrically related to position +14. Although BrdU-associated strand scission at +8

  2. Effect of DNA polymorphisms related to fatty acid composition in adipose tissue of Holstein cattle.

    PubMed

    Narukami, Takahiro; Sasazaki, Shinji; Oyama, Kenji; Nogi, Takuya; Taniguchi, Masaaki; Mannen, Hideyuki

    2011-06-01

    Fatty acid composition of adipose tissue has been recognized as an important carcass trait because of its relationship with eating quality such as favorable beef flavor and tenderness. Therefore, we investigated the effects of genetic polymorphisms of liver X receptor, alpha (LXR), stearoyl-CoA desaturase (SCD), Fatty acid synthase (FASN), and Fatty acid binding protein 4 (FABP4) on fatty acid composition in intramuscular fat tissue of Holstein steers. The major allele frequencies were 0.705 in SCD, 0.518 in FABP4, 0.888 in FASN, and 0.984 in LXR. Genotyping of SCD showed significant effect on C14:0, C14:1, C18:0 and saturated fatty acid (P < 0.05). In addition, the result suggested that SCD genotype possibly had effect on composition of C18:1 and monounsaturated fatty acid. Genotype of FABP4 had significant effect on composition of C16:0. Effect of LXR genotypes could not be analyze because of extremely biased genotype frequencies. Our results suggest that genotypes of SCD and FABP4 may in part affect meat quality in Holstein.

  3. Electrochemical detection of nucleic acids, proteins, small molecules and cells using a DNA-nanostructure-based universal biosensing platform.

    PubMed

    Lin, Meihua; Song, Ping; Zhou, Guobao; Zuo, Xiaolei; Aldalbahi, Ali; Lou, Xiaoding; Shi, Jiye; Fan, Chunhai

    2016-07-01

    The occurrence and prognosis of many complex diseases, such as cancers, is associated with the variation of various molecules, including DNA at the genetic level, RNA at the regulatory level, proteins at the functional level and small molecules at the metabolic level (defined collectively as multilevel molecules). Thus it is highly desirable to develop a single platform for detecting multilevel biomarkers for early-stage diagnosis. Here we report a protocol on DNA-nanostructure-based programmable engineering of the biomolecular recognition interface, which provides a universal electrochemical biosensing platform for the ultrasensitive detection of nucleic acids (DNA/RNA), proteins, small molecules and whole cells. The protocol starts with the synthesis of a series of differentially sized, self-assembled tetrahedral DNA nanostructures (TDNs) with site-specifically modified thiol groups that can be readily anchored on the surface of a gold electrode with high reproducibility. By exploiting the rigid structure, nanoscale addressability and versatile functionality of TDNs, one can tailor the type of biomolecular probes appended on individual TDNs for the detection of specific molecules of interest. Target binding occurring on the gold surface patterned with TDNs is quantitatively translated into electrochemical signals via a coupled enzyme-based catalytic process. This uses a sandwich assay strategy in which biotinylated reporter probes recognize TDN-bound target biomolecules, which then allow binding of horseradish-peroxidase-conjugated avidin (avidin-HRP). Hydrogen peroxide (H2O2) is then reduced by avidin-HRP in the presence of TMB (3,3',5,5'-tetramethylbenzidine) to generate a quantitative electrochemical signal. The time range for the entire protocol is ∼1 d, whereas the detection process takes ∼30 min to 3 h. PMID:27310264

  4. Ternary copper(II) complexes with amino acid chains and heterocyclic bases: DNA binding, cytotoxic and cell apoptosis induction properties.

    PubMed

    Ma, Tieliang; Xu, Jun; Wang, Yuan; Yu, Hao; Yang, Yong; Liu, Yang; Ding, Weiliang; Zhu, Wenjiao; Chen, Ruhua; Ge, Zhijun; Tan, Yongfei; Jia, Lei; Zhu, Taofeng

    2015-03-01

    Nowadays, chemotherapy is a common means of oncology. However, it is difficult to find excellent chemotherapy drugs. Here we reported three new ternary copper(II) complexes which have potential chemotherapy characteristics with reduced Schiff base ligand and heterocyclic bases (TBHP), [Cu(phen)(TBHP)]H2O (1), [Cu(dpz)(TBHP)]H2O (2) and [Cu(dppz)(TBHP)]H2O (3) (phen=1,10-phenanthroline, dpz=dipyrido [3,2:2',3'-f]quinoxaline, dppz=dipyrido [3,2-a:2',3'-c]phenazine, H2TBHP=2-(3,5-di-tert-butyl-2-hydroxybenzylamino)-2-benzyl-acetic acid). The DNA-binding properties of the complexes were investigated by spectrometric titrations, ethidium bromide displacement experiments and viscosity measurements. The results indicated that the three complexes, especially the complex 13, can strongly bind to calf-thymus DNA (CT-DNA). The intrinsic binding constants Kb of the ternary copper(II) complexes with CT-DNA were 1.37×10(5), 1.81×10(5) and 3.21×10(5) for 1, 2 and 3 respectively. Comparative cytotoxic activities of the copper(II) complexes were also determined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results showed that the ternary copper(II) complexes had significant cytotoxic activity against the human lung cancer (A549), human esophageal cancer (Eca109) and human gastric cancer (SGC7901) cell lines. Cell apoptosis were detected by AnnexinV/PI flow cytometry and by Western blotting with the protein expression of p53, Bax and Bcl-2. All the three copper complexes can effectively induce apoptosis of the three human tumor cells. PMID:25555321

  5. Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

    PubMed Central

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality. PMID:12514026

  6. Detection of deoxyribonucleic acid (DNA) targets using polymerase chain reaction (PCR) and paper surface-enhanced Raman spectroscopy (SERS) chromatography.

    PubMed

    Hoppmann, Eric P; Yu, Wei W; White, Ian M

    2014-01-01

    Surface-enhanced Raman spectroscopy (SERS) enables multiplex detection of analytes using simple, portable equipment consisting of a single excitation source and detector. Thus, in theory, SERS is ideally suited to replace fluorescence in assays that screen for numerous deoxyribonucleic acid (DNA) targets, but in practice, SERS-based assays have suffered from complexity and elaborate processing steps. Here, we report an assay in which a simple inkjet-fabricated plasmonic paper device enables SERS-based detection of multiple DNA targets within a single polymerase chain reaction (PCR). In prior work, we demonstrated the principles of chromatographic separation and SERS-based detection on inkjet-fabricated plasmonic paper. The present work extends that capability for post-PCR gene sequence detection. In this design, hydrolysis DNA probes with 5' Raman labels are utilized; if the target is present, the probe is hydrolyzed during PCR, freeing the reporter. After applying the PCR sample to a paper SERS device, an on-device chromatographic separation and concentration is conducted to discriminate between hydrolyzed and intact probes. SERS is then used to detect the reporter released by the hydrolyzed probes. This simple separation and detection on paper eliminates the need for complex sample processing steps. In this work, we simultaneously detect the methicillin-resistant Staphylococcus aureus genes mecA and femB to illustrate the concept. We envision that this approach could contribute to the development of multiplex DNA diagnostic tests enabling screening for several target sequences within a single reaction, which is necessary for cases in which sample volume and resources are limited.

  7. Ternary copper(II) complexes with amino acid chains and heterocyclic bases: DNA binding, cytotoxic and cell apoptosis induction properties.

    PubMed

    Ma, Tieliang; Xu, Jun; Wang, Yuan; Yu, Hao; Yang, Yong; Liu, Yang; Ding, Weiliang; Zhu, Wenjiao; Chen, Ruhua; Ge, Zhijun; Tan, Yongfei; Jia, Lei; Zhu, Taofeng

    2015-03-01

    Nowadays, chemotherapy is a common means of oncology. However, it is difficult to find excellent chemotherapy drugs. Here we reported three new ternary copper(II) complexes which have potential chemotherapy characteristics with reduced Schiff base ligand and heterocyclic bases (TBHP), [Cu(phen)(TBHP)]H2O (1), [Cu(dpz)(TBHP)]H2O (2) and [Cu(dppz)(TBHP)]H2O (3) (phen=1,10-phenanthroline, dpz=dipyrido [3,2:2',3'-f]quinoxaline, dppz=dipyrido [3,2-a:2',3'-c]phenazine, H2TBHP=2-(3,5-di-tert-butyl-2-hydroxybenzylamino)-2-benzyl-acetic acid). The DNA-binding properties of the complexes were investigated by spectrometric titrations, ethidium bromide displacement experiments and viscosity measurements. The results indicated that the three complexes, especially the complex 13, can strongly bind to calf-thymus DNA (CT-DNA). The intrinsic binding constants Kb of the ternary copper(II) complexes with CT-DNA were 1.37×10(5), 1.81×10(5) and 3.21×10(5) for 1, 2 and 3 respectively. Comparative cytotoxic activities of the copper(II) complexes were also determined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results showed that the ternary copper(II) complexes had significant cytotoxic activity against the human lung cancer (A549), human esophageal cancer (Eca109) and human gastric cancer (SGC7901) cell lines. Cell apoptosis were detected by AnnexinV/PI flow cytometry and by Western blotting with the protein expression of p53, Bax and Bcl-2. All the three copper complexes can effectively induce apoptosis of the three human tumor cells.

  8. APE1-mediated DNA damage repair provides survival advantage for esophageal adenocarcinoma cells in response to acidic bile salts.

    PubMed

    Hong, Jun; Chen, Zheng; Peng, Dunfa; Zaika, Alexander; Revetta, Frank; Washington, M Kay; Belkhiri, Abbes; El-Rifai, Wael

    2016-03-29

    Chronic Gastroesophageal Reflux Disease (GERD) is the main risk factor for the development of Barrett's esophagus (BE) and its progression to esophageal adenocarcinoma (EAC). Accordingly, EAC cells are subjected to high levels of oxidative stress and subsequent DNA damage. In this study, we investigated the expression and role of Apurinic/apyrimidinic endonuclease 1 (APE1) protein in promoting cancer cell survival by counteracting the lethal effects of acidic bile salts (ABS)-induced DNA damage. Immunohistochemistry analysis of human tissue samples demonstrated overexpression of APE1 in more than half of EACs (70 of 130), as compared to normal esophagus and non-dysplastic BE samples (P < 0.01). To mimic in vivo conditions, we treated in vitro cell models with a cocktail of ABS. The knockdown of endogenous APE1 in EAC FLO-1 cells significantly increased oxidative DNA damage (P < 0.01) and DNA single- and double-strand breaks (P < 0.01), whereas overexpression of APE1 in EAC OE33 cells reversed these effects. Annexin V/PI staining indicated that the APE1 expression in OE33 cells protects against ABS-induced apoptosis. In contrast, knockdown of endogenous APE1 in FLO-1 cells increased apoptosis under the same conditions. Mechanistic investigations indicated that the pro-survival function of APE1 was associated with the regulation of stress response c-Jun N-terminal protein kinase (JNK) and p38 kinases. Pharmacological inhibition of APE1 base excision repair (BER) function decreased cell survival and enhanced activation of JNK and p38 kinases by ABS. Our findings suggest that constitutive overexpression of APE1 in EAC may be an adaptive pro-survival mechanism that protects against the genotoxic lethal effects of bile reflux episodes. PMID:26934647

  9. Does the marine biotoxin okadaic acid cause DNA fragmentation in the blue mussel and the pacific oyster?

    PubMed

    McCarthy, Moira; O'Halloran, John; O'Brien, Nora M; van Pelt, Frank F N A M

    2014-10-01

    Two bivalve species of global economic importance: the blue mussel, Mytilus edulis and the pacific oyster, Crassostrea gigas were exposed in vivo, to the diarrhoetic shellfish toxin okadaic acid (OA), and impacts on DNA fragmentation were measured. Shellfish were exposed using two different regimes, the first was a single (24 h) exposure of 2.5 nM OA (∼0.1 μg/shellfish) and algal feed at the beginning of the trial (T0), after which shellfish were only fed algae. The second was daily exposure of shellfish to two different concentrations of OA mixed with the algal feed over 7 days; 1.2 nM OA (∼0.05 μg OA/shellfish/day) and 50 nM OA (∼2 μg OA/shellfish/day). Haemolymph and hepatopancreas cells were extracted following 1, 3 and 7 days exposure. Cell viability was measured using the trypan blue exclusion assay and remained above 85% for both cell types. DNA fragmentation was examined using the single-cell gel electrophoresis (comet) assay. A significant increase in DNA fragmentation was observed in the two cell types from both species relative to the controls. This increase was greater in the pacific oyster at the higher toxin concentration. However, there was no difference in the proportion of damage measured between the two cell types, and a classic dose response was not observed, increasing toxin concentration did not correspond to increased DNA fragmentation. PMID:25440785

  10. Development of a small gantry robotic workcell for deoxyribonucleic acid (DNA) filter array construction

    SciTech Connect

    Beugelsdijk, T.J.; Hollen, R.M.; Snider, K.T.

    1990-01-01

    At Los Alamos National Laboratory, we have constructed a primary cosmid library of human chromosome 16. This library consists of an 11-fold representation of the chromosome and is arrayed in microtiter plate format. A need has arisen in the large scale physical mapping of this chromosome, to array spots of DNA from each of these colonies onto filter media for hybridization studies. We are currently developing a small gantry robot-based workcell to array small spots of DNA in an interleaved format. This allows for the construction of a high spot density format filter array. This paper will discuss the features incorporated into this workcell for the handling of thousands of colonies and their automatic tracking and positioning onto the filter. 7 refs., 3 figs., 1 tab.

  11. Methods of staining target chromosomal DNA employing high complexity nucleic acid probes

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel; Kallioniemi, Ol'li-Pekka; Kallioniemi, Anne; Sakamoto, Masaru

    2006-10-03

    Methods and compositions for staining based upon nucleic acid sequence that employ nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyses. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acid probes are typically of a complexity greater than 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML), retinoblastoma, ovarian and uterine cancers, and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar but genetically different diseases, and for many prognostic and diagnostic applications.

  12. Ultraspecific and highly sensitive nucleic acid detection by integrating a DNA catalytic network with a label-free microcavity.

    PubMed

    Wu, Yuqiang; Zhang, David Yu; Yin, Peng; Vollmer, Frank

    2014-05-28

    Nucleic acid detection with label-free biosensors circumvents costly fluorophore functionalization steps associated with conventional assays by utilizing transducers of impressive ultimate detection limits. Despite this technological prowess, molecular recognition at a surface limits the biosensors' sensitivity, specificity, and reusability. It is therefore imperative to integrate novel molecular approaches with existing label-free transducers to overcome those limitations. Here, we demonstrate this concept by integrating a DNA strand displacement circuit with a micron-scale whispering gallery mode (WGM) microsphere biosensor. The integrated biosensor exhibits at least 25-fold improved nucleic acid sensitivity, and sets a new record for label-free microcavity biosensors by detecting 80 pM (32 fmol) of a 22nt oligomer; this improvement results from the catalytic behavior of the circuit. Furthermore, the integrated sensor exhibits extremely high specificity; single nucleotide variants yield 40- to 100-fold lower signal. Finally, the same physical sensor was demonstrated to alternatingly detect 2 different nucleic acid sequences through 5 cycles of detection, showcasing both its reusability and its versatility.

  13. Development of a nucleic Acid extraction procedure for simultaneous recovery of DNA and RNA from diverse microbes in water.

    PubMed

    Hill, Vincent R; Narayanan, Jothikumar; Gallen, Rachel R; Ferdinand, Karen L; Cromeans, Theresa; Vinjé, Jan

    2015-01-01

    Drinking and environmental water samples contain a diverse array of constituents that can interfere with molecular testing techniques, especially when large volumes of water are concentrated to the small volumes needed for effective molecular analysis. In this study, a suite of enteric viruses, bacteria, and protozoan parasites were seeded into concentrated source water and finished drinking water samples, in order to investigate the relative performance of nucleic acid extraction techniques for molecular testing. Real-time PCR and reverse transcription-PCR crossing threshold (CT) values were used as the metrics for evaluating relative performance. Experimental results were used to develop a guanidinium isothiocyanate-based lysis buffer (UNEX buffer) that enabled effective simultaneous extraction and recovery of DNA and RNA from the suite of study microbes. Procedures for bead beating, nucleic acid purification, and PCR facilitation were also developed and integrated in the protocol. The final lysis buffer and sample preparation procedure was found to be effective for a panel of drinking water and source water concentrates when compared to commercial nucleic acid extraction kits. The UNEX buffer-based extraction protocol enabled PCR detection of six study microbes, in 100 L finished water samples from four drinking water treatment facilities, within three CT values (i.e., within 90% difference) of the reagent-grade water control. The results from this study indicate that this newly formulated lysis buffer and sample preparation procedure can be useful for standardized molecular testing of drinking and environmental waters.

  14. Cysteine residues in the zinc finger and amino acids adjacent to the finger are necessary for DNA binding by the LAC9 regulatory protein of Kluyveromyces lactis.

    PubMed Central

    Witte, M M; Dickson, R C

    1988-01-01

    LAC9 is a positive regulatory protein that controls transcription of the lactose-galactose regulon in Kluyveromyces lactis. LAC9 is homologous to the GAL4 protein of Saccharomyces cerevisiae. Both proteins have a single "zinc finger" which plays a role in DNA binding. We previously hypothesized (L. V. Wray, M. M. Witte, R. C. Dickson, and M. I. Riley, Mol. Cell. Biol. 7:1111-1121, 1987) that the DNA-binding domain of the LAC9 protein consisted of the zinc finger as well as a region of amino acids on the carboxyl-terminal side of the zinc finger. In this study we used oligonucleotide-directed mutagenesis to introduce 13 single-amino-acid changes into the proposed DNA-binding domain of the LAC9 protein. Variant LAC9 proteins carrying an amino acid substitution in any one of the four highly conserved Cys residues of the zinc finger had reduced DNA-binding activity, suggesting that each Cys is necessary for DNA binding. Three of four variant LAC9 proteins with amino acid substitutions located on the carboxyl-terminal side of the zinc finger had reduced DNA-binding activity. These results support our hypothesis that the DNA-binding domain of the LAC9 protein is composed of the zinc finger and the adjacent region on the carboxyl side of the zinc finger, a region that has the potential to form an alpha-helix. Finally, LAC9 proteins containing His residues substituted for the conserved Cys residues also had reduced DNA-binding activity, indicating that His residues are not equivalent to Cys residues, as had been previously thought. Images PMID:3146691

  15. Prooxidant DNA breakage induced by caffeic acid in human peripheral lymphocytes: involvement of endogenous copper and a putative mechanism for anticancer properties.

    PubMed

    Bhat, S H; Azmi, A S; Hadi, S M

    2007-02-01

    Plant-derived dietary material contains several classes of polyphenols such as flavonoids, curcuminoids, stilbenes and hydroxycinnamic acids. They are recognized as naturally occurring antioxidants but also act as prooxidants catalyzing cellular DNA degradation in the presence of transition metal ions such as copper. Earlier we have shown that the stilbene resveratrol is able to mobilize endogenous copper ions leading to oxidative breakage of cellular DNA. In this paper, we show that caffeic acid (a hydroxycinnamic acid), which is a major constituent of coffee, is also capable of DNA breakage in human peripheral lymphocytes. Incubation of lymphocytes with neocuproine inhibited the DNA degradation confirming that Cu(I) is an intermediate in the DNA cleavage reaction. Further, we have also shown that caffeic acid generates oxidative stress in lymphocytes, which is inhibited by scavengers of reactive oxygen species and neocuproine. These results are in further support of our hypothesis that anticancer mechanism of plant polyphenols involves mobilization of endogenous copper, possibly chromatin bound copper, and the consequent prooxidant action.

  16. Prooxidant DNA breakage induced by caffeic acid in human peripheral lymphocytes: Involvement of endogenous copper and a putative mechanism for anticancer properties

    SciTech Connect

    Bhat, S.H.; Azmi, A.S.; Hadi, S.M. . E-mail: smhadi@vsnl.com

    2007-02-01

    Plant-derived dietary material contains several classes of polyphenols such as flavonoids, curcuminoids, stilbenes and hydroxycinnamic acids. They are recognized as naturally occurring antioxidants but also act as prooxidants catalyzing cellular DNA degradation in the presence of transition metal ions such as copper. Earlier we have shown that the stilbene resveratrol is able to mobilize endogenous copper ions leading to oxidative breakage of cellular DNA. In this paper, we show that caffeic acid (a hydroxycinnamic acid), which is a major constituent of coffee, is also capable of DNA breakage in human peripheral lymphocytes. Incubation of lymphocytes with neocuproine inhibited the DNA degradation confirming that Cu(I) is an intermediate in the DNA cleavage reaction. Further, we have also shown that caffeic acid generates oxidative stress in lymphocytes, which is inhibited by scavengers of reactive oxygen species and neocuproine. These results are in further support of our hypothesis that anticancer mechanism of plant polyphenols involves mobilization of endogenous copper, possibly chromatin bound copper, and the consequent prooxidant action.

  17. Solution structure of the single-stranded DNA binding protein of the filamentous Pseudomonas phage Pf3: similarity to other proteins binding to single-stranded nucleic acids.

    PubMed Central

    Folmer, R H; Nilges, M; Konings, R N; Hilbers, C W

    1995-01-01

    The three-dimensional structure of the homodimeric single-stranded DNA binding protein encoded by the filamentous Pseudomonas bacteriophage Pf3 has been determined using heteronuclear multidimensional NMR techniques and restrained molecular dynamics. NMR experiments and structure calculations have been performed on a mutant protein (Phe36 --> His) that was successfully designed to reduce the tendency of the protein to aggregate. The protein monomer is composed of a five-stranded antiparallel beta-sheet from which two beta-hairpins and a large loop protrude. The structure is compared with the single-stranded DNA binding protein encoded by the filamentous Escherichia coli phage Ff, a protein with a similar biological function and DNA binding properties, yet quite different amino acid sequence, and with the major cold shock protein of Escherichia coli, a single-stranded DNA binding protein with an entirely different sequence, biological function and binding characteristics. The amino acid sequence of the latter is highly homologous to the nucleic acid binding domain (i.e. the cold shock domain) of proteins belonging to the Y-box family. Despite their differences in amino acid sequence and function, the folds of the three proteins are remarkably similar, suggesting that this is a preferred folding pattern shared by many single-stranded DNA binding proteins. Images PMID:7556054

  18. DNA-damaging disinfection byproducts: alkylation mechanism of mutagenic mucohalic acids.

    PubMed

    Gómez-Bombarelli, Rafael; González-Pérez, Marina; Arenas-Valgañón, Jorge; Céspedes-Camacho, Isaac Fabián; Calle, Emilio; Casado, Julio

    2011-10-15

    Hydroxyhalofuranones form a group of genotoxic disinfection byproduct (DBP) of increasing interest. Among them, mucohalic acids (3,4-dihalo-5-hydroxyfuran-2(5H)-one, MXA) are known mutagens that react with nucleotides, affording etheno, oxaloetheno, and halopropenal derivatives. Mucohalic acids have also found use in organic synthesis due to their high functionalization. In this work, the alkylation kinetics of mucochloric and mucobromic acids with model nucleophiles aniline and NBP has been studied experimentally. Also, the alkylation mechanism of nucleosides by MXA has been studied in silico. The results described allow us to reach the following conclusions: (i) based on the kinetic and computational evidence obtained, a reaction mechanism was proposed, in which MXA react directly with amino groups in nucleotides, preferentially attacking the exocyclic amino groups over the endocyclic aromatic nitrogen atoms; (ii) the suggested mechanism is in agreement with both the product distribution observed experimentally and the mutational pattern of MXA; (iii) the limiting step in the alkylation reaction is addition to the carbonyl group, subsequent steps occurring rapidly; and (iv) mucoxyhalic acids, the hydrolysis products of MXA, play no role in the alkylation reaction by MXA.

  19. Comparison of Five Commercial Nucleic Acid Extraction Kits for the PCR-based Detection of Burkholderia Pseudomallei DNA in Formalin-Fixed, Paraffin-Embedded Tissues

    PubMed Central

    Obersteller, Sonja; Neubauer, Heinrich; Hagen, Ralf Matthias; Frickmann, Hagen

    2016-01-01

    The extraction and further processing of nucleic acids (NA) from formalin-fixed paraffin-embedded (FFPE) tissues for microbiological diagnostic polymerase chain reaction (PCR) approaches is challenging. Here, we assessed the effects of five different commercially available nucleic acid extraction kits on the results of real-time PCR. FFPE samples from organs of Burkholderia pseudomallei-infected Swiss mice were subjected to processing with five different extraction kits from QIAGEN (FFPE DNA Tissue Kit, EZ1 DNA Tissue Kit, DNA Mini Kit, DNA Blood Mini Kit, and FlexiGene DNA Kit) in combination with three different real-time PCRs targeting B. pseudomallei-specific sequences of varying length after 16 years of storage. The EZ1 DNA Tissue Kit and the DNA Mini Kit scored best regarding the numbers of successful PCR reactions. In case of positive PCR, differences regarding the cycle-threshold (Ct) values were marginal. The impact of the applied extraction kits on the reliability of PCR from FFPE material seems to be low. Interfering factors like the quality of the dewaxing procedure or the sample age appear more important than the selection of specialized FFPE kits. PMID:27766174

  20. A label-free fluorescent probe based on DNA-templated silver nanoclusters and exonuclease III-assisted recycling amplification detection of nucleic acid.

    PubMed

    Yang, Wen; Tian, Jianniao; Ma, Yefei; Wang, Lijun; Zhao, Yanchun; Zhao, Shulin

    2015-11-01

    A number of specific nucleic acids are closely related with many serious diseases, in the current research, a platform taking advantage of exonuclease III (Exo III) to realize double recycling amplification and label-free fluorescent DNA-templated silver nanoclusters (DNA-AgNCs) for detecting of nucleic acid had been developed. In this method, a molecular beacon (MB) with 3'-protruding termini and a single-stranded cytosine-rich (C-rich) probe were designed that coexist stably with Exo III. Once the target DNA appeared, portion of the MB could hybridize with target DNA and was digested by Exo III, which allowed the release of target DNA and a residual sequence. Subsequently, the residual sequence could trigger the Exo III to digest C-rich probe, and the DNA-AgNCs was not able to be synthesized because of the C-rich probe was destroyed; finally the fluorescent of solution was quenched. This assay enables to monitor human hemochromatosis gene (as a model) with high sensitivity, the detection limit is as low as 120 pM compared with other fluorescence DNA-AgNCs methods, this assay also exhibits superior specificity even against single base mismatch. The strategy is applied to detect human hemochromatosis gene in real human serum samples successfully. PMID:26572843

  1. A label-free fluorescent probe based on DNA-templated silver nanoclusters and exonuclease III-assisted recycling amplification detection of nucleic acid.

    PubMed

    Yang, Wen; Tian, Jianniao; Ma, Yefei; Wang, Lijun; Zhao, Yanchun; Zhao, Shulin

    2015-11-01

    A number of specific nucleic acids are closely related with many serious diseases, in the current research, a platform taking advantage of exonuclease III (Exo III) to realize double recycling amplification and label-free fluorescent DNA-templated silver nanoclusters (DNA-AgNCs) for detecting of nucleic acid had been developed. In this method, a molecular beacon (MB) with 3'-protruding termini and a single-stranded cytosine-rich (C-rich) probe were designed that coexist stably with Exo III. Once the target DNA appeared, portion of the MB could hybridize with target DNA and was digested by Exo III, which allowed the release of target DNA and a residual sequence. Subsequently, the residual sequence could trigger the Exo III to digest C-rich probe, and the DNA-AgNCs was not able to be synthesized because of the C-rich probe was destroyed; finally the fluorescent of solution was quenched. This assay enables to monitor human hemochromatosis gene (as a model) with high sensitivity, the detection limit is as low as 120 pM compared with other fluorescence DNA-AgNCs methods, this assay also exhibits superior specificity even against single base mismatch. The strategy is applied to detect human hemochromatosis gene in real human serum samples successfully.

  2. The acidic C-terminus of vaccinia virus I3 single-strand binding protein promotes proper assembly of DNA-protein complexes.

    PubMed

    Harrison, Melissa L; Desaulniers, Megan A; Noyce, Ryan S; Evans, David H

    2016-02-01

    The vaccinia virus I3L gene encodes a single-stranded DNA binding protein (SSB) that is essential for virus DNA replication and is conserved in all Chordopoxviruses. The I3 protein contains a negatively charged C-terminal tail that is a common feature of SSBs. Such acidic tails are critical for SSB-dependent replication, recombination and repair. We cloned and purified variants of the I3 protein, along with a homolog from molluscum contagiosum virus, and tested how the acidic tail affected DNA-protein interactions. Deleting the C terminus of I3 enhanced the affinity for single-stranded DNA cellulose and gel shift analyses showed that it also altered the migration of I3-DNA complexes in agarose gels. Microinjecting an antibody against I3 into vaccinia-infected cells also selectively inhibited virus replication. We suggest that this domain promotes cooperative binding of I3 to DNA in a way that would maintain an open DNA configuration around a replication site.

  3. [Gene therapy: nucleic acids as drugs. Action mechanisms and delivery into the cell].

    PubMed

    Cavagnari, Brian M

    2011-06-01

    Gene therapy involves the transference of new genetic material to the cell in order to obtain a therapeutic benefit, offering a new option for the treatment of various diseases. In this article, some of these nucleic acid-based drugs, such as plasmids, aptamers, oligonucleotides, ribozymes and small interfering ribonucleic acid, are presented. Their mechanism and level of action is commented and several delivery systems, such as liposomes, cationic polymers, direct nucleic acid transfer and viral vectors, are also discussed.

  4. Dna Sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  5. Selenium-Assisted Nucleic Acid Crystallography: Use of DNA Phosphoroselenoates for MAD Phasing

    SciTech Connect

    Wilds, C.J.; Pattanayek, R.; Pan, C.; Wawrzak, Z.; Egli, M.

    2010-03-08

    The combination of synchrotron radiation and a variety of atoms or ions (either covalently attached to the biomolecule prior to crystallization or soaked into crystals) that serve as anomalous scatterers constitutes a powerful tool in the X-ray crystallographer's repertoire of structure determination techniques. Phosphoroselenoates in which one of the nonbridging phosphate oxygens in the backbone is replaced by selenium offer a simplified means for introducing an anomalous scatterer into oligonucleotides by conventional solid-phase synthesis. Unlike other methods that are used to derivatize DNA or RNA by covalent attachment of a heavy atom (i.e., bromine at the C5 position of pyrimidines), tedious synthesis of specialized nucleosides is not required. Introduction of selenium is readily accomplished in solid-phase oligonucleotide synthesis by replacing the standard oxidation agent with a solution of potassium selenocyanide. This results in a diastereomeric mixture of phosphoroselenoates that can be separated by strong anion-exchange HPLC. As a test case, all 10 DNA hexamers of the sequence CGCGCG containing a single phosphoroselenoate linkage (PSe) were prepared. Crystals were grown for a subset of them, and the structure of [d(C{sub PSe}GCGCG)]{sub 2} was determined by the multiwavelength anomalous dispersion technique and refined to 1.1 {angstrom} resolution.

  6. A split G-quadruplex-based DNA nano-tweezers structure as a signal-transducing molecule for the homogeneous detection of specific nucleic acids.

    PubMed

    Nakatsuka, Keisuke; Shigeto, Hajime; Kuroda, Akio; Funabashi, Hisakage

    2015-12-15

    A portable method of specific nucleic acid detection would be very useful for monitoring public health in a variety of settings for point-of-care and point-of-need testing. However, conventional methods for the detection of nucleic acids are not ideal for use in the field, as they require skilled operators and complex equipment. Here, we constructed a method for specific nucleic acid detection using a split G-quadruplex (Gq) structure that can recognize target nucleic acids without competitive reactions in a bimolecular reaction and directly produce a detectable signal based on peroxidase activity. We developed a single signal-transducing molecule with a split Gq-based DNA-nano tweezers (NT) structure that self-assembles from three single-stranded DNAs through simple mixing, and detects its target without requiring any washing steps. A model target, a partial norovirus mRNA (NV-RNA), was specifically recognized by the split Gq-based DNA-NT, causing it to undergo a structural change that restored its peroxidase activity. The peroxidase activity was measured by following the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), which gave a greenish colorimetric response, and was proportional to the NV-RNA concentration. The lower detection limit was 4 nM. Our results demonstrated the feasibility of detecting specific nucleic acids with a split Gq-based DNA-NT structure as a nucleic acid signal-transducing molecule in a homogenous assay format. Also the target recognition sites of split Gq-based DNA-NT can easily be designed without delicate optimization of tweezers structure. Thus a split Gq-based DNA-NT technique is readily applicable to a basic platform for the development of a portable device.

  7. Duplex DNA-Invading γ-Modified Peptide Nucleic Acids Enable Rapid Identification of Bloodstream Infections in Whole Blood

    PubMed Central

    Nölling, Jörk; Rapireddy, Srinivas; Amburg, Joel I.; Crawford, Elizabeth M.; Prakash, Ranjit A.; Rabson, Arthur R.

    2016-01-01

    ABSTRACT Bloodstream infections are a leading cause of morbidity and mortality. Early and targeted antimicrobial intervention is lifesaving, yet current diagnostic approaches fail to provide actionable information within a clinically viable time frame due to their reliance on blood culturing. Here, we present a novel pathogen identification (PID) platform that features the use of duplex DNA-invading γ-modified peptide nucleic acids (γPNAs) for the rapid identification of