Science.gov

Sample records for acid dna synthesis

  1. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  2. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  3. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus.

  4. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  5. DNA (deoxyribonucleic acid) synthesis following microinjection of heterologous sperm and somatic cell nuclei into hamster oocytes

    SciTech Connect

    Naish, S.J.; Perreault, S.D.; Zirkin, B.R.

    1987-01-01

    The authors investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in /sup 3/H-thymidine after being parthenogenetically activated by sham microinjection, or microinjected with hamster, mouse, rabbit, or fish sperm nuclei, or hamster hepatocyte nuclei. Within 6 hr of sham or nucleus microinjection, nuclei of each type underwent transformation into pronuclei and synthesized DNA. These results demonstrated that the hamster egg can access and utilize its own and each type of template provided, whether homologous or heterologous. However, pronuclei derived from hamster sperm nuclei were more likely to be synthesizing DNA at 6 hr than pronuclei derived from sperm nuclei of other species. The authors conclude that the mechanisms employed by the hamster oocyte to transform hamster sperm nuclei into pronuclei and to effect DNA synthesis in these nuclei are not specific for the hamster sperm nucleus. Nevertheless, these mechanisms apparently operate more efficiently when the hamster sperm nucleus, rather than a heterologous sperm nucleus, is present.

  6. Synthesis of chemically modified DNA.

    PubMed

    Shivalingam, Arun; Brown, Tom

    2016-06-15

    Naturally occurring DNA is encoded by the four nucleobases adenine, cytosine, guanine and thymine. Yet minor chemical modifications to these bases, such as methylation, can significantly alter DNA function, and more drastic changes, such as replacement with unnatural base pairs, could expand its function. In order to realize the full potential of DNA in therapeutic and synthetic biology applications, our ability to 'write' long modified DNA in a controlled manner must be improved. This review highlights methods currently used for the synthesis of moderately long chemically modified nucleic acids (up to 1000 bp), their limitations and areas for future expansion. PMID:27284032

  7. Synthesis of nucleoside and nucleotide conjugates of bile acids, and polymerase construction of bile acid-functionalized DNA.

    PubMed

    Ikonen, Satu; Macícková-Cahová, Hana; Pohl, Radek; Sanda, Miloslav; Hocek, Michal

    2010-03-01

    Aqueous Sonogashira cross-coupling reactions of 5-iodopyrimidine or 7-iodo-7-deazaadenine nucleosides with bile acid-derived terminal acetylenes linked via an ester or amide tether gave the corresponding bile acid-nucleoside conjugates. Analogous reactions of halogenated nucleoside triphosphates gave directly bile acid-modified dNTPs. Enzymatic incorporation of these modified nucleotides to DNA was successfully performed using Phusion polymerase for primer extension. One of the dNTPs (dCTP bearing cholic acid) was also efficient for PCR amplification. PMID:20165813

  8. DNA adducts of aristolochic acid II: total synthesis and site-specific mutagenesis studies in mammalian cells

    PubMed Central

    Attaluri, Sivaprasad; Bonala, Radha R.; Yang, In-Young; Lukin, Mark A.; Wen, Yujing; Grollman, Arthur P.; Moriya, Masaaki; Iden, Charles R.; Johnson, Francis

    2010-01-01

    Aristolochic acids I and II (AA-I, AA-II) are found in all Aristolochia species. Ingestion of these acids either in the form of herbal remedies or as contaminated wheat flour causes a dose-dependent chronic kidney failure characterized by renal tubulointerstitial fibrosis. In ∼50% of these cases, the condition is accompanied by an upper urinary tract malignancy. The disease is now termed aristolochic acid nephropathy (AAN). AA-I is largely responsible for the nephrotoxicity while both AA-I and AA-II are genotoxic. DNA adducts derived from AA-I and AA-II have been isolated from renal tissues of patients suffering from AAN. We describe the total synthesis, de novo, of the dA and dG adducts derived from AA-II, their incorporation site-specifically into DNA oligomers and the splicing of these modified oligomers into a plasmid construct followed by transfection into mouse embryonic fibroblasts. Analysis of the plasmid progeny revealed that both adducts blocked replication but were still partly processed by DNA polymerase(s). Although the majority of coding events involved insertion of correct nucleotides, substantial misincorporation of bases also was noted. The dA adduct is significantly more mutagenic than the dG adduct; both adducts give rise, almost exclusively, to misincorporation of dA, which leads to AL-II-dA→T and AL-II-dG→T transversions. PMID:19854934

  9. DNA Three Way Junction Core Decorated with Amino Acids-Like Residues-Synthesis and Characterization.

    PubMed

    Addamiano, Claudia; Gerland, Béatrice; Payrastre, Corinne; Escudier, Jean-Marc

    2016-01-01

    Construction and physico-chemical behavior of DNA three way junction (3WJ) functionalized by protein-like residues (imidazole, alcohol and carboxylic acid) at unpaired positions at the core is described. One 5'-C(S)-propargyl-thymidine nucleotide was specifically incorporated on each strand to react through a post synthetic CuACC reaction with either protected imidazolyl-, hydroxyl- or carboxyl-azide. Structural impacts of 5'-C(S)-functionalization were investigated to evaluate how 3WJ flexibility/stability is affected. PMID:27563857

  10. Homodinuclear lanthanide complexes of phenylthiopropionic acid: synthesis, characterization, cytotoxicity, DNA cleavage, and antimicrobial activity.

    PubMed

    Shiju, C; Arish, D; Kumaresan, S

    2013-03-15

    Lanthanide complexes of La(III), Pr(III), Nd(III), Sm(III), and Ho(III) with phenylthiopropionic acid were synthesized and characterized by elemental analysis, mass, IR, electronic spectra, molar conductance, TGA, and powder XRD. The results show that the lanthanide complexes are homodinuclear in nature. The two lanthanide ions are bridged by eight oxygen atoms from four carboxylate groups. Thermal decomposition profiles are consistent with the proposed formulations. Powder XRD studies show that all the complexes are amorphous in nature. Antimicrobial studies indicate that these complexes exhibit more activity than the ligand itself. The DNA cleavage activity of the ligand and its complexes were assayed on Escherichia coli DNA using gel electrophoresis in the presence of H(2)O(2). The result shows that the Pr(III) and Nd(III) complexes have completely cleaved the DNA. The anticancer activities of the complexes have also been studied towards human cervical cancer cell line (HeLa) and colon cancer cells (HCT116) and it was found that the La(III) and Nd(III) complexes are more active than the corresponding Pr(III), Sm(III), Ho(III) complexes, and the free ligand on both the cancer cells.

  11. Homodinuclear lanthanide complexes of phenylthiopropionic acid: Synthesis, characterization, cytotoxicity, DNA cleavage, and antimicrobial activity

    NASA Astrophysics Data System (ADS)

    Shiju, C.; Arish, D.; Kumaresan, S.

    2013-03-01

    Lanthanide complexes of La(III), Pr(III), Nd(III), Sm(III), and Ho(III) with phenylthiopropionic acid were synthesized and characterized by elemental analysis, mass, IR, electronic spectra, molar conductance, TGA, and powder XRD. The results show that the lanthanide complexes are homodinuclear in nature. The two lanthanide ions are bridged by eight oxygen atoms from four carboxylate groups. Thermal decomposition profiles are consistent with the proposed formulations. Powder XRD studies show that all the complexes are amorphous in nature. Antimicrobial studies indicate that these complexes exhibit more activity than the ligand itself. The DNA cleavage activity of the ligand and its complexes were assayed on Escherichia coli DNA using gel electrophoresis in the presence of H2O2. The result shows that the Pr(III) and Nd(III) complexes have completely cleaved the DNA. The anticancer activities of the complexes have also been studied towards human cervical cancer cell line (HeLa) and colon cancer cells (HCT116) and it was found that the La(III) and Nd(III) complexes are more active than the corresponding Pr(III), Sm(III), Ho(III) complexes, and the free ligand on both the cancer cells.

  12. Translesion DNA synthesis

    PubMed Central

    Vaisman, Alexandra; McDonald, John P.; Woodgate, Roger

    2014-01-01

    All living organisms are continually exposed to agents that damage their DNA, which threatens the integrity of their genome. As a consequence, cells are equipped with a plethora of DNA repair enzymes to remove the damaged DNA. Unfortunately, situations nevertheless arise where lesions persist, and these lesions block the progression of the cell’s replicase. Under these situations, cells are forced to choose between recombination-mediated “damage avoidance” pathways, or use a specialized DNA polymerase (pol) to traverse the blocking lesion. The latter process is referred to as Translesion DNA Synthesis (TLS). As inferred by its name, TLS not only results in bases being (mis)incorporated opposite DNA lesions, but also downstream of the replicase-blocking lesion, so as to ensure continued genome duplication and cell survival. Escherichia coli and Salmonella typhimurium possess five DNA polymerases, and while all have been shown to facilitate TLS under certain experimental conditions, it is clear that the LexA-regulated and damage-inducible pols II, IV and V perform the vast majority of TLS under physiological conditions. Pol V can traverse a wide range of DNA lesions and performs the bulk of mutagenic TLS, whereas pol II and pol IV appear to be more specialized TLS polymerases. PMID:26442823

  13. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  14. Synthesis of gamma-substituted peptide nucleic acids: a new place to attach fluorophores without affecting DNA binding.

    PubMed

    Englund, Ethan A; Appella, Daniel H

    2005-08-01

    Molecular beacon strategies using PNA are currently restricted to fluorophore attachment to the ends of the PNA. We report the synthesis of PNA oligomers wherein fluorophores can be attached to the PNA backbone from novel gamma-lysine PNA monomers. Oligomers incorporating the modified PNA showed comparable thermal stability to the corresponding aegPNA oligomer with DNA. When the modified PNA oligomer was annealed with complementary DNA, the fluorescence intensity increased 4-fold over the unbound PNA. [structure: see text

  15. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(A)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of know chemical and physical mutagens. Neither retinol or retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 ..mu..M to 50 ..mu..M. Retinol and retinoic acid did not significantly affect 200..mu..g/mL ethyl methanesulfonate (EMS)- or 32 J/m/sup 2/ ultraviolet light (UV)-induced UDS at concentrations ranging from 1..mu..M to 50 ..mu..M. In contrast, retinol and retinoic acid significantly inhibited 2.5 ..mu..g/mL and 5.0 ..mu..g/mL 7,12-dimethyl-benz(a)-anthracene(DMBA)-induced UDS at concentrations of 1..mu..M or greater. Retinol-and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 ..mu..M and 100 ..mu..M. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  16. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(a)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of known chemical and physical mutagens. Neither retinol nor retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 microM to 50 microM. Retinol and retinoic acid did not significantly affect 200 micrograms/mL ethyl methanesulfonate(EMS)- or 32 J/m2 ultraviolet light(UV)-induced UDS at concentrations ranging from 1 microM to 50 microM. In contrast, retinol and retinoic acid significantly inhibited 2.5 micrograms/mL and 5.0 micrograms/mL 7,12-dimethyl-benz(a)anthracene(DMBA)-induced UDS at concentrations of 1 microM or greater. Retinol- and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 microM and 100 microM. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  17. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    PubMed

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  18. Direct electrical detection of DNA synthesis

    PubMed Central

    Pourmand, Nader; Karhanek, Miloslav; Persson, Henrik H. J.; Webb, Chris D.; Lee, Thomas H.; Zahradníková, Alexandra; Davis, Ronald W.

    2006-01-01

    Rapid, sequence-specific DNA detection is essential for applications in medical diagnostics and genetic screening. Electrical biosensors that use immobilized nucleic acids are especially promising in these applications because of their potential for miniaturization and automation. Current DNA detection methods based on sequencing by synthesis rely on optical readouts; however, a direct electrical detection method for this technique is not available. We report here an approach for direct electrical detection of enzymatically catalyzed DNA synthesis by induced surface charge perturbation. We discovered that incorporation of a complementary deoxynucleotide (dNTP) into a self-primed single-stranded DNA attached to the surface of a gold electrode evokes an electrode surface charge perturbation. This event can be detected as a transient current by a voltage-clamp amplifier. Based on current understanding of polarizable interfaces, we propose that the electrode detects proton removal from the 3′-hydroxyl group of the DNA molecule during phosphodiester bond formation. PMID:16614066

  19. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  20. Synthesis and multi-spectroscopic DNA binding study of 1,3,4-oxadiazole and 1,3,4-thiadiazole derivatives of fatty acid.

    PubMed

    Hassan, Mohammad F; Rauf, Abdul

    2016-01-15

    A facile and convenient synthesis of a series of fatty acid derivatives of 1,3,4-oxadiazole and 1,3,4-thiadiazole has been described. The key step of this protocol is the cyclization of acyl thiosemicarbazides via iodobenzene diacetate and methanesulfonic acid under mild conditions. The newly synthesized compounds were characterized by FT-IR, (1)HNMR, (13)CNMR and mass spectral study. The binding affinity of 5-(pentadecyl)-N-propenyl-1,3,4-oxadiazol-2-amine (3a) and 5-(heptadecyl)-2-amino-1,3,4-thiadiazole (6a) with CT-DNA has been evaluated by UV, fluorescence, Circular Dichroism (CD) and thermal denaturation studies. It has been found that these small and planer heteroaromatic compounds are capable of binding to the minor groove region of DNA.

  1. Synthesis and multi-spectroscopic DNA binding study of 1,3,4-oxadiazole and 1,3,4-thiadiazole derivatives of fatty acid

    NASA Astrophysics Data System (ADS)

    Hassan, Mohammad F.; Rauf, Abdul

    2016-01-01

    A facile and convenient synthesis of a series of fatty acid derivatives of 1,3,4-oxadiazole and 1,3,4-thiadiazole has been described. The key step of this protocol is the cyclization of acyl thiosemicarbazides via iodobenzene diacetate and methanesulfonic acid under mild conditions. The newly synthesized compounds were characterized by FT-IR, 1HNMR, 13CNMR and mass spectral study. The binding affinity of 5-(pentadecyl)-N-propenyl-1,3,4-oxadiazol-2-amine (3a) and 5-(heptadecyl)-2-amino-1,3,4-thiadiazole (6a) with CT-DNA has been evaluated by UV, fluorescence, Circular Dichroism (CD) and thermal denaturation studies. It has been found that these small and planer heteroaromatic compounds are capable of binding to the minor groove region of DNA.

  2. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  3. Synthesis, physicochemical studies, embryos toxicity and DNA interaction of some new Iron(II) Schiff base amino acid complexes

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; El-Khatib, Rafat M.; Nassr, Lobna A. E.; Abu-Dief, Ahmed M.

    2013-05-01

    New Fe(II) Schiff base amino acid complexes derived from the condensation of o-hydroxynaphthaldehyde with L-alanine, L-phenylalanine, L-aspartic acid, L-histidine and L-arginine were synthesized and characterized by elemental analysis, IR, electronic spectra, and conductance measurements. The stoichiometry and the stability constants of the complexes were determined spectrophotometrically. The investigated Schiff bases exhibited tridentate coordination mode with the general formulae [Fe(HL)2]·nH2O for all amino acids except L-histidine. But in case of L-histidine, the ligand acts as tetradentate ([FeL(H2O)2]·2H2O), where HL = mono anion and L = dianion of the ligand. The structure of the prepared complexes is suggested to be octahedral. The prepared complexes were tested for their toxicity on chick embryos and found to be safe until a concentration of 100 μg/egg with full embryos formation. The interaction between CT-DNA and the investigated complexes were followed by spectrophotometry and viscosity measurements. It was found that, the prepared complexes bind to DNA via classical intercalative mode and showed a different DNA cleavage activity with the sequence: nhi > nari > nali > nasi > nphali. The thermodynamic Profile of the binding of nphali complex and CT-DNA was constructed by analyzing the experimental data of absorption titration and UV melting studies with the McGhee equation, van't Hoff's equation, and the Gibbs-Helmholtz equation.

  4. A beta-D-allopyranoside-grafted Ru(II) complex: synthesis and acid-base and DNA-binding properties.

    PubMed

    Ma, Yan-Zi; Yin, Hong-Ju; Wang, Ke-Zhi

    2009-08-01

    A new ruthenium(II) complex grafted with beta-d-allopyranoside, Ru(bpy)(2)(Happip)(ClO(4))(2) (where bpy = 2,2'-bipyridine; Happip = 2-(4-(beta-d-allopyranoside)phenyl)imidazo[4,5-f][1,10]phenanthroline), has been synthesized and characterized by elemental analysis, (1)H NMR spectroscopy, and mass spectrometry. The acid-base properties of the complex have been studied by UV-visible and luminescence spectrophotometric pH titrations, and ground- and excited-state ionization constants have been derived. The Ru(II) complex functions as a DNA intercalator as revealed by UV-visible and emission titrations, salt effects, steady-state emission quenching by [Fe(CN)(6)](4-), DNA competitive binding with ethidium bromide, DNA melting experiment, and viscosity measurements.

  5. Monounsaturated and polyunsaturated n-6 fatty acid-enriched diets modify LDL oxidation and decrease human coronary smooth muscle cell DNA synthesis.

    PubMed

    Mata, P; Varela, O; Alonso, R; Lahoz, C; de Oya, M; Badimon, L

    1997-10-01

    Proliferation of smooth muscle cells (SMCs) plays an important role in atherosclerotic lesion progression. The purpose of this investigation was to examine the effect of diets differing in fatty acid composition on human coronary SMC entry in the cell proliferation cycle. Twenty-four healthy men and women were placed on four consecutive diets lasting 5 weeks each: (1) saturated fatty acid (SFA)-rich diet with palm oil; (2) monounsaturated fatty acid (MUFA)-rich diet with olive oil; (3) polyunsaturated fatty acid (PUFA) n-6-rich diet with sunflower oil; and (4) PUFA n-3-rich diet (3.8 g/d). All diets supplied 35% of calories as fat. Compared with the SFA diet, all unsaturated diets reduced LDL cholesterol. Resistance of LDL to oxidative modification was significantly increased during the MUFA period (P < .05). Human coronary SMCs were cultured and induced by sera derived from the different groups. 3H-Thymidine incorporation into doubling DNA was significantly (P < .01) reduced during the MUFA and PUFA n-6 periods but not during the PUFA n-3 diet with respect to the SFA diet. This effect was more pronounced in women than in men. In conclusion, the MUFA-enriched diet reduced SMC DNA synthesis and LDL levels and protected LDL from oxidation. Therefore, these combined effects suggest that an oleic acid-rich Mediterranean diet could be better than PUFA (n-6)- or PUFA (n-3)-rich diets in the prevention of atherosclerosis.

  6. Concepts in Biochemistry: Chemical Synthesis of DNA.

    ERIC Educational Resources Information Center

    Caruthers, Marvin H.

    1989-01-01

    Outlines the chemistry of the rapid synthesis of relatively large DNA fragments (100-200 monomers each) with yields exceeding 99 percent per coupling. DNA synthesis methodologies are outlined and a polymer-supported synthesis of DNA using deoxynucleoside phosphoramidites is described with structural formulas. (YP)

  7. Synthesis, spectroscopic characterization and in vitro antimicrobial, anticancer and antileishmanial activities as well interaction with Salmon sperm DNA of newly synthesized carboxylic acid derivative, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid.

    PubMed

    Sirajuddin, Muhammad; Ali, Saqib; McKee, Vickie; Ullah, Hameed

    2015-03-01

    This paper stresses on the synthesis, characterization of novel carboxylic acid derivative and its application in pharmaceutics. Carboxylic acid derivatives have a growing importance in medicine, particularly in oncology. A novel carboxylic acid, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid, was synthesized and characterized by elemental analysis, FT-IR, NMR ((1)H, and (13)C), mass spectrometry and single crystal X-ray structural analysis. The structure of the title compound, C11H12N2O6, shows the molecules dimerised by short intramolecular OH⋯O hydrogen bonds. The compound was screened for in vitro antimicrobial, anticancer, and antileishmanial activities as well as interaction with SS-DNA. The compound was also checked for in vitro anticancer activity against BHK-21, H-157 and HCEC cell lines, and showed significant anticancer activity. The compound was almost non-toxic towards human corneal epithelial cells (HCEC) and did not show more than 7.4% antiproliferative activity when used at the 2.0μg/mL end concentration. It was also tested for antileishmanial activity against the promastigote form of leishmania major and obtained attractive result. DNA interaction study exposes that the binding mode of the compound with SS-DNA is an intercalative as it results in hypochromism along with minor red shift. A new and efficient strategy to identify pharmacophores sites in carboxylic acid derivative for antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

  8. Synthesis, spectroscopic characterization and in vitro antimicrobial, anticancer and antileishmanial activities as well interaction with Salmon sperm DNA of newly synthesized carboxylic acid derivative, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid

    NASA Astrophysics Data System (ADS)

    Sirajuddin, Muhammad; Ali, Saqib; McKee, Vickie; Ullah, Hameed

    2015-03-01

    This paper stresses on the synthesis, characterization of novel carboxylic acid derivative and its application in pharmaceutics. Carboxylic acid derivatives have a growing importance in medicine, particularly in oncology. A novel carboxylic acid, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid, was synthesized and characterized by elemental analysis, FT-IR, NMR (1H, and 13C), mass spectrometry and single crystal X-ray structural analysis. The structure of the title compound, C11H12N2O6, shows the molecules dimerised by short intramolecular Osbnd H⋯O hydrogen bonds. The compound was screened for in vitro antimicrobial, anticancer, and antileishmanial activities as well as interaction with SS-DNA. The compound was also checked for in vitro anticancer activity against BHK-21, H-157 and HCEC cell lines, and showed significant anticancer activity. The compound was almost non-toxic towards human corneal epithelial cells (HCEC) and did not show more than 7.4% antiproliferative activity when used at the 2.0 μg/mL end concentration. It was also tested for antileishmanial activity against the promastigote form of leishmania major and obtained attractive result. DNA interaction study exposes that the binding mode of the compound with SS-DNA is an intercalative as it results in hypochromism along with minor red shift. A new and efficient strategy to identify pharmacophores sites in carboxylic acid derivative for antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

  9. Contributions of the TEL-patch amino acid cluster on TPP1 to telomeric DNA synthesis by human telomerase.

    PubMed

    Dalby, Andrew B; Hofr, Ctirad; Cech, Thomas R

    2015-03-27

    Telomere maintenance is a highly coordinated process, and its misregulation is linked to cancer and telomere-shortening syndromes. Recent studies have shown that the TEL-patch--a cluster of amino acids on the surface of the shelterin component TPP1--is necessary for the recruitment of telomerase to the telomere in human cells. However, there has been only basic biochemical analysis of the role of TPP1 in the telomerase recruitment process. Here we develop an in vitro assay to quantitatively measure the contribution of the TEL-patch to telomerase recruitment--binding and extension of the first telomeric repeat. We also demonstrate that the TEL-patch contributes to the translocation step of the telomerase reaction. Finally, our quantitative observations indicate that the TEL-patch stabilizes the association between telomerase and telomeric DNA substrates, providing a molecular explanation for its contributions to telomerase recruitment and action.

  10. Initiation of lymphocyte DNA synthesis.

    PubMed

    Coffman, F D; Fresa, K L; Cohen, S

    1991-01-01

    The initiation of DNA replication in T lymphocytes appears to be regulated by two distinct activities: one associated with proliferation which mediates initiation, and another associated with quiescence which blocks initiation. Activated lymphocytes and proliferating lymphoid cell lines produce an activity, termed ADR, which can initiate DNA replication in isolated, quiescent nuclei. ADR is heat-labile, has protease activity or interacts closely with a protease, and is distinct from the DNA polymerases. ADR activity is absent in quiescent lymphocytes and appears in mitogen-stimulated lymphocytes after IL-2 binding. The generation of active ADR appears to be mediated by phosphorylation of a precursor which is present in resting cells. Nuclei from mitogen-unresponsive lymphocytes fail to initiate DNA replication in response to ADR, of potential importance in the age-related decline of immunity. Quiescent lymphocytes lack ADR and synthesize an ADR-inhibitory activity. The ADR inhibitor is a heat-stable protein which suppresses the initiation of DNA synthesis, but is ineffective at suppressing elongation once DNA strand replication has begun. Nuclei from several neoplastic cell lines fail to respond to the ADR inhibitor, which may play a role in the continuous proliferation of these cells. At least one of these neoplastic cell lines produces both ADR and an inhibitory factor. These findings suggest that the regulation of proliferation is dependent on the balance between activating and inhibitory pathways. PMID:2005180

  11. Clickable Cγ-azido(methylene/butylene) peptide nucleic acids and their clicked fluorescent derivatives: synthesis, DNA hybridization properties, and cell penetration studies.

    PubMed

    Jain, Deepak R; Ganesh, Krishna N

    2014-07-18

    Synthesis, characterization, and DNA complementation studies of clickable C(γ)-substituted methylene (azm)/butylene (azb) azido PNAs show that these analogues enhance the stability of the derived PNA:DNA duplexes. The fluorescent PNA oligomers synthesized by their click reaction with propyne carboxyfluorescein are seen to accumulate around the nuclear membrane in 3T3 cells.

  12. RNA-Primed DNA Synthesis In Vitro

    PubMed Central

    Keller, Walter

    1972-01-01

    In vitro DNA synthesis on single-stranded circular DNA can be initiated by RNA primers. RNA chains are covalently extended by DNA polymerase II from KB cells and DNA polymerase I from Micrococcus luteus, but not by an RNA-dependent DNA polymerase from avian myeloblastosis virus. The reaction product consists of DNA chains with a piece of RNA at their 5′-ends, hydrogen bonded to the template DNA. The primer RNA is linked to the product DNA via a 3′:5′-phosphodiester bond, and can be specifically removed by ribonuclease H. The possible role of ribonuclease H in RNA-primed DNA synthesis in vivo is discussed. Images PMID:4338598

  13. Enzymatic synthesis of DNA strands containing α-L-LNA (α-L-configured locked nucleic acid) thymine nucleotides.

    PubMed

    Højland, Torben; Veedu, Rakesh N; Vester, Birte; Wengel, Jesper

    2012-01-01

    We describe the first enzymatic incorporation of an α-L-LNA nucleotide into an oligonucleotide. It was found that the 5'-triphosphate of α-L-LNA is a substrate for the DNA polymerases KOD, 9°N(m), Phusion and HIV RT. Three dispersed α-L-LNA thymine nucleotides can be incorporated into DNA strands by all four polymerases, but they were unable to perform consecutive incorporations of α-L-LNA nucleotides. In addition it was found that primer extension can be achieved using templates containing one α-L-LNA nucleotide. PMID:22679529

  14. Ligation of retinoic acid receptor alpha regulates negative selection of thymocytes by inhibiting both DNA binding of nur77 and synthesis of bim.

    PubMed

    Szegezdi, Eva; Kiss, Ildikó; Simon, Agnes; Blaskó, Bernadett; Reichert, Uwe; Michel, Serge; Sándor, Mátyás; Fésüs, László; Szondy, Zsuzsa

    2003-04-01

    Negative selection refers to the selective deletion of autoreactive thymocytes. Its molecular mechanisms have not been well defined. Previous studies in our laboratory have demonstrated that retinoic acids, physiological ligands for the nuclear retinoid receptors, selectively inhibit TCR-mediated death under in vitro conditions, and the inhibition is mediated via the retinoic acid receptor (RAR) alpha. The present studies were undertaken to investigate whether ligation of RARalpha leads to inhibition of TCR-mediated death in vivo and to identify the molecular mechanisms involved. Three models of TCR-mediated death were studied: anti-CD3-mediated death of thymocytes in wild-type mice, and Ag- and bacterial superantigen-driven thymocyte death in TCR-transgenic mice expressing a receptor specific for a fragment of pigeon cytochrome c in the context of the E(k) (class II MHC) molecule. Our data demonstrate that the molecular program of both anti-CD3- and Ag-driven, but not that of superantigen-mediated apoptosis involves up-regulation of nur77, an orphan nuclear receptor, and bim, a BH3-only member of the proapoptotic bcl-2 protein family, proteins previously implicated to participate in the negative selection. Ligation of RARalpha by the synthetic agonist CD336 inhibited apoptosis, DNA binding of nur77, and synthesis of bim induced by anti-CD3 or the specific Ag, but had no effect on the superantigen-driven cell death. Our data imply that retinoids are able to inhibit negative selection in vivo as well, and they interfere with multiple steps of the T cell selection signal pathway.

  15. Synthesis, spectroscopic characterization and structural investigations of new adduct compound of carbazole with picric acid: DNA binding and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Saravanabhavan, Munusamy; Sathya, Krishnan; Puranik, Vedavati G.; Sekar, Marimuthu

    2014-01-01

    Carbazole picrate (CP), a new organic compound has been synthesized, characterized by various analytical and spectroscopic technique such as FT-IR, UV-Vis, 1H and 13C NMR spectroscopy. An orthorhombic geometry was proposed based on single crystal XRD study. The thermal stability of the crystal was studied by using thermo-gravimetric and differential thermal analyses and found that it was stable up to 170 °C. Further, the newly synthesized title compound was tested for its in vitro antibacterial and antifungal activity against various bacterial and fungal species. Also, the compound was tested for its binding activity with Calf thymus (CT) DNA and the results show a considerable interaction between CP and CT-DNA.

  16. Mechanism for priming DNA synthesis by yeast DNA Polymerase α

    PubMed Central

    Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca

    2013-01-01

    The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895

  17. DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

    PubMed Central

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

    2016-01-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  18. Short-step chemical synthesis of DNA by use of MMTrS group for protection of 5'-hydroxyl group.

    PubMed

    Shiraishi, Miyuki; Utagawa, Eri; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

    2007-01-01

    4-methoxytrithylthio (MMTrS) group was applied for the appropriately protected four canonical nucleosides. We prepared the phosphoroamidite units by use of these nucleosides and developed the synthesis of oligodeoxynucleotides without any acidic treatment. Moreover, the new DNA synthesis protocol was applied to an automated DNA synthesizer for the synthesis of longer oligodeoxynucleotides. PMID:18029620

  19. ATP-Releasing Nucleotides: Linking DNA Synthesis to Luciferase Signaling.

    PubMed

    Ji, Debin; Mohsen, Michael G; Harcourt, Emily M; Kool, Eric T

    2016-02-01

    A new strategy is reported for the production of luminescence signals from DNA synthesis through the use of chimeric nucleoside tetraphosphate dimers in which ATP, rather than pyrophosphate, is the leaving group. ATP-releasing nucleotides (ARNs) were synthesized as derivatives of the four canonical nucleotides. All four derivatives are good substrates for DNA polymerase, with Km values averaging 13-fold higher than those of natural dNTPs, and kcat values within 1.5-fold of those of native nucleotides. Importantly, ARNs were found to yield very little background signal with luciferase. DNA synthesis experiments show that the ATP byproduct can be harnessed to elicit a chemiluminescence signal in the presence of luciferase. When using a polymerase together with the chimeric nucleotides, target DNAs/RNAs trigger the release of stoichiometrically large quantities of ATP, thereby allowing sensitive isothermal luminescence detection of nucleic acids as diverse as phage DNAs and short miRNAs.

  20. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  1. Synthesis, structural characterization and DNA interaction of zinc complex from 2,6-diacetylpyridine dihydrazone and {4-[(2E)-2-(hydroxyimino)acetyl]phenoxy} acetic acid.

    PubMed

    Gup, Ramazan; Gökçe, Cansu; Dilek, Nefise

    2015-03-01

    A new water soluble zinc complex has been prepared and structurally characterized. The Zn(II) complex was synthesized by the reaction of 2,6-diacetylpyridine dihydrazone (dph) with {4-[(2E)-2-(hydroxyimino)acetyl]phenoxy} acetic acid (H₂L) in the presence of zinc(II) acetate. Single crystal X-ray diffraction study revealed that the zinc ion is situated in distorted trigonal-bipyramidal environment where the equatorial position is occupied by the nitrogen atom of pyridine ring and the oxygen atoms of acetate groups of two oxime ligands (H₂L) whereas the axial positions of the zinc complex are occupied by the imine nitrogen atoms of dph ligand. Characterization of the complex with FTIR, (1)H and (13)C NMR, UV-vis and elemental analysis also confirmed the proposed structure. Interaction of the Zn(II) complex with calf-thymus DNA (CT-DNA) was investigated through UV-vis spectroscopy and viscosity measurements. The results suggest that the complex preferably bind to DNA through the groove binding mode. The zinc complex cleaves plasmid pBR 322 DNA in the presence and absence of an oxidative agent (H₂O₂), possibly through a hydrolytic pathway which is also supported by DNA cleave experiments in the presence of different radical scavengers. The nuclease activity of the zinc complex significantly depends on concentration of the complex and incubation time both in the presence and absence of H₂O₂. DNA cleave activity is inhibited in the presence of methyl green indicating that the zinc complex seems to bind the major groove of DNA.

  2. Synthesis, spectral characterization and DNA binding of Schiff-base metal complexes derived from 2-amino-3-hydroxyprobanoic acid and acetylacetone.

    PubMed

    Hosny, Nasser Mohammed; Hussien, Mostafa A; Radwan, Fatima M; Nawar, Nagwa

    2014-11-11

    Four new metal complexes derived from the reaction of Cu(II), Co(II), Ni(II) and Zn(II) acetates with the Schiff-base ligand (H3L) resulted from the condensation of the amino acid 2-amino-3-hydroxyprobanoic acid (serine) and acetylacetone have been synthesized and characterized by, elemental analyses, ES-MS, IR, UV-Vis., 1H NMR, 13C NMR, ESR, thermal analyses (TGA and DTG) and magnetic measurements. The results showed that the Schiff-base ligand acts as bi-negative tridentate through the azomethine nitrogen, the deprotonated carboxylate oxygen and the enolic carbonyl oxygen. The optical band gaps measurements indicated the semi-conducting nature of these complexes. Molecular docking was used to predict the binding between the Schiff base ligand with the receptor of prostate cancer mutant H874Y. The interactions between the Cu(II) complex and calf thymus DNA (CT-DNA) have been studied by UV spectra. The results confirm that the Cu(II) complex binds to CT-DNA in an intercalative mode.

  3. Synthesis, spectral characterization and DNA binding of Schiff-base metal complexes derived from 2-amino-3-hydroxyprobanoic acid and acetylacetone

    NASA Astrophysics Data System (ADS)

    Hosny, Nasser Mohammed; Hussien, Mostafa A.; Radwan, Fatima M.; Nawar, Nagwa

    2014-11-01

    Four new metal complexes derived from the reaction of Cu(II), Co(II), Ni(II) and Zn(II) acetates with the Schiff-base ligand (H3L) resulted from the condensation of the amino acid 2-amino-3-hydroxyprobanoic acid (serine) and acetylacetone have been synthesized and characterized by, elemental analyses, ES-MS, IR, UV-Vis., 1H NMR, 13C NMR, ESR, thermal analyses (TGA and DTG) and magnetic measurements. The results showed that the Schiff-base ligand acts as bi-negative tridentate through the azomethine nitrogen, the deprotonated carboxylate oxygen and the enolic carbonyl oxygen. The optical band gaps measurements indicated the semi-conducting nature of these complexes. Molecular docking was used to predict the binding between the Schiff base ligand with the receptor of prostate cancer mutant H874Y. The interactions between the Cu(II) complex and calf thymus DNA (CT-DNA) have been studied by UV spectra. The results confirm that the Cu(II) complex binds to CT-DNA in an intercalative mode.

  4. Metal based pharmacologically active agents: Synthesis, structural characterization, molecular modeling, CT-DNA binding studies and in vitro antimicrobial screening of iron(II) bromosalicylidene amino acid chelates

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; El-Khatib, Rafat M.; Nassr, Lobna A. E.; Abu-Dief, Ahmed M.; Ismael, Mohamed; Seleem, Amin Abdou

    2014-01-01

    In recent years, great interest has been focused on Fe(II) Schiff base amino acid complexes as cytotoxic and antitumor drugs. Thus a series of new iron(II) complexes based on Schiff bases amino acids ligands have been designed and synthesized from condensation of 5-bromosalicylaldehyde (bs) and α-amino acids (L-alanine (ala), L-phenylalanine (phala), L-aspartic acid (aspa), L-histidine (his) and L-arginine (arg)). The structure of the investigated iron(II) complexes was elucidated using elemental analyses, infrared, ultraviolet-visible, thermogravimetric analysis, as well as conductivity and magnetic susceptibility measurements. Moreover, the stoichiometry and the stability constants of the prepared complexes have been determined spectrophotometrically. The results suggest that 5-bromosalicylaldehyde amino acid Schiff bases (bs:aa) behave as dibasic tridentate ONO ligands and coordinate to Fe(II) in octahedral geometry according to the general formula [Fe(bs:aa)2]ṡnH2O. The conductivity values between 37 and 64 ohm-1 mol-1 cm2 in ethanol imply the presence of nonelectrolyte species. The structure of the complexes was validated using quantum mechanics calculations based on accurate DFT methods. Geometry optimization of the Fe-Schiff base amino acid complexes showed that all complexes had octahedral coordination. In addition, the interaction of these complexes with (CT-DNA) was investigated at pH = 7.2, by using UV-vis absorption, viscosity and agarose gel electrophoresis measurements. Results indicated that the investigated complexes strongly bind to calf thymus DNA via intercalative mode and showed a different DNA binding according to the sequence: bsari > bshi > bsali > bsasi > bsphali. Moreover, the prepared compounds are screened for their in vitro antibacterial and antifungal activity against three types of bacteria, Escherichia coli, Pseudomonas aeruginosa and Bacillus cereus and three types of anti fungal cultures, Penicillium purpurogenium, Aspergillus

  5. Metal based pharmacologically active agents: synthesis, structural characterization, molecular modeling, CT-DNA binding studies and in vitro antimicrobial screening of iron(II) bromosalicylidene amino acid chelates.

    PubMed

    Abdel-Rahman, Laila H; El-Khatib, Rafat M; Nassr, Lobna A E; Abu-Dief, Ahmed M; Ismael, Mohamed; Seleem, Amin Abdou

    2014-01-01

    In recent years, great interest has been focused on Fe(II) Schiff base amino acid complexes as cytotoxic and antitumor drugs. Thus a series of new iron(II) complexes based on Schiff bases amino acids ligands have been designed and synthesized from condensation of 5-bromosalicylaldehyde (bs) and α-amino acids (L-alanine (ala), L-phenylalanine (phala), L-aspartic acid (aspa), L-histidine (his) and L-arginine (arg)). The structure of the investigated iron(II) complexes was elucidated using elemental analyses, infrared, ultraviolet-visible, thermogravimetric analysis, as well as conductivity and magnetic susceptibility measurements. Moreover, the stoichiometry and the stability constants of the prepared complexes have been determined spectrophotometrically. The results suggest that 5-bromosalicylaldehyde amino acid Schiff bases (bs:aa) behave as dibasic tridentate ONO ligands and coordinate to Fe(II) in octahedral geometry according to the general formula [Fe(bs:aa)2]·nH2O. The conductivity values between 37 and 64 ohm(-1) mol(-1) cm(2) in ethanol imply the presence of nonelectrolyte species. The structure of the complexes was validated using quantum mechanics calculations based on accurate DFT methods. Geometry optimization of the Fe-Schiff base amino acid complexes showed that all complexes had octahedral coordination. In addition, the interaction of these complexes with (CT-DNA) was investigated at pH=7.2, by using UV-vis absorption, viscosity and agarose gel electrophoresis measurements. Results indicated that the investigated complexes strongly bind to calf thymus DNA via intercalative mode and showed a different DNA binding according to the sequence: bsari>bshi>bsali>bsasi>bsphali. Moreover, the prepared compounds are screened for their in vitro antibacterial and antifungal activity against three types of bacteria, Escherichia coli, Pseudomonas aeruginosa and Bacillus cereus and three types of anti fungal cultures, Penicillium purpurogenium, Aspergillus flavus

  6. Effects of phenolic antioxidants and flavonoids on DNA synthesis in rat liver, spleen, and testis in vitro.

    PubMed

    Wong, W S; McLean, A E

    1999-12-01

    Paracetamol (acetaminophen) and hydroxyurea were found to inhibit DNA synthesis in a dose-dependent manner in tissue slices in vitro, with little effect on protein synthesis. Considerable variation in the sensitivity of the different tissues was also observed with an order of least sensitive to most sensitive tissue of liver < testis < spleen. The phenolic antioxidant properties of paracetamol are thought to be the mechanism by which paracetamol inhibits DNA synthesis, which led us to study other phenolic antioxidant molecules and flavonoids for specific inhibition of DNA synthesis. (+)-catechin, m-aminophenol, p-aminophenol and p-cresol all displayed a highly specific inhibition of DNA synthesis. Quercetin displayed a preferential inhibition of DNA synthesis but a significant level of inhibition of protein synthesis was also seen. Nordihydroguaiaretic acid (NDGA) and n-propyl gallate showed preferential inhibition of DNA synthesis at the lower doses tested, but at higher doses showed significant inhibition of protein synthesis, presumably because of cytotoxicity. Caffeic acid and naringenin did not display any specific inhibition of DNA synthesis as protein synthesis was equally inhibited at all doses tested. This study demonstrates that certain phenolic antioxidants can inhibit DNA synthesis specifically but this is not a property shared by all phenolic antioxidants; and that these inhibitors show considerable variation in effectiveness between different tissues. PMID:10647924

  7. Gibberellic Acid enhancement of DNA turnover in barley aleurone cells.

    PubMed

    Taiz, L; Starks, J E

    1977-08-01

    When imbibed, deembryonated halfseeds from barley (Hordeum vulgare L., var. Himalaya) are incubated in buffer, the DNA content of the aleurone layer increases 25 to 40% over a 24-hour period. In contrast, the DNA of isolated aleurone layers declines by 20% over the same time period. Gibberellic acid (GA) causes a reduction in DNA levels in both halfseed aleurone layers and isolated aleurone layers. GA also increases the specific radioactivity of [(3)H]thymidine-labeled halfseed aleurone layer DNA during the first 12 hours of treatment. Pulse-chase studies demonstrated that the newly synthesized DNA is metabolically labile.The buoyant density on CsCl density gradients of hormone-treated aleurone DNA is identical with that of DNA extracted from whole seedlings. After density-labeling halfseed DNA with 5-bromodeoxyuridine, a bimodal absorption profile is obtained in neutral CsCl. The light band (1.70 g/ml) corresponds to unsubstituted DNA, while the heavy band (1.725-1.74 g/ml) corresponds to a hybrid density-labeled species. GA increases the relative amount of the heavy (hybrid) peak in halfseed aleurone layer DNA, further suggesting that the hormone enhances semiconservative replication in halfseeds.DNA methylation was also demonstrated. Over 60% of the radioactivity from [(3)H-Me]methionine is incorporated into 5-methylcytosine. GA has no effect on the percentage distribution of label among the bases.It was concluded that GA enhances the rate of DNA degradation and DNA synthesis (turnover) in halfseeds, but primarily DNA degradation in isolated aleurone layers. Incorporation by isolated aleurone layers is due to DNA repair. Semiconservative replication apparently plays no physiological role in the hormone response, since both isolated aleurone layers and gamma-irradiated halfseeds respond normally. The hypothesis was advanced that endoreduplication and DNA degradation are means by which the seed stores and mobilizes deoxyribonucleotides for the embryo during

  8. Human acidic ribosomal phosphoproteins P0, P1, and P2: Analysis of cDNA clones, in vitro synthesis, and assembly

    SciTech Connect

    Rich, B.E.; Steitz, J.A.

    1987-11-01

    cDNA clones encoding three antigenically related human ribosomal phosophoproteins (P-proteins) P0, P1, and P2 were isolated and sequenced. P1 and P2 are analogous to Escherichia coli ribosomal protein L7/L12, and P0 is likely to be an analog of L10. The three proteins have a nearly identical carboxy-terminal 17-amino-acid sequence (KEESEESD(D/E)DMGFGLFD-COOH) that is the basis of their immunological cross-reactivity. The identifies of the P1 and P2 cDNAs were confirmed by the strong similarities of their encoded amino acid sequences to published primary structures of the homologous rat, brine shrimp, and Saccharomyces cerevisiae proteins. The P0 cDNA was initially identified by translation of hybrid-selected mRNA and immunoprecipitation of the products. To demonstrate that the coding sequences are full length, the P0, P1, and P2 cDNAs were transcribed in vitro by bacteriophage T7 RNA polymerase and the resulting mRNAs were translated in vitro. The synthetic P0, P1, and P2 proteins were serologically and electrophoretically identical to P-proteins extracted from HeLa cells. These synthetic P-proteins were incorporated into 60S but not 40S ribosomes and also assembled into a complex similar to that described for E. coli L7/L12 and L10.

  9. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  10. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  11. Synthesis, structure elucidation, biological screening, molecular modeling and DNA binding of some Cu(II) chelates incorporating imines derived from amino acids

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; Abu-Dief, Ahmed M.; Ismael, Mohammed; Mohamed, Mounir A. A.; Hashem, Nahla Ali

    2016-01-01

    Three tridentate Schiff bases amino acids were prepared by direct condensation of 3-methoxysalicylaldehyde (MS) or 4-diethylaminosalicylaldehyde (DS) with α-amino acid ligands [L-phenylalanine (P), L-histidine (H) and DL-tryptophan (T)]. The prepared Schiff bases amino acids were investigated by melting points, elemental analysis, 1HNMR and 13CNMR, IR, UV-Vis spectra, conductivity and magnetic measurements analyses. Subsequently, copper was introduced and Cu(II) complexes formed. These complexes were analyzed by thermal and elemental analyses and further investigated by FT-IR and UV/Vis spectroscopies. The experimental results indicating that all Cu(II) complexes contain hydrated water molecules (except DSPCu complex) and don't contain coordinated water molecules. The kinetic and thermal parameters were extracted from the thermal data using Coast and Redfern method. The molar conductance values of the Schiff base amino acid ligands and their Cu(II) complexes were relatively low, showing that these compounds have non-electrolytic nature. Magnetic susceptibility measurements showed the diamagnetic nature of the Schiff base amino acid ligands and paramagnetic nature of their complexes. Additionally, a spectrophotometric method was determined to extract their stability constants. It was found that the complexes possess 1:2 (M:L) stoichiometry. The results suggested that 3-methoxysalicylaldehyde and 4-diethylaminosalicylaldehyde amino acid Schiff bases behave as monobasic tridentate ONO ligands and coordinate Cu(II) ions in octahedral geometry according to the general formula [Cu(HL)2]·nH2O. To further understanding the structural and electronic properties of these complexes, Density Functional Theory (DFT) calculations were employed and provided a satisfactory description. The optimized structures of MST Schiff base ligand and its complex were calculated using DFT. The antimicrobial activity of the Schiff base ligands and their complexes were screened against some

  12. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  13. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  14. Synthesis of novel MMT/acyl-protected nucleo alanine monomers for the preparation of DNA/alanyl-PNA chimeras

    PubMed Central

    Roviello, G. N.; Gröschel, S.; Pedone, C.

    2009-01-01

    Alanyl-peptide nucleic acid (alanyl-PNA)/DNA chimeras are oligomers envisaged to be beneficial in efficient DNA diagnostics based on an improved molecular beacon concept. A synthesis of alanyl-PNA/DNA chimera can be based on the solid phase assembly of the oligomer with mixed oligonucleotide/peptide backbone under DNA synthesis conditions, in which the nucleotides are introduced as phosphoramidites, whereas the nucleo amino acids make use of the acid labile monomethoxytrityl (MMT) group for temporary protection of the α-amino groups and acyl protecting groups for the exocyclic amino functions of the nucleobases. In this work, we realized for the first time the synthesis of all four MMT/acyl-protected nucleo alanines, achieved by deprotection/reprotection of the newly synthesized Boc/acyl intermediates, useful monomers for the obtainment of (alanyl-PNA)/DNA chimeras by conditions fully compatible with the standard phosphoramidite DNA synthesis strategy. PMID:19629638

  15. Synthesis of novel MMT/acyl-protected nucleo alanine monomers for the preparation of DNA/alanyl-PNA chimeras.

    PubMed

    Roviello, G N; Gröschel, S; Pedone, C; Diederichsen, U

    2010-05-01

    Alanyl-peptide nucleic acid (alanyl-PNA)/DNA chimeras are oligomers envisaged to be beneficial in efficient DNA diagnostics based on an improved molecular beacon concept. A synthesis of alanyl-PNA/DNA chimera can be based on the solid phase assembly of the oligomer with mixed oligonucleotide/peptide backbone under DNA synthesis conditions, in which the nucleotides are introduced as phosphoramidites, whereas the nucleo amino acids make use of the acid labile monomethoxytrityl (MMT) group for temporary protection of the alpha-amino groups and acyl protecting groups for the exocyclic amino functions of the nucleobases. In this work, we realized for the first time the synthesis of all four MMT/acyl-protected nucleo alanines, achieved by deprotection/reprotection of the newly synthesized Boc/acyl intermediates, useful monomers for the obtainment of (alanyl-PNA)/DNA chimeras by conditions fully compatible with the standard phosphoramidite DNA synthesis strategy.

  16. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  17. Synthesis of DNA oligonucleotides containing C5-ethynylbenzenesulfonamide-modified nucleotides (EBNA) by polymerases towards the construction of base functionalized nucleic acids.

    PubMed

    Goubet, Astrid; Chardon, Antoine; Kumar, Pawan; Sharma, Pawan K; Veedu, Rakesh N

    2013-02-01

    C5-Ethynylbenzenesulfonamide-modified nucleotide (EBNA) was investigated as substrate of various DNA polymerases. The experiments revealed that KOD, Phusion and Klenow DNA polymerases successfully accepted EBNA-T nucleotide as a substrate and yielded the fully extended DNA. KOD DNA polymerase was found to be the most efficient enzyme to furnish EBNA-T containing DNA in good yields. Phusion DNA polymerase efficiently amplified the template containing EBNA-T nucleotides by PCR. PMID:23265899

  18. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  19. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response.

  20. DNA Nanoparticles for Improved Protein Synthesis In Vitro.

    PubMed

    Galinis, Robertas; Stonyte, Greta; Kiseliovas, Vaidotas; Zilionis, Rapolas; Studer, Sabine; Hilvert, Donald; Janulaitis, Arvydas; Mazutis, Linas

    2016-02-24

    The amplification and digital quantification of single DNA molecules are important in biomedicine and diagnostics. Beyond quantifying DNA molecules in a sample, the ability to express proteins from the amplified DNA would open even broader applications in synthetic biology, directed evolution, and proteomics. Herein, a microfluidic approach is reported for the production of condensed DNA nanoparticles that can serve as efficient templates for in vitro protein synthesis. Using phi29 DNA polymerase and a multiple displacement amplification reaction, single DNA molecules were converted into DNA nanoparticles containing up to about 10(4)  clonal gene copies of the starting template. DNA nanoparticle formation was triggered by accumulation of inorganic pyrophosphate (produced during DNA synthesis) and magnesium ions from the buffer. Transcription-translation reactions performed in vitro showed that individual DNA nanoparticles can serve as efficient templates for protein synthesis in vitro.

  1. Patterns of DNA synthesis during pollen embryogenesis in henbane.

    PubMed

    Raghavan, V

    1977-05-01

    Continued DNA synthesis in the generative cell nucleus, followed by mitosis and cytokinesis, results in the formation of pollen embryoids in cultured anthers of H. niger. In contrast, the nucleus of the vegetative cell undergoes no DNA synthesis after it is cut off, or synthesizes DNA only during a limited number of cell cycles. DNA synthetic patterns in the generative and vegetative cell nuclei confirm the ontogeny of embryoids described in this plant.

  2. Chemoenzymatic synthesis and antibody detection of DNA glycoconjugates.

    PubMed

    Wang, Yingli; Sheppard, Terry L

    2003-01-01

    A chemoenzymatic approach for the efficient synthesis of DNA-carbohydrate conjugates was developed and applied to an antibody-based strategy for the detection of DNA glycoconjugates. A phosphoramidite derivative of N-acetylglucosamine (GlcNAc) was synthesized and utilized to attach GlcNAc sugars to the 5'-terminus of DNA oligonucleotides by solid-phase DNA synthesis. The resulting GlcNAc-DNA conjugates were used as substrates for glycosyl transferase enzymes to synthesize DNA glycoconjugates. Treatment of GlcNAc-DNA with beta-1,4-galactosyl transferase (GalT) and UDP-Gal produced N-acetyllactosamine-modified DNA (LacNAc-DNA), which could be converted quantitatively to the trisaccharide Lewis X (LeX)-DNA conjugate by alpha-1,3-fucosyltransferase VI (FucT) and GDP-Fuc. The facile enzymatic synthesis of LeX-DNA from GlcNAc-DNA also was accomplished in a one-pot reaction by the combined action of GalT and FucT. The resulting glycoconjugates were characterized by gel electrophoresis, matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), and glycosidase digestion experiments. Covalent modification of the 5'-terminus of DNA with carbohydrates did not interfere with the ability of DNA glycoconjugates to hybridize with complementary DNA, as indicated by UV thermal denaturation analysis. The trisaccharide DNA glycoconjugate, LeX-DNA, was detected by a dual DNA hybridization/monoclonal antibody (mAb) detection protocol ("Southwestern"): membrane-immobilized LeX-DNA was visualized by Southern detection with a radiolabeled complementary DNA probe and by Western chemiluminescence detection with a mAb specific for the LeX antigen. The efficient chemoenzymatic synthesis of DNA glycoconjugates and the Southwestern detection protocol may facilitate the application of glycosylated DNA to cellular targeting and DNA glycoconjugate detection strategies. PMID:14624649

  3. Chemoenzymatic synthesis and antibody detection of DNA glycoconjugates.

    PubMed

    Wang, Yingli; Sheppard, Terry L

    2003-01-01

    A chemoenzymatic approach for the efficient synthesis of DNA-carbohydrate conjugates was developed and applied to an antibody-based strategy for the detection of DNA glycoconjugates. A phosphoramidite derivative of N-acetylglucosamine (GlcNAc) was synthesized and utilized to attach GlcNAc sugars to the 5'-terminus of DNA oligonucleotides by solid-phase DNA synthesis. The resulting GlcNAc-DNA conjugates were used as substrates for glycosyl transferase enzymes to synthesize DNA glycoconjugates. Treatment of GlcNAc-DNA with beta-1,4-galactosyl transferase (GalT) and UDP-Gal produced N-acetyllactosamine-modified DNA (LacNAc-DNA), which could be converted quantitatively to the trisaccharide Lewis X (LeX)-DNA conjugate by alpha-1,3-fucosyltransferase VI (FucT) and GDP-Fuc. The facile enzymatic synthesis of LeX-DNA from GlcNAc-DNA also was accomplished in a one-pot reaction by the combined action of GalT and FucT. The resulting glycoconjugates were characterized by gel electrophoresis, matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), and glycosidase digestion experiments. Covalent modification of the 5'-terminus of DNA with carbohydrates did not interfere with the ability of DNA glycoconjugates to hybridize with complementary DNA, as indicated by UV thermal denaturation analysis. The trisaccharide DNA glycoconjugate, LeX-DNA, was detected by a dual DNA hybridization/monoclonal antibody (mAb) detection protocol ("Southwestern"): membrane-immobilized LeX-DNA was visualized by Southern detection with a radiolabeled complementary DNA probe and by Western chemiluminescence detection with a mAb specific for the LeX antigen. The efficient chemoenzymatic synthesis of DNA glycoconjugates and the Southwestern detection protocol may facilitate the application of glycosylated DNA to cellular targeting and DNA glycoconjugate detection strategies.

  4. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  5. Synthesis, spectroscopic characterization and structural investigations of a new charge transfer complex of 2,6-diaminopyridine with 3,5-dinitrobenzoic acid: DNA binding and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Khan, Ishaat M.; Ahmad, Afaq; Kumar, Sarvendra

    2013-03-01

    A new charge transfer (CT) complex [(DAPH)+(DNB)-] consisting of 2,6-diaminopyridine (DAP) as donor and 3,5-dinitrobenzoic acid (DNB-H) as acceptor, was synthesized and characterized by FTIR, 1H and 13C NMR, ESI mass spectroscopic and X-ray crystallographic techniques. The hydrogen bonding (N+-H⋯O-) plays an important role to consolidate the cation and anion together. CT complex shows a considerable interaction with Calf thymus DNA. The CT complex was also tested for its antibacterial activity against two Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa strains by using Tetracycline as standard, and antifungal property against Aspergillus niger, Candida albicans, and Penicillium sp. by using Nystatin as standard. The results were compared with standard drugs and significant conclusions were obtained. A polymeric net work through H-bonding interactions between neighboring moieties was observed. This has been attributed to the formation of 1:1 type CT complex.

  6. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  7. Crown gall oncogenesis: evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid.

    PubMed Central

    Thomashow, L S; Reeves, S; Thomashow, M F

    1984-01-01

    Stable incorporation of tumor-inducing (Ti) plasmid sequences, the T-DNA, into the genomes of dicotyledonous plants results in the formation of crown gall tumors. Previous genetic studies have suggested that the products of the genes encoding transcripts 1 and 2, which are encoded by the TL-DNA region of pTiA6, are responsible for inducing the auxin-independent phenotype of crown gall tissues. Here we report the construction of a plasmid, pMTlacT2, which directs the synthesis of the Mr 49,800 polypeptide encoded by the transcript 2 gene. Cell-free extracts prepared from Escherichia coli harboring this plasmid converted indoleacetamide to indoleacetic acid, the natural auxin of plants; extracts prepared from plasmidless strains of E. coli or strains harboring the cloning vehicle pBR322 did not carry out this reaction. We conclude that the transcript 2 gene of pTiA6 codes for an enzyme that participates in auxin biosynthesis, probably an indoleacetamide hydrolase. Images PMID:6089175

  8. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  9. Inhibitory effect of benzene metabolites on nuclear DNA synthesis in bone marrow cells

    SciTech Connect

    Lee, E.W.; Johnson, J.T.; Garner, C.D. )

    1989-01-01

    Effects of endogenously produced and exogenously added benzene metabolites on the nuclear DNA synthetic activity were investigated using a culture system of mouse bone marrow cells. Effects of the metabolites were evaluated by a 30-min incorporation of ({sup 3}H)thymidine into DNA following a 30-min interaction with the cells in McCoy's 5a medium with 10% fetal calf serum. Phenol and muconic acid did not inhibit nuclear DNA synthesis. However, catechol, 1,2,4-benzenetriol, hydroquinone, and p-benzoquinone were able to inhibit 52, 64, 79, and 98% of the nuclear DNA synthetic activity, respectively, at 24 {mu}M. In a cell-free DNA synthetic system, catechol and hydroquinone did not inhibit the incorporation of ({sup 3}H)thymidine triphosphate into DNA up to 24 {mu}M but 1,2,4-benzenetriol and p-benzoquinone did. The effect of the latter two benzene metabolites was completely blocked in the presence of 1,4-dithiothreitol (1 mM) in the cell-free assay system. Furthermore, when DNA polymerase {alpha}, which requires a sulfhydryl (SH) group as an active site, was replaced by DNA polymerase 1, which does not require an SH group for its catalytic activity, p-benzoquinone and 1,2,4-benzenetriol were unable to inhibit DNA synthesis. Thus, the data imply the p-benzoquinone and 1,2,4-benzenetriol inhibited DNA polymerase {alpha}, consequently resulting in inhibition of DNA synthesis in both cellular and cell-free DNA synthetic systems. The present study identifies catechol, hydroquinone, p-benzoquinone, and 1,2,4-benzenetriol as toxic benzene metabolites in bone marrow cells and also suggests that their inhibitory action on DNA synthesis is mediated by mechanism(s) other than that involving DNA damage as a primary cause.

  10. Dual roles for DNA polymerase eta in homologous DNA recombination and translesion DNA synthesis.

    PubMed

    Kawamoto, Takuo; Araki, Kasumi; Sonoda, Eiichiro; Yamashita, Yukiko M; Harada, Kouji; Kikuchi, Koji; Masutani, Chikahide; Hanaoka, Fumio; Nozaki, Kazuhiko; Hashimoto, Nobuo; Takeda, Shunichi

    2005-12-01

    Chicken B lymphocyte precursors and DT40 cells diversify their immunoglobulin-variable (IgV) genes through homologous recombination (HR)-mediated Ig gene conversion. To identify DNA polymerases that are involved in Ig gene conversion, we created DT40 clones deficient in DNA polymerase eta (poleta), which, in humans, is defective in the variant form of xeroderma pigmentosum (XP-V). Poleta is an error-prone translesion DNA synthesis polymerase that can bypass UV damage-induced lesions and is involved in IgV hypermutation. Like XP-V cells, poleta-disrupted (poleta) clones exhibited hypersensitivity to UV. Remarkably, poleta cells showed a significant decrease in the frequency of both Ig gene conversion and double-strand break-induced HR when compared to wild-type cells, and these defects were reversed by complementation with human poleta. Our findings identify a DNA polymerase that carries out DNA synthesis for physiological HR and provides evidence that a single DNA polymerase can play multiple cellular roles. PMID:16337602

  11. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  12. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  13. DNA sequencing by synthesis based on elongation delay detection

    NASA Astrophysics Data System (ADS)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2015-03-01

    The one of most important problem in modern genetics, biology and medicine is determination of the primary nucleotide sequence of the DNA of living organisms (DNA sequencing). This paper describes the label-free DNA sequencing approach, based on the observation of a discrete dynamics of DNA sequence elongation phase. The proposed DNA sequencing principle are studied by numerical simulation. The numerical model for proposed label-free DNA sequencing approach is based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) and dynamics of nucleotides incorporation to rising DNA strand. The estimates for number of copied DNA sequences for required probability of nucleotide incorporation event detection and correct DNA sequence determination was obtained. The proposed approach can be applied at all known DNA sequencing devices with "sequencing by synthesis" principle of operation.

  14. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  15. Apicobasal gradient of chloroplast DNA synthesis and distribution in Acetabularia.

    PubMed

    Hoursiangou-Neubrun, D; Lüttke, A; Arapis, G; Puiseux-Dao, S; Bonotto, S

    1982-01-01

    Autoradiographic and biochemical experiments have revealed the presence, in vegetative cells of Acetabularia, of an apicobasal gradient of penetration and incorporation of labelled DNA precursors into the chloroplasts. Staining of chloroplasts with the DNA-specific fluorochrome DAPI has shown that the number of chloroplasts without DNA increases from the apex towards the base of the cell. All together, our findings support the existence of an apicobasal gradient of chloroplast DNA synthesis and distribution in Acetabularia.

  16. De novo DNA synthesis using single molecule PCR

    PubMed Central

    Yehezkel, Tuval Ben; Linshiz, Gregory; Buaron, Hen; Kaplan, Shai; Shabi, Uri; Shapiro, Ehud

    2008-01-01

    The throughput of DNA reading (sequencing) has dramatically increased recently due to the incorporation of in vitro clonal amplification. The throughput of DNA writing (synthesis) is trailing behind, with cloning and sequencing constituting the main bottleneck. To overcome this bottleneck, an in vitro alternative for in vivo DNA cloning must be integrated into DNA synthesis methods. Here we show how a new single molecule PCR (smPCR)-based procedure can be employed as a general substitute to in vivo cloning thereby allowing for the first time in vitro DNA synthesis. We integrated this rapid and high fidelity in vitro procedure into our earlier recursive DNA synthesis and error correction procedure and used it to efficiently construct and error-correct a 1.8-kb DNA molecule from synthetic unpurified oligos completely in vitro. Although we demonstrate incorporating smPCR in a particular method, the approach is general and can be used in principle in conjunction with other DNA synthesis methods as well. PMID:18667587

  17. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  18. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  19. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  20. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    PubMed

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-01

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  1. Template strand scrunching during DNA gap repair synthesis by human polymerase [lamda

    SciTech Connect

    Garcia-Diaz, Miguel; Bebenek, Katarzyna; Larrea, Andres A.; Havener, Jody M.; Perera, Lalith; Krahn, Joseph M.; Pedersen, Lars C.; Ramsden, Dale A.; Kunkel, Thomas A.

    2009-09-25

    Family X polymerases such as DNA polymerase {lambda}(Pol {lambda}) are well suited for filling short gaps during DNA repair because they simultaneously bind both the 5{prime} and 3{prime} ends of short gaps. DNA binding and gap filling are well characterized for 1-nucleotide (nt) gaps, but the location of yet-to-be-copied template nucleotides in longer gaps is unknown. Here we present crystal structures revealing that, when bound to a 2-nt gap, Pol {lambda} scrunches the template strand and binds the additional uncopied template base in an extrahelical position within a binding pocket that comprises three conserved amino acids. Replacing these amino acids with alanine results in less processive gap filling and less efficient NHEJ when 2-nt gaps are involved. Thus, akin to scrunching by RNA polymerase during transcription initiation, scrunching occurs during gap filling DNA synthesis associated with DNA repair.

  2. Inhibition of DNA-dependent RNA synthesis by 8-methoxypsoralen.

    PubMed

    Gniazdowski, M; Czyz, M; Wilmańska, D; Studzian, K; Frasunek, M; Płucienniczak, A; Szmigiero, L

    1988-09-01

    The effect of the photobinding of 8-methoxypsoralen to phage T7 DNA on different steps of RNA synthesis in vitro was assayed. Total RNA synthesis is reduced to a few percent and the transcript size is decreased, as shown by means of gel filtration on a Sepharose 4B column when DNA of the adduct content of six drug molecules per 10(3) nucleotides is used. The initiation of RNA chains seems to be less affected, as inferred from an abortive initiation assay. Synthesis of pppApU on DNA of the same adduct content is inhibited to 34% of the corresponding controls, while the overall RNA synthesis is inhibited to 6%. The amount of the enzyme needed for maximal retention of DNA, the kinetics of its binding and the decay of the polymerase-DNA complex at high ionic strength (or on decrease of the temperature) are similar with DNA either irradiated in the absence of the drug or DNA bearing six 8-methoxypsoralen molecules per 10(3) nucleotides. It is concluded from this study that 8-methoxypsoralen partially inhibits initiation and blocks movement of RNA polymerase along the template, inducing premature termination. It does not appear to influence the binding of the enzyme to DNA. PMID:3048406

  3. Effect of low molecular weight epidermal material upon DNA synthesis in primary cultures of newborn rat keratinocytes

    SciTech Connect

    Abler, A.S.

    1985-01-01

    The objective of this study was to isolate inhibitors of replicative DNA synthesis from newborn rat epidermis. The strategy for this study was to assay epidermal extracts for inhibitors of DNA synthesis in primary cultures of newborn rat keratinocytes. DNA synthesis was measured as the incorporation of /sup 4/H-TdR into acid precipitable material. The low molecular weight fraction, LMWF (less than 10Kd), of an aqueous epidermal extract was found to contain activity that inhibits replicative DNA synthesis in primary cultures. The inhibitory activity of the LMWD was detected in a novel assay utilizing primary cultures that were synchronized at the G1/S boundary with the DNA polymerase alpha inhibitor, aphidicolin. LMWF caused a dose dependent inhibition of replicative DNA synthesis as measured by the incorporation of /sup 3/H-TdR into acid precipitable material. The magnitude of the inhibitory effect for a given dose of LMWF was dependent upon the duration of exposure to that dose. The results presented in this investigation suggest that newborn rat epidermis contains a small polypeptide factor that inhibits replicative DNA synthesis in primary culture of newborn rat keratinocytes.

  4. Post-synthesis DNA Modifications Using a trans-Cyclooctene Click Handle

    PubMed Central

    Wang, Ke; Wang, Danzhu; Ji, Kaili; Chen, Weixuan; Zheng, Yueqin; Dai, Chaofeng

    2015-01-01

    Post-synthesis DNA modification is a very useful method for DNA functionalization. This is achieved by using a modified NTP, which has a handle for further modifications, replacing the corresponding natural NTP in polymerase-catalyzed DNA synthesis. Subsequently, the handle can be used for further functionalization after PCR, preferably through a very fast reaction. Herein we describe polymerase-mediated incorporation of trans-cyclooctene modified thymidine triphosphate (TCO-TTP). Subsequently, the trans-cyclooctene group was reacted with a tetrazine tethered to other functional groups through a very fast click reaction. The utility of this DNA functionalization method was demonstrated with the incorporation of a boronic acid group and a fluorophore. The same approach was also successfully used in modifying a known aptamer for fluorescent labelling applications. PMID:25407744

  5. Post-synthesis DNA modifications using a trans-cyclooctene click handle.

    PubMed

    Wang, Ke; Wang, Danzhu; Ji, Kaili; Chen, Weixuan; Zheng, Yueqin; Dai, Chaofeng; Wang, Binghe

    2015-01-21

    Post-synthesis DNA modification is a very useful method for DNA functionalization. This is achieved by using a modified NTP, which has a handle for further modifications, replacing the corresponding natural NTP in polymerase-catalyzed DNA synthesis. Subsequently, the handle can be used for further functionalization after PCR, preferably through a very fast reaction. Herein we describe polymerase-mediated incorporation of trans-cyclooctene modified thymidine triphosphate (TCO-TTP). Subsequently, the trans-cyclooctene group was reacted with a tetrazine tethered to other functional groups through a very fast click reaction. The utility of this DNA functionalization method was demonstrated with the incorporation of a boronic acid group and a fluorophore. The same approach was also successfully used in modifying a known aptamer for fluorescent labelling applications.

  6. Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

    SciTech Connect

    Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

    1985-01-01

    Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.

  7. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  8. Translesion DNA synthesis in the context of cancer research

    PubMed Central

    2011-01-01

    During cell division, replication of the genomic DNA is performed by high-fidelity DNA polymerases but these error-free enzymes can not synthesize across damaged DNA. Specialized DNA polymerases, so called DNA translesion synthesis polymerases (TLS polymerases), can replicate damaged DNA thereby avoiding replication fork breakdown and subsequent chromosomal instability. We focus on the involvement of mammalian TLS polymerases in DNA damage tolerance mechanisms. In detail, we review the discovery of TLS polymerases and describe the molecular features of all the mammalian TLS polymerases identified so far. We give a short overview of the mechanisms that regulate the selectivity and activity of TLS polymerases. In addition, we summarize the current knowledge how different types of DNA damage, relevant either for the induction or treatment of cancer, are bypassed by TLS polymerases. Finally, we elucidate the relevance of TLS polymerases in the context of cancer therapy. PMID:22047021

  9. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  10. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  11. Stimulation of DNA synthesis in cultured rat alveolar type II cells

    SciTech Connect

    Leslie, C.C.; McCormick-Shannon, K.; Robinson, P.C.; Mason, R.J.

    1985-01-01

    Restoration of the alveolar epithelium after injury is thought to be dependent on the proliferation of alveolar type II cells. To understand the factors that may be involved in promoting type II cell proliferation in vivo, we determined the effect of potential mitogens and culture substrata on DNA synthesis in rat alveolar type II cells in primary culture. Type II cells cultured in basal medium containing 10% fetal bovine serum (FBS) exhibited essentially no DNA synthesis. Factors that stimulated /sup 3/H-thymidine incorporation included cholera toxin, epidermal growth factor, and rat serum. The greatest degree of stimulation was achieved by plating type II cells on an extracellular matrix prepared from bovine corneal endothelial cells and then by culturing the pneumocytes in medium containing rat serum, cholera toxin, insulin, and epidermal growth factor. Under conditions of stimulation of /sup 3/H-thymidine incorporation there was an increased DNA content per culture dish but no increase in cell number. The ability of various culture conditions to promote DNA synthesis in type II cells was verified by autoradiography. Type II cells were identified by the presence of cytoplasmic inclusions, which were visualized by tannic acid staining before autoradiography. These results demonstrate the importance of soluble factors and culture substratum in stimulating DNA synthesis in rat alveolar type II cells in primary culture.

  12. Stimulation of adrenal DNA synthesis in cadmium-treated male rats

    SciTech Connect

    Nishiyama, S.; Nakamura, K.

    1984-07-01

    Cadmium chloride (CdCl2) at a dose of 1 mg/kg body wt was injected into male rats of the Wistar strain, weighing 250 g on the average, twice a day (12-hr intervals) for 7 consecutive days. DNA and RNA contents and (/sup 3/H)-thymidine and (/sup 3/H)-uridine incorporation into the acid-insoluble fraction significantly increased in the adrenals of rats treated with Cd for 2 and 7 consecutive days. Adrenal protein content and weight also significantly increased. These results indicate that continued treatment with Cd stimulates DNA and RNA synthesis in the adrenal cortex, which in turn results in the increase of the total protein contents of the adrenal gland and subsequently in the enlargement of the gland. Serum adrenocorticotrophin (ACTH) and insulin levels in Cd-treated rats were not higher than control levels, suggesting that the stimulation of DNA synthesis in the adrenals of Cd-treated rats is due to factor(s) other than serum ACTH and insulin. Treatment with Cd inhibited DNA synthesis in cultured adrenocortical cells at concentrations of 10(-4) to 10(-8) M, suggesting that Cd does not directly stimulate DNA synthesis in the adrenal gland in vivo. Although the adrenal gland became enlarged, the total adrenal corticosterone content decreased significantly. The decrease of total adrenal corticosterone content may be due to the fall in serum ACTH level of Cd-treated rats.

  13. Amiloride inhibits rat mucosal ornithine decarboxylase activity and DNA synthesis

    SciTech Connect

    Ulrich-Baker, M.G.; Wang, P.; Fitzpatrick, L.; Johnson, L.R. )

    1988-03-01

    Refeeding fasted rats induces a dramatic trophic response in gastrointestinal mucosa and is associated with elevations in both rate of DNA synthesis and ornithine decarboxylase (ODC) activity. The signal for these increases is unknown. Amiloride prevents cell alkalinization by blocking Na{sup +}-H{sup +} exchange at apical epithelial cell membranes. In study 1, rats were fasted 48 h, treated with amiloride (0.5 to 500 mg/kg), and refed for 4 h. Refeeding increased ODC activities in the jejunal mucosa (X8) and liver (X19) but not in the oxyntic gland mucosa. In the jejunum, but not the liver, the activation of ODC was completely abolished by 100 mg/kg amiloride. In study 2, the rate of DNA synthesis was determine by measuring the rate of ({sup 3}H)thymidine incorporation 16 h after refeeding. Refeeding resulted in significantly increased rates of DNA synthesis over fasted levels, and amiloride at 100 mg/kg significantly reduced the elevations in the jejenum and liver. In conclusion, amiloride inhibits the postprandial increases in jejunal ODC activity and DNA synthesis in the jejunum and liver. The results indicate that (1) the Na{sup +}-H{sup +} antiport is essential to the increased ODC activity in the jejunum and liver after a meal and (2) increases in DNA synthesis and their suppression by amiloride are not necessary linked to ODC activity.

  14. Hypoxia-ischemia induces DNA synthesis without cell proliferation in dying neurons in adult rodent brain.

    PubMed

    Kuan, Chia-Yi; Schloemer, Aryn J; Lu, Aigang; Burns, Kevin A; Weng, Wei-Lan; Williams, Michael T; Strauss, Kenneth I; Vorhees, Charles V; Flavell, Richard A; Davis, Roger J; Sharp, Frank R; Rakic, Pasko

    2004-11-24

    Recent studies suggest that postmitotic neurons can reenter the cell cycle as a prelude to apoptosis after brain injury. However, most dying neurons do not pass the G1/S-phase checkpoint to resume DNA synthesis. The specific factors that trigger abortive DNA synthesis are not characterized. Here we show that the combination of hypoxia and ischemia induces adult rodent neurons to resume DNA synthesis as indicated by incorporation of bromodeoxyuridine (BrdU) and expression of G1/S-phase cell cycle transition markers. After hypoxia-ischemia, the majority of BrdU- and neuronal nuclei (NeuN)-immunoreactive cells are also terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL)-stained, suggesting that they undergo apoptosis. BrdU+ neurons, labeled shortly after hypoxia-ischemia, persist for >5 d but eventually disappear by 28 d. Before disappearing, these BrdU+/NeuN+/TUNEL+ neurons express the proliferating cell marker Ki67, lose the G1-phase cyclin-dependent kinase (CDK) inhibitors p16INK4 and p27Kip1 and show induction of the late G1/S-phase CDK2 activity and phosphorylation of the retinoblastoma protein. This contrasts to kainic acid excitotoxicity and traumatic brain injury, which produce TUNEL-positive neurons without evidence of DNA synthesis or G1/S-phase cell cycle transition. These findings suggest that hypoxia-ischemia triggers neurons to reenter the cell cycle and resume apoptosis-associated DNA synthesis in brain. Our data also suggest that the demonstration of neurogenesis after brain injury requires not only BrdU uptake and mature neuronal markers but also evidence showing absence of apoptotic markers. Manipulating the aberrant apoptosis-associated DNA synthesis that occurs with hypoxia-ischemia and perhaps neurodegenerative diseases could promote neuronal survival and neurogenesis.

  15. Amino Acid Racemization and the Preservation of Ancient DNA

    NASA Technical Reports Server (NTRS)

    Poinar, Hendrik N.; Hoss, Matthias

    1996-01-01

    The extent of racemization of aspartic acid, alanine, and leucine provides criteria for assessing whether ancient tissue samples contain endogenous DNA. In samples in which the D/L ratio of aspartic acid exceeds 0.08, ancient DNA sequences could not be retrieved. Paleontological finds from which DNA sequences purportedly millions of years old have been reported show extensive racemization, and the amino acids present are mainly contaminates. An exception is the amino acids in some insects preserved in amber.

  16. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase γ.

    PubMed

    Copeland, William C; Kasiviswanathan, Rajesh; Longley, Matthew J

    2016-01-01

    Mitochondrial DNA is replicated by the nuclear-encoded DNA polymerase γ (pol γ) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand cross-links from chemotherapy agents. Although many of these lesions block DNA replication, pol γ can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by pol γ can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis.

  17. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase γ

    PubMed Central

    Copeland, William C.; Kasiviswanathan, Rajesh; Longley, Matthew J.

    2016-01-01

    Summary Mitochondrial DNA is replicated by the nuclear encoded DNA polymerase γ (pol γ) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand crosslinks from chemotherapy agents. Although many of these lesions block DNA replication, Pol γ can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by Pol γ can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis. PMID:26530671

  18. Unscheduled synthesis of DNA and poly(ADP-ribose) in human fibroblasts following DNA damage

    SciTech Connect

    McCurry, L.S.; Jacobson, M.K.

    1981-01-01

    Unscheduled DNA synthesis has been measured in human fibroblasts under conditions of reduced rates of conversion of NAD to poly)ADP-ribose). Cells heterozygous for the xeroderma pigmentosum genotype showed normal rates of uv induced unscheduled DNA synthesis under conditions in which the rate of poly(ADP-ribose) synthesis was one-half the rate of normal cells. The addition of theophylline, a potent inhibitor of poly(ADP-ribose) polymerase, to the culture medium of normal cells blocked over 90% of the conversion of NAD to poly(ADP-ribose) following treatment with uv or N-methyl-N'-nitro-N-nitro-soguanidine but did not affect the rate of unscheduled DNA synthesis.

  19. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    SciTech Connect

    Jones, R.A.

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  20. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

    PubMed

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

    2012-03-13

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases. PMID:22320201

  1. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis

    PubMed Central

    2015-01-01

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the “structure elucidation problem”: the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS’s utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 104 molecules/bead and sequencing allowed for elucidation of each compound’s synthetic history. We applied DESPS to the combinatorial synthesis of a 75 645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and

  2. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis.

    PubMed

    MacConnell, Andrew B; McEnaney, Patrick J; Cavett, Valerie J; Paegel, Brian M

    2015-09-14

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the "structure elucidation problem": the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS's utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 10(4) molecules/bead and sequencing allowed for elucidation of each compound's synthetic history. We applied DESPS to the combinatorial synthesis of a 75,645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and PCR

  3. D-ribose inhibits DNA repair synthesis in human lymphocytes

    SciTech Connect

    Zunica, G.; Marini, M.; Brunelli, M.A.; Chiricolo, M.; Franceschi, C.

    1986-07-31

    D-ribose is cytotoxic for quiescent human lymphocytes and severely inhibits their PHA-induced proliferation at concentrations (25-50 mM) at which other simple sugars are ineffective. In order to explain these effects, DNA repair synthesis was evaluated in PHA-stimulated human lymphocytes treated with hydroxyurea and irradiated. D-ribose, in contrast to other reducing sugars, did not induce repair synthesis and therefore did not apparently damage DNA in a direct way, although it markedly inhibited gamma ray-induced repair. Taking into account that lymphocytes must rejoin physiologically-formed DNA strand breaks in order to enter the cell cycle, we suggest that D-ribose exerts its cytotoxic activity by interfering with metabolic pathways critical for the repair of DNA breaks.

  4. Polyaniline nanowire synthesis templated by DNA

    NASA Astrophysics Data System (ADS)

    Nickels, Patrick; Dittmer, Wendy U.; Beyer, Stefan; Kotthaus, Jörg P.; Simmel, Friedrich C.

    2004-11-01

    DNA-templated polyaniline nanowires and networks are synthesized using three different methods. The resulting DNA/polyaniline hybrids are fully characterized using atomic force microscopy, UV-vis spectroscopy and current-voltage measurements. Oxidative polymerization of polyaniline at moderate pH values is accomplished using ammonium persulfate as an oxidant, or alternatively in an enzymatic oxidation by hydrogen peroxide using horseradish peroxidase, or by photo-oxidation using a ruthenium complex as photo-oxidant. Atomic force microscopy shows that all three methods lead to the preferential growth of polyaniline along DNA templates. With ammonium persulfate, polyaniline can be grown on DNA templates already immobilized on a surface. Current-voltage measurements are successfully conducted on DNA/polyaniline networks synthesized by the enzymatic method and the photo-oxidation method. The conductance is found to be consistent with values measured for undoped polyaniline films.

  5. De novo design, synthesis and spectroscopic characterization of chiral benzimidazole-derived amino acid Zn(II) complexes: Development of tryptophan-derived specific hydrolytic DNA artificial nuclease agent

    NASA Astrophysics Data System (ADS)

    Parveen, Shazia; Arjmand, Farukh

    2012-01-01

    Novel ternary dizinc(II) complexes 1- 3, derived from 1,2-bis(1H-benzimidazol-2-yl)ethane-1,2-diol and L-form of amino acids (viz., tryptophan, leucine and valine) were synthesized and characterized by spectroscopic (IR, 1H NMR, UV-vis, ESI-MS) and other analytical methods. To evaluate the biological preference of chiral drugs for inherently chiral target DNA, interaction of 1- 3 with calf thymus DNA in Tris-HCl buffer was studied by various biophysical techniques which reveal that all these complexes bind to CT DNA non-covalently via electrostatic interaction. The higher Kb value of L-tryptophan complex 1 suggested greater DNA binding propensity. Further, to evaluate the mode of action at the molecular level, interaction studies of complexes 1 and 2 with nucleotides (5'-GMP and 5'-TMP) were carried out by UV-vis titrations, 1H and 31P NMR which implicates the preferential selectivity of these complexes to N3 of thymine rather than N7 of guanine. Furthermore, complex 1 exhibits efficient DNA cleavage with supercoiled pBR322. The complex 1 cleaves DNA efficiently involving hydrolytic cleavage pathway. Such chiral synthetic hydrolytic nucleases with asymmetric centers are gaining considerable attention owing to their importance in biotechnology and drug design, in particular to cleave DNA with sequence selectivity different from that of the natural enzymes.

  6. Cytoplasmic DNA synthesis in Amoeba proteus. I. On the particulate nature of the DNA-containing elements.

    PubMed

    RABINOVITCH, M; PLAUT, W

    1962-12-01

    The incorporation of tritiated thymidine in Amoeba proteus was reinvestigated in order to see if it could be associated with microscopically detectable structures. Staining experiments with basic dyes, including the fluorochrome acridine orange, revealed the presence of large numbers of 0.3 to 0.5 micro particles in the cytoplasm of all cells studied. The effect of nuclease digestion on the dye affinity of the particles suggests that they contain DNA as well as RNA. Centrifugation of living cells at 10,000 g leads to the sedimentation of the particles in the centrifugal third of the ameba near the nucleus. Analysis of centrifuged cells which had been incubated with H(3)-thymidine showed a very high degree of correlation between the location of the nucleic acid-containing granules and that of acid-insoluble, deoxyribonuclease-sensitive labeled molecules and leads to the conclusion that cytoplasmic DNA synthesis in Amoeba proteus occurs in association with these particles.

  7. Synthesis, structural investigation, DNA and protein binding study of some 3d-metal complexes with N‧-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide

    NASA Astrophysics Data System (ADS)

    Mishra, Monika; Tiwari, Karishma; Shukla, Sachin; Mishra, R.; Singh, Vinod P.

    2014-11-01

    The ligand, N‧-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide (Hpmtc) derived from thiophene-2-carboxylic acid hydrazide and 2-benzoyl pyridine, and its metal complexes with Co(II), Ni(II), Cu(II) and Zn(II) have been synthesized. These compounds are characterized by elemental analyses, magnetic susceptibility measurements, IR, NMR and UV-Vis spectral studies. The molecular structures of Hpmtc and its Co(II) (1), Ni(II) (2), Cu(II) (3) and Zn(II) (4) complexes are finally determined by X-ray crystallography. Various spectral and single-crystal X-ray diffraction studies suggest that Hpmtc coordinates with metal ions as a monobasic tridentate ligand forming mononuclear distorted octahedral complexes of the type [M(pmtc)2]. The molecular structures of the complexes are stabilized by Csbnd H⋯N, Csbnd H⋯O intermolecular H-bonding, and Csbnd H⋯π and π⋯π interactions. The DNA binding experiment of the complexes 1, 3 and 4 by UV-Vis absorption, and EB-DNA displacement by fluorescence spectroscopy, reveal an intercalative mode of binding between CT-DNA (calf-thymus DNA) and the metal complexes. These complexes exhibit a moderate ability to cleave pBR322 plasmid DNA. A comparative bovine serum albumin (BSA) protein binding activity of the complexes 1, 3 and 4 has also been determined by UV-Vis absorption and fluorescence spectroscopy. The DNA binding and protein binding studies suggest that the complex 3 exhibits more effective binding activity (Kb = 5.54 × 105 and Kq = 1.26 × 106 M-1, respectively) than complexes 1 and 4. However, the complex 1 shows better hydrolytic DNA cleavage activity compared to 3 and 4 complexes.

  8. Synthesis, structural investigation, DNA and protein binding study of some 3d-metal complexes with N'-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide.

    PubMed

    Mishra, Monika; Tiwari, Karishma; Shukla, Sachin; Mishra, R; Singh, Vinod P

    2014-11-11

    The ligand, N'-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide (Hpmtc) derived from thiophene-2-carboxylic acid hydrazide and 2-benzoyl pyridine, and its metal complexes with Co(II), Ni(II), Cu(II) and Zn(II) have been synthesized. These compounds are characterized by elemental analyses, magnetic susceptibility measurements, IR, NMR and UV-Vis spectral studies. The molecular structures of Hpmtc and its Co(II) (1), Ni(II) (2), Cu(II) (3) and Zn(II) (4) complexes are finally determined by X-ray crystallography. Various spectral and single-crystal X-ray diffraction studies suggest that Hpmtc coordinates with metal ions as a monobasic tridentate ligand forming mononuclear distorted octahedral complexes of the type [M(pmtc)2]. The molecular structures of the complexes are stabilized by CH⋯N, CH⋯O intermolecular H-bonding, and CH⋯π and π⋯π interactions. The DNA binding experiment of the complexes 1, 3 and 4 by UV-Vis absorption, and EB-DNA displacement by fluorescence spectroscopy, reveal an intercalative mode of binding between CT-DNA (calf-thymus DNA) and the metal complexes. These complexes exhibit a moderate ability to cleave pBR322 plasmid DNA. A comparative bovine serum albumin (BSA) protein binding activity of the complexes 1, 3 and 4 has also been determined by UV-Vis absorption and fluorescence spectroscopy. The DNA binding and protein binding studies suggest that the complex 3 exhibits more effective binding activity (Kb=5.54×10(5) and Kq=1.26×10(6) M(-1), respectively) than complexes 1 and 4. However, the complex 1 shows better hydrolytic DNA cleavage activity compared to 3 and 4 complexes.

  9. The coordinate induction of DNA synthesis after tuber wounding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tuber wounding induces a cascade of biological responses involved in processes required to heal and protect surviving plant issues. Little is known about the coordination of these processes, including essential wound-induced DNA synthesis, yet they play critical roles in maintaining marketability o...

  10. Magnetic isotope and magnetic field effects on the DNA synthesis

    PubMed Central

    Buchachenko, Anatoly L.; Orlov, Alexei P.; Kuznetsov, Dmitry A.; Breslavskaya, Natalia N.

    2013-01-01

    Magnetic isotope and magnetic field effects on the rate of DNA synthesis catalysed by polymerases β with isotopic ions 24Mg2+, 25Mg2+ and 26Mg2+ in the catalytic sites were detected. No difference in enzymatic activity was found between polymerases β carrying 24Mg2+ and 26Mg2+ ions with spinless, non-magnetic nuclei 24Mg and 26Mg. However, 25Mg2+ ions with magnetic nucleus 25Mg were shown to suppress enzymatic activity by two to three times with respect to the enzymatic activity of polymerases β with 24Mg2+ and 26Mg2+ ions. Such an isotopic dependence directly indicates that in the DNA synthesis magnetic mass-independent isotope effect functions. Similar effect is exhibited by polymerases β with Zn2+ ions carrying magnetic 67Zn and non-magnetic 64Zn nuclei, respectively. A new, ion–radical mechanism of the DNA synthesis is suggested to explain these effects. Magnetic field dependence of the magnesium-catalysed DNA synthesis is in a perfect agreement with the proposed ion–radical mechanism. It is pointed out that the magnetic isotope and magnetic field effects may be used for medicinal purposes (trans-cranial magnetic treatment of cognitive deceases, cell proliferation, control of the cancer cells, etc). PMID:23851636

  11. Nitrous acid induced damage in T7 DNA and phage

    SciTech Connect

    Scearce, L.M.; Masker, W.E.

    1986-05-01

    The response of bacteriophage T7 to nitrous acid damage was investigated. The T7 system allows in vitro mimicry of most aspects of in vivo DNA metabolism. Nitrous acid is of special interest since it has been previously shown to induce deletions and point mutations as well as novel adducts in DNA. T7 phage was exposed to 56 mM nitrous acid at pH 4.6 in vivo, causing a time dependent 98% decrease in survival for each 10 min duration of exposure to nitrous acid. These studies were extended to include examination of pure T7 DNA exposed in vitro to nitrous acid conditions identical to those used in the in vivo survival studies. The treated DNA was dialyzed to remove the nitrous acid and the DNA was encapsulated into empty phage heads. These in vitro packaged phage showed a survival curve analogous to the in vivo system. There was no change in survival when either in vitro or in vivo exposed phage were grown on wild type E. coli or on E. coli strains deficient in DNA repair due to mutations in DNA polymerase I, exonuclease III or a uvrA mutation. Survival was not increased when nitrous acid treated T7 were grown on E. coli induced for SOS repair. In vitro replication of nitrous acid treated DNA showed a time dependent decrease in the total amount of DNA synthesized.

  12. Changes in the amplitude of cyclic load biphasically modulate endothelial cell DNA synthesis and division.

    PubMed

    Upchurch, G R; Loscalzo, J; Banes, A J

    1997-01-01

    Several physical factors, including shear stress and cyclic load, modulate the ability of endothelial cells to respond to injury. The objective of these experiments was to test the hypothesis that cyclic mechanical load stimulates endothelial cell DNA synthesis and division in vitro. Rabbit aortic endothelial cells were cultured on Flex I flexible-bottomed culture plates, and subjected to load amplitudes of increasing magnitude (0, 0.18, 0.24 and 0.27 load at 1 Hz) using a Flexercell strain unit. Cells were harvested enzymatically and cell numbers determined on days 1, 3 and 5 after initiating the load regimen. DNA synthesis was quantified after trichloroacetic acid precipitation of [3H]thymidine-labeled cells from: (1) whole culture wells and (2) areas of minimum and maximum strain in culture cells. Data were analyzed using analysis of variance and a Tukey's test (n = 6 observations/strain regimen per day in triplicate). Results from analysis of endothelial cells in whole, subconfluent cultures showed that cells subjected to strains of 0.18 had a decreased rate of cell division (76% of control) and DNA synthesis (63% of control), while cells subjected to strains of 0.24 and 0.27 had an increased rate of cell division (108 and 83% increase, respectively, compared with control; p < 0.001) and DNA synthesis (39 and 172% increase, respectively, compared with control; p < 0.001 for 0.27) on day 3 when compared with control cells. The results indicate that endothelial cells respond to various physiologic levels of cyclic load in a biphasic manner to initiate DNA synthesis and cell division. These data suggest that endothelial cell mitogenesis may be modulated by specific levels of cyclic load. PMID:9546945

  13. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  14. Sickle erythrocytes inhibit human endothelial cell DNA synthesis

    SciTech Connect

    Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K. )

    1990-11-15

    Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling.

  15. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  16. The interaction of amino acids, peptides, and proteins with DNA.

    PubMed

    Solovyev, Andrey Y; Tarnovskaya, Svetlana I; Chernova, Irina A; Shataeva, Larisa K; Skorik, Yury A

    2015-01-01

    Amino acids that carry charges on their side groups can bind to double stranded DNA (dsDNA) and change the strength of the double helix. Measurement of the DNA melting temperature (Tm) confirmed that acidic amino acids (Glu, Asp) weaken the H-bonds between DNA strands, whereas basic amino acids (Arg, Lys) strengthen the interaction between the strands. A rank correlation exists between the amino acid isoelectric points and the observed changes in Tm. A similar dependence of the hyperchromic effect on the isoelectric point of a protein (pepsin, insulin, cortexin, and protamine) was observed for DNA-protein complexes at room temperature. Short peptides (KE, AEDG, and KEDP) containing a mixture of acidic and basic amino acid residues also affect Tm and the stability of the double helix. A model for binding Glu and Lys to dsDNA was explored by a docking simulation. The model shows that Glu, in an untwisted shape, binds to dsDNA in its major groove and disrupts three H-bonds between the strands, thereby destabilizing the double helix. Lys, in an untwisted shape, binds to the external side of the dsDNA and forms two bonds with O atoms of neighboring phosphodiester groups, thereby strengthening the DNA helix.

  17. Cell cycle specific distribution of killin: evidence for negative regulation of both DNA and RNA synthesis.

    PubMed

    Qiao, Man; Luo, Dan; Kuang, Yi; Feng, Haiyan; Luo, Guangping; Liang, Peng

    2015-01-01

    p53 tumor-suppressor gene is a master transcription factor which controls cell cycle progression and apoptosis. killin was discovered as one of the p53 target genes implicated in S-phase control coupled to cell death. Due to its extreme proximity to pten tumor-suppressor gene on human chromosome 10, changes in epigenetic modification of killin have also been linked to Cowden syndrome as well as other human cancers. Previous studies revealed that Killin is a high-affinity DNA-binding protein with preference to single-stranded DNA, and it inhibits DNA synthesis in vitro and in vivo. Here, co-localization studies of RFP-Killin with either GFP-PCNA or endogenous single-stranded DNA binding protein RPA during S-phase show that Killin always adopts a mutually exclusive punctuated nuclear expression pattern with the 2 accessory proteins in DNA replication. In contrast, when cells are not in S-phase, RFP-Killin largely congregates in the nucleolus where rRNA transcription normally occurs. Both of these cell cycle specific localization patterns of RFP-Killin are stable under high salt condition, consistent with Killin being tightly associated with nucleic acids within cell nuclei. Together, these cell biological results provide a molecular basis for Killin in competitively inhibiting the formation of DNA replication forks during S-phase, as well as potentially negatively regulate RNA synthesis during other cell cycle phases.

  18. 'Shotgun DNA synthesis' for the high-throughput construction of large DNA molecules.

    PubMed

    Kim, Hwangbeom; Han, Hyojun; Ahn, Jinwoo; Lee, Joongoo; Cho, Namjin; Jang, Hoon; Kim, Hyoki; Kwon, Sunghoon; Bang, Duhee

    2012-10-01

    We developed a highly scalable 'shotgun' DNA synthesis technology by utilizing microchip oligonucleotides, shotgun assembly and next-generation sequencing technology. A pool of microchip oligonucleotides targeting a penicillin biosynthetic gene cluster were assembled into numerous random fragments, and tagged with 20 bp degenerate barcode primer pairs. An optimal set of error-free fragments were identified by high-throughput DNA sequencing, selectively amplified using the barcode sequences, and successfully assembled into the target gene cluster.

  19. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  20. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  1. Switchable reconfiguration of nucleic acid nanostructures by stimuli-responsive DNA machines.

    PubMed

    Liu, Xiaoqing; Lu, Chun-Hua; Willner, Itamar

    2014-06-17

    CONSPECTUS: The base sequence in DNA dictates structural and reactivity features of the biopolymer. These properties are implemented to use DNA as a unique material for developing the area of DNA nanotechnology. The design of DNA machines represents a rapidly developing research field in the area of DNA nanotechnology. The present Account discusses the switchable reconfiguration of nucleic acid nanostructures by stimuli-responsive DNA machines, and it highlights potential applications and future perspectives of the area. Programmed switchable DNA machines driven by various fuels and antifuels, such as pH, Hg(2+) ions/cysteine, or nucleic acid strands/antistrands, are described. These include the assembly of DNA tweezers, walkers, a rotor, a pendulum, and more. Using a pH-oscillatory system, the oscillatory mechanical operation of a DNA pendulum is presented. Specifically, the synthesis and "mechanical" properties of interlocked DNA rings are described. This is exemplified with the preparation of interlocked DNA catenanes and a DNA rotaxane. The dynamic fuel-driven reconfiguration of the catenane/rotaxane structures is followed by fluorescence spectroscopy. The use of DNA machines as functional scaffolds to reconfigurate Au nanoparticle assemblies and to switch the fluorescence features within fluorophore/Au nanoparticle conjugates between quenching and surface-enhanced fluorescence states are addressed. Specifically, the fluorescence features of the different DNA machines are characterized as a function of the spatial separation between the fluorophore and Au nanoparticles. The experimental results are supported by theoretical calculations. The future development of reconfigurable stimuli-responsive DNA machines involves fundamental challenges, such as the synthesis of molecular devices exhibiting enhanced complexities, the introduction of new fuels and antifuels, and the integration of new payloads being reconfigured by the molecular devices, such as enzymes or

  2. Synthesis of nucleic acid probes on membrane supports: a procedure for the removal of unincorporated precursors.

    PubMed

    Bhat, S P

    1990-01-01

    We have used DNA bound to small pieces of nylon membrane for the synthesis of radioactive probes. The DNA to be used for generating the probe(s) is first bound to nylon membranes and then introduced into the reaction mix. The labeling reaction takes place on the membrane and therefore allows easy removal of unincorporated precursors by simple washing for 1-2 min. The clean labeled probe is eluted from the membrane in formamide or in water and is ready for use. This DNA-membrane can be stored for reuse. Synthesis of probes on a solid support such as nylon membrane thus circumvents problems associated with chromatographic manipulations needed for the separation of labeled DNA from unicorporated precursors. Probes synthesized in this manner are as efficient in detecting nucleic acid sequences as those synthesized in solution. PMID:2321760

  3. Translesion synthesis past acrolein-derived DNA adducts by human mitochondrial DNA polymerase γ.

    PubMed

    Kasiviswanathan, Rajesh; Minko, Irina G; Lloyd, R Stephen; Copeland, William C

    2013-05-17

    Acrolein, a mutagenic aldehyde, is produced endogenously by lipid peroxidation and exogenously by combustion of organic materials, including tobacco products. Acrolein reacts with DNA bases forming exocyclic DNA adducts, such as γ-hydroxy-1,N(2)-propano-2'-deoxyguanosine (γ-HOPdG) and γ-hydroxy-1,N(6)-propano-2'-deoxyadenosine (γ-HOPdA). The bulky γ-HOPdG adduct blocks DNA synthesis by replicative polymerases but can be bypassed by translesion synthesis polymerases in the nucleus. Although acrolein-induced adducts are likely to be formed and persist in mitochondrial DNA, animal cell mitochondria lack specialized translesion DNA synthesis polymerases to tolerate these lesions. Thus, it is important to understand how pol γ, the sole mitochondrial DNA polymerase in human cells, acts on acrolein-adducted DNA. To address this question, we investigated the ability of pol γ to bypass the minor groove γ-HOPdG and major groove γ-HOPdA adducts using single nucleotide incorporation and primer extension analyses. The efficiency of pol γ-catalyzed bypass of γ-HOPdG was low, and surprisingly, pol γ preferred to incorporate purine nucleotides opposite the adduct. Pol γ also exhibited ∼2-fold lower rates of excision of the misincorporated purine nucleotides opposite γ-HOPdG compared with the corresponding nucleotides opposite dG. Extension of primers from the termini opposite γ-HOPdG was accomplished only following error-prone purine nucleotide incorporation. However, pol γ preferentially incorporated dT opposite the γ-HOPdA adduct and efficiently extended primers from the correctly paired terminus, indicating that γ-HOPdA is probably nonmutagenic. In summary, our data suggest that acrolein-induced exocyclic DNA lesions can be bypassed by mitochondrial DNA polymerase but, in the case of the minor groove γ-HOPdG adduct, at the cost of unprecedented high mutation rates.

  4. A complex between replication factor A (SSB) and DNA helicase stimulates DNA synthesis of DNA polymerase alpha on double-stranded DNA.

    PubMed

    Zhang, S; Grosse, F

    1992-11-01

    A helicase-like DNA unwinding activity was found in highly purified fractions of the calf thymus single-stranded DNA binding protein (ctSSB), also known as replication protein A (RP-A) or replication factor A (RF-A). This activity depended on the hydrolysis of ATP or dATP, and used CTP with a lower efficiency. ctSSB promoted the homologous DNA polymerase alpha to perform DNA synthesis on double-stranded templates containing replication fork-like structures. The rate and amount of DNA synthesis was found to be dependent on the concentration of ctSSB. At a 10-fold mass excess of ctSSB over double-stranded DNA, products of 200-600 nucleotides in length were obtained. This comprises or even exceeds the length of a eukaryotic Okazaki fragment. The ctSSB-associated DNA helicase activity is most likely a distinct protein rather than an inherent property of SSB, as inferred from titration experiments between SSB and DNA. The association of a helicase with SSB and the stimulatory action of this complex to the DNA polymerase alpha-catalyzed synthesis of double-stranded DNA suggests a cooperative function of the three enzymatic activities in the process of eukaryotic DNA replication.

  5. Mechanism of translesion DNA synthesis by DNA polymerase II. Comparison to DNA polymerases I and III core.

    PubMed

    Paz-Elizur, T; Takeshita, M; Goodman, M; O'Donnell, M; Livneh, Z

    1996-10-01

    Bypass synthesis by DNA polymerase II was studied using a synthetic 40-nucleotide-long gapped duplex DNA containing a site-specific abasic site analog, as a model system for mutagenesis associated with DNA lesions. Bypass synthesis involved a rapid polymerization step terminating opposite the nucleotide preceding the lesion, followed by a slow bypass step. Bypass was found to be dependent on polymerase and dNTP concentrations, on the DNA sequence context, and on the size of the gap. A side-by-side comparison of DNA polymerases I, II, and III core revealed the following. 1) Each of the three DNA polymerases bypassed the abasic site analog unassisted by other proteins. 2) In the presence of physiological-like salt conditions, only DNA polymerase II bypassed the lesion. 3) Bypass by each of the three DNA polymerases increased dramatically in the absence of proofreading. These results support a model (Tomer, G., Cohen-Fix, O. , O'Donnell, M., Goodman, M. and Livneh, Z. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1376-1380) by which the RecA, UmuD, and UmuC proteins are accessory factors rather than being absolutely required for the core mutagenic bypass reaction in induced mutagenesis in Escherichia coli.

  6. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  7. Synthesis of DNA and Poly(Adenosine Diphosphate Ribose) in Normal and Chronic Lymphocytic Leukemia Lymphocytes

    PubMed Central

    Berger, Nathan A.; Adams, Jessie W.; Sikorski, Georgina W.; Petzold, Shirley J.; Shearer, William T.

    1978-01-01

    Peripheral blood lymphocytes were isolated from 9 patients with chronic lymphocytic leukemia (CLL) and 12 normal control donors. The cells were assayed for synthesis of DNA and poly-(adenosine diphosphate ribose) (poly[ADPR]) immediately after isolation and on successive days following their treatment with phytohemagglutinin (PHA). Two different techniques were used to measure DNA synthesis. In the standard technique, DNA synthesis was measured by incubating intact cells with [3H]deoxythymidine. In the new technique, the lymphocytes were first rendered permeable to nucleotides, then DNA synthesis was measured by incubating them with [3H]deoxythymidine triphosphate in the presence of deoxyATP, deoxyGTP, deoxyCTP, ATP, and Mg++. Both assays showed the anticipated rise in DNA synthesis after PHA stimulation of normal cells. PHA-stimulated lymphocytes from patients with CLL demonstrated low levels of DNA synthesis in both assay systems. The initial levels of poly(ADPR) synthesis were greater in CLL lymphocytes than in normal cells. Studies with a T-cell-depleted population of normal cells showed the same activity for poly(ADPR) synthesis that was demonstrated by the original population of normal cells. PHA stimulation produced an increase in poly(ADPR) synthesis in both the normal and CLL cells. The increase in poly(ADPR) synthesis in normal cells was coincident with the increase in DNA synthesis. The increase in poly(ADPR) synthesis in the CLL cells was dissociated from the delayed and diminished increase in DNA synthesis. Thus, CLL cells have higher than normal initial levels of poly(ADPR) synthesis. Poly(ADPR) synthesis is dissociated from DNA synthesis in CLL cells whereas it varies directly with DNA synthesis in normal lymphocytes. PMID:659624

  8. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  9. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis.

    PubMed Central

    Duester, G; Shean, M L; McBride, M S; Stewart, M J

    1991-01-01

    Retinoic acid regulation of one member of the human class I alcohol dehydrogenase (ADH) gene family was demonstrated, suggesting that the retinol dehydrogenase function of ADH may play a regulatory role in the biosynthetic pathway for retinoic acid. Promoter activity of human ADH3, but not ADH1 or ADH2, was shown to be activated by retinoic acid in transient transfection assays of Hep3B human hepatoma cells. Deletion mapping experiments identified a region in the ADH3 promoter located between -328 and -272 bp which confers retinoic acid activation. This region was also demonstrated to confer retinoic acid responsiveness on the ADH1 and ADH2 genes in heterologous promoter fusions. Within a 34-bp stretch, the ADH3 retinoic acid response element (RARE) contains two TGACC motifs and one TGAAC motif, both of which exist in RAREs controlling other genes. A block mutation of the TGACC sequence located at -289 to -285 bp eliminated the retinoic acid response. As assayed by gel shift DNA binding studies, the RARE region (-328 to -272 bp) of ADH3 bound the human retinoic acid receptor beta (RAR beta) and was competed for by DNA containing a RARE present in the gene encoding RAR beta. Since ADH catalyzes the conversion of retinol to retinal, which can be further converted to retinoic acid by aldehyde dehydrogenase, these results suggest that retinoic acid activation of ADH3 constitutes a positive feedback loop regulating retinoic acid synthesis. Images PMID:1996113

  10. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA.

  11. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA. PMID:27311715

  12. Association of DNA sequence variation in mitochondrial DNA polymerase with mitochondrial DNA synthesis and risk of oral cancer.

    PubMed

    Datta, Sayantan; Ray, Anindita; Roy, Roshni; Roy, Bidyut

    2016-01-10

    Enzymes responsible for mitochondrial (mt) DNA synthesis and transcription are encoded by nuclear genome and inherited mutations in these genes may play important roles in enhancing risk of precancer and cancer. Here, genetic variations in 23 functionally relevant tagSNPs in 6 genes responsible for mtDNA synthesis and transcription were studied in 522 cancer and 241 precancer (i.e. leukoplakia) patients and 525 healthy controls using Illumina Golden Gate assay to explore association with risk of oral precancer and cancer. Two SNPs, rs41553913 at POLRMT and rs9905016 at POLG2, significantly increased risk of oral leukoplakia and cancer, respectively, at both genotypic and allelic levels. Gene-environment interaction models also revealed that tobacco habits and SNPs at POLG2 and TFAM may modulate risk of both leukoplakia and cancer. In silico analysis of published data-set also revealed that variant heterozygote (TC) significantly increased transcription of POLG2 compared to wild genotype (p=0.03). Cancer tissues having variant allele genotypes (TC+CC) at POLG2 contained 1.6 times (p<0.01) more mtDNA compared to cancer tissues having wild genotype (TT). In conclusion, polymorphisms at POLG2 and POLRMT increased risk of oral cancer and leukoplakia, respectively, probably modulating synthesis and activity of the enzymes. Enhanced synthesis of mtDNA in cancer tissues may have implication in carcinogenesis, but the mechanism is yet to be explored. PMID:26403317

  13. Association of DNA sequence variation in mitochondrial DNA polymerase with mitochondrial DNA synthesis and risk of oral cancer.

    PubMed

    Datta, Sayantan; Ray, Anindita; Roy, Roshni; Roy, Bidyut

    2016-01-10

    Enzymes responsible for mitochondrial (mt) DNA synthesis and transcription are encoded by nuclear genome and inherited mutations in these genes may play important roles in enhancing risk of precancer and cancer. Here, genetic variations in 23 functionally relevant tagSNPs in 6 genes responsible for mtDNA synthesis and transcription were studied in 522 cancer and 241 precancer (i.e. leukoplakia) patients and 525 healthy controls using Illumina Golden Gate assay to explore association with risk of oral precancer and cancer. Two SNPs, rs41553913 at POLRMT and rs9905016 at POLG2, significantly increased risk of oral leukoplakia and cancer, respectively, at both genotypic and allelic levels. Gene-environment interaction models also revealed that tobacco habits and SNPs at POLG2 and TFAM may modulate risk of both leukoplakia and cancer. In silico analysis of published data-set also revealed that variant heterozygote (TC) significantly increased transcription of POLG2 compared to wild genotype (p=0.03). Cancer tissues having variant allele genotypes (TC+CC) at POLG2 contained 1.6 times (p<0.01) more mtDNA compared to cancer tissues having wild genotype (TT). In conclusion, polymorphisms at POLG2 and POLRMT increased risk of oral cancer and leukoplakia, respectively, probably modulating synthesis and activity of the enzymes. Enhanced synthesis of mtDNA in cancer tissues may have implication in carcinogenesis, but the mechanism is yet to be explored.

  14. Folic acid binds DNA and RNA at different locations.

    PubMed

    Bourassa, P; Tajmir-Riahi, H A

    2015-03-01

    We located multiple binding sites for folic acid on DNA and tRNA at physiological conditions, using FTIR, CD, fluorescence spectroscopic methods and molecular modeling. Structural analysis revealed that folic acid binds DNA and tRNA at multiple sites via hydrophilic, hydrophobic and H-bonding contacts with overall binding constants of Kfolic acid-DNA=1.1 (±0.3)×10(4) M(-1) and Kfolic acid-tRNA=6.4 (±0.5)×10(3) M(-1). Molecular modeling showed the participation of several nucleobases in folic acid complexes with DNA and tRNA, stabilized by H-bonding network. Two types of complexes were located for folic acid-tRNA adducts, one at the major groove and the other with TΨC loop, while acid binding occurs at major and minor grooves of DNA duplex. Folic acid complexation induced more alterations of DNA structure than tRNA.

  15. One-stop genomic DNA extraction by salicylic acid-coated magnetic nanoparticles.

    PubMed

    Zhou, Zhongwu; Kadam, Ulhas S; Irudayaraj, Joseph

    2013-11-15

    Salicylic acid-coated magnetic nanoparticles were prepared via a modified one-step synthesis and used for a one-stop extraction of genomic DNA from mammalian cells. The synthesized magnetic particles were used for magnetic separation of cells from the media by nonspecific binding of the particles as well as extraction of genomic DNA from the lysate. The quantity and quality were confirmed by agarose gel electrophoresis and polymerase chain reaction. The entire process of extraction and isolation can be completed within 30 min. Compared with traditional methods based on centrifugation and filtration, the established method is fast, simple, reliable, and environmentally friendly.

  16. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  17. Design and synthesis of threading intercalators to target DNA.

    PubMed

    Howell, Lesley A; Gulam, Rosul; Mueller, Anja; O'Connell, Maria A; Searcey, Mark

    2010-12-01

    Threading intercalators are high affinity DNA binding agents that bind by inserting a chromophore into the duplex and locating one group in each groove. The first threading intercalators that can be conjugated to acids, sulfonic acids and peptides to target them to duplex DNA are described, based upon the well studied acridine-3- or 4-carboxamides. Cellular uptake of the parent acridine is rapid and it can be visualized in the nucleus of cells. Both the parent compounds and their conjugates maintain antitumor activity.

  18. Replication stress activates DNA repair synthesis in mitosis.

    PubMed

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach.

  19. Replication stress activates DNA repair synthesis in mitosis.

    PubMed

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach. PMID:26633632

  20. Synthesis, spectroscopic characterization and structural investigation of a new charge transfer complex of 2,6-diaminopyridine with 4-nitrophenylacetic acid: Antimicrobial, DNA binding/cleavage and antioxidant studies

    NASA Astrophysics Data System (ADS)

    Murugesan, Venkatesan; Saravanabhavan, Munusamy; Sekar, Marimuthu

    2015-08-01

    A new hydrogen-bonded charge-transfer complex (CT) formed by the reaction between donor, 2,6-diaminopyridine and acceptor, 4-nitrophenylacetic acid in methanol at room temperature. The crystal was characterized by elemental analysis, IR, NMR spectroscopic studies and thermal studies. The elemental analysis of CT complex, obtained data revealed that the formation of 1:1 ratio CT complex was proposed. Infrared and NMR studies confirm the chemical constituents and molecular structure of the synthesized complex crystal. The high thermal stability is due to the molecular frame work through H-bonding interactions. Structural investigation indicates that cation and anion are linked through strong N+-H⋯O- type of hydrogen bond. The hydrogen bonded charge transfer crystal was screened for its pharmacology, such as antimicrobial, DNA binding/cleavage and antioxidant studies. The CT complex was screened for its antibacterial and antifungal activity against various bacterial and fungal species, which shows good antimicrobial activity. The DNA binding results indicated that the compound could interact with DNA through intercalation. It should have weak to moderate capacity of scavenging with DPPH.

  1. Synthesis, spectroscopic characterization and structural investigation of a new charge transfer complex of 2,6-diaminopyridine with 4-nitrophenylacetic acid: Antimicrobial, DNA binding/cleavage and antioxidant studies.

    PubMed

    Murugesan, Venkatesan; Saravanabhavan, Munusamy; Sekar, Marimuthu

    2015-08-01

    A new hydrogen-bonded charge-transfer complex (CT) formed by the reaction between donor, 2,6-diaminopyridine and acceptor, 4-nitrophenylacetic acid in methanol at room temperature. The crystal was characterized by elemental analysis, IR, NMR spectroscopic studies and thermal studies. The elemental analysis of CT complex, obtained data revealed that the formation of 1:1 ratio CT complex was proposed. Infrared and NMR studies confirm the chemical constituents and molecular structure of the synthesized complex crystal. The high thermal stability is due to the molecular frame work through H-bonding interactions. Structural investigation indicates that cation and anion are linked through strong N(+)-H⋯O(-) type of hydrogen bond. The hydrogen bonded charge transfer crystal was screened for its pharmacology, such as antimicrobial, DNA binding/cleavage and antioxidant studies. The CT complex was screened for its antibacterial and antifungal activity against various bacterial and fungal species, which shows good antimicrobial activity. The DNA binding results indicated that the compound could interact with DNA through intercalation. It should have weak to moderate capacity of scavenging with DPPH.

  2. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    DOEpatents

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  3. Synthesis, spectroscopic, crystal structure and DNA binding of Ru(II) complexes with 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide

    NASA Astrophysics Data System (ADS)

    Chitrapriya, Nataraj; Sathiya Kamatchi, Thangavel; Zeller, Matthias; Lee, Hyosun; Natarajan, Karuppannan

    2011-10-01

    Reactions of 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide (H 2L) with [RuHCl(CO)(EPh 3) 3] (E = P or As) were carried out and the new complexes obtained were characterized by elemental analysis, electronic, IR, 1H NMR and 13C NMR spectroscopic techniques and single crystal X-ray diffraction studies. Complex ( 1) crystallizes in the monoclinic space group P2(1)/ c with unit cell dimensions a = 18.6236(17) Å, b = 12.8627(12) Å, c = 21.683(2) Å, α = 90.00, β = 114.626(2), γ = 90.00 V = 4721.8(8) Å, Z = 4. The crystal structure of the complex shows Ru(II) atom is six-coordinated, forming a slightly distorted octahedral geometry with two P atoms in axial positions, and three chelating donor atoms of the tridentate Schiff base ligand and one carbonyl group located in the equatorial plane. The molecular structure is stabilized by intramolecular O—H···N interactions. No intermolecular hydrogen bond was observed. The intramolecular hydrogen bond exists between the oxygen atom from salicylic acid moiety and nitrogen from the same moiety. A variety of solution studies were carried out for the determination of DNA binding mode of the complexes. The results suggest that both complexes bind to Herring sperm DNA via non intercalative mode.

  4. Synthesis, spectroscopic, crystal structure and DNA binding of Ru(II) complexes with 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide.

    PubMed

    Chitrapriya, Nataraj; Kamatchi, Thangavel Sathiya; Zeller, Matthias; Lee, Hyosun; Natarajan, Karuppannan

    2011-10-15

    Reactions of 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide (H(2)L) with [RuHCl(CO)(EPh(3))(3)] (E = P or As) were carried out and the new complexes obtained were characterized by elemental analysis, electronic, IR, (1)H NMR and (13)C NMR spectroscopic techniques and single crystal X-ray diffraction studies. Complex (1) crystallizes in the monoclinic space group P2(1)/c with unit cell dimensions a=18.6236(17) Å, b=12.8627(12) Å, c=21.683(2) Å, α=90.00, β=114.626(2), γ=90.00 V=4721.8(8) Å, Z=4. The crystal structure of the complex shows Ru(II) atom is six-coordinated, forming a slightly distorted octahedral geometry with two P atoms in axial positions, and three chelating donor atoms of the tridentate Schiff base ligand and one carbonyl group located in the equatorial plane. The molecular structure is stabilized by intramolecular O-H···N interactions. No intermolecular hydrogen bond was observed. The intramolecular hydrogen bond exists between the oxygen atom from salicylic acid moiety and nitrogen from the same moiety. A variety of solution studies were carried out for the determination of DNA binding mode of the complexes. The results suggest that both complexes bind to Herring sperm DNA via non intercalative mode. PMID:21763180

  5. Growth and Synthesis of Nucleic Acid and Protein by Excised Radish Cotyledons 1

    PubMed Central

    Nieman, R. H.; Poulsen, L. L.

    1967-01-01

    Nutritional and light requirements for growth and synthesis of RNA, DNA, and protein by cotyledons excised from 5-day-old seedlings of Raphanus sativus L. were investigated, and the course of synthesis was followed through the cell cycle. The minimum requirements for a net increase in nucleic acid and protein were sugar, nitrate, and light. The cotyledons used nitrite at low concentration, but not ammonium ion. Light was required for preliminary steps in synthesis of RNA, DNA, and protein, but the actual polymerization reactions occurred in the dark. The cotyledons contained sufficient endogenous growth factors for about half of the cells to complete 1 cycle on a medium of 1% sucrose, 80 mm KNO3. The increase in DNA was limited to about 50% and was accompanied by a comparable increase in cell number. Fresh weight, RNA, and protein tended to increase in proportion to DNA. Growth of the isolated cotyledons commenced with cell enlargement. RNA began to increase after about 4 hours, DNA after about 12. The major increase in protein also began at about 12 hours. The maximum rate of increase for all 3 occurred between 12 and 16 hours. Cell counts indicated that by 28 hours most of the cells which had replicated DNA had also completed cell division. PMID:16656601

  6. Uracil misincorporation into DNA and folic acid supplementation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BACKGROUND: Folate deficiency decreases thymidylate synthesis from deoxyuridylate, which results in an imbalance of deoxyribonucleotide that may lead to excessive uracil misincorporation (UrMis) into DNA during replication and repair. OBJECTIVE: We evaluated the relation between UrMis in different ...

  7. Femtosecond spectroscopic study of carminic acid DNA interactions

    NASA Astrophysics Data System (ADS)

    Comanici, Radu; Gabel, Bianca; Gustavsson, Thomas; Markovitsi, Dimitra; Cornaggia, Christian; Pommeret, Stanislas; Rusu, Catalin; Kryschi, Carola

    2006-06-01

    Photo-excited carminic acid and carminic acid-DNA complexes in a buffer solution at pH 7 have been examined using a variety of spectroscopy techniques, that are in particular, the femtosecond resolved fluorescence upconversion and transient absorption spectroscopy. The observation of dual fluorescence emission, one peaks at 470 nm and the other at 570 nm, indicates to an excited-state (S 1) intramolecular proton transfer (ESIPT). A detailed analysis of the transient absorption measurements of an aqueous carminic-acid solution at pH 7 yielded four lifetimes for the excited-state (S 1): 8, 15, 33 and 46 ps. On the other hand, only two lifetimes, 34 and 47 ps, were observed by fluorescence upconversion spectroscopy because of the detection limitation to the long wavelength edge of the carminic-acid spectrum. The four S 1 lifetimes were ascribed to the coexistence of respectively two tautomer (normal and tautomer) forms of carminic acid, in the non-dissociated state (CAH) and in the deprotonated state (CA -). The fluorescence upconversion measurements of carminic acid-DNA complexes exhibited a prolongation of the fluorescence lifetimes. This effect was accepted as evidence for the formation of intercalation complexes between the carminic acid and the DNA. The intercalative binding of the carminic acid to DNA was confirmed by the fluorescence titration experiments resulting to a binding constant of 2 × 10 5 M -1 that is typical for anthracycline-DNA complexes.

  8. Antioxidant and DNA damage protection potentials of selected phenolic acids.

    PubMed

    Sevgi, Kemal; Tepe, Bektas; Sarikurkcu, Cengiz

    2015-03-01

    In this study, ten different phenolic acids (caffeic, chlorogenic, cinnamic, ferulic, gallic, p-hydroxybenzoic, protocatechuic, rosmarinic, syringic, and vanillic acids) were evaluated for their antioxidant and DNA damage protection potentials. Antioxidant activity was evaluated by using four different test systems named as β-carotene bleaching, DPPH free radical scavenging, reducing power and chelating effect. In all test systems, rosmarinic acid showed the maximum activity potential, while protocatechuic acid was determined as the weakest antioxidant in β-carotene bleaching, DPPH free radical scavenging, and chelating effect assays. Phenolic acids were also screened for their protective effects on pBR322 plasmid DNA against the mutagenic and toxic effects of UV and H2O2. Ferulic acid was found as the most active phytochemical among the others. Even at the lowest concentration value (0.002 mg/ml), ferulic acid protected all of the bands in the presence of H2O2 and UV. It is followed by caffeic, rosmarinic, and vanillic acids. On the other hand, cinnamic acid (at 0.002 mg/ml), gallic acid (at 0.002 mg/ml), p-hydroxybenzoic acid (at 0.002 and 0.004 mg/ml), and protocatechuic acid (at 0.002 and 0.004 mg/ml) could not protect plasmid DNA. PMID:25542528

  9. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  10. A DNA-hairpin model for repeat-addition processivity in telomere synthesis.

    PubMed

    Yang, Wei; Lee, Young-Sam

    2015-11-01

    We propose a DNA-hairpin model for the processivity of telomeric-repeat addition. Concomitantly with template-RNA translocation after each repeat synthesis, the complementary DNA repeat, for example, AGGGTT, loops out in a noncanonical base-paired hairpin, thus freeing the RNA template for the next round of repeat synthesis. The DNA hairpin is temporarily stabilized by telomerase and the incoming dGTP but becomes realigned for processive telomere synthesis.

  11. Reovirus inhibition of cellular DNA synthesis: role of the S1 gene.

    PubMed

    Sharpe, A H; Fields, B N

    1981-04-01

    Type 3 reovirus inhibits L cell DNA synthesis, whereas type 1 reovirus exerts little or no effect on L cell DNA synthesis. By using recombinant viruses containing both type 1 and type 3 double-standard RNA segments, we determined that one double-stranded RNA segment, the reovirus type 3 S1 double-stranded RNA segment which encodes the viral hemagglutinin, segregates with and is responsible for the capacity of reovirus type 3 to inhibit L cell DNA synthesis.

  12. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  13. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail.

  14. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates.

    PubMed

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

    2016-01-15

    A simple and elegant method for inhibition of non-templated nucleotide addition by DNA polymerases and for following DNA 3'-heterogeneity in enzymatic DNA synthesis by primer extension (PEX) is described. When template bearing ortho-twisted intercalating nucleic acid (ortho-TINA) at the 5'-end is used, non-templated nucleotide addition is reduced in both the A- and B-family DNA polymerases (KOD XL, KOD (exo-), Bst 2.0, Therminator, Deep Vent (exo-) and Taq). Formation of a single oligonucleotide product was observed with ortho-TINA modified template and KOD XL, KOD (exo-), Bst 2.0, Deep Vent (exo-) and Taq DNA polymerases. This approach can be applied to the synthesis of both unmodified and base-modified oligonucleotides. PMID:26707394

  15. Centrosomal Localization of Cyclin E-Cdk2 is Required for Initiation of DNA Synthesis

    PubMed Central

    Ferguson, Rebecca L.; Maller, James L.

    2010-01-01

    Summary Cyclin E-Cdk2 is known to regulate both DNA replication and centrosome duplication during the G1-S transition in the cell cycle [1–4], and disruption of centrosomes results in a G1 arrest in some cell types [5–7]. Localization of cyclin E on centrosomes is mediated by a 20 amino acid domain termed the centrosomal localization sequence (CLS), and expression of the GFP-tagged CLS displaces both cyclin E and cyclin A from the centrosome [8]. In asynchronous cells CLS expression inhibits the incorporation of bromodeoxyuridine (BrdU) into DNA, an effect proposed to reflect a G1 arrest. Here we show in synchronized cells that the reduction in BrdU incorporation reflects not a G1 arrest but rather direct inhibition of the initiation of DNA replication in S phase. The loading of essential DNA replication factors such as Cdc45 and PCNA onto chromatin is blocked by CLS expression, but DNA synthesis can be rescued by retargeting active cyclin E-Cdk2 to the centrosome. These results suggest that initial steps of DNA replication require centrosomally localized Cdk activity and link the nuclear cycle with the centrosome cycle at the G1-S transition. PMID:20399658

  16. Lanthanide cofactors accelerate DNA-catalyzed synthesis of branched RNA.

    PubMed

    Javadi-Zarnaghi, Fatemeh; Höbartner, Claudia

    2013-08-28

    Most deoxyribozymes (DNA catalysts) require metal ions as cofactors for catalytic activity, with Mg(2+), Mn(2+), and Zn(2+) being the most represented activators. Trivalent transition-metal ions have been less frequently considered. Rare earth ions offer attractive properties for studying metal ion binding by biochemical and spectroscopic methods. Here we report the effect of lanthanide cofactors, in particular terbium (Tb(3+)), for DNA-catalyzed synthesis of 2',5'-branched RNA. We found up to 10(4)-fold increased ligation rates for the 9F7 deoxribozyme using 100 μM Tb(3+) and 7 mM Mg(2+), compared to performing the reaction with 7 mM Mg(2+) alone. Combinatorial mutation interference analysis (CoMA) was used to identify nucleotides in the catalytic region of 9F7 that are essential for ligation activity with different metal ion combinations. A minimized version of the DNA enzyme sustained high levels of Tb(3+)-assisted activity. Sensitized luminescence of Tb(3+) bound to DNA in combination with DMS probing and DNase I footprinting results supported the CoMA data. The accelerating effect of Tb(3+) was confirmed for related RNA-ligating deoxyribozymes, pointing toward favorable activation of internal 2'-OH nucleophiles. The results of this study offer fundamental insights into nucleotide requirements for DNA-catalyzed RNA ligation and will be beneficial for practical applications that utilize 2',5'-branched RNA.

  17. Thermodynamic impact of abasic sites on simulated translesion DNA synthesis.

    PubMed

    Malina, Jaroslav; Brabec, Viktor

    2014-06-16

    Loss of a base in DNA and the creation of an abasic (apurinic/apyrimidinic, AP) site is a frequent lesion that may occur spontaneously, or as a consequence of the action of DNA-damaging agents. The AP lesion is mutagenic or lethal if not repaired. We report a systematic thermodynamic investigation by differential scanning calorimetry on the evolution, during primer extension, of a model AP site in chemically simulated DNA translesion synthesis. Incorporation of dAMP (deoxyadenosine monophosphate), as well as dTMP (deoxythymidine monophosphate), opposite an AP site is enthalpically unfavorable, although incorporation of dTMP is more enthalpically unfavorable than that of dAMP. This finding is in a good agreement with experimental data showing that AP sites block various DNA polymerases of eukaryotic and prokaryotic origin and that, if bypassed, dAMP is preferentially inserted, whereas insertion of dTMP is less likely. The results emphasize the importance of thermodynamic contributions to the insertion of nucleotides opposite an AP site by DNA polymerases.

  18. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  19. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  20. Synthesis and structural characterization of piperazino-modified DNA that favours hybridization towards DNA over RNA

    PubMed Central

    Skov, Joan; Bryld, Torsten; Lindegaard, Dorthe; Nielsen, Katrine E.; Højland, Torben; Wengel, Jesper; Petersen, Michael

    2011-01-01

    We report the synthesis of two C4′-modified DNA analogues and characterize their structural impact on dsDNA duplexes. The 4′-C-piperazinomethyl modification stabilizes dsDNA by up to 5°C per incorporation. Extension of the modification with a butanoyl-linked pyrene increases the dsDNA stabilization to a maximum of 9°C per incorporation. Using fluorescence, ultraviolet and nuclear magnetic resonance (NMR) spectroscopy, we show that the stabilization is achieved by pyrene intercalation in the dsDNA duplex. The pyrene moiety is not restricted to one intercalation site but rather switches between multiple sites in intermediate exchange on the NMR timescale, resulting in broad lines in NMR spectra. We identified two intercalation sites with NOE data showing that the pyrene prefers to intercalate one base pair away from the modified nucleotide with its linker curled up in the minor groove. Both modifications are tolerated in DNA:RNA hybrids but leave their melting temperatures virtually unaffected. Fluorescence data indicate that the pyrene moiety is residing outside the helix. The available data suggest that the DNA discrimination is due to (i) the positive charge of the piperazino ring having a greater impact in the narrow and deep minor groove of a B-type dsDNA duplex than in the wide and shallow minor groove of an A-type DNA:RNA hybrid and (ii) the B-type dsDNA duplex allowing the pyrene to intercalate and bury its apolar surface. PMID:21062815

  1. Nucleic Acid Engineering: RNA Following the Trail of DNA.

    PubMed

    Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2016-02-01

    The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.

  2. Information transfer from DNA to peptide nucleic acids by template-directed syntheses

    NASA Technical Reports Server (NTRS)

    Schmidt, J. G.; Christensen, L.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1997-01-01

    Peptide nucleic acids (PNAs) are analogs of nucleic acids in which the ribose-phosphate backbone is replaced by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. Oligocytidylates have been shown to act as templates for formation of longer oligomers of G from PNA G2 dimers. In this paper we show that information can be transferred from DNA to PNA. DNA C4T2C4 is an efficient template for synthesis of PNA G4A2G4 using G2 and A2 units as substrates. The corresponding synthesis of PNA G4C2G4 on DNA C4G2C4 is less efficient. Incorporation of PNA T2 into PNA products on DNA C4A2C4 is the least efficient of the three reactions. These results, obtained using PNA dimers as substrates, parallel those obtained using monomeric activated nucleotides.

  3. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  4. A Ru(II) complex with 2-(4-(methylsulfonyl)phenyl)-1H-imidazo[4,5- f][1,10]phenanthroline: Synthesis, characterization, and acid-base and DNA-binding properties

    NASA Astrophysics Data System (ADS)

    Gao, Jie; Wang, Zhi-Ping; Yuan, Cui-Li; Jia, Hai-Shun; Wang, Ke-Zhi

    2011-09-01

    A new Ru(II) complex of [Ru(bpy) 2(Hmspip)]Cl 2 {in which bpy = 2,2'-bipyridine, Hmspip = 2-(4-(methylsulfonyl)phenyl)-1 H-imidazo[4,5- f][1,10]phenanthroline} have been synthesized and characterized. The ground- and excited-state acid-base properties of [Ru(bpy) 2(Hmspip)]Cl 2 and its parent complex of [Ru(bpy) 2(Hpip)]Cl 2 {Hpip = 2-phenyl-1H-imidazo[4,5- f][1,10]phenanthroline} have been studied by UV-visible (UV-vis) and emission spectrophotometric pH titrations. [Ru(bpy) 2(Hmspip)]Cl 2 acts as a calf thymus DNA intercalators with a binding constant of 4.0 × 10 5 M -1 in buffered 50 mM NaCl, as evidenced by UV-vis and luminescence titrations, steady-state emission quenching by [Fe(CN) 6] 4-, DNA competitive binding with ethidium bromide, reverse salt titrations and viscosity measurements.

  5. A Ru(II) complex with 2-(4-(methylsulfonyl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline: synthesis, characterization, and acid-base and DNA-binding properties.

    PubMed

    Gao, Jie; Wang, Zhi-Ping; Yuan, Cui-Li; Jia, Hai-Shun; Wang, Ke-Zhi

    2011-09-01

    A new Ru(II) complex of [Ru(bpy)2(Hmspip)]Cl2 {in which bpy=2,2'-bipyridine, Hmspip=2-(4-(methylsulfonyl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline} have been synthesized and characterized. The ground- and excited-state acid-base properties of [Ru(bpy)2(Hmspip)]Cl2 and its parent complex of [Ru(bpy)2(Hpip)]Cl2 {Hpip=2-phenyl-1H-imidazo[4,5-f][1,10]phenanthroline} have been studied by UV-visible (UV-vis) and emission spectrophotometric pH titrations. [Ru(bpy)2(Hmspip)]Cl2 acts as a calf thymus DNA intercalators with a binding constant of 4.0×10(5) M(-1) in buffered 50 mM NaCl, as evidenced by UV-vis and luminescence titrations, steady-state emission quenching by [Fe(CN)6]4-, DNA competitive binding with ethidium bromide, reverse salt titrations and viscosity measurements.

  6. Isolation and Characterization of a Protein That Stimulates DNA Synthesis from Avian Myeloblastosis Virus*

    PubMed Central

    Leis, Jonathan P.; Hurwitz, Jerard

    1972-01-01

    A protein has been isolated from avian myeloblastosis virus that stimulates the rate and yield of DNA synthesis primed by viral RNA with purified viral polymerase. It specifically affects the viral polymerase and does not stimulate other DNA polymerases under the conditions tested. The viral polymerase, in conjunction with this protein, transcribes extended single-stranded regions of DNA, and permits the enzyme to initiate synthesis from single-strand breaks in DNA. PMID:4340754

  7. [Interrelationships in experiments in vitro between the migration activity of leukocytes and RNA and DNA synthesis].

    PubMed

    Nazarov, P G; Volgarev, A P; Ermakov, S A

    1978-06-01

    The following correlations were revealed in the parallel study of leukocyte migration in vitro in the presence of a specific antigen and of spontaneous RNA and DNA synthesis in the cultured lymphocytes: 1) a direct correlation between the RNA and DNA synthesis in lymphocytes; 2) a close correlation between the antigen-induced migration and the levels of RNA and DNA synthesis. The effect of the antigen was evidenced by the inhibition or stimulation of leukocyte migration. A high ratio of RNA synthesis to DNA synthesis corresponded to the migration inhibition and a low one--to the migration stimulation. The ratio value varied mainly on account of the changes in the level of DNA synthesis. Participation of T and B cells in the regulation of the antigen-induced leukocyte mobility is discussed. PMID:352440

  8. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  9. Peptide Synthesis on a Next-Generation DNA Sequencing Platform.

    PubMed

    Svensen, Nina; Peersen, Olve B; Jaffrey, Samie R

    2016-09-01

    Methods for displaying large numbers of peptides on solid surfaces are essential for high-throughput characterization of peptide function and binding properties. Here we describe a method for converting the >10(7) flow cell-bound clusters of identical DNA strands generated by the Illumina DNA sequencing technology into clusters of complementary RNA, and subsequently peptide clusters. We modified the flow-cell-bound primers with ribonucleotides thus enabling them to be used by poliovirus polymerase 3D(pol) . The primers hybridize to the clustered DNA thus leading to RNA clusters. The RNAs fold into functional protein- or small molecule-binding aptamers. We used the mRNA-display approach to synthesize flow-cell-tethered peptides from these RNA clusters. The peptides showed selective binding to cognate antibodies. The methods described here provide an approach for using DNA clusters to template peptide synthesis on an Illumina flow cell, thus providing new opportunities for massively parallel peptide-based assays.

  10. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  11. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

    PubMed

    Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

    2016-01-21

    Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids.

  12. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  13. Synergistic template-free synthesis of dsDNA by Thermococcus nautili primase PolpTN2, DNA polymerase PolB, and pTN2 helicase.

    PubMed

    Béguin, Pierre; Gill, Sukhvinder; Charpin, Nicole; Forterre, Patrick

    2015-01-01

    A combination of three enzymes from the hyperthermophilic archaeon Thermococcus nautili, DNA primase PolpTN2, DNA polymerase PolB, and pTN2 DNA helicase, was found to synthesize up to 300-400 ng/µl dsDNA from deoxynucleotide triphosphates in less than 30 min in the absence of added template DNA and oligonucleotide primer. The reaction did not occur below 64 °C. No synthesis was observed if PolpTN2 or PolB were left out; helicase was not essential but accelerated the reaction. The DNA synthesized consisted of highly reiterated palindromic sequences reaching up to more that 10 kb. Sequence analysis of three independent reaction products synthesized at different temperatures showed that the palindromes shared a common pentanucleotide core, suggesting that random nucleic acid fragments were not responsible for priming the reaction. When enzymes were added sequentially, preincubation with primase plus helicase followed by PolB led to a shorter delay before the onset of the reaction as compared to preincubation with PolB plus helicase followed by primase. This suggests that the primase generates seeds that are subsequently amplified and elongated in synergy with PolB by a mechanism involving hairpin formation and slippage synthesis. PMID:25420601

  14. Synergistic template-free synthesis of dsDNA by Thermococcus nautili primase PolpTN2, DNA polymerase PolB, and pTN2 helicase.

    PubMed

    Béguin, Pierre; Gill, Sukhvinder; Charpin, Nicole; Forterre, Patrick

    2015-01-01

    A combination of three enzymes from the hyperthermophilic archaeon Thermococcus nautili, DNA primase PolpTN2, DNA polymerase PolB, and pTN2 DNA helicase, was found to synthesize up to 300-400 ng/µl dsDNA from deoxynucleotide triphosphates in less than 30 min in the absence of added template DNA and oligonucleotide primer. The reaction did not occur below 64 °C. No synthesis was observed if PolpTN2 or PolB were left out; helicase was not essential but accelerated the reaction. The DNA synthesized consisted of highly reiterated palindromic sequences reaching up to more that 10 kb. Sequence analysis of three independent reaction products synthesized at different temperatures showed that the palindromes shared a common pentanucleotide core, suggesting that random nucleic acid fragments were not responsible for priming the reaction. When enzymes were added sequentially, preincubation with primase plus helicase followed by PolB led to a shorter delay before the onset of the reaction as compared to preincubation with PolB plus helicase followed by primase. This suggests that the primase generates seeds that are subsequently amplified and elongated in synergy with PolB by a mechanism involving hairpin formation and slippage synthesis.

  15. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  16. Control of left ventricular mass by moxonidine involves reduced DNA synthesis and enhanced DNA fragmentation

    PubMed Central

    Paquette, P-A; Duguay, D; Ayoubi, R El-; Menaouar, A; Danalache, B; Gutkowska, J; DeBlois, D; Mukaddam-Daher, S

    2007-01-01

    Background and purpose: Left ventricular hypertrophy (LVH) is a maladaptive process associated with increased cardiovascular risk. Regression of LVH is associated with reduced complications of hypertension. Moxonidine is an antihypertensive imidazoline compound that reduces blood pressure primarily by central inhibition of sympathetic outflow and by direct actions on the heart to release atrial natriuretic peptide, a vasodilator and an antihypertrophic cardiac hormone. This study investigated the effect of moxonidine on LVH and the mechanisms involved in this effect. Experimental approach: Spontaneously hypertensive rats were treated with several doses of moxonidine (s.c.) over 4 weeks. Blood pressure and heart rate were continuously monitored by telemetry. Body weight and water and food intake were measured weekly. Measurements also included left ventricular mass, DNA content, synthesis, fragmentation, and apoptotic/anti-apoptotic pathway proteins. Key results: The decrease in mean arterial pressure stabilized at ∼ −10 mm Hg after 1 week of treatment and thereafter. Compared to vehicle-treated rats (100%), left ventricular mass was dose- and time-dependently reduced by treatment. This reduction remained significantly lower after normalizing to body weight. Moxonidine reduced left ventricular DNA content and inhibited DNA synthesis. DNA fragmentation transiently, but significantly increased at 1 week of moxonidine treatment and was paralleled by elevated active caspase-3 protein. The highest dose significantly decreased the apoptotic protein Bax and all doses stimulated anti-apoptotic Bcl-2 after 4 weeks of treatment. Conclusions and implications: These studies implicate the modulation of cardiac DNA dynamics in the control of left ventricular mass by moxonidine in a rat model of hypertension. PMID:18059325

  17. Laccaic Acid A Is a Direct, DNA-competitive Inhibitor of DNA Methyltransferase 1*

    PubMed Central

    Fagan, Rebecca L.; Cryderman, Diane E.; Kopelovich, Levy; Wallrath, Lori L.; Brenner, Charles

    2013-01-01

    Methylation of cytosines in CpG dinucleotides is the predominant epigenetic mark on vertebrate DNA. DNA methylation is associated with transcriptional repression. The pattern of DNA methylation changes during development and with disease. Human DNA methyltransferase 1 (Dnmt1), a 1616-amino acid multidomain enzyme, is essential for maintenance of DNA methylation in proliferating cells and is considered an important cancer drug target. Using a fluorogenic, endonuclease-coupled DNA methylation assay with an activated form of Dnmt1 engineered to lack the replication foci targeting sequence domain, we discovered that laccaic acid A (LCA), a highly substituted anthraquinone natural product, is a direct inhibitor with a 310 nm Ki. LCA is competitive with the DNA substrate in in vitro methylation assays and alters the expression of methylated genes in MCF-7 breast cancer cells synergistically with 5-aza-2′-deoxycytidine. LCA represents a novel class of Dnmt-targeted molecular probes, with biochemical properties that allow it to distinguish between non DNA-bound and DNA-bound Dnmt1. PMID:23839987

  18. Investigation of perfluorooctanoic acid induced DNA damage using electrogenerated chemiluminescence associated with charge transfer in DNA.

    PubMed

    Lu, Liping; Guo, Linqing; Li, Meng; Kang, Tianfang; Cheng, Shuiyuan; Miao, Wujian

    2016-10-01

    An electrogenerated chemiluminescence (ECL)-DNA sensor was designed and fabricated for the investigation of DNA damage by a potential environmental pollutant, perfluorooctanoic acid (PFOA). The ECL-DNA sensor consisted of a Au electrode that had a self-assembled monolayer of 15 base-pair double-stranded (ds) DNA oligonucleotides with covalently attached semiconductor CdSe quantum dots (QDs) at the distal end of the DNA. Characterization of the ECL-DNA sensor was conducted with X-ray photoelectron spectroscopy (XPS), electrochemical impedance spectroscopy (EIS), ECL, and cyclic voltammetry before and after the exposure of the sensor to PFOA. Consistent data revealed that the dsDNA on Au was severely damaged upon the incubation of the electrode in PFOA, causing significant increase in charge (or electron) transfer (CT) resistance within DNA strands. Consequently, the cathodic coreactant ECL responses of the Au/dsDNA-QDs electrode in the presence of K2S2O8 were markedly decreased. The strong interaction between DNA and PFOA via the hydrophobic interaction, especially the formation of F···H hydrogen bonds by insertion of the difluoro-methylene group of PFOA into the DNA base pairs, was believed to be responsible for the dissociation or loosening of dsDNA structure, which inhibited the CT through DNA. A linear relationship between the ECL signal of the sensor and the logarithmical concentration of PFOA displayed a dynamic range of 1.00 × 10(-14)-1.00 × 10(-4) M, with a limit of detection of 1.00 × 10(-15) M at a signal-to-noise ratio of 3. Graphical Abstract Illustration of ECL detection of PFOA on a Au/dsDNA-QDs ECL-DNA sensor.

  19. Investigation of perfluorooctanoic acid induced DNA damage using electrogenerated chemiluminescence associated with charge transfer in DNA.

    PubMed

    Lu, Liping; Guo, Linqing; Li, Meng; Kang, Tianfang; Cheng, Shuiyuan; Miao, Wujian

    2016-10-01

    An electrogenerated chemiluminescence (ECL)-DNA sensor was designed and fabricated for the investigation of DNA damage by a potential environmental pollutant, perfluorooctanoic acid (PFOA). The ECL-DNA sensor consisted of a Au electrode that had a self-assembled monolayer of 15 base-pair double-stranded (ds) DNA oligonucleotides with covalently attached semiconductor CdSe quantum dots (QDs) at the distal end of the DNA. Characterization of the ECL-DNA sensor was conducted with X-ray photoelectron spectroscopy (XPS), electrochemical impedance spectroscopy (EIS), ECL, and cyclic voltammetry before and after the exposure of the sensor to PFOA. Consistent data revealed that the dsDNA on Au was severely damaged upon the incubation of the electrode in PFOA, causing significant increase in charge (or electron) transfer (CT) resistance within DNA strands. Consequently, the cathodic coreactant ECL responses of the Au/dsDNA-QDs electrode in the presence of K2S2O8 were markedly decreased. The strong interaction between DNA and PFOA via the hydrophobic interaction, especially the formation of F···H hydrogen bonds by insertion of the difluoro-methylene group of PFOA into the DNA base pairs, was believed to be responsible for the dissociation or loosening of dsDNA structure, which inhibited the CT through DNA. A linear relationship between the ECL signal of the sensor and the logarithmical concentration of PFOA displayed a dynamic range of 1.00 × 10(-14)-1.00 × 10(-4) M, with a limit of detection of 1.00 × 10(-15) M at a signal-to-noise ratio of 3. Graphical Abstract Illustration of ECL detection of PFOA on a Au/dsDNA-QDs ECL-DNA sensor. PMID:27108285

  20. ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

    PubMed

    Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

    2016-07-15

    Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria. PMID:27418514

  1. ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

    PubMed

    Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

    2016-07-15

    Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria.

  2. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  3. Effect of Ethylene on Cell Division and Deoxyribonucleic Acid Synthesis in Pisum sativum1

    PubMed Central

    Apelbaum, Akiva; Burg, Stanley P.

    1972-01-01

    Ethylene and supraoptimal levels of 2,4-dichlorophenoxyacetic acid inhibit the growth of the apical hook region of etiolated Pisum sativum (var. Alaska) seedlings by stopping almost all cell divisions. Cells are prevented from entering prophase. The hormones also retard cell division in intact root tips and completely stop the process in lateral buds. The latter inhibition is reversed partially by benzyl adenine. In root tips and the stem plumular and subhook regions, ethylene inhibits DNA synthesis. The magnitude of this inhibition is correlated with the degree of repression of cell division in meristematic tissue, suggesting that the effect on cell division results from a lack of DNA synthesis. Ethylene inhibits cell division within a few hours with a dose-response curve similar to that for most other actions of the gas. Experiments with seedlings grown under hypobaric conditions suggest that the gas naturally controls plumular expansion and cell division in the apical region. Images PMID:16658105

  4. Coordination behavior and bio-potent aspects of Ni(II) with 2-aminobenzamide and some amino acid mixed ligands--Part II: Synthesis, spectral, morphological, pharmacological and DNA interaction studies.

    PubMed

    Dharmaraja, Jeyaprakash; Subbaraj, Paramasivam; Esakkidurai, Thirugnanasamy; Shobana, Sutha

    2014-11-11

    A series of novel bioactive mixed ligand Ni(II) complexes (1a-1d) have been synthesised by using 2-aminobenzamide (2AB) and some bio-relevant amino acid ligands. The synthesised Ni(II) complexes were structurally characterized by various physico-chemical and spectral studies. Elemental analysis and molar conductance values suggest that 1:1:1 stoichiometry with non-electrolytic nature. Based on the spectral studies, both the ligands act as bidentate and they chelate with Ni(II) ion via amino-NH2 and amido-O and deprotonated carboxylato-O and amino-NH2 atoms respectively to form a stable six, five membered chelate rings with mononuclear octahedral geometry. Thermal studies show the presence of coordinated water and acetate molecules in the coordination. The powder X-ray diffractogram and SEM pictograph imply that all the complexes have fine crystalline peaks with homogeneous surface morphology. In vitro antimicrobial and antioxidant studies indicate the complexes are more active than free 2-aminobenzamide ligand. The Ni(II)-2AB-gly/phe complexes (1a and 1d) show significant oxidative cleavage and DNA binding activities. Moreover, the 3D molecular modeling, analysis of the complexes has also been studied.

  5. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  6. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  7. Sequential initiation of lagging and leading strand synthesis by two different polymerase complexes at the SV40 DNA replication origin.

    PubMed

    Tsurimoto, T; Melendy, T; Stillman, B

    1990-08-01

    Enzymatic synthesis of DNA from the simian virus 40 origin of DNA replication has been reconstituted in vitro with eight purified components. DNA polymerase alpha-primase complex first initiates DNA synthesis at the replication origin and continues as the lagging strand polymerase. Subsequently, the DNA polymerase delta complex initiates replication on the leading strand template. Some prokaryotic DNA polymerase complexes can replace the eukaryotic polymerase delta complex. A model for polymerase switching during initiation of DNA replication is presented.

  8. Aphidicolin-resistant polyomavirus and subgenomic cellular DNA synthesis occur early in the differentiation of cultured myoblasts to myotubes.

    PubMed Central

    DePolo, N J; Villarreal, L P

    1993-01-01

    Small DNA viruses have been historically used as probes of cellular control mechanisms of DNA replication, gene expression, and differentiation. Polyomavirus (Py) DNA replication is known to be linked to differentiation of may cells, including myoblasts. In this report, we use this linkage in myoblasts to simultaneously examine (i) cellular differentiation control of Py DNA replication and (ii) an unusual type of cellular and Py DNA synthesis during differentiation. Early proposals that DNA synthesis was involved in the induced differentiation of myoblasts to myotubes were apparently disproved by reliance on inhibitors of DNA synthesis (cytosine arabinoside and aphidicolin), which indicated that mitosis and DNA replication are not necessary for differentiation. Theoretical problems with the accessibility of inactive chromatin to trans-acting factors led us to reexamine possible involvement of DNA replication in myoblast differentiation. We show here that Py undergoes novel aphidicolin-resistant net DNA synthesis under specific conditions early in induced differentiation of myoblasts (following delayed aphidicolin addition). Under similar conditions, we also examined uninfected myoblast DNA synthesis, and we show that soon after differentiation induction, a period of aphidicolin-resistant cellular DNA synthesis can also be observed. This drug-resistant DNA synthesis appears to be subgenomic, not contributing to mitosis, and more representative of polyadenylated than of nonpolyadenylated RNA. These results renew the possibility that DNA synthesis plays a role in myoblast differentiation and suggest that the linkage of Py DNA synthesis to differentiation may involve a qualitative cellular alteration in Py DNA replication. Images PMID:8389922

  9. Effect of dexamethasone on proliferating osteoblasts: inhibition of prostaglandin E2 synthesis, DNA synthesis, and alterations in actin cytoskeleton.

    PubMed

    Hughes-Fulford, M; Appel, R; Kumegawa, M; Schmidt, J

    1992-11-01

    Elevated levels of glucocorticoids caused by disease (Cushing's syndrome) or therapeutic treatment of asthma are known to cause osteoporosis. Space flight, an environmental condition, is known to cause a rise in endogenous cortisols accompanied by a significant loss of bone and calcium. Long-term space inhabitants have lost up to 18% of weight bearing bone during long-term flight. This study demonstrates that elevated concentrations of glucocorticoids lower the endogenous production of PGE2 and interfere with osteoblast proliferation. Osteoblasts grown with dexamethasone had significantly lower DNA synthesis and endogenous synthesis of PGE2. Addition of exogenous dmPGE2 to the dexamethasone growth-inhibited cells stimulated DNA synthesis over twofold. In synchronous control cultures, we found that endogenous prostaglandin synthesis increased in late G1, preceding S-phase DNA synthesis by several hours. The addition of exogenous dexamethasone to synchronous cultures resulted in a significant decrease in the prostaglandin synthesis followed by a significant decrease in DNA synthesis in parallel cultures. Further, dexamethasone caused the actin cytoskeleton to collapse and the cell morphology to become rounded and spindle shaped. Addition of exogenous PGE2 to the dexamethasone-treated osteoblasts caused recovery of the actin architecture and phenotype. These data support the hypothesis that the glucocorticoid-mediated decrease in prostaglandin synthesis may be a contributing factor in the reduced bone quality and trabecular bone formation seen in glucocorticoid-induced osteoporosis. PMID:1426038

  10. Structural basis of high-fidelity DNA synthesis by yeast DNA polymerase [delta

    SciTech Connect

    Swan, Michael K.; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2009-09-25

    DNA polymerase {delta} (Pol {delta}) is a high-fidelity polymerase that has a central role in replication from yeast to humans. We present the crystal structure of the catalytic subunit of yeast Pol {delta} in ternary complex with a template primer and an incoming nucleotide. The structure, determined at 2.0-{angstrom} resolution, catches the enzyme in the act of replication, revealing how the polymerase and exonuclease domains are juxtaposed relative to each other and how a correct nucleotide is selected and incorporated. The structure also reveals the 'sensing' interactions near the primer terminus, which signal a switch from the polymerizing to the editing mode. Taken together, the structure provides a chemical basis for the bulk of DNA synthesis in eukaryotic cells and a framework for understanding the effects of cancer-causing mutations in Pol {delta}.

  11. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  12. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  13. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  14. Relationship between DNA adduct formation and unscheduled DNA synthesis (UDS) in cultured mouse epidermal keratinocytes

    SciTech Connect

    Gill, R.D.; Nettikumara, A.N.; DiGiovanni, J. ); Butterworth, B.E. )

    1991-01-01

    Primary cultures of mouse epidermal keratinocytes from SENCAR mice were treated with 7,12-dimethylbenz(a)anthracene (DMBA), benzo(a)pyrene (B(a)P), ({plus minus}) 7{beta}-8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus}) anti-BPDE), and ({plus minus}) 7{beta},8{alpha}-dihydroxy-9{beta},10{beta}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus})syn-BPDE) to examine the relationship between DNA adduct formation and the induction of unscheduled DNA synthesis (UDS). DNA adducts were measured as pmol hydrocarbon bound per mg of DNA, and UDS was quantitated autoradiographically as net grains per nucleus. A good correlation was observed between the levels of UDS detected and the amount of DNA adducts present int he cell population when comparing similar compounds within the linear dose-response range of 0.005 {mu}g/ml-0.25 {mu}g/ml. These results suggest that the present UDS assay with MEKs is a useful assay for the rapid screening of potential genotoxic agents. However, the limits of sensitivity are such that the current assay may be unable to detect a low level of DNA damage induced by some weakly genotoxic (carcinogenic) agents. In addition, while the limits of sensitivity determined in these experiments apply to the polycyclic aromatic hydrocarbon class, other classes of genotoxic compounds such as alkylating agents or crosslinking agents may exhibit different thresholds of detection.

  15. Nerve growth factor enhances DNA synthesis in cultured cerebellar neuroblasts.

    PubMed

    Confort, C; Charrasse, S; Clos, J

    1991-10-01

    The cerebellar neuroblasts in primary cultures from five-day-old rats bore NGF receptor immunoreactivity, suggesting a potential responsive to NGF. At low plating density, NGF was found to enhance DNA synthesis in these cells in a dose-dependent manner. As these cells synthesize NGF, one possibility to account for the lack of response of neuroblasts plated at high density is that the amount of endogenous trophic agent produced in this culture condition is sufficient to ensure an optimal effect. The results demonstrate that premitotic neuroblasts in the CNS, as well postmitotic neurons, are responsive to NGF. At the early stage of its development, the cerebellum therefore appears to be a very good autocrine model of NGF action.

  16. Nerve growth factor enhances DNA synthesis in cultured cerebellar neuroblasts.

    PubMed

    Confort, C; Charrasse, S; Clos, J

    1991-10-01

    The cerebellar neuroblasts in primary cultures from five-day-old rats bore NGF receptor immunoreactivity, suggesting a potential responsive to NGF. At low plating density, NGF was found to enhance DNA synthesis in these cells in a dose-dependent manner. As these cells synthesize NGF, one possibility to account for the lack of response of neuroblasts plated at high density is that the amount of endogenous trophic agent produced in this culture condition is sufficient to ensure an optimal effect. The results demonstrate that premitotic neuroblasts in the CNS, as well postmitotic neurons, are responsive to NGF. At the early stage of its development, the cerebellum therefore appears to be a very good autocrine model of NGF action. PMID:1661619

  17. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  18. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  19. Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

    SciTech Connect

    Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

    1982-12-01

    Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-dalton DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.

  20. Unscheduled DNA Synthesis: The Clinical and Functional Assay for Global Genomic DNA Nucleotide Excision Repair

    PubMed Central

    Latimer, Jean J.; Kelly, Crystal M.

    2016-01-01

    The unscheduled DNA synthesis (UDS) assay measures the ability of a cell to perform global genomic nucleotide excision repair (NER). This chapter provides instructions for the application of this technique by creating 6-4 photoproducts and pyrimidine dimers using UV-C irradiation. This procedure is designed specifically for quantification of the 6-4 photoproducts. Repair is quantified by the amount of radioactive thymidine incorporated during repair synthesis after this insult, and radioactivity is evaluated by grain counting after autoradiography. The results are used to clinically diagnose human DNA repair deficiency disorders and provide a basis for investigation of repair deficiency in human tissues or tumors. No other functional assay is available that directly measures the capacity to perform NER on the entire genome without the use of specific antibodies. Since live cells are required for this assay, explant culture techniques must be previously established. Host cell reactivation (HCR), as discussed in Chapter 37, is not an equivalent technique, as it measures only transcription-coupled repair (TCR) at active genes, a small subset of total NER. PMID:24623250

  1. DNA methylation landscape of fat deposits and fatty acid composition in obese and lean pigs

    PubMed Central

    Zhang, Shunhua; Shen, Linyuan; Xia, Yudong; Yang, Qiong; Li, Xuewei; Tang, Guoqing; Jiang, Yanzhi; Wang, Jinyong; Li, Mingzhou; Zhu, Li

    2016-01-01

    Obese and lean type pig breeds exhibit differences in their fat deposits and fatty acid composition. Here, we compared the effect of genome-wide DNA methylation on fatty acid metabolism between Landrace pigs (LP, leaner) and Rongchang pigs (RP, fatty). We found that LP backfat (LBF) had a higher polyunsaturated fatty acid content but a lower adipocyte volume than RP backfat (RBF). LBF exhibited higher global DNA methylation levels at the genome level than RBF. A total of 483 differentially methylated regions (DMRs) were located in promoter regions, mainly affecting olfactory and sensory activity and lipid metabolism. In LBF, the promoters of genes related to ATPase activity had significantly stronger methylation. This fact may suggest lower energy metabolism levels, which may result in less efficient lipid synthesis in LBF. Furthermore, we identified a DMR in the miR-4335 and miR-378 promoters and validated their methylation status by bisulfite sequencing PCR. The hypermethylation of the promoters of miR-4335 and miR-378 in LBF and the resulting silencing of the target genes may result in LBF’s low content in saturated fatty acids and fat deposition capacity. This study provides a solid basis for exploring the epigenetic mechanisms affecting fat deposition and fatty acid composition. PMID:27721392

  2. Evaluation of DNA synthesis with carbon-11-labeled 4′-thiothymidine

    PubMed Central

    Toyohara, Jun

    2016-01-01

    In the cancer research field, the preferred method for evaluating the proliferative activity of cancer cells in vivo is to measure DNA synthesis rates. The cellular proliferation rate is one of the most important cancer characteristics, and represents the gold standard of pathological diagnosis. Positron emission tomography (PET) has been used to evaluate in vivo DNA synthetic activity through visualization of enhanced nucleoside metabolism. However, methods for the quantitative measurement of DNA synthesis rates have not been fully clarified. Several groups have been engaged in research on 4′-[methyl-11C]-thiothymidine (11C-4DST) in an effort to develop a PET tracer that allows quantitative measurement of in vivo DNA synthesis rates. This mini-review summarizes the results of recent studies of the in vivo measurement of cancer DNA synthesis rates using 11C-4DST. PMID:27721942

  3. The effect of bleomycin on DNA synthesis in ataxia telangiectasia lymphoid cells

    SciTech Connect

    Cohen, M.M.; Simpson, S.J.

    1982-01-01

    Bleomycin, a radiomimetic glycopeptide, inhibits de novo DNA synthesis in ataxia telangiectasia lymphoblastoid B cells to a markedly lesser extent than in normal and xeroderma pigmentosum lymphoid cells. This observation is similar to that following ionizing radiation; however, the effect is slower following the chemical treatment. Recovery of the normal cells occurs 15-18 hours after treatment, whereas the ataxia telangiectasia lines do not attain normal levels of DNA synthesis during the entire 24-hour observation period. Similar differences were not observed following treatment with mitomycin C, a bifunctional alkylating agent, indicating a specific effect of bleomycin on DNA synthesis in ataxia telangiectasia cells. Following bleomycin treatment and preincubation with hydroxyurea, residual DNA synthesis in ataxia telangiectasia cells was similar to that in both normal and xeroderma pigmentosum lymphoid lines, suggesting that the capacity to repair the induced DNA lesion is present.

  4. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  5. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  6. Method and apparatus for synthesis of arrays of DNA probes

    DOEpatents

    Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland

    2002-04-23

    The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.

  7. PIDD orchestrates translesion DNA synthesis in response to UV irradiation

    PubMed Central

    Logette, E; Schuepbach-Mallepell, S; Eckert, M J; Leo, X H; Jaccard, B; Manzl, C; Tardivel, A; Villunger, A; Quadroni, M; Gaide, O; Tschopp, J

    2011-01-01

    PIDD has been implicated in survival and apoptotic pathways in response to DNA damage, and a role for PIDD was recently identified in non-homologous end-joining (NHEJ) repair induced by γ-irradiation. Here, we present an interaction of PIDD with PCNA, first identified in a proteomics screen. PCNA has essential functions in DNA replication and repair following UV irradiation. Translesion synthesis (TLS) is a process that prevents UV irradiation-induced replication blockage and is characterized by PCNA monoubiquitination and interaction with the TLS polymerase eta (polη). Both of these processes are inhibited by p21. We report that PIDD modulates p21-PCNA dissociation, and promotes PCNA monoubiquitination and interaction with polη in response to UV irradiation. Furthermore, PIDD deficiency leads to a defect in TLS that is associated, both in vitro and in vivo, with cellular sensitization to UV-induced apoptosis. Thus, PIDD performs key functions upon UV irradiation, including TLS, NHEJ, NF-κB activation and cell death. PMID:21415862

  8. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  9. Repair synthesis step involving ERCC1-XPF participates in DNA repair of the Top1-DNA damage complex.

    PubMed

    Takahata, Chiaki; Masuda, Yuji; Takedachi, Arato; Tanaka, Kiyoji; Iwai, Shigenori; Kuraoka, Isao

    2015-08-01

    Topoisomerase 1 (Top1) is the intercellular target of camptothecins (CPTs). CPT blocks DNA religation in the Top1-DNA complex and induces Top1-attached nick DNA lesions. In this study, we demonstrate that excision repair cross complementing 1 protein-xeroderma pigmentosum group F (ERCC1-XPF) endonuclease and replication protein A (RPA) participate in the repair of Top1-attached nick DNA lesions together with other nucleotide excision repair (NER) factors. ERCC1-XPF shows nuclease activity in the presence of RPA on a 3'-phosphotyrosyl bond nick-containing DNA (Tyr-nick DNA) substrate, which mimics a Top1-attached nick DNA lesion. In addition, ERCC1-XPF and RPA form a DNA/protein complex on the nick DNA substrate in vitro, and co-localize in CPT-treated cells in vivo. Moreover, the DNA repair synthesis of Tyr-nick DNA lesions occurred in the presence of NER factors, including ERCC1-XPF, RPA, DNA polymerase delta, flap endonuclease 1 and DNA ligase 1. Therefore, some of the NER repair machinery might be an alternative repair pathway for Top1-attached nick DNA lesions. Clinically, these data provide insights into the potential of ERCC1 as a biomarker during CPT regimens.

  10. Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis.

    PubMed

    Cleary, Michele A; Kilian, Kristopher; Wang, Yanqun; Bradshaw, Jeff; Cavet, Guy; Ge, Wei; Kulkarni, Amit; Paddison, Patrick J; Chang, Kenneth; Sheth, Nihar; Leproust, Eric; Coffey, Ernest M; Burchard, Julja; McCombie, W Richard; Linsley, Peter; Hannon, Gregory J

    2004-12-01

    Generation of complex libraries of defined nucleic acid sequences can greatly aid the functional analysis of protein and gene function. Previously, such studies relied either on individually synthesized oligonucleotides or on cellular nucleic acids as the starting material. As each method has disadvantages, we have developed a rapid and cost-effective alternative for construction of small-fragment DNA libraries of defined sequences. This approach uses in situ microarray DNA synthesis for generation of complex oligonucleotide populations. These populations can be recovered and either used directly or immortalized by cloning. From a single microarray, a library containing thousands of unique sequences can be generated. As an example of the potential applications of this technology, we have tested the approach for the production of plasmids encoding short hairpin RNAs (shRNAs) targeting numerous human and mouse genes. We achieved high-fidelity clone retrieval with a uniform representation of intended library sequences. PMID:15782200

  11. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  12. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  13. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  14. Synthesis, characterization, DNA binding, DNA cleavage, protein binding and cytotoxic activities of Ru(II) complexes.

    PubMed

    Thota, Sreekanth; Vallala, Srujana; Yerra, Rajeshwar; Rodrigues, Daniel Alencar; Raghavendra, Nulgumnalli Manjunathaiah; Barreiro, Eliezer J

    2016-01-01

    We report on the synthesis of novel Ru(II) compounds (Ru-1 to Ru-8) bearing R-pdc, 4-Cl-pbinh ligands (where R=4-CF3, 4-F, 4-OH pdc=3-phenyl-5-(1H-pyrrol-2-yl)-4,5-dihydro-1H-pyrazole-1-carbothioamide, pbinh=phenoxybenzylidene isonicotinyl hydrazides) and their in vitro antitumor activity toward the cell lines murine leukemia L1210, human lymphocyte CEM, human epithelial cervical carcinoma HeLa, BEL-7402 and Molt4/C8. Some of the complexes exhibited more potent antiproliferative activity against cell lines than the standard drug cisplatin. Ruthenium complex Ru-2 displayed potent cytotoxicity with than that of cisplatin. DNA-binding, DNA cleavage and protein binding properties of ruthenium complexes with these ligands are reported. Interactions of these ruthenium complexes with DNA revealed an intercalative mode of binding between them. Synchronous fluorescence spectra proved that the interaction of ruthenium complexes with bovine serum albumin (BSA) resulted in a conformational change of the latter.

  15. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  16. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  17. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  18. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases.

    PubMed

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-03-15

    New types of double-headed 2'-deoxycytidine 5'-O-triphosphates (dC(XC)TPs) bearing another cytosine or 5-fluorocytosine linked through a flexible propargyl, homopropargyl or pent-1-ynyl linker to position 5 were prepared by the aqueous Sonogashira cross-coupling reactions of 5-iodo-dCTP with the corresponding (fluoro)cytosine-alkynes. The modified dC(XC)TPs were good substrates for DNA polymerases and were used for enzymatic synthesis of cytosine-functionalized DNA by primer extension or PCR. The cytosine- or fluorocytosine-linked DNA probes did not significantly inhibit DNA methyltransferases and did not cross-link to these proteins.

  19. Label-free potentiometry for detecting DNA hybridization using peptide nucleic acid and DNA probes.

    PubMed

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-02-07

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry.

  20. DNA Tetrominoes: The Construction of DNA Nanostructures Using Self-Organised Heterogeneous Deoxyribonucleic Acids Shapes

    PubMed Central

    Ong, Hui San; Rahim, Mohd Syafiq; Firdaus-Raih, Mohd; Ramlan, Effirul Ikhwan

    2015-01-01

    The unique programmability of nucleic acids offers alternative in constructing excitable and functional nanostructures. This work introduces an autonomous protocol to construct DNA Tetris shapes (L-Shape, B-Shape, T-Shape and I-Shape) using modular DNA blocks. The protocol exploits the rich number of sequence combinations available from the nucleic acid alphabets, thus allowing for diversity to be applied in designing various DNA nanostructures. Instead of a deterministic set of sequences corresponding to a particular design, the protocol promotes a large pool of DNA shapes that can assemble to conform to any desired structures. By utilising evolutionary programming in the design stage, DNA blocks are subjected to processes such as sequence insertion, deletion and base shifting in order to enrich the diversity of the resulting shapes based on a set of cascading filters. The optimisation algorithm allows mutation to be exerted indefinitely on the candidate sequences until these sequences complied with all the four fitness criteria. Generated candidates from the protocol are in agreement with the filter cascades and thermodynamic simulation. Further validation using gel electrophoresis indicated the formation of the designed shapes. Thus, supporting the plausibility of constructing DNA nanostructures in a more hierarchical, modular, and interchangeable manner. PMID:26258940

  1. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  2. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  3. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  4. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  5. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  6. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  7. Folic acid, polymorphism of methyl-group metabolism genes, and DNA methylation in relation to GI carcinogenesis.

    PubMed

    Fang, Jing Yuan; Xiao, Shu Dong

    2003-01-01

    DNA methylation is the main epigenetic modification after replication in humans. DNA (cytosine-5)-methyltransferase (DNMT) catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to C5 of cytosine within CpG dinucleotide sequences in the genomic DNA of higher eukaryotes. There is considerable evidence that aberrant DNA methylation plays an integral role in carcinogenesis. Folic acid or folate is crucial for normal DNA synthesis and can regulate DNA methylation, and through this, it affects cellular SAM levels. Folate deficiency results in DNA hypomethylation. Epidemiological studies have indicated that folic acid protects against gastrointestinal (GI) cancers. Methylene-tetrahydrofolate reductase (MTHFR) and methionine synthase (MS) are the enzymes involved in folate metabolism and are thought to influence DNA methylation. MTHFR is highly polymorphic, and the variant genotypes result in decreased MTHFR enzyme activity and lower plasma folate level. Two common MTHFR polymorphisms, 677CT (or 677TT) and A1298C, and an MS polymorphism, A-->G at 2756, have been identified. Most studies support an inverse association between folate status and the rate of colorectal adenomas and carcinomas. During human GI carcinogenesis, MTHFR is highly polymorphic, and the variant genotypes result in decreased MTHFR enzyme activity and lower plasma folate level, as well as aberrant methylation.

  8. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells.

    PubMed

    Canitrot, Y; Hoffmann, J S; Calsou, P; Hayakawa, H; Salles, B; Cazaux, C

    2000-09-01

    The nucleotide excision repair pathway contributes to genetic stability by removing a wide range of DNA damage through an error-free reaction. When the lesion is located, the altered strand is incised on both sides of the lesion and a damaged oligonucleotide excised. A repair patch is then synthesized and the repaired strand is ligated. It is assumed that only DNA polymerases delta and/or epsilon participate to the repair DNA synthesis step. Using UV and cisplatin-modified DNA templates, we measured in vitro that extracts from cells overexpressing the error-prone DNA polymerase beta exhibited a five- to sixfold increase of the ultimate DNA synthesis activity compared with control extracts and demonstrated the specific involvement of Pol beta in this step. By using a 28 nt gapped, double-stranded DNA substrate mimicking the product of the incision step, we showed that Pol beta is able to catalyze strand displacement downstream of the gap. We discuss these data within the scope of a hypothesis previously presented proposing that excess error-prone Pol beta in cancer cells could perturb the well-defined specific functions of DNA polymerases during error-free DNA transactions. PMID:10973926

  9. Flexibility of nucleic acids: From DNA to RNA

    NASA Astrophysics Data System (ADS)

    Lei, Bao; Xi, Zhang; Lei, Jin; Zhi-Jie, Tan

    2016-01-01

    The structural flexibility of nucleic acids plays a key role in many fundamental life processes, such as gene replication and expression, DNA-protein recognition, and gene regulation. To obtain a thorough understanding of nucleic acid flexibility, extensive studies have been performed using various experimental methods and theoretical models. In this review, we will introduce the progress that has been made in understanding the flexibility of nucleic acids including DNAs and RNAs, and will emphasize the experimental findings and the effects of salt, temperature, and sequence. Finally, we will discuss the major unanswered questions in understanding the flexibility of nucleic acids. Project supported by the National Basic Research Program of China (Grant No. 2011CB933600), the National Natural Science Foundation of China (Grant Nos. 11175132, 11575128, and 11374234), and the Program for New Century Excellent Talents, China (Grant No. NCET 08-0408).

  10. Extracellular matrix components influence DNA synthesis of rat hepatocytes in primary culture

    SciTech Connect

    Sawada, N.; Tomomura, A.; Sattler, C.A.; Sattler, G.L.; Kleinman, H.K.; Pitot, H.C.

    1986-12-01

    The effects of several extracellular matrix components (EMCs) - fibronectin (Fn), laminin (Ln), type I (C-I) and type IV (C-IV) collagen - on DNA synthesis in rat hepatocytes in primary culture were examined by both quantitative scintillation spectrometry and autoradiography of (/sup 3/H)thymidine incorporation. Hepatocytes cultured on Fn showed the most active DNA synthesis initiated by epidermal growth factor (EGF) with decreasing levels of (/sup 3/H)thymidine uptake exhibited in the cell cultured on C-IV, C-I, and Ln, respectively. The decreasing level of DNA synthesis in hepatocytes cultured on Fn, C-IV, C-I, and Ln respectively was not influenced by cell density. The number of EGF receptors of hepatocytes was also not influenced by EMCs. These data suggest that EMCs modify hepatocyte DNA synthesis by means of post-EGF-receptor mechanisms which are regulated by both growth factors and cell density.

  11. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  12. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  13. Associations between Serum Perfluoroalkyl Acids and LINE-1 DNA Methylation

    PubMed Central

    Watkins, Deborah J.; Wellenius, Gregory A.; Butler, Rondi A.; Bartell, Scott M.; Fletcher, Tony; Kelsey, Karl T.

    2014-01-01

    Perfluoroalkyl acids (PFAAs) are persistent, synthetic compounds that are used in a number of consumer products. Perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS) have been associated with cardiovascular risk factors, and changes in gene expression and DNA methylation in animals and cellular systems. However, whether PFAA exposure is associated with LINE-1 DNA methylation, a potential marker of cardiovascular risk, in humans remains unknown. We sought to evaluate the cross-sectional associations between serum PFAAs and LINE-1 DNA methylation in a population highly exposed to PFOA. We measured serum PFAAs twice four to five years apart in 685 adult participants (47% male, mean age ± SD=42 ± 11 years). We measured percent LINE-1 DNA methylation in peripheral blood leukocytes at the second time point (follow-up), and estimated absolute differences in LINE-1 methylation associated with an interquartile (IQR) shift in mean PFAA serum levels. IQR increases in mean serum PFOA, PFOS, perfluorononanoic acid (PFNA), and perfluorohexane sulfonate (PFHxS) were associated with differences of −0.04 (p=0.16), 0.20 (p=0.001), 0.06 (p=0.19), and 0.02 (p=0.57), respectively, in % LINE-1 methylation at follow-up after adjustment for potential confounders. We observed a monotonic increase in LINE-1 DNA methylation across tertiles of PFOS and PFNA (ptrend=0.02 for both associations), but not across tertiles of PFOA or PFHxS (ptrend=0.71 and 0.44, respectively). In summary, serum PFOS was associated with LINE-1 methylation, while serum PFOA, PFHxS, and PFNA were not. Additional research is needed to more precisely determine whether these compounds are epigenetically active. PMID:24263140

  14. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  15. In vitro synthesis of ribosomal proteins directed by Escherichia coli DNA.

    PubMed

    Kaltschmidt, E; Kahan, L; Nomura, M

    1974-02-01

    In vitro synthesis of a number of E. coli 30S ribosomal proteins has been demonstrated in a cell-free system consisting of ribosomes, initiation factors, RNA polymerase, a fraction containing soluble enzymes and factors, and E. coli DNA. DNA-dependent synthesis of the following 30S proteins has been demonstrated: S4, S5, S7, S8, S9, S10, S13, S14, S16, S19, and S20.

  16. Nucleic Acid-Peptide Complex Phase Controlled by DNA Hybridization

    NASA Astrophysics Data System (ADS)

    Vieregg, Jeffrey; Lueckheide, Michael; Leon, Lorraine; Marciel, Amanda; Tirrell, Matthew

    When polyanions and polycations are mixed, counterion release drives formation of polymer-rich complexes that can either be solid (precipitates) or liquid (coacervates) depending on the properties of the polyelectrolytes. These complexes are important in many fields, from encapsulation of industrial polymers to membrane-free segregation of biomolecules such as nucleic acids and proteins. Condensation of long double-stranded DNA has been studied for several decades, but comparatively little attention has been paid to the polyelectrolyte behavior of oligonucleotides. We report here studies of DNA oligonucleotides (10 - 88 nt) complexed with polylysine (10 - 100 aa). Unexpectedly, we find that the phase of the resulting complexes is controlled by the hybridization state of the nucleic acid, with double-stranded DNA forming precipitates and single-stranded DNA forming coacervates. Stability increases with polyelectrolyte length and decreases with solution salt concentration, with complexes of the longer double-stranded polymers undergoing precipitate/coacervate/soluble transitions as ionic strength is increased. Mixing coacervates formed by complementary single-stranded oligonucleotides results in precipitate formation, raising the possibility of stimulus-responsive material design.

  17. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  18. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips.

    PubMed

    Kosuri, Sriram; Eroshenko, Nikolai; Leproust, Emily M; Super, Michael; Way, Jeffrey; Li, Jin Billy; Church, George M

    2010-12-01

    Development of cheap, high-throughput and reliable gene synthesis methods will broadly stimulate progress in biology and biotechnology. Currently, the reliance on column-synthesized oligonucleotides as a source of DNA limits further cost reductions in gene synthesis. Oligonucleotides from DNA microchips can reduce costs by at least an order of magnitude, yet efforts to scale their use have been largely unsuccessful owing to the high error rates and complexity of the oligonucleotide mixtures. Here we use high-fidelity DNA microchips, selective oligonucleotide pool amplification, optimized gene assembly protocols and enzymatic error correction to develop a method for highly parallel gene synthesis. We tested our approach by assembling 47 genes, including 42 challenging therapeutic antibody sequences, encoding a total of ∼35 kilobase pairs of DNA. These assemblies were performed from a complex background containing 13,000 oligonucleotides encoding ∼2.5 megabases of DNA, which is at least 50 times larger than in previously published attempts.

  19. RecG Directs DNA Synthesis during Double-Strand Break Repair.

    PubMed

    Azeroglu, Benura; Mawer, Julia S P; Cockram, Charlotte A; White, Martin A; Hasan, A M Mahedi; Filatenkova, Milana; Leach, David R F

    2016-02-01

    Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR) that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300), arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability.

  20. Characterization of DNA Binding and Retinoic Acid Binding Properties of Retinoic Acid Receptor

    NASA Astrophysics Data System (ADS)

    Yang, Na; Schule, Roland; Mangelsdorf, David J.; Evans, Ronald M.

    1991-05-01

    High-level expression of the full-length human retinoic acid receptor (RAR) α and the DNA binding domain of the RAR in Escherichia coli was achieved by using a T7 RNA polymerase-directed expression system. After induction, full-length RAR protein was produced at an estimated level of 20% of the total bacterial proteins. Both intact RAR molecules and the DNA binding domain bind to the cognate DNA response element with high specificity in the absence of retinoic acid. However, this binding is enhanced to a great extent upon the addition of eukaryotic cell extracts. The factor responsible for this enhancement is heat-sensitive and forms a complex with RAR that binds to DNA and exhibits a distinct migration pattern in the gel-mobility-shift assay. The interaction site of the factor with RAR is localized in the 70-amino acid DNA binding region of RAR. The hormone binding ability of the RARα protein was assayed by a charcoal absorption assay and the RAR protein was found to bind to retinoic acid with a K_d of 2.1 x 10-10 M.

  1. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  2. [Analysis of the biological effect of city smog extract. V. Comparative investigations on the effect of city smog extracts on DNA synthesis of Syrian hamster kidney and embryonic cells and of African green monkey kidney cells in vitro (author's transl)].

    PubMed

    Krampitz, G; Seemayer, N

    1979-01-01

    We analysed the effect of two samples of city smog extract from Bochum and Duisburg on DNA synthesis of mammalian cells in vitro. As a test system we used tissue cultures of kidney and embryonic cells from the Syrian golden hamster and monkey kidney cells from Cercopithecus aethiops. DNA synthesis of cells was measured by autoradiography using 3H-Thymidine. Both samples of city smog extract exerted a dose-dependent decrease of the rate of DNA synthesis in tissue culture cells. These alterations of nucleic acid metabolism were expressed by a reduction of DNA-synthesizing cells and by a delay of entrance of cells in DNA synthesis. High concentrations of city smog extracts induced a large number of cell necroses. Monkey kidney cells were more sensitive to the toxic action than hamster cells. Furthermore the city smog extract from Duisburg showed a stronger toxic effect than the extract from Bochum.

  3. A proposed role played by benzene itself in the induction of acute cytopenia: inhibition of DNA synthesis.

    PubMed

    Lee, E W; Garner, C D; Johnson, J T

    1988-04-01

    A single intraperitoneal dose of benzene (880 mg/kg) in mice inhibited DNA synthesis of bone marrow cells within one hour postinjection. However, there was no inhibitory effect on the synthesis of heme and protein at that dosage. Dose-dependent inhibition of DNA synthesis by benzene was observed over the range of 440 to 1760 mg/kg, supporting the idea that cytopenia which was observed by others following multiple doses of benzene (e.g., 440 or 880 mg/kg) might be due to the inhibitory effect of benzene on DNA synthesis. In our studies, benzene concentrations above 81 micrograms/g wet bone marrow resulted in inhibition of DNA synthesis, regardless of whether it was given ip or by inhalation. The effect of benzene itself, rather than its toxic metabolites, on DNA synthesis was further seen in experiments using a bone marrow cell culture system and cell-free DNA synthetic system. Experimental results demonstrated that benzene alone was capable of inhibiting the DNA synthesis of bone marrow cells and that the reduced DNA synthesis resulted from the inhibitory effect of benzene on DNA polymerase alpha, the enzyme that catalyzes the last step of the DNA synthetic pathway. Thus, benzene itself could play a significant role in inducing myelotoxicity in the case of acute or subacute toxicity by exerting its inhibitory effect on DNA synthesis.

  4. Induction of internucleosomal DNA fragmentation by carcinogenic chromate: relationship to DNA damage, genotoxicity, and inhibition of macromolecular synthesis.

    PubMed Central

    Manning, F C; Blankenship, L J; Wise, J P; Xu, J; Bridgewater, L C; Patierno, S R

    1994-01-01

    Hexavalent chromium (Cr) compounds are respiratory carcinogens in humans and animals. Treatment of Chinese hamster ovary cells with 150 and 300 microM sodium chromate (Na2CrO4) for 2 hr decreased colony-forming efficiency by 46 and 92%, respectively. These treatments induced dose-dependent internucleosomal fragmentation of cellular DNA beyond 24 hr after chromate treatment. This fragmentation pattern is characteristic of apoptosis as a mechanism of cell death. These treatments also induced an immediate inhibition of macromolecular synthesis and delayed progression of cells through S-phase of the cell cycle. Cell growth (as evidenced by DNA synthesis) was inhibited for at least 4 days and transcription remained suppressed for at least 32 hr. Many of the cells that did progress to metaphase exhibited chromosome damage. Chromate caused the dose-dependent formation of DNA single-strand breaks and DNA-protein cross-links, but these were repaired 8 and 24 hr after removal of the treatment, respectively. In contrast, Cr-DNA adducts (up to 1/100 base-pairs) were extremely resistant to repair and were still detectable even 5 days after treatment. Compared with other regions of the genome, DNA-protein cross-links and Cr adducts were preferentially associated with the nuclear matrix DNA of treated cells, which was 4.5-fold enriched in actively transcribed genes. Chromium adducts, formed on DNA in vitro at a similar level to that detected in nuclear matrix DNA, arrested the progression of a DNA polymerase in a sequence-specific manner, possibly through the formation of DNA-DNA cross-links.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 2. Figure 3. Figure 7. PMID:7843091

  5. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  6. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  7. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  8. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  9. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A–T phosphoramidite building blocks

    PubMed Central

    Schmidtgall, Boris; Höbartner, Claudia

    2015-01-01

    Summary Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T–T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X–T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A–T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  10. Genome Calligrapher: A Web Tool for Refactoring Bacterial Genome Sequences for de Novo DNA Synthesis.

    PubMed

    Christen, Matthias; Deutsch, Samuel; Christen, Beat

    2015-08-21

    Recent advances in synthetic biology have resulted in an increasing demand for the de novo synthesis of large-scale DNA constructs. Any process improvement that enables fast and cost-effective streamlining of digitized genetic information into fabricable DNA sequences holds great promise to study, mine, and engineer genomes. Here, we present Genome Calligrapher, a computer-aided design web tool intended for whole genome refactoring of bacterial chromosomes for de novo DNA synthesis. By applying a neutral recoding algorithm, Genome Calligrapher optimizes GC content and removes obstructive DNA features known to interfere with the synthesis of double-stranded DNA and the higher order assembly into large DNA constructs. Subsequent bioinformatics analysis revealed that synthesis constraints are prevalent among bacterial genomes. However, a low level of codon replacement is sufficient for refactoring bacterial genomes into easy-to-synthesize DNA sequences. To test the algorithm, 168 kb of synthetic DNA comprising approximately 20 percent of the synthetic essential genome of the cell-cycle bacterium Caulobacter crescentus was streamlined and then ordered from a commercial supplier of low-cost de novo DNA synthesis. The successful assembly into eight 20 kb segments indicates that Genome Calligrapher algorithm can be efficiently used to refactor difficult-to-synthesize DNA. Genome Calligrapher is broadly applicable to recode biosynthetic pathways, DNA sequences, and whole bacterial genomes, thus offering new opportunities to use synthetic biology tools to explore the functionality of microbial diversity. The Genome Calligrapher web tool can be accessed at https://christenlab.ethz.ch/GenomeCalligrapher  .

  11. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  12. Deglycobleomycin: solid-phase synthesis and DNA cleavage by the resin-bound ligand.

    PubMed

    Smith, Kenneth L; Tao, Zhi-Fu; Hashimoto, Shigeki; Leitheiser, Christopher J; Wu, Xihan; Hecht, Sidney M

    2002-04-01

    [structure: see text] A greatly improved solid-phase synthesis of deglycobleomycin using a Dde-based linker is reported. The resin-bound deglycobleomycin could be completely deblocked and assayed for DNA plasmid relaxation, sequence-selective DNA cleavage, and light production from a molecular beacon.

  13. Aphidicolin does not inhibit DNA repair synthesis in ultraviolet-irradiated HeLa cells. A radioautographic study.

    PubMed Central

    Hardt, N; Pedrali-Noy, G; Focher, F; Spadari, S

    1981-01-01

    A radioautographic examination of nuclear DNA synthesis in unirradiated and u.v.-irradiated HeLa cells, in the presence and in the absence of aphidicolin, showed that aphidicolin inhibits nuclear DNA replication and has no detectable effect on DNA repair synthesis. Although the results establish that in u.v.-irradiated HeLa cells most of the DNA repair synthesis is not due to DNA polymerase alpha, they do not preclude a significant role for this enzyme in DNA repair processes. Images PLATE 1 PMID:6803764

  14. Synthesis and spectroscopic studies of the aminoglycoside (neomycin)--perylene conjugate binding to human telomeric DNA.

    PubMed

    Xue, Liang; Ranjan, Nihar; Arya, Dev P

    2011-04-12

    Synthesis of a novel perylene-neomycin conjugate (3) and the properties of its binding to human telomeric G-quadruplex DNA, 5'-d[AG3(T2AG3)3] (4), are reported. Various spectroscopic techniques were employed to characterize the binding of conjugate 3 to 4. A competition dialysis assay revealed that 3 preferentially binds to 4, in the presence of other nucleic acids, including DNA, RNA, DNA-RNA hybrids, and other higher-order structures (single strands, duplexes, triplexes, other G-quadruplexes, and the i-motif). UV thermal denaturation studies showed that thermal stabilization of 4 increases as a function of the increasing concentration of 3. The fluorescence intercalator displacement (FID) assay displayed a significantly tighter binding of 3 with 4 as compared to its parent constituents [220-fold stronger than neomycin (1) and 4.5-fold stronger than perylene diamine (2), respectively]. The binding of 3 with 4 resulted in pronounced changes in the molar ellipticity of the DNA absorption region as confirmed by circular dichroism. The UV-vis absorption studies of the binding of 3 to 4 resulted in a red shift in the spectrum of 3 as well as a marked hypochromic change in the perylene absorption region, suggesting that the ligand-quadruplex interaction involves stacking of the perylene moiety. Docking studies suggest that the perylene moiety serves as a bridge that end stacks on 4, making contacts with two thymine bases in the loop, while the two neomycin moieties branch into the grooves of 4.

  15. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  16. Repair synthesis by human cell extracts in DNA damaged by cis- and trans-diamminedichloroplatinum(II).

    PubMed Central

    Hansson, J; Wood, R D

    1989-01-01

    DNA damage was induced in closed circular plasmid DNA by treatment with cis- or trans-diamminedichloroplatinum(II). These plasmids were used as substrates in reactions to give quantitative measurements of DNA repair synthesis mediated by cell free extracts from human lymphoid cell lines. Adducts induced by both drugs stimulated repair synthesis in a dose dependent manner by an ATP-requiring process. Measurements by an isopycnic gradient sedimentation method gave an upper limit for the average patch sizes in this in vitro system of around 140 nucleotides. It was estimated that up to 3% of the drug adducts induce the synthesis of a repair patch. The repair synthesis is due to repair of a small fraction of frequent drug adducts, rather than extensive repair of a rare subclass of lesions. Nonspecific DNA synthesis in undamaged plasmids, caused by exonucleolytic degradation and resynthesis, was reduced by repeated purification of intact circular forms. An extract made from cells belonging to xeroderma pigmentosum complementation group A was deficient in repair synthesis in response to the presence of cis- or trans-diamminedichloroplatinum(II) adducts in DNA. Images PMID:2554251

  17. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  18. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  19. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  20. Nerve growth factor inhibits the synthesis of a single-stranded DNA binding protein in pheochromocytoma cells (clone PC12).

    PubMed Central

    Biocca, S; Cattaneo, A; Calissano, P

    1984-01-01

    Arrest of mitosis and neurite outgrowth induced by nerve growth factor (NGF) in rat pheochromocytoma cells (clone PC12) is accompanied by a progressive inhibition of the synthesis of a protein that binds to single-stranded but not to double-stranded DNA. Time course experiments show that this inhibition is already apparent after a 2-day incubation with NGF and is maximum (85-95%) upon achievement of complete PC12 cell differentiation. Inhibition of the synthesis of this single-stranded DNA binding protein after 48 hr of incubation with NGF is potentiated by concomitant treatment of PC12 cells with antimitotic drugs acting at different levels of DNA replication. Purification on a preparative scale of this protein and analysis of its major physicochemical properties show that: (i) it constitutes 0.5% of total soluble proteins of naive PC12 cells; (ii) its molecular weight measured by NaDodSO4/PAGE is Mr 34,000 (sucrose gradient centrifugation under nondenaturing conditions yields a sedimentation coefficient s20,w of 8.1 S, indicating that the native protein is an oligomer); (iii) amino acid analysis demonstrates a preponderance of acidic over basic residues, while electrofocusing experiments show that it has an isoelectric point around 8.0; (iv) approximately 15% of the protein is phosphorylated in vivo. It is postulated that control of the synthesis of this protein is connected with activation of a differentiative program triggered by NGF in the PC12 neoplastic cell line at some step(s) of DNA activity. Images PMID:6585787

  1. Activation of cell division and nucleic acid synthesis in the corneal epithelium of albino rats by repeated stress

    SciTech Connect

    Berezhnova, N.I.; Timoshin, S.S.

    1985-05-01

    Adaption to unfavorable factors is accompanied by activation of nucleic acid and protein synthesis in systems responsible for adaption. The authors investigate the possibility of similar changes taking place in structures not actively participating in adaptation. The corneas of the dead male albin rats were preincubated with tritium-uridine for 1.5 hours. The mitotic index, the index of tritium-thymidine-labeled nuclei and the intensity of thymidine labeling were determined. The results indicate that after a single exposure to hypoxia, hyperthermia, and immobilization, mitotic index in the corneal epithelium decreased and DNA synthesis under these circumstances remained stable.

  2. Complexing of amino acids to DNA by chromate in intact cells.

    PubMed Central

    Voitkun, V; Zhitkovich, A; Costa, M

    1994-01-01

    Using o-pthaldialdehyde (OPT) fluorescence, the amino acids associated with DNA were studied following exposure of intact Chinese hamster ovary cells to chromate. Rigorous extraction with EDTA, acid, or base was required to release the amino acids cross-linked to the DNA isolated from control or chromate-treated cells by standard procedures (i.e., proteinase K, phenol, etc.). Amino acids resisting extraction from DNA were not studied since analysis was limited to those that could be released by these procedures. There was a chromate dose-dependent increase in amino acids complexed with the DNA that could be released by EDTA, acid, and base, and these amino acids were separated by HPLC and identified. Substantial increases in cysteine, glutamine, glutamic acid, histidine, threonine, and tyrosine were found as a function of increasing concentrations of chromate. There was also a time-dependent increase in complexing of these amino acids to the DNA by chromate. The amino acids found complexed to DNA in intact cells by chromate were thought to originate from reactions of free amino acids or small peptides with the DNA rather than being proteolytic products derived from larger proteins that were cross-linked to the DNA. This was supported by a number of experiments: a) free amino acids or bovine serum albumin (BSA) were cross-linked by chromium to DNA in vitro and the DNA was isolated by standard procedures.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7843108

  3. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  4. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  5. Sm(III)nitrate-catalyzed one-pot synthesis of furano[3,2c]-1,2,3,4-tetrahydroquinolines and DNA photocleavage studies

    NASA Astrophysics Data System (ADS)

    Bindu, P. J.; Mahadevan, K. M.; Ravikumar Naik, T. R.

    2012-08-01

    The synthesis and DNA photocleavage studies of furano[3,2-c]-1,2,3,4-tetrahydroquinolines have been reported. Sm(III)nitrate was found to be an efficient for the Diels-Alder reaction of aryl amines with 2,3-dihydrofuran to offer the corresponding furano[3,2-c]-1,2,3,4-tetrahydroquinolines derivatives as a mixture of cis/trans stereoisomers in moderate yields. The aqueous solubility of acid catalyst can be recycled without significant loss of activity. The DNA photocleavage studies shows that, the cis/trans stereoisomers are good DNA cleavage mimic in terms of molecular structure.

  6. Interaction of photosensitive surfactant with DNA and poly acrylic acid

    SciTech Connect

    Zakrevskyy, Yuriy Paasche, Jens; Lomadze, Nino; Santer, Svetlana; Cywinski, Piotr; Cywinska, Magdalena; Reich, Oliver; Löhmannsröben, Hans-Gerd

    2014-01-28

    In this paper, we investigate interactions and phase transitions in polyelectrolyte-surfactant complexes formed between a cationic azobenzene-containing surfactant and two types of polyelectrolytes: natural (DNA) or synthetic (PAA: poly acrylic acid). The construction of a phase diagram allowed distancing between four major phases: extended coil conformation, colloidally stable compacted globules, colloidal instability range, and surfactant-stabilized compact state. Investigation on the complexes’ properties in different phases and under irradiation with UV light provides information about the role of the surfactant's hydrophobic trans isomers both in the formation and destruction of DNA and PAA globules as well as in their colloidal stabilization. The trans isomer shows much stronger affinity to the polyelectrolytes than the hydrophilic cis counterpart. There is no need for complete compensation of the polyelectrolyte charges to reach the complete compaction. On contrary to the findings previously reported in the literature, we demonstrate – for the first time – complete polyelectrolyte compaction which occurs already at 20% of DNA (and at 50% of PAA) charge compensation. The trans isomer plays the main role in the compaction. The aggregation between azobenzene units in the photosensitive surfactant is a driving force of this process. The decompaction can be realized during UV light irradiation and is strongly influenced by the interplay between surfactant-surfactant and surfactant-DNA interactions in the compacted globules.

  7. Interaction of photosensitive surfactant with DNA and poly acrylic acid.

    PubMed

    Zakrevskyy, Yuriy; Cywinski, Piotr; Cywinska, Magdalena; Paasche, Jens; Lomadze, Nino; Reich, Oliver; Löhmannsröben, Hans-Gerd; Santer, Svetlana

    2014-01-28

    In this paper, we investigate interactions and phase transitions in polyelectrolyte-surfactant complexes formed between a cationic azobenzene-containing surfactant and two types of polyelectrolytes: natural (DNA) or synthetic (PAA: poly acrylic acid). The construction of a phase diagram allowed distancing between four major phases: extended coil conformation, colloidally stable compacted globules, colloidal instability range, and surfactant-stabilized compact state. Investigation on the complexes' properties in different phases and under irradiation with UV light provides information about the role of the surfactant's hydrophobic trans isomers both in the formation and destruction of DNA and PAA globules as well as in their colloidal stabilization. The trans isomer shows much stronger affinity to the polyelectrolytes than the hydrophilic cis counterpart. There is no need for complete compensation of the polyelectrolyte charges to reach the complete compaction. On contrary to the findings previously reported in the literature, we demonstrate - for the first time - complete polyelectrolyte compaction which occurs already at 20% of DNA (and at 50% of PAA) charge compensation. The trans isomer plays the main role in the compaction. The aggregation between azobenzene units in the photosensitive surfactant is a driving force of this process. The decompaction can be realized during UV light irradiation and is strongly influenced by the interplay between surfactant-surfactant and surfactant-DNA interactions in the compacted globules. PMID:25669583

  8. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  9. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  10. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  11. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  12. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  13. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  14. Tributyrin inhibits human gastric cancer SGC-7901 cell growth by inducing apoptosis and DNA synthesis arrest

    PubMed Central

    Yan, Jun; Xu, Yong-Hua

    2003-01-01

    AIM: To evaluate the effects of tributyrin, a pro-drug of natural butyrate and a neutral short-chain fatty acid triglyceride, on the growth inhibition of human gastric cancer SGC-7901 cell. METHODS: Human gastric cancer SGC-7901 cells were exposed to tributyrin at 0.5, 1, 2, 5, 10 and 50 mmol·L-1 for 24-72 h. MTT assay was applied to detect the cell proliferation. [3H]-TdR uptake was measured to determine DNA synthesis. Apoptotic morphology was observed by electron microscopy and Hoechst-33258 staining. Flow cytometry and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay were performed to detect tributyrin-triggered apoptosis. The expressions of PARP, Bcl-2 and Bax were examined by Western blot assay. RESULTS: Tributyrin could initiate growth inhibition of SGC-7901 cell in a dose- and time-dependent manner. [3H]-TdR uptake by SGC-7901 cells was reduced to 33.6% after 48 h treatment with 2 mmol·L-1 tributyrin, compared with the control (P < 0.05). Apoptotic morphology was detected by TUNEL assay. Flow cytometry revealed that tributyrin could induce apoptosis of SGC-7901 cells in dose-dependent manner. After 48 hours incubation with tributyrin at 2 mmol·L-1, the level of Bcl-2 protein was lowered, and the level of Bax protein was increased in SGC-7901, accompanied by PARP cleavage. CONCLUSION: Tributyrin could inhibit the growth of gastric cancer cells effectively in vitro by inhibiting DNA synthesis and inducing apoptosis, which was associated with the down-regulated Bcl-2 expression and the up-regulated Bax expression. Therefore, tributyrin might be a promising chemopreventive and chemotherapeutic agent against human gastric carcinogenesis. PMID:12679905

  15. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  16. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  17. Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.

    PubMed

    Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay

    2014-05-01

    The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.

  18. Antifolate-induced misincorporation of deoxyuridine monophosphate into DNA: inhibition of high molecular weight DNA synthesis in human lymphoblastoid cells.

    PubMed Central

    Sedwick, W D; Kutler, M; Brown, O E

    1981-01-01

    In vitro exposure of a human lymphoblastoid cell line (WIL-2) to the antifolate metoprine (DDMP), when followed by the addition of exogenous deoxyuridine, led to intracellular accumulation of deoxyuridine triphosphate (dUTP) and incorporation of deoxyuridine monophosphate (dUMP) into DNA. When newly synthesized DNA was extracted from DDMP-treated cells that had been labeled with deoxyuridine for up to 3 min, most of the DNA synthesized was no larger than 4 S on alkaline sucrose gradients. In contrast, the predominant form of newly synthesized alkali-stable DNA in cells not treated with drug was larger than 4 S. Abnormal progression of DNA synthesis, degradation of newly synthesized DNA, or both occurred as a delayed consequence of DDMP treatment in the absence of exogenous deoxyuridine when thymidine was used to label DNA of DDMP-treated stability of antifolate-induced misincorporation of dUMP into DNA was not elucidated, it was clear that antifolates can directly perturb the quality as well as the quantity of DNA synthesized by drug-treated cells. PMID:6940156

  19. Surface passivation improves the synthesis of highly stable and specific DNA-functionalized gold nanoparticles with variable DNA density.

    PubMed

    Deka, Jashmini; Měch, Rostislav; Ianeselli, Luca; Amenitsch, Heinz; Cacho-Nerin, Fernando; Parisse, Pietro; Casalis, Loredana

    2015-04-01

    We report a novel and multifaceted approach for the quick synthesis of highly stable single-stranded DNA (ssDNA) functionalized gold nanoparticles (AuNPs). The method is based on the combined effect of surface passivation by (1-mercaptoundec-11-yl)hexa(ethylene glycol) and low pH conditions, does not require any salt pretreatment or high excess of ssDNA, and can be generalized for oligonucleotides of any length or base sequence. The synthesized ssDNA-coated AuNPs conjugates are stable at salt concentrations as high as 3.0 M, and also functional and specific toward DNA-DNA hybridization, as shown from UV-vis spectrophotometry, scanning electron microscopy, gel electrophoresis, fluorescence, and small angle X-ray scattering based analyses. The method is highly flexible and shows an additional advantage of creating ssDNA-AuNP conjugates with a predefined number of ssDNA strands per particle. Its simplicity and tenability make it widely applicable to diverse biosensing applications involving ssDNA functionalized AuNPs.

  20. Long-lived crowded-litter mice have an age-dependent increase in protein synthesis to DNA synthesis ratio and mTORC1 substrate phosphorylation.

    PubMed

    Drake, Joshua C; Bruns, Danielle R; Peelor, Frederick F; Biela, Laurie M; Miller, Richard A; Hamilton, Karyn L; Miller, Benjamin F

    2014-11-01

    Increasing mouse litter size [crowded litter (CL)] presumably imposes a transient nutrient stress during suckling and extends lifespan through unknown mechanisms. Chronic calorically restricted and rapamycin-treated mice have decreased DNA synthesis and mTOR complex 1 (mTORC1) signaling but maintained protein synthesis, suggesting maintenance of existing cellular structures. We hypothesized that CL would exhibit similar synthetic and signaling responses to other long-lived models and, by comparing synthesis of new protein to new DNA, that insight may be gained into the potential preservation of existing cellular structures in the CL model. Protein and DNA synthesis was assessed in gastroc complex, heart, and liver of 4- and 7-mo CL mice. We also examined mTORC1 signaling in 3- and 7-mo aged animals. Compared with controls, 4-mo CL had greater DNA synthesis in gastroc complex with no differences in protein synthesis or mTORC1 substrate phosphorylation across tissues. Seven-month CL had less DNA synthesis than controls in heart and greater protein synthesis and mTORC1 substrate phosphorylation across tissues. The increased new protein-to-new DNA synthesis ratio suggests that new proteins are synthesized more so in existing cells at 7 mo, differing from 4 mo, in CL vs. controls. We propose that, in CL, protein synthesis shifts from being directed toward new cells (4 mo) to maintenance of existing cellular structures (7 mo), independently of decreased mTORC1.

  1. Human CD4+ T cells require exogenous cystine for glutathione and DNA synthesis.

    PubMed

    Levring, Trine B; Kongsbak, Martin; Rode, Anna K O; Woetmann, Anders; Ødum, Niels; Bonefeld, Charlotte Menné; Geisler, Carsten

    2015-09-01

    Adaptive immune responses require activation and expansion of antigen-specific T cells. Whereas early T cell activation is independent of exogenous cystine (Cys2), T cell proliferation is dependent of Cys2. However, the exact roles of Cys2 in T cell proliferation still need to be determined. The aim of this study was to elucidate why activated human T cells require exogenous Cys2 in order to proliferate. We activated purified naïve human CD4+ T cells and found that glutathione (GSH) levels and DNA synthesis were dependent on Cys2 and increased in parallel with increasing concentrations of Cys2. Vice-versa, the GSH synthesis inhibitor L-buthionine-sulfoximine (BSO) and inhibition of Cys2 uptake with glutamate inhibited GSH and DNA synthesis in parallel. We further found that thioredoxin (Trx) can partly substitute for GSH during DNA synthesis. Finally, we show that GSH or Trx is required for the activity of ribonucleotide reductase (RNR), the enzyme responsible for generation of the deoxyribonucleotide DNA building blocks. In conclusion, we show that activated human T cells require exogenous Cys2 to proliferate and that this is partly explained by the fact that Cys2 is required for production of GSH, which in turn is required for optimal RNR-mediated deoxyribonucleotide synthesis and DNA replication.

  2. The identification of translesion DNA synthesis regulators: Inhibitors in the spotlight.

    PubMed

    Bertolin, A P; Mansilla, S F; Gottifredi, V

    2015-08-01

    Over the past half-century, we have become increasingly aware of the ubiquity of DNA damage. Under the constant exposure to exogenous and endogenous genomic stress, cells must attempt to replicate damaged DNA. The encounter of replication forks with DNA lesions triggers several cellular responses, including the activation of translesion DNA synthesis (TLS), which largely depends upon specialized DNA polymerases with flexible active sites capable of accommodating bulky DNA lesions. A detrimental aspect of TLS is its intrinsic mutagenic nature, and thus the activity of the TLS polymerases must ideally be restricted to synthesis on damaged DNA templates. Despite their potential clinical importance in chemotherapy, TLS inhibitors have been difficult to identify since a direct assay designed to quantify genomic TLS events is still unavailable. Herein we discuss the methods that have been used to validate TLS inhibitors such as USP1, p21 and Spartan, highlighting research that has revealed their contribution to the control of DNA synthesis on damaged and undamaged templates.

  3. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  4. Acyl-CoA sensing by FasR to adjust fatty acid synthesis in Corynebacterium glutamicum.

    PubMed

    Irzik, Kristina; van Ooyen, Jan; Gätgens, Jochem; Krumbach, Karin; Bott, Michael; Eggeling, Lothar

    2014-12-20

    Corynebacterium glutamicum, like Mycobacterium tuberculosis, is a member of the Corynebacteriales, which have linear fatty acids and as branched fatty acids the mycolic acids. We identified accD1 and fasA as key genes of fatty acid synthesis, encoding the β-subunit of the acetyl-CoA carboxylase and a type-I fatty acid synthase, respectively, and observed their repression during growth on minimal medium with acetate. We also identified the transcriptional regulator FasR and its binding sites in the 5′ upstream regions of accD1 and fasA. In the present work we establish by co-isolation and gel-mobility shifts oleoyl-CoA and palmitoyl-CoA as effectors of FasR, and show by DNA microarray analysis that in presence of exogeneous fatty acids accD1 and fasA are repressed. These results are evidence that acyl-CoA derivatives derived from extracellular fatty acids interact with FasR to repress the genes of fatty acid synthesis. This model also explains the observed repression of accD1 and fasA during growth on acetate, where apparently the known high intracellular acetyl-CoA concentration during growth on this substrate requires reduced accD1 and fasA expression for fine control of de novo fatty acid synthesis. Consequently, this mechanism ensures that membrane lipid homeostasis is maintained when specific nutrients are available resulting in increased acetyl-CoA concentration, as is the case with acetate, or when fatty acids are directly available from the extracellular environment. However, the genes specific to mycolic acid synthesis, which are in part shared with linear fatty acid synthesis, are not controlled by FasR, which is in agreement with the fact that they can not be supplied from the extracellular environment but that their synthesis fully depends on a constant supply of linear fatty acid chains. PMID:25449109

  5. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  6. DNA-Based Synthesis and Assembly of Organized Iron Oxide Nanostructures

    NASA Astrophysics Data System (ADS)

    Khomutov, Gennady B.

    Organized bio-inorganic and hybrid bio-organic-inorganic nanostructures consisting of iron oxide nanoparticles and DNA complexes have been formed using methods based on biomineralization, interfacial and bulk phase assembly, ligand exchange and substitution, Langmuir-Blodgett technique, DNA templating and scaffolding. Interfacially formed planar DNA complexes with water-insoluble amphiphilic polycation or intercalator Langmuir monolayers were prepared and deposited on solid substrates to form immobilized DNA complexes. Those complexes were then used for the synthesis of organized DNA-based iron oxide nanostructures. Planar net-like and circular nanostructures of magnetic Fe3O4 nanoparticles were obtained via interaction of cationic colloid magnetite nanoparticles with preformed immobilized DNA/amphiphilic polycation complexes of net-like and toroidal morphologies. The processes of the generation of iron oxide nanoparticles in immobilized DNA complexes via redox synthesis with various iron sources of biological (ferritin) and artificial (FeCl3) nature have been studied. Bulk-phase complexes of magnetite nanoparticles with biomolecular ligands (DNA, spermine) were formed and studied. Novel nano-scale organized bio-inorganic nanostructures - free-floating sheet-like spermine/magnetite nanoparticle complexes and DNA/spermine/magnetite nanoparticle complexes were synthesized in bulk aqueous phase and the effect of DNA molecules on the structure of complexes was discovered.

  7. A DNA origami nanorobot controlled by nucleic acid hybridization.

    PubMed

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators.

  8. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  9. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  10. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  11. Genomic assay reveals tolerance of DNA damage by both translesion DNA synthesis and homology-dependent repair in mammalian cells.

    PubMed

    Izhar, Lior; Ziv, Omer; Cohen, Isadora S; Geacintov, Nicholas E; Livneh, Zvi

    2013-04-16

    DNA lesions can block replication forks and lead to the formation of single-stranded gaps. These replication complications are mitigated by DNA damage tolerance mechanisms, which prevent deleterious outcomes such as cell death, genomic instability, and carcinogenesis. The two main tolerance strategies are translesion DNA synthesis (TLS), in which low-fidelity DNA polymerases bypass the blocking lesion, and homology-dependent repair (HDR; postreplication repair), which is based on the homologous sister chromatid. Here we describe a unique high-resolution method for the simultaneous analysis of TLS and HDR across defined DNA lesions in mammalian genomes. The method is based on insertion of plasmids carrying defined site-specific DNA lesions into mammalian chromosomes, using phage integrase-mediated integration. Using this method we show that mammalian cells use HDR to tolerate DNA damage in their genome. Moreover, analysis of the tolerance of the UV light-induced 6-4 photoproduct, the tobacco smoke-induced benzo[a]pyrene-guanine adduct, and an artificial trimethylene insert shows that each of these three lesions is tolerated by both TLS and HDR. We also determined the specificity of nucleotide insertion opposite these lesions during TLS in human genomes. This unique method will be useful in elucidating the mechanism of DNA damage tolerance in mammalian chromosomes and their connection to pathological processes such as carcinogenesis. PMID:23530190

  12. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  13. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  14. New coal tar extract and coal tar shampoos. Evaluation by epidermal cell DNA synthesis suppression assay.

    PubMed

    Lowe, N J; Breeding, J H; Wortzman, M S

    1982-07-01

    Coal tar therapy has been used for many years in the treatment of scaling skin diseases, including psoriasis and eczema. Previous studies of the potential effectiveness of tar have utilized phototoxic erythema assays with long-wave ultraviolet light (UV-A). However, in clinical use, coal tar is rarely used with UV-A, particularly for scalp disease. Therefore, we investigated a nonphototoxic approach to evaluate different coal tar products. Coal tar was found to suppress epidermal cell DNA synthesis in the hairless mouse model, and this is the basis for the assay presented. Using the epidermal cell DNA synthesis suppression assay, we observed that crude coal tar and a new extract of crude coal tar were equally effective and that a concentration gradient effect was achieved. In addition, four commercial coal tar shampoos assayed varied greatly in their ability to suppress epidermal cell DNA synthesis. One shampoo was washed after ten minutes and no significant alteration of suppressive effect was seen.

  15. Efficient Automated Solid-Phase Synthesis of DNA and RNA 5'-Triphosphates.

    PubMed

    Sarac, Ivo; Meier, Chris

    2015-11-01

    A fast, high-yielding and reliable method for the synthesis of DNA- and RNA 5'-triphosphates is reported. After synthesizing DNA or RNA oligonucleotides by automated oligonucleotide synthesis, 5-chloro-saligenyl-N,N-diisopropylphosphoramidite was coupled to the 5'-end. Oxidation of the formed 5'-phosphite using the same oxidizing reagent used in standard oligonucleotide synthesis led to 5'-cycloSal-oligonucleotides. Reaction of the support-bonded 5'-cycloSal-oligonucleotide with pyrophosphate yielded the corresponding 5'-triphosphates. The 5'-triphosphorylated DNA and RNA oligonucleotides were obtained after cleavage from the support in high purity and excellent yields. The whole reaction sequence was adapted to be used on a standard oligonucleotide synthesizer.

  16. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  17. Ribonucleotide reductase activity is coupled to DNA synthesis via proliferating cell nuclear antigen.

    PubMed

    Salguero, Israel; Guarino, Estrella; Shepherd, Marianne E A; Deegan, Tom D; Havens, Courtney G; MacNeill, Stuart A; Walter, Johannes C; Kearsey, Stephen E

    2012-04-24

    Synthesis of deoxynucleoside triphosphates (dNTPs) is required for both DNA replication and DNA repair and is catalyzed by ribonucleotide reductases (RNR), which convert ribonucleotides to their deoxy forms [1, 2]. Maintaining the correct levels of dNTPs for DNA synthesis is important for minimizing the mutation rate [3-7], and this is achieved by tight regulation of RNR [2, 8, 9]. In fission yeast, RNR is regulated in part by a small protein inhibitor, Spd1, which is degraded in S phase and after DNA damage to allow upregulation of dNTP supply [10-12]. Spd1 degradation is mediated by the activity of the CRL4(Cdt2) ubiquitin ligase complex [5, 13, 14]. This has been reported to be dependent on modulation of Cdt2 levels, which are cell cycle regulated, peaking in S phase, and which also increase after DNA damage in a checkpoint-dependent manner [7, 13]. We show here that Cdt2 level fluctuations are not sufficient to regulate Spd1 proteolysis and that the key step in this event is the interaction of Spd1 with the polymerase processivity factor proliferating cell nuclear antigen (PCNA), complexed onto DNA. This mechanism thus provides a direct link between DNA synthesis and RNR regulation. PMID:22464192

  18. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  19. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  20. The Roles of Tryptophans in Primer Synthesis by the DNA Primase of Bacteriophage T7*

    PubMed Central

    Zhang, Huidong; Lee, Seung-Joo; Richardson, Charles C.

    2012-01-01

    DNA primases catalyze the synthesis of oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Prokaryotic primases consist of a zinc-binding domain (ZBD) necessary for recognition of a specific template sequence and a catalytic RNA polymerase domain. Interactions of both domains with the DNA template and ribonucleotides are required for primer synthesis. Five tryptophan residues are dispersed in the primase of bacteriophage T7: Trp-42 in the ZBD and Trp-69, -97, -147, and -255 in the RNA polymerase domain. Previous studies showed that replacement of Trp-42 with alanine in the ZBD decreases primer synthesis, whereas substitution of non-aromatic residues for Trp-69 impairs both primer synthesis and delivery. However, the roles of tryptophan at position 97, 147, or 255 remain elusive. To investigate the essential roles of these residues, we replaced each tryptophan with the structurally similar tyrosine and examined the effect of this subtle alteration on primer synthesis. The substitution at position 42, 97, or 147 reduced primer synthesis, whereas substitution at position 69 or 255 did not. The functions of the tryptophans were further examined at each step of primer synthesis. Alteration of residue 42 disturbed the conformation of the ZBD and resulted in partial loss of the zinc ion, impairing binding to the ssDNA template. Replacement of Trp-97 with tyrosine reduced the binding affinity to NTP and the catalysis step. The replacement of Trp-147 with tyrosine also impaired the catalytic step. Therefore, Trp-42 is important in maintaining the conformation of the ZBD for template binding; Trp-97 contributes to NTP binding and the catalysis step; and Trp-147 maintains the catalysis step. PMID:22605336

  1. In vivo studies of the control of DNA synthesis in the rat adrenal cortex and medulla.

    PubMed

    McEwan, P E; Lindop, G B; Kenyon, C J

    1995-01-01

    The control of zonation in the adrenal cortex has been studied by measuring DNA synthesis using an analogue of thymidine, bromodeoxyuridine (BrDUrd). Groups of rats were infused with BrDUrd for 10-14 days whilst being treated with: high or low sodium diets; captopril; angiotensin II; dexamethasone; an inhibitor of nitric oxide synthesis, L-NAME. DNA synthesis in the zona glomerulosa was increased by low sodium food and angiotensin and was decreased by dexamethasone, captopril L-NAME and a high sodium diet. Dexamethasone, not manipulations of the renin-angiotensin system, affected DNA synthesis in the outer zona fasciculata. The BrDUrd index in the zona intermedia was unaffected by any of the treatments and was generally lower than in adjacent zona fasciculata and zona glomerulosa cells. Cells of the zona reticularis appeared to be regulated independent of the zona fasciculata. BrDUrd uptake in nuclei of the adrenal medulla was inversely related to blood pressure. We conclude that DNA synthesis in each adrenocortical zone is independently controlled. Migration of cells within zones after proliferation is likely.

  2. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  3. Synthesis of linear and cyclic peptide-PEG-lipids for stabilization and targeting of cationic liposome-DNA complexes.

    PubMed

    Ewert, Kai K; Kotamraju, Venkata Ramana; Majzoub, Ramsey N; Steffes, Victoria M; Wonder, Emily A; Teesalu, Tambet; Ruoslahti, Erkki; Safinya, Cyrus R

    2016-03-15

    Because nucleic acids (NAs) have immense potential value as therapeutics, the development of safe and effective synthetic NA vectors continues to attract much attention. In vivo applications of NA vectors require stabilized, nanometer-scale particles, but the commonly used approaches of steric stabilization with a polymer coat (e.g., PEGylation; PEG=poly(ethylene glycol)) interfere with attachment to cells, uptake, and endosomal escape. Conjugation of peptides to PEG-lipids can improve cell attachment and uptake for cationic liposome-DNA (CL-DNA) complexes. We present several synthetic approaches to peptide-PEG-lipids and discuss their merits and drawbacks. A lipid-PEG-amine building block served as the common key intermediate in all synthetic routes. Assembling the entire peptide-PEG-lipid by manual solid phase peptide synthesis (employing a lipid-PEG-carboxylic acid) allowed gram-scale synthesis but is mostly applicable to linear peptides connected via their N-terminus. Conjugation via thiol-maleimide or strain-promoted (copper-free) azide-alkyne cycloaddition chemistry is highly amenable to on-demand preparation of peptide-PEG-lipids, and the appropriate PEG-lipid precursors are available in a single chemical step from the lipid-PEG-amine building block. Azide-alkyne cycloaddition is especially suitable for disulfide-bridged peptides such as iRGD (cyclic CRGDKGPDC). Added at 10 mol% of a cationic/neutral lipid mixture, the peptide-PEG-lipids stabilize the size of CL-DNA complexes. They also affect cell attachment and uptake of nanoparticles in a peptide-dependent manner, thereby providing a platform for preparing stabilized, affinity-targeted CL-DNA nanoparticles. PMID:26874401

  4. Antiinflammatory drug effects on ultraviolet light-induced epidermal ornithine decarboxylase and DNA synthesis

    SciTech Connect

    Lowe, N.J.; Breeding, J.

    1980-06-01

    Epidermal ornithine decarboxylase activity is greatly elevated in response to tumor promoting agents and ultraviolet light. The purpose of this paper is to report modification of ultraviolet-induced epidermal ornithine decarboxylase activity by antiinflammatory agents. Topical triamoinolone acetonide and indomethacin were found to significantly inhibit the UV-B induction of epidermal ornithine decarboxylase in hairless mice when applied following ultraviolet light irradiation. The corticosteroid also showed inhibition of ultraviolet light increased epidermal DNA synthesis. Indomethacin failed to show any inhibition of DNA synthesis.

  5. DNA synthesis in periportal and perivenous hepatocytes of intact and hepatectomized young mice.

    PubMed

    Fernández-Blanco, A; Inda, A M; Errecalde, A L

    2015-01-01

    DNA synthesis of hepatocytes in two areas of Intact and Hepatectomized young mice liver along a circadian period was studied. DNA synthesis was significantly different at all analyzed time points in Intact and Hepatectomized animals. Differences between periportal and perivenous hepatocytes were found in hepatectomized animals at 04/42 and 08/46 hr of day/hour post-hepatectomy. DNAs peak in periportal hepatocytes regenerating liver occurs 4 hr earlier than in perivenous hepatocytes, probably reflecting their shorter G1 phase. Besides, daily mean values of regenerating livers were higher than those observed in Intact animals, as a consequence of surgical removal.

  6. Accurate multiplex gene synthesis from programmable DNA microchips

    NASA Astrophysics Data System (ADS)

    Tian, Jingdong; Gong, Hui; Sheng, Nijing; Zhou, Xiaochuan; Gulari, Erdogan; Gao, Xiaolian; Church, George

    2004-12-01

    Testing the many hypotheses from genomics and systems biology experiments demands accurate and cost-effective gene and genome synthesis. Here we describe a microchip-based technology for multiplex gene synthesis. Pools of thousands of `construction' oligonucleotides and tagged complementary `selection' oligonucleotides are synthesized on photo-programmable microfluidic chips, released, amplified and selected by hybridization to reduce synthesis errors ninefold. A one-step polymerase assembly multiplexing reaction assembles these into multiple genes. This technology enabled us to synthesize all 21 genes that encode the proteins of the Escherichia coli 30S ribosomal subunit, and to optimize their translation efficiency in vitro through alteration of codon bias. This is a significant step towards the synthesis of ribosomes in vitro and should have utility for synthetic biology in general.

  7. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  8. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  9. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  10. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  11. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  12. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  13. In vivo measurement of DNA synthesis rates of colon epithelial cells in carcinogenesis

    SciTech Connect

    Kim, Sylvia Jeewon; Turner, Scott; Killion, Salena; Hellerstein, Marc K. . E-mail: march@nature.berkeley.edu

    2005-05-27

    We describe here a highly sensitive technique for measuring DNA synthesis rates of colon epithelial cells in vivo. Male SD rats were given {sup 2}H{sub 2}O (heavy water). Colon epithelial cells were isolated, DNA was extracted, hydrolyzed to deoxyribonucleosides, and the deuterium enrichment of the deoxyribose moiety was determined by gas chromatographic/mass spectrometry. Turnover time of colon crypts and the time for migration of cells from basal to top fraction of the crypts were measured. These data were consistent with cell cycle analysis and bromodeoxyuridine labeling. By giving different concentrations of a promoter, dose-dependent increases in DNA synthesis rates were detected, demonstrating the sensitivity of the method. Administration of a carcinogen increased DNA synthesis rates cell proliferation in all fractions of the crypt. In conclusion, DNA synthesis rates of colon epithelial cells can be measured directly in vivo using stable-isotope labeling. Potential applications in humans include use as a biomarker for cancer chemoprevention studies.

  14. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics.

    PubMed

    Ben Yehezkel, Tuval; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-02-29

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  15. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics.

    PubMed

    Ben Yehezkel, Tuval; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-02-29

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development.

  16. Capture of a third Mg²⁺ is essential for catalyzing DNA synthesis.

    PubMed

    Gao, Yang; Yang, Wei

    2016-06-10

    It is generally assumed that an enzyme-substrate (ES) complex contains all components necessary for catalysis and that conversion to products occurs by rearrangement of atoms, protons, and electrons. However, we find that DNA synthesis does not occur in a fully assembled DNA polymerase-DNA-deoxynucleoside triphosphate complex with two canonical metal ions bound. Using time-resolved x-ray crystallography, we show that the phosphoryltransfer reaction takes place only after the ES complex captures a third divalent cation that is not coordinated by the enzyme. Binding of the third cation is incompatible with the basal ES complex and requires thermal activation of the ES for entry. It is likely that the third cation provides the ultimate boost over the energy barrier to catalysis of DNA synthesis.

  17. Continued DNA synthesis in replication checkpoint mutants leads to fork collapse.

    PubMed

    Sabatinos, Sarah A; Green, Marc D; Forsburg, Susan L

    2012-12-01

    Hydroxyurea (HU) treatment activates the intra-S phase checkpoint proteins Cds1 and Mrc1 to prevent replication fork collapse. We found that prolonged DNA synthesis occurs in cds1Δ and mrc1Δ checkpoint mutants in the presence of HU and continues after release. This is coincident with increased DNA damage measured by phosphorylated histone H2A in whole cells during release. High-resolution live-cell imaging shows that mutants first accumulate extensive replication protein A (RPA) foci, followed by increased Rad52. Both DNA synthesis and RPA accumulation require the MCM helicase. We propose that a replication fork "collapse point" in HU-treated cells describes the point at which accumulated DNA damage and instability at individual forks prevent further replication. After this point, cds1Δ and mrc1Δ forks cannot complete genome replication. These observations establish replication fork collapse as a dynamic process that continues after release from HU block.

  18. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.

  19. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected. PMID:10841936

  20. DNA-mediated silver nanoclusters: synthesis, properties and applications.

    PubMed

    Latorre, Alfonso; Somoza, Álvaro

    2012-05-01

    Fluorescent DNA-AgNCs have emerged as an alternative to standard emitters because of their unique properties: high fluorescent quantum yield, photostability, a broad pallet of colors (blue to near-IR), and the fact that their properties are easily modulated by the DNA sequence and environment. Applications as gene, ion, or small-molecule sensors have been reported. PMID:22508551

  1. Stimulation of DNA and Collagen Synthesis by Autologous Growth Factor in Cultured Fetal Rat Calvaria

    NASA Astrophysics Data System (ADS)

    Canalis, Ernesto; Peck, William A.; Raisz, Lawrence G.

    1980-11-01

    Conditioned medium derived from organ or cell cultures prepared from 19- to 21-day fetal rat calvaria stimulated the incorporation of [3H]proline into collagen and of [3H]thymidine into DNA in organ cultures of the same tissue. Addition of cortisol enhanced the effect on collagen but not on DNA synthesis. These effects appeared to be due to a nondialyzable and heat-stable growth factor.

  2. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  3. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  4. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  5. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  6. Interaction between Escherichia coli DNA polymerase IV and single-stranded DNA-binding protein is required for DNA synthesis on SSB-coated DNA.

    PubMed

    Furukohri, Asako; Nishikawa, Yoshito; Akiyama, Masahiro Tatsumi; Maki, Hisaji

    2012-07-01

    DNA polymerase IV (Pol IV) is one of three translesion polymerases in Escherichia coli. A mass spectrometry study revealed that single-stranded DNA-binding protein (SSB) in lysates prepared from exponentially-growing cells has a strong affinity for column-immobilized Pol IV. We found that purified SSB binds directly to Pol IV in a pull-down assay, whereas SSBΔC8, a mutant protein lacking the C-terminal tail, failed to interact with Pol IV. These results show that the interaction between Pol IV and SSB is mediated by the C-terminal tail of SSB. When polymerase activity was tested on an SSBΔC8-coated template, we observed a strong inhibition of Pol IV activity. Competition experiments using a synthetic peptide containing the amino acid sequence of SSB tail revealed that the chain-elongating capacity of Pol IV was greatly impaired when the interaction between Pol IV and SSB tail was inhibited. These results demonstrate that Pol IV requires the interaction with the C-terminal tail of SSB to replicate DNA efficiently when the template ssDNA is covered with SSB. We speculate that at the primer/template junction, Pol IV interacts with the tail of the nearest SSB tetramer on the template, and that this interaction allows the polymerase to travel along the template while disassembling SSB.

  7. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    PubMed

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  8. Effect of hypolipidemic peroxisome proliferators on unscheduled DNA synthesis in cultured hepatocytes and on mutagenesis in Salmonella.

    PubMed

    Glauert, H P; Reddy, J K; Kennan, W S; Sattler, G L; Rao, V S; Pitot, H C

    1984-09-01

    The peroxisome proliferators Wy-14,643, BR-931, nafenopin and ciprofibrate were tested in the primary hepatocyte culture-unscheduled DNA synthesis assay and in the Ames Salmonella microsome mutagenicity assay. The amount of unscheduled DNA synthesis (UDS) in hepatocytes was determined by quantifying the amount of [3H]thymidine incorporated into DNA in the presence of hydroxyurea after isolation of nuclei from hepatocytes treated with the test agent. Wy-14,643 and BR-931 induced unscheduled DNA synthesis in rat hepatocytes, whereas nafenopin and ciprofibrate had no effect. All of the peroxisome proliferators were negative in the Ames Salmonella assay.

  9. Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5'-flaps.

    PubMed

    Koc, Katrina N; Stodola, Joseph L; Burgers, Peter M; Galletto, Roberto

    2015-04-30

    The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3'-5' exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo(-) to carry out strand displacement synthesis and discovered that it is regulated by the 5'-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5'-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5'-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities.

  10. DNA adsorption to and elution from silica surfaces: influence of amino acid buffers.

    PubMed

    Vandeventer, Peter E; Mejia, Jorge; Nadim, Ali; Johal, Malkiat S; Niemz, Angelika

    2013-09-19

    Solid phase extraction and purification of DNA from complex samples typically requires chaotropic salts that can inhibit downstream polymerase amplification if carried into the elution buffer. Amino acid buffers may serve as a more compatible alternative for modulating the interaction between DNA and silica surfaces. We characterized DNA binding to silica surfaces, facilitated by representative amino acid buffers, and the subsequent elution of DNA from the silica surfaces. Through bulk depletion experiments, we found that more DNA adsorbs to silica particles out of positively compared to negatively charged amino acid buffers. Additionally, the type of the silica surface greatly influences the amount of DNA adsorbed and the final elution yield. Quartz crystal microbalance experiments with dissipation monitoring (QCM-D) revealed multiphasic DNA adsorption out of stronger adsorbing conditions such as arginine, glycine, and glutamine, with DNA more rigidly bound during the early stages of the adsorption process. The DNA film adsorbed out of glutamate was more flexible and uniform throughout the adsorption process. QCM-D characterization of DNA elution from the silica surface indicates an uptake in water mass during the initial stage of DNA elution for the stronger adsorbing conditions, which suggests that for these conditions the DNA film is partly dehydrated during the prior adsorption process. Overall, several positively charged and polar neutral amino acid buffers show promise as an alternative to methods based on chaotropic salts for solid phase DNA extraction.

  11. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  12. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  13. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  14. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  15. Substitutions at Phe61 in the beta3-beta4 hairpin of HIV-1 reverse transcriptase reveal a role for the Fingers subdomain in strand displacement DNA synthesis.

    PubMed

    Fisher, Timothy S; Darden, Tom; Prasad, Vinayaka R

    2003-01-17

    the ability of the side-chain of the amino acid residue at position 61 to stabilize the first base-pair of the DNA duplex to be melted and the degree of strand displacement synthesis. Our results confirm a role for F61 residue in processive synthesis and indicate that the fingers subdomain harbors a structural determinant of strand displacement synthesis by HIV-1 RT.

  16. DNA polymerase κ-dependent DNA synthesis at stalled replication forks is important for CHK1 activation

    PubMed Central

    Bétous, Rémy; Pillaire, Marie-Jeanne; Pierini, Laura; van der Laan, Siem; Recolin, Bénédicte; Ohl-Séguy, Emma; Guo, Caixia; Niimi, Naoko; Grúz, Petr; Nohmi, Takehiko; Friedberg, Errol; Cazaux, Christophe; Maiorano, Domenico; Hoffmann, Jean-Sébastien

    2013-01-01

    Formation of primed single-stranded DNA at stalled replication forks triggers activation of the replication checkpoint signalling cascade resulting in the ATR-mediated phosphorylation of the Chk1 protein kinase, thus preventing genomic instability. By using siRNA-mediated depletion in human cells and immunodepletion and reconstitution experiments in Xenopus egg extracts, we report that the Y-family translesion (TLS) DNA polymerase kappa (Pol κ) contributes to the replication checkpoint response and is required for recovery after replication stress. We found that Pol κ is implicated in the synthesis of short DNA intermediates at stalled forks, facilitating the recruitment of the 9-1-1 checkpoint clamp. Furthermore, we show that Pol κ interacts with the Rad9 subunit of the 9-1-1 complex. Finally, we show that this novel checkpoint function of Pol κ is required for the maintenance of genomic stability and cell proliferation in unstressed human cells. PMID:23799366

  17. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  18. Unscheduled DNA synthesis in human hair follicles after in vitro exposure to 11 chemicals: comparison with unscheduled DNA synthesis in rat hepatocytes.

    PubMed

    van Erp, Y H; Koopmans, M J; Heirbaut, P R; van der Hoeven, J C; Weterings, P J

    1992-06-01

    A new method is described to investigate unscheduled DNA synthesis (UDS) in human tissue after exposure in vitro: the human hair follicle. A histological technique was applied to assess cytotoxicity and UDS in the same hair follicle cells. UDS induction was examined for 11 chemicals and the results were compared with literature findings for UDS in rat hepatocytes. Most chemicals inducing UDS in rat hepatocytes raised DNA repair at comparable concentrations in the hair follicle. However, 1 of 9 chemicals that gave a positive response in the rat hepatocyte UDS test, 2-acetylaminofluorene, failed to induce DNA repair in the hair follicle. Metabolizing potential of hair follicle cells was shown in experiments with indirectly acting compounds, i.e., benzo[a]pyrene, 7,12-dimethylbenz[a]anthracene and dimethylnitrosamine. The results support the conclusion that the test in its present state is valuable as a screening assay for the detection of unscheduled DNA synthesis. Moreover, the use of human tissues may result in a better extrapolation to man.

  19. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    PubMed

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  20. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  1. Synthesis of PCR-derived, single-stranded DNA probes suitable for in situ hybridization.

    PubMed

    Hannon, K; Johnstone, E; Craft, L S; Little, S P; Smith, C K; Heiman, M L; Santerre, R F

    1993-08-01

    We report the novel synthesis of polymerase chain reaction (PCR)-derived single-stranded DNA (ssDNA) probes and their subsequent application in in situ hybridizations. Serial transverse sections of an 11.5-day postcoitum mouse embryo were hybridized to a 33P-ssDNA, 33P-RNA, or 35S-RNA probe corresponding to the same 181-bp sequence in the myogenin cDNA. Signal obtained using 33P-ssDNA was more intense than that using 33P-RNA probe, while signal/noise ratios obtained with both 33P-probes were far superior to those obtained with 35S-probe. Digoxigenin-labeled chicken growth hormone (GH) ssDNA gave slightly more intense signal than did digoxigenin-labeled chicken GH RNA when hybridized to chicken pituitary sections. 32P-ssDNA probes were found to be suitable for Northern blot hybridization. Advantages of using ssDNA probes for in situ hybridization include: (1) The ssDNA technique is rapid and simple. There was no need to clone a DNA template into a special RNA vector or order special T7-containing PCR primers. ssDNA probes can be synthesized in less than 1 day using any primers which currently exist in a laboratory (optimal probe length for in situ hybridization is between 50 and 200 bp). (2) In three separate in situ experiments, ssDNA probes yielded more intense signal than RNA probes. (3) ssDNA probes are potentially more stable than RNA probes. (4) Since the RNAse rinse is eliminated, posthybridization rinses are shortened when hybridizing with ssDNA probes. The ssDNA probes produced by this protocol can be labeled with a variety of different isotopes (both radioactive and nonradioactive), and are excellent probes for use in in situ hybridizations.

  2. Inhibition of Mammalian Target of Rapamycin Complex 1 (mTORC1) Downregulates ELOVL1 Gene Expression and Fatty Acid Synthesis in Goat Fetal Fibroblasts

    PubMed Central

    Wang, Weipeng; He, Qiburi; Guo, Zhixin; Yang, Limin; Bao, Lili; Bao, Wenlei; Zheng, Xu; Wang, Yanfeng; Wang, Zhigang

    2015-01-01

    Elongation of very-long-chain fatty acids 1 (ELOVL1) is a ubiquitously expressed gene that belongs to the ELOVL family and regulates the synthesis of very-long-chain fatty acids (VLCFAs) and sphingolipids, from yeast to mammals. Mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of cell metabolism and is associated with fatty acids synthesis. In this study, we cloned the cDNA that encodes Cashmere goat (Capra hircus) ELOVL1 (GenBank Accession number KF549985) and investigated its expression in 10 tissues. ELOVL1 cDNA was 840 bp, encoding a deduced protein of 279 amino acids, and ELOVL1 mRNA was expressed in a wide range of tissues. Inhibition of mTORC1 by rapamycin decreased ELOVL1 expression and fatty acids synthesis in Cashmere goat fetal fibroblasts. These data show that ELOVL1 expression is regulated by mTORC1 and that mTORC1 has significant function in fatty acids synthesis in Cashmere goat. PMID:26204830

  3. Effects of starvation and hormones on DNA synthesis in silk gland cells of the silkworm, Bombyx mori.

    PubMed

    Li, Yao-Feng; Chen, Xiang-Yun; Zhang, Chun-Dong; Tang, Xiao-Fang; Wang, La; Liu, Tai-Hang; Pan, Min-Hui; Lu, Cheng

    2016-08-01

    Silk gland cells of silkworm larvae undergo multiple cycles of endomitosis for the synthesis of silk proteins during the spinning phase. In this paper, we analyzed the endomitotic DNA synthesis of silk gland cells during larval development, and found that it was a periodic fluctuation, increasing during the vigorous feeding phase and being gradually inhibited in the next molting phase. That means it might be activated by a self-regulating process after molting. The expression levels of cyclin E, cdt1 and pcna were consistent with these developmental changes. Moreover, we further examined whether these changes in endomitotic DNA synthesis resulted from feeding or hormonal stimulation. The results showed that DNA synthesis could be inhibited by starvation and re-activated by re-feeding, and therefore appears to be dependent on nutrition. DNA synthesis was suppressed by in vivo treatment with 20-hydroxyecdysone (20E). However, there was no effect on DNA synthesis by in vitro 20E treatment or by either in vivo or in vitro juvenile hormone treatment. The levels of Akt and 4E-BP phosphorylation in the silk glands were also reduced by starvation and in vivo treatment with 20E. These results indicate that the activation of endomitotic DNA synthesis during the intermolt stages is related to feeding and DNA synthesis is inhibited indirectly by 20E.

  4. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.

    PubMed

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A

    2015-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER.

  5. Assessment of potential damage to DNA in urine of coke oven workers: an assay of unscheduled DNA synthesis.

    PubMed Central

    Roos, F; Renier, A; Ettlinger, J; Iwatsubo, Y; Letourneux, M; Haguenoer, J M; Jaurand, M C; Pairon, J C

    1997-01-01

    OBJECTIVES: A study was conducted in coke oven workers to evaluate the biological consequences of the exposure of these workers, particularly production of potential genotoxic factors. METHODS: 60 coke oven workers and 40 controls were recruited in the same iron and steel works. Exposure to polycyclic aromatic hydrocarbons (PAHs) was assessed by job and measurement of 1-hydroxypyrene (1OHP) in urine samples. An unscheduled DNA synthesis assay was performed on rat pleural mesothelial cells used as a test system to evaluate the effect of the workers' filtered urine on the DNA repair capacity of rat cells to determine whether DNA damaging agents are present in the urine of these workers. RESULTS: Urinary concentrations of 1OHP ranged from 0.06 to 24.2 (mean (SD) 2.1 (3.6)) mumol/mol creatinine in exposed coke oven workers, and from 0.01 to 0.9 in controls (0.12 (0.15)). These high concentrations in coke oven workers reflected recent exposure to PAHs and were in agreement with the assessment of exposure by job. No significant difference was found between coke oven workers and controls in the DNA repair level of rat cells treated with urine samples. However, the rat cell repair capacity decreased with increasing 1OHP concentrations in the exposed population (r = -0.28, P < 0.05). CONCLUSIONS: As high concentrations of 1OHP were found in the urine of some workers, a more stringent control of exposures to PAHs in the workplace is required. Exposure to PAHs was not associated with a clear cut modification of the urinary excretion of DNA damaging factors in this test, as shown by the absence of increased unscheduled DNA synthesis in rat cells. However, impairment of some repair mechanisms by urinary constituents is suspected. PMID:9470892

  6. Protective Effect of Folic Acid on Oxidative DNA Damage

    PubMed Central

    Guo, Xiaojuan; Cui, Huan; Zhang, Haiyang; Guan, Xiaoju; Zhang, Zheng; Jia, Chaonan; Wu, Jia; Yang, Hui; Qiu, Wenting; Zhang, Chuanwu; Yang, Zuopeng; Chen, Zhu; Mao, Guangyun

    2015-01-01

    Abstract Although previous reports have linked DNA damage with both transmissions across generations as well as our own survival, it is unknown how to reverse the lesion. Based on the data from a Randomized, Double-blind, Placebo Controlled Clinical Trial, this study aimed to assess the efficacy of folic acid supplementation (FAS) on DNA oxidative damage reversal. In this randomized clinical trial (RCT), a total of 450 participants were enrolled and randomly assigned to 3 groups to receive folic acid (FA) 0.4 mg/day (low-FA), 0.8 mg/day (high-FA), or placebo (control) for 8 weeks. The urinary 8-hydroxy-2’-deoxyguanosine (8-OHdG) and creatinine (Cr) concentration at pre- and post-FAS were measured with modified enzyme-linked immunosorbent assay (ELISA) and high-performance liquid chromatography (HPLC), respectively. A multivariate general linear model was applied to assess the individual effects of FAS and the joint effects between FAS and hypercholesterolemia on oxidative DNA damage improvement. This clinical trial was registered with ClinicalTrials.gov, number NCT02235948. Of the 438 subjects that received FA fortification or placebo, the median (first quartile, third quartile) of urinary 8-OHdG/Cr for placebo, low-FA, and high-FA groups were 58.19 (43.90, 82.26), 53.51 (38.97, 72.74), 54.73 (39.58, 76.63) ng/mg at baseline and 57.77 (44.35, 81.33), 51.73 (38.20, 71.30), and 50.65 (37.64, 76.17) ng/mg at the 56th day, respectively. A significant decrease of urinary 8-OHdG was observed after 56 days FA fortification (P < 0.001). Compared with the placebo, after adjusting for some potential confounding factors, including the baseline urinary 8-OHdG/Cr, the urinary 8-OHdG/Cr concentration significantly decreased after 56 days FAS [β (95% confidence interval) = −0.88 (−1.62, −0.14) and P = 0.020 for low-FA; and β (95% confidence interval) = −2.68 (−3.42, −1.94) and P < 0.001 for high-FA] in a dose-response fashion (Ptrend

  7. Action of ornithine alpha ketoglutarate on DNA synthesis by human fibroblasts

    SciTech Connect

    Vaubourdolle, M.; Salvucci, M.; Coudray-Lucas, C.; Agneray, J.; Cynober, L.; Ekindjian, O.G. )

    1990-02-01

    Ornithine alpha ketoglutarate (OKG) is largely used in clinical nutrition for its anabolic effects. However, the mechanism of its action remains questionable. We investigated the effect of OKG on the rate of DNA synthesis in human fibroblasts. The in vitro experimental procedure required to demonstrate in cell culture the anabolic effects of OKG observed in vivo was found to be glutamine-free and serum-poor medium with sparse cells. In these conditions, OKG induced a significant increase in ({sup 3}H)thymidine incorporation compared to untreated control cells. This effect was dose-dependent and was observed in all the cultures tested. Taken individually, the two constituents of OKG, i.e. alpha KG and Orn, also showed a stimulatory effect, but did not demonstrate a dose-dependent response. Concomitant analysis of extracellular amino acids showed in alpha KG-treated cultures an increase in glutamate and a decrease in aspartate, suggesting a cellular transamination of alpha KG. Glutamine, which is the preferential energetic substrate of fibroblasts, can be produced from glutamate and might play a role in the action of OKG. Moreover, OKG induced a rise in the cellular polyamine content. This, in association with the inhibitory effect on OKG action of difluoromethylornithine, a specific inhibitor of ornithine decarboxylase, suggests a link between the polyamine biosynthesis pathway and the anabolic effect of OKG.

  8. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173. PMID:15543522

  9. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173.

  10. The effect of vinyl chloride monomer, chloroethylene oxide and chloracetaldehyde on DNA synthesis in regenerating rat liver.

    PubMed

    Border, E A; Webster, I

    1977-05-01

    Vinyl chloride monomer used in the manufacture of polyvinyl chloride is a chemical of increasing industrial importance but has recently been incriminated as a carcinogen, producing a mutagenic effect after being metabolized to active metabolites. The initial effect of vinyl chloride monomer and two of its presumed metabolites, chloracetaldehyde and chloroethylene oxide, on DNA synthesis was investigated in vivo in regenerating rat liver. The established control curve for the DNA synthesis rate after partial hepatectomy demonstrated two waves of synthetic activity at 21 and 30 h. Vinyl chloride, injected intravenously immediately on completion of the operation, depressed the first wave of DNA synthesis by 49.6%. The second peak of DNA synthetic activity was similar to that of the control. Chloracetaldehyde and chloroethylene oxide both produced similar effects on the first wave of DNA synthesis after partial hepatectomy, inhibiting the DNA synthesis rate by approx. 50%. After a regenerating period of 27 h, however, they produced very different effects, chloroethylene oxide raising the control DNA synthesis rate at 30 h by 49% while chloracetaldehyde tended to desynchronize the well-defined second peak of the control. The test compounds have been compared to literature reports of the inhibitory effects of various carcinogens on DNA synthesis.

  11. [Pseudo-furocoumarin: synthesis, DNA-binding behavior and cytotoxicity].

    PubMed

    Xie, Li-Juan; Chen, Zhuo

    2014-11-01

    Furocoumarin shows some antitumor activity when it is radiated by the UV light. In order to improve the antitumor activity of furocoumarin under standard environment conditions, the "minimal DNA-intercalating" hypothesis was firstly introduced to the structural modification of furocoumarin, which resulted in the design of pseudo-furocoumarin. The pseudo-furocoumarin was synthesized by two-step reaction including Pechmann reaction catalyzed by conc. H2SO4 and Suzuki coupling reaction catalyzed by Pd(PPh3)4. The structural character of the pseudo-furocoumarin is that the bonding mode of furan ring fused to the coumarin is replaced by a chemical single bond between furan ring and coumarin. The interaction of the pseudo-furocoumarin with calf thymus DNA (CT-DNA) has been respectively investigated by using DNA melting curve, UV-Vis absorption spectra, fluorescence spectra and viscosity titration, and the modes of DNA-binding for the pseudo-furocoumarin have been proposed. Based on the results of DNA melting curve, spectra and viscosity titration, it was suggested that 5a and 5b bind to DNA by the partial intercalation and classical intercalation, respectively. The DNA-binding behaviors of 5c and 5d have been rarely reported in literature and may be interpreted in terms of bridge-structure. All target compounds, except 5b, show a decreasing capability of intercalation to DNA. Further, the antiproliferative activities of the pseudo-furocoumarin on human lung adenocarcinoma (A549), human breast cancer (MCF-7) and human ovarian carcinoma cell line (SKOV-3) in vitro were evaluated using the sulforhodamine B (SRB) protein statin assay. All pseudo-furocoumarin exhibited an improved anti-proliferative activity as compared with the control compound psoralen (PS, a linear furocoumarin). Interestingly the pseudo-furocoumarin binding to DNA by a non-classical intercalation mode showed a stronger anti-proliferative activity than PS. The present study extended the applied areas of

  12. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  13. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  14. Some Characteristics of DNA Synthesis and the Mitotic Cycle in Ehrlich Ascites Tumor Cells

    PubMed Central

    Edwards, Joshua L.; Koch, Arthur L.; Youcis, Pauline; Freese, Herbert L.; Laite, Melville B.; Donalson, J. Thomas

    1960-01-01

    In vivo studies of Ehrlich ascites tumor cells during the first 5 days of growth in peritoneal cavities of mice consisted of the following: 1. Determination of growth curves by direct enumeration of cells. 2. Estimation of the duration of each phase of the mitotic cycle based on incidence of cells in different phases. 3. Radioautographic studies to determine the proportion of cells in different phases of the mitotic cycle that incorporate tritiated thymidine during a single brief exposure to this precursor of DNA. 4. Estimation of the rate of incorporation of tritiated thymidine at different times during the period of DNA synthesis by comparison of mean grain counts over nuclei in radioautographs at different times following exposure to tritiated thymidine. The assumptions underlying these experiments and our observations concerning the duration of the period of DNA synthesis and its relation to the mitotic cycle are discussed. It is concluded that DNA synthesis is continuous, occupying a period of 8.5 hours during the interphase and that the average rate of synthesis is approximately constant. PMID:13819420

  15. Design, synthesis, and characterization of nucleosomes containing site-specific DNA damage.

    PubMed

    Taylor, John-Stephen

    2015-12-01

    How DNA damaged is formed, recognized, and repaired in chromatin is an area of intense study. To better understand the structure activity relationships of damaged chromatin, mono and dinucleosomes containing site-specific damage have been prepared and studied. This review will focus on the design, synthesis, and characterization of model systems of damaged chromatin for structural, physical, and enzymatic studies.

  16. Effect of hypertonicity and X radiation on DNA synthesis in normal and ataxia-telangiectasia cells

    SciTech Connect

    Painter, R.B.; Young, B.R.

    1982-12-01

    Normal human cells and cells from patients with ataxia-telangiectasia (A-T) were exposed to culture medium made hypertonic by raising the NaCl concentration. The rate of DNA synthesis in both types of cells was depressed as a function of increasing hypertonicity. When cells of both types were exposed to X radiation and incubated in hypertonic medium, DNA synthesis appeared to be more radioresistant than in cells incubated in normal medium. Velocity sedimentation analysis showed that this was due to a hypertonicity-induced inhibition of replicon initiation, which is the same process affected by X radiation, indicating that the two treatments were not additive. After a 5-hr incubation in hypertonic medium, there was a new steady state of replicon initiation and elongation similar to that existing in cells grown in normal medium, except that fewer replicons were participating. At this time DNA synthesis in each type of cell had a characteristic response to radiation, i.e., radiosenstivie in normal cells and radioresistant in A-T cells. These results suggest that radioresistant DNA synthesis in A-T cells is not due to increased condensation of chromatin.

  17. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  18. PLASMID DNA DAMAGE CAUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN

    EPA Science Inventory

    PLASMID DNA DAMAGE CAOUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN

    ABSTRACT

    Both dimethylarsinic acid (DMA(V)) and dimethylarsinous acid (DMA(III)) release iron from human liver ferritin (HLF) with or without the presence of ascorbic acid. ...

  19. DNA Before Proteins? Recent Discoveries in Nucleic Acid Catalysis Strengthen the Case

    NASA Astrophysics Data System (ADS)

    Burton, Aaron S.; Lehman, Niles

    2009-02-01

    An RNA-DNA World could arise from an all-RNA system with the development of as few as three ribozymes -- a DNA-dependent RNA polymerase, an RNA-dependent DNA polymerase, and a catalyst for the production of DNA nucleotides. A significant objection to DNA preceding proteins is that RNA has not been shown to catalyze the production of DNA. However, RNA- and DNAzymes have been recently discovered that catalyze chemical reactions capable of forming deoxyribose, such as mixed aldol condensation of 5'-glyceryl- and 3'-glycoaldehyde-terminated DNA strands. Thus, the only remaining obstacles to RNA-catalyzed in vitro DNA synthesis are alterations of substrate and template specificities of known ribozymes. The RNA-DNA World lessens genomic size constraints through a relaxed error threshold, affording the evolutionary time needed to develop protein synthesis. Separation of information from catalyst enables genotype and phenotype to be readily discriminated by absence or presence, respectively, of the 2'-OH. Novel ribozymes that arise through mutation can be preserved in DNA by reverse transcription, which makes them much more likely to be retained than in an RNA-genome milieu. The extra degree of separation between protein and mRNA, in terms of identifying and then retaining a useful enzyme, may have in fact necessitated storing information in DNA prior to the advent of translation.

  20. Synthesis of amino-rich silica-coated magnetic nanoparticles for the efficient capture of DNA for PCR.

    PubMed

    Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming

    2016-09-01

    Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR. PMID:27187190

  1. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  2. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  3. DNA-directed in vitro synthesis of proteins involved in bacterial transcription and translation.

    PubMed Central

    Zarucki-Schulz, T; Jerez, C; Goldberg, G; Kung, H F; Huang, K H; Brot, N; Weissbach, H

    1979-01-01

    The in vitro synthesis of elongation factor (EF)-Tu (tufB), the beta beta' subunits of RNA polymerase, ribosomal proteins L10 and L12 directed by DNA from the transducing phage lambda rifd 18, EF-Tu (tufA), EF-G, and the alpha subunit of RNA polymerase directed by DNA from the transducing phage lambda fus3 has been investigated in a crude and a partially defined protein-synthesizing system. Proteins L10 and L12 are synthesized in the partially defined system almost as well as in the crude system. However, the synthesis of EF-Tu, EF-G, and the alpha and beta beta' subunits of RNA polymerase is far less efficient in the partially defined system. An active fraction that stimulates the synthesis of these latter proteins has been obtained by fractionation of a high-speed supernatant on DEAE-cellulose. Because previous studies showed that this fraction (1 M DEAE salt eluate) contains a protein, called L factor, that stimulates beta-galactosidase synthesis in vitro, L factor was tested for activity. Although L factor stimulates the synthesis of the beta beta' subunits, it has little or no effect on the in vitro synthesis of the other products studied. In the present experiments, the ratio of L12/L10 and of EF-Tu (tufA)/EF-G formed is 4-6. These values are consistent with in vivo results. Images PMID:160561

  4. Alternative solutions and new scenarios for translesion DNA synthesis by human PrimPol.

    PubMed

    Martínez-Jiménez, María I; García-Gómez, Sara; Bebenek, Katarzyna; Sastre-Moreno, Guillermo; Calvo, Patricia A; Díaz-Talavera, Alberto; Kunkel, Thomas A; Blanco, Luis

    2015-05-01

    PrimPol is a recently described DNA polymerase that has the virtue of initiating DNA synthesis. In addition of being a sensu stricto DNA primase, PrimPol's polymerase activity has a large capacity to tolerate different kind of lesions. The different strategies used by PrimPol for DNA damage tolerance are based on its capacity to "read" certain lesions, to skip unreadable lesions, and as an ultimate solution, to restart DNA synthesis beyond the lesion thus acting as a TLS primase. This lesion bypass potential, revised in this article, is strengthened by the preferential use of moderate concentrations of manganese ions as the preferred metal activator. We show here that PrimPol is able to extend RNA primers with ribonucleotides, even when bypassing 8oxoG lesions, suggesting a potential new scenario for PrimPol as a TLS polymerase assisting transcription. We also show that PrimPol displays a high degree of versatility to accept or induce distortions of both primer and template strands, creating alternative alignments based on microhomology that would serve to skip unreadable lesions and to connect separate strands. In good agreement, PrimPol is highly prone to generate indels at short nucleotide repeats. Finally, an evolutionary view of the relationship between translesion synthesis and primase functions is briefly discussed.

  5. Microinjected pBR322 stimulates cellular DNA synthesis in Swiss 3T3 cells.

    PubMed Central

    Hyland, J K; Hirschhorn, R R; Avignolo, C; Mercer, W E; Ohta, M; Galanti, N; Jonak, G J; Baserga, R

    1984-01-01

    When pBR322 is manually microinjected into the nuclei of quiescent Swiss 3T3 cells it stimulates the incorporation of [3H]thymidine into DNA. The evidence clearly shows that this increased incorporation that is detected by in situ autoradiography in microinjected cells represents cellular DNA synthesis and not DNA repair or plasmid replication. The effect is due to pBR322 and not due to impurities, mechanical perturbances due to the microinjection technique, or aspecific effects. This stimulation is striking in Swiss 3T3 cells. Some NIH 3T3 cells show a slight stimulation, but hamster cells, derived from baby hamster kidney (BHK) cells, are not stimulated when microinjected with pBR322. The preliminary evidence seems to indicate that the integrity of the pBR322 genome is important for the stimulation of cellular DNA synthesis in quiescent Swiss 3T3 cells. These results, although of a preliminary nature, are of interest because they indicate that a prokaryotic genome may alter the cell cycle of mammalian cells. From a practical point of view the stimulatory effect of microinjected pBR322 on cellular DNA synthesis has a more immediate interest, because pBR322 is the vector most commonly used for molecular cloning and 3T3 cells are very frequently used for gene transfer experiments. Images PMID:6582497

  6. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  7. Structural specificity of steroids in stimulating DNA synthesis and protooncogene expression in primary rat hepatocyte cultures.

    PubMed

    Lee, C H; Edwards, A M

    2002-05-01

    Among the chemical compounds of varied structure which possess liver tumour-promoting are steroids, such as estrogens, pregnenolone derivatives and anabolic steroids. Although the mechanism(s) of tumour promotion in liver by these xenobiotics is not well understood, it is clear that growth stimulation is one important element in their action. As a basis for better defining whether steroids stimulate growth by a common mechanism or fall into sub-groups with differing actions, the effects of 46 steroids on DNA synthesis and the expression of protooncogenes c-fos and c-myc were examined in primary cultures of normal rat hepatocytes. Tentative groupings of steroids have been identified based on apparent structural requirements for stimulation of DNA synthesis, and effects of auxiliary factors in modulating this growth stimulus. For a "progestin" group, insulin appeared to be permissive for stimulation of DNA synthesis, and presence of an ester or hydroxyl group at 17alpha-position in combination with a non-polar group at C(6) appeared to be required for stimulation. For the pregnenes, dexamethasone was stimulatory. Structural requirements include a non-polar substitution at 16alpha-position and presence of a 6alpha-methyl group. Androgens were weak or ineffective stimulators of DNA synthesis. Anabolic steroids were weak to strong stimulators and alteration to A ring structure in combination with non-polar substitution at 17alpha-position appeared to be required for the activity. With the exception of the anabolic steroid, dianabol, there do not appear to be strong correlation between ability to stimulate DNA synthesis and ability to induce protooncogene expression among the steroids. This study provides a starting point for future more detailed examination of growth-stimulatory mechanism(s) of action of steroids in the liver. PMID:12127039

  8. Site Specific Synthesis and in-situ Immobilization of Fluorescent Silver Nanoclusters on DNA Nanoscaffolds Using Tollens Reaction

    SciTech Connect

    Pal, Suchetan; Varghese, R.; Deng, Z.; Zhao, Z.; Kumar, A.; Yan, Hao; Liu, Yan

    2011-04-06

    DNA strands with specific sequences and covalently attached sugar moieties were used for the site-specific incorporation of the sugar units on a DNA origami scaffold. This approach enabled the subsequent site-specific synthesis and in situ immobilization of fluorescent Ag clusters at predefined positions on the DNA nanoscaffold by treatment with the Tollens reagent.

  9. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    PubMed

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction. PMID:26815240

  10. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    PubMed

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction.

  11. L-arginine improves DNA synthesis in LPS-challenged enterocytes.

    PubMed

    Tan, Bi'e; Xiao, Hao; Xiong, Xia; Wang, Jing; Li, Guangran; Yin, Yulong; Huang, Bo; Hou, Yongqing; Wu, Guoyao

    2015-01-01

    The neonatal small intestine is susceptible to damage by endotoxin, and this cytotoxicity may involve intracellular generation of reactive oxygen species (ROS), resulting in DNA damage and mitochondrial dysfunction. L-Arginine (Arg) confers a cytoprotective effect on lipopolysaccharide (LPS)-treated enterocytes through activation of the mammalian target of the rapamycin (mTOR) signaling pathway. Arg improves DNA synthesis and mitochondrial bioenergetics, which may also be responsible for beneficial effects of Arg on intestinal mucosal cells. In support of this notion, results of recent studies indicate that elevated Arg concentrations enhances DNA synthesis, cell-cycle progression, and mitochondrial bioenergetics in LPS-treated intestinal epithelial cells through mechanisms involving activation of the PI3K-Akt pathway. These findings provide a biochemical basis for dietary Arg supplementation to improve the regeneration and repair of the small-intestinal mucosa in both animals and humans.

  12. Inhibition of DNA methylation by caffeic acid and chlorogenic acid, two common catechol-containing coffee polyphenols.

    PubMed

    Lee, Won Jun; Zhu, Bao Ting

    2006-02-01

    We studied the modulating effects of caffeic acid and chlorogenic acid (two common coffee polyphenols) on the in vitro methylation of synthetic DNA substrates and also on the methylation status of the promoter region of a representative gene in two human cancer cells lines. Under conditions that were suitable for the in vitro enzymatic methylation of DNA and dietary catechols, we found that the presence of caffeic acid or chlorogenic acid inhibited in a concentration-dependent manner the DNA methylation catalyzed by prokaryotic M.SssI DNA methyltransferase (DNMT) and human DNMT1. The IC50 values of caffeic acid and chlorogenic acid were 3.0 and 0.75 microM, respectively, for the inhibition of M.SssI DNMT-mediated DNA methylation, and were 2.3 and 0.9 microM, respectively, for the inhibition of human DNMT1-mediated DNA methylation. The maximal in vitro inhibition of DNA methylation was approximately 80% when the highest concentration (20 microM) of caffeic acid or chlorogenic acid was tested. Kinetic analyses showed that DNA methylation catalyzed by M.SssI DNMT or human DNMT1 followed the Michaelis-Menten curve patterns. The presence of caffeic acid or chlorogenic acid inhibited DNA methylation predominantly through a non-competitive mechanism, and this inhibition was largely due to the increased formation of S-adenosyl-L-homocysteine (SAH, a potent inhibitor of DNA methylation), resulting from the catechol-O-methyltransferase (COMT)-mediated O-methylation of these dietary catechols. Using cultured MCF-7 and MAD-MB-231 human breast cancer cells, we also demonstrated that treatment of these cells with caffeic acid or chlorogenic acid partially inhibited the methylation of the promoter region of the RARbeta gene. The findings of our present study provide a general mechanistic basis for the notion that a variety of dietary catechols can function as inhibitors of DNA methylation through increased formation of SAH during the COMT-mediated O-methylation of these dietary

  13. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    SciTech Connect

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  14. Wheat DNA Primase (RNA Primer Synthesis in Vitro, Structural Studies by Photochemical Cross-Linking, and Modulation of Primase Activity by DNA Polymerases).

    PubMed Central

    Laquel, P.; Litvak, S.; Castroviejo, M.

    1994-01-01

    DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187

  15. Nucleocapsid Protein Annealing of a Primer-Template Enhances (+)-Strand DNA Synthesis and Fidelity by HIV-1 Reverse Transcriptase†

    PubMed Central

    Kim, Jiae; Roberts, Anne; Yuan, Hua; Xiong, Yong; Anderson, Karen S.

    2012-01-01

    Human immunodeficiency virus type-1 (HIV-1) requires reverse transcriptase (RT) and HIV-1 nucleocapsid protein (NCp7) for proper viral replication. HIV-1 NCp7 has been shown to enhance various steps in reverse transcription including tRNA initiation and strand transfer which may be mediated through interactions with RT as well as RNA and DNA oligonucleotides. With the use of DNA oligonucleotides, we have examined the interaction of NCp7 with RT and the kinetics of reverse transcription during (+)-strand synthesis with an NCp7-facilitated annealed primer-template. Using a pre-steady state kinetics approach, the NCp7-annealed primer-template has a substantial increase (3-7 fold) in the rate of incorporation (kpol) by RT as compared to heat annealed primer-template with single nucleotide incorporation. There was also a 2-fold increase in the binding affinity constant (Kd) of the nucleotide. These differences in kpol and Kd were not through direct interactions between HIV-1 RT and NCp7. When examining extension by RT, the data suggests that the NCp7-annealed primer-template facilitates the formation of a longer product more quickly compared to the heat annealed primer-template. This enhancement in rate is mediated through interactions with NCp7’s zinc fingers and N-terminal domain and nucleic acids. The NCp7-annealed primer-template also enhances the fidelity of RT (3-fold) by slowing the rate of incorporation of an incorrect nucleotide. Taken together, this study elucidates a new role of NCp7 by facilitating DNA-directed DNA synthesis during reverse transcription by HIV-1 RT that may translate into enhanced viral fitness and offers an avenue to exploit for targeted therapeutic intervention against HIV. PMID:22210155

  16. Design and Synthesis of Triangulated DNA Origami Trusses.

    PubMed

    Matthies, Michael; Agarwal, Nayan P; Schmidt, Thorsten L

    2016-03-01

    DNA nanotechnology offers unique control over matter on the nanoscale. Here, we extend the DNA origami method to cover a range of wireframe truss structures composed of equilateral triangles, which use less material per volume than standard multiple-helix bundles. From a flat truss design, we folded tetrahedral, octahedral, or irregular dodecahedral trusses by exchanging few connector strands. Other than standard origami designs, the trusses can be folded in low-salt buffers that make them compatible with cell culture buffers. The structures also have defined cavities that may in the future be used to precisely position functional elements such as metallic nanoparticles or enzymes. Our graph routing program and a simple design pipeline will enable other laboratories to make use of this valuable and potent new construction principle for DNA-based nanoengineering.

  17. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  18. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  19. Further purification and characterization of a multienzyme complex for DNA synthesis in human cells.

    PubMed

    Li, C; Cao, L G; Wang, Y L; Baril, E F

    1993-12-01

    The 21 S complex of enzymes for DNA synthesis in the combined low salt nuclear extract-post microsomal supernatant from HeLa cells [Malkas et al. (1990) Biochemistry 29:6362-6374] was purified by poly (ethylene glycol) precipitation, Q-Sepharose chromatography, Mono Q Fast Protein Liquid Chromatography (FPLC), and velocity gradient centrifugation. The procedure gives purified enzyme complex at a yield of 45%. The 21 S enzyme complex remains intact and functional in the replication of simian virus 40 DNA throughout the purification. Sedimentation analysis showed that the 21 S enzyme complex exists in the crude HeLa cell extract and that simian virus 40 in vitro DNA replication activity in the cell extract resides exclusively with the 21 S complex. The results of enzyme and immunological analysis indicate that DNA polymerase alpha-primase, a 3',5' exonuclease, DNA ligase I, RNase H, and topoisomerase I are associated with the purified enzyme complex. Denaturing polyacrylamide gel electrophoresis of the purified enzyme complex showed the presence of about 30 polypeptides in the size range of 300 to 15 kDa. Immunofluorescent imaging analysis, with antibodies to DNA polymerase alpha,beta and DNA ligase I, showed that polymerase alpha and DNA ligase I are localized to granular-like foci within the nucleus during S-phase. In contrast, DNA polymerase beta, which is not associated with the 21 S complex, is diffusely distributed throughout the nucleoplasm. PMID:8300757

  20. Amplified and multiplexed detection of DNA using the dendritic rolling circle amplified synthesis of DNAzyme reporter units.

    PubMed

    Wang, Fuan; Lu, Chun-Hua; Liu, Xiaoqing; Freage, Lina; Willner, Itamar

    2014-02-01

    The amplified, highly sensitive detection of DNA using the dendritic rolling circle amplification (RCA) is introduced. The analytical platform includes a circular DNA and a structurally tailored hairpin structure. The circular nucleic acid template includes a recognition sequence for the analyte DNA (the Tay-Sachs mutant gene), a complementary sequence to the Mg(2+)-dependent DNAzyme, and a sequence identical to the loop region of the coadded hairpin structure. The functional hairpin in the system consists of the analyte-sequence that is caged in the stem region and a single-stranded loop domain that communicates with the RCA product. The analyte activates the RCA process, leading to DNA chains consisting of the Mg(2+)-dependent DNAzyme and sequences that are complementary to the loop of the functional hairpin structure. Opening of the coadded hairpin releases the caged analyte sequence, resulting in the dendritic RCA-induced synthesis of the Mg(2+)-dependent DNAzyme units. The DNAzyme-catalyzed cleavage of a fluorophore/quencher-modified substrate leads to a fluorescence readout signal. The method enabled the analysis of the target DNA with a detection limit corresponding to 1 aM. By the design of two different circular DNAs that include recognition sites for two different target genes, complementary sequences for two different Mg(2+)-dependent DNAzyme sequences and two different functional hairpin structures, the dendritic RCA-stimulated multiplexed analysis of two different genes is demonstrated. The amplified dendritic RCA detection of DNA is further implemented to yield the hemin/G-quadruplex horseradish peroxidase (HRP)-mimicking DNAzyme as catalytic labels that provide colorimetric or chemiluminescent readout signals.

  1. Molecular beacons: a novel DNA probe for nucleic acid and protein studies.

    PubMed

    Tan, W; Fang, X; Li, J; Liu, X

    2000-04-01

    A new concept has been introduced for molecular beacon DNA molecules. Molecular beacons are a new class of oligonucleotides that can report the presence of specific nucleic acids in both homogeneous solutions and at the liquid-solid interface. They emit an intense fluorescent signal only when hybridized to their target DNA or RNA molecules. Biotinylated molecular beacons have been designed and used for the development of ultrasensitive DNA sensors and for DNA molecular interaction studies at a solid-liquid interface. Molecular beacons have also been used to study protein-DNA interactions. They have provided a variety of exciting opportunities in DNA/RNA/protein studies.

  2. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  3. Chimeric RNA-DNA molecular beacons for quantification of nucleic acids, single nucleotide polymophisms, and nucleic acid damage.

    PubMed

    El-Yazbi, Amira F; Loppnow, Glen R

    2013-05-01

    Single nucleotide polymorphisms (SNPs) are the main cause for variations in the human genome. DNA lesions, such as cyclobutane pyrimidine dimers (CPDs), [6-4] pyrimidine-pyrimidinones, dewar pyrimidinones, and photohydrates, can subsequently lead to mutagenesis, carcinogenesis, and cell death. Much effort has focused on methods for detecting DNA, SNPs, or damaged nucleic acids. However, almost all of the proposed methods consist of multistep procedures, are limited to specific types of damage, some of these methods require expensive instruments, and some suffer from a high level of interferences. In this paper, we present a novel, simple, mix-and-read assay for the detection of nucleic acids that is general for all types of SNPs and nucleic acid damage. This method uses a chimeric RNA-DNA molecular beacon (chMB). The calibration curve of the chMB for detecting single base mismatch and ultraviolet (UV)-induced DNA damage shows good linearity (R(2) = 0.981 and 0.996, respectively) and limits of detection of 10.4 ± 2.2 and 8.64 ± 1.2 nM, respectively. The chimeric RNA-DNA MB proves to be a more sensitive and selective tool for the quantification of nucleic acids, DNA mismatches, and UV-induced DNA damage than DNA MBs.

  4. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  5. Synthesis of base-modified 2'-deoxyribonucleoside triphosphates and their use in enzymatic synthesis of modified DNA for applications in bioanalysis and chemical biology.

    PubMed

    Hocek, Michal

    2014-11-01

    The synthesis of 2'-deoxyribonucleoside triphosphates (dNTPs) either by classical triphosphorylation of nucleosides or by aqueous cross-coupling reactions of halogenated dNTPs is discussed. Different enzymatic methods for synthesis of modified oligonucleotides and DNA by polymerase incorporation of modified nucleotides are summarized, and the applications in redox or fluorescent labeling, as well as in bioconjugations and modulation of interactions of DNA with proteins, are outlined.

  6. Synthesis of DNA Oligodeoxynucleotides Containing Site-Specific 1,3-Butadiene- Deoxyadenosine Lesions

    PubMed Central

    Wickramaratne, Susith; Seiler, Christopher L.

    2016-01-01

    Post-oligomerization synthesis is a useful technique for preparing site-specifically modified DNA oligomers. This approach involves site-specific incorporation of inherently reactive halogenated nucleobases into DNA strands using standard solid phase synthesis, followed by post-oligomerization nucleophilic aromatic substitution (SNAr) reactions with carcinogen-derived synthons. In these reactions, the inherent reactivities of DNA and carcinogen-derived species are reversed: the modified DNA nucleobase acts as an electrophile, while the carcinogen-derived species acts as a nucleophile. In the present protocol, we describe the use of the post-oligomerization approach to prepare DNA strands containing site- and stereospecific N6-adenine and N1, N6-adenine adducts induced by epoxide metabolites of the known human and animal carcinogen, 1,3-butadiene (BD). The resulting oligomers containing site specific, structurally defined DNA adducts can be used in structural and biological studies to reveal the roles of specific BD adducts in carcinogenesis and mutagenesis. PMID:26344227

  7. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization.

  8. Synthesis and Characterization of DNA Minor Groove Binding Alkylating Agents

    PubMed Central

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K.; Mascara, Gerard P.; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W.; Bobola, Michael S.; Silber, John R.; Gold, Barry

    2012-01-01

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases the N-terminus was appended with a O-methyl sulfonate ester while the C-terminus group was varied with non-polar and polar sidechains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) vs. major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is > 10-fold higher than the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells over-expressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  9. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  10. Structural Basis of High-Fidelity DNA Synthesis by Yeast DNA Polymerase δ

    SciTech Connect

    Swan, M.; Johnson, R; Prakash, L; Prakash, S; Aggarwal, A

    2009-01-01

    DNA polymerase ? (Pol ?) has a crucial role in eukaryotic replication. Now the crystal structure of the yeast DNA Pol ? catalytic subunit in complex with template primer and incoming nucleotide is presented at 2.0-A resolution, providing insight into its high fidelity and a framework to understand the effects of mutations involved in tumorigenesis.

  11. Pyrosequencing for the quantitative assessment of 8-oxodG bypass DNA synthesis.

    PubMed

    Nachtergael, Amandine; Belayew, Alexandra; Duez, Pierre

    2014-10-01

    Translesion synthesis (TLS) with specialized DNA polymerases allows dealing with a base lesion on the template strand during DNA replication; a base is inserted opposite the lesion, correctly or incorrectly, depending on the lesion, the involved DNA polymerase(s) and the sequence context. The major oxidized DNA base 8-oxo-7, 8-dihydro-2'-deoxyguanosine (8-oxodG) is highly mutagenic due to its ability to pair with either cytosine or adenine during DNA synthesis, depending on its conformation and involved DNA polymerases. To measure the correct or mutagenic outcome of lesion bypass, an original quantitative pyrosequencing method was developed and analytically validated. The method was applied to the study of DNA synthesis fidelity through an 8-oxodG or an undamaged guanine. After an in vitro primer-extension through 8-oxodG in the presence of the four deoxynucleotides triphosphates and a total nuclear protein extract, obtained from normal human intestinal epithelial cells (FHs 74 Int cell line), the reaction products were amplified by polymerase chain reaction and analyzed by pyrosequencing to measure nucleotides inserted opposite the lesion. The 8-oxodG bypass fidelity of FHs 74 Int cells nuclear extract is about 85.3%. We calculated within-day and total precisions for both 8-oxodG (2.8% and 2.8%, respectively) and undamaged templates (1.0% and 1.1%, respectively). We also demonstrated that only cytosine is incorporated opposite a normal guanine and that both cytosine and adenine can be incorporated opposite an 8-oxodG lesion. The proposed method is straightforward, fast, reproducible and easily adaptable to other sequences and lesions. It thus has a wide range of applications in the biological field, notably to elucidate TLS mechanisms and modulators. PMID:25200840

  12. An improved method of gene synthesis based on DNA works software and overlap extension PCR.

    PubMed

    Dong, Bingxue; Mao, Runqian; Li, Baojian; Liu, Qiuyun; Xu, Peilin; Li, Gang

    2007-11-01

    A bottleneck in recent gene synthesis technologies is the high cost of oligonucleotide synthesis and post-synthesis sequencing. In this article, a simple and rapid method for low-cost gene synthesis technology was developed based on DNAWorks program and an improved single-step overlap extension PCR (OE-PCR). This method enables any DNA sequence to be synthesized with few errors, then any mutated sites could be corrected by site-specific mutagenesis technology or PCR amplification-assembly method, which can amplify different DNA fragments of target gene followed by assembly into an entire gene through their overlapped region. Eventually, full-length DNA sequence without error was obtained via this novel method. Our method is simple, rapid and low-cost, and also easily amenable to automation based on a DNAWorks design program and defined set of OE-PCR reaction conditions suitable for different genes. Using this method, several genes including Manganese peroxidase gene (Mnp) of Phanerochaete chrysosporium (P. chrysosporium), Laccase gene (Lac) of Trametes versicolor (T. versicolor) and Cip1 peroxidase gene (cip 1) of Coprinus cinereus (C. cinereus) with sizes ranging from 1.0 kb to 1.5 kb have been synthesized successfully.

  13. Antibacterial activity and inhibition of protein synthesis in Escherichia coli by antisense DNA analogs.

    PubMed

    Rahman, M A; Summerton, J; Foster, E; Cunningham, K; Stirchak, E; Weller, D; Schaup, H W

    1991-01-01

    Protein synthesis, which takes place within ribosomes, is essential for the survival of any living organism. Ribosomes are composed of both proteins and RNA. Specific interaction between the 3' end CCUCC sequence of prokaryotic 16S rRNA and a partially complementary sequence preceding the initiating codon of mRNA is believed to be a prerequisite for initiation of protein synthesis. Here we report the use of short (three to six nucleotides) synthetic DNA analogs complementary to this sequence to block protein synthesis in vitro and in vivo in Escherichia coli. In the DNA analogs the normal phosphodiester bond in the antisense DNA was replaced by methylcarbamate internucleoside linkages to enhance transport across plasma membranes. Of the analogs tested, those with the sequence AGG and GGA inhibit protein synthesis and colony formation by E. coli strains lacking an outer cell wall. Polyethylene glycol 1000 (PEG 1000) was attached to the 5' end of some of the test methylcarbamate DNAs to enhance solubility. Analogs of AGG and GGAG with PEG 1000 attached inhibited colony formation in normal E. coli. These analogs may be useful food additives to control bacterial spoilage and biomedically as antibiotics. PMID:1821653

  14. Human liver apolipoprotein B-100 cDNA: complete nucleic acid and derived amino acid sequence.

    PubMed Central

    Law, S W; Grant, S M; Higuchi, K; Hospattankar, A; Lackner, K; Lee, N; Brewer, H B

    1986-01-01

    Human apolipoprotein B-100 (apoB-100), the ligand on low density lipoproteins that interacts with the low density lipoprotein receptor and initiates receptor-mediated endocytosis and low density lipoprotein catabolism, has been cloned, and the complete nucleic acid and derived amino acid sequences have been determined. ApoB-100 cDNAs were isolated from normal human liver cDNA libraries utilizing immunoscreening as well as filter hybridization with radiolabeled apoB-100 oligodeoxynucleotides. The apoB-100 mRNA is 14.1 kilobases long encoding a mature apoB-100 protein of 4536 amino acids with a calculated amino acid molecular weight of 512,723. ApoB-100 contains 20 potential glycosylation sites, and 12 of a total of 25 cysteine residues are located in the amino-terminal region of the apolipoprotein providing a potential globular structure of the amino terminus of the protein. ApoB-100 contains relatively few regions of amphipathic helices, but compared to other human apolipoproteins it is enriched in beta-structure. The delineation of the entire human apoB-100 sequence will now permit a detailed analysis of the conformation of the protein, the low density lipoprotein receptor binding domain(s), and the structural relationship between apoB-100 and apoB-48 and will provide the basis for the study of genetic defects in apoB-100 in patients with dyslipoproteinemias. PMID:3464946

  15. Protein Synthesis with Ribosomes Selected for the Incorporation of β-Amino Acids.

    PubMed

    Maini, Rumit; Chowdhury, Sandipan Roy; Dedkova, Larisa M; Roy, Basab; Daskalova, Sasha M; Paul, Rakesh; Chen, Shengxi; Hecht, Sidney M

    2015-06-16

    In an earlier study, β³-puromycin was used for the selection of modified ribosomes, which were utilized for the incorporation of five different β-amino acids into Escherichia coli dihydrofolate reductase (DHFR). The selected ribosomes were able to incorporate structurally disparate β-amino acids into DHFR, in spite of the use of a single puromycin for the selection of the individual clones. In this study, we examine the extent to which the structure of the β³-puromycin employed for ribosome selection influences the regio- and stereochemical preferences of the modified ribosomes during protein synthesis; the mechanistic probe was a single suppressor tRNA(CUA) activated with each of four methyl-β-alanine isomers (1-4). The modified ribosomes were found to incorporate each of the four isomeric methyl-β-alanines into DHFR but exhibited a preference for incorporation of 3(S)-methyl-β-alanine (β-mAla; 4), i.e., the isomer having the same regio- and stereochemistry as the O-methylated β-tyrosine moiety of β³-puromycin. Also conducted were a selection of clones that are responsive to β²-puromycin and a demonstration of reversal of the regio- and stereochemical preferences of these clones during protein synthesis. These results were incorporated into a structural model of the modified regions of 23S rRNA, which included in silico prediction of a H-bonding network. Finally, it was demonstrated that incorporation of 3(S)-methyl-β-alanine (β-mAla; 4) into a short α-helical region of the nucleic acid binding domain of hnRNP LL significantly stabilized the helix without affecting its DNA binding properties.

  16. Mechanism of action of nalidixic acid: Purification of Escherichia coli nalA gene product and its relationship to DNA gyrase and a novel nicking-closing enzyme

    PubMed Central

    Sugino, Akio; Peebles, Craig L.; Kreuzer, Kenneth N.; Cozzarelli, Nicholas R.

    1977-01-01

    A target protein for nalidixic and oxolinic acids in Escherichia coli, the nalA gene product (Pnal), was purified to homogeneity as judged by gel electrophoresis, using an in vitro complementation assay. It is a dimer of identical 110,000-dalton subunits. A polypeptide of this molecular weight is uniquely induced by a λ nalA transducing phage, thereby showing that the purified Pnal is a product of the nalA gene. Nalidixic and oxolinic acids inhibit DNA gyrase activity and induce formation of a relaxation complex analogue. Treatment of the complex with sodium dodecyl sulfate causes a doublestrand break in the DNA substrate and the resulting linear molecule seems covalently bound to protein. Complex formation, unlike the introduction of supertwists, does not require ATP or relaxed circular DNA and is insensitive to novobiocin. DNA gyrase from a strain with a nalA mutation conferring drug resistance (nalAr) is 1/100 as sensitive to oxolinic and nalidixic acids with respect to inhibition of supertwisting and induction of the pre-linearization complex. Addition of Pnal restores drug sensitivity and stimulates DNA gyrase activity. DNA gyrase preparations and Pnal catalyze a third reaction sensitive to nalidixic and oxolinic acids, the ATP-independent relaxation of supertwister DNA. Relaxation by gyrase from nalAr cells is drug resistant. The nicking-closing activity is distinct from E. coli ω protein in several properties, including the ability to relax positively supertwisted DNA. We postulate that the nalA gene product occurs in two molecular forms, as Pnal and as a gyrase component. Both forms catalyze nicking-closing, and inhibition of this activity by nalidixic and oxolinic acids may account for the inhibition of DNA synthesis by these drugs. Images PMID:200930

  17. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  18. cis-Acting sequences in addition to donor and acceptor sites are required for template switching during synthesis of plus-strand DNA for duck hepatitis B virus.

    PubMed Central

    Havert, M B; Loeb, D D

    1997-01-01

    A characteristic of all hepadnaviruses is the relaxed-circular conformation of the DNA genome within an infectious virion. Synthesis of the relaxed-circular genome by reverse transcription requires three template switches. These template switches, as for the template switches or strand transfers of other reverse-transcribing genetic elements, require repeated sequences (the donor and acceptor sites) between which a complementary strand of nucleic acid is transferred. The mechanism for each of the template switches in hepadnaviruses is poorly understood. To determine whether sequences other than the donor and acceptor sites are involved in the template switches of duck hepatitis B virus (DHBV), a series of molecular clones which express viral genomes bearing deletion mutations were analyzed. We found that three regions of the DHBV genome, which are distinct from the donor and acceptor sites, are required for the synthesis of relaxed-circular DNA. One region, located near the 3' end of the minus-strand template, is required for the template switch that circularizes the genome. The other two regions, located in the middle of the genome and near DR2, appear to be required for plus-strand primer translocation. We speculate that these cis-acting sequences may play a role in the organization of the minus-strand DNA template within the capsid particle so that it supports efficient template switching during plus-strand DNA synthesis. PMID:9188603

  19. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis

    PubMed Central

    Hamdan, Samir M.; Loparo, Joseph J.; Takahashi, Masateru; Richardson, Charles C.; van Oijen, Antoine M.

    2009-01-01

    In all organisms, the protein machinery responsible for the replication of DNA, the replisome, is faced with a directionality problem. The antiparallel nature of duplex DNA permits the leading-strand polymerase to advance in a continuous fashion, but forces the lagging-strand polymerase to synthesize in the opposite direction. By extending RNA primers, the lagging-strand polymerase restarts at short intervals and produces Okazaki fragments1,2. At least in prokaryotic systems, this directionality problem is solved by the formation of a loop in the lagging strand of the replication fork to reorient the lagging-strand DNA polymerase so that it advances in parallel with the leading-strand polymerase. The replication loop grows and shrinks during each cycle of Okazaki-fragment synthesis3. Here, we employ single-molecule techniques to visualize, in real time, the formation and release of replication loops by individual replisomes of bacteriophage T7 supporting coordinated DNA replication. Analysis of the distributions of loop sizes and lag times between loops reveals that initiation of primer synthesis and the completion of an Okazaki fragment each serve as a trigger for loop release. The presence of two triggers may represent a fail-safe mechanism ensuring the timely reset of the replisome after the synthesis of every Okazaki fragment. PMID:19029884

  20. A new paradigm of DNA synthesis: three-metal-ion catalysis.

    PubMed

    Yang, Wei; Weng, Peter J; Gao, Yang

    2016-01-01

    Enzyme catalysis has been studied for over a century. How it actually occurs has not been visualized until recently. By combining in crystallo reaction and X-ray diffraction analysis of reaction intermediates, we have obtained unprecedented atomic details of the DNA synthesis process. Contrary to the established theory that enzyme-substrate complexes and transition states have identical atomic composition and catalysis occurs by the two-metal-ion mechanism, we have discovered that an additional divalent cation has to be captured en route to product formation. Unlike the canonical two metal ions, which are coordinated by DNA polymerases, this third metal ion is free of enzyme coordination. Its location between the α- and β-phosphates of dNTP suggests that the third metal ion may drive the phosphoryltransfer from the leaving group opposite to the 3'-OH nucleophile. Experimental data indicate that binding of the third metal ion may be the rate-limiting step in DNA synthesis and the free energy associated with the metal-ion binding can overcome the activation barrier to the DNA synthesis reaction. PMID:27602203

  1. Induction of DNA synthesis in isolated nuclei by cytoplasmic factors: inhibition by protease inhibitors

    SciTech Connect

    Wong, R.L.; Gutowski, J.K.; Katz, M.; Goldfarb, R.H.; Cohen, S.

    1987-01-01

    Cytoplasmic extracts from spontaneously proliferating and mitogen-activated lymphoid cells contain a protein factor called ADR (activator of DNA replication) that induces DNA synthesis in isolated quiescent nuclei. ADR-containing preparations have proteolytic activity, as indicated by their ability to degrade fibrin in a plasminogen-independent and plasminogen-dependent manner. In addition, aprotinin, a nonspecific protease inhibitor, abrogates ADR-induced DNA synthesis in a dose-dependent fashion. Preincubation studies demonstrated that the effect of aprotinin is not due to its suppressive effects on the nuclei themselves. Other protease inhibitors such as leupeptin, p-aminobenzamidine, and N-..cap alpha..-tosyllysine chloromethyl ketone are also inhibitory, but soybean trypsin inhibitor is without effect. ADR activity can be removed from active extracts by adsorption with aprotinin-conjugated agarose beads and can be recovered by elution with an acetate buffer (pH 5). These finding are consistent with the interpretation that the initiation of DNA synthesis in resting nuclei may be protease dependent and, further, that the cytoplasmic stimulatory factor the authors have called ADR may be a protease itself.

  2. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI

    SciTech Connect

    Vieira, P.; De Waal-Malefyt, R.; Dang, M.N.; Johnson, K.E.; Kastelein, R.; Fiorentino, D.F.; DeVries, J.E.; Roncarolo, M.G.; Mosmann, T.R.; Moore, K.W. )

    1991-02-15

    The authors demonstrated the existence of human cytokine synthesis inhibitory factor (DSIF) (interleukin 10 (IL-10)). cDNA clones encoding human IL-10 (hIL-10) were isolated from a tetanus toxin-specific human T-cell clone. Like mouse IL-10, hIL-10 exhibits strong DNA and amino acid sequence homology to an open reading frame in the Epstein-Barr virus, BDRFL. hIL-10 and the BCRFI product inhibit cytokine synthesis by activated human peripheral blood mononuclear cells and by a mouse Th1 clone. Both hIL-10 and mouse IL-10 sustain the viability of a mouse mast cell line in culture, but BCRFI lacks comparable activity in this way, suggesting that BCRFI may have conserved only a subset of hIL-10 activities.

  3. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N.; Mariella, Jr., Raymond P.; Christian, Allen T.; Young, Jennifer A.; Clague, David S.

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  4. Endotoxin or cytokines attenuate ozone-induced DNA synthesis in rat nasal transitional epithelium

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R. )

    1992-06-01

    Pretreatment of rats with endotoxin (E), a potent inducer of tumor necrosis factor alpha (TNF), and interleukin 1 beta (IL 1), or a combination of TNF and IL1, has been shown to increase levels of lung antioxidant enzymes and protect against pulmonary toxicity associated with hyperoxia. Inhalation of ozone (O3) induces cell injury, followed by increased DNA synthesis, cell proliferation, and secretory cell metaplasia in rat nasal transitional epithelium (NTE). This study was designed to test the effects of E, TNF, and IL1 pretreatment on acute O3-induced NTE cell injury as measured by changes in NTE cell DNA synthesis. Rats were exposed to either 0.8 ppm O3 or air for 6 hr in whole-body inhalation chambers. Immediately before exposure, rats in each group were injected intraperitoneally (ip) with either saline alone or saline containing E, TNF, IL1, or both TNF and IL1. Eighteen hours postexposure, rats were injected ip with bromodeoxyuridine to label cells undergoing DNA synthesis and were euthanized 2 hr later. NTE was processed for light microscopy and immunochemically stained to identify cells that had incorporated BrdU into nuclear DNA. The number of BrdU-labeled NTE nuclei per millimeter of basal lamina was quantitated. There were no significant differences in the number of BrdU-labeled NTE nuclei in air-exposed rats that were injected with E, TNF, IL1, or TNF/IL1 compared with those in saline-injected, air-exposed controls. Rats that were injected with saline and exposed to O3 had approximately 10 times the number of BrdU-labeled NTE nuclei than saline-injected, air-exposed control rats. O3 exposure also induced a significant increase in labeled nuclei in rats that were pretreated with TNF alone. In contrast, pretreatment with E, IL1, or TNF/IL1 attenuated the O3-induced increase in NTE DNA synthesis.

  5. Synthesis and biological activity of benzamide DNA minor groove binders.

    PubMed

    Khan, Gul Shahzada; Pilkington, Lisa I; Barker, David

    2016-02-01

    A range of di- and triaryl benzamides were synthesised to investigate the effect of the presence and nature of a polar sidechain, bonding and substitution patterns and functionalisation of benzylic substituents. These compounds were tested for their antiproliferative activity as well as their DNA binding activity. The most active compounds in all assays were unsymmetrical triaryl benzamides with a bulky or alkylating benzylic substituent and a polar amino sidechain.

  6. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  7. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  8. The ATPase domain but not the acidic region of Cockayne syndrome group B gene product is essential for DNA repair.

    PubMed

    Brosh, R M; Balajee, A S; Selzer, R R; Sunesen, M; Proietti De Santis, L; Bohr, V A

    1999-11-01

    Cockayne syndrome (CS) is a human genetic disorder characterized by UV sensitivity, developmental abnormalities, and premature aging. Two of the genes involved, CSA and CSB, are required for transcription-coupled repair (TCR), a subpathway of nucleotide excision repair that removes certain lesions rapidly and efficiently from the transcribed strand of active genes. CS proteins have also been implicated in the recovery of transcription after certain types of DNA damage such as those lesions induced by UV light. In this study, site-directed mutations have been introduced to the human CSB gene to investigate the functional significance of the conserved ATPase domain and of a highly acidic region of the protein. The CSB mutant alleles were tested for genetic complementation of UV-sensitive phenotypes in the human CS-B homologue of hamster UV61. In addition, the CSB mutant alleles were tested for their ability to complement the sensitivity of UV61 cells to the carcinogen 4-nitroquinoline-1-oxide (4-NQO), which introduces bulky DNA adducts repaired by global genome repair. Point mutation of a highly conserved glutamic acid residue in ATPase motif II abolished the ability of CSB protein to complement the UV-sensitive phenotypes of survival, RNA synthesis recovery, and gene-specific repair. These data indicate that the integrity of the ATPase domain is critical for CSB function in vivo. Likewise, the CSB ATPase point mutant failed to confer cellular resistance to 4-NQO, suggesting that ATP hydrolysis is required for CSB function in a TCR-independent pathway. On the contrary, a large deletion of the acidic region of CSB protein did not impair the genetic function in the processing of either UV- or 4-NQO-induced DNA damage. Thus the acidic region of CSB is likely to be dispensable for DNA repair, whereas the ATPase domain is essential for CSB function in both TCR-dependent and -independent pathways. PMID:10564257

  9. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  10. Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.

    PubMed

    Ortega, Janice; Li, Jessie Y; Lee, Sanghee; Tong, Dan; Gu, Liya; Li, Guo-Min

    2015-05-01

    Proliferating cell nuclear antigen (PCNA) plays essential roles in eukaryotic cells during DNA replication, DNA mismatch repair (MMR), and other events at the replication fork. Earlier studies show that PCNA is regulated by posttranslational modifications, including phosphorylation of tyrosine 211 (Y211) by the epidermal growth factor receptor (EGFR). However, the functional significance of Y211-phosphorylated PCNA remains unknown. Here, we show that PCNA phosphorylation by EGFR alters its interaction with mismatch-recognition proteins MutSα and MutSβ and interferes with PCNA-dependent activation of MutLα endonuclease, thereby inhibiting MMR at the initiation step. Evidence is also provided that Y211-phosphorylated PCNA induces nucleotide misincorporation during DNA synthesis. These findings reveal a novel mechanism by which Y211-phosphorylated PCNA promotes cancer development and progression via facilitating error-prone DNA replication and suppressing the MMR function.

  11. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailing description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  12. RNA primer used in synthesis of anticomplementary DNA by reverse transcriptase of avian myeloblastosis virus.

    PubMed Central

    Myers, J C; Dobkin, C; Spiegelman, S

    1980-01-01

    When either the homologous RNA (avian myeloblastosis virus RNA) or a heterologous RNA (poliovirus RNA) was used as a template, the anticomplementary DNA synthesized in vitro by avian myeloblastosis virus reverse transcriptase (RNA-directed DNA nucleotidyltransferase, EC 2.7.7.7) was primed by fragments of the original RNA template that usually had adenosine at their 3' ends. When we used phage T/ RNA ligase (EC 6.5.1.3) to label the 3' end of the RNA template fragments contained in the RNA . cDNA hybrid intermediate, adenosine was found to be the principal nucleoside carrying the label. We infer from these results that the ribonuclease H (hybrid nuclease) activity of the reverse transcriptase creates fragments of the original RNA template with adenosine as the principal 3' terminus and that these fragments serve as primers for the synthesis of anticomplementary DNA. Images PMID:6154930

  13. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  14. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  15. Effect of the amino acid substitution in the DNA-binding domain of the Fur regulator on production of pyoverdine.

    PubMed

    Valešová, Renáta; Palyzová, Andrea; Marešová, Helena; Stěpánek, Václav; Babiak, Peter; Kyslík, Pavel

    2013-07-01

    The ferric uptake regulator gene (fur), its promoter region and Fur box of pvdS gene involved in siderophore-mediated iron uptake system were sequenced in the parent strain Pseudomonas aeruginosa PAO1 and in the fur mutant FPA121 derived from the strain PAO1. We identified the gene fur 179 bearing a novel, single-point mutation that changed the amino acid residue Gln60Pro in the DNA-binding domain of the Fur protein. The synthesis of pyoverdine was studied in cultures of the strains PAO1 and FPA121 grown in iron-deplete and iron-replete (60 μmol/L FeIII) medium. The amino acid replacement in the regulatory Fur protein is responsible for the overproduction of pyoverdine in iron-deplete and iron-replete medium. No mutation was identified in the Fur box of the gene pvdS.

  16. Mutagenicity and pausing of HIV reverse transcriptase during HIV plus-strand DNA synthesis.

    PubMed Central

    Ji, J; Hoffmann, J S; Loeb, L

    1994-01-01

    The unusually high frequency of misincorporation by HIV-1 reverse transcriptase (HIV RT) is likely to be the major factor in the rapid accumulation of viral mutations in AIDS, especially in the env gene. To investigate the ability of HIV RT to copy the env gene, we subcloned an HIV env gene fragment into a single-stranded DNA vector and measured the progression of synthesis by HIV RT. We observed that HIV RT, but not RT from avian myeloblastosis virus, DNA polymerase-alpha or T7 DNA polymerase, pauses specifically at poly-deoxyadenosine stretches within the env gene. The frequency of bypassing the polyadenosine stretches by HIV RT is enhanced by increasing the ratio of enzyme to template. We measured the fidelity of DNA synthesis within a segment of the hypervariable region 1 of the env gene (V-1) containing a poly-deoxyadenosine sequence by repetitively copying the DNA by HIV RT, and then cloning and sequencing the copied fragments. We found that 27% of the errors identified in V-1 sequence were frameshift mutations opposite the poly-adenosine tract, a site where strong pausing was observed. Pausing of HIV RT at the polyadenosine tract could be enhanced by either distamycin A or netropsin, (A-T)-rich minor groove binding peptides. Moreover, netropsin increases the frequency of frameshift mutations in experiments in which HIV RT catalyzes gap filling synthesis within the lacZ gene in double-stranded circular M13mp2 DNA. These combined results suggest that the enhanced mutation frequency may be due to increased pausing at netropsin-modified polyadenosine tracts. Therefore, netropsin and related A-T binding chemicals may selectively enhance frameshift mutagenesis induced by HIV RT and yield predominantly non-viable virus. Images PMID:7510388

  17. Translesion synthesis is the main component of SOS repair in bacteriophage lambda DNA.

    PubMed Central

    Defais, M; Lesca, C; Monsarrat, B; Hanawalt, P

    1989-01-01

    Agents that interfere with DNA replication in Escherichia coli induce physiological adaptations that increase the probability of survival after DNA damage and the frequency of mutants among the survivors (the SOS response). Such agents also increase the survival rate and mutation frequency of irradiated bacteriophage after infection of treated bacteria, a phenomenon known as Weigle reactivation. In UV-irradiated single-stranded DNA phage, Weigle reactivation is thought to occur via induced, error-prone replication through template lesions (translesion synthesis [P. Caillet-Fauquet, M: Defais, and M. Radman, J. Mol. Biol. 117:95-112, 1977]). Weigle reactivation occurs with higher efficiency in double-stranded DNA phages such as lambda, and we therefore asked if another process, recombination between partially replicated daughter molecules, plays a major role in this case. To distinguish between translesion synthesis and recombinational repair, we studied the early replication of UV-irradiated bacteriophage lambda in SOS-induced and uninduced bacteria. To avoid complications arising from excision of UV lesions, we used bacterial uvrA mutants, in which such excision does not occur. Our evidence suggests that translesion synthesis is the primary component of Weigle reactivation of lambda phage in the absence of excision repair. The greater efficiency in Weigle reactivation of double-stranded DNA phage could thus be attributed to some inducible excision repair unable to occur on single-stranded DNA. In addition, after irradiation, lambda phage replication seems to switch prematurely from the theta mode to the rolling circle mode. Images PMID:2527845

  18. Synthesis, photochemical properties and DNA binding studies of dna cleaving agents based on chiral dipyridine dihydrodioxins salts

    NASA Astrophysics Data System (ADS)

    Shamaev, Alexei

    activated by UV-light. The mechanism of o-quinone release and intramolecular ET was studied in detail by methods of Ultrafast Transient Absortion Spectroscopy and supported by high-level quantum mechanical calculations. The binding properties of chiral intercalators based on PDHD to various DNA oligonucleotides were studied by various methods and DNA cleavage properties indicating strong binding and cleaving ability of the synthesized PDHDs. Also, a new method for synthesis of cyclohexa[e]pyrenes which possibly capable of intramolecular ET and electron transfer-oxidative stress (ET-OS) DNA cleavage was developed and partially accomplished.

  19. Method for nucleic acid hybridization using single-stranded DNA binding protein

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1996-01-01

    Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.

  20. Recent Advances in the Synthesis and Functions of Reconfigurable Interlocked DNA Nanostructures.

    PubMed

    Lu, Chun-Hua; Cecconello, Alessandro; Willner, Itamar

    2016-04-27

    Interlocked circular DNA nanostructures, e.g., catenanes or rotaxanes, provide functional materials within the area of DNA nanotechnology. Specifically, the triggered reversible reconfiguration of the catenane or rotaxane structures provides a means to yield new DNA switches and to use them as dynamic scaffolds for controlling chemical functions and positioning functional cargoes. The synthesis of two-ring catenanes and their switchable reconfiguration by pH, metal ions, or fuel/anti-fuel stimuli are presented, and the functions of these systems, as pendulum or rotor devices or as switchable catalysts, are described. Also, the synthesis of three-, five-, and seven-ring catenanes is presented, and their switchable reconfiguration using fuel/anti-fuel strands is addressed. Implementation of the dynamically reconfigured catenane structures for the programmed organization of Au nanoparticle (NP) assemblies, which allows the plasmonic control of the fluorescence properties of Au NP/fluorophore loads associated with the scaffold, and for the operation of logic gates is discussed. Interlocked DNA rotaxanes and their different synthetic approaches are presented, and their switchable reconfiguration by means of fuel/anti-fuel strands or photonic stimuli is described. Specifically, the use of the rotaxane as a scaffold to organize Au NP assemblies, and the control of the fluorescence properties with Au NP/fluorophore hybrids loaded on the rotaxane scaffold, are introduced. The future prospectives and challenges in the field of interlocked DNA nanostructures and the possible applications are discussed. PMID:27019201

  1. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  2. Ribonucleic acid synthesis by Escherichia coli C3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of the coliphage-induced double-stranded ribonucleic acid

    PubMed Central

    Bishop, D. H. L.

    1966-01-01

    1. The efficiency of extracting nucleic acids from Escherichia coli after five methods of obtaining cell lysis was determined. 2. The recovery of various nucleic acid species isolated after chromatography on methylated albumin-coated kieselguhr was also examined. 3. Double-stranded coliphage-induced RNA was isolated from infected bacteria and its resistance to ribonuclease digestion under various conditions determined. 4. The involvement of double-stranded RNA during the infection process was demonstrated. 5. The time-course of the syntheses in infected cells of double-stranded RNA, DNA, single-stranded coliphage and 16s ribosomal RNA, transfer RNA and ribosomal 23s RNA was examined. 6. It was demonstrated that the syntheses of DNA, transfer RNA and ribosomal RNA decreased 10–15min. after infection. 7. Synthesis of coliphage RNA commenced 10–15min. after infection and double-stranded RNA was also synthesized from about 10min. after coliphage adsorption. PMID:5338876

  3. Ribonucleic acid synthesis by Escherichia coli C 3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of the coliphage-induced double-stranged ribonucleic acid.

    PubMed

    Bishop, D H

    1966-09-01

    1. The efficiency of extracting nucleic acids from Escherichia coli after five methods of obtaining cell lysis was determined. 2. The recovery of various nucleic acid species isolated after chromatography on methylated albumin-coated kieselguhr was also examined. 3. Double-stranded coliphage-induced RNA was isolated from infected bacteria and its resistance to ribonuclease digestion under various conditions determined. 4. The involvement of double-stranded RNA during the infection process was demonstrated. 5. The time-course of the syntheses in infected cells of double-stranded RNA, DNA, single-stranded coliphage and 16s ribosomal RNA, transfer RNA and ribosomal 23s RNA was examined. 6. It was demonstrated that the syntheses of DNA, transfer RNA and ribosomal RNA decreased 10-15min. after infection. 7. Synthesis of coliphage RNA commenced 10-15min. after infection and double-stranded RNA was also synthesized from about 10min. after coliphage adsorption.

  4. Synthesis and application of acid labile anchor groups for the synthesis of peptide amides by Fmoc-solid-phase peptide synthesis.

    PubMed

    Breipohl, G; Knolle, J; Stüber, W

    1989-10-01

    The preparation and application of a new linker for the synthesis of peptide amides using a modified Fmoc-method is described. The new anchor group was developed based on our experience with 4,4'-dimethoxybenzhydryl (Mbh)-protecting group for amides. Lability towards acid treatment was increased dramatically and results in an easy cleavage procedure for the preparation of peptide amides. The synthesis of N-9-fluorenylmethoxycarbonyl- ([5-carboxylatoethyl-2.4-dimethoxyphenyl)- 4'-methoxyphenyl]-methylamin is reported in detail. This linker was coupled to a commercially available aminomethyl polystyrene resin. Peptide synthesis proceeded smoothly using HOOBt esters of Fmoc-amino acids. Release of the peptide amide and final cleavage of the side chain protecting groups was accomplished by treatment with trifluoroacetic acid-dichloromethane mixtures in the presence of scavengers. The synthesis of peptide amides such as LHRH and C-terminal hexapeptide of secretin are given as examples.

  5. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  6. On-Flow Synthesis of Co-Polymerizable Oligo-Microspheres and Application in ssDNA Amplification

    PubMed Central

    Lee, Se Hee; Lee, Jae Ha; Lee, Ho Won; Kim, Yang-Hoon; Jeong, Ok Chan; Ahn, Ji-Young

    2016-01-01

    We fabricated droplet-based microfluidic platform for copolymerizable microspheres with acrydite modified DNA probe. The copolymerizable 3-D polyacrylamide microspheres were successfully produced from microcontinuous-flow synthesis with on-channel solidification. DNA copolymerization activity, surface presentation and thermostability were assessed by using fluorescent labeled complementary probe. The binding performance was only visible on the surface area of oligo-microspheres. We show that the resulting oligo-microspheres can be directly integrated into a streamlined microsphere-PCR protocol for amplifying ssDNA. Our microspheres could be utilized as a potential material for ssDNA analysis such as DNA microarray and automatic DNA SELEX process. PMID:27447941

  7. Regulation of protein synthesis by amino acids in muscle of neonates.

    PubMed

    Suryawan, Agus; Davis, Teresa A

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed.

  8. Protein synthesis directly from PCR: progress and applications of cell-free protein synthesis with linear DNA.

    PubMed

    Schinn, Song-Min; Broadbent, Andrew; Bradley, William T; Bundy, Bradley C

    2016-06-25

    A rapid, versatile method of protein expression and screening can greatly facilitate the future development of therapeutic biologics, proteomic drug targets and biocatalysts. An attractive candidate is cell-free protein synthesis (CFPS), a cell-lysate-based in vitro expression system, which can utilize linear DNA as expression templates, bypassing time-consuming cloning steps of plasmid-based methods. Traditionally, such linear DNA expression templates (LET) have been vulnerable to degradation by nucleases present in the cell lysate, leading to lower yields. This challenge has been significantly addressed in the recent past, propelling LET-based CFPS as a useful tool for studying, screening and engineering proteins in a high-throughput manner. Currently, LET-based CFPS has promise in fields such as functional proteomics, protein microarrays, and the optimization of complex biological systems. PMID:27085957

  9. An autoradiographic study of DNA synthesis in lymphoid cells of leucotic and healthy cattle.

    PubMed

    Rodák, L; Procházka, Z

    1976-01-01

    The present study on 3H-thymidine incorporation using the histouatoradiographic method showed that spontaneous DNA synthesis occurred, on average, in 0.526 (+/- 0.233) per cent of lymphoid cells in 19 cattle with the normal blood picture (6,355+/-1,866 leucocytes/cu. mm). In 17 leucotic cattle with persistent leuco- and lymphocytosis (19,138+/-8,817 leucocytes/cu. mm) the proportion of these cells was insignificantly different, hovering about 0.554 (+/-0.191) per cent. The present sample did not include cases with marked changes in the blood picture (50,000-600,000 leucocytes/cu. mm) which occur in only 5-10 per cent of leucotic animals. This fact, however, could not influence the conclusion that even when used in conjunction with other methods, the determination of spontaneous DNA synthesis in peripheral lymphocytes is not a useful tool for the detection of preclinical phases of bovine leucosis.

  10. Nucleic acid chemistry in the organic phase: from functionalized oligonucleotides to DNA side chain polymers.

    PubMed

    Liu, Kai; Zheng, Lifei; Liu, Qing; de Vries, Jan Willem; Gerasimov, Jennifer Y; Herrmann, Andreas

    2014-10-01

    DNA-incorporating hydrophobic moieties can be synthesized by either solid-phase or solution-phase coupling. On a solid support the DNA is protected, and hydrophobic units are usually attached employing phosphoramidite chemistry involving a DNA synthesizer. On the other hand, solution coupling in aqueous medium results in low yields due to the solvent incompatibility of DNA and hydrophobic compounds. Hence, the development of a general coupling method for producing amphiphilic DNA conjugates with high yield in solution remains a major challenge. Here, we report an organic-phase coupling strategy for nucleic acid modification and polymerization by introducing a hydrophobic DNA-surfactant complex as a reactive scaffold. A remarkable range of amphiphile-DNA structures (DNA-pyrene, DNA-triphenylphosphine, DNA-hydrocarbon, and DNA block copolymers) and a series of new brush-type DNA side-chain homopolymers with high DNA grafting density are produced efficiently. We believe that this method is an important breakthrough in developing a generalized approach to synthesizing functional DNA molecules for self-assembly and related technological applications.

  11. [Overgrowth and DNA synthesis of neuroepithelium in embryonic stages of induced Long-Evans rat myeloschisis].

    PubMed

    Chono, Y

    1993-01-01

    Overgrowth of the myeloschisis, namely the excessive amount of the neural plate tissue, has been reported in the human myeloschisis. However, it is still debatable how the overgrowth develops and whether the overgrowth is the cause, or the secondary effect of spinal dysraphism. The author induced myeloschisis in the fetuses of Long-Evans rats by the administration of ethylenethiourea (ETU) to pregnant rats on day 10 of gestation. The fetuses were removed 1 hour after the treatment with bromodeoxyuridine (BrdU) to the dams on day 14 and 21. The fetuses were fixed in alcohol and embedded in paraffin. H-E staining and the immunohistologic examination were performed on the staining patterns to anti-neurofilament (NFP), anti-glial fibrillary acidic protein (GFAP) and anti-BrdU antibody by ABC method. On day 14, the lateral portion of everted neural plate showed a loose arrangement of cells and there was rosette formation in the mesoderm. On day 21, cell necrosis was observed at the dorsolateral portion of myeloschisis, although the ventral portion showed almost normal cytoarchitecture and was positive to NFP and GFAP. The cause of myeloschisis in this model is supposed to be the local and direct cytotoxic effect of ETU to neuro-ectodermal junction. On day 14, control animals contained few BrdU-incorporated cells at the basal plate of neural tube. In contrast, everted neural plate showed an active uptake of BrdU diffusely in the subependymal matrix layer cells. Overgrowth was not yet identified. On day 21, overgrowth of myeloschisis was found in spite of a few positive cells to BrdU which was identical to the control animals. These findings seem to suggest that cells in the myeloschisis retain their ability of DNA synthesis for longer periods of development and overgrowth found on day 21 is possibly a secondary effect of spinal dysraphism in this model.

  12. Synthesis of L-ascorbic acid in the phloem

    PubMed Central

    Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

    2003-01-01

    Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

  13. Lagging strand DNA synthesis by calf thymus DNA polymerases alpha, beta, delta and epsilon in the presence of auxiliary proteins.

    PubMed Central

    Podust, V N; Hübscher, U

    1993-01-01

    By using a defined gapped DNA substrate that mimics a lagging strand of 230 nucleotides and that contains a defined pause site, we have analyzed calf thymus DNA polymerases (pol) alpha, beta, delta, and epsilon in the presence of the three auxiliary proteins proliferating cell nuclear antigen (PCNA), replication factor C (RF-C) and replication protein A (RP-A) for their ability to complete an Okazaki fragment. Pol alpha alone could fill the gap to near completion, but was strongly stopped by the pause site. Addition of low amounts of RP-A resulted in an increased synthesis by pol alpha past the pause site. In contrast, high amounts of RP-A strongly inhibited gap filling by pol alpha. Further inhibition was evident when the two other auxiliary proteins, PCNA and RF-C, were added in addition to RP-A. Pol beta could completely fill the gap without specific pausing and also was strongly inhibited by RP-A. PCNA and RF-C had no detectable effect on pol beta. Pol delta, relied as expected, on all three auxiliary proteins for complete gap filling synthesis and could, upon longer incubation, perform a limited amount of strand displacement synthesis. Pol epsilon core enzyme was able to fill the gap completely, but like pol alpha, essentially stopped at the pause site. This pausing could only be overcome upon addition of PCNA, RF-C and E. coli single-stranded DNA binding protein. Thus pol epsilon holoenzyme preferentially synthesized to the end of the gap without pausing. Ligation of the DNA products indicated that pol beta core enzyme, pol delta and pol epsilon holoenzymes (but not pol alpha and pol epsilon core enzyme) synthesized products that were easily ligatable. Our results indicate that pol epsilon holoenzyme fills a defined lagging strand gapped template to exact completion and is able to pass a pause site. The data favour the hypothesis of Burgers (Burgers, P.M.J. (1991) J. Biol. Chem. 266, 22698-22706) that pol epsilon might be a candidate for the second

  14. Enzymatic synthesis of a DNA triblock copolymer that is composed of natural and unnatural nucleotides.

    PubMed

    Mitomo, Hideyuki; Watanabe, Yukie; Matsuo, Yasutaka; Niikura, Kenichi; Ijiro, Kuniharu

    2015-02-01

    DNA molecules have come under the spotlight as potential templates for the fabrication of nanoscale products, such as molecular-scale electronic or photonic devices. Herein, we report an enhanced approach for the synthesis of oligoblock copolymer-type DNA by using the Klenow fragment exonuclease minus of E. coli DNA polymerase I (KF(-) ) in a multi-step reaction with natural and unnatural nucleotides. First, we confirmed the applicability of unnatural nucleotides with 7-deaza-nucleosides-which was expected because they were non-metalized nucleotides-on the unique polymerization process known as the "strand-slippage model". Because the length of the DNA sequence could be controlled by tuning the reaction time, analogous to a living polymerization reaction on this process, stepwise polymerization provided DNA block copolymers with natural and unnatural bases. AFM images showed that this DNA block copolymer could be metalized sequence-selectively. This approach could expand the utility of DNA as a template.

  15. Deoxyribonucleotide synthesis and DNA polymerase activity in plant cells (Vicia faba and Glycine max).

    PubMed

    Hovemann, B; Follmann, H

    1979-01-26

    Enzymes of deoxyribonucleotide and DNA biosynthesis, which are little known in plants, were studied in root tips of germinating broad beans (Vicia faba) and in fast-growing cultures of soybean cells (Glycine max). The plant cells contain a ribonucleoside 5'-diphosphate reductase which is detected in vitro only during a limited period of growth, viz. 30--32 h after inhibition of Vicia seeds, and between the second and third day after inoculation of soybean cultures. In both species ribonucleotide reductase activity precedes maximum DNA synthesis. The reductases could be precipitated with ammonium sulfate but were not purified further due to the extremely low enzyme content of the plant extracts. Therefore the reductive pathway of deoxyribotide formation was also established in Vicia root tips by efficient labeling of the plant DNA with a ribonucleoside, [5-3H]cytidine, which reaches a maximum at the same time as the reductase activity measured in vitro. Cycloheximide inhibits this process, indicating the need for de novo enzyme induction. In contrast, DNA polymerase is present in the tissue throughout the entire development and rises only 2-fold in activity during the S phase. The soluble polymerases were partially characterized in both legume species and were found very similar to the DNA polymerase of pea seedlings. Ribonucleotide reductase is more likely a limiting component of DNA formation during the plant cell cycle than DNA polymerase.

  16. DNA damage and repair induced by diazoacetyl derivatives of amino acids with different mechanism of cytotoxicity. Correlations with mutagenicity and carcinogenicity.

    PubMed

    Brambilla, G; Cavanna, M; Carlo, P; Finollo, R; Sciaba, L; Parodi, S; Bolognesi, C

    1979-05-14

    Eight synthetic N-diazoacetyl amino acids, prepared by inserting a diazoacetyl group onto the alpha-nitrogen of a natural amino acid, and two natural diazoazetyl amino acids, azaserine (9-diazoacetyl-L-serine) and DON (6-diazo-5-oxo-L-norleucine), have been studied by autoradiography for their capacity to induce DNA repair synthesis in mouse cells cultivated "in vitro". Dose-dependent unscheduled DNA synthesis was present in cells treated with the eight N-diazoacetyl derivatives, and was absent in cells exposed to approximately equitoxic concentrations of azaserine and DON. Azaserine and DON, unlike N-diazoacetyl derivatives, did not alkylate gamma-(4-nitrobenzyl) pyridine at an appreciable extent. When DNA damage (single stranded breaks or weak points in alkali) was measured by the sensitive technique of alkaline elution, DGA was found about 4 times as potent as azaserine and about 12 times as DON on a molar basis, but about 800 and 17,000 times as potent as azaserine and DON respectively by extrapolating to equitoxic concentrations. Carcinogenicity and mutagenicity seem to follow mainly the capability of inducing DNA damage.

  17. Site-Selective Binding of Nanoparticles to Double-Stranded DNA via Peptide Nucleic Acid "Invasion"

    SciTech Connect

    Stadler, A.L.; van der Lelie, D.; Sun, D.; Maye, M. M.; Gang, O.

    2011-04-01

    We demonstrate a novel method for by-design placement of nano-objects along double-stranded (ds) DNA. A molecular intercalator, designed as a peptide nucleic acid (PNA)-DNA chimera, is able to invade dsDNA at the PNA-side due to the hybridization specificity between PNA and one of the duplex strands. At the same time, the single-stranded (ss) DNA tail of the chimera, allows for anchoring of nano-objects that have been functionalized with complementary ssDNA. The developed method is applied for interparticle attachment and for the fabrication of particle clusters using a dsDNA template. This method significantly broadens the molecular toolbox for constructing nanoscale systems by including the most conventional not yet utilized DNA motif, double helix DNA.

  18. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  19. Tailored fatty acid synthesis via dynamic control of fatty acid elongation.

    PubMed

    Torella, Joseph P; Ford, Tyler J; Kim, Scott N; Chen, Amanda M; Way, Jeffrey C; Silver, Pamela A

    2013-07-01

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  20. Design and synthesis of fluorescence-labeled nucleotide with a cleavable azo linker for DNA sequencing.

    PubMed

    Tan, Lianjiang; Liu, Yazhi; Yang, Qinglai; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

    2016-01-18

    A cleavable azo linker was synthesized and reacted with 5-(6)-carboxytetramethyl rhodamine succinimidyl ester, followed by further reactions with di(N-succinimidyl) carbonate and 5-(3-amino-1-propynyl)-2'-deoxyuridine 5'-triphosphate [dUTP(AP3)] to obtain the terminal product dUTP-azo linker-TAMRA as a potential reversible terminator for DNA sequencing by synthesis with no need for 3'-OH blocking. PMID:26587573

  1. The Foundry: the DNA synthesis and construction Foundry at Imperial College

    PubMed Central

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-01-01

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  2. The Foundry: the DNA synthesis and construction Foundry at Imperial College.

    PubMed

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-06-15

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  3. Total synthesis of the antitumor natural product polycarcin V and evaluation of its DNA binding profile.

    PubMed

    Cai, Xiao; Ng, Kevin; Panesar, Harmanpreet; Moon, Seong-Jin; Paredes, Maria; Ishida, Keishi; Hertweck, Christian; Minehan, Thomas G

    2014-06-01

    The convergent total synthesis of polycarcin V, a gilvocarcin-type natural product that shows significant cytotoxicity with selectivity for nonsmall-cell lung cancer, breast cancer, and melanoma cells, has been achieved in 13 steps from 7, 8, and 22; the sequence features a stereoselective α-C-glycosylation reaction for the union of protected carbohydrate 7 and naphthol 8. The association constant for the binding of polycarcin V to duplex DNA is similar to that previously reported for gilvocarcin V.

  4. Polymerase Synthesis and Restriction Enzyme Cleavage of DNA Containing 7-Substituted 7-Deazaguanine Nucleobases.

    PubMed

    Mačková, Michaela; Boháčová, Soňa; Perlíková, Pavla; Poštová Slavětínská, Lenka; Hocek, Michal

    2015-10-12

    Previous studies of polymerase synthesis of base-modified DNAs and their cleavage by restriction enzymes have mostly related only to 5-substituted pyrimidine and 7-substituted 7-deazaadenine nucleotides. Here we report the synthesis of a series of 7-substituted 7-deazaguanine 2'-deoxyribonucleoside 5'-O-triphosphates (dG(R) TPs), their use as substrates for polymerase synthesis of modified DNA and the influence of the modification on their cleavage by type II restriction endonucleases (REs). The dG(R) TPs were generally good substrates for polymerases but the PCR products could not be visualised on agarose gels by intercalator staining, due to fluorescence quenching. The presence of 7-substituted 7-deazaguanine residues in recognition sequences of REs in most cases completely blocked the cleavage.

  5. Thioacetic acid/NaSH-mediated synthesis of N-protected amino thioacids and their utility in peptide synthesis.

    PubMed

    Mali, Sachitanand M; Gopi, Hosahudya N

    2014-03-21

    Thioacids are recently gaining momentum due to their versatile reactivity. The reactivity of thioacids has been widely explored in the selective amide/peptide bond formation. Thioacids are generally synthesized from the reaction between activated carboxylic acids such as acid chlorides, active esters, etc., and Na2S, H2S, or NaSH. We sought to investigate whether the versatile reactivity of the thioacids can be tuned for the conversion of carboxylic acids into corresponding thioacids in the presence of NaSH. Herein, we report that thioacetic acid- and NaSH-mediated synthesis of N-protected amino thioacids from the corresponding N-protected amino acids, oxidative dimerization of thioacids, crystal conformations of thioacid oxidative dimers, and the utility of thioacids and oxidative dimers in peptide synthesis. Our results suggest that peptides can be synthesized without using standard coupling agents.

  6. [DNA synthesis inhibition test of INAH by cultured human fibroblasts].

    PubMed

    Nishio, K; Yanagisawa, K

    1986-03-20

    The most commonly used screening test of carcinogens is the Ames test. But this system occasionally shows false positive and false negative. Painter's method is one which has been developed to minimize false results. Now we test by Painter's method isonicotinic acid hydrazide, which shows negative in the Ames test but positive in an animal test. INAH showed positive by Painter's method. More chemicals are now under study for their carcinogenicity by Painter's method.

  7. Decreased UV-induced DNA repair synthesis in peripheral leukocytes from patients with the nevoid basal cell carcinoma syndrome

    SciTech Connect

    Ringborg, U.; Lambert, B.; Landergen, J.; Lewensohn, R.

    1981-04-01

    The uv-induced DNA repair synthesis in peripheral leukocytes from 7 patients with the nevoid basal cell carcinoma syndrome was compared to that in peripheral leukocytes from 5 patients with basal cell carcinomas and 39 healthy subjects. A dose response curve was established for each individual, and maximum DNA repair synthesis was used as a measure of the capacity for DNA repair. The patients with the nevoid basal cell carcinoma syndrome had about 25% lower level of maximum DNA repair synthesis as compared to the patients with basal cell carcinomas and control individuals. The possibility that DNA repair mechanisms may be involved in the etiology to the nevoid basal cell carcinoma syndrome is discussed.

  8. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  9. Deoxyadenosine family: improved synthesis, DNA damage and repair, analogs as drugs.

    PubMed

    Biswas, Himadri; Kar, Indrani; Chattopadhyaya, Rajagopal

    2013-08-01

    Improved synthesis of 2'-deoxyadenosine using Escherichia coli overexpressing some enzymes and gram-scale chemical synthesis of 2'-deoxynucleoside 5'-triphosphates reported recently are described in this review. Other topics include DNA damage induced by chromium(VI), Fenton chemistry, photoinduction with lumazine, or by ultrasound in neutral solution; 8,5'-cyclo-2'-deoxyadenosine isomers as potential biomarkers; and a recapitulation of purine 5',8-cyclonucleoside studies. The mutagenicities of some products generated by oxidizing 2'-deoxyadenosine 5'-triphosphate, nucleotide pool sanitization, and translesion synthesis are also reviewed. Characterizing cross-linking between nucleosides in opposite strands of DNA and endonuclease V-mediated deoxyinosine excision repair are discussed. The use of purine nucleoside analogs in the treatment of rarer chronic lymphoid leukemias is reviewed. Some analogs at the C8 position induced delayed polymerization arrest during HIV-1 reverse transcription. The susceptibility of clinically metronidazole-resistant Trichomonas vaginalis to two analogs, toyocamycin and 2-fluoro-2'-deoxyadenosine, were tested in vitro. GS-9148, a dAMP analog, was translocated to the priming site in a complex with reverse transcriptase and double-stranded DNA to gain insight into the mechanism of reverse transcriptase inhibition. PMID:25436589

  10. DNA repair after ultraviolet irradiation of ICR 2A frog cells: pyrimidine dimers are long acting blocks to nascent DNA synthesis

    SciTech Connect

    Rosenstein, B.S.; Setlow, R.B.

    1980-08-01

    The ability of ICR 2A frog cells to repair DNA damage induced by ultraviolet irradiation was examined. These cells are capable of photoreactivation but are nearly totally deficient in excision repair. They have the ability to convert the small molecular weight DNA made after irradiation into large molecules but do not show an enhancement in this process when the UV dose is delivered in two separate exposures separated by a 3- or 24-h incubation. Total DNA synthesis is depressed and low molecular weight DNA continues to be synthesized during pulse-labeling as long as 48 h after irradiation. The effects of pyrimidine dimer removal through exposure of UV irradiated cells to photoreactivating light indicate that dimers act as the critical lesions blocking DNA synthesis.

  11. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  12. Oxidative DNA damage induced by aminoacetone, an amino acid metabolite.

    PubMed

    Hiraku, Y; Sugimoto, J; Yamaguchi, T; Kawanishi, S

    1999-05-01

    We investigated DNA damage induced by aminoacetone, a metabolite of threonine and glycine. Pulsed-field gel electrophoresis revealed that aminoacetone caused cellular DNA cleavage. Aminoacetone increased the amount of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) in human cultured cells in a dose-dependent manner. The formation of 8-oxodG in calf thymus DNA increased due to aminoacetone only in the presence of Cu(II). DNA ladder formation was observed at higher concentrations of aminoacetone than those causing DNA cleavage. Flow cytometry showed that aminoacetone enhanced the generation of hydrogen peroxide (H2O2) in cultured cells. Aminoacetone caused damage to 32P-5'-end-labeled DNA fragments, obtained from the human c-Ha-ras-1 and p53 genes, at cytosine and thymine residues in the presence of Cu(II). Catalase and bathocuproine inhibited DNA damage, suggesting that H2O2 and Cu(I) were involved. Analysis of the products generated from aminoacetone revealed that aminoacetone underwent Cu(II)-mediated autoxidation in two different pathways: the major pathway in which methylglyoxal and NH+4 are generated and the minor pathway in which 2,5-dimethylpyrazine is formed through condensation of two molecules of aminoacetone. These findings suggest that H2O2 generated by the autoxidation of aminoacetone reacts with Cu(I) to form reactive species capable of causing oxidative DNA damage.

  13. Temporal relationships of chromatin protein synthesis, DNA synthesis, and assembly of deoxyribonucleoprotein.

    PubMed Central

    Seale, R L

    1976-01-01

    Chromatin assembly has been investigated in terms of the sites on DNA where newly synthesized chromatin proteins associate. Chromatin from cells labeled with [14C]-BrdUrd and [3H]lysine was fixed with formaldehyde and resolved in CsCl gradients. By varying the spacing of the labeling intervals of the two isotopes so as to encompass all possible periods in S-phase, the association of labeled, newly synthesized proteins on newly synthesized (BrdUrd-substituted) or preexisting chromatin DNA was determined. In all experiments it was found that newly synthesized chromatin proteins predominantly associated with nonreplicating DNA. Possible mechanisms by which cells recycle preexisting chromatin proteins to restore the protein content of newly synthesized DNA are discussed. PMID:1065876

  14. Click Reaction on Solid Phase Enables High Fidelity Synthesis of Nucleobase-Modified DNA.

    PubMed

    Tolle, Fabian; Rosenthal, Malte; Pfeiffer, Franziska; Mayer, Günter

    2016-03-16

    The post-synthetic functionalization of nucleic acids via click chemistry (CuAAC) has seen tremendous implementation, extending the applicability of nucleobase-modified nucleic acids in fields like fluorescent labeling, nanotechnology, and in vitro selection. However, the production of large quantities of high-density functionalized material via solid phase synthesis has been hampered by oxidative by-product formation associated with the alkaline workup conditions. Herein, we describe a rapid and cost-effective protocol for the high fidelity large-scale production of nucleobase-modified nucleic acids, exemplified with a recently described nucleobase-modified aptamer.

  15. Click Reaction on Solid Phase Enables High Fidelity Synthesis of Nucleobase-Modified DNA.

    PubMed

    Tolle, Fabian; Rosenthal, Malte; Pfeiffer, Franziska; Mayer, Günter

    2016-03-16

    The post-synthetic functionalization of nucleic acids via click chemistry (CuAAC) has seen tremendous implementation, extending the applicability of nucleobase-modified nucleic acids in fields like fluorescent labeling, nanotechnology, and in vitro selection. However, the production of large quantities of high-density functionalized material via solid phase synthesis has been hampered by oxidative by-product formation associated with the alkaline workup conditions. Herein, we describe a rapid and cost-effective protocol for the high fidelity large-scale production of nucleobase-modified nucleic acids, exemplified with a recently described nucleobase-modified aptamer. PMID:26850226

  16. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  17. Versatile Multicomponent Reaction Macrocycle Synthesis Using α-Isocyano-ω-carboxylic Acids.

    PubMed

    Liao, George P; Abdelraheem, Eman M M; Neochoritis, Constantinos G; Kurpiewska, Katarzyna; Kalinowska-Tłuścik, Justyna; McGowan, David C; Dömling, Alexander

    2015-10-16

    The direct macrocycle synthesis of α-isocyano-ω-carboxylic acids via an Ugi multicomponent reaction is introduced. This multicomponent reaction (MCR) protocol differs by being especially short, convergent, and versatile, giving access to 12-22 membered rings.

  18. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  19. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  20. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing.

    PubMed

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-21

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au(+) complexes, and then a class of ∼2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ∼1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au(+) complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe(3+) with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe(3+), and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs. PMID:26391420

  1. A microfluidic DNA computing processor for gene expression analysis and gene drug synthesis.

    PubMed

    Zhang, Yu; Yu, Hao; Qin, Jianhua; Lin, Bingcheng

    2009-11-06

    Boolean logic performs a logical operation on one or more logic input and produces a single logic output. Here, we describe a microfluidic DNA computing processor performing Boolean logic operations for gene expression analysis and gene drug synthesis. Multiple cancer-related genes were used as input molecules. Their expression levels were identified by interacting with the computing related DNA strands, which were designed according to the sequences of cancer-related genes and the suicide gene. When all the expressions of the cancer-related genes fit in with the diagnostic criteria, positive diagnosis would be confirmed and then a complete suicide gene (gene drug) could be synthesized as an output molecule. Microfluidic chip was employed as an effective platform to realize the computing process by integrating multistep biochemical reactions involving hybridization, displacement, denaturalization, and ligation. By combining the specific design of the computing related molecules and the integrated functions of the microfluidics, the microfluidic DNA computing processor is able to analyze the multiple gene expressions simultaneously and realize the corresponding gene drug synthesis with simplicity and fast speed, which demonstrates the potential of this platform for DNA computing in biomedical applications.

  2. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  3. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  4. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  5. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement. PMID:21157681

  6. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  7. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  8. A Transcriptional Repressor ZBTB1 Promotes Chromatin Remodeling and Translesion DNA Synthesis

    PubMed Central

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A.; D’Andrea, Alan D.

    2014-01-01

    SUMMARY Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for PCNA monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for PCNA monoubiquitination, by localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a new ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair. PMID:24657165

  9. One-pot synthesis of fluorescent oligonucleotide Ag nanoclusters for specific and sensitive detection of DNA.

    PubMed

    Lan, Guo-Yu; Chen, Wei-Yu; Chang, Huan-Tsung

    2011-01-15

    In this study, we prepared fluorescent, functional oligonucleotide-stabilized silver nanoclusters (FFDNA-Ag NCs) through one-pot synthesis and then employed them as probes for single nucleotide polymorphisms (SNPs). The FFDNA-Ag NCs were obtained through the NaBH(4)-mediated reduction of AgNO(3) in the presence of a DNA strand having the sequence 5'-C(12)-CCAGATACTCACCGG-3'. The specific DNA scaffold combines a fluorescent base motif (C(12)) and a specific sequence (CCAGATACTCACCGG) that recognizes a gene for fumarylacetoacetate hydrolase (FAH). The sensing mechanism of our new probe is based on the FFDNA-Ag NCs having different stabilities (fluorescence intensities) in solutions containing 150 mM NaCl in the absence and presence of perfect match DNA (DNA(pmt)). Under the optimal conditions (150 mM NaCl, 20 mM phosphate solution, pH 7.0), the fluorescence ratios of the FFDNA-Ag NC probes in the presence and absence of DNA(pmt), plotted against the concentration of DNA(pmt), was linear over the range 25-1000 nM (R(2)=0.98), with a limit of detection (S/N=3) of 14 nM. This cost-effective and simple FFDNA-Ag NC probe is sensitive and selective for SNPs of a gene for FAH.

  10. Transcriptional repressor ZBTB1 promotes chromatin remodeling and translesion DNA synthesis.

    PubMed

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A; D'Andrea, Alan D

    2014-04-10

    Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for proliferating cell nuclear antigen (PCNA) monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair.

  11. Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

    SciTech Connect

    Lovrinovic, Marina; Niemeyer, Christof M. . E-mail: christof.niemeyer@uni-dortmund.de

    2005-09-30

    We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter were ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.

  12. Fluorine containing amino acids: synthesis and peptide coupling of amino acids containing the all-cis tetrafluorocyclohexyl motif.

    PubMed

    Ayoup, Mohammed Salah; Cordes, David B; Slawin, Alexandra M Z; O'Hagan, David

    2015-05-28

    A synthesis of two (S)-phenylalanine derivatives is described which have the all-cis, 2,3,5,6-tetrafluorocyclohexyl motif attached to the aromatic ring at the meta and para positions; the para substituted isomer is elaborated into illustrative dipeptides via the free amine and carboxylate respectively demonstrating its utility as a novel amino acid for peptide synthesis and offering a vehicle for incorporation of this unique and facially polarized ring system into bioactive compounds.

  13. In vitro synthesis of large peptide molecules using glucosylated single-stranded bacteriophage T4D DNA template.

    PubMed Central

    Hulen, C; Legault-Demare, J

    1975-01-01

    Denatured Bacteriophage T4D DNA is able to stimulate aminoacid incorporation into TCA-precipitable material in an in vitro protein synthesis system according to base DNA sequences. Newly synthesized polypeptides remain associated with ribosomes and have a molecular weight in range of 15,000 to 45,000 Daltons. PMID:1052527

  14. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  15. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  16. Highly efficient procedure for the synthesis of fructone fragrance using a novel carbon based acid.

    PubMed

    Hu, Baowei; Li, Chunqing; Zhao, Sheng-Xian; Rong, Lin-Mei; Lv, Shao-Qin; Liang, Xuezheng; Qi, Chenze

    2010-08-01

    The novel carbon based acid has been synthesized via one-step hydrothermal carbonization of furaldehyde and hydroxyethylsulfonic acid. A highly efficient procedure for the synthesis of fructone has been developed using the novel carbon based acid. The results showed that the catalyst possessed high activity for the reaction, giving a yield of over 95%. The advantages of high activity, stability, reusability and low cost for a simple synthesis procedure and wide applicability to various diols and beta-keto esters make this novel carbon based acid one of the best choices for the reaction.

  17. The role of submarine hydrothermal systems in the synthesis of amino acids.

    PubMed

    Aubrey, A D; Cleaves, H J; Bada, Jeffrey L

    2009-04-01

    There is little consensus regarding the plausibility of organic synthesis in submarine hydrothermal systems (SHSs) and its possible relevance to the origin of life. The primary reason for the persistence of this debate is that most experimental high temperature and high-pressure organic synthesis studies have neglected important geochemical constraints with respect to source material composition. We report here the results of experiments exploring the potential for amino acid synthesis at high temperature from synthetic seawater solutions of varying composition. The synthesis of amino acids was examined as a function of temperature, heating time, starting material composition and concentration. Using very favorable reactant conditions (high concentrations of reactive, reduced species), small amounts of a limited set of amino acids are generated at moderate temperature conditions ( approximately 125-175 degrees C) over short heating times of a few days, but even these products are significantly decomposed after exposure times of approximately 1 week. The high concentration dependence observed for these synthetic reactions are demonstrated by the fact that a 10-fold drop in concentration results in orders of magnitude lower yields of amino acids. There may be other synthetic mechanisms not studied herein that merit investigation, but the results are likely to be similar. We conclude that although amino acids can be generated from simple likely environmentally available precursors under SHS conditions, the equilibrium at high temperatures characteristic of SHSs favors net amino acid degradation rather than synthesis, and that synthesis at lower temperatures may be more favorable. PMID:19034685

  18. DNA Diagnostics: Nanotechnology-enhanced Electrochemical Detection of Nucleic Acids

    PubMed Central

    Wei, Fang; Lillehoj, Peter B.; Ho, Chih-Ming

    2010-01-01

    The detection of mismatched base pairs in DNA plays a crucial role in the diagnosis of genetic-related diseases and conditions, especially for early stage treatment. Among the various biosensors that have been employed for DNA detection, electrochemical sensors show great promise since they are capable of precise DNA recognition and efficient signal transduction. Advancements in micro- and nanotechnologies, specifically fabrication techniques and new nanomaterials, have enabled for the development of highly sensitive, highly specific sensors making them attractive for the detection of small sequence variations. Furthermore, the integration of sensors with sample preparation and fluidic processes enables for rapid, multiplexed DNA detection for point-of-care (POC) clinical diagnostics. PMID:20075759

  19. A simple and efficient enzymatic method for covalent attachment of DNA to cellulose. Application for hybridization-restriction analysis and for in vitro synthesis of DNA probes.

    PubMed Central

    Goldkorn, T; Prockop, D J

    1986-01-01

    Single-stranded DNAs (ssDNAs) were covalently bound by a simple and efficient enzymatic method to a solid support matrix and used to develop several new procedures for gene analysis. The novel procedure to prepare a ssDNA stably coupled to a solid support employed T4 DNA ligase to link covalently oligo (dT)-cellulose and (dA)-tailed DNA. Beginning with essentially any double stranded DNA the procedure generates a ssDNA linked by its 5' end to a cellulose matrix in a concentration of over 500 ng per mg. DNA from the plasmid pBR322 (4300 bp) and a fragment of the beta-globin gene (1800 bp) were coupled to the solid support and used for several experiments. The ssDNAs on the cellulose efficiently hybridized with as little as 5 pg of complementary double-stranded DNAs. The DNA hybrids formed on the solid support were specifically and efficiently cleaved by restriction endonucleases. These specific restriction cuts were utilized for the diagnosis of correct sequences. In addition, the ssDNA on the solid support served as an efficient template for the synthesis of complementary ssDNAs. The complementary synthesized ssDNAs were uniformly labeled, more than two kilobases in size, and largely full length. About 85% of the ssDNA linked to cellulose was available for the synthesis of complementary DNA, and after strand-separation, the preparation was reusable for the synthesis of additional complementary DNA. Images PMID:3024131

  20. A versatile biosensing system for DNA-related enzyme activity assay via the synthesis of silver nanoclusters using enzymatically-generated DNA as template.

    PubMed

    Yuan, Yijia; Li, Wenhua; Liu, Zhuoliang; Nie, Zhou; Huang, Yan; Yao, Shouzhuo

    2014-11-15

    In the present day, oligonucleotide-encapsulated silver clusters (DNA-AgNCs) have been widely applied into bio-analysis as a signal producer. Herein, we developed a novel method to synthesize DNA-AgNCs encapsulated by long-chain cytosine (C)-rich DNA. Such DNA was polymerized in a template-free way by terminal deoxynucleotidyl transferase (TdT). We demonstrated that TdT-polymerized long chain C-rich DNA can serve as an excellent template for AgNCs synthesis. Based on this novel synthesis strategy, we developed a label-free and turn-on fluorescence assay to detect TdT activity with ultralow limit of detection (LOD) of 0.0318 U and ultrahigh signal to background (S/B) of 46.7. Furthermore, our proposed method was extended to a versatile biosensing strategy for turn-on nucleases activity assay based on the enzyme-activated TdT polymerization. Two nucleases, EcoRI and ExoIII as model of endonuclease and exonuclease, respectively, have been detected with high selectivity and competitive low LOD of 0.0629 U and 0.00867 U, respectively. Our work demonstrates the feasibility of TdT polymerization-based DNA-AgNCs synthesis strategy as a versatile and potent biosensing platform to detect the activity of DNA-related enzymes.

  1. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells.

    PubMed

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells' molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  2. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  3. Synthesis and characterization of Fatty acid/amino Acid self-assemblies.

    PubMed

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; Fray, Miroslawa El

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as "R" (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196-239 nm and critical micelle concentration (CMC) of 0.125-0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  4. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  5. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  6. Synthesis of amino-acid derivatives and dipeptides with an original peptidase enzyme.

    PubMed

    Auriol, D; Paul, F; Yoshpe, I; Gripon, J C; Monsan, P

    1991-01-01

    A peptidase from the non pathogenic Staphylococcus sp. strain BEC 299 was purified to a final specific activity of 84,400 U/mg protein. Its molecular weight is 450 kDa and optimum pH 10.0. This enzyme catalyzes the synthesis of dipeptides (aspartame) and alpha-amino acid derivatives (N-L-malyl-L-tyrosine ethyl ester). The influence of cosolvents and pH on dipeptides and alpha-amino acid derivative synthesis is described. Finally, we detail the use of the peptidase as a reagent in protease-catalyzed peptide synthesis.

  7. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    NASA Astrophysics Data System (ADS)

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-01

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

  8. Superior structure stability and selectivity of hairpin nucleic acid probes with an L-DNA stem.

    PubMed

    Kim, Youngmi; Yang, Chaoyong James; Tan, Weihong

    2007-01-01

    Hairpin nucleic acid probes have been highly useful in many areas, especially for intracellular and in vitro nucleic acid detection. The success of these probes can be attributed to the ease with which their conformational change upon target binding can be coupled to a variety of signal transduction mechanisms. However, false-positive signals arise from the opening of the hairpin due mainly to thermal fluctuations and stem invasions. Stem invasions occur when the stem interacts with its complementary sequence and are especially problematic in complex biological samples. To address the problem of stem invasions in hairpin probes, we have created a modified molecular beacon that incorporates unnatural enantiomeric l-DNA in the stem and natural d-DNA or 2'-O-Me-modified RNA in the loop. l-DNA has the same physical characteristics as d-DNA except that l-DNA cannot form stable duplexes with d-DNA. Here we show that incorporating l-DNA into the stem region of a molecular beacon reduces intra- and intermolecular stem invasions, increases the melting temperature, improves selectivity to its target, and leads to enhanced bio-stability. Our results suggest that l-DNA is useful for designing functional nucleic acid probes especially for biological applications.

  9. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  10. Human DNA Polymerase ν Catalyzes Correct and Incorrect DNA Synthesis with High Catalytic Efficiency.

    PubMed

    Gowda, A S Prakasha; Moldovan, George-Lucian; Spratt, Thomas E

    2015-06-26

    DNA polymerase ν (pol ν) is a low fidelity A-family polymerase with a putative role in interstrand cross-link repair and homologous recombination. We carried out pre-steady-state kinetic analysis to elucidate the kinetic mechanism of this enzyme. We found that the mechanism consists of seven steps, similar that of other A-family polymerases. pol ν binds to DNA with a Kd for DNA of 9.2 nm, with an off-rate constant of 0.013 s(-1)and an on-rate constant of 14 μm(-1) s(-1). dNTP binding is rapid with Kd values of 20 and 476 μm for the correct and incorrect dNTP, respectively. Pyrophosphorylation occurs with a Kd value for PPi of 3.7 mm and a maximal rate constant of 11 s(-1). Pre-steady-state kinetics, examination of the elemental effect using dNTPαS, and pulse-chase experiments indicate that a rapid phosphodiester bond formation step is flanked by slow conformational changes for both correct and incorrect base pair formation. These experiments in combination with computer simulations indicate that the first conformational change occurs with rate constants of 75 and 20 s(-1); rapid phosphodiester bond formation occurs with a Keq of 2.2 and 1.7, and the second conformational change occurs with rate constants of 2.1 and 0.5 s(-1), for correct and incorrect base pair formation, respectively. The presence of a mispair does not induce the polymerase to adopt a low catalytic conformation. pol ν catalyzes both correct and mispair formation with high catalytic efficiency.

  11. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  12. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  13. Impaired coenzyme A synthesis in fission yeast causes defective mitosis, quiescence-exit failure, histone hypoacetylation and fragile DNA

    PubMed Central

    Nakamura, Takahiro; Pluskal, Tomáš; Nakaseko, Yukinobu; Yanagida, Mitsuhiro

    2012-01-01

    Biosynthesis of coenzyme A (CoA) requires a five-step process using pantothenate and cysteine in the fission yeast Schizosaccharomyces pombe. CoA contains a thiol (SH) group, which reacts with carboxylic acid to form thioesters, giving rise to acyl-activated CoAs such as acetyl-CoA. Acetyl-CoA is essential for energy metabolism and protein acetylation, and, in higher eukaryotes, for the production of neurotransmitters. We isolated a novel S. pombe temperature-sensitive strain ppc1-537 mutated in the catalytic region of phosphopantothenoylcysteine synthetase (designated Ppc1), which is essential for CoA synthesis. The mutant becomes auxotrophic to pantothenate at permissive temperature, displaying greatly decreased levels of CoA, acetyl-CoA and histone acetylation. Moreover, ppc1-537 mutant cells failed to restore proliferation from quiescence. Ppc1 is thus the product of a super-housekeeping gene. The ppc1-537 mutant showed combined synthetic lethal defects with five of six histone deacetylase mutants, whereas sir2 deletion exceptionally rescued the ppc1-537 phenotype. In synchronous cultures, ppc1-537 cells can proceed to the S phase, but lose viability during mitosis failing in sister centromere/kinetochore segregation and nuclear division. Additionally, double-strand break repair is defective in the ppc1-537 mutant, producing fragile broken DNA, probably owing to diminished histone acetylation. The CoA-supported metabolism thus controls the state of chromosome DNA. PMID:23091701

  14. Biodegradable DNA-Brush Block Copolymer Spherical Nucleic Acids Enable Transfection Agent-Free Intracellular Gene Regulation.

    PubMed

    Zhang, Chuan; Hao, Liangliang; Calabrese, Colin M; Zhou, Yu; Choi, Chung Hang J; Xing, Hang; Mirkin, Chad A

    2015-10-28

    By grafting multiple DNA strands onto one terminus of a polyester chain, a DNA-brush block copolymer that can assemble into micelle structure is constructed. These micelle spherical nucleic acids have a density of nucleic acids that is substantively higher than linear DNA block copolymer structures, which makes them effective cellular transfection and intracellular gene regulation agents.

  15. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  16. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  17. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition.

  18. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  19. Amino acid racemization in amber-entombed insects: implications for DNA preservation

    NASA Technical Reports Server (NTRS)

    Bada, J. L.; Wang, X. S.; Poinar, H. N.; Paabo, S.; Poinar, G. O.

    1994-01-01

    DNA depurination and amino acid racemization take place at similar rates in aqueous solution at neutral pH. This relationship suggests that amino acid racemization may be useful in accessing the extent of DNA chain breakage in ancient biological remains. To test this suggestion, we have investigated the amino acids in insects entombed in fossilized tree resins ranging in age from <100 years to 130 million years. The amino acids present in 40 to 130 million year old amber-entombed insects resemble those in a modern fly and are probably the most ancient, unaltered amino acids found so far on Earth. In comparison to other geochemical environments on the surface of the Earth, the amino acid racemization rate in amber insect inclusions is retarded by a factor of >10(4). These results suggest that in amber insect inclusions DNA depurination rates would also likely be retarded in comparison to aqueous solution measurements, and thus DNA fragments containing many hundreds of base pairs should be preserved. This conclusion is consistent with the reported successful retrieval of DNA sequences from amber-entombed organisms.

  20. End invasion of peptide nucleic acids (PNAs) with mixed-base composition into linear DNA duplexes.

    PubMed

    Smolina, Irina V; Demidov, Vadim V; Soldatenkov, Viatcheslav A; Chasovskikh, Sergey G; Frank-Kamenetskii, Maxim D

    2005-01-01

    Peptide nucleic acid (PNA) is a synthetic DNA mimic with valuable properties and a rapidly growing scope of applications. With the exception of recently introduced pseudocomplementary PNAs, binding of common PNA oligomers to target sites located inside linear double-stranded DNAs (dsDNAs) is essentially restricted to homopurine-homopyrimidine sequence motifs, which significantly hampers some of the PNA applications. Here, we suggest an approach to bypass this limitation of common PNAs. We demonstrate that PNA with mixed composition of ordinary nucleobases is capable of sequence-specific targeting of complementary dsDNA sites if they are located at the very termini of DNA duplex. We then show that such targeting makes it possible to perform capturing of designated dsDNA fragments via the DNA-bound biotinylated PNA as well as to signal the presence of a specific dsDNA sequence, in the case a PNA beacon is employed. We also examine the PNA-DNA conjugate and prove that it can initiate the primer-extension reaction starting from the duplex DNA termini when a DNA polymerase with the strand-displacement ability is used. We thus conclude that recognition of duplex DNA by mixed-base PNAs via the end invasion has a promising potential for site-specific and sequence-unrestricted DNA manipulation and detection.