Science.gov

Sample records for acid dna synthesis

  1. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  2. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  3. Stimulation of Endomitotic DNA Synthesis and Cell Elongation by Gibberellic Acid in Epicotyls Grown from Gamma-irradiated Pea Seeds 1

    PubMed Central

    Callebaut, Alfons; Van Oostveldt, Patrick; Van Parijs, Roger

    1980-01-01

    Large doses of γ-irradiation, given to air-dried pea seeds, inhibit the endomitotic DNA synthesis in pea epicotyls during germination in darkness. The cortex cells of the etiolated epicotyls reach only the 4 C DNA level, whereas cortex cells of unirradiated seeds reach the 8 C DNA level. Epicotyl elongation and cell elongation are also reduced. Application of gibberellic acid restores the endomitotic DNA synthesis and the cell elongation in epicotyls of irradiated seeds. The cortex cells reach again the 8 C DNA level in darkness. The results suggest that γ-irradiation blocks endomitotic DNA synthesis and cell elongation by lowering the concentration of endogenous gibberellins. PMID:16661127

  4. Synthesis and DNA-binding properties of novel DNA cyclo-intercalators containing purine-glucuronic acid hybrids.

    PubMed

    Zhang, Renshuai; Chen, Shaopeng; Wang, Xueting; Yu, Rilei; Li, Mingjing; Ren, Sumei; Jiang, Tao

    2016-06-24

    Novel DNA cyclo-intercalators, which incorporated two intercalator subunits linked by two bridges, were synthesized. Binding of the compounds to calf-thymus DNA was studied by fluorescence spectroscopy, and docking simulations were used to predict the binding modes of these cyclic compounds. The spectral data demonstrated that all of these compounds can interact with CT-DNA. The sugar moiety played an important role in the process of binding between the intercalators containing glucuronic acid and DNA. The length and flexibility of the connecting bridges affected the binding affinity of the resultant cyclo-intercalators. Docking simulations showed that compounds 7 and 8 interact with DNA as mono-intercalators.

  5. DNA (deoxyribonucleic acid) synthesis following microinjection of heterologous sperm and somatic cell nuclei into hamster oocytes

    SciTech Connect

    Naish, S.J.; Perreault, S.D.; Zirkin, B.R.

    1987-01-01

    The authors investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in /sup 3/H-thymidine after being parthenogenetically activated by sham microinjection, or microinjected with hamster, mouse, rabbit, or fish sperm nuclei, or hamster hepatocyte nuclei. Within 6 hr of sham or nucleus microinjection, nuclei of each type underwent transformation into pronuclei and synthesized DNA. These results demonstrated that the hamster egg can access and utilize its own and each type of template provided, whether homologous or heterologous. However, pronuclei derived from hamster sperm nuclei were more likely to be synthesizing DNA at 6 hr than pronuclei derived from sperm nuclei of other species. The authors conclude that the mechanisms employed by the hamster oocyte to transform hamster sperm nuclei into pronuclei and to effect DNA synthesis in these nuclei are not specific for the hamster sperm nucleus. Nevertheless, these mechanisms apparently operate more efficiently when the hamster sperm nucleus, rather than a heterologous sperm nucleus, is present.

  6. Design and synthesis of N-benzoyl amino acid derivatives as DNA methylation inhibitors.

    PubMed

    Garella, Davide; Atlante, Sandra; Borretto, Emily; Cocco, Mattia; Giorgis, Marta; Costale, Annalisa; Stevanato, Livio; Miglio, Gianluca; Cencioni, Chiara; Fernández-de Gortari, Eli; Medina-Franco, José L; Spallotta, Francesco; Gaetano, Carlo; Bertinaria, Massimo

    2016-11-01

    The inhibition of human DNA Methyl Transferases (DNMT) is a novel promising approach to address the epigenetic dysregulation of gene expression in different diseases. Inspired by the validated virtual screening hit NSC137546, a series of N-benzoyl amino acid analogues was synthesized and obtained compounds were assessed for their ability to inhibit DNMT-dependent DNA methylation in vitro. The biological screening allowed the definition of a set of preliminary structure-activity relationships and the identification of compounds promising for further development. Among the synthesized compounds, L-glutamic acid derivatives 22, 23, and 24 showed the highest ability to prevent DNA methylation in a total cell lysate. Compound 22 inhibited DNMT1 and DNMT3A activity in a concentration-dependent manner in the micromolar range. In addition, compound 22 proved to be stable in human serum and it was thus selected as a starting point for further biological studies.

  7. Homodinuclear lanthanide complexes of phenylthiopropionic acid: synthesis, characterization, cytotoxicity, DNA cleavage, and antimicrobial activity.

    PubMed

    Shiju, C; Arish, D; Kumaresan, S

    2013-03-15

    Lanthanide complexes of La(III), Pr(III), Nd(III), Sm(III), and Ho(III) with phenylthiopropionic acid were synthesized and characterized by elemental analysis, mass, IR, electronic spectra, molar conductance, TGA, and powder XRD. The results show that the lanthanide complexes are homodinuclear in nature. The two lanthanide ions are bridged by eight oxygen atoms from four carboxylate groups. Thermal decomposition profiles are consistent with the proposed formulations. Powder XRD studies show that all the complexes are amorphous in nature. Antimicrobial studies indicate that these complexes exhibit more activity than the ligand itself. The DNA cleavage activity of the ligand and its complexes were assayed on Escherichia coli DNA using gel electrophoresis in the presence of H(2)O(2). The result shows that the Pr(III) and Nd(III) complexes have completely cleaved the DNA. The anticancer activities of the complexes have also been studied towards human cervical cancer cell line (HeLa) and colon cancer cells (HCT116) and it was found that the La(III) and Nd(III) complexes are more active than the corresponding Pr(III), Sm(III), Ho(III) complexes, and the free ligand on both the cancer cells.

  8. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    PubMed

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  9. Direct electrical detection of DNA synthesis

    PubMed Central

    Pourmand, Nader; Karhanek, Miloslav; Persson, Henrik H. J.; Webb, Chris D.; Lee, Thomas H.; Zahradníková, Alexandra; Davis, Ronald W.

    2006-01-01

    Rapid, sequence-specific DNA detection is essential for applications in medical diagnostics and genetic screening. Electrical biosensors that use immobilized nucleic acids are especially promising in these applications because of their potential for miniaturization and automation. Current DNA detection methods based on sequencing by synthesis rely on optical readouts; however, a direct electrical detection method for this technique is not available. We report here an approach for direct electrical detection of enzymatically catalyzed DNA synthesis by induced surface charge perturbation. We discovered that incorporation of a complementary deoxynucleotide (dNTP) into a self-primed single-stranded DNA attached to the surface of a gold electrode evokes an electrode surface charge perturbation. This event can be detected as a transient current by a voltage-clamp amplifier. Based on current understanding of polarizable interfaces, we propose that the electrode detects proton removal from the 3′-hydroxyl group of the DNA molecule during phosphodiester bond formation. PMID:16614066

  10. Synthesis and DNA transfection properties of new head group modified malonic acid diamides.

    PubMed

    Wölk, Christian; Heinze, Martin; Kreideweiss, Patrick; Dittrich, Matthias; Brezesinski, Gerald; Langner, Andreas; Dobner, Bodo

    2011-05-16

    Malonic acid diamides with two long hydrophobic alkyl chains and a basic polar head group as a new class of non-viral gene transferring compounds have shown high transfection efficiency and moderate toxicity. Based on the results obtained with saturated and unsaturated alkyl residues new derivatives with a more complex head group structure have been synthesized. For this purpose, cationic respectively basic groups were introduced by one or two lysine residues bound via tris(aminoethyl)amine spacer to the malonic acid diamide backbone. By studying in vitro gene delivery an increase of transfection efficacy was observed when using lipids with at least one unsaturated alkyl chain. This leads to cationic lipids exhibiting comparable or even higher transfection efficacies compared to the commercially available transfection agents LipofectAmine™ and SuperFect™. Phase transitions and phase structures of selected compounds have been analyzed and discussed in terms of transfection abilities. Particle size and zeta potential of liposomes and lipoplexes were also determined.

  11. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  12. Synthesis and multi-spectroscopic DNA binding study of 1,3,4-oxadiazole and 1,3,4-thiadiazole derivatives of fatty acid

    NASA Astrophysics Data System (ADS)

    Hassan, Mohammad F.; Rauf, Abdul

    2016-01-01

    A facile and convenient synthesis of a series of fatty acid derivatives of 1,3,4-oxadiazole and 1,3,4-thiadiazole has been described. The key step of this protocol is the cyclization of acyl thiosemicarbazides via iodobenzene diacetate and methanesulfonic acid under mild conditions. The newly synthesized compounds were characterized by FT-IR, 1HNMR, 13CNMR and mass spectral study. The binding affinity of 5-(pentadecyl)-N-propenyl-1,3,4-oxadiazol-2-amine (3a) and 5-(heptadecyl)-2-amino-1,3,4-thiadiazole (6a) with CT-DNA has been evaluated by UV, fluorescence, Circular Dichroism (CD) and thermal denaturation studies. It has been found that these small and planer heteroaromatic compounds are capable of binding to the minor groove region of DNA.

  13. Synthesis and multi-spectroscopic DNA binding study of 1,3,4-oxadiazole and 1,3,4-thiadiazole derivatives of fatty acid.

    PubMed

    Hassan, Mohammad F; Rauf, Abdul

    2016-01-15

    A facile and convenient synthesis of a series of fatty acid derivatives of 1,3,4-oxadiazole and 1,3,4-thiadiazole has been described. The key step of this protocol is the cyclization of acyl thiosemicarbazides via iodobenzene diacetate and methanesulfonic acid under mild conditions. The newly synthesized compounds were characterized by FT-IR, (1)HNMR, (13)CNMR and mass spectral study. The binding affinity of 5-(pentadecyl)-N-propenyl-1,3,4-oxadiazol-2-amine (3a) and 5-(heptadecyl)-2-amino-1,3,4-thiadiazole (6a) with CT-DNA has been evaluated by UV, fluorescence, Circular Dichroism (CD) and thermal denaturation studies. It has been found that these small and planer heteroaromatic compounds are capable of binding to the minor groove region of DNA.

  14. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  15. Lysophosphatidic acid induces both EGFR-dependent and EGFR-independent effects on DNA synthesis and migration in pancreatic and colorectal carcinoma cells.

    PubMed

    Tveteraas, Ingun Heiene; Aasrum, Monica; Brusevold, Ingvild Johnsen; Ødegård, John; Christoffersen, Thoralf; Sandnes, Dagny

    2016-02-01

    Lysophosphatidic acid (LPA) is a small glycerophospholipid ubiquitously present in tissues and plasma. It acts through receptors belonging to the G-protein-coupled receptor (GPCR) family, is involved in several biological processes, and is strongly implicated in different cancers. In this paper, we have investigated the effects of LPA on DNA synthesis and migration in a panel of pancreatic and colon cancer cells, with particular focus on the involvement of the epidermal growth factor (EGF) receptor (EGFR) in LPA-induced signaling. LPA stimulated DNA synthesis and/or migration in all the cell lines included in this study. In five of the six cell lines, LPA induced phosphorylation of the EGFR, and the effects on EGFR and Akt, and in some of the cells also ERK, were sensitive to the EGFR tyrosine kinase inhibitor gefitinib, strongly suggesting LPA-induced EGFR transactivation in these cells. In contrast, in one of the pancreatic carcinoma cell lines (Panc-1), we found no evidence of transactivation of the EGFR. In the pancreatic carcinoma cell lines where transactivation took place (BxPC3, AsPC1, HPAFII), gefitinib reduced LPA-induced DNA synthesis and/or migration. However, we also found evidence of transactivation in the two colon carcinoma cell lines (HT29, HCT116) although gefitinib did not inhibit LPA-induced DNA synthesis or migration in these cells. Taken together, the data indicate that in many gastrointestinal carcinoma cells, LPA uses EGFR transactivation as a mechanism when exerting such effects as stimulation of cell proliferation and migration, but EGFR-independent pathways may be involved instead of, or in concerted action with, the EGFR transactivation.

  16. Synthesis, physicochemical studies, embryos toxicity and DNA interaction of some new Iron(II) Schiff base amino acid complexes

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; El-Khatib, Rafat M.; Nassr, Lobna A. E.; Abu-Dief, Ahmed M.

    2013-05-01

    New Fe(II) Schiff base amino acid complexes derived from the condensation of o-hydroxynaphthaldehyde with L-alanine, L-phenylalanine, L-aspartic acid, L-histidine and L-arginine were synthesized and characterized by elemental analysis, IR, electronic spectra, and conductance measurements. The stoichiometry and the stability constants of the complexes were determined spectrophotometrically. The investigated Schiff bases exhibited tridentate coordination mode with the general formulae [Fe(HL)2]·nH2O for all amino acids except L-histidine. But in case of L-histidine, the ligand acts as tetradentate ([FeL(H2O)2]·2H2O), where HL = mono anion and L = dianion of the ligand. The structure of the prepared complexes is suggested to be octahedral. The prepared complexes were tested for their toxicity on chick embryos and found to be safe until a concentration of 100 μg/egg with full embryos formation. The interaction between CT-DNA and the investigated complexes were followed by spectrophotometry and viscosity measurements. It was found that, the prepared complexes bind to DNA via classical intercalative mode and showed a different DNA cleavage activity with the sequence: nhi > nari > nali > nasi > nphali. The thermodynamic Profile of the binding of nphali complex and CT-DNA was constructed by analyzing the experimental data of absorption titration and UV melting studies with the McGhee equation, van't Hoff's equation, and the Gibbs-Helmholtz equation.

  17. Biphasic DNA Synthesis in Spumaviruses

    PubMed Central

    Delelis, Olivier; Saïb, Ali; Sonigo, Pierre

    2003-01-01

    Spumaviruses are complex retroviruses whose replication cycle resembles that of hepadnaviruses, especially by a late-occurring reverse transcription step. The possible existence of an early reverse transcription as observed in other retroviruses was not documented. Using real-time quantitative PCR, we addressed directly the kinetics of DNA synthesis during spumavirus infection. An early phase of viral DNA synthesis developed until 3 h postinfection, followed by a second phase, culminating 10 h postinfection. Both phases were abolished by the reverse transcriptase inhibitor 3′-azido-3′-deoxythymidine. Similar to other retroviruses, circular forms of viral DNA harboring two long terminal repeats were mainly found in the nucleus of infected cells. Interestingly, a fraction of these circular forms were detected in the cytoplasm and in extracellular virions, a feature shared with hepadnaviruses. Combined with packaging of both viral DNA and RNA genomes in virions, early and late reverse transcription might allow spumavirus to maximize its genome replication. PMID:12829852

  18. Concepts in Biochemistry: Chemical Synthesis of DNA.

    ERIC Educational Resources Information Center

    Caruthers, Marvin H.

    1989-01-01

    Outlines the chemistry of the rapid synthesis of relatively large DNA fragments (100-200 monomers each) with yields exceeding 99 percent per coupling. DNA synthesis methodologies are outlined and a polymer-supported synthesis of DNA using deoxynucleoside phosphoramidites is described with structural formulas. (YP)

  19. Enzymatic initiation of DNA synthesis by yeast DNA polymerases.

    PubMed Central

    Plevani, P; Chang, L M

    1977-01-01

    Partially purified yeast RNA polymerases (RNA nucleotidyltransferases) initiate DNA synthesis by yeast DNA polymerase (DNA nucleotidyltransferase) I and to a lesser extent yeast DNA polymerase II in the replication of single-stranded DNA. The enzymatic initiation of DNA synthesis on phage fd DNA template occurs with dNTPs alone and is further stimulated by the presence of rNTPs in DNA polymerase I reactions. The presence of rNTPs has no effect on the RNA polymerase initiation of the DNA polymerase II reaction. RNA polymerases I and III are more efficient in initiation of DNA synthesis than RNA polymerase II. Analyses of the products of fd DNA replication show noncovalent linkage between the newly synthesized DNA and the template DNA, and covalent linkage between the newly synthesized RNA and DNA. PMID:325562

  20. Synthesis, spectroscopic characterization and in vitro antimicrobial, anticancer and antileishmanial activities as well interaction with Salmon sperm DNA of newly synthesized carboxylic acid derivative, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid.

    PubMed

    Sirajuddin, Muhammad; Ali, Saqib; McKee, Vickie; Ullah, Hameed

    2015-03-05

    This paper stresses on the synthesis, characterization of novel carboxylic acid derivative and its application in pharmaceutics. Carboxylic acid derivatives have a growing importance in medicine, particularly in oncology. A novel carboxylic acid, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid, was synthesized and characterized by elemental analysis, FT-IR, NMR ((1)H, and (13)C), mass spectrometry and single crystal X-ray structural analysis. The structure of the title compound, C11H12N2O6, shows the molecules dimerised by short intramolecular OH⋯O hydrogen bonds. The compound was screened for in vitro antimicrobial, anticancer, and antileishmanial activities as well as interaction with SS-DNA. The compound was also checked for in vitro anticancer activity against BHK-21, H-157 and HCEC cell lines, and showed significant anticancer activity. The compound was almost non-toxic towards human corneal epithelial cells (HCEC) and did not show more than 7.4% antiproliferative activity when used at the 2.0μg/mL end concentration. It was also tested for antileishmanial activity against the promastigote form of leishmania major and obtained attractive result. DNA interaction study exposes that the binding mode of the compound with SS-DNA is an intercalative as it results in hypochromism along with minor red shift. A new and efficient strategy to identify pharmacophores sites in carboxylic acid derivative for antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

  1. Synthesis, spectroscopic characterization and in vitro antimicrobial, anticancer and antileishmanial activities as well interaction with Salmon sperm DNA of newly synthesized carboxylic acid derivative, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid

    NASA Astrophysics Data System (ADS)

    Sirajuddin, Muhammad; Ali, Saqib; McKee, Vickie; Ullah, Hameed

    2015-03-01

    This paper stresses on the synthesis, characterization of novel carboxylic acid derivative and its application in pharmaceutics. Carboxylic acid derivatives have a growing importance in medicine, particularly in oncology. A novel carboxylic acid, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid, was synthesized and characterized by elemental analysis, FT-IR, NMR (1H, and 13C), mass spectrometry and single crystal X-ray structural analysis. The structure of the title compound, C11H12N2O6, shows the molecules dimerised by short intramolecular Osbnd H⋯O hydrogen bonds. The compound was screened for in vitro antimicrobial, anticancer, and antileishmanial activities as well as interaction with SS-DNA. The compound was also checked for in vitro anticancer activity against BHK-21, H-157 and HCEC cell lines, and showed significant anticancer activity. The compound was almost non-toxic towards human corneal epithelial cells (HCEC) and did not show more than 7.4% antiproliferative activity when used at the 2.0 μg/mL end concentration. It was also tested for antileishmanial activity against the promastigote form of leishmania major and obtained attractive result. DNA interaction study exposes that the binding mode of the compound with SS-DNA is an intercalative as it results in hypochromism along with minor red shift. A new and efficient strategy to identify pharmacophores sites in carboxylic acid derivative for antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

  2. Contributions of the TEL-patch Amino Acid Cluster on TPP1 to Telomeric DNA Synthesis by Human Telomerase

    PubMed Central

    Dalby, Andrew B.; Hofr, Ctirad; Cech, Thomas R.

    2015-01-01

    Telomere maintenance is a highly coordinated process, and its misregulation is linked to cancer as well as telomere-shortening syndromes. Recent studies have shown that the TEL-patch – a cluster of amino acids on the surface of the shelterin component TPP1 – is necessary for the recruitment of telomerase to the telomere in human cells. However, there has been only basic biochemical analysis of the role of TPP1 in the telomerase recruitment process. Here we develop an in vitro assay to quantitatively measure the contribution of the TEL-patch to telomerase recruitment – binding and extension of the first telomeric repeat. We also demonstrate that the TEL-patch contributes to the translocation step of the telomerase reaction. Finally, our quantitative observations indicate that the TEL-patch stabilizes the association between telomerase and telomeric DNA substrates, providing a molecular explanation for its contributions to telomerase recruitment and action. PMID:25623306

  3. Clickable Cγ-azido(methylene/butylene) peptide nucleic acids and their clicked fluorescent derivatives: synthesis, DNA hybridization properties, and cell penetration studies.

    PubMed

    Jain, Deepak R; Ganesh, Krishna N

    2014-07-18

    Synthesis, characterization, and DNA complementation studies of clickable C(γ)-substituted methylene (azm)/butylene (azb) azido PNAs show that these analogues enhance the stability of the derived PNA:DNA duplexes. The fluorescent PNA oligomers synthesized by their click reaction with propyne carboxyfluorescein are seen to accumulate around the nuclear membrane in 3T3 cells.

  4. Design and Synthesis of Biaryl DNA-Encoded Libraries.

    PubMed

    Ding, Yun; Franklin, G Joseph; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Clark, Matthew A; Skinner, Steven R; Belyanskaya, Svetlana

    2016-10-10

    DNA-encoded library technology (ELT) is a powerful tool for the discovery of new small-molecule ligands to various protein targets. Here we report the design and synthesis of biaryl DNA-encoded libraries based on the scaffold of 5-formyl 3-iodobenzoic acid. Three reactions on DNA template, acylation, Suzuki-Miyaura coupling and reductive amination, were applied in the library synthesis. The three cycle library of 3.5 million diversity has delivered potent hits for phosphoinositide 3-kinase α (PI3Kα).

  5. Synthesis of DNA mimics representing HypNA-pPNA hetero-oligomers.

    PubMed

    Efimov, Vladimir A; Chakhmakhcheva, Oksana G

    2005-01-01

    The methods for the synthesis and purification of negatively charged peptide nucleic acid (PNA)-relative deoxyribonucleic acid (DNA) mimics containing alternating residues of phosphono peptide nucleic acid (pPNA) monomers and PNA-like monomers on the base of trans-4-hydroxy-L-proline are described. Examples of the chimeric oligomers hybridization with complementary DNA and ribonucleic acid fragments are demonstrated.

  6. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  7. Synthesis, spectroscopic characterization and structural investigations of new adduct compound of carbazole with picric acid: DNA binding and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Saravanabhavan, Munusamy; Sathya, Krishnan; Puranik, Vedavati G.; Sekar, Marimuthu

    2014-01-01

    Carbazole picrate (CP), a new organic compound has been synthesized, characterized by various analytical and spectroscopic technique such as FT-IR, UV-Vis, 1H and 13C NMR spectroscopy. An orthorhombic geometry was proposed based on single crystal XRD study. The thermal stability of the crystal was studied by using thermo-gravimetric and differential thermal analyses and found that it was stable up to 170 °C. Further, the newly synthesized title compound was tested for its in vitro antibacterial and antifungal activity against various bacterial and fungal species. Also, the compound was tested for its binding activity with Calf thymus (CT) DNA and the results show a considerable interaction between CP and CT-DNA.

  8. Mechanism for priming DNA synthesis by yeast DNA Polymerase α

    PubMed Central

    Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca

    2013-01-01

    The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895

  9. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  10. Facile dimer synthesis for DNA-binding polyamide ligands.

    PubMed

    Wetzler, Modi; Wemmer, David E

    2010-08-06

    Pyrrole-imidazole polyamide ligands are highly sequence specific synthetic DNA-binding ligands that bind with high affinity. To counter the synthetic difficulties associated with coupling the electron-rich heterocyclic acids to the electron-deficient nucleophilic imidazole amine, a novel approach is described for synthesis of Fmoc-protected dimers for solid-phase peptide synthesis (SPPS). This method produces the dimers in high yields, is broadly applicable to other heterocyclic-containing polyamides, and results in improved ligand yields and synthesis times.

  11. DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

    PubMed Central

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

    2016-01-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  12. Synthesis of circular double-stranded DNA having single-stranded recognition sequence as molecular-physical probe for nucleic acid hybridization detection based on atomic force microscopy imaging.

    PubMed

    Nakano, Koji; Matsunaga, Hideshi; Murata, Masaharu; Soh, Nobuaki; Imato, Toshihiko

    2009-08-01

    A new class of DNA probes having a mechanically detectable tag is reported. The DNA probe, which consists of a single-stranded recognition sequence and a double-stranded circular DNA entity, was prepared by polymerase reaction. M13mp18 single strand and a 32mer oligodeoxynucleotide whose 5'-end is decorated with the recognition sequence were used in combination as template and primer, respectively. We have successfully demonstrated that the DNA probe is useful for bioanalytical purposes: by deliberately attaching target DNA molecules onto Au(111) substrates and by mechanically reading out the tag-entity using a high-resolution microscopy including atomic force microscopy, visualization/detection of the individual target/probe DNA conjugate was possible simply yet straightforwardly. The present DNA probe can be characterized as a 100%-nucleic acid product material. It is simply available by one-pod synthesis. A surface topology parameter, image roughness, has witnessed its importance as a quantitative analysis index with particular usability in the present visualization/detection method.

  13. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  14. Differential effect of aphidicolin on adenovirus DNA synthesis and cellular DNA synthesis.

    PubMed

    Kwant, M M; van der Vliet, P C

    1980-09-11

    There is strong evidence for a participation of DNA polymerase gamma in the replication of adenovirus (Ad) DNA. To study a possible additional role of DNA polymerase alpha we measured the effect of aphidicolin on viral DNA replication. In intact cells, aphidicolin inhibits Ad DNA synthesis weakly. The drug concentration required for 50% inhibition of Ad DNA replication was 300-400 fold higher than for a similar effect on cellular DNA synthesis. Such a differential inhibition was also observed in AGMK cells doubly infected with SV40 and the simian adenovirus SA7. No evidence was found for modification of aphidicolin in infected cells or for a change in aphidicolin sensitivity of DNA polymerase alpha after infection. The extent of inhibition of purified DNA polymerase alpha was dependent upon the dCTP concentration. The same situation was observed when DNA synthesis was studied in isolated nuclei from uninfected cells. However, in nuclei from Ad infected cells no effect of dCTP on aphidicolin sensitivity was found. These results were taken as evidence that DNA polymerase alpha does not participate in the replication of adenovirus DNA.

  15. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  16. Synthesis, spectral characterization and DNA binding of Schiff-base metal complexes derived from 2-amino-3-hydroxyprobanoic acid and acetylacetone

    NASA Astrophysics Data System (ADS)

    Hosny, Nasser Mohammed; Hussien, Mostafa A.; Radwan, Fatima M.; Nawar, Nagwa

    2014-11-01

    Four new metal complexes derived from the reaction of Cu(II), Co(II), Ni(II) and Zn(II) acetates with the Schiff-base ligand (H3L) resulted from the condensation of the amino acid 2-amino-3-hydroxyprobanoic acid (serine) and acetylacetone have been synthesized and characterized by, elemental analyses, ES-MS, IR, UV-Vis., 1H NMR, 13C NMR, ESR, thermal analyses (TGA and DTG) and magnetic measurements. The results showed that the Schiff-base ligand acts as bi-negative tridentate through the azomethine nitrogen, the deprotonated carboxylate oxygen and the enolic carbonyl oxygen. The optical band gaps measurements indicated the semi-conducting nature of these complexes. Molecular docking was used to predict the binding between the Schiff base ligand with the receptor of prostate cancer mutant H874Y. The interactions between the Cu(II) complex and calf thymus DNA (CT-DNA) have been studied by UV spectra. The results confirm that the Cu(II) complex binds to CT-DNA in an intercalative mode.

  17. Metal based pharmacologically active agents: Synthesis, structural characterization, molecular modeling, CT-DNA binding studies and in vitro antimicrobial screening of iron(II) bromosalicylidene amino acid chelates

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; El-Khatib, Rafat M.; Nassr, Lobna A. E.; Abu-Dief, Ahmed M.; Ismael, Mohamed; Seleem, Amin Abdou

    2014-01-01

    In recent years, great interest has been focused on Fe(II) Schiff base amino acid complexes as cytotoxic and antitumor drugs. Thus a series of new iron(II) complexes based on Schiff bases amino acids ligands have been designed and synthesized from condensation of 5-bromosalicylaldehyde (bs) and α-amino acids (L-alanine (ala), L-phenylalanine (phala), L-aspartic acid (aspa), L-histidine (his) and L-arginine (arg)). The structure of the investigated iron(II) complexes was elucidated using elemental analyses, infrared, ultraviolet-visible, thermogravimetric analysis, as well as conductivity and magnetic susceptibility measurements. Moreover, the stoichiometry and the stability constants of the prepared complexes have been determined spectrophotometrically. The results suggest that 5-bromosalicylaldehyde amino acid Schiff bases (bs:aa) behave as dibasic tridentate ONO ligands and coordinate to Fe(II) in octahedral geometry according to the general formula [Fe(bs:aa)2]ṡnH2O. The conductivity values between 37 and 64 ohm-1 mol-1 cm2 in ethanol imply the presence of nonelectrolyte species. The structure of the complexes was validated using quantum mechanics calculations based on accurate DFT methods. Geometry optimization of the Fe-Schiff base amino acid complexes showed that all complexes had octahedral coordination. In addition, the interaction of these complexes with (CT-DNA) was investigated at pH = 7.2, by using UV-vis absorption, viscosity and agarose gel electrophoresis measurements. Results indicated that the investigated complexes strongly bind to calf thymus DNA via intercalative mode and showed a different DNA binding according to the sequence: bsari > bshi > bsali > bsasi > bsphali. Moreover, the prepared compounds are screened for their in vitro antibacterial and antifungal activity against three types of bacteria, Escherichia coli, Pseudomonas aeruginosa and Bacillus cereus and three types of anti fungal cultures, Penicillium purpurogenium, Aspergillus

  18. Thymidine analogues for tracking DNA synthesis.

    PubMed

    Cavanagh, Brenton L; Walker, Tom; Norazit, Anwar; Meedeniya, Adrian C B

    2011-09-15

    Replicating cells undergo DNA synthesis in the highly regulated, S-phase of the cell cycle. Analogues of the pyrimidine deoxynucleoside thymidine may be inserted into replicating DNA, effectively tagging dividing cells allowing their characterisation. Tritiated thymidine, targeted using autoradiography was technically demanding and superseded by 5-bromo-2-deoxyuridine (BrdU) and related halogenated analogues, detected using antibodies. Their detection required the denaturation of DNA, often constraining the outcome of investigations. Despite these limitations BrdU alone has been used to target newly synthesised DNA in over 20,000 reviewed biomedical studies. A recent breakthrough in "tagging DNA synthesis" is the thymidine analogue 5-ethynyl-2'-deoxyuridine (EdU). The alkyne group in EdU is readily detected using a fluorescent azide probe and copper catalysis using 'Huisgen's reaction' (1,3-dipolar cycloaddition or 'click chemistry'). This rapid, two-step biolabelling approach allows the tagging and imaging of DNA within cells whilst preserving the structural and molecular integrity of the cells. The bio-orthogonal detection of EdU allows its application in more experimental assays than previously possible with other "unnatural bases". These include physiological, anatomical and molecular biological experimentation in multiple fields including, stem cell research, cancer biology, and parasitology. The full potential of EdU and related molecules in biomedical research remains to be explored.

  19. Synthesis, spectroscopic characterization, crystal structure, DNA interaction study and invitro biological screenings of 4-(5-chloro-2-hydroxyphenylamino)-4-oxobut-2-enoic acid

    NASA Astrophysics Data System (ADS)

    Sirajuddin, Muhammad; Nooruddin; Ali, Saqib; McKee, Vickie; Khan, Shahan Zeb; Malook, Khan

    2015-01-01

    The titled compound, 4-(5-chloro-2-hydroxyphenylamino)-4-oxobut-2-enoic acid was synthesized and characterized by various techniques like elemental analyses, FT-IR, NMR (1H, and 13C) and single crystal X-ray structural analysis. The appearance of the OH peak of the carboxylic acid in the FT-IR and NMR spectra conform the formation of the compound. A good agreement was found between the calculated values of C, H, N and found values in elemental analysis that show the purity of the compound. Protons H2 and H3 are in cis conformation with each other as conformed both from 1H NMR as well as from single crystal X-ray analysis. The molecular structure of the title compound, C10H10NO3Cl, is stabilized by short intramolecular Osbnd H- - -O hydrogen bonds within the molecule. In the crystal structure, intermolecular Nsbnd H- - -O hydrogen bonds link molecules into zigzag chains resulting in a dendrimer like structure. The title compound was screened for biological activities like interaction with DNA, cytotoxicity, antitumor and antioxidant activities. DNA interaction study reveals that the binding mode of interaction of the compound with SS-DNA is intercalative as it results in hypochromism along with significant red shift of 5 nm. It was also found to be effective antioxidant of 2,2-diphenyl-1-picrylhydrazyl radical (DPPH) and show almost comparable antioxidant activity to that of the standard and known antioxidant, ascorbic acid, at higher concentration. The antitumor activity data of the compound shows that it can be used as potent antitumor agent.

  20. Chemically-enzymatic synthesis of photosensitive DNA.

    PubMed

    Westphal, Kinga; Zdrowowicz, Magdalena; Zylicz-Stachula, Agnieszka; Rak, Janusz

    2017-02-01

    The sensitizing propensity of radio-/photosensitizing nucleoside depends on DNA sequence surrounding a sensitizer. Therefore, in order to compare sensitizers with regard to their ability to induce a DNA damage one has to study the sequence dependence of damage yield. However, chemical synthesis of oligonucleotides labeled with sensitizing nucleosides is hindered due to the fact that a limited number of such nucleoside phosphoramidites are accessible. Here, we report on a chemically-enzymatic method, employing a DNA polymerase and ligase, that enables a modified nucleoside, in the form of its 5'-triphosphate, to be incorporated into DNA fragment in a pre-determined site. Using such a protocol two double-stranded DNA fragments - a long one, 75 base pairs (bp), and a short one, 30bp in length - were pin-point labeled with 5-bromodeoxyuridine. Four DNA polymerases together with DHPLC for the inspection of reaction progress were used to optimize the process under consideration. As an ultimate test showing that the product possessing an assumed nucleotide sequence was actually obtained, we irradiated the synthesized oligonucleotide with UVB photons and analyzed its photoreactivity with the LC-MS method. Our results prove that a general approach enabling precise labeling of DNA with any nucleoside modification processed by DNA polymerase and ligase has been worked out.

  1. Synthesis and characterization of transition metal 2,6-pyridinedicarboxylic acid derivatives, interactions of Cu(II) and Ni(II) complexes with DNA in vitro

    NASA Astrophysics Data System (ADS)

    Khan, Sadaf; Nami, Shahab A. A.; Siddiqi, K. S.; Husain, Eram; Naseem, Imrana

    2009-03-01

    Mononuclear complexes M(L)Cl 2 where M = Mn(II), Fe(II), Co(II), Ni(II) and Cu(II) and (L = N,N-diethylpiperazinyl,2,6-pyridinedicarboxylate), have been synthesized and characterized by elemental analysis, FT-IR, 1H NMR spectroscopy, UV-vis, magnetic moment, TGA/DSC, cyclic voltammetry and conductivity measurement data. The spectral data suggests that the dipicolinic acid acts as a bidentate ligand and is coordinated to the metal ion through the carboxylate oxygen. The cyclic voltammogram for Cu(L)Cl 2 complex was found to display two reversible Cu(II)/Cu(I) and Cu(II)/Cu(III) redox couple. The ligand exhibits a two-step thermolytic pattern while the complexes decompose in three stages respectively. An octahedral geometry has been proposed for both the complexes. The investigation of the interaction of the complexes with calf thymus DNA has been performed with absorption spectroscopy and fluorescence quenching experiments, which showed that the complexes are avid binders of calf thymus DNA. Also the interaction of the Cu(II) and Ni(II) complexes with plasmid DNA (pUC 19) was studied using agarose gel electrophoresis. The results revealed that these complexes can act as effective DNA cleaving agents resulting in the nicked form of DNA (pUC 19) under physiological conditions. The gel was run both in the absence and presence of an oxidizing agent (H 2O 2). The ligand and its complexes have also been screened against microbes in order to study their antibacterial action. The results revealed that the Cu(II) complex has activity comparable with the reference drugs gentamycin and flucanzole.

  2. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  3. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  4. Magnetic control of the DNA synthesis

    NASA Astrophysics Data System (ADS)

    Buchachenko, Anatoly L.; Orlov, Alexei P.; Kuznetsov, Dmitry A.; Breslavskaya, Natalia N.

    2013-10-01

    By using polymerases β loaded with isotopic ions 24Mg2+, 25Mg2+ and 26Mg2+ magnetic isotope effect was detected: 25Mg2+ ions with magnetic nuclei 25Mg suppress enzymatic activity by 2-3 times with respect to that of polymerases β loaded by 24Mg2+ and 26Mg2+ ions. No difference in enzymatic activity of polymerases β with 24Mg2+ and 26Mg2+ ions exists. The rate of DNA synthesis strongly depends on the magnetic field. The polymerase chain reaction is also suppressed by 25Mg2+ ions with respect to the ions with nonmagnetic nuclei. Magnetic control of the DNA synthesis may be used for medical purposes.

  5. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  6. Synthesis, structure elucidation, biological screening, molecular modeling and DNA binding of some Cu(II) chelates incorporating imines derived from amino acids

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; Abu-Dief, Ahmed M.; Ismael, Mohammed; Mohamed, Mounir A. A.; Hashem, Nahla Ali

    2016-01-01

    Three tridentate Schiff bases amino acids were prepared by direct condensation of 3-methoxysalicylaldehyde (MS) or 4-diethylaminosalicylaldehyde (DS) with α-amino acid ligands [L-phenylalanine (P), L-histidine (H) and DL-tryptophan (T)]. The prepared Schiff bases amino acids were investigated by melting points, elemental analysis, 1HNMR and 13CNMR, IR, UV-Vis spectra, conductivity and magnetic measurements analyses. Subsequently, copper was introduced and Cu(II) complexes formed. These complexes were analyzed by thermal and elemental analyses and further investigated by FT-IR and UV/Vis spectroscopies. The experimental results indicating that all Cu(II) complexes contain hydrated water molecules (except DSPCu complex) and don't contain coordinated water molecules. The kinetic and thermal parameters were extracted from the thermal data using Coast and Redfern method. The molar conductance values of the Schiff base amino acid ligands and their Cu(II) complexes were relatively low, showing that these compounds have non-electrolytic nature. Magnetic susceptibility measurements showed the diamagnetic nature of the Schiff base amino acid ligands and paramagnetic nature of their complexes. Additionally, a spectrophotometric method was determined to extract their stability constants. It was found that the complexes possess 1:2 (M:L) stoichiometry. The results suggested that 3-methoxysalicylaldehyde and 4-diethylaminosalicylaldehyde amino acid Schiff bases behave as monobasic tridentate ONO ligands and coordinate Cu(II) ions in octahedral geometry according to the general formula [Cu(HL)2]·nH2O. To further understanding the structural and electronic properties of these complexes, Density Functional Theory (DFT) calculations were employed and provided a satisfactory description. The optimized structures of MST Schiff base ligand and its complex were calculated using DFT. The antimicrobial activity of the Schiff base ligands and their complexes were screened against some

  7. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  8. An autoradiographic demonstration of nuclear DNA replication by DNA polymerase alpha and of mitochondrial DNA synthesis by DNA polymerase gamma.

    PubMed Central

    Geuskens, M; Hardt, N; Pedrali-Noy, G; Spadari, S

    1981-01-01

    The incorporation of thymidine into the DNA of eukaryotic cells is markedly depressed, but not completely inhibited, by aphidicolin, a highly specific inhibitor of DNA polymerase alpha. An electron microscope autoradiographic analysis of the synthesis of nuclear and mitochondrial DNA in vivo in Concanavalin A stimulated rabbit spleen lymphocytes and in Hamster cell cultures, in the absence and in the presence of aphidicolin, revealed that aphidicolin inhibits the nuclear but not the mitochondrial DNA replication. We therefore conclude that DNA polymerase alpha performs the synchronous bidirectional replication of nuclear DNA and that DNA polymerase gamma, the only DNA polymerase present in the mitochondria, performs the "strand displacement" DNA synthesis of these organelles. Images PMID:6262734

  9. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  10. Synthesis of DNA oligonucleotides containing C5-ethynylbenzenesulfonamide-modified nucleotides (EBNA) by polymerases towards the construction of base functionalized nucleic acids.

    PubMed

    Goubet, Astrid; Chardon, Antoine; Kumar, Pawan; Sharma, Pawan K; Veedu, Rakesh N

    2013-02-01

    C5-Ethynylbenzenesulfonamide-modified nucleotide (EBNA) was investigated as substrate of various DNA polymerases. The experiments revealed that KOD, Phusion and Klenow DNA polymerases successfully accepted EBNA-T nucleotide as a substrate and yielded the fully extended DNA. KOD DNA polymerase was found to be the most efficient enzyme to furnish EBNA-T containing DNA in good yields. Phusion DNA polymerase efficiently amplified the template containing EBNA-T nucleotides by PCR.

  11. Identification of conserved amino acids in the herpes simplex virus type 1 UL8 protein required for DNA synthesis and UL52 primase interaction in the virus replisome.

    PubMed

    Muylaert, Isabella; Zhao, Zhiyuan; Andersson, Torbjörn; Elias, Per

    2012-09-28

    We have used oriS-dependent transient replication assays to search for species-specific interactions within the herpes simplex virus replisome. Hybrid replisomes derived from herpes simplex virus type 1 (HSV-1) and equine herpesvirus type 1 (EHV-1) failed to support DNA replication in cells. Moreover, the replisomes showed a preference for their cognate origin of replication. The results demonstrate that the herpesvirus replisome behaves as a molecular machine relying on functionally important interactions. We then searched for functional interactions in the replisome context by subjecting HSV-1 UL8 protein to extensive mutagenesis. 52 mutants were made by replacing single or clustered charged amino acids with alanines. Four mutants showed severe replication defects. Mutant A23 exhibited a lethal phenotype, and mutants A49, A52 and A53 had temperature-sensitive phenotypes. Mutants A49 and A53 did not interact with UL52 primase as determined by co-immunoprecipitation experiments. Using GFP-tagged UL8, we demonstrate that all mutants were unable to support formation of ICP8-containing nuclear replication foci. Extended mutagenesis suggested that a highly conserved motif corresponding to mutant A49 serves an important role for establishing a physical contact between UL8 and UL52. The replication-defective mutations affected conserved amino acids, and similar phenotypes were observed when the corresponding mutations were introduced into EHV-1 UL8.

  12. DNA Compatible Multistep Synthesis and Applications to DNA Encoded Libraries.

    PubMed

    Satz, Alexander Lee; Cai, Jianping; Chen, Yi; Goodnow, Robert; Gruber, Felix; Kowalczyk, Agnieszka; Petersen, Ann; Naderi-Oboodi, Goli; Orzechowski, Lucja; Strebel, Quentin

    2015-08-19

    Complex mixtures of DNA encoded small molecules may be readily interrogated via high-throughput sequencing. These DNA encoded libraries (DELs) are commonly used to discover molecules that interact with pharmaceutically relevant proteins. The chemical diversity displayed by the library is key to successful discovery of potent, novel, and drug-like chemical matter. The small molecule moieties of DELs are generally synthesized though a multistep process, and each chemical step is accomplished while it is simultaneously attached to an encoding DNA oligomer. Hence, library chemical diversity is often limited to DNA compatible synthetic reactions. Herein, protocols for 24 reactions are provided that have been optimized for high-throughput production of DELs. These protocols detail the multistep synthesis of benzimidazoles, imidazolidinones, quinazolinones, isoindolinones, thiazoles, and imidazopyridines. Additionally, protocols are provided for a diverse range of useful chemical reactions including BOC deprotection (under pH neutral conditions), carbamylation, and Sonogashira coupling. Last, step-by-step protocols for synthesizing functionalized DELs from trichloronitropyrimidine and trichloropyrimidine scaffolds are detailed.

  13. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  14. Kinetic and biochemical correlation between sustained p44ERK1 (44 kDa extracellular signal-regulated kinase 1) activation and lysophosphatidic acid-stimulated DNA synthesis in Rat-1 cells.

    PubMed Central

    Cook, S J; McCormick, F

    1996-01-01

    Rat-1 fibroblasts were used to study the role of the sustained activation of extracellular signal-regulated kinase 1 (ERK1) in lysophosphatidic acid (LPA)-stimulated mitogenic signalling. Mitogenic doses of LPA, like serum, stimulated biphasic, sustained, ERK activation that persisted towards the G1/S boundary. The EC50 for LPA-stimulated ERK activation after 10 min, the time of peak response, was 2 orders of magnitude to the left of that for the sustained response after 3 h or that for DNA synthesis after 22 h, with the result that non-mitogenic doses stimulated a maximal peak response but no second phase. To complement these studies, we examined the role of different signal pathways in regulating the sustained and acute phases of ERK activation using defined biochemical inhibitors and mimetics. Activation of protein kinase C and Ca2+ fluxes played a minor and transient role in regulation of ERK1 activity by LPA in Rat-1 cells. Sustained ERK1 activation stimulated by LPA was completely inhibited by pertussis toxin, whereas the early peak response was only partly affected; this is correlated with the specific inhibition of LPA-stimulated DNA synthesis by pertussis toxin. The selective tyrosine kinase inhibitor herbimycin A completely inhibited sustained ERK1 activation by LPA but, again, the early phase of the response was only partially inhibited. In addition, low doses of staurosporine inhibited ERK1 activation by LPA. The effects of herbimycin A and staurosporine were selective for the response to LPA but did not affect that to epidermal growth factor. The results suggest a strong correlation between sustained ERK1 activation and DNA synthesis in LPA-stimulated Rat-1 cells. Furthermore, the two discrete phases of ERK activation by LPA are regulated by a combination of at least two different signalling pathways; the sustained activation of ERK1 in Rat-1 cells proceeds via a G1- or Gzero-mediated pathway which may also involve a tyrosine kinase. PMID:8947493

  15. Synthesis, spectroscopic characterization and structural investigations of a new charge transfer complex of 2,6-diaminopyridine with 3,5-dinitrobenzoic acid: DNA binding and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Khan, Ishaat M.; Ahmad, Afaq; Kumar, Sarvendra

    2013-03-01

    A new charge transfer (CT) complex [(DAPH)+(DNB)-] consisting of 2,6-diaminopyridine (DAP) as donor and 3,5-dinitrobenzoic acid (DNB-H) as acceptor, was synthesized and characterized by FTIR, 1H and 13C NMR, ESI mass spectroscopic and X-ray crystallographic techniques. The hydrogen bonding (N+-H⋯O-) plays an important role to consolidate the cation and anion together. CT complex shows a considerable interaction with Calf thymus DNA. The CT complex was also tested for its antibacterial activity against two Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa strains by using Tetracycline as standard, and antifungal property against Aspergillus niger, Candida albicans, and Penicillium sp. by using Nystatin as standard. The results were compared with standard drugs and significant conclusions were obtained. A polymeric net work through H-bonding interactions between neighboring moieties was observed. This has been attributed to the formation of 1:1 type CT complex.

  16. Enzymatic synthesis of organic-polymer-grafted DNA.

    PubMed

    Baccaro, Anna; Marx, Andreas

    2010-01-04

    To create bioorganic hybrid materials, interdisciplinary work in the fields of chemistry, biology and materials science is conducted. DNA block copolymers are promising hybrid materials due to the combination of properties intrinsic to both the polymer and the nucleic acid blocks. Until now, the coupling of DNA and organic polymers has been exercised post-synthetically in solution or on solid support. Herein, we report the first enzyme-catalysed synthesis of DNA-organic polymer chimeras. For this purpose, four novel 2'-deoxyuridine triphosphates carrying polymer-like moieties linked to the nucleobase were synthesised. Linear polyethylene glycol monomethyl ethers of different sizes (1) and branched polyamido dendrons with varying terminal groups (2) were chosen as building blocks. We investigated the ability of DNA polymerases to accept the copolymers in comparison to the natural substrate and showed, through primer extensions, polymerase chain reactions and rolling circle amplification, that these building blocks could serve as a surrogate for the natural thymidine. By this method, DNA hybrid materials with high molecular weight, modification density, and defined structure are accessible.

  17. Survival, Deoxyribonucleic Acid Breakdown, and Synthesis in Salmonella typhimurium as Compared with Escherichia coli B Strains

    PubMed Central

    Hudnik-Plevnik, Tamara A.; Djordjević, Nadežda

    1970-01-01

    Salmonella typhimurium LT-2 was compared with radioresistant (B/r) and radiosensitive (Bs−2) strains of Escherichia coli in respect to the survival, deoxyribonucleic acid (DNA) breakdown, and DNA synthesis after X irradiation. It is shown that S. typhimurium LT-2 is about four times more sensitive than E. coli B/r but less sensitive than Bs−2. The DNA breakdown is in S. typhimurium LT-2 lower than the postirradiation breakdown of DNA in both E. coli strains and DNA synthesis proceeds in this bacterium in spite of a much lower survival, as in the radioresistant E. coli B/r. PMID:4916313

  18. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  19. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  20. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  1. Nucleotide sequence of a preferred maize chloroplast genome template for in vitro DNA synthesis.

    PubMed Central

    Gold, B; Carrillo, N; Tewari, K K; Bogorad, L

    1987-01-01

    Maize chloroplast DNA sequences representing 94% of the chromosome have been surveyed for their activity as autonomously replicating sequences in yeast and as templates for DNA synthesis in vitro by a partially purified chloroplast DNA polymerase. A maize chloroplast DNA region extending over about 9 kilobase pairs is especially active as a template for the DNA synthesis reaction. Fragments from within this region are much more active than DNA from elsewhere in the chromosome and 50- to 100-fold more active than DNA of the cloning vector pBR322. The smallest of the strongly active subfragments that we have studied, the 1368-base-pair EcoRI fragment x, has been sequenced and found to contain the coding region of chloroplast ribosomal protein L16. EcoRI fragment x shows sequence homology with a portion of the Chlamydomonas reinhardtii chloroplast chromosome that forms a displacement loop [Wang, X.-M., Chang, C.H., Waddell, J. & Wu, M. (1984) Nucleic Acids Res. 12, 3857-3872]. Maize chloroplast DNA fragments that permit autonomous replication of DNA in yeast are not active as templates for DNA synthesis in the in vitro assay. The template active region we have identified may represent one of the origins of replication of maize chloroplast DNA. Images PMID:3025853

  2. Study of stimulators of DNA synthesis in nerve tissue cells

    SciTech Connect

    Vitvitskii, V.N.

    1986-04-10

    Changes in proliferative activity in different regions of the brain during ontogenesis are connected with changes in the composition and properties of regulators of cell proliferation. Extracts of regions of the brain in which active cell division takes place in a given stage of development (cortex of 15- to 17-day-old embryos or cerebellum of 8- to 10-day-old rats) can stimulate the incorporation of labeled precursors into the brain cell DNA of both newborn and adult rats. Salting out at increasing ammonium sulfate concentrations, gel filtration on Sephadex, and isoelectric focusing led to the isolation of three fractions of stimulators of DNA synthesis: in acid, neutral, and alkaline pH regions. A method is described for obtaining purified preparations and for determining some physicochemical properties of the acid activator, which is a low-molecular-weight peptide capable of noticeably stimulating the incorporation of labeled precursors into the DNA of nerve tissue cells when added to an in vitro system in a concentration of the order of 1 ..mu..g/ml.

  3. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  4. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  5. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  6. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  8. DNA sequencing by synthesis based on elongation delay detection

    NASA Astrophysics Data System (ADS)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2015-03-01

    The one of most important problem in modern genetics, biology and medicine is determination of the primary nucleotide sequence of the DNA of living organisms (DNA sequencing). This paper describes the label-free DNA sequencing approach, based on the observation of a discrete dynamics of DNA sequence elongation phase. The proposed DNA sequencing principle are studied by numerical simulation. The numerical model for proposed label-free DNA sequencing approach is based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) and dynamics of nucleotides incorporation to rising DNA strand. The estimates for number of copied DNA sequences for required probability of nucleotide incorporation event detection and correct DNA sequence determination was obtained. The proposed approach can be applied at all known DNA sequencing devices with "sequencing by synthesis" principle of operation.

  9. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  10. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  11. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    PubMed Central

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability. PMID:28298904

  12. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV.

    PubMed

    Tashjian, Tommy F; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M; Godoy, Veronica G

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB's fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  13. Facile synthesis of nucleic acid-polymer amphiphiles and their self-assembly.

    PubMed

    Jia, Fei; Lu, Xueguang; Tan, Xuyu; Zhang, Ke

    2015-05-07

    A solid-phase synthesis for nucleic acid-polymer amphiphiles is developed. Using this strategy, several DNA-b-polymer amphiphiles are synthesized, and their self-assembly in aqueous solution is investigated. This general method can in principle be extended to nearly all polymers synthesized by atom transfer radical polymerization to produce a variety of nucleic acid-polymer conjugates.

  14. Inhibition of DNA synthesis in Meth A cells by chlorpromazine.

    PubMed

    Mizushima, T; Natori, S; Sekimizu, K

    1993-10-01

    We examined the influence of chlorpromazine, a phenothiazine derivative, on DNA synthesis in Meth A cells. Pulse-labelling experiments with [3H]thymidine showed that chlorpromazine inhibited DNA synthesis in cells cultured in vitro. The drug also inhibited DNA synthesis in isolated nuclei. Observation by fluorescence microscopy of fibroblastic cells stained with chlorpromazine indicated that the drug was localized in the cytoplasm and nuclear membranes, suggesting that it inhibited DNA synthesis in a manner dependent on the interaction of replication proteins with nuclear membranes. Meth A sarcomas growing in the endoderm of BALB/c mice regressed on intra-tumor injection of chlorpromazine, indicating that the drug has an anticancer action.

  15. Synthesis of Nucleic Acid and Protein in L Cells Infected with the Agent of Meningopneumonitis

    PubMed Central

    Schechter, Esther M.

    1966-01-01

    Schechter, Esther M. (The University of Chicago, Chicago, Ill.). Synthesis of nucleic acid and protein in L cells infected with the agent of meningopneumonitis. J. Bacteriol. 91:2069–2080. 1966.—Synthesis of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein in uninfected L cells and in L cells infected with the meningopneumonitis agent was compared by measuring rates of incorporation of H3-cytidine and C14-lysine into nuclear, cytoplasmic, and agent fractions in successive 5-hr periods during the meningopneumonitis growth cycle. Synthesis of meningopneumonitis DNA, RNA, and protein was first clearly evident in the labeling period 15 to 20 hr after infection, soon after initiation of agent multiplication. The rates of synthesis of agent DNA, RNA, and protein increased logarithmically for a brief period and then declined. However, rates of isotope incorporation into all three meningopneumonitis macromolecules were sustained at near maximal values throughout the remainder of the meningopneumonitis growth cycle. These data are most readily interpreted in terms of multiplication of the meningopneumonitis agent by binary fission. The L cell response to infection was a decreased rate of DNA and RNA synthesis and an accelerated rate of cell death. Host protein synthesis was unaffected. The inhibition of nucleic acid synthesis in infected L cells probably involved competition between host and parasite for nucleic acid precursors. Different sublines of L cells varied greatly in the degree to which their nucleic acid-synthesizing mechanisms were damaged by infection. The cytoplasm of infected L cells contained newly synthesized DNA and RNA that could not be accounted for as intact meningopneumonitis cells. This nucleic acid probably arose from disintegration of the fragile intracellular forms of the meningopneumonitis agent. Images PMID:5937251

  16. Fractional synthesis rates of DNA and protein in rabbit skin are not correlated.

    PubMed

    Zhang, Xiao-jun; Chinkes, David L; Wu, Zhanpin; Martini, Wenjun Z; Wolfe, Robert R

    2004-09-01

    We developed a method for measurement of skin DNA synthesis, reflecting cell division, in conscious rabbits by infusing D-[U-(13)C(6)]glucose and L-[(15)N]glycine. Cutaneous protein synthesis was simultaneously measured by infusion of L-[ring-(2)H(5)]phenylalanine. Rabbits were fitted with jugular venous and carotid arterial catheters, and were studied during the infusion of an amino acid solution (10% Travasol). The fractional synthetic rate (FSR) of DNA from the de novo nucleotide synthesis pathway, a reflection of total cell division, was 3.26 +/- 0.59%/d in whole skin and 3.08 +/- 1.86%/d in dermis (P = 0.38). The de novo base synthesis pathway accounted for 76 and 60% of the total DNA FSR in whole skin and dermis, respectively; the contribution from the base salvage pathway was 24% in whole skin and 40% in dermis. The FSR of protein in whole skin was 5.35 +/- 4.42%/d, which was greater (P < 0.05) than that in dermis (2.91 +/- 2.52%/d). The FSRs of DNA and protein were not correlated (P = 0.33), indicating that cell division and protein synthesis are likely regulated by different mechanisms. This new approach enables investigations of metabolic disorders of skin diseases and regulation of skin wound healing by distinguishing the 2 principal components of skin metabolism, which are cell division and protein synthesis.

  17. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  18. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    PubMed

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  19. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  20. Post-synthesis DNA Modifications Using a trans-Cyclooctene Click Handle

    PubMed Central

    Wang, Ke; Wang, Danzhu; Ji, Kaili; Chen, Weixuan; Zheng, Yueqin; Dai, Chaofeng

    2015-01-01

    Post-synthesis DNA modification is a very useful method for DNA functionalization. This is achieved by using a modified NTP, which has a handle for further modifications, replacing the corresponding natural NTP in polymerase-catalyzed DNA synthesis. Subsequently, the handle can be used for further functionalization after PCR, preferably through a very fast reaction. Herein we describe polymerase-mediated incorporation of trans-cyclooctene modified thymidine triphosphate (TCO-TTP). Subsequently, the trans-cyclooctene group was reacted with a tetrazine tethered to other functional groups through a very fast click reaction. The utility of this DNA functionalization method was demonstrated with the incorporation of a boronic acid group and a fluorophore. The same approach was also successfully used in modifying a known aptamer for fluorescent labelling applications. PMID:25407744

  1. Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

    SciTech Connect

    Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

    1985-01-01

    Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.

  2. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  3. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  4. DNA synthesis and DNA polymerase activity of herpes simplex virus type 1 temperature-sensitive mutants.

    PubMed Central

    Aron, G M; Purifoy, D J; Schaffer, P A

    1975-01-01

    Fifteen temperature-sensitive mutants of herpes simplex virus type 1 were studied with regard to the relationship between their ability to synthesize viral DNA and to induce viral DNA polymerase (DP) activity at permissive (34 C) and nonpermissive (39 C) temperatures. At 34 C, all mutants synthesized viral DNA, while at 39 C four mutants demonstrated a DNA+ phenotype, three were DNA+/-, and eight were DNA-. DNA+ mutants induced levels of DP activity similar to thhose of the wild-type virus at both temperatures, and DNA+/- mutants induced reduced levels of DP activity at 39 C but not at 34 C. Among the DNA- mutants three were DP+, two were DP+/-, and three showed reduced DP activity at 34 C with no DP activity at 39 C. DNA-, DP- mutants induced the synthesis of a temperature-sensitive DP as determined by in vivo studies. PMID:169388

  5. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  6. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  7. Nonuniform distribution of excision repair synthesis in nucleosome core DNA

    SciTech Connect

    Lan, S.Y.; Smerdon, M.J.

    1985-12-17

    We have studied the distribution in nucleosome core DNA of nucleotides incorporated by excision repair synthesis occurring immediately after UV irradiation in human cells. The differences previously observed for whole nuclei between the DNase I digestion profiles of repaired DNA (following its refolding into a nucleosome structure) and bulk DNA are obtained for isolated nucleosome core particles. Analysis of the differences obtained indicates that they could reflect a significant difference in the level of repair-incorporated nucleotides at different sites within the core DNA region. To test this possibility directly, we have used exonuclease III digestion of very homogeneous sized core particle DNA to map the distribution of repair synthesis in these regions. Results indicate that in a significant fraction of the nucleosomes the 5' and 3' ends of the core DNA are markedly enhanced in repair-incorporated nucleotides relative to the central region of the core particle. A best fit analysis indicates that a good approximation of the data is obtained for a distribution where the core DNA is uniformly labeled from the 5' end to position 62 and from position 114 to the 3' end, with the 52-base central region being devoid of repair-incorporated nucleotides. This distribution accounts for all of the quantitative differences observed previously between repaired DNA and bulk DNA following the rapid phase of nucleosome rearrangement when it is assumed that linker DNA and the core DNA ends are repaired with equal efficiency and the nucleosome structure of newly repaired DNA is identical with that of bulk chromatin. The 52-base central region that is devoid of repair synthesis contains the lowest frequency cutting sites for DNase I in vitro, as well as the only internal locations where two (rather than one) histones interact with a 10-base segment of each DNA strand.

  8. Stimulation of adrenal DNA synthesis in cadmium-treated male rats

    SciTech Connect

    Nishiyama, S.; Nakamura, K.

    1984-07-01

    Cadmium chloride (CdCl2) at a dose of 1 mg/kg body wt was injected into male rats of the Wistar strain, weighing 250 g on the average, twice a day (12-hr intervals) for 7 consecutive days. DNA and RNA contents and (/sup 3/H)-thymidine and (/sup 3/H)-uridine incorporation into the acid-insoluble fraction significantly increased in the adrenals of rats treated with Cd for 2 and 7 consecutive days. Adrenal protein content and weight also significantly increased. These results indicate that continued treatment with Cd stimulates DNA and RNA synthesis in the adrenal cortex, which in turn results in the increase of the total protein contents of the adrenal gland and subsequently in the enlargement of the gland. Serum adrenocorticotrophin (ACTH) and insulin levels in Cd-treated rats were not higher than control levels, suggesting that the stimulation of DNA synthesis in the adrenals of Cd-treated rats is due to factor(s) other than serum ACTH and insulin. Treatment with Cd inhibited DNA synthesis in cultured adrenocortical cells at concentrations of 10(-4) to 10(-8) M, suggesting that Cd does not directly stimulate DNA synthesis in the adrenal gland in vivo. Although the adrenal gland became enlarged, the total adrenal corticosterone content decreased significantly. The decrease of total adrenal corticosterone content may be due to the fall in serum ACTH level of Cd-treated rats.

  9. Stimulation of DNA synthesis in cultured rat alveolar type II cells

    SciTech Connect

    Leslie, C.C.; McCormick-Shannon, K.; Robinson, P.C.; Mason, R.J.

    1985-01-01

    Restoration of the alveolar epithelium after injury is thought to be dependent on the proliferation of alveolar type II cells. To understand the factors that may be involved in promoting type II cell proliferation in vivo, we determined the effect of potential mitogens and culture substrata on DNA synthesis in rat alveolar type II cells in primary culture. Type II cells cultured in basal medium containing 10% fetal bovine serum (FBS) exhibited essentially no DNA synthesis. Factors that stimulated /sup 3/H-thymidine incorporation included cholera toxin, epidermal growth factor, and rat serum. The greatest degree of stimulation was achieved by plating type II cells on an extracellular matrix prepared from bovine corneal endothelial cells and then by culturing the pneumocytes in medium containing rat serum, cholera toxin, insulin, and epidermal growth factor. Under conditions of stimulation of /sup 3/H-thymidine incorporation there was an increased DNA content per culture dish but no increase in cell number. The ability of various culture conditions to promote DNA synthesis in type II cells was verified by autoradiography. Type II cells were identified by the presence of cytoplasmic inclusions, which were visualized by tannic acid staining before autoradiography. These results demonstrate the importance of soluble factors and culture substratum in stimulating DNA synthesis in rat alveolar type II cells in primary culture.

  10. Amino Acid Racemization and the Preservation of Ancient DNA

    NASA Technical Reports Server (NTRS)

    Poinar, Hendrik N.; Hoss, Matthias

    1996-01-01

    The extent of racemization of aspartic acid, alanine, and leucine provides criteria for assessing whether ancient tissue samples contain endogenous DNA. In samples in which the D/L ratio of aspartic acid exceeds 0.08, ancient DNA sequences could not be retrieved. Paleontological finds from which DNA sequences purportedly millions of years old have been reported show extensive racemization, and the amino acids present are mainly contaminates. An exception is the amino acids in some insects preserved in amber.

  11. COORDINATING DNA POLYMERASE TRAFFIC DURING HIGH AND LOW FIDELITY SYNTHESIS

    PubMed Central

    Sutton, Mark D.

    2009-01-01

    With the discovery that organisms possess multiple DNA polymerases (Pols) displaying different fidelities, processivities, and activities came the realization that mechanisms must exist to manage the actions of these diverse enzymes to prevent gratuitous mutations. Although many of the Pols encoded by most organisms are largely accurate, and participate in DNA replication and DNA repair, a sizeable fraction display a reduced fidelity, and act to catalyze potentially error-prone translesion DNA synthesis (TLS) past lesions that persist in the DNA. Striking the proper balance between use of these different enzymes during DNA replication, DNA repair, and TLS is essential for ensuring accurate duplication of the cell’s genome. This review highlights mechanisms that organisms utilize to manage the actions of their different Pols. A particular emphasis is placed on discussion of current models for how different Pols switch places with each other at the replication fork during high fidelity replication and potentially error-pone TLS. PMID:19540941

  12. Potency of carcinogens derived from covalent DNA binding and stimulation of DNA synthesis in rat liver

    SciTech Connect

    Lutz, W.K.; Buesser, M.T.; Sagelsdorff, P.

    1984-01-01

    In order to investigate the role of the stimulation of cell division for the initiation (and possibly promotion) of liver tumors by chemical carcinogens, the incorporation of radiolabelled thymidine into liver DNA was determined in male rats. Single doses of various levels of aflatoxin B1, benzidine and carbon tetrachloride (all known to be genotoxic via DNA binding) did not affect cell division, whereas several hepatocarcinogens known not to bind to DNA (alpha-HCH, clofibrate, and 2,3,7,8-tetrachlorodibenzo-p-dioxin) gave rise to a dose-dependent stimulation of liver DNA synthesis within 24 h. An equation combining the influences of mitotic stimulation, expressed as dose required to double the control level of DNA synthesis, and DNA binding potency, expressed as the Covalent Binding Index, correlated well with the carcinogenic potency for both classes of hepatocarcinogens.

  13. Characterization of human translesion DNA synthesis across a UV-induced DNA lesion

    PubMed Central

    Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

    2016-01-01

    Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570

  14. Synthesis and evaluation of new spacers for use as dsDNA endcaps

    PubMed Central

    Ng, Pei-Sze; Laing, Brian M.; Balasundarum, Ganesan; Pingle, Maneesh; Friedman, Alan; Bergstrom, Donald E.

    2010-01-01

    A series of aliphatic and aromatic spacer molecules designed to cap the ends of DNA duplexes have been synthesized. The spacers were converted into dimethoxytrityl protected phosphoramidites as synthons for oligonucleotides synthesis. The effect of the spacers on the stability of short DNA duplexes was assessed by melting temperature studies. Endcaps containing amide groups were found to be less stabilizing than the hexaethylene glycol spacer. Endcaps containing either a terthiophene or a naphthalene tetracarboxylic acid dimide were found to be significantly more stabilizing. The former showed a preference for stacking above an A•T base pair. Spacers containing only methylene (-CH2-) and amide (-CONH-) groups interact weakly with DNA and consequently may be optimal for applications that require minimal influence on DNA structure but require a way to hold the ends of double-stranded DNA together. PMID:20715857

  15. Synthesis and evaluation of new spacers for use as dsDNA end-caps.

    PubMed

    Ng, Pei-Sze; Laing, Brian M; Balasundarum, Ganesan; Pingle, Maneesh; Friedman, Alan; Bergstrom, Donald E

    2010-08-18

    A series of aliphatic and aromatic spacer molecules designed to cap the ends of DNA duplexes have been synthesized. The spacers were converted into dimethoxytrityl-protected phosphoramidites as synthons for oligonucleotides synthesis. The effect of the spacers on the stability of short DNA duplexes was assessed by melting temperature studies. End-caps containing amide groups were found to be less stabilizing than the hexaethylene glycol spacer. End-caps containing either a terthiophene or a naphthalene tetracarboxylic acid diimide were found to be significantly more stabilizing. The former showed a preference for stacking above an A*T base pair. Spacers containing only methylene (-CH(2)-) and amide (-CONH-) groups interact weakly with DNA and consequently may be optimal for applications that require minimal influence on DNA structure but require a way to hold the ends of double-stranded DNA together.

  16. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    SciTech Connect

    Jones, R.A.

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  17. Porous silicon microparticles as an alternative support for solid phase DNA synthesis

    NASA Astrophysics Data System (ADS)

    McInnes, Steven; Graney, Sean; Khung, Yit-lung; Voelcker, Nicolas H.

    2006-01-01

    Current methods to produce short DNA strands (oligonucleotides) involve the stepwise coupling of phosphoramidites onto a solid support, typically controlled pore glass. The full-length oligonucleotide is then cleaved from the solid support using a suitable aqueous or organic base and the oligonucleotide is subsequently separated from the spent support. This final step, albeit seemingly easy, invariably leads to increased production costs due to increased synthesis time and reduced yields. This paper describes the preparation of a dissolvable support for DNA synthesis based on porous silicon (pSi). Initially it was thought that the pSi support would undergo dissolution by hydrolysis upon cleavage of the freshly synthesised oligonucleotide strands with ammonium hydroxide. The ability to dissolve the solid support after completion of the synthesis cycle would eliminate the separation step required in current DNA synthesis protocols, leading to simpler and faster synthesis as well as increased yields, however it was found that the functionalisation of the pSi imparted a stability that impeded the dissolution. This strategy may also find applications for drug delivery where the controlled release of carrier-immobilised short antisense DNA is desired. The approach taken involves the fabrication of porous silicon (pSi) microparticles and films. Subsequently, the pSi is oxidised and functionalised with a dimethoxytrityl protected propanediol to facilitate the stepwise solid phase synthesis of DNA oligonucleotides. The functionalisation of the pSi is monitored by diffuse reflectance infrared spectroscopy and the successful trityl labelling of the pSi is detected by UV-Vis spectroscopy after release of the dimethoxytrityl cation in the presence of trichloroacetic acid (TCA). Oligonucleotide yields can be quantified by UV-Vis spectroscopy.

  18. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis

    PubMed Central

    2015-01-01

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the “structure elucidation problem”: the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS’s utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 104 molecules/bead and sequencing allowed for elucidation of each compound’s synthetic history. We applied DESPS to the combinatorial synthesis of a 75 645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and

  19. Switchable Protecting Strategy for Solid Phase Synthesis of DNA and RNA Interacting Nucleopeptides.

    PubMed

    Mercurio, Maria Emilia; Tomassi, Stefano; Gaglione, Maria; Russo, Rosita; Chambery, Angela; Lama, Stefania; Stiuso, Paola; Cosconati, Sandro; Novellino, Ettore; Di Maro, Salvatore; Messere, Anna

    2016-12-02

    Nucleopeptides are promising nucleic acid mimetics in which the peptide backbone bears nucleobases. They can recognize DNA and RNA targets modulating their biological functions. To date, the lack of an effective strategy for the synthesis of nucleopeptides prevents their evaluation for biological and biomedical applications. Herein, we describe an unprecedented approach that enables the synthesis of cationic both homo and heterosequence nucleopeptides wholly on solid support with high yield and purity. Spectroscopic studies indicate advantageous properties of the nucleopeptides in terms of binding, thermodynamic stability and sequence specific recognition. Biostability assay and laser scanning confocal microscopy analyses reveal that the nucleopeptides feature acceptable serum stability and ability to cross the cell membrane.

  20. De novo design, synthesis and spectroscopic characterization of chiral benzimidazole-derived amino acid Zn(II) complexes: Development of tryptophan-derived specific hydrolytic DNA artificial nuclease agent

    NASA Astrophysics Data System (ADS)

    Parveen, Shazia; Arjmand, Farukh

    2012-01-01

    Novel ternary dizinc(II) complexes 1- 3, derived from 1,2-bis(1H-benzimidazol-2-yl)ethane-1,2-diol and L-form of amino acids (viz., tryptophan, leucine and valine) were synthesized and characterized by spectroscopic (IR, 1H NMR, UV-vis, ESI-MS) and other analytical methods. To evaluate the biological preference of chiral drugs for inherently chiral target DNA, interaction of 1- 3 with calf thymus DNA in Tris-HCl buffer was studied by various biophysical techniques which reveal that all these complexes bind to CT DNA non-covalently via electrostatic interaction. The higher Kb value of L-tryptophan complex 1 suggested greater DNA binding propensity. Further, to evaluate the mode of action at the molecular level, interaction studies of complexes 1 and 2 with nucleotides (5'-GMP and 5'-TMP) were carried out by UV-vis titrations, 1H and 31P NMR which implicates the preferential selectivity of these complexes to N3 of thymine rather than N7 of guanine. Furthermore, complex 1 exhibits efficient DNA cleavage with supercoiled pBR322. The complex 1 cleaves DNA efficiently involving hydrolytic cleavage pathway. Such chiral synthetic hydrolytic nucleases with asymmetric centers are gaining considerable attention owing to their importance in biotechnology and drug design, in particular to cleave DNA with sequence selectivity different from that of the natural enzymes.

  1. Double-helical nucleic acids with cross-linked strands: synthesis and applications in molecular biology

    NASA Astrophysics Data System (ADS)

    Antsypovitch, Sergei I.; Oretskaya, Tat'yana S.

    1998-03-01

    Data on the methods employed for cross-linking of DNA strands and for the synthesis of oligonucleotide duplexes with cross-links between strands are summarised. Existing methods are systematised; their advantages and drawbacks are discussed. The examples of applications of DNA duplexes with covalently cross-linked chains for the study of protein-nucleic acid recognition and mechanisms of action of nucleic acid-binding proteins for gaining information about the spatial structure of nucleic acids, and for the solution of other problems of molecular biology are given. The bibliography includes 131 references.

  2. Translesion Synthesis: Insights into the Selection and Switching of DNA Polymerases

    PubMed Central

    Zhao, Linlin; Washington, M. Todd

    2017-01-01

    DNA replication is constantly challenged by DNA lesions, noncanonical DNA structures and difficult-to-replicate DNA sequences. Two major strategies to rescue a stalled replication fork and to ensure continuous DNA synthesis are: (1) template switching and recombination-dependent DNA synthesis; and (2) translesion synthesis (TLS) using specialized DNA polymerases to perform nucleotide incorporation opposite DNA lesions. The former pathway is mainly error-free, and the latter is error-prone and a major source of mutagenesis. An accepted model of translesion synthesis involves DNA polymerase switching steps between a replicative DNA polymerase and one or more TLS DNA polymerases. The mechanisms that govern the selection and exchange of specialized DNA polymerases for a given DNA lesion are not well understood. In this review, recent studies concerning the mechanisms of selection and switching of DNA polymerases in eukaryotic systems are summarized. PMID:28075396

  3. Strand displacement synthesis by yeast DNA polymerase ε

    PubMed Central

    Ganai, Rais A.; Zhang, Xiao-Ping; Heyer, Wolf-Dietrich; Johansson, Erik

    2016-01-01

    DNA polymerase ε (Pol ε) is a replicative DNA polymerase with an associated 3′–5′ exonuclease activity. Here, we explored the capacity of Pol ε to perform strand displacement synthesis, a process that influences many DNA transactions in vivo. We found that Pol ε is unable to carry out extended strand displacement synthesis unless its 3′–5′ exonuclease activity is removed. However, the wild-type Pol ε holoenzyme efficiently displaced one nucleotide when encountering double-stranded DNA after filling a gap or nicked DNA. A flap, mimicking a D-loop or a hairpin structure, on the 5′ end of the blocking primer inhibited Pol ε from synthesizing DNA up to the fork junction. This inhibition was observed for Pol ε but not with Pol δ, RB69 gp43 or Pol η. Neither was Pol ε able to extend a D-loop in reconstitution experiments. Finally, we show that the observed strand displacement synthesis by exonuclease-deficient Pol ε is distributive. Our results suggest that Pol ε is unable to extend the invading strand in D-loops during homologous recombination or to add more than two nucleotides during long-patch base excision repair. Our results support the hypothesis that Pol ε participates in short-patch base excision repair and ribonucleotide excision repair. PMID:27325747

  4. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  5. Towards the Batch Synthesis of Long DNA

    DTIC Science & Technology

    2002-10-01

    MISMATCHES In a series of papers,136 the SantaLucia NN model137 of Watson - Crick paired DNA thermodynamics was successfully extended to incorporate...generally indicate a- helix coding or structural motifs for DNA incorporation into chromatin. Trifonov, E. N., “3-,!10.5-, 200- and 400-base...double-stranded DNA , is well-described by Hearst’s “weakly bending rod” model with 3.4 Å rise/bp and 13 Å radius for the helix ; its persistence length39

  6. Sugar-oligoamides: synthesis of DNA minor groove binders.

    PubMed

    Badía, Concepción; Souard, Florence; Vicent, Cristina

    2012-12-07

    Sugar-oligoamides have been designed and synthesized as structurally simple carbohydrate-based ligands to study carbohydrate-minor groove DNA interactions. Here we report an efficient solution-phase synthetic strategy to obtain two broad families of sugar-oligoamides. The first type, structure vector A (-Py[Me]-γ-Py-Ind), has a methyl group present as a substituent on the nitrogen of pyrrole B, connected to the C terminal of the oligoamide fragment. The second type, structure vector B (-Py[(CH(2))(11)OH]-γ-Py-Ind), has an alkyl chain present on the nitrogen of pyrrole B connected to the C terminal of the oligoamide fragment and has been designed to access to di- and multivalent sugar-oligoamides. By using sequential DIPC/HOBt coupling reactions, the oligoamide fragment -Py[R]-γ-Py-Ind has been constructed. The last coupling reaction between the anomeric amino sugar and the oligoamide fragment was carried out by activating the acid derivative as a BtO- ester, which has been performed by using TFFH. The isolated esters (BtO-Py[R]-γ-Py-Ind) were coupled with selected amino sugars using DIEA in DMF. The synthesis of two different selective model vectors (vector A (1) and vector B (2)) and two types of water-soluble sugar-oligoamide ligands, with vector A structure (compounds 3-7) and with vector B structure (compound 8), was carried out.

  7. Synthesis, structural investigation, DNA and protein binding study of some 3d-metal complexes with N'-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide.

    PubMed

    Mishra, Monika; Tiwari, Karishma; Shukla, Sachin; Mishra, R; Singh, Vinod P

    2014-11-11

    The ligand, N'-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide (Hpmtc) derived from thiophene-2-carboxylic acid hydrazide and 2-benzoyl pyridine, and its metal complexes with Co(II), Ni(II), Cu(II) and Zn(II) have been synthesized. These compounds are characterized by elemental analyses, magnetic susceptibility measurements, IR, NMR and UV-Vis spectral studies. The molecular structures of Hpmtc and its Co(II) (1), Ni(II) (2), Cu(II) (3) and Zn(II) (4) complexes are finally determined by X-ray crystallography. Various spectral and single-crystal X-ray diffraction studies suggest that Hpmtc coordinates with metal ions as a monobasic tridentate ligand forming mononuclear distorted octahedral complexes of the type [M(pmtc)2]. The molecular structures of the complexes are stabilized by CH⋯N, CH⋯O intermolecular H-bonding, and CH⋯π and π⋯π interactions. The DNA binding experiment of the complexes 1, 3 and 4 by UV-Vis absorption, and EB-DNA displacement by fluorescence spectroscopy, reveal an intercalative mode of binding between CT-DNA (calf-thymus DNA) and the metal complexes. These complexes exhibit a moderate ability to cleave pBR322 plasmid DNA. A comparative bovine serum albumin (BSA) protein binding activity of the complexes 1, 3 and 4 has also been determined by UV-Vis absorption and fluorescence spectroscopy. The DNA binding and protein binding studies suggest that the complex 3 exhibits more effective binding activity (Kb=5.54×10(5) and Kq=1.26×10(6) M(-1), respectively) than complexes 1 and 4. However, the complex 1 shows better hydrolytic DNA cleavage activity compared to 3 and 4 complexes.

  8. Synthesis, structural investigation, DNA and protein binding study of some 3d-metal complexes with N‧-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide

    NASA Astrophysics Data System (ADS)

    Mishra, Monika; Tiwari, Karishma; Shukla, Sachin; Mishra, R.; Singh, Vinod P.

    2014-11-01

    The ligand, N‧-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide (Hpmtc) derived from thiophene-2-carboxylic acid hydrazide and 2-benzoyl pyridine, and its metal complexes with Co(II), Ni(II), Cu(II) and Zn(II) have been synthesized. These compounds are characterized by elemental analyses, magnetic susceptibility measurements, IR, NMR and UV-Vis spectral studies. The molecular structures of Hpmtc and its Co(II) (1), Ni(II) (2), Cu(II) (3) and Zn(II) (4) complexes are finally determined by X-ray crystallography. Various spectral and single-crystal X-ray diffraction studies suggest that Hpmtc coordinates with metal ions as a monobasic tridentate ligand forming mononuclear distorted octahedral complexes of the type [M(pmtc)2]. The molecular structures of the complexes are stabilized by Csbnd H⋯N, Csbnd H⋯O intermolecular H-bonding, and Csbnd H⋯π and π⋯π interactions. The DNA binding experiment of the complexes 1, 3 and 4 by UV-Vis absorption, and EB-DNA displacement by fluorescence spectroscopy, reveal an intercalative mode of binding between CT-DNA (calf-thymus DNA) and the metal complexes. These complexes exhibit a moderate ability to cleave pBR322 plasmid DNA. A comparative bovine serum albumin (BSA) protein binding activity of the complexes 1, 3 and 4 has also been determined by UV-Vis absorption and fluorescence spectroscopy. The DNA binding and protein binding studies suggest that the complex 3 exhibits more effective binding activity (Kb = 5.54 × 105 and Kq = 1.26 × 106 M-1, respectively) than complexes 1 and 4. However, the complex 1 shows better hydrolytic DNA cleavage activity compared to 3 and 4 complexes.

  9. Nitrous acid induced damage in T7 DNA and phage

    SciTech Connect

    Scearce, L.M.; Masker, W.E.

    1986-05-01

    The response of bacteriophage T7 to nitrous acid damage was investigated. The T7 system allows in vitro mimicry of most aspects of in vivo DNA metabolism. Nitrous acid is of special interest since it has been previously shown to induce deletions and point mutations as well as novel adducts in DNA. T7 phage was exposed to 56 mM nitrous acid at pH 4.6 in vivo, causing a time dependent 98% decrease in survival for each 10 min duration of exposure to nitrous acid. These studies were extended to include examination of pure T7 DNA exposed in vitro to nitrous acid conditions identical to those used in the in vivo survival studies. The treated DNA was dialyzed to remove the nitrous acid and the DNA was encapsulated into empty phage heads. These in vitro packaged phage showed a survival curve analogous to the in vivo system. There was no change in survival when either in vitro or in vivo exposed phage were grown on wild type E. coli or on E. coli strains deficient in DNA repair due to mutations in DNA polymerase I, exonuclease III or a uvrA mutation. Survival was not increased when nitrous acid treated T7 were grown on E. coli induced for SOS repair. In vitro replication of nitrous acid treated DNA showed a time dependent decrease in the total amount of DNA synthesized.

  10. Two new neutral copper(II) complexes with dipicolinic acid and 3-amino-1H-1,2,4-triazole formed under different reaction conditions: synthesis, characterization, molecular structures and DNA-binding studies.

    PubMed

    Tabatabaee, Masoumeh; Bordbar, Maryam; Ghassemzadeh, Mitra; Tahriri, Mozhgan; Tahrir, Marjan; Mehri Lighvan, Zohreh; Neumüller, Bernhard

    2013-01-01

    Two Cu(II) complexes, [Cu₂(μ-atr)(pydc)₂(H₂O)₄]·5H₂O (1) and [Cu(atr)(pydc) (H₂O)]·H₂O (2), with pyridine-2,6-dicarboxylic acid (H₂pydc) and 3-amino-1H-1,2,4-triazole (atr), have been synthesized and characterized. The interaction ability of the both complexes with native calf thymus DNA (CT-DNA) has been monitored as a function of the metal complex-DNA molar ratio. UV-vis spectrophotometry, circular dichroism (CD), thermal denaturation studies, cyclic voltammetry (CV) and viscosity measurements. The intrinsic binding constants K(b) of complexes 1 and 2, with CT-DNA obtained from UV-vis absorption studies were 4.7 (±0. 1) × 10(4) and 9.5 (±0. 1) × 10(4) M(-1), respectively. Further investigation of interaction mode was performed using viscosity, cyclic voltammetry and T(m) of CT-DNA studies as well as CD study, indicating complexes bind to DNA via an intercalation mode.

  11. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  12. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  13. Sickle erythrocytes inhibit human endothelial cell DNA synthesis

    SciTech Connect

    Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K. )

    1990-11-15

    Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling.

  14. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  15. Cell cycle specific distribution of killin: evidence for negative regulation of both DNA and RNA synthesis.

    PubMed

    Qiao, Man; Luo, Dan; Kuang, Yi; Feng, Haiyan; Luo, Guangping; Liang, Peng

    2015-01-01

    p53 tumor-suppressor gene is a master transcription factor which controls cell cycle progression and apoptosis. killin was discovered as one of the p53 target genes implicated in S-phase control coupled to cell death. Due to its extreme proximity to pten tumor-suppressor gene on human chromosome 10, changes in epigenetic modification of killin have also been linked to Cowden syndrome as well as other human cancers. Previous studies revealed that Killin is a high-affinity DNA-binding protein with preference to single-stranded DNA, and it inhibits DNA synthesis in vitro and in vivo. Here, co-localization studies of RFP-Killin with either GFP-PCNA or endogenous single-stranded DNA binding protein RPA during S-phase show that Killin always adopts a mutually exclusive punctuated nuclear expression pattern with the 2 accessory proteins in DNA replication. In contrast, when cells are not in S-phase, RFP-Killin largely congregates in the nucleolus where rRNA transcription normally occurs. Both of these cell cycle specific localization patterns of RFP-Killin are stable under high salt condition, consistent with Killin being tightly associated with nucleic acids within cell nuclei. Together, these cell biological results provide a molecular basis for Killin in competitively inhibiting the formation of DNA replication forks during S-phase, as well as potentially negatively regulate RNA synthesis during other cell cycle phases.

  16. The nexus of vitamin homeostasis and DNA synthesis and modification in mammalian brain.

    PubMed

    Spector, Reynold; Johanson, Conrad E

    2014-01-10

    The purpose of this review is to discuss the implications of the 2009 discovery of the sixth deoxyribonucleoside (dN) [5-hydroxymethyldeoxycytidine (hmdC)] in DNA which is the most abundant in neurons. The concurrent discovery of the three ten-eleven translocation enzymes (TET) which not only synthesize but also oxidize hmdC in DNA, prior to glycosylase removal and base excision repair, helps explain many heretofore unexplained phenomena in brain including: 1) the high concentration of ascorbic acid (AA) in neurons since AA is a cofactor for the TET enzymes, 2) the requirement for reduced folates and the dN synthetic enzymes in brain, 3) continued DNA synthesis in non-dividing neurons to repair the dynamic formation/removal of hmdC, and 4) the heretofore unexplained mechanism to remove 5-methyldeoxycytidine, the fifth nucleoside, from DNA. In these processes, we also describe the important role of choroid plexus and CSF in supporting vitamin homeostasis in brain: especially for AA and folates, for hmdC synthesis and removal, and methylated deoxycytidine (mdC) removal from DNA in brain. The nexus linking AA and folates to methylation, hydroxymethylation, and demethylation of DNA is pivotal to understanding not only brain development but also the subsequent function.

  17. The nexus of vitamin homeostasis and DNA synthesis and modification in mammalian brain

    PubMed Central

    2014-01-01

    The purpose of this review is to discuss the implications of the 2009 discovery of the sixth deoxyribonucleoside (dN) [5-hydroxymethyldeoxycytidine (hmdC)] in DNA which is the most abundant in neurons. The concurrent discovery of the three ten-eleven translocation enzymes (TET) which not only synthesize but also oxidize hmdC in DNA, prior to glycosylase removal and base excision repair, helps explain many heretofore unexplained phenomena in brain including: 1) the high concentration of ascorbic acid (AA) in neurons since AA is a cofactor for the TET enzymes, 2) the requirement for reduced folates and the dN synthetic enzymes in brain, 3) continued DNA synthesis in non-dividing neurons to repair the dynamic formation/removal of hmdC, and 4) the heretofore unexplained mechanism to remove 5-methyldeoxycytidine, the fifth nucleoside, from DNA. In these processes, we also describe the important role of choroid plexus and CSF in supporting vitamin homeostasis in brain: especially for AA and folates, for hmdC synthesis and removal, and methylated deoxycytidine (mdC) removal from DNA in brain. The nexus linking AA and folates to methylation, hydroxymethylation, and demethylation of DNA is pivotal to understanding not only brain development but also the subsequent function. PMID:24410751

  18. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  19. Switchable reconfiguration of nucleic acid nanostructures by stimuli-responsive DNA machines.

    PubMed

    Liu, Xiaoqing; Lu, Chun-Hua; Willner, Itamar

    2014-06-17

    CONSPECTUS: The base sequence in DNA dictates structural and reactivity features of the biopolymer. These properties are implemented to use DNA as a unique material for developing the area of DNA nanotechnology. The design of DNA machines represents a rapidly developing research field in the area of DNA nanotechnology. The present Account discusses the switchable reconfiguration of nucleic acid nanostructures by stimuli-responsive DNA machines, and it highlights potential applications and future perspectives of the area. Programmed switchable DNA machines driven by various fuels and antifuels, such as pH, Hg(2+) ions/cysteine, or nucleic acid strands/antistrands, are described. These include the assembly of DNA tweezers, walkers, a rotor, a pendulum, and more. Using a pH-oscillatory system, the oscillatory mechanical operation of a DNA pendulum is presented. Specifically, the synthesis and "mechanical" properties of interlocked DNA rings are described. This is exemplified with the preparation of interlocked DNA catenanes and a DNA rotaxane. The dynamic fuel-driven reconfiguration of the catenane/rotaxane structures is followed by fluorescence spectroscopy. The use of DNA machines as functional scaffolds to reconfigurate Au nanoparticle assemblies and to switch the fluorescence features within fluorophore/Au nanoparticle conjugates between quenching and surface-enhanced fluorescence states are addressed. Specifically, the fluorescence features of the different DNA machines are characterized as a function of the spatial separation between the fluorophore and Au nanoparticles. The experimental results are supported by theoretical calculations. The future development of reconfigurable stimuli-responsive DNA machines involves fundamental challenges, such as the synthesis of molecular devices exhibiting enhanced complexities, the introduction of new fuels and antifuels, and the integration of new payloads being reconfigured by the molecular devices, such as enzymes or

  20. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2009-01-01

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  1. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  2. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  3. The control of lambda DNA terminase synthesis.

    PubMed Central

    Murialdo, H; Davidson, A; Chow, S; Gold, M

    1987-01-01

    Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

  4. Developing Inhibitors of Translesion DNA Synthesis as Therapeutic Agents against Lung Cancer

    DTIC Science & Technology

    2015-12-01

    AWARD NUMBER: W81XWH-13-1-0238 TITLE: Developing Inhibitors of Translesion DNA Synthesis as Therapeutic Agents against Lung Cancer PRINCIPAL...of Translesion DNA Synthesis as Therapeutic Agents against Lung Cancer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S...Oxygen-rich environments can create pro-mutagenic DNA lesions such as 8-oxoguanine (8-oxo-G) that can be misreplicated during translesion DNA synthesis

  5. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  6. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-05

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA.

  7. Pif1 helicase and Polδ promote recombination-coupled DNA synthesis via bubble migration.

    PubMed

    Wilson, Marenda A; Kwon, YoungHo; Xu, Yuanyuan; Chung, Woo-Hyun; Chi, Peter; Niu, Hengyao; Mayle, Ryan; Chen, Xuefeng; Malkova, Anna; Sung, Patrick; Ira, Grzegorz

    2013-10-17

    During DNA repair by homologous recombination (HR), DNA synthesis copies information from a template DNA molecule. Multiple DNA polymerases have been implicated in repair-specific DNA synthesis, but it has remained unclear whether a DNA helicase is involved in this reaction. A good candidate DNA helicase is Pif1, an evolutionarily conserved helicase in Saccharomyces cerevisiae important for break-induced replication (BIR) as well as HR-dependent telomere maintenance in the absence of telomerase found in 10-15% of all cancers. Pif1 has a role in DNA synthesis across hard-to-replicate sites and in lagging-strand synthesis with polymerase δ (Polδ). Here we provide evidence that Pif1 stimulates DNA synthesis during BIR and crossover recombination. The initial steps of BIR occur normally in Pif1-deficient cells, but Polδ recruitment and DNA synthesis are decreased, resulting in premature resolution of DNA intermediates into half-crossovers. Purified Pif1 protein strongly stimulates Polδ-mediated DNA synthesis from a D-loop made by the Rad51 recombinase. Notably, Pif1 liberates the newly synthesized strand to prevent the accumulation of topological constraint and to facilitate extensive DNA synthesis via the establishment of a migrating D-loop structure. Our results uncover a novel function of Pif1 and provide insights into the mechanism of HR.

  8. One-stop genomic DNA extraction by salicylic acid-coated magnetic nanoparticles.

    PubMed

    Zhou, Zhongwu; Kadam, Ulhas S; Irudayaraj, Joseph

    2013-11-15

    Salicylic acid-coated magnetic nanoparticles were prepared via a modified one-step synthesis and used for a one-stop extraction of genomic DNA from mammalian cells. The synthesized magnetic particles were used for magnetic separation of cells from the media by nonspecific binding of the particles as well as extraction of genomic DNA from the lysate. The quantity and quality were confirmed by agarose gel electrophoresis and polymerase chain reaction. The entire process of extraction and isolation can be completed within 30 min. Compared with traditional methods based on centrifugation and filtration, the established method is fast, simple, reliable, and environmentally friendly.

  9. Synthesis, Characterization, and DNA Binding Profile of a Macrocyclic β-Sheet Analogue of ARC Protein

    PubMed Central

    2015-01-01

    ARC repressor (apoptosis repressor with caspase recruitment domain) is a protein which binds selectively to a specific sequence of DNA. In humans, ARC is primarily expressed in striated muscle tissue, which normally does not undergo rapid cell turnover. This suggests that ARC may play a protective role in the prevention against Duchenne Muscular Dystrophy and several types of tumors. In this Letter we report the synthesis, characterization, and conformational analysis of a β-sheet ARC repressor mimetic, based on the amino acid sequence of the β-sheet domain in the ARC protein. The ability of this β-sheet macrocycle to bind to double-stranded DNA was also evaluated using spectroscopic methods. Our data show that the synthetic peptide has a defined conformation and is able to bind DNA with reasonable affinity. These initial results lay the groundwork for the design of novel β-sheets folded peptides as valuable substitutes of transcription factor proteins in drug therapy. PMID:26713108

  10. Psoralen plus near-ultraviolet light: a possible new method for measuring DNA repair synthesis

    SciTech Connect

    Heimer, Y.M.; Kol, R.; Shiloh, Y.; Riklis, E.

    1983-09-01

    A new method is proposed to inhibit semiconservative DNA synthesis in cultured cells while DNA repair synthesis is being measured. The cells are treated with the DNA-crosslinking agent Trioxalen (4,5,8-trimethylpsoralen) plus near-ultraviolet light, and consequently 99.5% inhibition of replicative DNA synthesis is achieved. Additional DNA-damaging agents induce thymidine incorporation into the double-stranded regions of the DNA. The new method gave results very similar to those obtained with the benzoylated naphthoylated DEAE (BND) cellulose method using three human fibroblast strains, of which one had deficient capacity for DNA repair synthesis following treatment with ..gamma.. rays and methyl methanesulfonate. The advantages of the new method are simplicity and rapidity, as well as the high extent to which replicative DNA synthesis is inhibited.

  11. Psoralen plus near-ultraviolet light: a possible new method for measuring DNA repair synthesis

    SciTech Connect

    Heimer, Y.M.; Kol, R.; Shiloh, Y.; Riklis, E.

    1983-09-01

    A new method is proposed to inhibit semiconservative DNA synthesis in cultured cells while DNA repair synthesis is being measured. The cells are treated with the DNA-crosslinking agent Trioxalen (4,5,8-trimethylpsoralen) plus near-ultraviolet light, and consequently 99.5% inhibition of replicative DNA synthesis is achieved. Additional DNA-damaging agents induce thymidine incorporation into the double-stranded regions of the DNA. The new method gave results very similar to those obtained with the benzoylated naphthoylated DEAE (BND) cellulose method using three human fibroblast strains, of which one had deficient capacity for DNA repair synthesis following treatment with gamma rays and methyl methanesulfonate. The advantages of the new method are simplicity and rapidity, as well as the high extent to which replicative DNA synthesis is inhibited.

  12. Synchronization of mitochondrial DNA synthesis in Chinese hamster cells (line CHO) deprived of isoleucine.

    PubMed

    Ley, K D; Murphy, M M

    1973-08-01

    Mitochondrial DNA (mit-DNA) synthesis was compared in suspension cultures of Chinese hamster cells (line CHO) whose cell cycle events had been synchronized by isoleucine deprivation or mitotic selection. At hourly intervals during cell cycle progression, synchronized cells were exposed to tritiated thymidine ([(3)H]TdR), homogenized, and nuclei and mitochondria isolated by differential centrifugation. Mit-DNA and nuclear DNA were isolated and incorporation of radioisotope measured as counts per minute ([(3)H]TdR) per microgram DNA. Mit-DNA synthesis in cells synchronized by mitotic selection began after 4 h and continued for approximately 9 h. This time-course pattern resembled that of nuclear DNA synthesis. In contrast, mit-DNA synthesis in cells synchronized by isoleucine deprivation did not begin until 9-12 h after addition of isoleucine and virtually all [(3)H]TdR was incorporated during a 3-h interval. We have concluded from these results that mit-DNA synthesis is inhibited in CHO cells which are arrested in G(1) because of isoleucine deprivation and that addition of isoleucine stimulates synchronous synthesis of mit-DNA. We believe this method of synchronizing mit-DNA synthesis may be of value in studies of factors which regulate synthesis of mit-DNA.

  13. Iron reverses impermeable chelator inhibition of DNA synthesis in CCl 39 cells.

    PubMed

    Alcain, F J; Löw, H; Crane, F L

    1994-08-16

    Treatment of Chinese hamster lung fibroblasts (CCl 39 cells) with the impermeable iron(II) chelator bathophenanthroline disulfonate (BPS) inhibits DNA synthesis when cell growth is initiated with growth factors including epidermal growth factor plus insulin, thrombin, or ceruloplasmin, but not with 10% fetal calf serum. The BPS treatment inhibits transplasma membrane electron transport. The treatment leads to release of iron from the cells as determined by BPS iron(II) complex formation over 90 min. Growth factor stimulation of DNA synthesis and electron transport are restored by addition of di- or trivalent iron to the cells in the form of ferric ammonium citrate, ferrous ammonium sulfate, or diferric transferrin. The effect with BPS differs from the inhibition of growth by hydroxyurea, which acts on the ribonucleotide reductase, or diethylenetriaminepentaacetic acid, which is another impermeable chelating agent, in that these agents inhibit growth in 10% fetal calf serum. The BPS effect is consistent with removal of iron from a site on the cell surface that controls DNA synthesis.

  14. Iron Reverses Impermeable Chelator Inhibition of DNA Synthesis in CCl39 Cells

    NASA Astrophysics Data System (ADS)

    Alcain, Francisco J.; Low, Hans; Crane, Frederick L.

    1994-08-01

    Treatment of Chinese hamster lung fibro-blasts (CCl 39 cells) with the impermeable iron(II) chelator bathophenanthroline disulfonate (BPS) inhibits DNA synthesis when cell growth is initiated with growth factors including epidermal growth factor plus insulin, thrombin, or ceruloplasmin, but not with 10% fetal calf serum. The BPS treatment inhibits transplasma membrane electron transport. The treatment leads to release of iron from the cells as determined by BPS iron(II) complex formation over 90 min. Growth factor stimulation of DNA synthesis and electron transport are restored by addition of di- or trivalent iron to the cells in the form of ferric ammonium citrate, ferrous ammonium sulfate, or diferric transferrin. The effect with BPS differs from the inhibition of growth by hydroxyurea, which acts on the ribonucleotide reductase, or diethylenetriaminepentaacetic acid, which is another impermeable chelating agent, in that these agents inhibit growth in 10% fetal calf serum. The BPS effect is consistent with removal of iron from a site on the cell surface that controls DNA synthesis.

  15. Application of Biocatalysis to on-DNA Carbohydrate Library Synthesis.

    PubMed

    Thomas, Baptiste; Lu, Xiaojie; Birmingham, William R; Huang, Kun; Both, Peter; Reyes Martinez, Juana Elizabeth; Young, Robert J; Davie, Christopher P; Flitsch, Sabine L

    2017-01-26

    DNA-encoded libraries are increasingly used for the discovery of bioactive lead compounds in high-throughput screening programs against specific biological targets. Although a number of libraries are now available, they cover limited chemical space due to bias in ease of synthesis and the lack of chemical reactions that are compatible with DNA tagging. For example, compound libraries rarely contain complex biomolecules such as carbohydrates with high levels of functionality, stereochemistry, and hydrophilicity. By using biocatalysis in combination with chemical methods, we aimed to significantly expand chemical space and generate generic libraries with potentially better biocompatibility. For DNA-encoded libraries, biocatalysis is particularly advantageous, as it is highly selective and can be performed in aqueous environments, which is an essential feature for this split-and-mix library technology. In this work, we demonstrated the application of biocatalysis for the on-DNA synthesis of carbohydrate-based libraries by using enzymatic oxidation and glycosylation in combination with traditional organic chemistry.

  16. Uracil misincorporation into DNA and folic acid supplementation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BACKGROUND: Folate deficiency decreases thymidylate synthesis from deoxyuridylate, which results in an imbalance of deoxyribonucleotide that may lead to excessive uracil misincorporation (UrMis) into DNA during replication and repair. OBJECTIVE: We evaluated the relation between UrMis in different ...

  17. Synthesis, spectroscopic characterization and structural investigation of a new charge transfer complex of 2,6-diaminopyridine with 4-nitrophenylacetic acid: Antimicrobial, DNA binding/cleavage and antioxidant studies

    NASA Astrophysics Data System (ADS)

    Murugesan, Venkatesan; Saravanabhavan, Munusamy; Sekar, Marimuthu

    2015-08-01

    A new hydrogen-bonded charge-transfer complex (CT) formed by the reaction between donor, 2,6-diaminopyridine and acceptor, 4-nitrophenylacetic acid in methanol at room temperature. The crystal was characterized by elemental analysis, IR, NMR spectroscopic studies and thermal studies. The elemental analysis of CT complex, obtained data revealed that the formation of 1:1 ratio CT complex was proposed. Infrared and NMR studies confirm the chemical constituents and molecular structure of the synthesized complex crystal. The high thermal stability is due to the molecular frame work through H-bonding interactions. Structural investigation indicates that cation and anion are linked through strong N+-H⋯O- type of hydrogen bond. The hydrogen bonded charge transfer crystal was screened for its pharmacology, such as antimicrobial, DNA binding/cleavage and antioxidant studies. The CT complex was screened for its antibacterial and antifungal activity against various bacterial and fungal species, which shows good antimicrobial activity. The DNA binding results indicated that the compound could interact with DNA through intercalation. It should have weak to moderate capacity of scavenging with DPPH.

  18. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    DOEpatents

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  19. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.

    2014-01-01

    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  20. Synthesis, spectroscopic, crystal structure and DNA binding of Ru(II) complexes with 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide

    NASA Astrophysics Data System (ADS)

    Chitrapriya, Nataraj; Sathiya Kamatchi, Thangavel; Zeller, Matthias; Lee, Hyosun; Natarajan, Karuppannan

    2011-10-01

    Reactions of 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide (H 2L) with [RuHCl(CO)(EPh 3) 3] (E = P or As) were carried out and the new complexes obtained were characterized by elemental analysis, electronic, IR, 1H NMR and 13C NMR spectroscopic techniques and single crystal X-ray diffraction studies. Complex ( 1) crystallizes in the monoclinic space group P2(1)/ c with unit cell dimensions a = 18.6236(17) Å, b = 12.8627(12) Å, c = 21.683(2) Å, α = 90.00, β = 114.626(2), γ = 90.00 V = 4721.8(8) Å, Z = 4. The crystal structure of the complex shows Ru(II) atom is six-coordinated, forming a slightly distorted octahedral geometry with two P atoms in axial positions, and three chelating donor atoms of the tridentate Schiff base ligand and one carbonyl group located in the equatorial plane. The molecular structure is stabilized by intramolecular O—H···N interactions. No intermolecular hydrogen bond was observed. The intramolecular hydrogen bond exists between the oxygen atom from salicylic acid moiety and nitrogen from the same moiety. A variety of solution studies were carried out for the determination of DNA binding mode of the complexes. The results suggest that both complexes bind to Herring sperm DNA via non intercalative mode.

  1. Synthesis, spectroscopic, crystal structure and DNA binding of Ru(II) complexes with 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide.

    PubMed

    Chitrapriya, Nataraj; Kamatchi, Thangavel Sathiya; Zeller, Matthias; Lee, Hyosun; Natarajan, Karuppannan

    2011-10-15

    Reactions of 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide (H(2)L) with [RuHCl(CO)(EPh(3))(3)] (E = P or As) were carried out and the new complexes obtained were characterized by elemental analysis, electronic, IR, (1)H NMR and (13)C NMR spectroscopic techniques and single crystal X-ray diffraction studies. Complex (1) crystallizes in the monoclinic space group P2(1)/c with unit cell dimensions a=18.6236(17) Å, b=12.8627(12) Å, c=21.683(2) Å, α=90.00, β=114.626(2), γ=90.00 V=4721.8(8) Å, Z=4. The crystal structure of the complex shows Ru(II) atom is six-coordinated, forming a slightly distorted octahedral geometry with two P atoms in axial positions, and three chelating donor atoms of the tridentate Schiff base ligand and one carbonyl group located in the equatorial plane. The molecular structure is stabilized by intramolecular O-H···N interactions. No intermolecular hydrogen bond was observed. The intramolecular hydrogen bond exists between the oxygen atom from salicylic acid moiety and nitrogen from the same moiety. A variety of solution studies were carried out for the determination of DNA binding mode of the complexes. The results suggest that both complexes bind to Herring sperm DNA via non intercalative mode.

  2. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  3. Spherical Nucleic Acids: A New Form of DNA

    NASA Astrophysics Data System (ADS)

    Cutler, Joshua Isaac

    Spherical Nucleic Acids (SNAs) are a new class of nucleic acid-based nanomaterials that exhibit unique properties currently being explored in the contexts of gene-based cancer therapies and in the design of programmable nanoparticle-based materials. The properties of SNAs differ from canonical, linear nucleic acids by virtue of their dense packing into an oriented 3-dimensional array. SNAs can be synthesized from a number of useful nanoparticle templates, such as plasmonic gold and silver, magnetic oxides, luminescent semi-conductor quantum dots, and silica. In addition, by crosslinking the oligonucleotides and dissolving the core, they can be made in a hollow form as well. This dissertation describes the evolution of SNAs from initial studies of inorganic nanoparticle-based materials densely functionalized with oligonucleotides to the proving of a hypothesis that their unique properties can be observed in a core-less structure if the nucleic acids are densely packed and highly oriented. Chapter two describes the synthesis of densely functionalized polyvalent oligonucleotide superparamagnetic iron oxide nanoparticles using the copper-catalyzed azide-alkyne cycloaddition reaction. These particles are shown to exhibit cooperative binding in a density- and salt concentration-dependent fashion, with nearly identical behaviors to those of SNA-functionalized gold nanoparticles. Importantly, these particles are the first non-gold particles shown to be capable of entering cells in high numbers via the SNA-mediated cellular uptake pathway, and provided the first evidence that SNA-mediated cellular uptake is core-independent. In the third chapter, a gold nanoparticle catalyzed alkyne cross-linking reaction is described that is capable of forming hollow organic nanoparticles using polymers with alkyne-functionalized backbones. With this method, the alkyne-modified polymers adsorb to the particle surfaces, cross-link on the surface, allowing the gold nanoparticle to be

  4. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  5. Control of the Synthesis of Macromolecules During Amino Acid and Thymine Starvation in Bacillus subtilis

    PubMed Central

    Anraku, Naoyo; Landman, Otto E.

    1968-01-01

    Studies of Maaløe, Lark, and others with amino acid- and thymine-starved cultures revealed successive steps in the biosynthesis of Escherichia coli chromosomes. In this study, the corresponding mechanisms in Bacillus subtilis 168 were examined. Using a strain requiring both thymine and tryptophan, we found that, 3 hr after the start of amino acid starvation, when the deoxyribonucleic acid (DNA) content of the culture had increased 40 to 50%, DNA synthesis ceased. After 4 to 5 hr, 100% of the cells were immune to thymineless death; their chromosomes had presumably been completed. Immune cultures slowly incorporated 3H-thymine. Thymine incorporation increased 20-fold 30 min after readdition of amino acids, indicating reinitiation of chromosome synthesis. Simultaneous presence of amino acids and thymine was required for reinitiation. If 5-bromouracil (5-BU) was added instead of thymine, newly replicated DNA segments could be separated by centrifugation in CsCl. Analysis of the CsCl fractions by a transformation assay showed that the order in which the markers were synthesized was ade-16, thr-5, leu-8, metB5. Less than half the chromosomes started resynthesis synchronously in 5-BU. Nevertheless, chromosome alignment in the amino acid-starved culture is probably very good: marker frequency analysis of its DNA gives the same normalized frequencies as DNA from “perfectly” aligned spores. Full viability is maintained in the chromosome-arrested culture for 10 hr in thymine-free medium in the absence or presence of amino acids. In the latter condition, protein synthesis proceeds, and the cells filament and become more lysozyme-sensitive. Such cells must be incubated and plated on hypertonic or on slow-growth media; otherwise, they undergo “quasiosmotic” thymineless death. This death is thus apparently not directly attributable to any damage of chromosomal DNA. Further, weakening of the teichoic acid portion of the cell wall is not involved, since 32P incorporation

  6. Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

    PubMed

    Schneider, Uffe Vest

    2012-01-01

    This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA

  7. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  8. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  9. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  10. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  11. HGF-induced DNA synthesis in hepatocytes is suppressed by p38.

    PubMed

    Aasrum, Monica; Brusevold, Ingvild J; Christoffersen, Thoralf; Thoresen, G Hege

    2016-12-01

    Previous studies in rat hepatocytes have shown that the MEK/ERK, PI3K/Akt and p38 pathways are all involved in the activation of DNA synthesis by EGF and that sustained activation of MEK/ERK is required. Here, we show that although HGF stimulated DNA synthesis and activated signaling in the same manner as EGF, the contribution of the signaling pathways to the induction of DNA synthesis differed. While HGF-induced DNA synthesis was dependent on MEK/ERK, with no significant contribution from PI3K/Akt, p38 suppressed HGF-induced DNA synthesis. The p38 inhibitor SB203580 increased HGF-induced DNA synthesis and enhanced the phosphorylation of ERK. In contrast, SB203580 decreased EGF-induced ERK phosphorylation. This suggests that p38 has distinct effects on DNA synthesis induced by EGF and HGF. Due to differential regulation of signaling through the MEK/ERK pathway, p38 acts as an enhancer of EGF-induced DNA synthesis and as a suppressor of HGF-induced DNA synthesis.

  12. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  13. Cyclosporin A inhibits DNA synthesis by epidermal Langerhans cells.

    PubMed

    Haftek, M; Urabe, A; Kanitakis, J; Dusserre, N; Thivolet, J

    Cyclosporin A, a potent immunosuppressive drug currently used in organ transplant recipients, has been shown to exert in vitro a direct antiproliferative effect on a number of cell types present in the skin, including keratinocytes, fibroblasts, and endothelial cells. Although in vitro studies suggest that cyclosporin A may interfere with the functional capacities of epidermal Langerhans cells, there is no evidence that the treatment influences the distribution or number of Langerhans cells in vivo. We used a model of normal human skin graft to "nude" mice, which is free of the human systemic control mechanisms, for studies on the DNA synthesis of human Langerhans cells under the influence of cyclosporin A. The grafted animals were given daily subcutaneous (50 mg/kg) or intraperitoneal (5, 12.5, and 25 mg/kg) drug injections during three weeks, which resulted in mean blood levels comparable to those observed in treated patients with organ transplants or psoriasis, respectively. BrdU administered during the last week of the experiment was incorporated by all cells synthesizing DNA, including those passing through S-phase. Langerhans cells were detected on deparaffinized or frozen tissue sections of xenografts with anti-CD1a and anti-HLA DR monoclonal antibodies, and the number of BrdU-positive cells was determined by double labeling. Our results indicate that the Langerhans cell DNA synthesis is impaired by therapeutic levels of cyclosporin A.

  14. Information transfer from DNA to peptide nucleic acids by template-directed syntheses

    NASA Technical Reports Server (NTRS)

    Schmidt, J. G.; Christensen, L.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1997-01-01

    Peptide nucleic acids (PNAs) are analogs of nucleic acids in which the ribose-phosphate backbone is replaced by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. Oligocytidylates have been shown to act as templates for formation of longer oligomers of G from PNA G2 dimers. In this paper we show that information can be transferred from DNA to PNA. DNA C4T2C4 is an efficient template for synthesis of PNA G4A2G4 using G2 and A2 units as substrates. The corresponding synthesis of PNA G4C2G4 on DNA C4G2C4 is less efficient. Incorporation of PNA T2 into PNA products on DNA C4A2C4 is the least efficient of the three reactions. These results, obtained using PNA dimers as substrates, parallel those obtained using monomeric activated nucleotides.

  15. Nucleic Acid Engineering: RNA Following the Trail of DNA.

    PubMed

    Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2016-02-08

    The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.

  16. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  17. A Ru(II) complex with 2-(4-(methylsulfonyl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline: synthesis, characterization, and acid-base and DNA-binding properties.

    PubMed

    Gao, Jie; Wang, Zhi-Ping; Yuan, Cui-Li; Jia, Hai-Shun; Wang, Ke-Zhi

    2011-09-01

    A new Ru(II) complex of [Ru(bpy)2(Hmspip)]Cl2 {in which bpy=2,2'-bipyridine, Hmspip=2-(4-(methylsulfonyl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline} have been synthesized and characterized. The ground- and excited-state acid-base properties of [Ru(bpy)2(Hmspip)]Cl2 and its parent complex of [Ru(bpy)2(Hpip)]Cl2 {Hpip=2-phenyl-1H-imidazo[4,5-f][1,10]phenanthroline} have been studied by UV-visible (UV-vis) and emission spectrophotometric pH titrations. [Ru(bpy)2(Hmspip)]Cl2 acts as a calf thymus DNA intercalators with a binding constant of 4.0×10(5) M(-1) in buffered 50 mM NaCl, as evidenced by UV-vis and luminescence titrations, steady-state emission quenching by [Fe(CN)6]4-, DNA competitive binding with ethidium bromide, reverse salt titrations and viscosity measurements.

  18. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  19. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  20. Selective inhibition of in vitro synthesis of cancer DNA by alkaloids of beta-carboline class.

    PubMed

    Beljanski, M; Beljanski, M S

    1982-01-01

    The high template in vitro activity of native DNA from cancerous mammalian and plant tissues, compared to DNA from healthy tissues, enabled us to select substances which selectively inhibit cancer DNA synthesis. Among them, alstonine, serpentine, sempervirine and flavopereirine, all alkaloids which belong to the Beta-carboline class, distinguish cancer DNA from healthy tissue DNA inhibit DNA in vitro synthesis when native DNA from different cancerous tissues or cells is used as template. They have practically no effect on DNA from healthy tissues. The inhibitory effect of alkaloids is due to their capacity to form an 'alkaloid-cancer DNA' complex which has been characterized by use of the Sephadex column. Evidence is presented showing that these alkaloids inhibit the initiation of DNA synthesis but not chain elongation. The stimulating action caused by carcinogens during cancer DNA in vitro synthesis may be prevented and reversed by alkaloids. Furthermore, the stimulating action of steroids during in vitro synthesis of hormone target tissue DNA might be neutralized by alkaloids. However, at relatively high doses, steroids reversibly compete with alkaloids for binding sites on breast cancer DNA. This is not observed with DNA from nonhormone target tissues.

  1. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  2. Aphidicolin inhibits DNA synthesis by DNA polymerase alpha and isolated nuclei by a similar mechanism.

    PubMed Central

    Krokan, H; Wist, E; Krokan, R H

    1981-01-01

    Aphidicolin is a selective inhibitor of DNA polymerase alpha. In contrast to earlier reports, the drug was found to inhibit DNA synthesis catalyzed by DNA polymerase alpha and isolated HeLa cell nuclei by a similar mechanism. For both systems aphidicolin primarily competed with dCTP incorporation. However, the apparent Vmax for dCTP incorporation was reduced by 50-60% at relatively low concentrations of aphidicolin, thus the mechanism of inhibition is complex. Furthermore, a 2-5 fold increase in apparent Km for dTTP was observed in the presence of aphidicolin, but the apparent Km values for dATP and dGTP were essentially unaltered. This, together with additional evidence, suggested that the mechanism of action of aphidicolin involves a strong competition with dCMP incorporation, a weaker competition with dTMP incorporation and very little, if any, competition with dGMP and dAMP incorporation. PMID:6795595

  3. Nucleic acid sensing with enzyme-DNA binding protein conjugates cascade and simple DNA nanostructures.

    PubMed

    Aktas, Gülsen Betül; Skouridou, Vasso; Masip, Lluis

    2017-03-22

    A versatile and universal DNA sensing platform is presented based on enzyme-DNA binding protein tags conjugates and simple DNA nanostructures. Two enzyme conjugates were thus prepared, with horseradish peroxidase linked to the dimeric single-chain bacteriophage Cro repressor protein (HRP-scCro) and glucose oxidase linked to the dimeric headpiece domain of Escherichia coli LacI repressor protein (GOx-dHP), and used in conjunction with a hybrid ssDNA-dsDNA detection probe. This probe served as a simple DNA nanostructure allowing first for target recognition through its target-complementary single-stranded DNA (ssDNA) part and then for signal generation after conjugate binding on the double-stranded DNA (dsDNA) containing the specific binding sites for the dHP and scCro DNA binding proteins. The DNA binding proteins chosen in this work have different sequence specificity, high affinity, and lack of cross-reactivity. The proposed sensing system was validated for the detection of model target ssDNA from high-risk human papillomavirus (HPV16) and the limits of detection of 45, 26, and 21 pM were achieved using the probes with scCro/dHP DNA binding sites ratio of 1:1, 2:1, and 1:2, respectively. The performance of the platform in terms of limit of detection was comparable to direct HRP systems using target-specific oligonucleotide-HRP conjugates. The ratio of the two enzymes can be easily manipulated by changing the number of binding sites on the detection probe, offering further optimization possibilities of the signal generation step. Moreover, since the signal is obtained in the absence of externally added hydrogen peroxide, the described platform is compatible with paper-based assays for molecular diagnostics applications. Finally, just by changing the ssDNA part of the detection probe, this versatile nucleic acid platform can be used for the detection of different ssDNA target sequences or in a multiplex detection configuration without the need to change any of the

  4. FANCJ promotes DNA synthesis through G-quadruplex structures.

    PubMed

    Castillo Bosch, Pau; Segura-Bayona, Sandra; Koole, Wouter; van Heteren, Jane T; Dewar, James M; Tijsterman, Marcel; Knipscheer, Puck

    2014-11-03

    Our genome contains many G-rich sequences, which have the propensity to fold into stable secondary DNA structures called G4 or G-quadruplex structures. These structures have been implicated in cellular processes such as gene regulation and telomere maintenance. However, G4 sequences are prone to mutations particularly upon replication stress or in the absence of specific helicases. To investigate how G-quadruplex structures are resolved during DNA replication, we developed a model system using ssDNA templates and Xenopus egg extracts that recapitulates eukaryotic G4 replication. Here, we show that G-quadruplex structures form a barrier for DNA replication. Nascent strand synthesis is blocked at one or two nucleotides from the G4. After transient stalling, G-quadruplexes are efficiently unwound and replicated. In contrast, depletion of the FANCJ/BRIP1 helicase causes persistent replication stalling at G-quadruplex structures, demonstrating a vital role for this helicase in resolving these structures. FANCJ performs this function independently of the classical Fanconi anemia pathway. These data provide evidence that the G4 sequence instability in FANCJ(-/-) cells and Fancj/dog1 deficient C. elegans is caused by replication stalling at G-quadruplexes.

  5. Structure of a mutant form of proliferating cell nuclear antigen that blocks translesion DNA synthesis

    PubMed Central

    Freudenthal, Bret D.; Ramaswamy, S.; Hingorani, Manju M.; Washington, M. Todd

    2009-01-01

    Proliferating cell nuclear antigen (PCNA) is a homotrimeric protein that functions as a sliding clamp during DNA replication. Several mutant forms of PCNA that block translesion DNA synthesis have been identified in genetic studies in yeast. One such mutant protein (encoded by the rev6-1 allele) is a glycine to serine substitution at residue 178, located at the subunit interface of PCNA. To better understand how this substitution interferes with translesion synthesis, we have determined the X-ray crystal structure of the G178S PCNA mutant protein. This substitution has little effect on the structure of the domain in which the substitution occurs. Instead, significant, local structural changes are observed in the adjacent subunit. The most notable difference between mutant and wild-type structures is in a single, extended loop (comprising amino acid residues 105-110), which we call loop J. In the mutant protein structure, loop J adopts a very different conformation in which the atoms of the protein backbone have moved by as much as 6.5 Å from their positions in the wild-type structure. To better understand the functional consequences of this structural change, we have examined the ability of this mutant protein to stimulate nucleotide incorporation by DNA polymerase eta (pol η). Steady state kinetic studies show that while wild-type PCNA stimulates incorporation by pol η opposite an abasic site, the mutant PCNA protein actually inhibits incorporation opposite this DNA lesion. These results show that the position of loop J in PCNA plays an essential role in facilitating translesion synthesis. PMID:19053247

  6. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  7. Interactions of carcinogens with DNA (deoxyribonucleic acid)

    SciTech Connect

    Broyde, S.; Shapiro, R.

    1989-10-01

    The principal goal of this research has been the determination of the conformational changes produced in DNA by the covalent binding of a carcinogenic aromatic amine, and the correlation of these changes with the mutations and carcinogenic effects initiated by the same substances. To this end, we have devised new synthetic methods for the preparation of oligonucleotides modified by derivatives af 4-aminobiphenyl and aniline. We have also performed potential energy minimization studies on the above substances and on single and double stranded DNA fragments bearing the above amines as well as acetylaminofluorene, aminofluorene, aminopyrene and the antibiotic mitomycin. Our computations have been carried out on DOE supercomputers using our program, DUPLEX. We have defined a number of novel structures for these modified DNAs, including Hoogsteen, wedge'' (see below) denatured, cross-linked and intercalated forms. Some suggestions have been made about the relation of these forms to mutagenesis. 7 refs.

  8. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  9. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  10. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  11. Beyond DNA origami: the unfolding prospects of nucleic acid nanotechnology.

    PubMed

    Michelotti, Nicole; Johnson-Buck, Alexander; Manzo, Anthony J; Walter, Nils G

    2012-01-01

    Nucleic acid nanotechnology exploits the programmable molecular recognition properties of natural and synthetic nucleic acids to assemble structures with nanometer-scale precision. In 2006, DNA origami transformed the field by providing a versatile platform for self-assembly of arbitrary shapes from one long DNA strand held in place by hundreds of short, site-specific (spatially addressable) DNA 'staples'. This revolutionary approach has led to the creation of a multitude of two-dimensional and three-dimensional scaffolds that form the basis for functional nanodevices. Not limited to nucleic acids, these nanodevices can incorporate other structural and functional materials, such as proteins and nanoparticles, making them broadly useful for current and future applications in emerging fields such as nanomedicine, nanoelectronics, and alternative energy.

  12. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  13. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acids in relaxed and stringent amino acid auxotrophs of Escherichia coli.

    PubMed

    Gray, W J; Midgley, J E

    1972-08-01

    The biosynthesis and stability of various RNA fractions was studied in RC(str) and RC(rel) multiple amino acid auxotrophs of Escherichia coli. In conditions of amino acid deprivation, RC(str) mutants were labelled with exogenous nucleotide bases at less than 1% of the rate found in cultures growing normally in supplemented media. Studies by DNA-RNA hybridization and by other methods showed that, during a period of amino acid withdrawal, not more than 60-70% of the labelled RNA formed in RC(str) mutants had the characteristics of mRNA. Evidence was obtained for some degradation of newly formed 16S and 23S rRNA species to heterogeneous material of lower molecular weight. This led to overestimations of the mRNA content of rapidly labelled RNA from such methods as simple examination of sucrose-density-gradient profiles. In RC(rel) strains the absolute and relative rates of synthesis of the various RNA fractions were not greatly affected. However, the stability of about half of the mRNA fraction was increased in RC(rel) strains during amino acid starvation, giving kinetics of mRNA labelling and turnover that were identical with those found in either RC(str) or RC(rel) strains inhibited by high concentrations of chloramphenicol. Coincidence hybridization techniques showed that the mRNA content of amino acid-starved RC(str) auxotrophs was unchanged from that found in normally growing cells. In contrast, RC(rel) strains deprived of amino acids increased their mRNA content about threefold. In such cultures the mRNA content of accumulating newly formed RNA was a constant 16% by wt.

  14. Potassium channel openers stimulate DNA synthesis in mouse epidermal keratinocyte and whole hair follicle cultures.

    PubMed

    Harmon, C S; Lutz, D; Ducote, J

    1993-01-01

    We have conducted studies using primary mouse epidermal keratinocyte and whole hair follicle cultures to investigate the mechanism of the hypertrichotic activity of potassium channel openers. In a time course study, the extent of stimulation of epidermal keratinocyte DNA synthesis by minoxidil increased as the rate of DNA synthesis in control cultures declined. Minoxidil stimulation of DNA synthesis in 7-day cultures required prolonged (> 1 day) exposure to the agent. Pinacidil and diazoxide also stimulated DNA synthesis in mouse epidermal keratinocyte cultures. In addition, minoxidil, pinacidil, diazoxide, and cromakalim stimulated DNA synthesis in whole-organ cultures of mouse hair follicles. These results suggest that potassium channel openers retard the loss of proliferative activity of differentiating keratinocytes and support the hypothesis that these agents stimulate hair growth through a direct effect on hair follicles.

  15. ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

    PubMed

    Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

    2016-07-15

    Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria.

  16. Misincorporation during DNA synthesis, analyzed by gel electrophoresis.

    PubMed Central

    Hillebrand, G G; McCluskey, A H; Abbott, K A; Revich, G G; Beattie, K L

    1984-01-01

    A method has been developed for simultaneous comparison of the propensity of a DNA polymerase to misincorporate at different points on a natural template-primer. In this method elongation of a [5'-32P] primer, annealed to a bacteriophage template strand, is carried out in the presence of only three dNTPs (highly purified by HPLC). Under these conditions the rate of primer elongation (monitored by gel electrophoresis/autoradiography) is limited by the rate of misincorporation at template positions complementary to the missing dNTP. Variations in the rate of elongation (revealed by autoradiographic banding patterns) reflect variations in the propensity for misincorporation at different positions along the template. The effect on primer elongation produced by addition of a chemically modified dNTP to 'minus' reactions reveals the mispairing potential of the modified nucleotide during DNA synthesis. By use of this electrophoretic assay of misincorporation we have demonstrated that the fidelity of E. coli DNA polymerase I varies greatly at different positions along a natural template, and that BrdUTP and IodUTP can be incorporated in place of dCTP during chain elongation catalyzed by this enzyme. Images PMID:6326053

  17. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  18. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  19. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  20. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  1. 3-Phosphono-L-alanine as pyrophosphate mimic for DNA synthesis using HIV-1 reverse transcriptase.

    PubMed

    Yang, Shiqiong; Froeyen, Mathy; Lescrinier, Eveline; Marlière, Philippe; Herdewijn, Piet

    2011-01-07

    A series of sulf(on)ate and phosph(on)ate amino acid phosphoramidate analogues of deoxynucleotides were synthesized as potential substrates for HIV-1 reverse transcriptase. Taurine, L-cysteic acid, 3-phosphono-L-alanine, O-sulfonato-L-serine, and O-phospho-L-serine were investigated as leaving groups in an enzyme catalyzed DNA synthesis protocol. Among these analogues, the phosphonate congener performed best and 3-phosphono-L-alanine can be considered as an excellent mimic of the pyrophosphate (PPi) moiety of deoxyadenosine triphosphate, to be used in enzymatic synthesis of nucleic acids. During a single nucleotide incorporation assay the use of 3-phosphono-L-Ala-dAMP as substrate resulted in 95% conversion to a P + 1 strand in 60 min at 50 μM (a concentration 10 times less than found for L-Asp-dAMP) and with improved incorporation kinetics and less stalling. For the sequences investigated, the efficiency of the incorporation is base dependent and decreases in the order (A ≥ T = G > C). In all cases, the incorporation follows Watson-Crick rules.

  2. Structural basis of high-fidelity DNA synthesis by yeast DNA polymerase [delta

    SciTech Connect

    Swan, Michael K.; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2009-09-25

    DNA polymerase {delta} (Pol {delta}) is a high-fidelity polymerase that has a central role in replication from yeast to humans. We present the crystal structure of the catalytic subunit of yeast Pol {delta} in ternary complex with a template primer and an incoming nucleotide. The structure, determined at 2.0-{angstrom} resolution, catches the enzyme in the act of replication, revealing how the polymerase and exonuclease domains are juxtaposed relative to each other and how a correct nucleotide is selected and incorporated. The structure also reveals the 'sensing' interactions near the primer terminus, which signal a switch from the polymerizing to the editing mode. Taken together, the structure provides a chemical basis for the bulk of DNA synthesis in eukaryotic cells and a framework for understanding the effects of cancer-causing mutations in Pol {delta}.

  3. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  4. Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

    SciTech Connect

    Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

    1982-12-01

    Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-dalton DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.

  5. DNA methylation landscape of fat deposits and fatty acid composition in obese and lean pigs

    PubMed Central

    Zhang, Shunhua; Shen, Linyuan; Xia, Yudong; Yang, Qiong; Li, Xuewei; Tang, Guoqing; Jiang, Yanzhi; Wang, Jinyong; Li, Mingzhou; Zhu, Li

    2016-01-01

    Obese and lean type pig breeds exhibit differences in their fat deposits and fatty acid composition. Here, we compared the effect of genome-wide DNA methylation on fatty acid metabolism between Landrace pigs (LP, leaner) and Rongchang pigs (RP, fatty). We found that LP backfat (LBF) had a higher polyunsaturated fatty acid content but a lower adipocyte volume than RP backfat (RBF). LBF exhibited higher global DNA methylation levels at the genome level than RBF. A total of 483 differentially methylated regions (DMRs) were located in promoter regions, mainly affecting olfactory and sensory activity and lipid metabolism. In LBF, the promoters of genes related to ATPase activity had significantly stronger methylation. This fact may suggest lower energy metabolism levels, which may result in less efficient lipid synthesis in LBF. Furthermore, we identified a DMR in the miR-4335 and miR-378 promoters and validated their methylation status by bisulfite sequencing PCR. The hypermethylation of the promoters of miR-4335 and miR-378 in LBF and the resulting silencing of the target genes may result in LBF’s low content in saturated fatty acids and fat deposition capacity. This study provides a solid basis for exploring the epigenetic mechanisms affecting fat deposition and fatty acid composition. PMID:27721392

  6. A New Direct Single-Molecule Observation Method for DNA Synthesis Reaction Using Fluorescent Replication Protein A

    PubMed Central

    Takahashi, Shunsuke; Kawasaki, Shohei; Miyata, Hidefumi; Kurita, Hirofumi; Mizuno, Takeshi; Matsuura, Shun-ichi; Mizuno, Akira; Oshige, Masahiko; Katsura, Shinji

    2014-01-01

    Using a single-stranded region tracing system, single-molecule DNA synthesis reactions were directly observed in microflow channels. The direct single-molecule observations of DNA synthesis were labeled with a fusion protein consisting of the ssDNA-binding domain of a 70-kDa subunit of replication protein A and enhanced yellow fluorescent protein (RPA-YFP). Our method was suitable for measurement of DNA synthesis reaction rates with control of the ssλDNA form as stretched ssλDNA (+flow) and random coiled ssλDNA (−flow) via buffer flow. Sequentially captured photographs demonstrated that the synthesized region of an ssλDNA molecule monotonously increased with the reaction time. The DNA synthesis reaction rate of random coiled ssλDNA (−flow) was nearly the same as that measured in a previous ensemble molecule experiment (52 vs. 50 bases/s). This suggested that the random coiled form of DNA (−flow) reflected the DNA form in the bulk experiment in the case of DNA synthesis reactions. In addition, the DNA synthesis reaction rate of stretched ssλDNA (+flow) was approximately 75% higher than that of random coiled ssλDNA (−flow) (91 vs. 52 bases/s). The DNA synthesis reaction rate of the Klenow fragment (3′-5′exo–) was promoted by DNA stretching with buffer flow. PMID:24625741

  7. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  8. Kinetics of DNA Strand Displacement Systems with Locked Nucleic Acids.

    PubMed

    Olson, Xiaoping; Kotani, Shohei; Yurke, Bernard; Graugnard, Elton; Hughes, William L

    2017-03-30

    Locked nucleic acids (LNAs) are conformationally restricted RNA nucleotides. Their increased thermal stability and selectivity toward their complements make them well-suited for diagnostic and therapeutic applications. Although the structural and thermodynamic properties of LNA-LNA, LNA-RNA, and LNA-DNA hybridizations are known, the kinetic effects of incorporating LNA nucleotides into DNA strand displacement systems are not. Here, we thoroughly studied the strand displacement kinetics as a function of the number and position of LNA nucleotides in DNA oligonucleotides. When compared to that of an all-DNA control, with an identical sequence, the leakage rate constant was reduced more than 50-fold, to an undetectable level, and the invasion rate was preserved for a hybrid DNA/LNA system. The total performance enhancement ratio also increased more than 70-fold when calculating the ratio of the invading rate to the leakage rate constants for a hybrid system. The rational substitution of LNA nucleotides for DNA nucleotides preserves sequence space while improving the signal-to-noise ratio of strand displacement systems. Hybrid DNA/LNA systems offer great potential for high-performance chemical reaction networks that include catalyzed hairpin assemblies, hairpin chain reactions, motors, walkers, and seesaw gates.

  9. The effect of bleomycin on DNA synthesis in ataxia telangiectasia lymphoid cells

    SciTech Connect

    Cohen, M.M.; Simpson, S.J.

    1982-01-01

    Bleomycin, a radiomimetic glycopeptide, inhibits de novo DNA synthesis in ataxia telangiectasia lymphoblastoid B cells to a markedly lesser extent than in normal and xeroderma pigmentosum lymphoid cells. This observation is similar to that following ionizing radiation; however, the effect is slower following the chemical treatment. Recovery of the normal cells occurs 15-18 hours after treatment, whereas the ataxia telangiectasia lines do not attain normal levels of DNA synthesis during the entire 24-hour observation period. Similar differences were not observed following treatment with mitomycin C, a bifunctional alkylating agent, indicating a specific effect of bleomycin on DNA synthesis in ataxia telangiectasia cells. Following bleomycin treatment and preincubation with hydroxyurea, residual DNA synthesis in ataxia telangiectasia cells was similar to that in both normal and xeroderma pigmentosum lymphoid lines, suggesting that the capacity to repair the induced DNA lesion is present.

  10. Evaluation of DNA synthesis with carbon-11-labeled 4′-thiothymidine

    PubMed Central

    Toyohara, Jun

    2016-01-01

    In the cancer research field, the preferred method for evaluating the proliferative activity of cancer cells in vivo is to measure DNA synthesis rates. The cellular proliferation rate is one of the most important cancer characteristics, and represents the gold standard of pathological diagnosis. Positron emission tomography (PET) has been used to evaluate in vivo DNA synthetic activity through visualization of enhanced nucleoside metabolism. However, methods for the quantitative measurement of DNA synthesis rates have not been fully clarified. Several groups have been engaged in research on 4′-[methyl-11C]-thiothymidine (11C-4DST) in an effort to develop a PET tracer that allows quantitative measurement of in vivo DNA synthesis rates. This mini-review summarizes the results of recent studies of the in vivo measurement of cancer DNA synthesis rates using 11C-4DST. PMID:27721942

  11. Method and apparatus for synthesis of arrays of DNA probes

    DOEpatents

    Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland

    2002-04-23

    The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.

  12. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  13. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  14. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  15. CyDNA: synthesis and replication of highly Cy-dye substituted DNA by an evolved polymerase.

    PubMed

    Ramsay, Nicola; Jemth, Ann-Sofie; Brown, Anthony; Crampton, Neal; Dear, Paul; Holliger, Philipp

    2010-04-14

    DNA not only transmits genetic information but can also serve as a versatile supramolecular scaffold. Here we describe a strategy for the synthesis and replication of DNA displaying hundreds of substituents using directed evolution of polymerase function by short-patch compartmentalized self-replication (spCSR) and the widely used fluorescent dye labeled deoxinucleotide triphosphates Cy3-dCTP and Cy5-dCTP as substrates. In just two rounds of spCSR selection, we have isolated a polymerase that allows the PCR amplification of double stranded DNA fragments up to 1kb, in which all dC bases are substituted by its fluorescent dye-labeled equivalent Cy3- or Cy5-dC. The resulting "CyDNA" displays hundreds of aromatic heterocycles on the outside of the DNA helix and is brightly colored and highly fluorescent. CyDNA also exhibits significantly altered physicochemical properties compared to standard B-form DNA, including loss of silica and intercalating dye binding, resistance to cleavage by some endonucleases, an up to 40% increased apparent diameter as judged by atomic force microscopy and organic phase partitioning during phenol extraction. CyDNA also displays very bright fluorescence enabling significant signal gains in microarray and microfluidic applications. CyDNA represents a step toward a long-term goal of the encoded synthesis of DNA-based polymers of programmable and evolvable sequence and properties.

  16. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  17. DNA Tetrominoes: The Construction of DNA Nanostructures Using Self-Organised Heterogeneous Deoxyribonucleic Acids Shapes

    PubMed Central

    Ong, Hui San; Rahim, Mohd Syafiq; Firdaus-Raih, Mohd; Ramlan, Effirul Ikhwan

    2015-01-01

    The unique programmability of nucleic acids offers alternative in constructing excitable and functional nanostructures. This work introduces an autonomous protocol to construct DNA Tetris shapes (L-Shape, B-Shape, T-Shape and I-Shape) using modular DNA blocks. The protocol exploits the rich number of sequence combinations available from the nucleic acid alphabets, thus allowing for diversity to be applied in designing various DNA nanostructures. Instead of a deterministic set of sequences corresponding to a particular design, the protocol promotes a large pool of DNA shapes that can assemble to conform to any desired structures. By utilising evolutionary programming in the design stage, DNA blocks are subjected to processes such as sequence insertion, deletion and base shifting in order to enrich the diversity of the resulting shapes based on a set of cascading filters. The optimisation algorithm allows mutation to be exerted indefinitely on the candidate sequences until these sequences complied with all the four fitness criteria. Generated candidates from the protocol are in agreement with the filter cascades and thermodynamic simulation. Further validation using gel electrophoresis indicated the formation of the designed shapes. Thus, supporting the plausibility of constructing DNA nanostructures in a more hierarchical, modular, and interchangeable manner. PMID:26258940

  18. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  19. One-step synthesis of silver nanoparticles, nanorods, and nanowires on the surface of DNA network.

    PubMed

    Wei, Gang; Zhou, Hualan; Liu, Zhiguo; Song, Yonghai; Wang, Li; Sun, Lanlan; Li, Zhuang

    2005-05-12

    Here, we describe a one-step synthesis of silver nanoparticles, nanorods, and nanowires on DNA network surface in the absence of surfactant. Silver ions were first adsorbed onto the DNA network and then reduced in sodium borohydride solution. Silver nanoparticles, nanorods, and nanowires were formed by controlling the size of pores of the DNA network. The diameter of the silver nanoparticles and the aspect ratio of the silver nanorods and nanowires can be controlled by adjusting the DNA concentration and reduction time.

  20. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  1. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  2. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  3. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  4. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  5. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  6. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  7. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  8. Flexibility of nucleic acids: From DNA to RNA

    NASA Astrophysics Data System (ADS)

    Lei, Bao; Xi, Zhang; Lei, Jin; Zhi-Jie, Tan

    2016-01-01

    The structural flexibility of nucleic acids plays a key role in many fundamental life processes, such as gene replication and expression, DNA-protein recognition, and gene regulation. To obtain a thorough understanding of nucleic acid flexibility, extensive studies have been performed using various experimental methods and theoretical models. In this review, we will introduce the progress that has been made in understanding the flexibility of nucleic acids including DNAs and RNAs, and will emphasize the experimental findings and the effects of salt, temperature, and sequence. Finally, we will discuss the major unanswered questions in understanding the flexibility of nucleic acids. Project supported by the National Basic Research Program of China (Grant No. 2011CB933600), the National Natural Science Foundation of China (Grant Nos. 11175132, 11575128, and 11374234), and the Program for New Century Excellent Talents, China (Grant No. NCET 08-0408).

  9. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  10. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  11. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  12. Synthesis and Crystal Structure Study of 2’-Se-Adenosine-Derivatized DNA

    SciTech Connect

    Sheng, J.; Salon, J; Gan, J; Huang, Z

    2010-01-01

    The selenium derivatization of nucleic acids is a novel and promising strategy for 3D structure determination of nucleic acids. Selenium can serve as an excellent anomalous scattering center to solve the phase problem, which is one of the two major bottlenecks in macromolecule X-ray crystallography. The other major bottleneck is crystallization. It has been demonstrated that the incorporated selenium functionality at the 2'-positions of the nucleosides and nucleotides is stable and does not cause significant structure perturbation. Furthermore, it was observed that the 2'-Se-derivatization could facilitate crystallization of oligonucleotides with fast crystal growth and high diffraction quality. Herein, we describe a convenient synthesis of the 2'-Se-adenosine phosphoramidite, and report the first synthesis and X-ray crystal structure determination of the DNA containing the 2'-Se-A derivatization. The 3D structure of 2'-Se-A-DNA decamer [5'-GTACGCGT(2'-Se-A)C-3']{sub 2} was determined at 1.75 {angstrom} resolution, the 2'-Se-functionality points to the minor groove, and the Se-modified and native structures are virtually identical. Moreover, we have observed that the 2'-Se-A modification can greatly facilitate the crystal growth with high diffraction quality. In conjunction with the crystallization facilitation by the 2'-Se-U and 2'-Se-T, this novel observation on the 2'-Se-A functionality suggests that the 2'-Se moiety is sole responsible for the crystallization facilitation and the identity of nucleobases does not influence the crystal growth significantly.

  13. Repeated allergen exposure of sensitized Brown-Norway rats induces airway cell DNA synthesis and remodelling.

    PubMed

    Salmon, M; Walsh, D A; Koto, H; Barnes, P J; Chung, K F

    1999-09-01

    Chronic inflammation in asthmatic airways can lead to characteristic airway smooth muscle (ASM) thickening and pathological changes within the airway wall. This study assessed the effect of repeated allergen exposure on ASM and epithelial cell deoxyribonucleic acid (DNA) synthesis, cell recruitment and airway wall pathology. Brown-Norway rats were sensitized and then exposed to ovalbumin or saline aerosol every 3 days on six occasions. After the final exposure, rats were administered twice daily for 7 days with the DNA S-phase marker bromodeoxyuridine (BrdU). Using a triple immunohistochemical staining technique, BrdU incorporation into ASM and epithelium was quantified employing computer-assisted image analysis. There were >3-fold mean increases in BrdU incorporation into ASM from 1.3% of cells (95% confidence interval (CI) 1.0-1.6) in saline controls to 4.7% (95% CI 2.6-6.7) after allergen exposure (p<0.001), and in airway epithelium, from 1.3 (95% CI 0.6-2.0) BrdU-positive cells x mm basement membrane(-1) in saline controls to 4.9 (95% CI 3.0-6.7) after allergen exposure (p<0.001). There was increased subepithelial collagen deposition and mucus secretion along with a significant eosinophil and lymphocyte recruitment to the airways. Increased rates of deoxyribonucleic acid synthesis in both airway smooth muscle and epithelial cells along with changes to the airway wall pathology may precede the establishment of smooth muscle thickening and airway remodelling after repeated allergen exposure in rats. This model seems to be appropriate for studying structural changes within the airways as observed in asthma.

  14. Nucleic Acid-Peptide Complex Phase Controlled by DNA Hybridization

    NASA Astrophysics Data System (ADS)

    Vieregg, Jeffrey; Lueckheide, Michael; Leon, Lorraine; Marciel, Amanda; Tirrell, Matthew

    When polyanions and polycations are mixed, counterion release drives formation of polymer-rich complexes that can either be solid (precipitates) or liquid (coacervates) depending on the properties of the polyelectrolytes. These complexes are important in many fields, from encapsulation of industrial polymers to membrane-free segregation of biomolecules such as nucleic acids and proteins. Condensation of long double-stranded DNA has been studied for several decades, but comparatively little attention has been paid to the polyelectrolyte behavior of oligonucleotides. We report here studies of DNA oligonucleotides (10 - 88 nt) complexed with polylysine (10 - 100 aa). Unexpectedly, we find that the phase of the resulting complexes is controlled by the hybridization state of the nucleic acid, with double-stranded DNA forming precipitates and single-stranded DNA forming coacervates. Stability increases with polyelectrolyte length and decreases with solution salt concentration, with complexes of the longer double-stranded polymers undergoing precipitate/coacervate/soluble transitions as ionic strength is increased. Mixing coacervates formed by complementary single-stranded oligonucleotides results in precipitate formation, raising the possibility of stimulus-responsive material design.

  15. Synthesis of a major mitomycin C DNA adduct via a triaminomitosene.

    PubMed

    Champeil, Elise; Paz, Manuel M; Lukasiewicz, Elaan; Kong, Wan S; Watson, Stephanie; Sapse, Anne-Marie

    2012-12-01

    We report here the synthesis of two amino precursors for the production of mitomycin C and 10-decarbamoylmitomycin C DNA adducts with opposite stereochemistry at C-1. The triamino mitosene precursors were synthesized in 5 steps from mitomycin C. In addition synthesis of the major mitomycin C-DNA adduct has been accomplished via coupling of a triaminomitosene with 2-fluoro-O(6)-(2-p-nitrophenylethyl)deoxyinosine followed by deprotection at the N(2) and O(6) positions.

  16. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  17. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips.

    PubMed

    Kosuri, Sriram; Eroshenko, Nikolai; Leproust, Emily M; Super, Michael; Way, Jeffrey; Li, Jin Billy; Church, George M

    2010-12-01

    Development of cheap, high-throughput and reliable gene synthesis methods will broadly stimulate progress in biology and biotechnology. Currently, the reliance on column-synthesized oligonucleotides as a source of DNA limits further cost reductions in gene synthesis. Oligonucleotides from DNA microchips can reduce costs by at least an order of magnitude, yet efforts to scale their use have been largely unsuccessful owing to the high error rates and complexity of the oligonucleotide mixtures. Here we use high-fidelity DNA microchips, selective oligonucleotide pool amplification, optimized gene assembly protocols and enzymatic error correction to develop a method for highly parallel gene synthesis. We tested our approach by assembling 47 genes, including 42 challenging therapeutic antibody sequences, encoding a total of ∼35 kilobase pairs of DNA. These assemblies were performed from a complex background containing 13,000 oligonucleotides encoding ∼2.5 megabases of DNA, which is at least 50 times larger than in previously published attempts.

  18. Inhibition of mouse peritoneal macrophage DNA synthesis by infection with the Arenavirus Pichinde. Interim report

    SciTech Connect

    Friedlander, A.M.; Jahrling, P.B.; Merrill, P.; Tobery, S.

    1983-01-19

    Macrophage DNA synthesis and proliferation occur during the development of cell-mediated immunity and in the early non-specific reaction to infection. Arenaviruses have a predilection for infection of cells of the reticuloendothelial system and in this study we have examined the effect of the arenavirus Pichinde on macrophage DNA synthesis. We have found that infection of mouse peritoneal macrophages with Pichinde caused a profound dose dependent inhibition of the DNA synthesis induced by macrophage growth factor/colony stimulating factor. At a multiplicity of inoculum of five there is a 75-95% inhibition of DNA synthesis. Viable virus is necessary for inhibition since Pichinde inactivated by heat or cobalt irradiation had no effect. Similarly, virus pre-treated with an antiserum to Pichinde was without inhibitory effect. Inhibition was demonstrated by measuring DNA synthesis spectrofluorometrically as well as by 3H-thymidine incorporation. The inhibition of DNA synthesis was not associated with any cytopathology. There was no evidence that the inhibition was due to soluble factors, such as prostaglandins or interferon, released by infected cells. These studies demonstrate, for the first time in vitro, a significant alteration in macrophage function caused by infection with an arenavirus. It is possible that inhibition of macrophage proliferation represents a mechanism by which some microorganisms interfere with host resistance.

  19. RecG Directs DNA Synthesis during Double-Strand Break Repair.

    PubMed

    Azeroglu, Benura; Mawer, Julia S P; Cockram, Charlotte A; White, Martin A; Hasan, A M Mahedi; Filatenkova, Milana; Leach, David R F

    2016-02-01

    Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR) that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300), arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability.

  20. Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

    PubMed Central

    Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

    2011-01-01

    Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

  1. Nucleotide sequences of the Pseudomonas savastanoi indoleacetic acid genes show homology with Agrobacterium tumefaciens T-DNA

    PubMed Central

    Yamada, Tetsuji; Palm, Curtis J.; Brooks, Bob; Kosuge, Tsune

    1985-01-01

    We report the nucleotide sequences of iaaM and iaaH, the genetic determinants for, respectively, tryptophan 2-monooxygenase and indoleacetamide hydrolase, the enzymes that catalyze the conversion of L-tryptophan to indoleacetic acid in the tumor-forming bacterium Pseudomonas syringae pv. savastanoi. The sequence analysis indicates that the iaaM locus contains an open reading frame encoding 557 amino acids that would comprise a protein with a molecular weight of 61,783; the iaaH locus contains an open reading frame of 455 amino acids that would comprise a protein with a molecular weight of 48,515. Significant amino acid sequence homology was found between the predicted sequence of the tryptophan monooxygenase of P. savastanoi and the deduced product of the T-DNA tms-1 gene of the octopine-type plasmid pTiA6NC from Agrobacterium tumefaciens. Strong homology was found in the 25 amino acid sequence in the putative FAD-binding region of tryptophan monooxygenase. Homology was also found in the amino acid sequences representing the central regions of the putative products of iaaH and tms-2 T-DNA. The results suggest a strong similarity in the pathways for indoleacetic acid synthesis encoded by genes in P. savastanoi and in A. tumefaciens T-DNA. Images PMID:16593610

  2. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  3. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  4. Synthesis, integration, and restriction and modification of mycoplasma virus L2 DNA

    SciTech Connect

    Dybvig, K.

    1981-01-01

    Mycoplasma virus L2 is an enveloped, nonlytic virus containing double-stranded, superhelical DNA. The L2 virion contains about 7 to 8 major proteins identified by SDS-polyacrylamide gel electrophoresis, but the virion has no discernible capsid structure. It has been suggested that the L2 virion is a DNA-protein condensation surrounded by a lipid-protein membrane. The host for mycoplasma virus L2 is Acholeplasma laidlawii. A. laidlawii has no cell wall and contains a small genome, 1 x 10/sup 9/ daltons, which is two to three times smaller than that of most bacteria. Infection of A. laidlawii by L2 is nonlytic. The studies in this thesis show that L2 DNA synthesis begins at about 1 hour of infection and lasts throughout the infection. Viral DNA synthesis is inhibited by chloramphenicol, streptomycin, and novobiocin. Packaging of L2 DNA into progeny virus is also inhibited by chloramphenicol and novobiocin. It is concluded that protein synthesis and probably DNA gyrase activity are required for L2 DNA synthesis, and for packaging of L2 DNA into progeny virus. DNA-DNA hybridization studies demonstrate that L2 DNA integrates into the host cell during infection, and subsequent to infection the cells are mycoplasma virus L2 lysogens. The viral site of integration has been roughly mapped. L2 virus is restricted and modified by A. laidlawii strains JA1 and K2. The nature of the modification in strain K2 has been elucidated. Two L2 variants containing insertions in the viral DNA were identified in these studies. Restriction endonuclease cleavage maps of these variants have been determined. DNA from L2 and another isolate of L2, MV-Lg-L 172, are compared in these studies. 74 references, 33 figures, 6 tables. (ACR)

  5. Genome Calligrapher: A Web Tool for Refactoring Bacterial Genome Sequences for de Novo DNA Synthesis.

    PubMed

    Christen, Matthias; Deutsch, Samuel; Christen, Beat

    2015-08-21

    Recent advances in synthetic biology have resulted in an increasing demand for the de novo synthesis of large-scale DNA constructs. Any process improvement that enables fast and cost-effective streamlining of digitized genetic information into fabricable DNA sequences holds great promise to study, mine, and engineer genomes. Here, we present Genome Calligrapher, a computer-aided design web tool intended for whole genome refactoring of bacterial chromosomes for de novo DNA synthesis. By applying a neutral recoding algorithm, Genome Calligrapher optimizes GC content and removes obstructive DNA features known to interfere with the synthesis of double-stranded DNA and the higher order assembly into large DNA constructs. Subsequent bioinformatics analysis revealed that synthesis constraints are prevalent among bacterial genomes. However, a low level of codon replacement is sufficient for refactoring bacterial genomes into easy-to-synthesize DNA sequences. To test the algorithm, 168 kb of synthetic DNA comprising approximately 20 percent of the synthetic essential genome of the cell-cycle bacterium Caulobacter crescentus was streamlined and then ordered from a commercial supplier of low-cost de novo DNA synthesis. The successful assembly into eight 20 kb segments indicates that Genome Calligrapher algorithm can be efficiently used to refactor difficult-to-synthesize DNA. Genome Calligrapher is broadly applicable to recode biosynthetic pathways, DNA sequences, and whole bacterial genomes, thus offering new opportunities to use synthetic biology tools to explore the functionality of microbial diversity. The Genome Calligrapher web tool can be accessed at https://christenlab.ethz.ch/GenomeCalligrapher  .

  6. Synthesis, Acetylation, and Phosphorylation of Histone IV and Its Binding to DNA During Spermatogenesis in Trout*

    PubMed Central

    Louie, Andrew J.; Dixon, Gordon H.

    1972-01-01

    During spermatogenesis in trout testis, histone IV is extensively modified by acetylation and phosphorylation. To examine the relationship of synthesis of histone IV to its modification, histone IV labeled with [3H]aminoacids and inorganic [32P]phosphate was prepared from testis cells by acid extraction and column chromatography. Purified histone IV was resolved by starch gel electrophoresis into 10 bands, of which nine are modified by acetylation and/or phosphorylation. In the first 4 hr of labeling, the diacetyl-histone IV band showed the highest proportion of [3H]aminoacid label. After 12 hr of incorporation, more label was found in the triacetyl and tetraacetyl bands. A significant amount of amino-acid label in the two major bands (the unsubstituted and monoacetyl bands) of histone IV was not seen until 16 hr of incubation. From 1 to 12 days, the proportion of label in the unsubstituted and monoacetylated bands increased, while that in the tetra-, tri-, and monoacetyl bands decreased. Very little [3H]aminoacid was found in the phosphorylated bands of histone IV in the first 12 hr. However, after 16 hr about 20% of the total 3H was found in the phosphorylated bands. The proportion increased to 33% and remained at this level between 1 and 8 days, but, by 16 days, had decreased to 12% of the total. These data suggest that an “obligatory” acetylation of recently synthesized histone IV is involved in the correct binding of newly synthesized histone IV to DNA. We propose that ε-amino acetylation of lysyl residues 5, 8, 12, and 16 neutralizes their positive charges and allows the NH2-terminal region of histone IV to assume the correct conformation (in this case, an α-helix), and fit into the major groove of DNA. Deacetylation then “locks” histone IV to DNA by ionic linkages. The biological significance of phosphorylation of histone IV is not known. Images PMID:4505675

  7. The natural non-protein amino acid N-β-methylamino-L-alanine (BMAA) is incorporated into protein during synthesis.

    PubMed

    Glover, W Broc; Mash, Deborah C; Murch, Susan J

    2014-11-01

    N-β-methylamino-L-alanine (BMAA) is an amino acid produced by cyanobacteria and accumulated through trophic levels in the environment and natural food webs. Human exposure to BMAA has been linked to progressive neurodegenerative diseases, potentially due to incorporation of BMAA into protein. The insertion of BMAA and other non-protein amino acids into proteins may trigger protein misfunction, misfolding and/or aggregation. However, the specific mechanism by which BMAA is associated with proteins remained unidentified. Such studies are challenging because of the complexity of biological systems and samples. A cell-free in vitro protein synthesis system offers an excellent approach for investigation of changing amino acid composition in protein. In this study, we report that BMAA incorporates into protein as an error in synthesis when a template DNA sequence is used. Bicinchoninic acid assay of total protein synthesis determined that BMAA effectively substituted for alanine and serine in protein product. LC-MS/MS confirmed that BMAA was selectively inserted into proteins in place of other amino acids, but isomers N-(2-aminoethyl)glycine (AEG) and 2,4-diaminobutyric acid (DAB) did not share this characteristic. Incorporation of BMAA into proteins was significantly higher when genomic DNA from post-mortem brain was the template. About half of BMAA in the synthetic proteins was released with denaturation with sodium dodecylsulfonate and dithiothreitol, but the remaining BMAA could only be released by acid hydrolysis. Together these data demonstrate that BMAA is incorporated into the amino acid backbone of proteins during synthesis and also associated with proteins through non-covalent bonding.

  8. Aphidicolin does not inhibit DNA repair synthesis in ultraviolet-irradiated HeLa cells. A radioautographic study.

    PubMed Central

    Hardt, N; Pedrali-Noy, G; Focher, F; Spadari, S

    1981-01-01

    A radioautographic examination of nuclear DNA synthesis in unirradiated and u.v.-irradiated HeLa cells, in the presence and in the absence of aphidicolin, showed that aphidicolin inhibits nuclear DNA replication and has no detectable effect on DNA repair synthesis. Although the results establish that in u.v.-irradiated HeLa cells most of the DNA repair synthesis is not due to DNA polymerase alpha, they do not preclude a significant role for this enzyme in DNA repair processes. Images PLATE 1 PMID:6803764

  9. Activation of cell division and nucleic acid synthesis in the corneal epithelium of albino rats by repeated stress

    SciTech Connect

    Berezhnova, N.I.; Timoshin, S.S.

    1985-05-01

    Adaption to unfavorable factors is accompanied by activation of nucleic acid and protein synthesis in systems responsible for adaption. The authors investigate the possibility of similar changes taking place in structures not actively participating in adaptation. The corneas of the dead male albin rats were preincubated with tritium-uridine for 1.5 hours. The mitotic index, the index of tritium-thymidine-labeled nuclei and the intensity of thymidine labeling were determined. The results indicate that after a single exposure to hypoxia, hyperthermia, and immobilization, mitotic index in the corneal epithelium decreased and DNA synthesis under these circumstances remained stable.

  10. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  11. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  12. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  13. Inhibition of Thymidine Kinase Activity and Deoxyribonucleic Acid Synthesis in L Cells Infected with the Meningopneumonitis Agent

    PubMed Central

    Lin, Hsiu-San

    1968-01-01

    The activities of enzymes related to deoxyribonucleic acid (DNA) synthesis were studied in uninfected L cells and in L cells infected with Chlamydia psittaci (strain meningopneumonitis). The meningopneumonitis agent multiplied normally but failed to induce the synthesis of thymidine kinase in LM (TK−) cells which contain no thymidine kinase in the uninfected state. It was concluded that this microorganism has no thymidine kinase of its own and that it does not depend on the functioning of the host enzyme for synthesizing its DNA. Exposure of clone 5b L cells to the meningopneumonitis agent was followed by a decline in their thymidine kinase activity to nearly zero levels, whereas the levels of uridine kinase and thymidylate synthetase remained unchanged. Inhibition of thymidine kinase activity in L cells occurred soon after infection and required new protein synthesis by the meningopneumonitis agent. This inhibition occurred before inhibition of host DNA synthesis, but it was not an essential prelude to the latter inhibition. On the basis of this and previous investigations and in light of present knowledge of the mammalian cell cycle, it was postulated that the meningopneumonitis agent inhibits macromolecular synthesis in L cells by preventing the initiation of a new cell cycle. PMID:5724972

  14. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  15. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  16. Autonomous Multistep Organic Synthesis in a Single Isothermal Solution Mediated by a DNA Walker

    PubMed Central

    He, Yu; Liu, David R.

    2010-01-01

    Multistep synthesis in the laboratory typically requires numerous reaction vessels, each containing a different set of reactants. In contrast, cells are capable of performing highly efficient and selective multistep biosynthesis under mild conditions with all reactants simultaneously present in solution. If the latter approach could be applied in the laboratory, it may improve the ease, speed, and efficiency of multistep reaction sequences. Here we show that a DNA mechanical device— a DNA walker moving along a DNA track— can be used to perform a series of amine acylation reactions in a single solution without any external intervention. The multistep products generated by this primitive ribosome mimetic are programmed by the sequence of the DNA track, are unrelated to the structure of DNA, and are formed with speeds and overall yields significantly greater than those previously achieved by multistep DNA-templated small-molecule synthesis. PMID:20935654

  17. Nerve growth factor inhibits the synthesis of a single-stranded DNA binding protein in pheochromocytoma cells (clone PC12).

    PubMed Central

    Biocca, S; Cattaneo, A; Calissano, P

    1984-01-01

    Arrest of mitosis and neurite outgrowth induced by nerve growth factor (NGF) in rat pheochromocytoma cells (clone PC12) is accompanied by a progressive inhibition of the synthesis of a protein that binds to single-stranded but not to double-stranded DNA. Time course experiments show that this inhibition is already apparent after a 2-day incubation with NGF and is maximum (85-95%) upon achievement of complete PC12 cell differentiation. Inhibition of the synthesis of this single-stranded DNA binding protein after 48 hr of incubation with NGF is potentiated by concomitant treatment of PC12 cells with antimitotic drugs acting at different levels of DNA replication. Purification on a preparative scale of this protein and analysis of its major physicochemical properties show that: (i) it constitutes 0.5% of total soluble proteins of naive PC12 cells; (ii) its molecular weight measured by NaDodSO4/PAGE is Mr 34,000 (sucrose gradient centrifugation under nondenaturing conditions yields a sedimentation coefficient s20,w of 8.1 S, indicating that the native protein is an oligomer); (iii) amino acid analysis demonstrates a preponderance of acidic over basic residues, while electrofocusing experiments show that it has an isoelectric point around 8.0; (iv) approximately 15% of the protein is phosphorylated in vivo. It is postulated that control of the synthesis of this protein is connected with activation of a differentiative program triggered by NGF in the PC12 neoplastic cell line at some step(s) of DNA activity. Images PMID:6585787

  18. Repair synthesis by human cell extracts in DNA damaged by cis- and trans-diamminedichloroplatinum(II).

    PubMed Central

    Hansson, J; Wood, R D

    1989-01-01

    DNA damage was induced in closed circular plasmid DNA by treatment with cis- or trans-diamminedichloroplatinum(II). These plasmids were used as substrates in reactions to give quantitative measurements of DNA repair synthesis mediated by cell free extracts from human lymphoid cell lines. Adducts induced by both drugs stimulated repair synthesis in a dose dependent manner by an ATP-requiring process. Measurements by an isopycnic gradient sedimentation method gave an upper limit for the average patch sizes in this in vitro system of around 140 nucleotides. It was estimated that up to 3% of the drug adducts induce the synthesis of a repair patch. The repair synthesis is due to repair of a small fraction of frequent drug adducts, rather than extensive repair of a rare subclass of lesions. Nonspecific DNA synthesis in undamaged plasmids, caused by exonucleolytic degradation and resynthesis, was reduced by repeated purification of intact circular forms. An extract made from cells belonging to xeroderma pigmentosum complementation group A was deficient in repair synthesis in response to the presence of cis- or trans-diamminedichloroplatinum(II) adducts in DNA. Images PMID:2554251

  19. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  20. Interaction of photosensitive surfactant with DNA and poly acrylic acid

    SciTech Connect

    Zakrevskyy, Yuriy Paasche, Jens; Lomadze, Nino; Santer, Svetlana; Cywinski, Piotr; Cywinska, Magdalena; Reich, Oliver; Löhmannsröben, Hans-Gerd

    2014-01-28

    In this paper, we investigate interactions and phase transitions in polyelectrolyte-surfactant complexes formed between a cationic azobenzene-containing surfactant and two types of polyelectrolytes: natural (DNA) or synthetic (PAA: poly acrylic acid). The construction of a phase diagram allowed distancing between four major phases: extended coil conformation, colloidally stable compacted globules, colloidal instability range, and surfactant-stabilized compact state. Investigation on the complexes’ properties in different phases and under irradiation with UV light provides information about the role of the surfactant's hydrophobic trans isomers both in the formation and destruction of DNA and PAA globules as well as in their colloidal stabilization. The trans isomer shows much stronger affinity to the polyelectrolytes than the hydrophilic cis counterpart. There is no need for complete compensation of the polyelectrolyte charges to reach the complete compaction. On contrary to the findings previously reported in the literature, we demonstrate – for the first time – complete polyelectrolyte compaction which occurs already at 20% of DNA (and at 50% of PAA) charge compensation. The trans isomer plays the main role in the compaction. The aggregation between azobenzene units in the photosensitive surfactant is a driving force of this process. The decompaction can be realized during UV light irradiation and is strongly influenced by the interplay between surfactant-surfactant and surfactant-DNA interactions in the compacted globules.

  1. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  2. Regulatory interactions between phospholipid synthesis and DNA replication in Caulobacter crescentus.

    PubMed Central

    Loewy, B; Marczynski, G T; Dingwall, A; Shapiro, L

    1990-01-01

    Several Caulobacter crescentus mutants with lesions in phospholipid biosynthesis have DNA replication phenotypes. A C. crescentus mutant deficient in glycerol 3-phosphate dehydrogenase activity (gpsA) blocks phospholipid synthesis, ceases DNA replication, and loses viability in the absence of a glycerol phosphate supplement. To investigate the interaction between membrane synthesis and DNA replication during a single cell cycle, we moved the gpsA mutation into a synchronizable, but otherwise wild-type, strain. The first effect of withholding supplement was the cessation of synthesis of phosphatidylglycerol, a major component of the C. crescentus membrane. In the absence of glycerol 3-phosphate, DNA replication was initiated in the stalked cell at the correct time in the cell cycle and at the correct site on the chromosome. However, after replication proceeded bidirectionally for a short time, DNA synthesis dropped to a low level. The cell cycle blocked at a distinct middivision stalked cell, and this was followed by cell death. The "glycerol-less" death of the gpsA mutant could be prevented if the cells were treated with novobiocin to prevent the initiation of DNA replication. Our observations suggest that the processivity of C. crescentus replication requires concomitant phospholipid synthesis and that cell death results from incomplete replication of the chromosome. Images PMID:2211495

  3. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  4. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  5. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  6. The effects of radioprotectors on DNA polymerase I-directed repair synthesis and DNA strand breaks in toluene-treated and X-irradiated Escherichia coli

    SciTech Connect

    Billen, D.

    1983-07-01

    In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is induced by exposure to X rays. This repair synthesis may be amplified and easily measured through inhibition of DNA ligase action. In an effort to learn more of the relationship between X-ray-induced strand breaks in cellular DNA and the extent of this repair synthesis, experiments designed to compare the influence of radioprotectors on both strand-break production and repair synthesis have been carried out. The results show that cysteamine, sodium formate, and glycerol not only protect against strand breaks but also reduce DNA polymerase I-directed repair synthesis. However, I-, an efficient hydroxyl radical scavenger, is not as effective a protective agent against strand breaks and does not measurably affect repair synthesis in our system.

  7. Effects of radioprotectors on DNA polymerase I-directed repair synthesis and DNA strand breaks in toluene-treated and x-irradiated Escherichia coli

    SciTech Connect

    Billen, D.

    1983-07-01

    In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is induced by exposure to x rays. This repair synthesis may be amplified and easily measured through inhibition of DNA ligase action. In an effort to learn more of the relationship between x-ray-induced strand breaks in cellular DNA and the extent of this repair synthesis, experiments designed to compare the influence of radioprotectors on both strand-break production and repair synthesis have been carried out. The results show that cysteamine, sodium formate, and glycerol not only protect against strand breaks but also reduce DNA polymerase I-directed repair synthesis. However, I/sup -/, an efficient hydroxyl radical scavenger, is not as effective a protective agent against strand breaks and does not measurably affect repair synthesis in our system.

  8. Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.

    PubMed

    Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay

    2014-05-01

    The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.

  9. In situ synthesis of DNA microarray on functionalized cyclic olefin copolymer substrate.

    PubMed

    Saaem, Ishtiaq; Ma, Kuo-Sheng; Marchi, Alexandria N; LaBean, Thomas H; Tian, Jingdong

    2010-02-01

    Thermoplastic materials such as cyclic-olefin copolymers (COC) provide a versatile and cost-effective alternative to the traditional glass or silicon substrate for rapid prototyping and industrial scale fabrication of microdevices. To extend the utility of COC as an effective microarray substrate, we developed a new method that enabled for the first time in situ synthesis of DNA oligonucleotide microarrays on the COC substrate. To achieve high-quality DNA synthesis, a SiO(2) thin film array was prepatterned on the inert and hydrophobic COC surface using RF sputtering technique. The subsequent in situ DNA synthesis was confined to the surface of the prepatterned hydrophilic SiO(2) thin film features by precision delivery of the phosphoramidite chemistry using an inkjet DNA synthesizer. The in situ SiO(2)-COC DNA microarray demonstrated superior quality and stability in hybridization assays and thermal cycling reactions. Furthermore, we demonstrate that pools of high-quality mixed-oligos could be cleaved off the SiO(2)-COC microarrays and used directly for construction of DNA origami nanostructures. It is believed that this method will not only enable synthesis of high-quality and low-cost COC DNA microarrays but also provide a basis for further development of integrated microfluidics microarrays for a broad range of bioanalytical and biofabrication applications.

  10. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  11. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  12. Influence of Nrf2 activators on subcellular skeletal muscle protein and DNA synthesis rates after 6 weeks of milk protein feeding in older adults.

    PubMed

    Konopka, Adam R; Laurin, Jaime L; Musci, Robert V; Wolff, Christopher A; Reid, Justin J; Biela, Laurie M; Zhang, Qian; Peelor, Fredrick F; Melby, Christopher L; Hamilton, Karyn L; Miller, Benjamin F

    2017-03-10

    In older adults, chronic oxidative and inflammatory stresses are associated with an impaired increase in skeletal muscle protein synthesis after acute anabolic stimuli. Conjugated linoleic acid (CLA) and Protandim have been shown to activate nuclear factor erythroid-derived 2-like 2 (Nrf2), a transcription factor for the antioxidant response element and anti-inflammatory pathways. This study tested the hypothesis that compared to a placebo control (CON), CLA and Protandim would increase skeletal muscle subcellular protein (myofibrillar, mitochondrial, cytoplasmic) and DNA synthesis in older adults after 6 weeks of milk protein feeding. CLA decreased oxidative stress and skeletal muscle oxidative damage with a trend to increase messenger RNA (mRNA) expression of a Nrf2 target, NAD(P)H dehydrogenase quinone 1 (NQO1). However, CLA did not influence other Nrf2 targets (heme oxygenase-1 (HO-1), glutathione peroxidase 1 (Gpx1)) or protein or DNA synthesis. Conversely, Protandim increased HO-1 protein content but not the mRNA expression of downstream Nrf2 targets, oxidative stress, or skeletal muscle oxidative damage. Rates of myofibrillar protein synthesis were maintained despite lower mitochondrial and cytoplasmic protein syntheses after Protandim versus CON. Similarly, DNA synthesis was non-significantly lower after Protandim compared to CON. After Protandim, the ratio of protein to DNA synthesis tended to be greater in the myofibrillar fraction and maintained in the mitochondrial and cytoplasmic fractions, emphasizing the importance of measuring both protein and DNA synthesis to gain insight into proteostasis. Overall, these data suggest that Protandim may enhance proteostatic mechanisms of skeletal muscle contractile proteins after 6 weeks of milk protein feeding in older adults.

  13. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  14. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  15. Assessment of okadaic acid effects on cytotoxicity, DNA damage and DNA repair in human cells.

    PubMed

    Valdiglesias, Vanessa; Méndez, Josefina; Pásaro, Eduardo; Cemeli, Eduardo; Anderson, Diana; Laffon, Blanca

    2010-07-07

    Okadaic acid (OA) is a phycotoxin produced by several types of dinoflagellates causing diarrheic shellfish poisoning (DSP) in humans. Symptoms induced by DSP toxins are mainly gastrointestinal, but the intoxication does not appear to be fatal. Despite this, this toxin presents a potential threat to human health even at concentrations too low to induce acute toxicity, since previous animal studies have shown that OA has very potent tumour promoting activity. However, its concrete action mechanism has not been described yet and the results reported with regard to OA cytotoxicity and genotoxicity are often contradictory. In the present study, the genotoxic and cytotoxic effects of OA on three different types of human cells (peripheral blood leukocytes, HepG2 hepatoma cells, and SHSY5Y neuroblastoma cells) were evaluated. Cells were treated with a range of OA concentrations in the presence and absence of S9 fraction, and MTT test and Comet assay were performed in order to evaluate cytotoxicity and genotoxicity, respectively. The possible effects of OA on DNA repair were also studied by means of the DNA repair competence assay, using bleomycin as DNA damage inductor. Treatment with OA in absence of S9 fraction induced not statistically significant decrease in cell viability and significant increase in DNA damage in all cell types at the highest concentrations investigated. However, only SHSY5Y cells showed OA induced genotoxic and cytotoxic effects in presence of S9 fraction. Furthermore, we found that OA can induce modulations in DNA repair processes when exposure was performed prior to BLM treatment, in co-exposure, or during the subsequent DNA repair process.

  16. Initiation of simian virus 40 DNA replication in vitro: aphidicolin causes accumulation of early-replicating intermediates and allows determination of the initial direction of DNA synthesis.

    PubMed Central

    Decker, R S; Yamaguchi, M; Possenti, R; DePamphilis, M L

    1986-01-01

    Aphidicolin, a specific inhibitor of DNA polymerase alpha, provided a novel method for distinguishing between initiation of DNA synthesis at the simian virus 40 (SV40) origin of replication (ori) and continuation of replication beyond ori. In the presence of sufficient aphidicolin to inhibit total DNA synthesis by 50%, initiation of DNA replication in SV40 chromosomes or ori-containing plasmids continued in vitro, whereas DNA synthesis in the bulk of SV40 replicative intermediate DNA (RI) that had initiated replication in vivo was rapidly inhibited. This resulted in accumulation of early RI in which most nascent DNA was localized within a 600- to 700-base-pair region centered at ori. Accumulation of early RI was observed only under conditions that permitted initiation of SV40 ori-dependent, T-antigen-dependent DNA replication and only when aphidicolin was added to the in vitro system. Increasing aphidicolin concentrations revealed that DNA synthesis in the ori region was not completely resistant to aphidicolin but simply less sensitive than DNA synthesis at forks that were farther away. Since DNA synthesized in the presence of aphidicolin was concentrated in the 300 base pairs on the early gene side of ori, we conclude that the initial direction of DNA synthesis was the same as that of early mRNA synthesis, consistent with the model proposed by Hay and DePamphilis (Cell 28:767-779, 1982). The data were also consistent with initiation of the first DNA chains in ori by CV-1 cell DNA primase-DNA polymerase alpha. Synthesis of pppA/G(pN)6-8(pdN)21-23 chains on a single-stranded DNA template by a purified preparation of this enzyme was completely resistant to aphidicolin, and further incorporation of deoxynucleotide monophosphates was inhibited. Therefore, in the presence of aphidicolin, this enzyme could initiate RNA-primed DNA synthesis at ori first in the early gene direction and then in the late gene direction, but could not continue DNA synthesis for an extended

  17. Human CD4+ T cells require exogenous cystine for glutathione and DNA synthesis.

    PubMed

    Levring, Trine B; Kongsbak, Martin; Rode, Anna K O; Woetmann, Anders; Ødum, Niels; Bonefeld, Charlotte Menné; Geisler, Carsten

    2015-09-08

    Adaptive immune responses require activation and expansion of antigen-specific T cells. Whereas early T cell activation is independent of exogenous cystine (Cys2), T cell proliferation is dependent of Cys2. However, the exact roles of Cys2 in T cell proliferation still need to be determined. The aim of this study was to elucidate why activated human T cells require exogenous Cys2 in order to proliferate. We activated purified naïve human CD4+ T cells and found that glutathione (GSH) levels and DNA synthesis were dependent on Cys2 and increased in parallel with increasing concentrations of Cys2. Vice-versa, the GSH synthesis inhibitor L-buthionine-sulfoximine (BSO) and inhibition of Cys2 uptake with glutamate inhibited GSH and DNA synthesis in parallel. We further found that thioredoxin (Trx) can partly substitute for GSH during DNA synthesis. Finally, we show that GSH or Trx is required for the activity of ribonucleotide reductase (RNR), the enzyme responsible for generation of the deoxyribonucleotide DNA building blocks. In conclusion, we show that activated human T cells require exogenous Cys2 to proliferate and that this is partly explained by the fact that Cys2 is required for production of GSH, which in turn is required for optimal RNR-mediated deoxyribonucleotide synthesis and DNA replication.

  18. Iron at the cell surface controls DNA synthesis in CCl 39 cells.

    PubMed

    Alcain, F J; Löw, H; Crane, F L

    1994-08-30

    Treatment of CCl 39 cells with the impermeable iron II chelator bathophenanthroline disulfonate (BPS) inhibits both DNA synthesis and transplasma membrane electron transport. The inhibition persists when the BPS is removed, and the extract from 10(6) cells contains up to 1.28 nmoles iron II chelated to BPS. The BPS iron II chelate itself is not inhibitory. Both DNA synthesis and electron transport are restored by addition of microM iron II or iron III compounds to extracted cells. Other impermeable chelators for iron II give similar inhibition, whereas the iron III-specific Tiron or copper-specific bathocuproine sulfonate do not inhibit. The inhibition differs from the permeable iron III chelator inhibition of ribonucleotide reductase, because inhibition of DNA synthesis by the permeable chelators is reversed when chelator is removed. The response to growth factors also differs, with no impermeable chelator inhibition on 10% fetal calf serum contrasting to inhibition by permeable chelators. DNA synthesis with both activation of tyrosine kinase with EGF plus insulin or by thrombin or ceruloplasmin led to protein kinase C activation as inhibited by the impermeable chelators. It is proposed that an iron available on the cell surface is required for DNA synthesis and plasma membrane electron transport.

  19. Inhibition of DNA synthesis in CCL 39 cells by impermeable iron chelators.

    PubMed

    Alcaín, F J; Löw, H; Crane, F L

    1997-02-01

    The synthesis of DNA in CCl 39 cells is inhibited by the presence of the Fe2+ chelator bathophenanthroline disulfonate (BPS) when growth is stimulated by thrombin EGF plus insulin, but not by fetal calf serum. The presence of transferrin and Fe3+ in fetal calf serum can be the basis for lack of BPS effect with serum. The impermeable Fe3+ chelator Tiron does not, by itself, inhibit growth factor induced DNA synthesis, but it induces together with BPS inhibition on fetal calf serum induced DNA synthesis. The combined effect of BPS and Tiron is similar to inhibition of DNA synthesis by impermeable polyvalent DTPA which can chelate both Fe2+ and Fe3+ but does not inhibit ribonucleotide reductase in intact cells. Ferrous iron that bind BPS can relieve the inhibition at stoichiometric concentration. Ferric iron also prevents the inhibition even though it does not bind BPS. BPS does not inhibit DNA synthesis in HeLa cells. BPS reacts with iron from CCl 39 cells but not from HeLa cells. Data show that iron available for impermeable external chelators is in the ferrous state, and that exogenous iron should be reduced before it reverses the inhibition.

  20. A DNA origami nanorobot controlled by nucleic acid hybridization.

    PubMed

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators.

  1. The identification of translesion DNA synthesis regulators: inhibitors in the spotlight

    PubMed Central

    Bertolin, AP; Mansilla, SF; Gottifredi, V

    2015-01-01

    Over the past half-century, we have become increasingly aware of the ubiquity of DNA damage. Under the constant exposure to exogenous and endogenous genomic stress, cells must attempt to replicate damaged DNA. The encounter of replication forks with DNA lesions triggers several cellular responses, including the activation of translesion DNA synthesis (TLS), which largely depends upon specialized DNA polymerases with flexible active sites capable of accommodating bulky DNA lesions. A detrimental aspect of TLS is its intrinsic mutagenic nature, and thus the activity of the TLS polymerases must ideally be restricted to synthesis on damaged DNA templates. Despite their potential clinical importance in chemotherapy, TLS inhibitors have been difficult to identify since a direct assay designed to quantify genomic TLS events is still unavailable. Herein we discuss the methods that have been used to validate TLS inhibitors such as USP1, p21 and Spartan, highlighting research that has revealed their contribution to the control of DNA synthesis on damaged and undamaged templates. PMID:26002196

  2. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  3. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  4. DNA-Based Synthesis and Assembly of Organized Iron Oxide Nanostructures

    NASA Astrophysics Data System (ADS)

    Khomutov, Gennady B.

    Organized bio-inorganic and hybrid bio-organic-inorganic nanostructures consisting of iron oxide nanoparticles and DNA complexes have been formed using methods based on biomineralization, interfacial and bulk phase assembly, ligand exchange and substitution, Langmuir-Blodgett technique, DNA templating and scaffolding. Interfacially formed planar DNA complexes with water-insoluble amphiphilic polycation or intercalator Langmuir monolayers were prepared and deposited on solid substrates to form immobilized DNA complexes. Those complexes were then used for the synthesis of organized DNA-based iron oxide nanostructures. Planar net-like and circular nanostructures of magnetic Fe3O4 nanoparticles were obtained via interaction of cationic colloid magnetite nanoparticles with preformed immobilized DNA/amphiphilic polycation complexes of net-like and toroidal morphologies. The processes of the generation of iron oxide nanoparticles in immobilized DNA complexes via redox synthesis with various iron sources of biological (ferritin) and artificial (FeCl3) nature have been studied. Bulk-phase complexes of magnetite nanoparticles with biomolecular ligands (DNA, spermine) were formed and studied. Novel nano-scale organized bio-inorganic nanostructures - free-floating sheet-like spermine/magnetite nanoparticle complexes and DNA/spermine/magnetite nanoparticle complexes were synthesized in bulk aqueous phase and the effect of DNA molecules on the structure of complexes was discovered.

  5. Accumulation of ricinoleic, lesquerolic, and densipolic acids in seeds of transgenic Arabidopsis plants that express a fatty acyl hydroxylase cDNA from castor bean.

    PubMed Central

    Broun, P; Somerville, C

    1997-01-01

    A cDNA encoding the oleate 12-hydroxylase from castor bean (Ricinus communis L.) has previously been shown to direct the synthesis of small amounts of ricinoleic acid (12-hydroxyoctadec-cis-9-enoic acid) in seeds of transgenic tobacco plants. Expression of the cDNA under control of the Brassica napus napin promoter in transgenic Arabidopsis thaliana plants resulted in the accumulation of up to 17% of seed fatty acids as ricinoleate and two novel fatty acids that have been identified by gas chromatography-mass spectrometry as lesquerolic (14-hydroxyeicos-cis-11-enoic acid) and densipolic (12-hydroxyoctadec-cis-9,15-dienoic acid) acids. Traces of auricolic acid were also observed. These results suggest that either the castor hydroxylase can utilize oleic acid and eicosenoic acid as substrates for ricinoleic and lesquerolic acid biosynthesis, respectively, or Arabidopsis contains an elongase that accepts ricinoleic acid as a substrate. These observations are also consistent with indirect biochemical evidence that an n-3 desaturase is capable of converting ricinoleic acid to densipolic acid. Expression of the castor hydroxylase also caused enhanced accumulation of oleic acid and a corresponding decrease in the levels of polyunsaturated fatty acids. Since the steady-state level of mRNA for the oleate-12 desaturase was not affected, it appears that the presence of the hydroxylase, directly or indirectly, causes posttranscriptional inhibition of desaturation. PMID:9085577

  6. Unlocked nucleic acids with a pyrene-modified uracil: synthesis, hybridization studies, fluorescent properties and i-motif stability.

    PubMed

    Perlíková, Pavla; Karlsen, Kasper K; Pedersen, Erik B; Wengel, Jesper

    2014-01-03

    The synthesis of two new phosphoramidite building blocks for the incorporation of 5-(pyren-1-yl)uracilyl unlocked nucleic acid (UNA) monomers into oligonucleotides has been developed. Monomers containing a pyrene-modified nucleobase component were found to destabilize an i-motif structure at pH 5.2, both under molecular crowding and noncrowding conditions. The presence of the pyrene-modified UNA monomers in DNA strands led to decreases in the thermal stabilities of DNA*/DNA and DNA*/RNA duplexes, but these duplexes' thermal stabilities were better than those of duplexes containing unmodified UNA monomers. Pyrene-modified UNA monomers incorporated in bulges were able to stabilize DNA*/DNA duplexes due to intercalation of the pyrene moiety into the duplexes. Steady-state fluorescence emission studies of oligonucleotides containing pyrene-modified UNA monomers revealed decreases in fluorescence intensities upon hybridization to DNA or RNA. Efficient quenching of fluorescence of pyrene-modified UNA monomers was observed after formation of i-motif structures at pH 5.2. The stabilizing/destabilizing effect of pyrene-modified nucleic acids might be useful for designing antisense oligonucleotides and hybridization probes.

  7. Liver nuclear DNA synthesis in mice following carbon tetrachloride administration or partial hepatectomy

    SciTech Connect

    Gans, J.H.; Korson, R.

    1984-02-01

    Long-term, continuous (twice per week) administration of CCl/sub 4/ to male mice resulted in a high incidence of liver nodules which appear to be resistant to the necrotizing effects of CCl/sub 4/ but showed no features of malignant neoplasia. Liver nuclear DNA synthesis was compared in mice given CCl/sub 4/ and in mice subjected to partial hepatectomy (PH). Mice were given by gavage corn oil or CCl/sub 4/ in corn oil for periods of 2 to 25 weeks and several mice were subjected to PH after 12 and 25 weeks of corn oil treatment. Mice were given (/sup 3/H)TdR during liver regeneration and newly synthesized liver nuclear DNA was isolated and separated by BND-cellulose chromatography. Greater than 85% of the labeled DNA from PH mice eluted from BND-cellulose columns as double-stranded (ds) DNA with single-stranded (ss) regions or ends and less than 15% as ds DNA. When mice were treated with CCl/sub 4/ for 8 weeks or longer a significantly greater portion of liver nuclear DNA eluted as ds DNA. Administration of HU and 5-FU with (/sup 3/H)TdR decreased (/sup 3/H)TdR incorporation into DNA to low levels incompatible with unscheduled DNA synthesis. Single doses of CCl/sub 4/ given to mice treated with corn oil for 2 to 12 weeks provided newly synthesized DNA which was primarily (>80%) ds DNA with ss regions or ends, but after 25 weeks of corn oil administration, a single dose of CCl/sub 4/ resulted in newly synthesized DNA with a greater proportion of ds DNA. The high labeling of ds DNA in mice treated with CCl/sub 4/ may have resulted from an alternate pathway of DNA synthesis catalyzed by the enzymes or enzyme complexes associated with semiconservative DNA synthesis or from proliferation of nonparenchymal cells with a rapid turn-over rate.

  8. Comparison of dna-copying fidelity during repair and semiconservative synthesis by radioactive precursor distribution analysis

    SciTech Connect

    Nemirovskii, L.E.; Vasil'ev, V.K.

    1986-04-01

    The authors compare the fidelity of DNA copying during semiconservative and reparative synthesis under normal conditions and during cortisol-induced activation of free-radical processes, by examining the distribution of radioactivity among DNA pyrimidine isopliths. Radioactivity of nucleotide material in the isopliths was measured by counting in appropriate zones of the chromatograms in toluene scintillator. The investigation shows that injury to DNA of different organs, both directly and as a result of faulty repair, leads to shortening of the pyrimidine isopliths, i.e., to changes in the primary structure of DNA. These data help to explain the simultaneously cytostatic, carcinostatic, and mutagenic action of irradiation, cortisol and hydroxyurea.

  9. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  10. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    2000-08-01

    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  11. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  12. Role of mucosal prostaglandins and DNA synthesis in gastric cytoprotection by luminal epidermal growth factor.

    PubMed Central

    Konturek, S J; Brzozowski, T; Piastucki, I; Dembinski, A; Radecki, T; Dembinska-Kiec, A; Zmuda, A; Gregory, H

    1981-01-01

    This study compares the effect of epidermal growth factor and prostaglandins (PGE2 or PGI2), applied topically to gastric mucosa, on gastric secretion and formation of ASA-induced gastric ulcerations in rats. Epidermal growth factor given topically in non-antisecretory doses prevented dose-dependently the formation of ASA-induced ulcers without affecting prostaglandin generation but with a significant rise in DNA synthesis in the oxyntic mucosa. The anti-ulcer effect of topical prostaglandins was also accompanied by an increase in DNA synthesis. This study indicates that topical epidermal growth factor, like PGE2 or PGI2, is cytoprotective and that this cytoprotection is not mediated by the inhibition of gastric secretion or prostaglandin formation but related to the increase in DNA synthesis in oxyntic mucosa. PMID:7030877

  13. DNA synthesis in mouse brown adipose tissue is under. beta. -adrenergic control

    SciTech Connect

    Rehnmark, S.; Nedergaard, J. )

    1989-02-01

    The rate of DNA synthesis in mouse brown adipose tissue was followed with injections of ({sup 3}H)thymidine. Cold exposure led to a large increase in the rate of ({sup 3}H)thymidine incorporation, reaching a maximum after 8 days, after which the activity abruptly ceased. A series of norepinephrine injections was in itself able to increase ({sup 3}H)thymidine incorporation. When norepinephrine was injected in combination with the {alpha}-adrenergic antagonist phentolamine or with the {beta}-adrenergic antagonist propranolol, the stimulation was fully blocked by propranolol. It is suggested that stimulation of DNA synthesis in brown adipose tissue is a {beta}-adrenergically mediated process and that the tissue is an interesting model for studies of physiological control of DNA synthesis.

  14. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  15. Ribonucleotide reductase activity is coupled to DNA synthesis via proliferating cell nuclear antigen.

    PubMed

    Salguero, Israel; Guarino, Estrella; Shepherd, Marianne E A; Deegan, Tom D; Havens, Courtney G; MacNeill, Stuart A; Walter, Johannes C; Kearsey, Stephen E

    2012-04-24

    Synthesis of deoxynucleoside triphosphates (dNTPs) is required for both DNA replication and DNA repair and is catalyzed by ribonucleotide reductases (RNR), which convert ribonucleotides to their deoxy forms [1, 2]. Maintaining the correct levels of dNTPs for DNA synthesis is important for minimizing the mutation rate [3-7], and this is achieved by tight regulation of RNR [2, 8, 9]. In fission yeast, RNR is regulated in part by a small protein inhibitor, Spd1, which is degraded in S phase and after DNA damage to allow upregulation of dNTP supply [10-12]. Spd1 degradation is mediated by the activity of the CRL4(Cdt2) ubiquitin ligase complex [5, 13, 14]. This has been reported to be dependent on modulation of Cdt2 levels, which are cell cycle regulated, peaking in S phase, and which also increase after DNA damage in a checkpoint-dependent manner [7, 13]. We show here that Cdt2 level fluctuations are not sufficient to regulate Spd1 proteolysis and that the key step in this event is the interaction of Spd1 with the polymerase processivity factor proliferating cell nuclear antigen (PCNA), complexed onto DNA. This mechanism thus provides a direct link between DNA synthesis and RNR regulation.

  16. The roles of tryptophans in primer synthesis by the DNA primase of bacteriophage T7.

    PubMed

    Zhang, Huidong; Lee, Seung-Joo; Richardson, Charles C

    2012-07-06

    DNA primases catalyze the synthesis of oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Prokaryotic primases consist of a zinc-binding domain (ZBD) necessary for recognition of a specific template sequence and a catalytic RNA polymerase domain. Interactions of both domains with the DNA template and ribonucleotides are required for primer synthesis. Five tryptophan residues are dispersed in the primase of bacteriophage T7: Trp-42 in the ZBD and Trp-69, -97, -147, and -255 in the RNA polymerase domain. Previous studies showed that replacement of Trp-42 with alanine in the ZBD decreases primer synthesis, whereas substitution of non-aromatic residues for Trp-69 impairs both primer synthesis and delivery. However, the roles of tryptophan at position 97, 147, or 255 remain elusive. To investigate the essential roles of these residues, we replaced each tryptophan with the structurally similar tyrosine and examined the effect of this subtle alteration on primer synthesis. The substitution at position 42, 97, or 147 reduced primer synthesis, whereas substitution at position 69 or 255 did not. The functions of the tryptophans were further examined at each step of primer synthesis. Alteration of residue 42 disturbed the conformation of the ZBD and resulted in partial loss of the zinc ion, impairing binding to the ssDNA template. Replacement of Trp-97 with tyrosine reduced the binding affinity to NTP and the catalysis step. The replacement of Trp-147 with tyrosine also impaired the catalytic step. Therefore, Trp-42 is important in maintaining the conformation of the ZBD for template binding; Trp-97 contributes to NTP binding and the catalysis step; and Trp-147 maintains the catalysis step.

  17. Hybridization-modulated ion fluxes through peptide-nucleic-acid- functionalized gold nanotubes. A new approach to quantitative label-free DNA analysis.

    PubMed

    Jágerszki, Gyula; Gyurcsányi, Róbert E; Höfler, Lajos; Pretsch, Ernö

    2007-06-01

    The inner walls of gold nanotubes, prepared by template synthesis in the nanopores of polycarbonate track etch membranes, have been chemically modified with peptide nucleic acid (PNA) and used for label-free quantification of complementary DNA sequences. Selective binding of DNA to the PNA-modified nanotubes is shown to decrease the flux of optically detected anionic markers through the nanotubes in a concentration-dependent manner. The strong dependence of the biorecognition-modulated ion transport through the nanopores on the ionic strength suggests a dominantly electrostatic exclusion mechanism of the ion flux decrease as a result of DNA binding to the PNA-modified nanopores.

  18. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  19. Synthesis of linear and cyclic peptide-PEG-lipids for stabilization and targeting of cationic liposome-DNA complexes.

    PubMed

    Ewert, Kai K; Kotamraju, Venkata Ramana; Majzoub, Ramsey N; Steffes, Victoria M; Wonder, Emily A; Teesalu, Tambet; Ruoslahti, Erkki; Safinya, Cyrus R

    2016-03-15

    Because nucleic acids (NAs) have immense potential value as therapeutics, the development of safe and effective synthetic NA vectors continues to attract much attention. In vivo applications of NA vectors require stabilized, nanometer-scale particles, but the commonly used approaches of steric stabilization with a polymer coat (e.g., PEGylation; PEG=poly(ethylene glycol)) interfere with attachment to cells, uptake, and endosomal escape. Conjugation of peptides to PEG-lipids can improve cell attachment and uptake for cationic liposome-DNA (CL-DNA) complexes. We present several synthetic approaches to peptide-PEG-lipids and discuss their merits and drawbacks. A lipid-PEG-amine building block served as the common key intermediate in all synthetic routes. Assembling the entire peptide-PEG-lipid by manual solid phase peptide synthesis (employing a lipid-PEG-carboxylic acid) allowed gram-scale synthesis but is mostly applicable to linear peptides connected via their N-terminus. Conjugation via thiol-maleimide or strain-promoted (copper-free) azide-alkyne cycloaddition chemistry is highly amenable to on-demand preparation of peptide-PEG-lipids, and the appropriate PEG-lipid precursors are available in a single chemical step from the lipid-PEG-amine building block. Azide-alkyne cycloaddition is especially suitable for disulfide-bridged peptides such as iRGD (cyclic CRGDKGPDC). Added at 10 mol% of a cationic/neutral lipid mixture, the peptide-PEG-lipids stabilize the size of CL-DNA complexes. They also affect cell attachment and uptake of nanoparticles in a peptide-dependent manner, thereby providing a platform for preparing stabilized, affinity-targeted CL-DNA nanoparticles.

  20. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  1. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  2. DNA synthesis in periportal and perivenous hepatocytes of intact and hepatectomized young mice.

    PubMed

    Fernández-Blanco, A; Inda, A M; Errecalde, A L

    2015-01-01

    DNA synthesis of hepatocytes in two areas of Intact and Hepatectomized young mice liver along a circadian period was studied. DNA synthesis was significantly different at all analyzed time points in Intact and Hepatectomized animals. Differences between periportal and perivenous hepatocytes were found in hepatectomized animals at 04/42 and 08/46 hr of day/hour post-hepatectomy. DNAs peak in periportal hepatocytes regenerating liver occurs 4 hr earlier than in perivenous hepatocytes, probably reflecting their shorter G1 phase. Besides, daily mean values of regenerating livers were higher than those observed in Intact animals, as a consequence of surgical removal.

  3. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  4. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  5. EGFR Modulates DNA Synthesis and Repair through Tyr Phosphorylation of Histone H4

    PubMed Central

    Chou, Ruey-Hwang; Wang, Ying-Nai; Hsieh, Yi-Hsien; Li, Long-Yuan; Xia, Weiya; Chang, Wei-Chao; Chang, Ling-Chu; Cheng, Chien-Chia; Lai, Chien-Chen; Hsu, Jennifer L.; Chang, Wei-Jung; Chiang, Shu-Ya; Lee, Hong-Jen; Liao, Hsin-Wei; Chuang, Pei-Huan; Chen, Hui-Yu; Wang, Hung-Ling; Kuo, Sheng-Chu; Chen, Chung-Hsuan; Yu, Yung-Luen; Hung, Mien-Chie

    2014-01-01

    Summary Posttranslational modifications of histones play fundamental roles in many biological functions. Specifically, histone H4-K20 methylation is critical in DNA synthesis and repair. However, little is known about how these functions are regulated by the upstream stimuli. Here, we identify a tyrosine phosphorylation site at Y72 of histone H4, which facilitates recruitment of histone methyltransferases (HMTases), SET8 and SUV4-20H, to enhance its K20 methylation, thereby promoting DNA synthesis and repair. Phosphorylation-defective histone H4 mutant is deficient in K20 methylation, leading to reduced DNA synthesis, delayed cell cycle progression, and decreased DNA repair ability. Disrupting the interaction between epidermal growth factor receptor (EGFR) and histone H4 by Y72 peptide significantly reduced tumor growth. Furthermore, EGFR expression clinically correlates with histone H4-Y72 phosphorylation, H4-K20 mono-methylation, and the Ki-67 proliferation marker. These findings uncover a mechanism by which EGFR transduces signal to chromatin to regulate DNA synthesis and repair. PMID:25073158

  6. Capture of a third Mg²⁺ is essential for catalyzing DNA synthesis.

    PubMed

    Gao, Yang; Yang, Wei

    2016-06-10

    It is generally assumed that an enzyme-substrate (ES) complex contains all components necessary for catalysis and that conversion to products occurs by rearrangement of atoms, protons, and electrons. However, we find that DNA synthesis does not occur in a fully assembled DNA polymerase-DNA-deoxynucleoside triphosphate complex with two canonical metal ions bound. Using time-resolved x-ray crystallography, we show that the phosphoryltransfer reaction takes place only after the ES complex captures a third divalent cation that is not coordinated by the enzyme. Binding of the third cation is incompatible with the basal ES complex and requires thermal activation of the ES for entry. It is likely that the third cation provides the ultimate boost over the energy barrier to catalysis of DNA synthesis.

  7. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics

    PubMed Central

    Yehezkel, Tuval Ben; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-01-01

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  8. Quantification of DNA synthesis in multicellular organisms by a combined DAPI and BrdU technique.

    PubMed

    Knobloch, Jürgen; Kunz, Werner; Grevelding, Christoph G

    2002-12-01

    The development of a novel method to detect and quantify mitotic activity in multicellular organisms is reported. The method is based on the combinatorial use of 4',6-diamidino-2-phenylindole (DAPI) as a dye for the specific staining of DNA and the thymidine analog 5-bromo-2'-deoxyuridine (BrdU) as a marker for DNA synthesis. It is shown that on nitrocellulose filters, the amount of DNA can be determined by DAPI as a prerequisite for the subsequent quantification of mitotic activity by BrdU. As a model system to prove the applicability of this technique, the blood fluke Schistosoma mansoni has been used. It is demonstrated that the DNA synthesis rate is higher in adult female schistosomes than in adult males. Furthermore, dimethyl sulfoxide, a widely used solvent for many mitogens and inhibitors of mitosis, has no influence on mitotic activity in adult schistosomes.

  9. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics.

    PubMed

    Ben Yehezkel, Tuval; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-02-29

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development.

  10. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.

  11. Stimulation of DNA and Collagen Synthesis by Autologous Growth Factor in Cultured Fetal Rat Calvaria

    NASA Astrophysics Data System (ADS)

    Canalis, Ernesto; Peck, William A.; Raisz, Lawrence G.

    1980-11-01

    Conditioned medium derived from organ or cell cultures prepared from 19- to 21-day fetal rat calvaria stimulated the incorporation of [3H]proline into collagen and of [3H]thymidine into DNA in organ cultures of the same tissue. Addition of cortisol enhanced the effect on collagen but not on DNA synthesis. These effects appeared to be due to a nondialyzable and heat-stable growth factor.

  12. Dihedral angle preferences of DNA and RNA binding amino acid residues in proteins.

    PubMed

    Ponnuraj, Karthe; Saravanan, Konda Mani

    2017-04-01

    A protein can interact with DNA or RNA molecules to perform various cellular processes. Identifying or analyzing DNA/RNA binding site amino acid residues is important to understand molecular recognition process. It is quite possible to accurately model DNA/RNA binding amino acid residues in experimental protein-DNA/RNA complex by using the electron density map whereas, locating/modeling the binding site amino acid residues in the predicted three dimensional structures of DNA/RNA binding proteins is still a difficult task. Considering the above facts, in the present work, we have carried out a comprehensive analysis of dihedral angle preferences of DNA and RNA binding site amino acid residues by using a classical Ramachandran map. We have computed backbone dihedral angles of non-DNA/RNA binding residues and used as control dataset to make a comparative study. The dihedral angle preference of DNA and RNA binding site residues of twenty amino acid type is presented. Our analysis clearly revealed that the dihedral angles (φ, ψ) of DNA/RNA binding amino acid residues prefer to occupy (-89° to -60°, -59° to -30°) bins. The results presented in this paper will help to model/locate DNA/RNA binding amino acid residues with better accuracy.

  13. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  14. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  15. Prooxidant action of chebulinic acid and tellimagrandin I: causing copper-dependent DNA strand breaks.

    PubMed

    Yi, Zong-Chun; Liu, Yan-Ze; Li, Hai-Xia; Wang, Zhao

    2009-04-01

    The prooxidant activity of two hydrolysable tannins, chebulinic acid and tellimagrandin I, on plasmid DNA and genomic DNA of cultured MRC-5 human embryo lung fibroblasts was assessed. The results revealed that both hydrolysable tannins in combination with Cu(II) induced DNA strand breaks in pBR322 plasmid DNA in a concentration-dependent manner. Chebulinic acid and tellimagrandin I also induced genomic DNA strand breaks of MRC-5 human embryo lung fibroblasts in the presence of Cu(II). After treatment with chebulinic acid or tellimagrandin I alone, the pBR322 plasmid DNA and genomic DNA in MRC-5 cells kept intact. In addition, addition of Cu(I) reagent bathocuproinedisulfonic acid or catalase markedly inhibited the copper-dependent DNA strand breaks by both tannins. However, three typical hydroxyl radical scavengers, DMSO, ethanol and mannitol, did not inhibit the DNA strand breaks. Both tannins were able to reduce Cu(II) to Cu(I). These results indicated that chebulinic acid and tellimagrandin I induced the copper-dependent strand breaks of pBR322 plasmid DNA and MRC-5 genomic DNA with prooxidant action, in which Cu(II)/Cu(I) redox cycle and H(2)O(2) were involved and hydroxyl radical formation is important in the hypothetical mechanism by which DNA strand breaks are formed.

  16. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  17. DNA adsorption to and elution from silica surfaces: influence of amino acid buffers.

    PubMed

    Vandeventer, Peter E; Mejia, Jorge; Nadim, Ali; Johal, Malkiat S; Niemz, Angelika

    2013-09-19

    Solid phase extraction and purification of DNA from complex samples typically requires chaotropic salts that can inhibit downstream polymerase amplification if carried into the elution buffer. Amino acid buffers may serve as a more compatible alternative for modulating the interaction between DNA and silica surfaces. We characterized DNA binding to silica surfaces, facilitated by representative amino acid buffers, and the subsequent elution of DNA from the silica surfaces. Through bulk depletion experiments, we found that more DNA adsorbs to silica particles out of positively compared to negatively charged amino acid buffers. Additionally, the type of the silica surface greatly influences the amount of DNA adsorbed and the final elution yield. Quartz crystal microbalance experiments with dissipation monitoring (QCM-D) revealed multiphasic DNA adsorption out of stronger adsorbing conditions such as arginine, glycine, and glutamine, with DNA more rigidly bound during the early stages of the adsorption process. The DNA film adsorbed out of glutamate was more flexible and uniform throughout the adsorption process. QCM-D characterization of DNA elution from the silica surface indicates an uptake in water mass during the initial stage of DNA elution for the stronger adsorbing conditions, which suggests that for these conditions the DNA film is partly dehydrated during the prior adsorption process. Overall, several positively charged and polar neutral amino acid buffers show promise as an alternative to methods based on chaotropic salts for solid phase DNA extraction.

  18. Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5'-flaps.

    PubMed

    Koc, Katrina N; Stodola, Joseph L; Burgers, Peter M; Galletto, Roberto

    2015-04-30

    The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3'-5' exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo(-) to carry out strand displacement synthesis and discovered that it is regulated by the 5'-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5'-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5'-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities.

  19. A euryarchaeal histone modulates strand displacement synthesis by replicative DNA polymerases.

    PubMed

    Sun, Fei; Huang, Li

    2016-07-01

    Euryarchaeota and Crenarchaeota, the two main lineages of the domain Archaea, encode different chromatin proteins and differ in the use of replicative DNA polymerases. Crenarchaea possess a single family B DNA polymerase (PolB), which is capable of strand displacement modulated by the chromatin proteins Cren7 and Sul7d. Euryarchaea have two distinct replicative DNA polymerases, PolB and PolD, a family D DNA polymerase. Here we characterized the strand displacement activities of PolB and PolD from the hyperthermophilic euryarchaeon Pyrococcus furiosus and investigated the influence of HPfA1, a homolog of eukaryotic histones from P. furiosus, on these activities. We showed that both PolB and PolD were efficient in strand displacement. HPfA1 inhibited DNA strand displacement by both DNA polymerases but exhibited little effect on the displacement of a RNA strand annealed to single-stranded template DNA. This is consistent with the finding that HPfA1 bound more tightly to double-stranded DNA than to a RNA:DNA hybrid. Our results suggest that, although crenarchaea and euryarchaea differ in chromosomal packaging, they share similar mechanisms in modulating strand displacement by DNA polymerases during lagging strand DNA synthesis.

  20. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  1. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  2. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  3. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    PubMed

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods.

  4. Protective Effect of Folic Acid on Oxidative DNA Damage

    PubMed Central

    Guo, Xiaojuan; Cui, Huan; Zhang, Haiyang; Guan, Xiaoju; Zhang, Zheng; Jia, Chaonan; Wu, Jia; Yang, Hui; Qiu, Wenting; Zhang, Chuanwu; Yang, Zuopeng; Chen, Zhu; Mao, Guangyun

    2015-01-01

    Abstract Although previous reports have linked DNA damage with both transmissions across generations as well as our own survival, it is unknown how to reverse the lesion. Based on the data from a Randomized, Double-blind, Placebo Controlled Clinical Trial, this study aimed to assess the efficacy of folic acid supplementation (FAS) on DNA oxidative damage reversal. In this randomized clinical trial (RCT), a total of 450 participants were enrolled and randomly assigned to 3 groups to receive folic acid (FA) 0.4 mg/day (low-FA), 0.8 mg/day (high-FA), or placebo (control) for 8 weeks. The urinary 8-hydroxy-2’-deoxyguanosine (8-OHdG) and creatinine (Cr) concentration at pre- and post-FAS were measured with modified enzyme-linked immunosorbent assay (ELISA) and high-performance liquid chromatography (HPLC), respectively. A multivariate general linear model was applied to assess the individual effects of FAS and the joint effects between FAS and hypercholesterolemia on oxidative DNA damage improvement. This clinical trial was registered with ClinicalTrials.gov, number NCT02235948. Of the 438 subjects that received FA fortification or placebo, the median (first quartile, third quartile) of urinary 8-OHdG/Cr for placebo, low-FA, and high-FA groups were 58.19 (43.90, 82.26), 53.51 (38.97, 72.74), 54.73 (39.58, 76.63) ng/mg at baseline and 57.77 (44.35, 81.33), 51.73 (38.20, 71.30), and 50.65 (37.64, 76.17) ng/mg at the 56th day, respectively. A significant decrease of urinary 8-OHdG was observed after 56 days FA fortification (P < 0.001). Compared with the placebo, after adjusting for some potential confounding factors, including the baseline urinary 8-OHdG/Cr, the urinary 8-OHdG/Cr concentration significantly decreased after 56 days FAS [β (95% confidence interval) = −0.88 (−1.62, −0.14) and P = 0.020 for low-FA; and β (95% confidence interval) = −2.68 (−3.42, −1.94) and P < 0.001 for high-FA] in a dose-response fashion (Ptrend

  5. Synthesis and properties of 4′-ThioDNA: unexpected RNA-like behavior of 4′-ThioDNA

    PubMed Central

    Inoue, Naonori; Minakawa, Noriaki; Matsuda, Akira

    2006-01-01

    The synthesis and properties of fully modified 4′-thioDNAs, oligonucleotides consisting of 2′-deoxy-4′-thionucleosides, were examined. In addition to the known literature properties (preferable hybridization with RNA and resistance to endonuclease hydrolysis), we also observed higher resistance of 4′-thioDNA to 3′-exonuclease cleavage. Furthermore, we found that fully modified 4′-thioDNAs behaved like RNA molecules in their hybridization properties and structural aspect, at least in the case of the 4′-thioDNA duplex. This observation was confirmed by experiments using groove binders, in which a 4′-thioDNA duplex interacts with an RNA major groove binder, lividomycin A, but not with DNA groove binders, to give an increase in its thermal stability. Since a 4′-thioDNA duplex competitively inhibited the hydrolysis of an RNA duplex by RNase V1, it was not only the physical properties but also this biological data suggested that a 4′-thioDNA duplex has an RNA-like structure. PMID:16855286

  6. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  7. PLASMID DNA DAMAGE CAUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN

    EPA Science Inventory

    PLASMID DNA DAMAGE CAOUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN

    ABSTRACT

    Both dimethylarsinic acid (DMA(V)) and dimethylarsinous acid (DMA(III)) release iron from human liver ferritin (HLF) with or without the presence of ascorbic acid. ...

  8. Molecular Recognition of DNA. Synthesis of Novel Bases for Triple Helix Formation

    DTIC Science & Technology

    1991-01-01

    to the purine strand in the major groove of the Watson - Crick double helical DNA (TAT, C+GC triplets). Purine oligonucleotides bind antiparallel to...R&T Code 4135018 S MAy 05 199411 "Molecular Recognition of DNA . Synthesis of Novel Bases for Triple Helix Formation" Peter B. Dervan cv _California...035 T"IQA""D PART I A) Completed work (1988-91) Triple Helix Formation by Oligonucleotides on DNA Extended to the Physiological pH Range. T. J. Povsic

  9. Stimulation of DNA synthesis in cultured primary human mesothelial cells by specific growth factors

    SciTech Connect

    Gabrielson, E.W.; Gerwin, B.I.; Harris, C.C.; Roberts, A.B.; Sporn, M.B.; Lechner, J.F.

    1988-08-01

    Monolayer cultures of human mesothelial cells made quiescent by serum deprivation are induced to undergo one round of DNA synthesis by platelet-derived growth factor (PDGF), epidermal growth factor (EGF), or transforming growth factor type beta 1 (TGF-beta 1). This one-time stimulation is independent of other serum components. The kinetics for induction of DNA synthesis observed for PDGF, EGF, and TGF-beta 1 are all similar to one another, with a peak of DNA synthesis occurring 24-36 h after the addition of the growth factors. Repetitive rounds of DNA synthesis and cell division do not ensue after addition of PDGF, EGF, or TGF-beta 1 alone or in combination; however, in media supplemented with chemically denatured serum, each of these factors is capable of sustaining continuous replication of mesothelial cells. Stimulation of growth by PDGF and TGF-beta 1 is unusual for an epithelial cell type, and indicates that mesothelial cells have growth regulatory properties similar to connective tissue cells.

  10. Evidence for cell surface control of macronuclear DNA synthesis in Stentor.

    PubMed

    de Terra, N

    1975-11-27

    In cell grafts, Stentor macronuclei associated with separate regions of cell surface can be made asynchronous with regard to morphology and DNA synthesis even though they demonstrably share a common endoplasm. These results suggest a mechanism for nuclear differentiation within a single cytoplasmic compartment, based on cell surface differences.

  11. Design, synthesis, and characterization of nucleosomes containing site-specific DNA damage.

    PubMed

    Taylor, John-Stephen

    2015-12-01

    How DNA damaged is formed, recognized, and repaired in chromatin is an area of intense study. To better understand the structure activity relationships of damaged chromatin, mono and dinucleosomes containing site-specific damage have been prepared and studied. This review will focus on the design, synthesis, and characterization of model systems of damaged chromatin for structural, physical, and enzymatic studies.

  12. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  13. Synthesis and characterization of DNA nano-meso-microspheres as drug delivery carriers for intratumoral chemotherapy

    NASA Astrophysics Data System (ADS)

    Enriquez Schumacher, Iris Vanessa

    Conventional cancer chemotherapy results in systemic toxicity which severely limits effectiveness and often adversely affects patient quality of life. There is a need to find new drugs and delivery methods for less toxic therapy. Previous studies concerning DNA complexing with chemotherapy drugs suggest unique opportunities for DNA as a mesosphere drug carrier. The overall objective of this research was devoted to the synthesis and evaluation of novel DNA-drug nano-mesospheres designed for localized chemotherapy via intratumoral injection. My research presents DNA nano-meso-microspheres (DNA-MS) that were prepared using a modified steric stabilization method originally developed in this lab for the preparation of albumin MS. DNA-MS were prepared with glutaraldehyde covalent crosslinking (genipin crosslinking was attempted) through the DNA base pairs. In addition, novel crosslinking of DNA-MS was demonstrated using chromium, gadolinium, or iron cations through the DNA phosphate groups. Covalent and ionic crosslinked DNA-MS syntheses yielded smooth and spherical particle morphologies with multimodal size distributions. Optimized DNA-MS syntheses produced particles with narrow and normal size distributions in the 50nm to 5mum diameter size range. In aqueous dispersions approximately 200% swelling was observed with dispersion stability for more than 48 hours. Typical process conditions included a 1550rpm initial mixing speed and particle filtration through 20mum filters to facilitate preparation. DNA-MS were in situ loaded during synthesis for the first time with mitoxantrone, 5-fluorouracil, and methotrexate. DNA-MS drug incorporation was 12%(w/w) for mitoxantrone, 9%(w/w) for methotrexate, and 5%(w/w) for 5-fluorouracil. In vitro drug release into phosphate buffered saline was observed for over 35 days by minimum sink release testing. The effect of gadolinium crosslink concentration on mitoxantrone release was evaluated at molar equivalences in the range of 20% to

  14. Synthesis of the tellurium-derivatized phosphoramidites and their incorporation into DNA oligonucleotides.

    PubMed

    Jiang, Sibo; Sheng, Jia; Huang, Zhen

    2011-12-01

    In this unit, an efficient method for the synthesis of 2'-tellerium-modified phosphoramidite and its incorporation into oligonucleotide are presented. We choose 5'-O-DMTr-2,2'-anhydro-uridine and -thymidine nucleosides (S.1, S.2) as starting materials due to their easy preparation. The 5'-O-DMTr-2,2'-anhydro-uridine and -thymidine can be converted to the corresponding 2'-tellerium-derivatized nucleosides by treating with the telluride nucleophiles. Subsequently, the 2'-Te-nucleosides can be transformed into 3'-phosphoramidites, which are the building blocks for DNA/RNA synthesis. The DNA synthesis, purification, and applications of oligonucleotides containing 2'-Te-U or 2'-Te-T are described in the protocol.

  15. Synthesis of amino-rich silica-coated magnetic nanoparticles for the efficient capture of DNA for PCR.

    PubMed

    Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming

    2016-09-01

    Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR.

  16. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  17. DNA-directed in vitro synthesis of proteins involved in bacterial transcription and translation.

    PubMed Central

    Zarucki-Schulz, T; Jerez, C; Goldberg, G; Kung, H F; Huang, K H; Brot, N; Weissbach, H

    1979-01-01

    The in vitro synthesis of elongation factor (EF)-Tu (tufB), the beta beta' subunits of RNA polymerase, ribosomal proteins L10 and L12 directed by DNA from the transducing phage lambda rifd 18, EF-Tu (tufA), EF-G, and the alpha subunit of RNA polymerase directed by DNA from the transducing phage lambda fus3 has been investigated in a crude and a partially defined protein-synthesizing system. Proteins L10 and L12 are synthesized in the partially defined system almost as well as in the crude system. However, the synthesis of EF-Tu, EF-G, and the alpha and beta beta' subunits of RNA polymerase is far less efficient in the partially defined system. An active fraction that stimulates the synthesis of these latter proteins has been obtained by fractionation of a high-speed supernatant on DEAE-cellulose. Because previous studies showed that this fraction (1 M DEAE salt eluate) contains a protein, called L factor, that stimulates beta-galactosidase synthesis in vitro, L factor was tested for activity. Although L factor stimulates the synthesis of the beta beta' subunits, it has little or no effect on the in vitro synthesis of the other products studied. In the present experiments, the ratio of L12/L10 and of EF-Tu (tufA)/EF-G formed is 4-6. These values are consistent with in vivo results. Images PMID:160561

  18. Co-opting the Fanconi anemia genomic stability pathway enables herpesvirus DNA synthesis and productive growth.

    PubMed

    Karttunen, Heidi; Savas, Jeffrey N; McKinney, Caleb; Chen, Yu-Hung; Yates, John R; Hukkanen, Veijo; Huang, Tony T; Mohr, Ian

    2014-07-03

    DNA damage associated with viral DNA synthesis can result in double-strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi anemia (FA) genomic stability pathway is exploited by herpes simplex virus 1 (HSV-1) to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV-1-infected cells resulted in monoubiquitination of FA effector proteins FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments, and FANCI-D2 interacted with a multisubunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, whereas HSV-1 productive growth was impaired in monoubiquitination-defective FA cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for nonhomologous end-joining (NHEJ). This identifies the FA-pathway as a cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral life cycle.

  19. Co-opting the Fanconi Anemia Genomic Stability Pathway Enables Herpesvirus DNA Synthesis and Productive Growth

    PubMed Central

    Karttunen, Heidi; Savas, Jeffrey N.; McKinney, Caleb; Chen, Yu-Hung; Yates, John R.; Hukkanen, Veijo; Huang, Tony T.; Mohr, Ian

    2015-01-01

    SUMMARY DNA damage associated with viral DNA synthesis can result in double strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi Anemia (FA) genomic stability pathway is exploited by HSV1 to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV1-infected cells resulted in monoubiquitination of FA effector proteins, FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments and FANCI-D2 interacted with a multi-subunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, while HSV1 productive growth was impaired in monoubiquitination-defective FA patient cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for non-homologous end-joining (NHEJ). This identifies the FA-pathway as a new cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral lifecycle. PMID:24954902

  20. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  1. A Scalable Gene Synthesis Platform Using High-Fidelity DNA Microchips

    PubMed Central

    Kosuri, Sriram; Eroshenko, Nikolai; LeProust, Emily; Super, Michael; Way, Jeffrey; Li, Jin Billy; Church, George M.

    2010-01-01

    Development of cheap, high-throughput, and reliable gene synthesis methods will broadly stimulate progress in biology and biotechnology1. Currently, the reliance on column-synthesized oligonucleotides as a source of DNA limits further cost reductions in gene synthesis2. Oligonucleotides from DNA microchips can reduce costs by at least an order of magnitude3,4,5, yet efforts to scale their use have been largely unsuccessful due to the high error rates and complexity of the oligonucleotide mixtures. Here we use high-fidelity DNA microchips, selective oligonucleotide pool amplification, optimized gene assembly protocols, and enzymatic error correction to develop a highly parallel gene synthesis platform. We tested our platform by assembling 47 genes, including 42 challenging therapeutic antibody sequences, encoding a total of ~35 kilo-basepairs of DNA. These assemblies were performed from a complex background containing 13,000 oligonucleotides encoding ~2.5 megabases of DNA, which is at least 50 times larger than previously published attempts. PMID:21113165

  2. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  3. Translesion Synthesis of 2′-Deoxyguanosine Lesions by Eukaryotic DNA Polymerases

    PubMed Central

    2016-01-01

    With the discovery of translesion synthesis DNA polymerases, great strides have been made in the last two decades in understanding the mode of replication of various DNA lesions in prokaryotes and eukaryotes. A database search indicated that approximately 2000 articles on this topic have been published in this period. This includes research involving genetic and structural studies as well as in vitro experiments using purified DNA polymerases and accessory proteins. It is a daunting task to comprehend this exciting and rapidly emerging area of research. Even so, as the majority of DNA damage occurs at 2′-deoxyguanosine residues, this perspective attempts to summarize a subset of this field, focusing on the most relevant eukaryotic DNA polymerases responsible for their bypass. PMID:27760288

  4. DNA polymerases drive DNA sequencing-by-synthesis technologies: both past and present.

    PubMed

    Chen, Cheng-Yao

    2014-01-01

    Next-generation sequencing (NGS) technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. Escherichia coli DNA polymerase I proteolytic (Klenow) fragment was originally utilized in Sanger's dideoxy chain-terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE) and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ϕ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ϕ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

  5. Effects of retinoids on iodine metabolism, thyroid peroxidase gene expression, and deoxyribonucleic acid synthesis in porcine thyroid cells in culture.

    PubMed

    Arai, M; Tsushima, T; Isozaki, O; Shizume, K; Emoto, N; Demura, H; Miyakawa, M; Onoda, N

    1991-12-01

    Effects of retinoids on DNA synthesis, iodine metabolism, and thyroid peroxidase messenger RNA levels were studied in cultured porcine thyroid cells. Retinol (10(-8)-10(-5) M) alone did not affect DNA synthesis but potentiated that induced by epidermal growth factor or insulin-like growth factor-I without changes in the number or affinity of receptors for the growth factors, suggesting that retinol stimulates postreceptor events responsible for DNA synthesis. Retinol was an inhibitor of TSH-stimulated iodine metabolism. Iodide uptake and release of organified iodine stimulated by TSH or forskolin were inhibited dose dependently by treatment with retinol. The inhibition was detected at 10(-8) M and was approximately 50% at 10(-6) M. The potency of retinoic acid was comparable to that of retinol. The inhibitory effect of retinol was detected after treatments of thyroid cells for 24 h, and the maximal effect occurred after 48 h incubation. The cAMP accumulation in cultures treated with TSH plus retinol was lower than that of control cultures treated with TSH alone. However, iodide uptake stimulated by 8-bromo-cAMP was also inhibited by retinoids. Retinol reduced TSH- or 8-bromo-cAMP-stimulated gene expression of thyroid peroxidase. Thus, the data suggest that retinoids inhibit TSH-stimulated iodine metabolism by reducing cAMP accumulation and also by acting on the steps subsequent to cAMP production.

  6. Action of cytochalasin D on DNA synthesis in cells in culture

    SciTech Connect

    Glushankova, N.A.

    1986-10-01

    To solve the problem of the effect of changes in the actin cytoskeleton on DNA replication during the action of cytochalasins, the effect of long-term incubation of normal cells with cytochalasin D (CCD), which selectively destroys the microfilament system but does not affect transport of sugars, was investigated. Incorporation of labeled thymidine into mononuclear and binuclear cells in the presence of CCD and after its removal by rinsing also was studied separately. To investigate DNA synthesis the method of autoradiography with /sup 3/H-thymidine was used. A culture of mouse fibroblasts of the BALB/3T3 line and a secondary culture of fibroblasts obtained by trypsinization of mouse embryos (MEF) were used. On incubation of MEF and 3T3 cells, gradual inhibition of DNA synthesis is observed. The results obtained indicate that structural changes in the active cytoskeleton can abruptly and reversibly disturb passage of the normal cell through the cycle.

  7. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    PubMed

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction.

  8. Estrogens protect against hydrogen peroxide and arachidonic acid induced DNA damage.

    PubMed

    Tang, M; Subbiah, M T

    1996-01-19

    The ability of estrogens to protect against DNA damage induced by either hydrogen peroxide or arachidonic acid alone or in combination with Cu2+ was investigated. DNA strand breaks were determined by conversion of double stranded supercoiled OX-174 RFI DNA to double stranded open circular DNA and linear single stranded DNA. Estradiol-17 beta significantly decreased the formation of single and double strand breaks in DNA induced by H2O2 alone or with Cu2+. Equilin (an equine estrogen) was more effective than estradiol-17 beta at the doses tested. Arachidonic acid in the presence of Cu2+ caused the formation of high levels of linear DNA which was protected by estrogen with equilen being more effective. These studies suggest that estrogens through this protective effect on DNA damage might contribute to cardioprotection.

  9. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  10. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  11. Synthesis of Sindbis virus complementary DNA by avian myeloblastosis virus RNA-directed DNA polymerase.

    PubMed

    Yuferov, V; Grandgenett, D P; Bondurant, M; Riggin, C; Tigges, M

    1978-07-24

    Sindbis virus 42 S RNA was efficiently transcribed into complementary DNA (CDNA) by avian myeloblastosis virus alphabeta DNA polymerase using oligo- (dT) or single-stranded calf thymus DNA as primers. Both of the Sindbis virus cDNA products were able to protect 60% of 125I-labeled Sindbis virus RNA, at near equal weight ratios, from RNAase A and T1 digestion. Using hybridization kinetics, the Crt 1/2 value for hybridization of the calf thymus-primed cDNA product with excess Sindbis RNA was determined to be 1.8 9 10-2 mol . s . 1-1. Thes data demonstrate that the Sindbis virus cDNA products are relatively uniform representations of Sindbis virus RNA sequences.

  12. Homologous Recombination and Translesion DNA Synthesis Play Critical Roles on Tolerating DNA Damage Caused by Trace Levels of Hexavalent Chromium

    PubMed Central

    Chen, Youjun; Zhou, Yi-Hui; Neo, Dayna; Clement, Jean; Takata, Minoru; Takeda, Shunichi; Sale, Julian; Wright, Fred A.; Swenberg, James A.; Nakamura, Jun

    2016-01-01

    Contamination of potentially carcinogenic hexavalent chromium (Cr(VI)) in the drinking water is a major public health concern worldwide. However, little information is available regarding the biological effects of a nanomoler amount of Cr(VI). Here, we investigated the genotoxic effects of Cr(VI) at nanomoler levels and their repair pathways. We found that DNA damage response analyzed based on differential toxicity of isogenic cells deficient in various DNA repair proteins is observed after a three-day incubation with K2CrO4 in REV1-deficient DT40 cells at 19.2 μg/L or higher as well as in TK6 cells deficient in polymerase delta subunit 3 (POLD3) at 9.8 μg/L or higher. The genotoxicity of Cr(VI) decreased ~3000 times when the incubation time was reduced from three days to ten minutes. TK mutation rate also significantly decreased from 6 day to 1 day exposure to Cr(VI). The DNA damage response analysis suggest that DNA repair pathways, including the homologous recombination and REV1- and POLD3-mediated error-prone translesion synthesis pathways, are critical for the cells to tolerate to DNA damage caused by trace amount of Cr(VI). PMID:27907204

  13. Role of Amino Acid Insertions on Intermolecular Forces between Arginine Peptide Condensed DNA Helices

    PubMed Central

    DeRouchey, Jason E.; Rau, Donald C.

    2011-01-01

    In spermatogenesis, chromatin histones are replaced by arginine-rich protamines to densely compact DNA in sperm heads. Tight packaging is considered necessary to protect the DNA from damage. To better understand the nature of the forces condensing protamine-DNA assemblies and their dependence on amino acid content, the effect of neutral and negatively charged amino acids on DNA-DNA intermolecular forces was studied using model peptides containing six arginines. We have previously observed that the neutral amino acids in salmon protamine decrease the net attraction between protamine-DNA helices compared with the equivalent homo-arginine peptide. Using osmotic stress coupled with x-ray scattering, we have investigated the component attractive and repulsive forces that determine the net attraction and equilibrium interhelical distance as a function of the chemistry, position, and number of the amino acid inserted. Neutral amino acids inserted into hexa-arginine increase the short range repulsion while only slightly affecting longer range attraction. The amino acid content alone of salmon protamine is enough to rationalize the forces that package DNA in sperm heads. Inserting a negatively charged amino acid into hexa-arginine dramatically weakens the net attraction. Both of these observations have biological implications for protamine-DNA packaging in sperm heads. PMID:21994948

  14. Design and Synthesis of Triangulated DNA Origami Trusses.

    PubMed

    Matthies, Michael; Agarwal, Nayan P; Schmidt, Thorsten L

    2016-03-09

    DNA nanotechnology offers unique control over matter on the nanoscale. Here, we extend the DNA origami method to cover a range of wireframe truss structures composed of equilateral triangles, which use less material per volume than standard multiple-helix bundles. From a flat truss design, we folded tetrahedral, octahedral, or irregular dodecahedral trusses by exchanging few connector strands. Other than standard origami designs, the trusses can be folded in low-salt buffers that make them compatible with cell culture buffers. The structures also have defined cavities that may in the future be used to precisely position functional elements such as metallic nanoparticles or enzymes. Our graph routing program and a simple design pipeline will enable other laboratories to make use of this valuable and potent new construction principle for DNA-based nanoengineering.

  15. A fluorescence-based analysis of aristolochic acid-derived DNA adducts.

    PubMed

    Romanov, Victor; Sidorenko, Victoria; Rosenquist, Thomas A; Whyard, Terry; Grollman, Arthur P

    2012-08-01

    Aristolochic acids (AAs), major components of plant extracts from Aristolochia species, form (after metabolic activation) pro-mutagenic DNA adducts in renal tissue. The DNA adducts can be used as biomarkers for studies of AA toxicity. Identification of these adducts is a complicated and time-consuming procedure. We present here a fast, nonisotopic, fluorescence-based assay for the detection of AA-DNA adducts in multiple samples. This approach allows analysis of AA adducts in synthetic DNA with known nucleotide composition and analysis of DNA adducts formed from chemically diverse AAs in vitro. The method can be applied to compare AA-DNA adduct formation in cells and tissues.

  16. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  17. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  18. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  19. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  20. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools.

  1. Human liver apolipoprotein B-100 cDNA: complete nucleic acid and derived amino acid sequence.

    PubMed Central

    Law, S W; Grant, S M; Higuchi, K; Hospattankar, A; Lackner, K; Lee, N; Brewer, H B

    1986-01-01

    Human apolipoprotein B-100 (apoB-100), the ligand on low density lipoproteins that interacts with the low density lipoprotein receptor and initiates receptor-mediated endocytosis and low density lipoprotein catabolism, has been cloned, and the complete nucleic acid and derived amino acid sequences have been determined. ApoB-100 cDNAs were isolated from normal human liver cDNA libraries utilizing immunoscreening as well as filter hybridization with radiolabeled apoB-100 oligodeoxynucleotides. The apoB-100 mRNA is 14.1 kilobases long encoding a mature apoB-100 protein of 4536 amino acids with a calculated amino acid molecular weight of 512,723. ApoB-100 contains 20 potential glycosylation sites, and 12 of a total of 25 cysteine residues are located in the amino-terminal region of the apolipoprotein providing a potential globular structure of the amino terminus of the protein. ApoB-100 contains relatively few regions of amphipathic helices, but compared to other human apolipoproteins it is enriched in beta-structure. The delineation of the entire human apoB-100 sequence will now permit a detailed analysis of the conformation of the protein, the low density lipoprotein receptor binding domain(s), and the structural relationship between apoB-100 and apoB-48 and will provide the basis for the study of genetic defects in apoB-100 in patients with dyslipoproteinemias. PMID:3464946

  2. Single-Molecule Measurements of Synthesis by DNA Polymerase with Base-Pair Resolution

    NASA Astrophysics Data System (ADS)

    Christian, Thomas; Romano, Louis; Rueda, David

    2010-03-01

    The catalytic mechanism of DNA polymerases involves multiple steps that precede and follow the transfer of a nucleotide to the 3'-hydroxyl of the growing DNA chain. Here we report a single-molecule approach to monitor the movement of E. coli DNA polymerase I (Klenow fragment) on a DNA template during DNA synthesis with single base-pair resolution. As each nucleotide is incorporated, the single-molecule F"orster resonance energy transfer intensity drops in discrete steps to values consistent with single nucleotide incorporations. Purines and pyrimidines are incorporated with comparable rates. A mismatched primer-template junction exhibits dynamics consistent with the primer moving into the exonuclease domain, which was used to determine the fraction of primer-termini bound to the exonuclease and polymerase sites. Most interestingly, we observe a structural change following the incorporation of a correctly paired nucleotide, consistent with transient movement of the polymerase past the pre-insertion site or a conformational change in the polymerase. This may represent a previously unobserved step in the mechanism of DNA synthesis that could be part of the proofreading process.

  3. Synthesis of DNA Oligodeoxynucleotides Containing Site-Specific 1,3-Butadiene- Deoxyadenosine Lesions

    PubMed Central

    Wickramaratne, Susith; Seiler, Christopher L.

    2016-01-01

    Post-oligomerization synthesis is a useful technique for preparing site-specifically modified DNA oligomers. This approach involves site-specific incorporation of inherently reactive halogenated nucleobases into DNA strands using standard solid phase synthesis, followed by post-oligomerization nucleophilic aromatic substitution (SNAr) reactions with carcinogen-derived synthons. In these reactions, the inherent reactivities of DNA and carcinogen-derived species are reversed: the modified DNA nucleobase acts as an electrophile, while the carcinogen-derived species acts as a nucleophile. In the present protocol, we describe the use of the post-oligomerization approach to prepare DNA strands containing site- and stereospecific N6-adenine and N1, N6-adenine adducts induced by epoxide metabolites of the known human and animal carcinogen, 1,3-butadiene (BD). The resulting oligomers containing site specific, structurally defined DNA adducts can be used in structural and biological studies to reveal the roles of specific BD adducts in carcinogenesis and mutagenesis. PMID:26344227

  4. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

    PubMed Central

    Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

    2016-01-01

    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

  5. Mechanism of action of nalidixic acid: Purification of Escherichia coli nalA gene product and its relationship to DNA gyrase and a novel nicking-closing enzyme

    PubMed Central

    Sugino, Akio; Peebles, Craig L.; Kreuzer, Kenneth N.; Cozzarelli, Nicholas R.

    1977-01-01

    A target protein for nalidixic and oxolinic acids in Escherichia coli, the nalA gene product (Pnal), was purified to homogeneity as judged by gel electrophoresis, using an in vitro complementation assay. It is a dimer of identical 110,000-dalton subunits. A polypeptide of this molecular weight is uniquely induced by a λ nalA transducing phage, thereby showing that the purified Pnal is a product of the nalA gene. Nalidixic and oxolinic acids inhibit DNA gyrase activity and induce formation of a relaxation complex analogue. Treatment of the complex with sodium dodecyl sulfate causes a doublestrand break in the DNA substrate and the resulting linear molecule seems covalently bound to protein. Complex formation, unlike the introduction of supertwists, does not require ATP or relaxed circular DNA and is insensitive to novobiocin. DNA gyrase from a strain with a nalA mutation conferring drug resistance (nalAr) is 1/100 as sensitive to oxolinic and nalidixic acids with respect to inhibition of supertwisting and induction of the pre-linearization complex. Addition of Pnal restores drug sensitivity and stimulates DNA gyrase activity. DNA gyrase preparations and Pnal catalyze a third reaction sensitive to nalidixic and oxolinic acids, the ATP-independent relaxation of supertwister DNA. Relaxation by gyrase from nalAr cells is drug resistant. The nicking-closing activity is distinct from E. coli ω protein in several properties, including the ability to relax positively supertwisted DNA. We postulate that the nalA gene product occurs in two molecular forms, as Pnal and as a gyrase component. Both forms catalyze nicking-closing, and inhibition of this activity by nalidixic and oxolinic acids may account for the inhibition of DNA synthesis by these drugs. Images PMID:200930

  6. Structural Basis of High-Fidelity DNA Synthesis by Yeast DNA Polymerase δ

    SciTech Connect

    Swan, M.; Johnson, R; Prakash, L; Prakash, S; Aggarwal, A

    2009-01-01

    DNA polymerase ? (Pol ?) has a crucial role in eukaryotic replication. Now the crystal structure of the yeast DNA Pol ? catalytic subunit in complex with template primer and incoming nucleotide is presented at 2.0-A resolution, providing insight into its high fidelity and a framework to understand the effects of mutations involved in tumorigenesis.

  7. Synthesis of parvovirus H-1 replicative form from viral DNA by DNA polymerase gamma.

    PubMed Central

    Kollek, R; Goulian, M

    1981-01-01

    The initial event in the replication cycle of parvovirus H-1 is conversion of the single-stranded linear viral DNA to the double-stranded linear replicative form. We describe here detection of an activity in uninfected cell extracts that carries out this reaction. The activity was purified and identified as DNA polymerase gamma. Images PMID:6947222

  8. Protein Synthesis with Ribosomes Selected for the Incorporation of β-Amino Acids.

    PubMed

    Maini, Rumit; Chowdhury, Sandipan Roy; Dedkova, Larisa M; Roy, Basab; Daskalova, Sasha M; Paul, Rakesh; Chen, Shengxi; Hecht, Sidney M

    2015-06-16

    In an earlier study, β³-puromycin was used for the selection of modified ribosomes, which were utilized for the incorporation of five different β-amino acids into Escherichia coli dihydrofolate reductase (DHFR). The selected ribosomes were able to incorporate structurally disparate β-amino acids into DHFR, in spite of the use of a single puromycin for the selection of the individual clones. In this study, we examine the extent to which the structure of the β³-puromycin employed for ribosome selection influences the regio- and stereochemical preferences of the modified ribosomes during protein synthesis; the mechanistic probe was a single suppressor tRNA(CUA) activated with each of four methyl-β-alanine isomers (1-4). The modified ribosomes were found to incorporate each of the four isomeric methyl-β-alanines into DHFR but exhibited a preference for incorporation of 3(S)-methyl-β-alanine (β-mAla; 4), i.e., the isomer having the same regio- and stereochemistry as the O-methylated β-tyrosine moiety of β³-puromycin. Also conducted were a selection of clones that are responsive to β²-puromycin and a demonstration of reversal of the regio- and stereochemical preferences of these clones during protein synthesis. These results were incorporated into a structural model of the modified regions of 23S rRNA, which included in silico prediction of a H-bonding network. Finally, it was demonstrated that incorporation of 3(S)-methyl-β-alanine (β-mAla; 4) into a short α-helical region of the nucleic acid binding domain of hnRNP LL significantly stabilized the helix without affecting its DNA binding properties.

  9. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  10. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  11. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  12. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  13. Inhibition of macrophage DNA synthesis by immunomodulators. II. Characterization of the suppression by muramyl dipeptide or lipopolysaccharide (/sup 3/H)thymidine incorporation into macrophages

    SciTech Connect

    Nagao, S.; Ikegami, S.; Tanaka, A.

    1984-12-01

    Guinea pig peritoneal exudate macrophages actively incorporated (/sup 3/H)thymidine into trichloroacetic acid-insoluble fraction in vitro. The incorporation of (/sup 3/H)thymidine was almost completely inhibited by aphidicolin, an inhibitor of DNA polymerase alpha and an autoradiograph showed heavy labeling in nuclei of 15% of macrophage populations. These results indicate that the observed thymidine incorporation was due to a nuclear DNA synthesis. The (/sup 3/H)thymidine incorporation was markedly suppressed when macrophages were activated by immunoadjuvants such as muramyl dipeptide (MDP) or bacterial lipopolysaccharide (LPS). The suppression of (/sup 3/H)thymidine incorporation by MDP was neither due to the decrease in thymidine transport through the cell membrane, nor due to dilution by newly synthesized cold thymidine. An autoradiograph revealed that MDP markedly decreased the number of macrophages the nuclei of which were labeled by (/sup 3/H)thymidine. These results suggest that the suppression of (/sup 3/H)thymidine incorporation by the immunoadjuvants reflects a true inhibition of DNA synthesis. The inhibition of DNA synthesis by MDP was also observed in vivo. Further, it was strongly suggested that the inhibition was not caused by some mediators, such as prostaglandin E2, released from macrophages stimulated by the immunoadjuvants but caused by a direct triggering of the adjuvants at least at the early stage of activation. Cyclic AMP appears to be involved in the inhibitory reaction.

  14. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI

    SciTech Connect

    Vieira, P.; De Waal-Malefyt, R.; Dang, M.N.; Johnson, K.E.; Kastelein, R.; Fiorentino, D.F.; DeVries, J.E.; Roncarolo, M.G.; Mosmann, T.R.; Moore, K.W. )

    1991-02-15

    The authors demonstrated the existence of human cytokine synthesis inhibitory factor (DSIF) (interleukin 10 (IL-10)). cDNA clones encoding human IL-10 (hIL-10) were isolated from a tetanus toxin-specific human T-cell clone. Like mouse IL-10, hIL-10 exhibits strong DNA and amino acid sequence homology to an open reading frame in the Epstein-Barr virus, BDRFL. hIL-10 and the BCRFI product inhibit cytokine synthesis by activated human peripheral blood mononuclear cells and by a mouse Th1 clone. Both hIL-10 and mouse IL-10 sustain the viability of a mouse mast cell line in culture, but BCRFI lacks comparable activity in this way, suggesting that BCRFI may have conserved only a subset of hIL-10 activities.

  15. In vitro DNA dependent synthesis of globin RNA sequences from erythroleukemic cell chromatin.

    PubMed

    Reff, M E; Davidson, R L

    1979-01-01

    Murine erythroleukemic cells in culture accumulate cytoplasmic globin mRNA during differentiation induced by dimethyl sulfoxide (DMSO)1. Chromatin was prepared from DMSO induced erythroleukemic cells that were transcribing globin RNA in order to determine whether in vitro synthesis of globin RNA sequences was possible from chromatin. RNA was synthesized in vitro using 5-mercuriuridine triphosphate and exogenous Escheria coli RNA polymerase. Newly synthesized mercurated RNA was purified from endogenous chromatin associated RNA by affinity chromatography on a sepharose sulfhydryl column, and the globin RNA sequence content of the mercurated RNA was assayed by hybridization to cDNA globin. The synthesis of globin RNA sequences was shown to occur and to be sensitive to actinomycin and rifampicin and insensitive to alpha-amanitin. In contrast, synthesis of globin RNA sequence synthesis was not detected in significant amounts from chromatin prepared from uninduced erythroleukemic cells, nor from uninduced cell chromatin to which globin RNA was added prior to transcription. Isolated RNA:cDNA globin hybrids were shown to contain mercurated RNA by affinity chromatography. These results indicated that synthesis of globin RNA sequences from chromatin can be performed by E. coli RNA polymerase.

  16. Efficient synthesis of supercoiled M13 DNA molecule containing a site specifically placed psoralen adduct and its use as a substrate for DNA replication

    SciTech Connect

    Kodadek, T.; Gamper, H.

    1988-05-03

    The authors report a simple method for the in vitro synthesis of large quantities of site specifically modified DNA. The protocol involves extension of an oligonucleotide primer annealed to M13 single-stranded DNA using part of the T4 DNA polymerase holoenzyme. The resulting nicked double-stranded circles are ligated and supercoiled in the same tube, producing good yields of form I DNA. When the oligonucleotide primer is chemically modified, the resultant product contains a site-specific lesion. In this study, they report the synthesis of an M13 mp19 form I DNA which contains a psoralen monoadduct or cross-link at the KpnI site. They demonstrate the utility of these modified substrates by assessing the ability of the bacteriophage T4 DNA replication complex to bypass the damage and show that the psoralen monoadduct poses a severe block to the holoenzyme when attached to the template strand.

  17. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  18. Endotoxin or cytokines attenuate ozone-induced DNA synthesis in rat nasal transitional epithelium

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R. )

    1992-06-01

    Pretreatment of rats with endotoxin (E), a potent inducer of tumor necrosis factor alpha (TNF), and interleukin 1 beta (IL 1), or a combination of TNF and IL1, has been shown to increase levels of lung antioxidant enzymes and protect against pulmonary toxicity associated with hyperoxia. Inhalation of ozone (O3) induces cell injury, followed by increased DNA synthesis, cell proliferation, and secretory cell metaplasia in rat nasal transitional epithelium (NTE). This study was designed to test the effects of E, TNF, and IL1 pretreatment on acute O3-induced NTE cell injury as measured by changes in NTE cell DNA synthesis. Rats were exposed to either 0.8 ppm O3 or air for 6 hr in whole-body inhalation chambers. Immediately before exposure, rats in each group were injected intraperitoneally (ip) with either saline alone or saline containing E, TNF, IL1, or both TNF and IL1. Eighteen hours postexposure, rats were injected ip with bromodeoxyuridine to label cells undergoing DNA synthesis and were euthanized 2 hr later. NTE was processed for light microscopy and immunochemically stained to identify cells that had incorporated BrdU into nuclear DNA. The number of BrdU-labeled NTE nuclei per millimeter of basal lamina was quantitated. There were no significant differences in the number of BrdU-labeled NTE nuclei in air-exposed rats that were injected with E, TNF, IL1, or TNF/IL1 compared with those in saline-injected, air-exposed controls. Rats that were injected with saline and exposed to O3 had approximately 10 times the number of BrdU-labeled NTE nuclei than saline-injected, air-exposed control rats. O3 exposure also induced a significant increase in labeled nuclei in rats that were pretreated with TNF alone. In contrast, pretreatment with E, IL1, or TNF/IL1 attenuated the O3-induced increase in NTE DNA synthesis.

  19. Design, synthesis and selection of DNA-encoded small-molecule libraries.

    PubMed

    Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A

    2009-09-01

    Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.

  20. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  1. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  2. [DNA reduplication cycle during chromosome polytenization in the salivary gland cells of Chironomus thummi larvae. III. The determination of the duration of the DNA synthesis period].

    PubMed

    Gundrina, L I; Sherudilo, A I; Mitina, R L

    1984-08-01

    The duration of DNA synthesis in the salivary gland cells of Chironomus thummi larvae of the IV instar was determined by means of autoradiography and cytophotometry. Cells of different levels of ploidy differ in the duration of their DNA synthesis period. The tS of 2(10)c and 2(11)c cells was equal to 17 and 22 hours, respectively. The doubling of DNA content of the chironomid salivary gland cells leads to a 1.3 time increase in the duration of S-phase.

  3. Effect of the amino acid substitution in the DNA-binding domain of the Fur regulator on production of pyoverdine.

    PubMed

    Valešová, Renáta; Palyzová, Andrea; Marešová, Helena; Stěpánek, Václav; Babiak, Peter; Kyslík, Pavel

    2013-07-01

    The ferric uptake regulator gene (fur), its promoter region and Fur box of pvdS gene involved in siderophore-mediated iron uptake system were sequenced in the parent strain Pseudomonas aeruginosa PAO1 and in the fur mutant FPA121 derived from the strain PAO1. We identified the gene fur 179 bearing a novel, single-point mutation that changed the amino acid residue Gln60Pro in the DNA-binding domain of the Fur protein. The synthesis of pyoverdine was studied in cultures of the strains PAO1 and FPA121 grown in iron-deplete and iron-replete (60 μmol/L FeIII) medium. The amino acid replacement in the regulatory Fur protein is responsible for the overproduction of pyoverdine in iron-deplete and iron-replete medium. No mutation was identified in the Fur box of the gene pvdS.

  4. DNA Origami Rotaxanes: Tailored Synthesis and Controlled Structure Switching.

    PubMed

    Powell, John T; Akhuetie-Oni, Benjamin O; Zhang, Zhao; Lin, Chenxiang

    2016-09-12

    Mechanically interlocked supramolecular assemblies are appealing building blocks for creating functional nanodevices. Herein, we describe the multistep assembly of large DNA origami rotaxanes that are capable of programmable structural switching. We validated the topology and structural integrity of these rotaxanes by analyzing the intermediate and final products of various assembly routes by electrophoresis and electron microscopy. We further analyzed two structure-switching behaviors of our rotaxanes, which are both mediated by DNA hybridization. In the first mechanism, the translational motion of the macrocycle can be triggered or halted at either terminus. In the second mechanism, the macrocycle can be elongated after completion of the rotaxane assembly, giving rise to a unique structure that is otherwise difficult to access.

  5. Inhibition of N-methyl-N-nitrosourea-induced mutagenicity and DNA methylation by ellagic acid.

    PubMed Central

    Dixit, R; Gold, B

    1986-01-01

    Ellagic acid, a naturally occurring plant phenol, inhibits the activity of the direct-acting mutagen N-methyl-N-nitrosourea (MeNU) in Salmonella typhimurium TA100. Ellagic acid at 0.10, 0.25, 0.50, and 1.00 mM inhibited the mutagenicity of MeNU (0.40 mM) by 3%, 13%, 45%, and 60%, respectively. Ellagic acid (3 mM) also inhibited the mutagenic activity of N,N-dimethylnitrosamine (25-200 mM) in the presence of pyrazole-induced rat liver fraction S-9. The effect of ellagic acid on DNA methylation was studied by incubating 0, 0.72, 1.32, 2.64, and 6.60 mM ellagic acid with DNA (0.9 mM nucleotide) and [3H]MeNU (0.66 mM). HPLC analysis of DNA hydrolysates showed that ellagic acid caused a dose-dependent 36-84% decrease in O6-methylguanine but only a 20% decrease in the 7-methylguanine adduct. Under conditions where methylation at the O6 position of guanine in double-stranded DNA was inhibited 65% by ellagic acid, no significant inhibition of either O6- or 7-methylguanine formation was detected in single-stranded DNA. Affinity-binding studies revealed that [3H]ellagic acid binds equally to double-stranded or single-stranded DNA but that poly(dA X dT) binds 1.5 times as much ellagic acid as does poly(dG X dC). The binding of ellagic acid to DNA is dependent on the concentration of both ellagic acid and DNA. The specific inhibition of O6-methylguanine formation only in double-stranded DNA and the relatively low inhibition of 7-methylguanine formation rule out the possibility that ellagic acid prevents DNA alkylation by scavenging the electrophilic intermediate generated in the hydrolysis of MeNU. The results suggest that ellagic acid inhibition of MeNU-induced mutagenicity is due to specific inhibition of methylation at the O6 position of guanine through an ellagic acid-duplex DNA affinity-binding mechanism. PMID:3464940

  6. First total synthesis and antileishmanial activity of (Z)-16-methyl-11-heptadecenoic acid, a new marine fatty acid from the sponge Dragmaxia undata

    PubMed Central

    Carballeira, Néstor M.; Montano, Nashbly; Cintrón, Gabriel A.; Márquez, Carmary; Rubio, Celia Fernández; Prada, Christopher Fernández; Balaña-Fouce, Rafael

    2010-01-01

    The first total synthesis for the (Z)-16-methyl-11-heptadecenoic acid, a novel fatty acid from the sponge Dragmaxia undata, was accomplished in seven steps and in a 44% overall yield. The use of (trimethylsilyl)acetylene was key in the synthesis. Based on a previous developed strategy in our laboratory the best synthetic route towards the title compound was first acetylide coupling of (trimethylsilyl)acetylene to the long-chain protected 10-bromo-1-decanol followed by a second acetylide coupling to the short-chain 1-bromo-4-methylpentane, which resulted in higher yields. Complete spectral data is also presented for the first time for this recently discovered fatty acid and the cis double bond stereochemistry of the natural acid was established. The title compound displayed antiprotozoal activity against Leishmania donovani (IC50 = 165.5 ± 23.4 µM) and inhibited the leishmania DNA topoisomerase IB enzyme (LdTopIB) with an IC50 = 62.3 ± 0.7 µM. PMID:21129369

  7. Method for nucleic acid hybridization using single-stranded DNA binding protein

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1996-01-01

    Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.

  8. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    PubMed

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-06

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs.

  9. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  10. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailing description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  11. Synthesis and DNA interaction of a mixed proflavine-phenanthroline Tröger base.

    PubMed

    Baldeyrou, Brigitte; Tardy, Christelle; Bailly, Christian; Colson, Pierre; Houssier, Claude; Charmantray, Franck; Demeunynck, Martine

    2002-04-01

    We report the synthesis of an asymmetric Tröger base containing the two well characterised DNA binding chromophores, proflavine and phenanthroline. The mode of interaction of the hybrid molecule was investigated by circular and linear dichroism experiments and a biochemical assay using DNA topoisomerase I. The data are compatible with a model in which the proflavine moiety intercalates between DNA base pairs and the phenanthroline ring occupies the DNA groove. DNase I cleavage experiments were carried out to investigate the sequence preference of the hybrid ligand and a well resolved footprint was detected at a site encompassing two adjacent 5'-GTC.5-GAC triplets. The sequence preference of the asymmetric molecule is compared to that of the symmetric analogues.

  12. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  13. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  14. DNA Dispose, but Subjects Decide. Learning and the Extended Synthesis.

    PubMed

    Lindholm, Markus

    Adaptation by means of natural selection depends on the ability of populations to maintain variation in heritable traits. According to the Modern Synthesis this variation is sustained by mutations and genetic drift. Epigenetics, evodevo, niche construction and cultural factors have more recently been shown to contribute to heritable variation, however, leading an increasing number of biologists to call for an extended view of speciation and evolution. An additional common feature across the animal kingdom is learning, defined as the ability to change behavior according to novel experiences or skills. Learning constitutes an additional source for phenotypic variation, and change in behavior may induce long lasting shifts in fitness, and hence favor evolutionary novelties. Based on published studies, I demonstrate how learning about food, mate choice and habitats has contributed substantially to speciation in the canonical story of Darwin's finches on the Galapagos Islands. Learning cannot be reduced to genetics, because it demands decisions, which requires a subject. Evolutionary novelties may hence emerge both from shifts in allelic frequencies and from shifts in learned, subject driven behavior. The existence of two principally different sources of variation also prevents the Modern Synthesis from self-referring explanations.

  15. Synthesis, photochemical properties and DNA binding studies of dna cleaving agents based on chiral dipyridine dihydrodioxins salts

    NASA Astrophysics Data System (ADS)

    Shamaev, Alexei

    activated by UV-light. The mechanism of o-quinone release and intramolecular ET was studied in detail by methods of Ultrafast Transient Absortion Spectroscopy and supported by high-level quantum mechanical calculations. The binding properties of chiral intercalators based on PDHD to various DNA oligonucleotides were studied by various methods and DNA cleavage properties indicating strong binding and cleaving ability of the synthesized PDHDs. Also, a new method for synthesis of cyclohexa[e]pyrenes which possibly capable of intramolecular ET and electron transfer-oxidative stress (ET-OS) DNA cleavage was developed and partially accomplished.

  16. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  17. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.

    PubMed

    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu

    2012-12-11

    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.

  18. ORAL AND INTRAVENOUSLY ADMINISTERED AMINO ACIDS PRODUCE SIMILAR EFFECTS ON MUSCLE PROTEIN SYNTHESIS IN THE ELDERLY

    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.

    2011-01-01

    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  19. Development of artificial nucleic acid that recognizes a CG base pair in triplex DNA formation.

    PubMed

    Hari, Yoshiyuki

    2013-01-01

    An oligonucleotide that can form a triplex with double-stranded DNA is called a triplex-forming oligonucleotide (TFO). TFOs have gained considerable attention because of their potential as gene targeting tools. However, triplex DNA formation involves inherent problems for practical use. The most important problem is that natural nucleotides in TFO do not have sufficient affinity and base pair-selectivity to pyrimidine-purine base pair, like a CG or TA base pair, within dsDNA. This suggests that dsDNA region including a CG or TA base pair cannot be targeted. Therefore, artificial nucleotides, especially with non-natural nucleobases, capable of direct recognition of a CG or TA base pair via hydrogen bond formation have been developed; however, nucleotides with better selectivity and stronger affinity are necessary for implementing this dsDNA-targeting technology using TFOs. Under such a background, we considered that facile and efficient synthesis of various nucleobase derivatives in TFOs would be useful for finding an ideal nucleobase for recognition of a CG or TA base pair because detailed and rational exploration of nucleobase structures is facilitated. Recently, to develop a nucleobase recognizing a CG base pair, we have used post-elongation modification, i.e., modification after oligonucleotide synthesis, for the facile synthesis of nucleobase derivatives. This review mainly summarizes our recent findings on the development of artificial nucleobases and nucleotides for recognition of a CG base pair in triplexes formed between dsDNA and TFOs.

  20. Recent Advances in the Synthesis and Functions of Reconfigurable Interlocked DNA Nanostructures.

    PubMed

    Lu, Chun-Hua; Cecconello, Alessandro; Willner, Itamar

    2016-04-27

    Interlocked circular DNA nanostructures, e.g., catenanes or rotaxanes, provide functional materials within the area of DNA nanotechnology. Specifically, the triggered reversible reconfiguration of the catenane or rotaxane structures provides a means to yield new DNA switches and to use them as dynamic scaffolds for controlling chemical functions and positioning functional cargoes. The synthesis of two-ring catenanes and their switchable reconfiguration by pH, metal ions, or fuel/anti-fuel stimuli are presented, and the functions of these systems, as pendulum or rotor devices or as switchable catalysts, are described. Also, the synthesis of three-, five-, and seven-ring catenanes is presented, and their switchable reconfiguration using fuel/anti-fuel strands is addressed. Implementation of the dynamically reconfigured catenane structures for the programmed organization of Au nanoparticle (NP) assemblies, which allows the plasmonic control of the fluorescence properties of Au NP/fluorophore loads associated with the scaffold, and for the operation of logic gates is discussed. Interlocked DNA rotaxanes and their different synthetic approaches are presented, and their switchable reconfiguration by means of fuel/anti-fuel strands or photonic stimuli is described. Specifically, the use of the rotaxane as a scaffold to organize Au NP assemblies, and the control of the fluorescence properties with Au NP/fluorophore hybrids loaded on the rotaxane scaffold, are introduced. The future prospectives and challenges in the field of interlocked DNA nanostructures and the possible applications are discussed.

  1. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  2. Effect of metallic cations on the efficiency of DNA amplification. Implications for nucleic acid replication during early stages of life

    NASA Astrophysics Data System (ADS)

    Arribas, María; de Vicente, Aránzazu; Arias, Armando; Lázaro, Ester

    2005-04-01

    The process of catalysis of biochemical reactions has been essential since the first organic molecules appeared on Earth. As the complexity of the ensemble of primitive biomolecules was very low, primitive catalysts had necessarily to be very simple molecules or ions. The evolution of catalysts had to be in parallel with the evolution of the molecular species reacting. An example of this parallel evolution is nucleic acid polymerization. Synthesis of primitive short oligonucleotides could have been catalysed by metal ions either in solution or on the surface of minerals such as montmorillonite clays. Some oligonucleotides could start to function as templates for the synthesis of complementary copies and there is experimental evidence supporting the role also played by metal ions in this process. In later stages of evolution, a group of enzymatic proteins, nucleic acid polymerases, has been selected to catalyse nucleic acid replication. The presence of Mg2+ in the active centre of these enzymes suggests that evolution has preserved some of the primitive catalysts, including them as cofactors of more complex molecules. However, the reasons why Mg2+ was selected among other ions that possibly were present in primitive environments are unknown. In this paper we try to approach this question by analysing the amplification efficiency of the polymerase chain reaction of a DNA fragment in the presence of different metal ions. In some cases the conditions of the reaction have been displaced from optimum (by the presence of nucleotide imbalances and a suboptimal Mg2+concentration). The results obtained permit one to draw interesting conclusions about how some metallic cations can help replication to proceed in conditions of limited substrate availability, a circumstance that could have been frequent at prebiotic stages, when nucleic acid synthesis was dependent on the physico-chemical conditions of the environment.

  3. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  4. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  5. Nucleic acid chemistry in the organic phase: from functionalized oligonucleotides to DNA side chain polymers.

    PubMed

    Liu, Kai; Zheng, Lifei; Liu, Qing; de Vries, Jan Willem; Gerasimov, Jennifer Y; Herrmann, Andreas

    2014-10-08

    DNA-incorporating hydrophobic moieties can be synthesized by either solid-phase or solution-phase coupling. On a solid support the DNA is protected, and hydrophobic units are usually attached employing phosphoramidite chemistry involving a DNA synthesizer. On the other hand, solution coupling in aqueous medium results in low yields due to the solvent incompatibility of DNA and hydrophobic compounds. Hence, the development of a general coupling method for producing amphiphilic DNA conjugates with high yield in solution remains a major challenge. Here, we report an organic-phase coupling strategy for nucleic acid modification and polymerization by introducing a hydrophobic DNA-surfactant complex as a reactive scaffold. A remarkable range of amphiphile-DNA structures (DNA-pyrene, DNA-triphenylphosphine, DNA-hydrocarbon, and DNA block copolymers) and a series of new brush-type DNA side-chain homopolymers with high DNA grafting density are produced efficiently. We believe that this method is an important breakthrough in developing a generalized approach to synthesizing functional DNA molecules for self-assembly and related technological applications.

  6. On-Flow Synthesis of Co-Polymerizable Oligo-Microspheres and Application in ssDNA Amplification

    PubMed Central

    Lee, Se Hee; Lee, Jae Ha; Lee, Ho Won; Kim, Yang-Hoon; Jeong, Ok Chan; Ahn, Ji-Young

    2016-01-01

    We fabricated droplet-based microfluidic platform for copolymerizable microspheres with acrydite modified DNA probe. The copolymerizable 3-D polyacrylamide microspheres were successfully produced from microcontinuous-flow synthesis with on-channel solidification. DNA copolymerization activity, surface presentation and thermostability were assessed by using fluorescent labeled complementary probe. The binding performance was only visible on the surface area of oligo-microspheres. We show that the resulting oligo-microspheres can be directly integrated into a streamlined microsphere-PCR protocol for amplifying ssDNA. Our microspheres could be utilized as a potential material for ssDNA analysis such as DNA microarray and automatic DNA SELEX process. PMID:27447941

  7. Forks and combs and DNA: the synthesis of branched oligodeoxyribonucleotides.

    PubMed Central

    Horn, T; Urdea, M S

    1989-01-01

    Nucleoside phosphoramidite derivatives containing two protected primary hydroxyl functions have been incorporated into synthetic oligonucleotides as 'branching monomers'. With selective deprotection, multiple identical copies of an additional oligonucleotide can be incorporated to form fork- or comb-like structures for use as signal amplification materials in nucleic acid hybridization assays. Images PMID:2780317

  8. Site-Selective Binding of Nanoparticles to Double-Stranded DNA via Peptide Nucleic Acid "Invasion"

    SciTech Connect

    Stadler, A.L.; van der Lelie, D.; Sun, D.; Maye, M. M.; Gang, O.

    2011-04-01

    We demonstrate a novel method for by-design placement of nano-objects along double-stranded (ds) DNA. A molecular intercalator, designed as a peptide nucleic acid (PNA)-DNA chimera, is able to invade dsDNA at the PNA-side due to the hybridization specificity between PNA and one of the duplex strands. At the same time, the single-stranded (ss) DNA tail of the chimera, allows for anchoring of nano-objects that have been functionalized with complementary ssDNA. The developed method is applied for interparticle attachment and for the fabrication of particle clusters using a dsDNA template. This method significantly broadens the molecular toolbox for constructing nanoscale systems by including the most conventional not yet utilized DNA motif, double helix DNA.

  9. Iron chelators hydroxyurea and bathophenanthroline disulfonate inhibit DNA synthesis by different pathways.

    PubMed

    Alcaín, F J; Löw, H; Crane, F L; Navas, P

    1994-09-01

    We previously showed that thrombin-stimulated DNA synthesis in CCL 39 cells was inhibited by hydroxyurea (HU) and bathophenanthroline disulfonate (BPS) (Proc. Natl. Acad. Sci. USA, in press). A clear difference exists between these two inhibitors. Inhibition mediated by HU was immediate and must be present in the culture medium. BPS was equally effective when it was present in the medium or after preincubation, but it required at least 12 h to achieve maximal effect. The permeable form 1,10 phenanthroline had the same inhibitory effect in short-term incubations that BPS. Moreover, 1,10 phenanthroline was cytotoxic in long-term incubations indicating that the site of BPS inhibition was outside the cell. Further, long-term incubations with HU did not affect the ability of the cell to reinitiate DNA synthesis after removal of the chelator.

  10. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  11. [Synthesis of biflavones and their interaction with DNA].

    PubMed

    Zhang, Zun-Ting; Gao, Run-Li; Zhuang, Su-Kai

    2009-08-01

    To explore new biflavones, 7-hydroxy-8-hydroxymethyl-4'-methoxyisoflavone (1), (5, 7-dihydroxyflavone-8-yl)-(7'-hydroxy-4"-methoxyisoflavone-8'-yl)methane (2), bis(7-hydroxy-4'-methoxyflavone-8-yl) methane (3), bis(3', 5'-diisopropyl-7, 4'-dihydroxy-isoflavone-8-yl)methane (4), and bis(7-hydroxy-isoflavone-8-yl) methane (5) were designed and synthesized from chrysin, formononetin, 7, 4'-dihydroxy-3', 5'-diisopropyl-isoflavone and 7-hydroxy-isoflavone. Their structures were identified with IR, 1H NMR, 13C NMR and elemental analysis. The binding of 1-5 with DNA was studied with fluorescent spectroscopy. Compounds 2-5 showed higher binding affinity with DNA than 1. According to the Stern-Volmer equation, the binding constants of 2, 3 were determined at 35 degrees C and 25 degrees C respectively, they were Kq2 (25 degrees C) = 1.95 x 10(4) Lx mol(-1) and Kq2 (35 degrees C) = 1.67 x 10(4) L x mol(-1); Kq3 (25 degrees C) = 1.89 x 10(4) L x mol(-1) and Kq3 (35 degrees C) = 1.58 x 10(4) L x mol(-1). The quenching mechanism of 2, 3 was suggested as static quenching.

  12. [Synthesis of chrysin derivatives and their interaction with DNA].

    PubMed

    Zhang, Zun-Ting; Chen, Li-Li

    2007-05-01

    Using chrysin as a leading compound, intermediate 5, 7-dihydroxy-6, 8-bis (hydroxymethyl) flavone (1) was synthesized by hydroxymethylation. The intermediate reacted with different alcohols to afford 5, 7-dihydroxy-6, 8-bis ( methoxymethyl) flavone (2), 6, 8-bis (ethoxymethyl) -5, 7dihydroxyflavone (3), 6, 8-bis-(butoxymethyl)-5, 7-dihydroxyflavone (4), 6, 8-bis (pentyloxymethyl) -5,7-dihydroxy flavone (5) and 6, 8-bis-(ethoxymethyl) -5-hydroxy-7-methoxyflavone (6). These compounds were characterized by IR, 1H NMR, 13C NMR and element analysis. The crystal structure of 6 was determined by X-ray crystal diffraction. The interaction of the derivatives with CT-DNA was studied by fluorescent spectroscopy. According to the Stern-Volmer equation, the quenching constants of the compounds 1 - 4 were measured, separately, they were K(q1) = 9.71 x 10(3) L x mol(-1), K(q2) = 2.25 x 10(4) L x mol(-1), K(q3) = 1.03 x 10(4) L x mol(-1) and K(q4) = 7.96 x 10(3) L x mol(-1). Compounds 1-4 showed higher binding affinity with DNA than chrysin did. The results provided the experimental basis for developing a more effective flavonoid and worthing further thoroughly study.

  13. Identification of polymerase and processivity inhibitors of vaccinia DNA synthesis using a stepwise screening approach

    PubMed Central

    Silverman, Janice Elaine Y.; Ciustea, Mihai; Shudofsky, Abigail M. Druck; Bender, Florent; Shoemaker, Robert H.; Ricciardi, Robert P.

    2008-01-01

    Nearly all DNA polymerases require processivity factors to ensure continuous incorporation of nucleotides. Processivity factors are specific for their cognate DNA polymerases. For this reason, the vaccinia DNA polymerase (E9) and the proteins associated with processivity (A20 and D4) are excellent therapeutic targets. In this study, we show the utility of stepwise rapid plate assays that i) screen for compounds that block vaccinia DNA synthesis, ii) eliminate trivial inhibitors, e.g. DNA intercalators, and iii) distinguish whether inhibitors are specific for blocking DNA polymerase activity or processivity. The sequential plate screening of 2,222 compounds from the NCI Diversity Set library yielded a DNA polymerase inhibitor (NSC 55636) and a processivity inhibitor (NSC 123526) that were capable of reducing vaccinia viral plaques with minimal cellular cytotoxicity. These compounds are predicted to block cellular infection by the smallpox virus, variola, based on the very high sequence identity between A20, D4 and E9 of vaccinia and the corresponding proteins of variola. PMID:18621425

  14. The Foundry: the DNA synthesis and construction Foundry at Imperial College

    PubMed Central

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-01-01

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  15. Quercetin-Iron Complex: Synthesis, Characterization, Antioxidant, DNA Binding, DNA Cleavage, and Antibacterial Activity Studies.

    PubMed

    Raza, Aun; Xu, Xiuquan; Xia, Li; Xia, Changkun; Tang, Jian; Ouyang, Zhen

    2016-11-01

    Quercetin-iron (II) complex was synthesized and characterized by elemental analysis, ultraviolet-visible spectrophotometry, fourier transform infrared spectroscopy, mass spectrometry, proton nuclear magnetic resonance spectroscopy, thermogravimetry and differential scanning calorimetry, scanning electron micrography and molar conductivity. The low molar conductivity value investigates the non-electrolyte nature of the complex. The elemental analysis and other physical and spectroscopic methods reveal the 1:2 stoichiometric ratio (metal:ligand) of the complex. Antioxidant study of the quercetin and its metal complex against 2, 2-di-phenyl-1-picryl hydrazyl radical showed that the complex has much more radical scavenging activity than free quercetin. The interaction of quercetin-iron (II) complex with DNA was determined using ultraviolet visible spectra, fluorescence spectra and agarose gel electrophoresis. The results showed that quercetin-iron (II) complex can intercalate moderately with DNA, quench a strong intercalator ethidium bromide and compete for the intercalative binding sites. The complex showed significant cleavage of pBR 322 DNA from supercoiled form to nicked circular form and these cleavage effects were dose-dependent. Moreover, the mechanism of DNA cleavage indicated that it was an oxidative cleavage pathway. These results revealed the potential nuclease activity of complex to cleave DNA. In addition, antibacterial activity of complex on E.coli and S. aureus was also investigated. The results showed that complex has higher antibacterial activity than ligand.

  16. Rutin-Nickel Complex: Synthesis, Characterization, Antioxidant, DNA Binding, and DNA Cleavage Activities.

    PubMed

    Raza, Aun; Bano, Shumaila; Xu, Xiuquan; Zhang, Rong Xian; Khalid, Haider; Iqbal, Furqan Muhammad; Xia, Changkun; Tang, Jian; Ouyang, Zhen

    2016-12-17

    The rutin-nickel (II) complex (RN) was synthesized and characterized by elemental analysis, UV-visible spectroscopy, IR, mass spectrometry, (1)H NMR, TG-DSC, SEM, and molar conductivity. The low molar conductivity value investigates the non-electrolyte nature of the complex. The elemental analysis and other physical and spectroscopic methods reveal the 1:2 stoichiometric ratio (metal/ligand) of the complex. An antioxidant study of rutin and its metal complex against DPPH radical showed that the complex has more radical scavenging activity than free rutin. The interaction of complex RN with DNA was determined using fluorescence spectra and agarose gel electrophoresis. The results showed that RN can intercalate moderately with DNA, quench a strong intercalator ethidium bromide (EB), and compete for the intercalative binding sites. The complex showed significant cleavage of pBR 322 DNA from supercoiled form (SC) to nicked circular form (NC), and these cleavage effects were dose-dependent. Moreover, the mechanism of DNA cleavage indicated that it was a hydrolytic cleavage pathway. These results revealed the potential nuclease activity of the complex to cleave DNA.

  17. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).

    PubMed

    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

    2013-04-01

    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  18. Nucleic acid (cDNA) and amino acid sequences of the maize endosperm protein glutelin-2.

    PubMed Central

    Prat, S; Cortadas, J; Puigdomènech, P; Palau, J

    1985-01-01

    The cDNA coding for a glutelin-2 protein from maize endosperm has been cloned and the complete amino acid sequence of the protein derived for the first time. An immature maize endosperm cDNA bank was screened for the expression of a beta-lactamase:glutelin-2 (G2) fusion polypeptide by using antibodies against the purified 28 kd G2 protein. A clone corresponding to the 28 kd G2 protein was sequenced and the primary structure of this protein was derived. Five regions can be defined in the protein sequence: an 11 residue N-terminal part, a repeated region formed by eight units of the sequence Pro-Pro-Pro-Val-His-Leu, an alternating Pro-X stretch 21 residues long, a Cys rich domain and a C-terminal part rich in Gln. The protein sequence is preceded by 19 residues which have the characteristics of the signal peptide found in secreted proteins. Unlike zeins, the main maize storage proteins, 28 kd glutelin-2 has several homologous sequences in common with other cereal storage proteins. Images PMID:3839076

  19. Gab1 mediates neurite outgrowth, DNA synthesis, and survival in PC12 cells.

    PubMed

    Korhonen, J M; Saïd, F A; Wong, A J; Kaplan, D R

    1999-12-24

    The Gab1-docking protein has been shown to regulate phosphatidylinositol 3-kinase PI3K activity and potentiate nerve growth factor (NGF)-induced survival in PC12 cells. Here, we investigated the potential of Gab1 to induce neurite outgrowth and DNA synthesis, two other important aspects of NGF-induced neuronal differentiation of PC12 cells and NGF-independent survival. We generated a recombinant adenovirus encoding hemagglutinin (HA)-epitope-tagged Gab1 and expressed this protein in PC12 cells. HA-Gab1 was constitutively tyrosine-phosphorylated in PC12 cells and induced the phosphorylation of Akt/protein kinase B and p44/42 mitogen-activated protein kinase. HA-Gab1-stimulated a 10-fold increase in neurite outgrowth in the absence of NGF and a 5-fold increase in NGF-induced neurite outgrowth. HA-Gab1 also stimulated DNA synthesis and caused NGF-independent survival in PC12 cells. Finally, we found that HA-Gab1-induced neuritogenesis was completely suppressed by pharmacological inhibition of mitogen-activated protein kinase kinase (MEK) activity and 50% suppressed by inhibition of PI3K activity. In contrast, HA-Gab1-stimulated cell survival was efficiently suppressed only by inhibition of both PI3K and MEK activities. These results indicate that Gab1 is capable of mediating differentiation, DNA synthesis, and cell survival and uses both PI3K and MEK signaling pathways to achieve its effects.

  20. Synthesis of homogeneous glycopeptides and their utility as DNA condensing agents.

    PubMed

    Collard, W T; Evers, D L; McKenzie, D L; Rice, K G

    2000-01-12

    Two glycopeptides were synthesized by attaching purified glycosylamines (N-glycans) to a 20 amino acid peptide. Triantennary and Man9 Boc-tyrosinamide N-glycans were treated with trifluoroacetic acid to remove the Boc group and expose a tyrosinamide amine. The amine group was coupled with iodoacetic acid to produce N-iodoacetyl-oligosaccharides. These were reacted with the sulfhydryl group of a cysteine-containing peptide (CWK18), resulting in the formation of glycopeptides in good yield that were characterized by 1H NMR and ESIMS. Both glycopeptides were able to bind to plasmid DNA and form DNA condensates of approximately 110 nm mean diameter with zeta potential of +31 mV. The resulting homogeneous glycopeptide DNA condensates will be valuable as receptor-mediated gene-delivery agents.

  1. [DNA synthesis inhibition test of INAH by cultured human fibroblasts].

    PubMed

    Nishio, K; Yanagisawa, K

    1986-03-20

    The most commonly used screening test of carcinogens is the Ames test. But this system occasionally shows false positive and false negative. Painter's method is one which has been developed to minimize false results. Now we test by Painter's method isonicotinic acid hydrazide, which shows negative in the Ames test but positive in an animal test. INAH showed positive by Painter's method. More chemicals are now under study for their carcinogenicity by Painter's method.

  2. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  3. Unscheduled DNA synthesis in rat pleural mesothelial cells treated with mineral fibres.

    PubMed

    Renier, A; Lévy, F; Pillière, F; Jaurand, M C

    1990-08-01

    Unscheduled DNA synthesis (UDS) was studied in confluent rat pleural mesothelial cells (RPMCs) arrested in G0/G1 with hydroxyurea (HU) and treated with various fibre types, i.e., chrysotile, crocidolite or attapulgite. In addition, the effects of UV light and of benzo[a]pyrene were determined as references. Using autoradiography after [3H]thymidine incorporation ([3H]dThd), RPMCs treated with 4 micrograms/cm2 of chrysotile fibres exhibited a low but significant enhancement of net grains compared to untreated cells. Treatment with higher doses of chrysotile was not possible because of the impairment of microscopic observation due to the presence of the fibres. Using liquid scintillation counting, RPMCs treated with chrysotile or crocidolite showed a significant dose-dependent increase in [3H]dThd incorporation compared to untreated cells. In contrast, attapulgite did not enhance [3H]dThd incorporation compared to untreated cells. Treatment of RPMCs with 1, 2 or 4 micrograms/ml of benzo[a]pyrene resulted in a significant increase in [3H]dThd incorporation. In order to discount a possible role of S cells in the augmentation of [3H]dThd incorporation, despite the presence of 5 mM HU, S cells were counted by autoradiography. Results indicated that the percentage of S cells was similar in asbestos-treated and untreated cultures. Stimulation of the S phase also seems unlikely because treatment of RPMCs with asbestos fibres in the absence of HU resulted in a reduction of [3H]dThd incorporation attributed to an impairment of the S phase by the fibres. 1-4 micrograms/ml benzo[a]pyrene or 10-50 J/m2 UV light resulted in an approximate doubling of [3H]dThd incorporation. The effects of inhibitors of DNA repair were determined in chrysotile-treated RPMCs. [3H]dThd incorporation was inhibited by cytosine arabinoside and nalidixic acid. These results show that asbestos produces UDS in RPMCs.

  4. Roles of the Envelope Proteins in the Amplification of Covalently Closed Circular DNA and Completion of Synthesis of the Plus-Strand DNA in Hepatitis B Virus ▿

    PubMed Central

    Lentz, Thomas B.; Loeb, Daniel D.

    2011-01-01

    Covalently closed circular DNA (cccDNA), the nuclear form of hepatitis B virus (HBV), is synthesized by repair of the relaxed circular (RC) DNA genome. Initially, cccDNA is derived from RC DNA from the infecting virion, but additional copies of cccDNA are derived from newly synthesized RC DNA molecules in a process termed intracellular amplification. It has been shown that the large viral envelope protein limits the intracellular amplification of cccDNA for duck hepatitis B virus. The role of the envelope proteins in regulating the amplification of cccDNA in HBV is not well characterized. The present report demonstrates regulation of synthesis of cccDNA by the envelope proteins of HBV. Ablation of expression of the envelope proteins led to an increase (>6-fold) in the level of cccDNA. Subsequent restoration of envelope protein expression led to a decrease (>50%) in the level of cccDNA, which inversely correlated with the level of the envelope proteins. We found that the expression of L protein alone or in combination with M and/or S proteins led to a decrease in cccDNA levels, indicating that L contributes to the regulation of cccDNA. Coexpression of L and M led to greater regulation than either L alone or L and S. Coexpression of all three envelope proteins was also found to limit completion of plus-strand DNA synthesis, and the degree of this effect correlated with the level of the proteins and virion secretion. PMID:21900164

  5. Synthesis of linear polyethylenimine derivatives for DNA transfection.

    PubMed

    Brissault, Blandine; Kichler, Antoine; Guis, Christine; Leborgne, Christian; Danos, Olivier; Cheradame, Hervé

    2003-01-01

    A series of linear polymers containing varying amounts of ethylenimine or N-propylethylenimine units were synthesized by hydrolysis and/or reduction of polyethyloxazolines. The pK(a)s of the polyamines were determined potentiometrically. Gel mobility shift assay showed that the efficiency of DNA complexation was related to the fraction of amino groups that are protonated at neutral pH. The effects of cationic charge density and molar weight of the polymers on the transfection efficiency were evaluated on HepG2 cells. The results obtained with different copolymers show that the transfection efficiency primarily depends on the fraction of ethylenimine units included in the polymer albeit the molar weight is also of importance. On the basis of the results obtained with poly(N-propylethylenimines), we also demonstrate that the high transfection efficiency of polyethylenimines does not solely rely on their capacity to capture protons which are transferred into the endo-lysosomes during acidification.

  6. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  7. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  8. Click Reaction on Solid Phase Enables High Fidelity Synthesis of Nucleobase-Modified DNA.

    PubMed

    Tolle, Fabian; Rosenthal, Malte; Pfeiffer, Franziska; Mayer, Günter

    2016-03-16

    The post-synthetic functionalization of nucleic acids via click chemistry (CuAAC) has seen tremendous implementation, extending the applicability of nucleobase-modified nucleic acids in fields like fluorescent labeling, nanotechnology, and in vitro selection. However, the production of large quantities of high-density functionalized material via solid phase synthesis has been hampered by oxidative by-product formation associated with the alkaline workup conditions. Herein, we describe a rapid and cost-effective protocol for the high fidelity large-scale production of nucleobase-modified nucleic acids, exemplified with a recently described nucleobase-modified aptamer.

  9. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E

    1996-01-01

    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  10. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  11. Synthesis and Properties of 2′-Deoxy-2′,4′-difluoroarabinose-Modified Nucleic Acids

    PubMed Central

    Martínez-Montero, Saúl; Deleavey, Glen F.; Dierker-Viik, Arden; Lindovska, Petra; Ilina, Tatiana; Portella, Guillem; Orozco, Modesto; Parniak, Michael A.; González, Carlos; Damha, Masad J.

    2015-01-01

    We report the synthesis, thermal stability, and RNase H substrate activity of 2′-deoxy-2′,4′-difluoroarabino-modified nucleic acids. 2′-Deoxy-2′,4′-difluoroarabinouridine (2,′4′-diF-araU) was prepared in a stereoselective way in six steps from 2′-deoxy-2′-fluoroarabinouridine (2′-F-araU). NMR analysis and quantum mechanical calculations at the nucleoside level reveal that introduction of 4′-fluorine introduces a strong bias toward the North conformation, despite the presence of the 2′-βF, which generally steers the sugar pucker toward the South/East conformation. Incorporation of the novel monomer into DNA results on a neutral to slightly stabilizing thermal effect on DNA–RNA hybrids. Insertion of 2′,4′-diF-araU nucleotides in the DNA strand of a DNA–RNA hybrid decreases the rate of both human and HIV reverse transcriptase-associated RNase H-mediated cleavage of the complement RNA strand compared to that for an all-DNA strand or a DNA strand containing the corresponding 2′-F-araU nucleotide units, consistent with the notion that a 4′-fluorine in 2′-F-araU switches the preferred sugar conformation from DNA-like (South/East) to RNA-like (North). PMID:25723361

  12. Synthesis of copper nanoparticles by electrolysis of DNA utilizing copper as sacrificial anode.

    PubMed

    Singh, Dinesh Pratap; Srivastava, Onkar Nath

    2007-06-01

    Copper nanoparticles have been synthesized by anodic oxidation through a simple electrolysis process employing de-oxy ribonucleic acid (DNA) as electrolyte. Platinum was taken as cathode and copper as anode. The applied voltage was 4 V and the electrolysis was performed for duration of 1 h. The copper nanoparticles were prepared in situ from the electron beam irradiation on residues of electrolyte consisting of DNA and copper particles: DNA (Cu) complexes. The size of the nanoparticles ranges between 5-50 nm. A tentative explanation has been given for the formation of copper nanoparticles.

  13. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  14. Effect of microwaves (2450-MHz) on the immune system in mice: studies of nucleic acid and protein synthesis

    SciTech Connect

    Wiktor-Jedrzejczak, W.; Ahmed, A.; Czerski, P.; Leach, W.M.; Sell, K.W.

    1980-01-01

    CBA/J adult male mice were given single or triple exposures to 2450-mHz microwaves in an environmentally controlled wave guide facility. The average absorbed dose rate for a single exposure varied from 12 to 15 mW/g. Sham-exposed mice served as controls. Lymphoid cells were collected and tested for metabolic activity on days 3, 6, and 9 following a single exposure, and on days 9, 12, and 16 following triple exposures on days 0, 3, and 6. Cells were cultured in vitro for four hours to seven days before their metabolic rates were assayed. Under these conditions, microwaves failed to produce any detectable change in deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein synthesis, as measured by the incorporation of methyl(3H)-thymidine (3H-TDR) (DNA substrate), 3H-uridine (3H-UR) (RNA substrate), and 3H-leucine (protein substrate) by spleen, bone marrow, and peripheral blood lymphocytes (PBL) in vitro. These data suggest that microwave-induced increases in the frequency of complement-receptor (CR)- or surface-immunoglobulin (sIg)-bearing cells were not associated with a concomitant increase in cell proliferation and/or protein synthesis, and favor the concept that microwaves under these conditions stimulate already existing B-cell precursors for maturation.

  15. Synthesis of unnatural amino acids from serine derivatives by beta-fragmentation of primary alkoxyl radicals.

    PubMed

    Boto, Alicia; Gallardo, Juan A; Hernández, Dacil; Hernández, Rosendo

    2007-09-14

    The fragmentation of primary alkoxyl radicals has been scarcely used in synthesis since other competing processes (such as oxidation or hydrogen abstraction) usually predominate. However, when serine derivatives were used as substrates, the scission took place in excellent yields. Tandem scission-allylation, -alkylation, or -arylation reactions were subsequently developed. This one-pot methodology was applied to the synthesis of unnatural amino acids, which are useful synthetic blocks or amino acid surrogates in peptidomimetics.

  16. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  17. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  18. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement.

  19. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  20. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  1. The enhanced rate of transcription of methyl mercury-exposed DNA by RNA polymerase is not sufficient to explain the stimulatory effect of methyl mercury on RNA synthesis in isolated nuclei.

    PubMed

    Frenkel, G D; Ducote, J

    1987-10-01

    Previous work demonstrated two stimulatory effects of methyl mercury on nucleic acid synthesis: (1) in isolated nuclei, methyl mercury stimulates RNA synthesis which is catalyzed by RNA polymerase II [Frenkel and Randles, J. Biol. Chem. 257, 6275-6279 (1982)]. (2) Brief exposure of purified DNA to methyl mercury increases the rate of its transcription by purified RNA polymerase II [Frenkel, Cain, and Chao, Biochem. Biophys. Res. Commun. 127, 849-856 (1985)]. The latter effect was considered as a possible mechanism of the former. Two lines of evidence are presented here which demonstrate that the latter effect is not a sufficient explanation for the former. (1) Mercuric perchlorate has been found to increase the rate of DNA transcription by purified polymerase and the template properties of the mercuric perchlorate-exposed DNA have been found to resemble those of methyl mercury-exposed DNA. Nevertheless, mercuric perchlorate has been shown not to stimulate RNA synthesis in isolated HeLa nuclei. (2) In isolated nuclei of the B50 rat neuroblastoma cell line, RNA synthesis has been found to be stimulated only minimally by methyl mercury. Nevertheless, RNA polymerase II purified from the B50 cells has been found to transcribe methyl mercury-exposed DNA at a higher rate than unexposed control DNA.

  2. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  3. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  4. Nucleic acid (cDNA) and amino acid sequences of alpha-type gliadins from wheat (Triticum aestivum).

    PubMed Central

    Kasarda, D D; Okita, T W; Bernardin, J E; Baecker, P A; Nimmo, C C; Lew, E J; Dietler, M D; Greene, F C

    1984-01-01

    The complete amino acid sequence for an alpha-type gliadin protein of wheat (Triticum aestivum Linnaeus) endosperm has been derived from a cloned cDNA sequence. An additional cDNA clone that corresponds to about 75% of a similar alpha-type gliadin has been sequenced and shows some important differences. About 97% of the composite sequence of A-gliadin (an alpha-type gliadin fraction) has also been obtained by direct amino acid sequencing. This sequence shows a high degree of similarity with amino acid sequences derived from both cDNA clones and is virtually identical to one of them. On the basis of sequence information, after loss of the signal sequence, the mature alpha-type gliadins may be divided into five different domains, two of which may have evolved from an ancestral gliadin gene, whereas the remaining three contain repeating sequences that may have developed independently. Images PMID:6589619

  5. Mining Enzyme Diversity of Transcriptome Libraries through DNA Synthesis for Benzylisoquinoline Alkaloid Pathway Optimization in Yeast.

    PubMed

    Narcross, Lauren; Bourgeois, Leanne; Fossati, Elena; Burton, Euan; Martin, Vincent J J

    2016-12-16

    The ever-increasing quantity of data deposited to GenBank is a valuable resource for mining new enzyme activities. Falling costs of DNA synthesis enables metabolic engineers to take advantage of this resource for identifying superior or novel enzymes for pathway optimization. Previously, we reported synthesis of the benzylisoquinoline alkaloid dihydrosanguinarine in yeast from norlaudanosoline at a molar conversion of 1.5%. Molar conversion could be improved by reduction of the side-product N-methylcheilanthifoline, a key bottleneck in dihydrosanguinarine biosynthesis. Two pathway enzymes, an N-methyltransferase and a cytochrome P450 of the CYP719A subfamily, were implicated in the synthesis of the side-product. Here, we conducted an extensive screen to identify enzyme homologues whose coexpression reduces side-product synthesis. Phylogenetic trees were generated from multiple sources of sequence data to identify a library of candidate enzymes that were purchased codon-optimized and precloned into expression vectors designed to facilitate high-throughput analysis of gene expression as well as activity assay. Simple in vivo assays were sufficient to guide the selection of superior enzyme homologues that ablated the synthesis of the side-product, and improved molar conversion of norlaudanosoline to dihydrosanguinarine to 10%.

  6. Cooperative Brønsted Acid-Type Organocatalysis for the Stereoselective Synthesis of Deoxyglycosides

    PubMed Central

    2016-01-01

    A practical approach for the α-stereoselective synthesis of deoxyglycosides using cooperative Brønsted acid-type organocatalysis has been developed. The method is tolerant of a wide range of glycoside donors and acceptors, and its versatility is exemplified in the one-pot synthesis of a trisaccharide. Mechanistic studies suggest that thiourea-induced acid amplification of the chiral acid via H-bonding is key for the enhancement in reaction rate and yield, while stereocontrol is dependent on the chirality of the acid. PMID:28004941

  7. Exogenous amino acids stimulate net muscle protein synthesis in the elderly.

    PubMed Central

    Volpi, E; Ferrando, A A; Yeckel, C W; Tipton, K D; Wolfe, R R

    1998-01-01

    We have investigated the response of amino acid transport and protein synthesis in healthy elderly individuals (age 71+/-2 yr) to the stimulatory effect of increased amino acid availability. Muscle protein synthesis and breakdown, and amino acid transport were measured in the postabsorptive state and during the intravenous infusion of an amino acid mixture. Muscle-free amino acid kinetics were calculated by means of a three compartment model using data obtained by femoral arterio-venous catheterization and muscle biopsies from the vastus lateralis during the infusion of stable isotope tracers of amino acids. In addition, muscle protein fractional synthetic rate (FSR) was measured. Peripheral amino acid infusion significantly increased amino acid delivery to the leg, amino acid transport, and muscle protein synthesis when measured either with the three compartment model (P < 0.05) or with the traditional precursor-product approach (FSR increased from 0. 0474+/-0.0054 to 0.0940+/-0.0143%/h, P < 0.05). Because protein breakdown did not change during amino acid infusion, a positive net balance of amino acids across the muscle was achieved. We conclude that, although muscle mass is decreased in the elderly, muscle protein anabolism can nonetheless be stimulated by increased amino acid availability. We thus hypothesize that muscle mass could be better maintained with an increased intake of protein or amino acids. PMID:9576765

  8. Green synthesis of gold nanoparticles for staining human cervical cancer cells and DNA binding assay.

    PubMed

    De, Swati; Kundu, Rikta; Ghorai, Atanu; Mandal, Ranju Prasad; Ghosh, Utpal

    2014-11-01

    Gold nanoparticles have been functionalized by non-ionic surfactants (polysorbates) used in pharmaceutical formulations. This results in the formation of more well-dispersed gold nanoparticles (GNPs) than the GNPs formed in neat water. The synthesized GNPs show good temporal stability. The synthesis conditions are mild and environmentally benign. The GNPs can bind to ct-DNA and displace bound dye molecules. The DNA-binding assay is significant as it preliminarily indicated that DNA-GNP conjugates can be formed. Such conjugates are extremely promising for applications in nanobiotechnology. The GNPs can also stain the human cervical cancer (HeLa) cells over a wide concentration range while remaining non-cytotoxic, thus providing a non invasive cell staining method. This result is very promising as we observe staining of HeLa cells at very low GNP concentrations (1 μM) while the cell viability is retained even at 10-fold higher GNP concentrations.

  9. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  10. In vitro synthesis of large peptide molecules using glucosylated single-stranded bacteriophage T4D DNA template.

    PubMed Central

    Hulen, C; Legault-Demare, J

    1975-01-01

    Denatured Bacteriophage T4D DNA is able to stimulate aminoacid incorporation into TCA-precipitable material in an in vitro protein synthesis system according to base DNA sequences. Newly synthesized polypeptides remain associated with ribosomes and have a molecular weight in range of 15,000 to 45,000 Daltons. PMID:1052527

  11. DNA Diagnostics: Nanotechnology-enhanced Electrochemical Detection of Nucleic Acids

    PubMed Central

    Wei, Fang; Lillehoj, Peter B.; Ho, Chih-Ming

    2010-01-01

    The detection of mismatched base pairs in DNA plays a crucial role in the diagnosis of genetic-related diseases and conditions, especially for early stage treatment. Among the various biosensors that have been employed for DNA detection, electrochemical sensors show great promise since they are capable of precise DNA recognition and efficient signal transduction. Advancements in micro- and nanotechnologies, specifically fabrication techniques and new nanomaterials, have enabled for the development of highly sensitive, highly specific sensors making them attractive for the detection of small sequence variations. Furthermore, the integration of sensors with sample preparation and fluidic processes enables for rapid, multiplexed DNA detection for point-of-care (POC) clinical diagnostics. PMID:20075759

  12. Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

    SciTech Connect

    Lovrinovic, Marina; Niemeyer, Christof M. . E-mail: christof.niemeyer@uni-dortmund.de

    2005-09-30

    We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter were ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.

  13. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.

    PubMed

    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko

    2003-01-01

    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  14. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  15. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  16. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  17. [Studies on the interaction of the metal complex of hydrazide of podophyllic acid with DNA].

    PubMed

    Wang, Ping-Hong; Zhang, Qi; Wang, Liu-Fang; Song, Yu-Min; Qu, Jian-Qiang; Liu, Ying-Qian

    2006-05-01

    The interaction between the metal complex of hydrazide of podophyllic acid and calf thymus (CT) DNA was studied by using absorption spectra, fluorescence spectra and DNA heat denaturation. It was found that the intensity of the maximal absorption peaks from absorption spectra is weakened in the presence of the metal complex of hydrazide of podophyllic acid compared with that in the absence of the metal complex. All the experimental results show that the intercalation mode was proved to exist between HDPP-Ni complexes and CT DNA.

  18. Steric and electrostatic effects in DNA synthesis by the SOS-induced DNA polymerases II and IV of Escherichia coli.

    PubMed

    Silverman, Adam P; Jiang, Qingfei; Goodman, Myron F; Kool, Eric T

    2007-12-04

    The SOS-induced DNA polymerases II and IV (pol II and pol IV, respectively) of Escherichia coli play important roles in processing lesions that occur in genomic DNA. Here we study how electrostatic and steric effects play different roles in influencing the efficiency and fidelity of DNA synthesis by these two enzymes. These effects were probed by the use of nonpolar shape analogues of thymidine, in which substituted toluenes replace the polar thymine base. We compared thymine with nonpolar analogues to evaluate the importance of hydrogen bonding in the polymerase active sites, while we used comparisons among a set of variably sized thymine analogues to measure the role of steric effects in the two enzymes. Steady-state kinetics measurements were carried out to evaluate activities for nucleotide insertion and extension. The results showed that both enzymes inserted nucleotides opposite nonpolar template bases with moderate to low efficiency, suggesting that both polymerases benefit from hydrogen bonding or other electrostatic effects involving the template base. Surprisingly, however, pol II inserted nonpolar nucleotide (dNTP) analogues into a primer strand with high (wild-type) efficiency, while pol IV handled them with an extremely low efficiency. Base pair extension studies showed that both enzymes bypass non-hydrogen-bonding template bases with moderately low efficiency, suggesting a possible beneficial role of minor groove hydrogen bonding interactions at the N-1 position. Measurement of the two polymerases' sensitivity to steric size changes showed that both enzymes were relatively flexible, yielding only small kinetic differences with increases or decreases in nucleotide size. Comparisons are made to recent data for DNA pol I (Klenow fragment), the archaeal polymerase Dpo4, and human pol kappa.

  19. A microenvironment-sensitive fluorescent pyrimidine ribonucleoside analogue: synthesis, enzymatic incorporation, and fluorescence detection of a DNA abasic site.

    PubMed

    Tanpure, Arun A; Srivatsan, Seergazhi G

    2011-11-04

    Base-modified fluorescent ribonucleoside-analogue probes are valuable tools in monitoring RNA structure and function because they closely resemble the structure of natural nucleobases. Especially, 2-aminopurine, a highly environment-sensitive adenosine analogue, is the most extensively utilized fluorescent nucleoside analogue. However, only a few isosteric pyrimidine ribonucleoside analogues that are suitable for probing the structure and recognition properties of RNA molecules are available. Herein, we describe the synthesis and photophysical characterization of a small series of base-modified pyrimidine ribonucleoside analogues derived from tagging indole, N-methylindole, and benzofuran onto the 5-position of uracil. One of the analogues, based on a 5-(benzofuran-2-yl)pyrimidine core, shows emission in the visible region with a reasonable quantum yield and, importantly, displays excellent solvatochromism. The corresponding triphosphate substrate is effectively incorporated into oligoribonucleotides by T7 RNA polymerase to produce fluorescent oligoribonucleotide constructs. Steady-state and time-resolved spectroscopic studies with fluorescent oligoribonucleotide constructs demonstrate that the fluorescent ribonucleoside photophysically responds to subtle changes in its environment brought about by the interaction of the chromophore with neighboring bases. In particular, the emissive ribonucleoside, if incorporated into an oligoribonucleotide, positively reports the presence of a DNA abasic site with an appreciable enhancement in fluorescence intensity. The straightforward synthesis, amicability to enzymatic incorporation, and sensitivity to changes in the microenvironment highlight the potential of the benzofuran-conjugated pyrimidine ribonucleoside as an efficient fluorescent probe to investigate nucleic acid structure, dynamics, and recognition events.

  20. A prediction of the amino acids and structures involved in DNA recognition by type I DNA restriction and modification enzymes.

    PubMed Central

    Sturrock, S S; Dryden, D T

    1997-01-01

    The S subunits of type I DNA restriction/modification enzymes are responsible for recognising the DNA target sequence for the enzyme. They contain two domains of approximately 150 amino acids, each of which is responsible for recognising one half of the bipartite asymmetric target. In the absence of any known tertiary structure for type I enzymes or recognisable DNA recognition motifs in the highly variable amino acid sequences of the S subunits, it has previously not been possible to predict which amino acids are responsible for sequence recognition. Using a combination of sequence alignment and secondary structure prediction methods to analyse the sequences of S subunits, we predict that all of the 51 known target recognition domains (TRDs) have the same tertiary structure. Furthermore, this structure is similar to the structure of the TRD of the C5-cytosine methyltransferase, Hha I, which recognises its DNA target via interactions with two short polypeptide loops and a beta strand. Our results predict the location of these sequence recognition structures within the TRDs of all type I S subunits. PMID:9254696

  1. Irreversible repression of DNA synthesis in Fanconi anemia cells is alleviated by the product of a novel cyclin-related gene.

    PubMed Central

    Digweed, M; Günthert, U; Schneider, R; Seyschab, H; Friedl, R; Sperling, K

    1995-01-01

    Primary fibroblasts from patients with the genetic disease Fanconi anemia, which are hypersensitive to cross-linking agents, were used to screen a cDNA library for sequences involved in their abnormal cellular response to a cross-linking challenge. By using library partition and microinjection of in vitro-transcribed RNA, a cDNA clone, pSPHAR (S-phase response), which is able to correct the permanent repression of semiconservative DNA synthesis rates characteristic of these cells, was isolated. Wild-type SPHAR mRNA is expressed in all fibroblasts so far analyzed, including those of Fanconi anemia patients. Correction of the abnormal response in these cells appears therefore to be due to overexpression after cDNA transfer rather than to genetic complementation. The cDNA contains an open reading frame coding for a polypeptide of 7.5 kDa. Rabbit antiserum directed against a SPHAR peptide detects a protein of 7.9 kDa in Western blots (immunoblots) of whole-cell extracts from proliferating, but not resting, fibroblasts. The deduced amino acid sequence of SPHAR contains a motif found in the cyclins, and it is proposed that SPHAR acts within the injected cell by interfering with the cyclin-controlled maintenance of S phase. In agreement with this proposal, normal cells transfected with an antisense SPHAR expression vector have a significantly reduced rate of DNA synthesis during S phase and a prolonged G2 phase, reflecting the need for postreplicative DNA processing before entry into mitosis. PMID:7799938

  2. Eicosanoid synthesis in cardiomyocytes: influence of hypoxia, reoxygenation, and polyunsaturated fatty acids.

    PubMed

    Oudot, F; Grynberg, A; Sergiel, J P

    1995-01-01

    The synthesis of eicosanoids was investigated in cultured rat ventricular myocytes. Under normoxia, the cardiomyocytes released 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha) and prostaglandin (PG) E2 and smaller amounts of PGF2 alpha and thromboxane B2. Hypoxia enhanced the production of PGE2 and PGF2 alpha, whereas the synthesis of 6-keto-PGF1 alpha was not affected. Conversely, posthypoxic reoxygenation greatly increased the synthesis of 6-keto-PGF1 alpha, whereas the synthesis of PGF2 alpha, was not affected and that of PGE2 was reduced. The cardiomyocyte polyunsaturated fatty acid (PUFA) profile was altered by arachidonic acid or eicosapentaenoic acid and docosahexaenoic acid. Under normoxia, the eicosanoid production appeared to be roughly related to the cell phospholipid arachidonic acid content. Conversely, during posthypoxic reoxygenation, the production of eicosanoids was related to the cell phospholipid n-3 PUFA content, with the n-3-rich cells displaying a marked inhibition of the synthesis. This inhibition was mainly attributed to eicosapentaenoic acid and/or docosapentaenoic acid. Whether this inhibition occurs in vivo during postischemic reperfusion, it may contribute to the beneficial effect of n-3 PUFA on the heart.

  3. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  4. Biochemical analysis of six genetic variants of error-prone human DNA polymerase ι involved in translesion DNA synthesis.

    PubMed

    Kim, Jinsook; Song, Insil; Jo, Ara; Shin, Joo-Ho; Cho, Hana; Eoff, Robert L; Guengerich, F Peter; Choi, Jeong-Yun

    2014-10-20

    DNA polymerase (pol) ι is the most error-prone among the Y-family polymerases that participate in translesion synthesis (TLS). Pol ι can bypass various DNA lesions, e.g., N(2)-ethyl(Et)G, O(6)-methyl(Me)G, 8-oxo-7,8-dihydroguanine (8-oxoG), and an abasic site, though frequently with low fidelity. We assessed the biochemical effects of six reported genetic variations of human pol ι on its TLS properties, using the recombinant pol ι (residues 1-445) proteins and DNA templates containing a G, N(2)-EtG, O(6)-MeG, 8-oxoG, or abasic site. The Δ1-25 variant, which is the N-terminal truncation of 25 residues resulting from an initiation codon variant (c.3G > A) and also is the formerly misassigned wild-type, exhibited considerably higher polymerase activity than wild-type with Mg(2+) (but not with Mn(2+)), coinciding with its steady-state kinetic data showing a ∼10-fold increase in kcat/Km for nucleotide incorporation opposite templates (only with Mg(2+)). The R96G variant, which lacks a R96 residue known to interact with the incoming nucleotide, lost much of its polymerase activity, consistent with the kinetic data displaying 5- to 72-fold decreases in kcat/Km for nucleotide incorporation opposite templates either with Mg(2+) or Mn(2+), except for that opposite N(2)-EtG with Mn(2+) (showing a 9-fold increase for dCTP incorporation). The Δ1-25 variant bound DNA 20- to 29-fold more tightly than wild-type (with Mg(2+)), but the R96G variant bound DNA 2-fold less tightly than wild-type. The DNA-binding affinity of wild-type, but not of the Δ1-25 variant, was ∼7-fold stronger with 0.15 mM Mn(2+) than with Mg(2+). The results indicate that the R96G variation severely impairs most of the Mg(2+)- and Mn(2+)-dependent TLS abilities of pol ι, whereas the Δ1-25 variation selectively and substantially enhances the Mg(2+)-dependent TLS capability of pol ι, emphasizing the potential translational importance of these pol ι genetic variations, e.g., individual differences

  5. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  6. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  7. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-06-28

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise.

  8. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  9. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  10. Amino acid racemization in amber-entombed insects: implications for DNA preservation

    NASA Technical Reports Server (NTRS)

    Bada, J. L.; Wang, X. S.; Poinar, H. N.; Paabo, S.; Poinar, G. O.

    1994-01-01

    DNA depurination and amino acid racemization take place at similar rates in aqueous solution at neutral pH. This relationship suggests that amino acid racemization may be useful in accessing the extent of DNA chain breakage in ancient biological remains. To test this suggestion, we have investigated the amino acids in insects entombed in fossilized tree resins ranging in age from <100 years to 130 million years. The amino acids present in 40 to 130 million year old amber-entombed insects resemble those in a modern fly and are probably the most ancient, unaltered amino acids found so far on Earth. In comparison to other geochemical environments on the surface of the Earth, the amino acid racemization rate in amber insect inclusions is retarded by a factor of >10(4). These results suggest that in amber insect inclusions DNA depurination rates would also likely be retarded in comparison to aqueous solution measurements, and thus DNA fragments containing many hundreds of base pairs should be preserved. This conclusion is consistent with the reported successful retrieval of DNA sequences from amber-entombed organisms.

  11. DNA Binding and Recognition of a CC Mismatch in a DNA Duplex by Water-Soluble Peptidocalix[4]arenes: Synthesis and Applications.

    PubMed

    Alavijeh, Nahid S; Zadmard, Reza; Balalaie, Saeed; Alavijeh, Mohammad S; Soltani, Nima

    2016-10-07

    Water-soluble peptidocalix[4]arenes were synthesized by the introduction of arginine-rich narrow groove-binding residues at lower rims through solid-phase synthesis. The study of binding of these water-soluble bidentate ligands to well-matched and mismatched DNA duplexes by fluorescent titrations, ethidium bromide (EB) displacement assays, DNA-melting experiments, and circular dichroism (CD) analysis revealed a sequence-dependent groove-binding mechanism.

  12. Photoaugmentation in the hairless mouse: a study using ornithine decarboxylase activity and alteration of DNA synthesis as markers of epidermal response

    SciTech Connect

    Gange, R.W.; Mendelson, I.R.

    1981-01-01

    Photoaugmentation is the potentiation of UVB-induced cutaneous erythema by UV irradiation. We have examined other cutaneous responses to UVB irradiation-the 4 hr depression of DNA synthesis, the 48 hr stimulation of DNA synthesis, and the induction of ornithine decarboxylase (ODC), to determine whether these were also susceptible to augmentation by UVA, which does not cause these responses when administered alone. No photoaugmentation of DNA synthesis, stimulation or ODC induction occurred. The early depression of DNA synthesis was slightly augmented for this did not consistently reach significance.

  13. Toward a designed genetic system with biochemical function: polymerase synthesis of single and multiple size-expanded DNA base pairs.

    PubMed

    Lu, Haige; Krueger, Andrew T; Gao, Jianmin; Liu, Haibo; Kool, Eric T

    2010-06-21

    The development of alternative architectures for genetic information-encoding systems offers the possibility of new biotechnological tools as well as basic insights into the function of the natural system. In order to examine the potential of benzo-expanded DNA (xDNA) to encode and transfer biochemical information, we carried out a study of the processing of single xDNA pairs by DNA Polymerase I Klenow fragment (Kf, an A-family sterically rigid enzyme) and by the Sulfolobus solfataricus polymerase Dpo4 (a flexible Y-family polymerase). Steady-state kinetics were measured and compared for enzymatic synthesis of the four correct xDNA pairs and twelve mismatched pairs, by incorporation of dNTPs opposite single xDNA bases. Results showed that, like Kf, Dpo4 in most cases selected the correctly paired partner for each xDNA base, but with efficiency lowered by the enlarged pair size. We also evaluated kinetics for extension by these polymerases beyond xDNA pairs and mismatches, and for exonuclease editing by the Klenow exo+ polymerase. Interestingly, the two enzymes were markedly different: Dpo4 extended pairs with relatively high efficiencies (within 18-200-fold of natural DNA), whereas Kf essentially failed at extension. The favorable extension by Dpo4 was tested further by stepwise synthesis of up to four successive xDNA pairs on an xDNA template.

  14. Temporal and topographic changes in DNA synthesis after induced follicular atresia

    SciTech Connect

    Greenwald, G.S. )

    1989-07-01

    Hamsters were hypophysectomized on the morning of estrus (Day 1) and injected immediately with 30 IU pregnant mare's serum (PMS). This was followed on Day 4 by the injection of an antiserum to PMS (PMS-AS) that initiated follicular atresia (Time zero). From 0 to 72 h after PMS-AS, the animals were injected with (3H)thymidine and killed 4 h later. One ovary was saved for autoradiography and histology; from the other ovary, 5-10 large antral follicles were dissected and pooled, and incorporation into DNA was determined by scintillation counting. DNA synthesis dropped sharply between 12 and 18 h, coinciding with a fall in labeling index of the cumulus oophorus and thecal endothelial cells and a sharp fall in thecal vascularity. In contrast, for the mural granulosa cells bordering on the antral cavity, labeling index dropped sharply between 8 and 12 h when thecal vascularity was still high. The earliest sign of atresia was evident by 4 h in cumulus cells when, paradoxically, DNA synthesis was still high. It took 3 days for atresia of the antral follicles to progress to advanced stages, as evidenced by pseudo-pronuclei in the free floating ovum, further erosion of the mural granulosa, and minimal DNA/follicle. However, the theca still retained its histological integrity and contained no pyknotic cells. Although by 48 h the granulosal compartment was in disarray (DNA/follicle significantly different from earlier values), the egg was still viable, as judged by maximal fluorescence after the addition of fluoroscein diacetate.

  15. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions

    PubMed Central

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G.

    2015-01-01

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa–Atr–Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  16. Nucleotides with altered hydrogen bonding capacities impede human DNA polymerase η by reducing synthesis in the presence of the major cisplatin DNA adduct.

    PubMed

    Nilforoushan, Arman; Furrer, Antonia; Wyss, Laura A; van Loon, Barbara; Sturla, Shana J

    2015-04-15

    Human DNA polymerase η (hPol η) contributes to anticancer drug resistance by catalyzing the replicative bypass of DNA adducts formed by the widely used chemotherapeutic agent cis-diamminedichloroplatinum (cisplatin). A chemical basis for overcoming bypass-associated resistance requires greater knowledge of how small molecules influence the hPol η-catalyzed bypass of DNA adducts. In this study, we demonstrated how synthetic nucleoside triphosphates act as hPol η substrates and characterized their influence on hPol η-mediated DNA synthesis over unmodified and platinated DNA. The single nucleotide incorporation efficiency of the altered nucleotides varied by more than 10-fold and the higher incorporation rates appeared to be attributable to the presence of an additional hydrogen bond between incoming dNTP and templating base. Finally, full-length DNA synthesis in the presence of increasing concentrations of synthetic nucleotides reduced the amount of DNA product independent of the template, representing the first example of hPol η inhibition in the presence of a platinated DNA template.

  17. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  18. Single molecule DNA interaction kinetics of retroviral nucleic acid chaperone proteins

    NASA Astrophysics Data System (ADS)

    Williams, Mark

    2010-03-01

    Retroviral nucleocapsid (NC) proteins are essential for several viral replication processes including specific genomic RNA packaging and reverse transcription. The nucleic acid chaperone activity of NC facilitates the latter process. In this study, we use single molecule biophysical methods to quantify the DNA interactions of wild type and mutant human immunodeficiency virus type 1 (HIV-1) NC and Gag and human T-cell leukemia virus type 1 (HTLV-1) NC. We find that the nucleic acid interaction properties of these proteins differ significantly, with HIV-1 NC showing rapid protein binding kinetics, significant duplex destabilization, and strong DNA aggregation, all properties that are critical components of nucleic acid chaperone activity. In contrast, HTLV-1 NC exhibits significant destabilization activity but extremely slow DNA interaction kinetics and poor aggregating capability, which explains why HTLV-1 NC is a poor nucleic acid chaperone. To understand these results, we developed a new single molecule method for quantifying protein dissociation kinetics, and applied this method to probe the DNA interactions of wild type and mutant HIV-1 and HTLV-1 NC. We find that mutations to aromatic and charged residues strongly alter the proteins' nucleic acid interaction kinetics. Finally, in contrast to HIV-1 NC, HIV-1 Gag, the nucleic acid packaging protein that contains NC as a domain, exhibits relatively slow binding kinetics, which may negatively impact its ability to act as a nucleic acid chaperone.

  19. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  20. Method Optimization of Deoxyribonucleic Acid (DNA) Thin Films for Biotronics

    DTIC Science & Technology

    2011-09-01

    Added to the Spin-coater ......................................................................4 3.3 Comparison of Spin - Coating Speed and Sample...precipitate after centrifugation. ..............................3 Figure 3. Diagram of spin - coating method. First, the DNA-CTMA solution was pipetted onto... spin - coating speeds. ...................................................................................................................6 Figure 5

  1. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  2. Prolonged stimulation of protein synthesis by leucine is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leucine is unique among the amino acids in its ability to enhance protein synthesis by activating translation initiation (Kimball and Jefferson, 2005). Our laboratory has shown that raising leucine to postprandial levels, whilst keeping all other amino acids at the post absorptive, level acutely st...

  3. Pyrazinoic acid decreases the proton motive force, respiratory ATP synthesis activity, and cellular ATP levels.

    PubMed

    Lu, Ping; Haagsma, Anna C; Pham, Hoang; Maaskant, Janneke J; Mol, Selena; Lill, Holger; Bald, Dirk

    2011-11-01

    Pyrazinoic acid, the active form of the first-line antituberculosis drug pyrazinamide, decreased the proton motive force and respiratory ATP synthesis rates in subcellular mycobacterial membrane assays. Pyrazinoic acid also significantly lowered cellular ATP levels in Mycobacterium bovis BCG. These results indicate that the predominant mechanism of killing by this drug may operate by depletion of cellular ATP reserves.

  4. Total synthesis of racemic and (R) and (S)-4-methoxyalkanoic acids and their antifungal activity.

    PubMed

    Das, Biswanath; Shinde, Digambar Balaji; Kanth, Boddu Shashi; Kamle, Avijeet; Kumar, C Ganesh

    2011-07-01

    The total synthesis of 4-methoxydecanoic acid and 4-methoxyundecanoic acid in racemic and stereoselective [(R) and (S)] forms has been accomplished. For stereoselective synthesis of the compounds (S) and (R)-BINOL complexes have been used to generate the required chiral centres. The antifungal activity of these compounds has been studied against different organisms and the results were found to be impressive. The activity of the compounds in racemic and in stereoselective forms was compared. (R)-4-Methoxydecanoic acid was found to be most potent (MIC: 0.019 mg/mL against Candida albicans MTCC 227, C. albicans MTCC 4748, Aspergillus brasiliensis (niger) MTCC 281 and Issatchenkia orientalis MTCC 3020).

  5. Final Step of Phosphatidic Acid Synthesis in Pea Chloroplasts Occurs in the Inner Envelope Membrane 1

    PubMed Central

    Andrews, Jaen; Ohlrogge, John B.; Keegstra, Kenneth

    1985-01-01

    The second enzyme of phosphatidic acid synthesis from glycerol-3-phosphate, 1-acylglycerophospate acyltransferase, was localized to the inner envelope membrane of pea chloroplasts. The activity of this enzyme was measured by both a coupled enzyme assay and a direct enzyme assay. Using the coupled enzyme assay, phosphatidic acid phosphatase was also localized to the inner envelope membrane, although this enzyme has very low activity in pea chloroplasts. The addition of UDP-galactose to unfractionated pea chloroplast envelope preparations did not result in significant conversion of newly synthesized diacylglycerol to monogalactosyldiacylglycerol. Thus, the envelope synthesized phosphatidic acid may not be involved in galactolipid synthesis in pea chloroplasts. PMID:16664266

  6. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  7. Synthesis of biodegradable polymer-mesoporous silica composite microspheres for DNA prime-protein boost vaccination.

    PubMed

    Ho, Jenny; Huang, Yi; Danquah, Michael K; Wang, Huanting; Forde, Gareth M

    2010-03-18

    DNA vaccines or proteins are capable of inducing specific immunity; however, the translation to the clinic has generally been problematic, primarily due to the reduced magnitude of immune response and poor pharmacokinetics. Herein we demonstrate a composite microsphere formulation, composed of mesoporous silica spheres (MPS) and poly(D,L-lactide-co-glycolide) (PLGA), enables the controlled delivery of a prime-boost vaccine via the encapsulation of plasmid DNA (pDNA) and protein in different compartments. Method with modified dual-concentric-feeding needles attached to a 40 kHz ultrasonic atomizer was studied. These needles focus the flow of two different solutions, which passed through the ultrasonic atomizer. The process synthesis parameters, which are important to the scale-up of composite microspheres, were also studied. These parameters include polymer concentration, feed flowrate, and volumetric ratio of polymer and pDNA-PEI/MPS-BSA. This fabrication technique produced composite microspheres with mean D[4,3] ranging from 6 to 34 microm, depending upon the microsphere preparation. The resultant physical morphology of composite microspheres was largely influenced by the volumetric ratio of pDNA-PEI/MPS-BSA to polymer, and this was due to the precipitation of MPS at the surface of the microspheres. The encapsulation efficiencies were predominantly in the range of 93-98% for pDNA and 46-68% for MPS. In the in vitro studies, the pDNA and protein showed different release kinetics in a 40 day time frame. The dual-concentric-feeding in ultrasonic atomization was shown to have excellent reproducibility. It was concluded that this fabrication technique is an effective method to prepare formulations containing a heterologous prime-boost vaccine in a single delivery system.

  8. RAGE is a nucleic acid receptor that promotes inflammatory responses to DNA

    PubMed Central

    Sirois, Cherilyn M.; Jin, Tengchuan; Miller, Allison L.; Bertheloot, Damien; Nakamura, Hirotaka; Horvath, Gabor L.; Mian, Abubakar; Jiang, Jiansheng; Schrum, Jacob; Bossaller, Lukas; Pelka, Karin; Garbi, Natalio; Brewah, Yambasu; Tian, Jane; Chang, ChewShun; Chowdhury, Partha S.; Sims, Gary P.; Kolbeck, Roland; Coyle, Anthony J.; Humbles, Alison A.

    2013-01-01

    Recognition of DNA and RNA molecules derived from pathogens or self-antigen is one way the mammalian immune system senses infection and tissue damage. Activation of immune signaling receptors by nucleic acids is controlled by limiting the access of DNA and RNA to intracellular receptors, but the mechanisms by which endosome-resident receptors encounter nucleic acids from the extracellular space are largely undefined. In this study, we show that the receptor for advanced glycation end-products (RAGE) promoted DNA uptake into endosomes and lowered the immune recognition threshold for the activation of Toll-like receptor 9, the principal DNA-recognizing transmembrane signaling receptor. Structural analysis of RAGE–DNA complexes indicated that DNA interacted with dimers of the outermost RAGE extracellular domains, and could induce formation of higher-order receptor complexes. Furthermore, mice deficient in RAGE were unable to mount a typical inflammatory response to DNA in the lung, indicating that RAGE is important for the detection of nucleic acids in vivo. PMID:24081950

  9. [The effect of spermine on acid-base equilibrium in DNA molecule].

    PubMed

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  10. Formamide Synthesis through Borinic Acid Catalysed Transamidation under Mild Conditions.

    PubMed

    Dine, Tharwat Mohy El; Evans, David; Rouden, Jacques; Blanchet, Jérôme

    2016-04-18

    A highly efficient and mild transamidation of amides with amines co-catalysed by borinic acid and acetic acid has been reported. A wide range of functionalised formamides was synthesized in excellent yields, including important chiral α-amino acid derivatives, with minor racemisation being observed. Experiments suggested that the reaction rely on a cooperative catalysis involving an enhanced boron-derived Lewis acidity rather than an improved Brønsted acidity of acetic acid.

  11. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  12. Enhanced unscheduled DNA synthesis in UV-irradiated human skin explants treated with T4N5 liposomes

    SciTech Connect

    Yarosh, D.B.; Kibitel, J.T.; Green, L.A.; Spinowitz, A. )

    1991-07-01

    Epidermal keratinocytes cultured from explants of skin cancer patients, including biopsies from xeroderma pigmentosum patients, were ultraviolet light-irradiated and DNA repair synthesis was measured. Repair capacity was much lower in xeroderma pigmentosum patients than in normal patients. The extent of DNA repair replication did not decline with the age of the normal patient. Treatment with T4N5 liposomes containing a DNA repair enzyme enhanced repair synthesis in both normal and xeroderma pigmentosum keratinocytes in an irradiation- and liposome-dose dependent manner. These results provide no evidence that aging people or skin cancer patients are predisposed to cutaneous malignancy by a DNA repair deficiency, but do demonstrate that T4N5 liposomes enhance DNA repair in the keratinocytes of the susceptible xeroderma pigmentosum and skin cancer population.

  13. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  14. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  15. Assessment of DNA synthesis in Islet-1{sup +} cells in the adult murine heart

    SciTech Connect

    Weinberger, Florian Mehrkens, Dennis Starbatty, Jutta Nicol, Philipp Eschenhagen, Thomas

    2015-01-02

    Highlights: • Islet-1 was expressed in the adult heart. • Islet-1-positive cells did not proliferate in the adult heart. • Sinoatrial node cells did not proliferate in the adult heart. - Abstract: Rationale: Islet-1 positive (Islet-1{sup +}) cardiac progenitor cells give rise to the right ventricle, atria and outflow tract during murine cardiac development. In the adult heart Islet-1 expression is limited to parasympathetic neurons, few cardiomyocytes, smooth muscle cells, within the proximal aorta and pulmonary artery and sinoatrial node cells. Its role in these cells is unknown. Here we tested the hypothesis that Islet-1{sup +} cells retain proliferative activity and may therefore play a role in regenerating specialized regions in the heart. Methods and results: DNA synthesis was analyzed by the incorporation of tritiated thymidine ({sup 3}H-thymidine) in Isl-1-nLacZ mice, a transgenic model with an insertion of a nuclear beta-galactosidase in the Islet-1 locus. Mice received daily injections of {sup 3}H-thymidine for 5 days. DNA synthesis was visualized throughout the heart by dipping autoradiography of cryosections. Colocalization of an nLacZ-signal and silver grains would indicate DNA synthesis in Islet-1{sup +} cells. Whereas Islet{sup −} non-myocyte nuclei were regularly marked by accumulation of silver grains, colocalization with nLacZ-signals was not detected in >25,000 cells analyzed. Conclusions: Islet-1{sup +} cells are quiescent in the adult heart, suggesting that, under normal conditions, even pacemaking cells do not proliferate at higher rates than normal cardiac myocytes.

  16. Nicotine inhibits collagen synthesis and alkaline phosphatase activity, but stimulates DNA synthesis in osteoblast-like cells

    SciTech Connect

    Ramp, W.K.; Lenz, L.G.; Galvin, R.J. )

    1991-05-01

    Use of smokeless tobacco is associated with various oral lesions including periodontal damage and alveolar bone loss. This study was performed to test the effects of nicotine on bone-forming cells at concentrations that occur in the saliva of smokeless tobacco users. Confluent cultures of osteoblast-like cells isolated from chick embryo calvariae were incubated for 2 days with nicotine added to the culture medium (25-600 micrograms/ml). Nicotine inhibited alkaline phosphatase in the cell layer and released to the medium, whereas glycolysis (as indexed by lactate production) was unaffected or slightly elevated. The effects on medium and cell layer alkaline phosphatase were concentration dependent with maximal inhibition occurring at 600 micrograms nicotine/ml. Nicotine essentially did not affect the noncollagenous protein content of the cell layer, but did inhibit collagen synthesis (hydroxylation of ({sup 3}H)proline and collagenase-digestible protein) at 100, 300, and 600 micrograms/ml. Release of ({sup 3}H)hydroxyproline to the medium was also decreased in a dose-dependent manner, as was the collagenase-digestible protein for both the medium and cell layer. In contrast, DNA synthesis (incorporation of ({sup 3}H)thymidine) was more than doubled by the alkaloid, whereas total DNA content was slightly inhibited at 600 micrograms/ml, suggesting stimulated cell turnover. Morphologic changes occurred in nicotine-treated cells including rounding up, detachment, and the occurrence of numerous large vacuoles. These results suggest that steps to reduce the salivary concentration of nicotine in smokeless tobacco users might diminish damaging effects of this product on alveolar bone.

  17. cDNA cloning and overexpression of acidic ribosomal phosphoprotein P1 gene (RPLP1) from the giant panda.

    PubMed

    Du, Yu-Jie; Luo, Xiao-Yan; Hao, Yan-Zhe; Zhang, Tian; Hou, Wan-Ru

    2007-10-26

    RPLP1 is one of acidic ribosomal phosphoproteins encoded by RPLP1 gene, which plays an important role in the elongation step of protein synthesis. The cDNA of RPLP1 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using RT-PCR technology, which was also sequenced, analyzed preliminarily and expressed in E.coli. The cDNA fragment cloned is 449bp in size, containing an open reading frame of 344bp encoding 114 amino acids. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to other five species studied, including Homo sapiens, Mus musculus, Rattus norvegicus, Bos Taurus and Sus scrofa. The homologies for nucleotide sequences of Giant Panda PPLP1 to that of these species are 92.4%, 89.8%, 89.0%, 91.3% and 87.5%, while the homologies for amino acid sequences are 96.5%, 94.7%, 95.6%, 96.5% and 88.6%. Topology prediction showed there are three Casein kinase II phosphorylation sites and two N-myristoylation sites in the RPLP1 protein of the Giant Panda (Ailuropoda melanoleuca). The RPLP1 gene was overexpressed in E. coli and the result indicated that RPLP1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 18kDa polypeptide, which was in accordance with the predicted protein and could also be used to purify the protein and study its function.

  18. The nitrosated bile acid DNA lesion O6-carboxymethylguanine is a substrate for the human DNA repair protein O6-methylguanine-DNA methyltransferase

    PubMed Central

    Senthong, Pattama; Millington, Christopher L.; Wilkinson, Oliver J.; Marriott, Andrew S.; Watson, Amanda J.; Reamtong, Onrapak; Eyers, Claire E.; Williams, David M.; Margison, Geoffrey P.; Povey, Andrew C.

    2013-01-01

    The consumption of red meat is a risk factor in human colorectal cancer (CRC). One hypothesis is that red meat facilitates the nitrosation of bile acid conjugates and amino acids, which rapidly convert to DNA-damaging carcinogens. Indeed, the toxic and mutagenic DNA adduct O6-carboxymethylguanine (O6-CMG) is frequently present in human DNA, increases in abundance in people with high levels of dietary red meat and may therefore be a causative factor in CRC. Previous reports suggested that O6-CMG is not a substrate for the human version of the DNA damage reversal protein O6-methylguanine-DNA methyltransferase (MGMT), which protects against the genotoxic effects of other O6-alkylguanine lesions by removing alkyl groups from the O6-position. We now show that synthetic oligodeoxyribonucleotides containing the known MGMT substrate O6-methylguanine (O6-MeG) or O6-CMG effectively inactivate MGMT in vitro (IC50 0.93 and 1.8 nM, respectively). Inactivation involves the removal of the O6-alkyl group and its transfer to the active-site cysteine residue of MGMT. O6-CMG is therefore an MGMT substrate, and hence MGMT is likely to be a protective factor in CRC under conditions where O6-CMG is a potential causative agent. PMID:23335782

  19. Calcium-activated gene transfection from DNA/poly(amic acid-co-imide) complexes.

    PubMed

    Wu, Szu-Yuan; Chang, Li-Ting; Peng, Sydeny; Tsai, Hsieh-Chih

    2015-01-01

    In this study, we synthesized a water-soluble poly(amic acid-co-imide) (PA-I) from ethylenediaminetetraacetic dianhydride (EDTA) and 2,2'-(ethylenedioxy)bis(ethylamine) that possesses comparable transfection efficiency to that of polyethylenimine (PEI), when prepared in combination with divalent calcium cations. The polycondensation of monomers afforded poly(amic acid) (PA) precursors, and subsequent thermal imidization resulted in the formation of PA-I. At a polymer/DNA ratio (indicated by the molar ratio of nitrogen in the polymer to phosphate in DNA) of 40, complete retardation of the DNA band was observed by gel electrophoresis, indicating the strong association of DNA with PA-I. A zeta potential of -22 mV was recorded for the PA-I polymer solution, and no apparent cytotoxicity was observed at concentrations up to 500 μg·mL(-1). In the presence of divalent Ca(2+), the transfection efficiency of PA-I was higher than that of PA, due to the formation of a copolymer/Ca(2+)/DNA polyplex and the reduction in negative charge due to thermal cyclization. Interestingly, a synergistic effect of Ca(2+) and the synthesized copolymer on DNA transfection was observed. The use of Ca(2+) or copolymer alone resulted in unsatisfactory delivery, whereas the formation of three-component polyplexes synergistically increased DNA transfection. Our findings demonstrated that a PA-I/Ca(2+)/DNA polyplex could serve as a promising candidate for gene delivery.

  20. Identification of dairy lactic acid bacteria by tRNAAla-23S rDNA-RFLP.

    PubMed

    Mancini, Andrea; Lazzi, Camilla; Bernini, Valentina; Neviani, Erasmo; Gatti, Monica

    2012-12-01

    The aim of this study was to evaluate the potential of target tRNA(Ala)-23S ribosomal DNA for identification of lactic acid bacteria strains associated with dairy ecosystem. For this purpose tRNA(Ala)-23S ribosomal DNA Restriction Fragment Length Polymorphism (tRNA(Ala)-23S rDNA-RFLP) was compared with two widely used DNA fingerprinting methods - P1 Random Amplified Polymorphic DNA (RAPD), (GTG)5 repetitive extragenic palindromic PCR (rep-PCR) - for their ability to identify different species on a set of 10 type and 34 reference strains. Moreover, 75 unknown isolates collected during different stages of Grana Padano cheese production and ripening were identified using tRNA(Ala)-23S rDNA-RFLP and compared to the RFLP profiles of the strains in the reference database. This study demonstrated that the target tRNA(Ala)-23S rDNA has high potential in bacterial identification and tRNA(Ala)-23S rDNA-RFLP is a promising method for reliable species-level identification of lactic acid bacteria (LAB) in dairy products.

  1. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  2. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  3. Deoxyribonucleic acid (DNA)-Ni-nanostrands composites for EMI shielding

    NASA Astrophysics Data System (ADS)

    Ouchen, Fahima; Wilson, Benjamin G.; Yaney, Perry P.; Salour, Michael M.; Grote, James G.

    2016-09-01

    In this study, we demonstrated the use of DNA-CTMA (DC) in combination with Nickel Nanostrands (NiNs) for application in Electromagnetic Interference (EMI) shielding. The addition of NiNs fillers to DC led to films with higher shielding effectiveness (SE) than when Silver nanoparticles were used. An enhanced EMI shielding effectiveness (SE) was also achieved by the fabrication of the DC-NiNs shielding film structure in a layered architecture. Very thin layer of Guanine ( 60 nm) were inserted between layers of DNA-NiNs ( 100um each) to total a thickness of 500um of the shielding film. An increase of the SE by 6-8 dB for the layered structure as compared to the bulk thick film with NiNs loadings up to 10 wt%. At higher loadings (>10 wt. %), a significant physical degradation of the films was observed for all films regardless of the thickness or the process of fabrication.

  4. Role of amino acid insertions on intermolecular forces between arginine peptide condensed DNA helices: implications for protamine-DNA packaging in sperm.

    PubMed

    DeRouchey, Jason E; Rau, Donald C

    2011-12-09

    In spermatogenesis, chromatin histones are replaced by arginine-rich protamines to densely compact DNA in sperm heads. Tight packaging is considered necessary to protect the DNA from damage. To better understand the nature of the forces condensing protamine-DNA assemblies and their dependence on amino acid content, the effect of neutral and negatively charged amino acids on DNA-DNA intermolecular forces was studied using model peptides containing six arginines. We have previously observed that the neutral amino acids in salmon protamine decrease the net attraction between protamine-DNA helices compared with the equivalent homo-arginine peptide. Using osmotic stress coupled with x-ray scattering, we have investigated the component attractive and repulsive forces that determine the net attraction and equilibrium interhelical distance as a function of the chemistry, position, and number of the amino acid inserted. Neutral amino acids inserted into hexa-arginine increase the short range repulsion while only slightly affecting longer range attraction. The amino acid content alone of salmon protamine is enough to rationalize the forces that package DNA in sperm heads. Inserting a negatively charged amino acid into hexa-arginine dramatically weakens the net attraction. Both of these observations have biological implications for protamine-DNA packaging in sperm heads.

  5. Reagents and methods for the solid-phase synthesis of protein-EDTA (ethylenediaminetetraacetic acid) for use in affinity cleaving

    SciTech Connect

    Sluka, J.P.; Griffin, J.H.; Mack, D.P.; Dervan, P.B. )

    1990-08-15

    Synthetic procedures for the introduction of the metal chelator ethylenediaminetetraacetic acid (EDTA) at unique amino acid positions of proteins by solid-phase methods are described. Two protected derivatives of EDTA compatible with Merrifield solid-phase protein synthesis employing N-tert-butyloxycarbonyl- (Boc-) protected amino acids were developed. The first reagent is a dipeptide with three of four carboxyl groups of EDTA protected as benzyl esters and the fourth coupled to a {gamma}-aminobutanoic acid linker, referred to as tribenzyl-EDTA-GABA (BEG). A second reagent is the tricyclohexyl ester of EDTA, TCE. BEG and TCE allow the modification of the NH{sub 2} terminus and/or lysine side chains of resin-bound peptides and proteins. Upon deprotection and cleavage from the resin, a protein is produced with EDTA at a defined amino acid position. The availability of protein-EDTA conjugates extends the affinity cleaving method to the study of protein-DNA complexes in solution.

  6. Synthesis and antiproliferative activity of some new DNA-targeted alkylating pyrroloquinolines.

    PubMed

    Ferlin, M G; Dalla Via, L; Gia, O M

    2004-02-15

    Two novel DNA-direct alkylating agents, consisting of aniline mustard linked to an angular 3H-pyrrolo[3,2-f]quinoline nucleus, were synthetized and assayed for their in vitro antiproliferative activity. Simple convergent synthesis, consisting of separate preparation of 9-chloro-3H-pyrrolo[3,2-f]quinoline and p-amino-aniline derivatives, and following their linkage by substitution reactions 8a, b and 10, yielded the corresponding diol derivatives 7b and 9. Biological properties were evaluated with respect to cell growth inhibition, ability to form cross-links with DNA, and capacity to give rise to a molecular complex with the macromolecule for 7b, 8b, 9 and 10.

  7. A chemical method for fast and sensitive detection of DNA synthesis in vivo.

    PubMed

    Salic, Adrian; Mitchison, Timothy J

    2008-02-19

    We have developed a method to detect DNA synthesis in proliferating cells, based on the incorporation of 5-ethynyl-2'-deoxyuridine (EdU) and its subsequent detection by a fluorescent azide through a Cu(I)-catalyzed [3 + 2] cycloaddition reaction ("click" chemistry). Detection of the EdU label is highly sensitive and can be accomplished in minutes. The small size of the fluorescent azides used for detection results in a high degree of specimen penetration, allowing the staining of whole-mount preparations of large tissue and organ explants. In contrast to BrdU, the method does not require sample fixation or DNA denaturation and permits good structural preservation. We demonstrate the use of the method in cultured cells and in the intestine and brain of whole animals.

  8. Novel designed enediynes: molecular design, chemical synthesis, mode of cycloaromatization and guanine-specific DNA cleavage.

    PubMed

    Toshima, K; Ohta, K; Kano, T; Nakamura, T; Nakata, M; Kinoshita, M; Matsumura, S

    1996-01-01

    The molecular design and chemical synthesis of novel enediyne molecules related to the neocarzinostatin chromophore (1), and their chemical and DNA cleaving properties are described. The 10-membered enediyne triols 16-18 were effectively synthesized from xylitol (10) in a short step, and found to be quite stable when handled at room temperature. The representative and acylated enediyne 16 was cycloaromatized by 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in cyclohexa-1,4-diene-benzene to give the benzenoid product 21 through a radical pathway. On the other hand, the enediyne 16 was cycloaromatized by diethylamine in dimethyl sulfoxide-Tris-HCl, pH 8.5 buffer to afford another benzenoid product 22 as a diethylamine adduct through a polar pathway. Furthermore, the enediynes 16-18 were found to exhibit guanine-specific DNA cleavage under weakly basic conditions with no additive.

  9. Fabrication of polyurethane molecular stamps for the synthesis of DNA microarray

    NASA Astrophysics Data System (ADS)

    Liu, Zhengchun; He, Quanguo; Xiao, Pengfeng; He, Nongyao; Lu, Zuhong; Bo, Liang

    2001-10-01

    Polyurethane based on polypropylene glycol (PPG) and Toluene diisocyanate (TDI) using 3,3'-dichloride-4,4'- methylenedianiline (MOCA) as the crosslinker is presented for the first time to fabricate molecular stamps (PU stamps) for the synthesis of DNA microarray with contact procedure. The predictability of the process is achieved by utilizing commercially available starting materials. SEM analysis of the morphology of PU stamps and master showed that PU elastometer could replicate subtly the motherboard's patterns with high fidelity. It was proved from the contact angle measurement that PU stamps surface has good affinity with acetonitrile, which guarantee the well-distribution of DNA monomers on patterned stamps. Laser confocal fluorescence microscopy images of oligonucleotide arrays confirmed polyurethane is an excellent material for molecular stamps.

  10. Switchable mechanical DNA ``arms'' operating on nucleic acid scaffolds associated with electrodes or semiconductor quantum dots

    NASA Astrophysics Data System (ADS)

    Pelossof, Gilad; Tel-Vered, Ran; Liu, Xiaoqing; Willner, Itamar

    2013-09-01

    Functional footholds linked to DNA scaffolds associated with surfaces provide nano-engineered assemblies acting as switching devices. By the assembly of a β-cyclodextrin receptor on one foothold, and a ferrocene-modified nucleic acid on a second foothold, the switchable and reversible, fuel-driven activation of ``molecular arms'' proceeds, transduced by electrochemical or optical signals.Functional footholds linked to DNA scaffolds associated with surfaces provide nano-engineered assemblies acting as switching devices. By the assembly of a β-cyclodextrin receptor on one foothold, and a ferrocene-modified nucleic acid on a second foothold, the switchable and reversible, fuel-driven activation of ``molecular arms'' proceeds, transduced by electrochemical or optical signals. Electronic supplementary information (ESI) available: Experimental procedures, time-dependent deactivation of a DNA ``arm'' using a DNA anti-fuel, and control experiments, excluding β-cyclodextrin from the systems. See DOI: 10.1039/c3nr02653a

  11. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis.

    PubMed

    Taggart, David J; Dayeh, Daniel M; Fredrickson, Saul W; Suo, Zucai

    2014-10-01

    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5'-2-deoxyribose-5-phosphate lyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or an 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated -1 or -2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of -2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of -1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase within the non

  12. Acrylamide exposure induces a delayed unscheduled DNA synthesis in germ cells of male mice that is correlated with the temporal pattern of adduct formation in testis DNA

    SciTech Connect

    Sega, G.A.; Generoso, E.E.; Brimer, P.A. )

    1990-01-01

    A study of meiotic and postmeiotic germ-cell-stage sensitivity of male mice to induction of unscheduled DNA synthesis (UDS) by acrylamide showed that DNA repair could be detected in early spermatocytes (after the last scheduled DNA synthesis) through about mid-spermatid stages. No DNA repair could be detected in later stages. The maximum UDS response was observed 6 hr after i.p. exposure and was about 5 times greater than the response measured immediately after treatment. This is the longest delay between chemical treatment and maximum UDS response yet observed in mouse germ cells. There was a linear relationship between the UDS response and acrylamide exposure from 7.8 to 125 mg/kg. By using 14C-labeled acrylamide it was determined that the temporal pattern of adduct formation in testes DNA paralleled that of the UDS response, with maximum binding occurring 4 to 6 hr after exposure. In contrast, the temporal pattern of adduct formation in liver DNA showed maximum binding within 1 to 2 hr after exposure and was an order of magnitude greater than that found for the testis DNA.

  13. Beyond DNA origami: A look on the bright future of nucleic acid nanotechnology

    PubMed Central

    Michelotti, Nicole; Johnson-Buck, Alexander; Manzo, Anthony J.

    2012-01-01

    Nucleic acid nanotechnology exploits the programmable molecular recognition properties of natural and synthetic nucleic acids to assemble structures with nanometer-scale precision. In 2006, DNA origami transformed the field by providing a versatile platform for self-assembly of arbitrary shapes from one long DNA strand held in place by hundreds of short, site-specific (spatially addressable) DNA ”staples”. This revolutionary approach has led to the creation of a multitude of 2D and 3D scaffolds that form the basis for functional nanodevices. Not limited to nucleic acids, these nanodevices can incorporate other structural and functional materials, such as proteins and nanoparticles, making them broadly useful for current and future applications in emerging fields such as nanomedicine, nanoelectronics, and alternative energy. PMID:22131292

  14. Genomewide expression analysis in amino acid-producing bacteria using DNA microarrays.

    PubMed

    Polen, Tino; Wendisch, Volker F

    2004-01-01

    DNA microarray technology has become an important research tool for biotechnology and microbiology. It is now possible to characterize genetic diversity and gene expression in a genomewide manner. DNA microarrays have been applied extensively to study the biology of many bacteria including Escherichia coli, but only recently have they been developed for the Gram-positive Corynebacterium glutamicum. Both bacteria are widely used for biotechnological amino acid production. In this article, in addition to the design and generation of microarrays as well as their use in hybridization experiments and subsequent data analysis, we describe recent applications of DNA microarray technology regarding amino acid production in C. glutamicum and E. coli. We also discuss the impact of functional genomics studies on fundamental as well as applied aspects of amino acid production with C. glutamicum and E. coli.

  15. Stability of the human polymerase δ holoenzyme and its implications in lagging strand DNA synthesis.

    PubMed

    Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

    2016-03-29

    In eukaryotes, DNA polymerase δ (pol δ) is responsible for replicating the lagging strand template and anchors to the proliferating cell nuclear antigen (PCNA) sliding clamp to form a holoenzyme. The stability of this complex is integral to every aspect of lagging strand replication. Most of our understanding comes from Saccharomyces cerevisae where the extreme stability of the pol δ holoenzyme ensures that every nucleobase within an Okazaki fragment is faithfully duplicated before dissociation but also necessitates an active displacement mechanism for polymerase recycling and exchange. However, the stability of the human pol δ holoenzyme is unknown. We designed unique kinetic assays to analyze the processivity and stability of the pol δ holoenzyme. Surprisingly, the results indicate that human pol δ maintains a loose association with PCNA while replicating DNA. Such behavior has profound implications on Okazaki fragment synthesis in humans as it limits the processivity of pol δ on undamaged DNA and promotes the rapid dissociation of pol δ from PCNA on stalling at a DNA lesion.

  16. Synthesis, characterization, and photoactivated DNA cleavage by copper (II)/cobalt (II) mediated macrocyclic complexes.

    PubMed

    Naik, H R Prakash; Naik, H S Bhojya; Aravinda, T; Lamani, D S

    2010-01-01

    We report the synthesis of new photonuclease consisting of two Co(II)/Cu(II) complexes of macrocyclic fused quinoline. Metal complexes are [MLX(2)], type where M = Co(II) (5), Cu(II) (6), and X = Cl, and are well characterized by elemental analysis, Fourier transform infrared spectroscopy, (1)H-NMR and electronic spectra. We have shown that photocleavage of plasmid DNA is markedly enhanced when this ligand is irradiated in the presence of Cu(II), and more so than that of cobalt. The chemistry of ternary and binary Co(II) complexes showing efficient light induced (360 nm) DNA cleavage activity is summarized. The role of the metal in photoinduced DNA cleavage reactions is explored by designing complex molecules having macrocyclic structure. The mechanistic pathways are found to be concentration dependent on Co(II)/Cu(II) complexes and the photoexcitation energy photoredox chemistry. Highly effective DNA cleavage ability of 6 is attributed to the effective cooperation of the metal moiety.

  17. Design and synthesis of fluorescent substrates for human tyrosyl-DNA phosphodiesterase I