Science.gov

Sample records for acid dna synthesis

  1. Role of amidation in bile acid effect on DNA synthesis by regenerating mouse liver.

    PubMed

    Barbero, E R; Herrera, M C; Monte, M J; Serrano, M A; Marin, J J

    1995-06-01

    Effect of bile acids on DNA synthesis by the regenerating liver was investigated in mice in vivo after partial hepatectomy (PH). Radioactivity incorporation into DNA after [14C]thymidine intraperitoneal administration peaked at 48 h after PH. At this time a significant taurocholate-induced dose-dependent reduction in DNA synthesis without changes in total liver radioactivity content was found (half-maximal effect at approximately 0.1 mumol/g body wt). Effect of taurocholate (0.5 mumol/g body wt) was mimicked by chocolate, ursodeoxycholate, deoxycholate, dehydrocholate, tauroursodeoxycholate, taurochenodeoxycholate, and taurodeoxycholate. In contrast, chenodeoxycholate, glycocholate, glycochenodeoxycholate, glycoursodeoxycholate, glycodeoxycholate, 5 beta-cholestane, bromosulfophthalein, and free taurine lacked this effect. No relationship between hydrophobic-hydrophilic balance and inhibitory effect was observed. Analysis by high-performance liquid chromatography indicated that inhibition of thymidine incorporation into DNA was not accompanied by an accumulation of phosphorylated DNA precursors in the liver but rather by a parallel increase in nucleotide catabolism. Bile acid-induced modifications in DNA synthesis were observed in vivo even in the absence of changes in toxicity tests, which suggests that the inhibitory effect shared by most unconjugated and tauroconjugated bile acids but not by glycoconjugated bile acids should be accounted for by mechanisms other than nonselective liver cell injury. PMID:7611405

  2. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  3. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. PMID:24571086

  4. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  5. DNA (DEOXYRIBONUCLEIC ACID) SYNTHESIS FOLLOWING MICROINJECTION OF HETEROLOGOUS SPERM AND SOMATIC CELL NUCLEI INTO HAMSTER OOCYTES

    EPA Science Inventory

    The authors have investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in 3H-thymidine after being parthenogenetically activated by sha...

  6. Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

    PubMed Central

    Horn, T; Chang, C A; Urdea, M S

    1997-01-01

    The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

  7. Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.

    PubMed

    Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus

    2012-10-01

    Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. PMID:22766489

  8. Peptide Nucleic Acid with a Lysine Side Chain at the β-Position: Synthesis and Application for DNA Cleavage.

    PubMed

    Sugiyama, Toru; Kuwata, Keiko; Imamura, Yasutada; Demizu, Yosuke; Kurihara, Masaaki; Takano, Masashi; Kittaka, Atsushi

    2016-01-01

    This paper reports the synthesis of new β-Lys peptide nucleic acid (PNA) monomers and their incorporation into a 10-residue PNA sequence. PNA containing β-Lys PNA units formed a stable hybrid duplex with DNA. However, incorporation of β-Lys PNA units caused destabilization of PNA-DNA duplexes to some extent. Electrostatic attractions between β-PNA and DNA could reduce this destabilization effect. Subsequently, bipyridine-conjugated β-Lys PNA was prepared and exhibited sequence selective cleavage of DNA. Based on the structures of the cleavage products and molecular modeling, we reasoned that bipyridine moiety locates within the minor groove of the PNA-DNA duplexes. The lysine side chain of β-PNA is a versatile handle for attaching various functional molecules. PMID:27373637

  9. DNA (deoxyribonucleic acid) synthesis following microinjection of heterologous sperm and somatic cell nuclei into hamster oocytes

    SciTech Connect

    Naish, S.J.; Perreault, S.D.; Zirkin, B.R.

    1987-01-01

    The authors investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in /sup 3/H-thymidine after being parthenogenetically activated by sham microinjection, or microinjected with hamster, mouse, rabbit, or fish sperm nuclei, or hamster hepatocyte nuclei. Within 6 hr of sham or nucleus microinjection, nuclei of each type underwent transformation into pronuclei and synthesized DNA. These results demonstrated that the hamster egg can access and utilize its own and each type of template provided, whether homologous or heterologous. However, pronuclei derived from hamster sperm nuclei were more likely to be synthesizing DNA at 6 hr than pronuclei derived from sperm nuclei of other species. The authors conclude that the mechanisms employed by the hamster oocyte to transform hamster sperm nuclei into pronuclei and to effect DNA synthesis in these nuclei are not specific for the hamster sperm nucleus. Nevertheless, these mechanisms apparently operate more efficiently when the hamster sperm nucleus, rather than a heterologous sperm nucleus, is present.

  10. Synthesis of chemically modified DNA.

    PubMed

    Shivalingam, Arun; Brown, Tom

    2016-06-15

    Naturally occurring DNA is encoded by the four nucleobases adenine, cytosine, guanine and thymine. Yet minor chemical modifications to these bases, such as methylation, can significantly alter DNA function, and more drastic changes, such as replacement with unnatural base pairs, could expand its function. In order to realize the full potential of DNA in therapeutic and synthetic biology applications, our ability to 'write' long modified DNA in a controlled manner must be improved. This review highlights methods currently used for the synthesis of moderately long chemically modified nucleic acids (up to 1000 bp), their limitations and areas for future expansion. PMID:27284032

  11. Synthesis of herpes simplex virus, vaccinia virus, and adenovirus DNA in isolated HeLa cell nuclei. I. Effect of viral-specific antisera and phosphonoacetic acid.

    PubMed Central

    Bolden, A; Aucker, J; Weissbach, A

    1975-01-01

    Purified nuclei, isolated from appropriately infected HeLa cells, are shown to synthesize large amounts of either herpes simplex virus (HSV) or vaccinia virus DNA in vitro. The rate of synthesis of DNA by nuclei from infected cells is up to 30 times higher than the synthesis of host DNA in vitro by nuclei isolated from uninfected HeLa cells. Thus HSV nuclei obtained from HSV-infected cells make DNA in vitro at a rate comparable to that seen in the intact, infected cell. Molecular hybridization studies showed that 80% of the DNA sequences synthesized in vitro by nuclei from herpesvirus-infected cells are herpesvirus specific. Vaccinia virus nuclei from vaccinia virus-infected cells, also produce comparable percentages of vaccinia virus-specific DNA sequences. Adenovirus nuclei from adenovirus 2-infected HeLa cells, which also synthesize viral DNA in vitro, have been included in this study. Synthesis of DNA by HSV or vaccinia virus nuclei is markedly inhibited by the corresponding viral-specific antisera. These antisera inhibit in a similar fashion the purified herpesvirus-induced or vaccinia virus-induced DNA polymerase isolated from infected cells. Phosphonoacetic acid, reported to be a specific inhibitor of herpesvirus formation and the herpesvirus-induced DNA polymerase, is equally effective as an inhibitor of HSV DNA synthesis in isolated nuclei in vitro. However, we also find phosphonoacetic acid to be an effective inhibitor of vaccinia virus nuclear DNA synthesis and the purified vaccinia virus-induced DNA polymerase. In addition, this compound shows significant inhibition of DNA synthesis in isolated nuclei obtained from adenovirus-infected or uninfected cells and is a potent inhibitor of HeLa cell DNA polymerase alpha. PMID:172658

  12. Synthesis of nucleoside and nucleotide conjugates of bile acids, and polymerase construction of bile acid-functionalized DNA.

    PubMed

    Ikonen, Satu; Macícková-Cahová, Hana; Pohl, Radek; Sanda, Miloslav; Hocek, Michal

    2010-03-01

    Aqueous Sonogashira cross-coupling reactions of 5-iodopyrimidine or 7-iodo-7-deazaadenine nucleosides with bile acid-derived terminal acetylenes linked via an ester or amide tether gave the corresponding bile acid-nucleoside conjugates. Analogous reactions of halogenated nucleoside triphosphates gave directly bile acid-modified dNTPs. Enzymatic incorporation of these modified nucleotides to DNA was successfully performed using Phusion polymerase for primer extension. One of the dNTPs (dCTP bearing cholic acid) was also efficient for PCR amplification. PMID:20165813

  13. The DNA gyrase inhibitors, nalidixic acid and oxolinic acid, prevent iron-mediated repression of catechol siderophore synthesis in Azotobacter vinelandii.

    PubMed

    Page, W J; Patrick, J

    1988-01-01

    Low concentrations of nalidixic acid and oxolinic acid that were just inhibitory to Azotobacter vinelandii growth promoted the production of the catechol siderophores azotochelin and aminochelin, in the presence of normally repressive concentrations of Fe3+. There was a limited effect on the pyoverdin siderophore, azotobactin, where low concentrations of Fe3+ were rendered less repressive, but the repression by higher concentrations of Fe3+ was normal. These drugs did not induce high-molecular-mass iron-repressible outer-membrane proteins and similar effects on the regulation of catechol siderophore synthesis were not produced by novobiocin, coumermycin, or ethidium bromide. The timing of nalidixic acid and Fe3+ addition to iron-limited cells was critical. Nalidixic acid had to be added before iron-repression of catechol siderophore synthesis and before the onset of iron-sufficient growth. Continued production of the catechol siderophores, however, was not due to interference with normal iron uptake. These data indicated that nalidixic acid prevented normal iron-repression of catechol siderophore synthesis but could not reverse iron repression once it had occurred. The possible roles of DNA gyrase activity in the regulation of catechol siderophore synthesis is discussed. PMID:2856355

  14. DNA Three Way Junction Core Decorated with Amino Acids-Like Residues-Synthesis and Characterization.

    PubMed

    Addamiano, Claudia; Gerland, Béatrice; Payrastre, Corinne; Escudier, Jean-Marc

    2016-01-01

    Construction and physico-chemical behavior of DNA three way junction (3WJ) functionalized by protein-like residues (imidazole, alcohol and carboxylic acid) at unpaired positions at the core is described. One 5'-C(S)-propargyl-thymidine nucleotide was specifically incorporated on each strand to react through a post synthetic CuACC reaction with either protected imidazolyl-, hydroxyl- or carboxyl-azide. Structural impacts of 5'-C(S)-functionalization were investigated to evaluate how 3WJ flexibility/stability is affected. PMID:27563857

  15. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  16. Photoelectrochemical synthesis of DNA microarrays

    PubMed Central

    Chow, Brian Y.; Emig, Christopher J.; Jacobson, Joseph M.

    2009-01-01

    Optical addressing of semiconductor electrodes represents a powerful technology that enables the independent and parallel control of a very large number of electrical phenomena at the solid-electrolyte interface. To date, it has been used in a wide range of applications including electrophoretic manipulation, biomolecule sensing, and stimulating networks of neurons. Here, we have adapted this approach for the parallel addressing of redox reactions, and report the construction of a DNA microarray synthesis platform based on semiconductor photoelectrochemistry (PEC). An amorphous silicon photoconductor is activated by an optical projection system to create virtual electrodes capable of electrochemically generating protons; these PEC-generated protons then cleave the acid-labile dimethoxytrityl protecting groups of DNA phosphoramidite synthesis reagents with the requisite spatial selectivity to generate DNA microarrays. Furthermore, a thin-film porous glass dramatically increases the amount of DNA synthesized per chip by over an order of magnitude versus uncoated glass. This platform demonstrates that PEC can be used toward combinatorial bio-polymer and small molecule synthesis. PMID:19706433

  17. Translesion DNA synthesis

    PubMed Central

    Vaisman, Alexandra; McDonald, John P.; Woodgate, Roger

    2014-01-01

    All living organisms are continually exposed to agents that damage their DNA, which threatens the integrity of their genome. As a consequence, cells are equipped with a plethora of DNA repair enzymes to remove the damaged DNA. Unfortunately, situations nevertheless arise where lesions persist, and these lesions block the progression of the cell’s replicase. Under these situations, cells are forced to choose between recombination-mediated “damage avoidance” pathways, or use a specialized DNA polymerase (pol) to traverse the blocking lesion. The latter process is referred to as Translesion DNA Synthesis (TLS). As inferred by its name, TLS not only results in bases being (mis)incorporated opposite DNA lesions, but also downstream of the replicase-blocking lesion, so as to ensure continued genome duplication and cell survival. Escherichia coli and Salmonella typhimurium possess five DNA polymerases, and while all have been shown to facilitate TLS under certain experimental conditions, it is clear that the LexA-regulated and damage-inducible pols II, IV and V perform the vast majority of TLS under physiological conditions. Pol V can traverse a wide range of DNA lesions and performs the bulk of mutagenic TLS, whereas pol II and pol IV appear to be more specialized TLS polymerases. PMID:26442823

  18. Solid-phase synthesis of amidine-substituted phenylbenzimidazoles and incorporation of this DNA binding and recognition motif into amino acid and peptide conjugates.

    PubMed

    Garner, Matthew L; Georgiadis, Taxiarchis M; Li, Jessica Bo; Wang, Tianxiu; Long, Eric C

    2014-05-01

    Amidine-substituted phenylbenzimidazoles are well-established DNA-binding structural motifs that have contributed to the development of diverse classes of DNA-targeted agents; this ring system not only assists in increasing the overall DNA affinity of an agent, but can also influence its site selectivity. Seeking a means to conveniently exploit these attributes, a protocol for the on-resin synthesis of amino acid- and peptide-phenylbenzimidazole-amidine conjugates was developed to facilitate installation of phenylbenzimidazole-amidines into peptide chains during the course of standard solid-phase syntheses. Building from a resin-bound amino acid or peptide on Rink amide resin, 4-formyl benzoic acid was coupled to the resin-bound free amine followed by introduction of 3,4-diamino-N'-hydroxybenzimidamide (in the presence of 1,4-benzoquinone) to construct the benzimidazole heterocycle. Finally, the resin-bound N'-hydroxybenzimidamide functionality was reduced to an amidine via 1 M SnCl2·2H2O in DMF prior to resin cleavage to release final product. This procedure permits the straightforward synthesis of amino acids or peptides that are N-terminally capped by a phenylbenzimidazole-amidine ring system. Employing this protocol, a series of amino acid-phenylbenzimidazole-amidine (Xaa-R) conjugates was synthesized as well as dipeptide conjugates of the general form Xaa-Gly-R (where R is the phenylbenzimidazole-amidine and Xaa is any amino acid). PMID:24562478

  19. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(A)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of know chemical and physical mutagens. Neither retinol or retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 ..mu..M to 50 ..mu..M. Retinol and retinoic acid did not significantly affect 200..mu..g/mL ethyl methanesulfonate (EMS)- or 32 J/m/sup 2/ ultraviolet light (UV)-induced UDS at concentrations ranging from 1..mu..M to 50 ..mu..M. In contrast, retinol and retinoic acid significantly inhibited 2.5 ..mu..g/mL and 5.0 ..mu..g/mL 7,12-dimethyl-benz(a)-anthracene(DMBA)-induced UDS at concentrations of 1..mu..M or greater. Retinol-and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 ..mu..M and 100 ..mu..M. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  20. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(a)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of known chemical and physical mutagens. Neither retinol nor retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 microM to 50 microM. Retinol and retinoic acid did not significantly affect 200 micrograms/mL ethyl methanesulfonate(EMS)- or 32 J/m2 ultraviolet light(UV)-induced UDS at concentrations ranging from 1 microM to 50 microM. In contrast, retinol and retinoic acid significantly inhibited 2.5 micrograms/mL and 5.0 micrograms/mL 7,12-dimethyl-benz(a)anthracene(DMBA)-induced UDS at concentrations of 1 microM or greater. Retinol- and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 microM and 100 microM. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  1. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  2. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  3. Synthesis, physicochemical studies, embryos toxicity and DNA interaction of some new Iron(II) Schiff base amino acid complexes

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; El-Khatib, Rafat M.; Nassr, Lobna A. E.; Abu-Dief, Ahmed M.

    2013-05-01

    New Fe(II) Schiff base amino acid complexes derived from the condensation of o-hydroxynaphthaldehyde with L-alanine, L-phenylalanine, L-aspartic acid, L-histidine and L-arginine were synthesized and characterized by elemental analysis, IR, electronic spectra, and conductance measurements. The stoichiometry and the stability constants of the complexes were determined spectrophotometrically. The investigated Schiff bases exhibited tridentate coordination mode with the general formulae [Fe(HL)2]·nH2O for all amino acids except L-histidine. But in case of L-histidine, the ligand acts as tetradentate ([FeL(H2O)2]·2H2O), where HL = mono anion and L = dianion of the ligand. The structure of the prepared complexes is suggested to be octahedral. The prepared complexes were tested for their toxicity on chick embryos and found to be safe until a concentration of 100 μg/egg with full embryos formation. The interaction between CT-DNA and the investigated complexes were followed by spectrophotometry and viscosity measurements. It was found that, the prepared complexes bind to DNA via classical intercalative mode and showed a different DNA cleavage activity with the sequence: nhi > nari > nali > nasi > nphali. The thermodynamic Profile of the binding of nphali complex and CT-DNA was constructed by analyzing the experimental data of absorption titration and UV melting studies with the McGhee equation, van't Hoff's equation, and the Gibbs-Helmholtz equation.

  4. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei

    2009-01-01

    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  5. An unprecedented Ag-pipemidic acid complex with helical structure: Synthesis, structure and interaction with CT-DNA

    NASA Astrophysics Data System (ADS)

    Li, Meng-Ting; Sun, Jing-Wen; Sha, Jing-Quan; Wu, Hong-Bin; Zhang, Er-Lin; Zheng, Tao-Ye

    2013-08-01

    A new Ag-pipemidic acid complex with helical structure has been prepared and structurally characterized by routine technique. Single-crystal X-ray diffraction analysis shows that there are the left- and right-handed helical chains constructed by Ag ions and PPA drugs along the b direction. And two types of helical chains are connected into 2D layer by sharing pseudo-tetra-nuclear clusters, which are stabilized by PPA-1 molecules as scaffolds. UV study of the interaction of the complex with CT-DNA shows that the title complex can bind to the CT-DNA and exhibits the higher binding constant (Kb) than free HPPA drugs. Additionally, its competitive study with ethidium bromide and the relatively high KSV value also indicates that complex can bind to DNA for the intercalative binding sites.

  6. Unscheduled deoxyribonucleic acid (DNA) synthesis assays for toxicological studies. May 1977-March 1990 (A Bibliography from the NTIS data base). Report for May 1977-March 1990

    SciTech Connect

    Not Available

    1990-04-01

    This bibliography contains citations concerning the unscheduled DNA synthesis (UDS) assay for toxicological studies. UDS assays provide very sensitive measures of damage to DNA by detecting induction of DNA synthesis in non-S-phase cells. UDS toxicological studies analyzing gamma radiation, drugs, pesticides, nerve gas, jet engine fuels, ultraviolet light, chlorated organic compounds, and aromatic compounds are discussed. UDS studies using both human and animal tissue cultures are described. (Contains 57 citations fully indexed and including a title list.)

  7. DNA polymerase-mediated synthesis of unbiased threose nucleic acid (TNA) polymers requires 7-deazaguanine to suppress G:G mispairing during TNA transcription.

    PubMed

    Dunn, Matthew R; Larsen, Andrew C; Zahurancik, Walter J; Fahmi, Nour Eddine; Meyers, Madeline; Suo, Zucai; Chaput, John C

    2015-04-01

    Threose nucleic acid (TNA) is an unnatural genetic polymer capable of undergoing Darwinian evolution to generate folded molecules with ligand-binding activity. This property, coupled with a nuclease-resistant backbone, makes TNA an attractive candidate for future applications in biotechnology. Previously, we have shown that an engineered form of the Archaean replicative DNA polymerase 9°N, known commercially as Therminator DNA polymerase, can copy a three-letter genetic alphabet (A,T,C) from DNA into TNA. However, our ability to transcribe four-nucleotide libraries has been limited by chain termination events that prevent the synthesis of full-length TNA products. Here, we show that chain termination is caused by tG:dG mispairing in the enzyme active site. We demonstrate that the unnatural base analogue 7-deazaguanine (7dG) will suppress tGTP misincorporation by inhibiting the formation of Hoogsteen tG:dG base pairs. DNA templates that contain 7dG in place of natural dG residues replicate with high efficiency and >99% overall fidelity. Pre-steady-state kinetic measurements indicate that the rate of tCTP incorporation is 5-fold higher opposite 7dG than dG and only slightly lower than dCTP incorporation opposite either 7dG or dG. These results provide a chemical solution to the problem of how to synthesize large, unbiased pools of TNA molecules by polymerase-mediated synthesis. PMID:25785966

  8. Synthesis, spectroscopic characterization and in vitro antimicrobial, anticancer and antileishmanial activities as well interaction with Salmon sperm DNA of newly synthesized carboxylic acid derivative, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid

    NASA Astrophysics Data System (ADS)

    Sirajuddin, Muhammad; Ali, Saqib; McKee, Vickie; Ullah, Hameed

    2015-03-01

    This paper stresses on the synthesis, characterization of novel carboxylic acid derivative and its application in pharmaceutics. Carboxylic acid derivatives have a growing importance in medicine, particularly in oncology. A novel carboxylic acid, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid, was synthesized and characterized by elemental analysis, FT-IR, NMR (1H, and 13C), mass spectrometry and single crystal X-ray structural analysis. The structure of the title compound, C11H12N2O6, shows the molecules dimerised by short intramolecular Osbnd H⋯O hydrogen bonds. The compound was screened for in vitro antimicrobial, anticancer, and antileishmanial activities as well as interaction with SS-DNA. The compound was also checked for in vitro anticancer activity against BHK-21, H-157 and HCEC cell lines, and showed significant anticancer activity. The compound was almost non-toxic towards human corneal epithelial cells (HCEC) and did not show more than 7.4% antiproliferative activity when used at the 2.0 μg/mL end concentration. It was also tested for antileishmanial activity against the promastigote form of leishmania major and obtained attractive result. DNA interaction study exposes that the binding mode of the compound with SS-DNA is an intercalative as it results in hypochromism along with minor red shift. A new and efficient strategy to identify pharmacophores sites in carboxylic acid derivative for antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

  9. Synthesis, spectroscopic characterization and in vitro antimicrobial, anticancer and antileishmanial activities as well interaction with Salmon sperm DNA of newly synthesized carboxylic acid derivative, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid.

    PubMed

    Sirajuddin, Muhammad; Ali, Saqib; McKee, Vickie; Ullah, Hameed

    2015-03-01

    This paper stresses on the synthesis, characterization of novel carboxylic acid derivative and its application in pharmaceutics. Carboxylic acid derivatives have a growing importance in medicine, particularly in oncology. A novel carboxylic acid, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid, was synthesized and characterized by elemental analysis, FT-IR, NMR ((1)H, and (13)C), mass spectrometry and single crystal X-ray structural analysis. The structure of the title compound, C11H12N2O6, shows the molecules dimerised by short intramolecular OH⋯O hydrogen bonds. The compound was screened for in vitro antimicrobial, anticancer, and antileishmanial activities as well as interaction with SS-DNA. The compound was also checked for in vitro anticancer activity against BHK-21, H-157 and HCEC cell lines, and showed significant anticancer activity. The compound was almost non-toxic towards human corneal epithelial cells (HCEC) and did not show more than 7.4% antiproliferative activity when used at the 2.0μg/mL end concentration. It was also tested for antileishmanial activity against the promastigote form of leishmania major and obtained attractive result. DNA interaction study exposes that the binding mode of the compound with SS-DNA is an intercalative as it results in hypochromism along with minor red shift. A new and efficient strategy to identify pharmacophores sites in carboxylic acid derivative for antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out. PMID:25536453

  10. Mutagenesis in Oocytes of DROSOPHILA MELANOGASTER. I. Scheduled Synthesis of Nuclear and Mitochondrial DNA and Unscheduled DNA Synthesis

    PubMed Central

    Kelley, Mark R.; Lee, William R.

    1983-01-01

    As a model system for studying mutagenesis, the oocyte of Drosophila melanogaster has exhibited considerable complexity. Very few experiments have been conducted on the effect of exposing oocytes to chemical mutagens, presumably due to their lower mutational response relative to sperm and spermatids. This lower response may be due either to a change in probability of mutation induction per adduct due to a change in the type of DNA repair or to a lower dose of the mutagen to the female germ line. To study molecular dosimetry and DNA repair in the oocyte, the large number of intracellular constituents (mtDNA, RNA, nucleic acid precursors and large quantities of proteins and lipids) must be separated from nuclear DNA. In this paper we present results showing reliable separation of such molecules enabling us to detect scheduled nuclear and mitochondrial DNA synthesis. We also, by understanding the precise timing of such events, can detect unscheduled DNA synthesis (UDS) as a measure of DNA repair. Furthermore, by comparing the UDS results in a repair competent (Ore-R) vs. a repair deficient (mei-9L1 ) strain, we have shown the oocyte capable of DNA repair after treatment with ethyl methanesulfonate (EMS). We conclude that the important determinant of mutation induction in oocytes after treatment with EMS is the time interval between DNA alkylation and DNA synthesis after fertilization, i.e., the interruption of continuous DNA repair. PMID:17246137

  11. Enzymatic synthesis of DNA strands containing α-L-LNA (α-L-configured locked nucleic acid) thymine nucleotides.

    PubMed

    Højland, Torben; Veedu, Rakesh N; Vester, Birte; Wengel, Jesper

    2012-01-01

    We describe the first enzymatic incorporation of an α-L-LNA nucleotide into an oligonucleotide. It was found that the 5'-triphosphate of α-L-LNA is a substrate for the DNA polymerases KOD, 9°N(m), Phusion and HIV RT. Three dispersed α-L-LNA thymine nucleotides can be incorporated into DNA strands by all four polymerases, but they were unable to perform consecutive incorporations of α-L-LNA nucleotides. In addition it was found that primer extension can be achieved using templates containing one α-L-LNA nucleotide. PMID:22679529

  12. Synthesis, spectroscopic characterization and structural investigations of new adduct compound of carbazole with picric acid: DNA binding and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Saravanabhavan, Munusamy; Sathya, Krishnan; Puranik, Vedavati G.; Sekar, Marimuthu

    2014-01-01

    Carbazole picrate (CP), a new organic compound has been synthesized, characterized by various analytical and spectroscopic technique such as FT-IR, UV-Vis, 1H and 13C NMR spectroscopy. An orthorhombic geometry was proposed based on single crystal XRD study. The thermal stability of the crystal was studied by using thermo-gravimetric and differential thermal analyses and found that it was stable up to 170 °C. Further, the newly synthesized title compound was tested for its in vitro antibacterial and antifungal activity against various bacterial and fungal species. Also, the compound was tested for its binding activity with Calf thymus (CT) DNA and the results show a considerable interaction between CP and CT-DNA.

  13. Mechanism for priming DNA synthesis by yeast DNA Polymerase α

    PubMed Central

    Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca

    2013-01-01

    The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895

  14. Short-step chemical synthesis of DNA by use of MMTrS group for protection of 5'-hydroxyl group.

    PubMed

    Shiraishi, Miyuki; Utagawa, Eri; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

    2007-01-01

    4-methoxytrithylthio (MMTrS) group was applied for the appropriately protected four canonical nucleosides. We prepared the phosphoroamidite units by use of these nucleosides and developed the synthesis of oligodeoxynucleotides without any acidic treatment. Moreover, the new DNA synthesis protocol was applied to an automated DNA synthesizer for the synthesis of longer oligodeoxynucleotides. PMID:18029620

  15. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco

    1972-01-01

    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  16. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  17. Synthesis, spectral characterization and DNA binding of Schiff-base metal complexes derived from 2-amino-3-hydroxyprobanoic acid and acetylacetone

    NASA Astrophysics Data System (ADS)

    Hosny, Nasser Mohammed; Hussien, Mostafa A.; Radwan, Fatima M.; Nawar, Nagwa

    2014-11-01

    Four new metal complexes derived from the reaction of Cu(II), Co(II), Ni(II) and Zn(II) acetates with the Schiff-base ligand (H3L) resulted from the condensation of the amino acid 2-amino-3-hydroxyprobanoic acid (serine) and acetylacetone have been synthesized and characterized by, elemental analyses, ES-MS, IR, UV-Vis., 1H NMR, 13C NMR, ESR, thermal analyses (TGA and DTG) and magnetic measurements. The results showed that the Schiff-base ligand acts as bi-negative tridentate through the azomethine nitrogen, the deprotonated carboxylate oxygen and the enolic carbonyl oxygen. The optical band gaps measurements indicated the semi-conducting nature of these complexes. Molecular docking was used to predict the binding between the Schiff base ligand with the receptor of prostate cancer mutant H874Y. The interactions between the Cu(II) complex and calf thymus DNA (CT-DNA) have been studied by UV spectra. The results confirm that the Cu(II) complex binds to CT-DNA in an intercalative mode.

  18. Metal based pharmacologically active agents: Synthesis, structural characterization, molecular modeling, CT-DNA binding studies and in vitro antimicrobial screening of iron(II) bromosalicylidene amino acid chelates

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; El-Khatib, Rafat M.; Nassr, Lobna A. E.; Abu-Dief, Ahmed M.; Ismael, Mohamed; Seleem, Amin Abdou

    2014-01-01

    In recent years, great interest has been focused on Fe(II) Schiff base amino acid complexes as cytotoxic and antitumor drugs. Thus a series of new iron(II) complexes based on Schiff bases amino acids ligands have been designed and synthesized from condensation of 5-bromosalicylaldehyde (bs) and α-amino acids (L-alanine (ala), L-phenylalanine (phala), L-aspartic acid (aspa), L-histidine (his) and L-arginine (arg)). The structure of the investigated iron(II) complexes was elucidated using elemental analyses, infrared, ultraviolet-visible, thermogravimetric analysis, as well as conductivity and magnetic susceptibility measurements. Moreover, the stoichiometry and the stability constants of the prepared complexes have been determined spectrophotometrically. The results suggest that 5-bromosalicylaldehyde amino acid Schiff bases (bs:aa) behave as dibasic tridentate ONO ligands and coordinate to Fe(II) in octahedral geometry according to the general formula [Fe(bs:aa)2]ṡnH2O. The conductivity values between 37 and 64 ohm-1 mol-1 cm2 in ethanol imply the presence of nonelectrolyte species. The structure of the complexes was validated using quantum mechanics calculations based on accurate DFT methods. Geometry optimization of the Fe-Schiff base amino acid complexes showed that all complexes had octahedral coordination. In addition, the interaction of these complexes with (CT-DNA) was investigated at pH = 7.2, by using UV-vis absorption, viscosity and agarose gel electrophoresis measurements. Results indicated that the investigated complexes strongly bind to calf thymus DNA via intercalative mode and showed a different DNA binding according to the sequence: bsari > bshi > bsali > bsasi > bsphali. Moreover, the prepared compounds are screened for their in vitro antibacterial and antifungal activity against three types of bacteria, Escherichia coli, Pseudomonas aeruginosa and Bacillus cereus and three types of anti fungal cultures, Penicillium purpurogenium, Aspergillus

  19. Synthesis, spectroscopic characterization, crystal structure, DNA interaction study and invitro biological screenings of 4-(5-chloro-2-hydroxyphenylamino)-4-oxobut-2-enoic acid

    NASA Astrophysics Data System (ADS)

    Sirajuddin, Muhammad; Nooruddin; Ali, Saqib; McKee, Vickie; Khan, Shahan Zeb; Malook, Khan

    2015-01-01

    The titled compound, 4-(5-chloro-2-hydroxyphenylamino)-4-oxobut-2-enoic acid was synthesized and characterized by various techniques like elemental analyses, FT-IR, NMR (1H, and 13C) and single crystal X-ray structural analysis. The appearance of the OH peak of the carboxylic acid in the FT-IR and NMR spectra conform the formation of the compound. A good agreement was found between the calculated values of C, H, N and found values in elemental analysis that show the purity of the compound. Protons H2 and H3 are in cis conformation with each other as conformed both from 1H NMR as well as from single crystal X-ray analysis. The molecular structure of the title compound, C10H10NO3Cl, is stabilized by short intramolecular Osbnd H- - -O hydrogen bonds within the molecule. In the crystal structure, intermolecular Nsbnd H- - -O hydrogen bonds link molecules into zigzag chains resulting in a dendrimer like structure. The title compound was screened for biological activities like interaction with DNA, cytotoxicity, antitumor and antioxidant activities. DNA interaction study reveals that the binding mode of interaction of the compound with SS-DNA is intercalative as it results in hypochromism along with significant red shift of 5 nm. It was also found to be effective antioxidant of 2,2-diphenyl-1-picrylhydrazyl radical (DPPH) and show almost comparable antioxidant activity to that of the standard and known antioxidant, ascorbic acid, at higher concentration. The antitumor activity data of the compound shows that it can be used as potent antitumor agent.

  20. Synthesis, spectroscopic characterization, crystal structure, DNA interaction study and invitro biological screenings of 4-(5-chloro-2-hydroxyphenylamino)-4-oxobut-2-enoic acid.

    PubMed

    Sirajuddin, Muhammad; Nooruddin; Ali, Saqib; McKee, Vickie; Khan, Shahan Zeb; Malook, Khan

    2015-01-01

    The titled compound, 4-(5-chloro-2-hydroxyphenylamino)-4-oxobut-2-enoic acid was synthesized and characterized by various techniques like elemental analyses, FT-IR, NMR ((1)H, and (13)C) and single crystal X-ray structural analysis. The appearance of the OH peak of the carboxylic acid in the FT-IR and NMR spectra conform the formation of the compound. A good agreement was found between the calculated values of C, H, N and found values in elemental analysis that show the purity of the compound. Protons H2 and H3 are in cis conformation with each other as conformed both from (1)H NMR as well as from single crystal X-ray analysis. The molecular structure of the title compound, C₁₀H₁₀NO₃Cl, is stabilized by short intramolecular OH---O hydrogen bonds within the molecule. In the crystal structure, intermolecular NH---O hydrogen bonds link molecules into zigzag chains resulting in a dendrimer like structure. The title compound was screened for biological activities like interaction with DNA, cytotoxicity, antitumor and antioxidant activities. DNA interaction study reveals that the binding mode of interaction of the compound with SS-DNA is intercalative as it results in hypochromism along with significant red shift of 5 nm. It was also found to be effective antioxidant of 2,2-diphenyl-1-picrylhydrazyl radical (DPPH) and show almost comparable antioxidant activity to that of the standard and known antioxidant, ascorbic acid, at higher concentration. The antitumor activity data of the compound shows that it can be used as potent antitumor agent. PMID:25022495

  1. Synthesis and characterization of transition metal 2,6-pyridinedicarboxylic acid derivatives, interactions of Cu(II) and Ni(II) complexes with DNA in vitro

    NASA Astrophysics Data System (ADS)

    Khan, Sadaf; Nami, Shahab A. A.; Siddiqi, K. S.; Husain, Eram; Naseem, Imrana

    2009-03-01

    Mononuclear complexes M(L)Cl 2 where M = Mn(II), Fe(II), Co(II), Ni(II) and Cu(II) and (L = N,N-diethylpiperazinyl,2,6-pyridinedicarboxylate), have been synthesized and characterized by elemental analysis, FT-IR, 1H NMR spectroscopy, UV-vis, magnetic moment, TGA/DSC, cyclic voltammetry and conductivity measurement data. The spectral data suggests that the dipicolinic acid acts as a bidentate ligand and is coordinated to the metal ion through the carboxylate oxygen. The cyclic voltammogram for Cu(L)Cl 2 complex was found to display two reversible Cu(II)/Cu(I) and Cu(II)/Cu(III) redox couple. The ligand exhibits a two-step thermolytic pattern while the complexes decompose in three stages respectively. An octahedral geometry has been proposed for both the complexes. The investigation of the interaction of the complexes with calf thymus DNA has been performed with absorption spectroscopy and fluorescence quenching experiments, which showed that the complexes are avid binders of calf thymus DNA. Also the interaction of the Cu(II) and Ni(II) complexes with plasmid DNA (pUC 19) was studied using agarose gel electrophoresis. The results revealed that these complexes can act as effective DNA cleaving agents resulting in the nicked form of DNA (pUC 19) under physiological conditions. The gel was run both in the absence and presence of an oxidizing agent (H 2O 2). The ligand and its complexes have also been screened against microbes in order to study their antibacterial action. The results revealed that the Cu(II) complex has activity comparable with the reference drugs gentamycin and flucanzole.

  2. Human acidic ribosomal phosphoproteins P0, P1, and P2: Analysis of cDNA clones, in vitro synthesis, and assembly

    SciTech Connect

    Rich, B.E.; Steitz, J.A.

    1987-11-01

    cDNA clones encoding three antigenically related human ribosomal phosophoproteins (P-proteins) P0, P1, and P2 were isolated and sequenced. P1 and P2 are analogous to Escherichia coli ribosomal protein L7/L12, and P0 is likely to be an analog of L10. The three proteins have a nearly identical carboxy-terminal 17-amino-acid sequence (KEESEESD(D/E)DMGFGLFD-COOH) that is the basis of their immunological cross-reactivity. The identifies of the P1 and P2 cDNAs were confirmed by the strong similarities of their encoded amino acid sequences to published primary structures of the homologous rat, brine shrimp, and Saccharomyces cerevisiae proteins. The P0 cDNA was initially identified by translation of hybrid-selected mRNA and immunoprecipitation of the products. To demonstrate that the coding sequences are full length, the P0, P1, and P2 cDNAs were transcribed in vitro by bacteriophage T7 RNA polymerase and the resulting mRNAs were translated in vitro. The synthetic P0, P1, and P2 proteins were serologically and electrophoretically identical to P-proteins extracted from HeLa cells. These synthetic P-proteins were incorporated into 60S but not 40S ribosomes and also assembled into a complex similar to that described for E. coli L7/L12 and L10.

  3. Synthesis, structure elucidation, biological screening, molecular modeling and DNA binding of some Cu(II) chelates incorporating imines derived from amino acids

    NASA Astrophysics Data System (ADS)

    Abdel-Rahman, Laila H.; Abu-Dief, Ahmed M.; Ismael, Mohammed; Mohamed, Mounir A. A.; Hashem, Nahla Ali

    2016-01-01

    Three tridentate Schiff bases amino acids were prepared by direct condensation of 3-methoxysalicylaldehyde (MS) or 4-diethylaminosalicylaldehyde (DS) with α-amino acid ligands [L-phenylalanine (P), L-histidine (H) and DL-tryptophan (T)]. The prepared Schiff bases amino acids were investigated by melting points, elemental analysis, 1HNMR and 13CNMR, IR, UV-Vis spectra, conductivity and magnetic measurements analyses. Subsequently, copper was introduced and Cu(II) complexes formed. These complexes were analyzed by thermal and elemental analyses and further investigated by FT-IR and UV/Vis spectroscopies. The experimental results indicating that all Cu(II) complexes contain hydrated water molecules (except DSPCu complex) and don't contain coordinated water molecules. The kinetic and thermal parameters were extracted from the thermal data using Coast and Redfern method. The molar conductance values of the Schiff base amino acid ligands and their Cu(II) complexes were relatively low, showing that these compounds have non-electrolytic nature. Magnetic susceptibility measurements showed the diamagnetic nature of the Schiff base amino acid ligands and paramagnetic nature of their complexes. Additionally, a spectrophotometric method was determined to extract their stability constants. It was found that the complexes possess 1:2 (M:L) stoichiometry. The results suggested that 3-methoxysalicylaldehyde and 4-diethylaminosalicylaldehyde amino acid Schiff bases behave as monobasic tridentate ONO ligands and coordinate Cu(II) ions in octahedral geometry according to the general formula [Cu(HL)2]·nH2O. To further understanding the structural and electronic properties of these complexes, Density Functional Theory (DFT) calculations were employed and provided a satisfactory description. The optimized structures of MST Schiff base ligand and its complex were calculated using DFT. The antimicrobial activity of the Schiff base ligands and their complexes were screened against some

  4. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  5. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  6. Hydroxamic acids in asymmetric synthesis.

    PubMed

    Li, Zhi; Yamamoto, Hisashi

    2013-02-19

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  7. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  8. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  9. Intermediates in the Synthesis of Type 2 Adenovirus Deoxyribonucleic Acid

    PubMed Central

    Horwitz, Marshall S.

    1971-01-01

    Intermediates in the synthesis of adenovirus type 2 deoxyribonucleic acid (DNA) were studied in HeLa cells. Pieces of DNA smaller than the viral genome were demonstrated after labeling with 3H-thymidine for 10 to 240 sec. Intermediates as small as the Okazaki fragments (8 to 10S) do not predominate at any of the above times. No detectable addition of nucleotides to parental genome could be shown, nor was there any breakdown of recently synthesized viral DNA. The DNA intermediates were of viral origin for they hybridized to viral DNA and were made at a stage of the cell cycle (G2) when host DNA is not synthesized. PMID:5132696

  10. Synthesis of novel MMT/acyl-protected nucleo alanine monomers for the preparation of DNA/alanyl-PNA chimeras

    PubMed Central

    Roviello, G. N.; Gröschel, S.; Pedone, C.

    2009-01-01

    Alanyl-peptide nucleic acid (alanyl-PNA)/DNA chimeras are oligomers envisaged to be beneficial in efficient DNA diagnostics based on an improved molecular beacon concept. A synthesis of alanyl-PNA/DNA chimera can be based on the solid phase assembly of the oligomer with mixed oligonucleotide/peptide backbone under DNA synthesis conditions, in which the nucleotides are introduced as phosphoramidites, whereas the nucleo amino acids make use of the acid labile monomethoxytrityl (MMT) group for temporary protection of the α-amino groups and acyl protecting groups for the exocyclic amino functions of the nucleobases. In this work, we realized for the first time the synthesis of all four MMT/acyl-protected nucleo alanines, achieved by deprotection/reprotection of the newly synthesized Boc/acyl intermediates, useful monomers for the obtainment of (alanyl-PNA)/DNA chimeras by conditions fully compatible with the standard phosphoramidite DNA synthesis strategy. PMID:19629638

  11. Mechanism of Shope Fibroma Virus-Induced Suppression of Host Deoxyribonucleic Acid Synthesis

    PubMed Central

    Chan, James C.; Hodes, M. E.

    1973-01-01

    The effects of treatment with live or inactivated Shope fibroma virus on host cell deoxyribonucleic acid (DNA) synthesis were determined. The incorporation of 3H-thymidine into nuclear DNA was suppressed by both active and inactivated virus, although live virus was more effective. During the early phase of infection, stimulation of host nuclear DNA synthesis of up to 240% of control value was observed in cells infected with active virus. Inhibition of DNA synthesis began at about the 8th h and was maximal by 12 h postinfection. Virus inactivated by ultraviolet-irradiation or heat treatment did not induce viral DNA synthesis but was, nevertheless, able to suppress host DNA synthesis. PMID:4202660

  12. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  13. Initiator RNA in Discontinuous Polyoma DNA Synthesis*

    PubMed Central

    Reichard, Peter; Eliasson, Rolf; Söderman, Gunilla

    1974-01-01

    During replication of polyoma DNA in isolated nuclei, RNA was found attached to the 5′ ends of growing progeny strands. This RNA starts with either ATP or GTP and can be labeled at its 5′ end with 32P from β-labeled nucleotides. Digestion of progeny strands with pancreatic DNase released 32P-labeled RNA that, on gel electrophoresis, gave a distinct peak in the position expected for a decanucleotide. We believe that this short RNA is involved in the initiation of the discontinuous synthesis of DNA and propose the name “initiator RNA” for it. The covalent linkage of initiator RNA to 5′ ends of growing DNA chains was substantiated by the finding that 32P was transferred to ribonucleotides by alkaline hydrolysis of purified initiator RNA obtained by DNase digestion of polyoma progeny strands synthesized from [α-32P]dTTP. While initiator RNA was quite homogeneous in size, it had no unique base sequence since digestion with pancreatic RNase of initiator RNA labeled at its 5′ end with 32P released a variety of different [32P]oligonucleotides. The switch from RNA to DNA synthesis during strand elongation may thus depend on the size of initiator RNA rather than on a specific base sequence. PMID:4373733

  14. Synthesis, spectroscopic, X-ray crystal structure, biological and DNA interaction studies of organotin(IV) complexes of 2-(4-ethoxybenzylidene) butanoic acid.

    PubMed

    Tariq, Muhammad; Muhammad, Niaz; Ali, Saqib; Shirazi, Jafir Hussain; Tahir, Muhammad Nawaz; Khalid, Nasir

    2014-03-25

    Six organotin(IV) carboxylates of the type R2SnL2 [R=CH3 (1), n-C4H9 (2), n-C8H17 (3)] and R3SnL [R=CH3 (4), n-C4H9 (5), C6H5 (6), where L=2-(4-ethoxybenzylidene) butanoic acid, have been synthesized and characterized by elemental analysis, FT-IR and NMR ((1)H, (13)C). The complex (1) was also analyzed by single crystal X-ray analysis. The complexes were screened for antimicrobial, cytotoxic and anti-tumor activities. The results showed significant activity in each area of the activity with few exceptions. DNA interactions studies of ligand HL and representative complex 2 were investigated by UV-Visible absorption spectroscopy and viscosity measurements. The results showed that both ligand HL and complex 2 interact with SS-DNA via intercalation as well as minor groove binding. PMID:24322756

  15. Synthesis of DNA oligonucleotides containing C5-ethynylbenzenesulfonamide-modified nucleotides (EBNA) by polymerases towards the construction of base functionalized nucleic acids.

    PubMed

    Goubet, Astrid; Chardon, Antoine; Kumar, Pawan; Sharma, Pawan K; Veedu, Rakesh N

    2013-02-01

    C5-Ethynylbenzenesulfonamide-modified nucleotide (EBNA) was investigated as substrate of various DNA polymerases. The experiments revealed that KOD, Phusion and Klenow DNA polymerases successfully accepted EBNA-T nucleotide as a substrate and yielded the fully extended DNA. KOD DNA polymerase was found to be the most efficient enzyme to furnish EBNA-T containing DNA in good yields. Phusion DNA polymerase efficiently amplified the template containing EBNA-T nucleotides by PCR. PMID:23265899

  16. Synthesis and dissolution of hemicatenanes by type IA DNA topoisomerases

    PubMed Central

    Lee, Shun-Hsiao; Siaw, Grace Ee-Lu; Willcox, Smaranda; Griffith, Jack D.; Hsieh, Tao-Shih

    2013-01-01

    Type IA DNA topoisomerases work with a unique mechanism of strand passage through an enzyme-bridged, ssDNA gate, thus enabling them to carry out diverse reactions in processing structures important for replication, recombination, and repair. Here we report a unique reaction mediated by an archaeal type IA topoisomerase, the synthesis and dissolution of hemicatenanes. We cloned, purified, and characterized an unusual type IA enzyme from a hyperthermophilic archaeum, Nanoarchaeum equitans, which is split into two pieces. The recombinant heterodimeric enzyme has the expected activities in its preference of relaxing negatively supercoiled DNA. Its amino acid sequence and cleavage site sequence analysis suggest that it is topoisomerase III, and therefore we named it “NeqTop3.” At high enzyme concentrations, NeqTop3 can generate high-molecular-weight DNA networks. Biochemical and electron microscopic data indicate that the DNA networks are connected through hemicatenane linkages. The hemicatenane formation likely is mediated by the single-strand passage through denatured bubbles in the substrate DNA under high temperature. NeqTop3 at lower concentrations can reverse hemicatenanes. A complex of human topoisomerase 3α, Bloom helicase, and RecQ-mediated genome instability protein 1 and 2 can partially disentangle the hemicatenane network. Both the formation and dissolution of hemicatenanes by type IA topoisomerases demonstrate that these enzymes have an important role in regulating intermediates from replication, recombination, and repair. PMID:24003117

  17. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  18. DNA Nanoparticles for Improved Protein Synthesis In Vitro

    PubMed Central

    Galinis, Robertas; Stonyte, Greta; Kiseliovas, Vaidotas; Zilionis, Rapolas; Studer, Sabine; Hilvert, Donald; Janulaitis, Arvydas

    2016-01-01

    Abstract The amplification and digital quantification of single DNA molecules are important in biomedicine and diagnostics. Beyond quantifying DNA molecules in a sample, the ability to express proteins from the amplified DNA would open even broader applications in synthetic biology, directed evolution, and proteomics. Herein, a microfluidic approach is reported for the production of condensed DNA nanoparticles that can serve as efficient templates for in vitro protein synthesis. Using phi29 DNA polymerase and a multiple displacement amplification reaction, single DNA molecules were converted into DNA nanoparticles containing up to about 104 clonal gene copies of the starting template. DNA nanoparticle formation was triggered by accumulation of inorganic pyrophosphate (produced during DNA synthesis) and magnesium ions from the buffer. Transcription–translation reactions performed in vitro showed that individual DNA nanoparticles can serve as efficient templates for protein synthesis in vitro. PMID:26821778

  19. Effect of Poliovirus on Deoxyribonucleic Acid Synthesis in HeLa Cells

    PubMed Central

    Ackermann, W. W.; Cox, D. C.; Kurtz, H.; Powers, C. D.; Davies, S. J.

    1966-01-01

    Ackermann, W. W. (University of Michigan, Ann Arbor), D. C. Cox, H. Kurtz, C. D. Powers, and S. J. Davies. Effect of poliovirus on deoxyribonucleic acid synthesis in HeLa cells. J. Bacteriol. 91:1943–1952. 1966.—Both poliovirus and arginine stimulated deoxyribonucleic acid (DNA) synthesis in cultures of HeLa cells which were preconditioned by incubation in a medium deficient in arginine. However, the number of cells producing DNA was unaffected. DNA synthesis in such preconditioned cells was 10 to 20% of the maximal value obtained with a full complement of amino acids. Inhibition of DNA synthesis was produced in these cultures either by increasing the multiplicity of exposure above 40 plaque-forming units of virus per cell or by increasing the concentration of the deficient amino acid at the time of virus addition. Inhibition of DNA synthesis resulted from a reduction in the fraction of cells producing DNA. The concentration of arginine required for viral inhibition of DNA synthesis is greater than that for viral multiplication. PMID:4287076

  20. An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

    PubMed Central

    Carballeira, Néstor M.; Sanabria, David; Oyola, Delise

    2006-01-01

    An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

  1. Synthesis, spectroscopic characterization and structural investigations of a new charge transfer complex of 2,6-diaminopyridine with 3,5-dinitrobenzoic acid: DNA binding and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Khan, Ishaat M.; Ahmad, Afaq; Kumar, Sarvendra

    2013-03-01

    A new charge transfer (CT) complex [(DAPH)+(DNB)-] consisting of 2,6-diaminopyridine (DAP) as donor and 3,5-dinitrobenzoic acid (DNB-H) as acceptor, was synthesized and characterized by FTIR, 1H and 13C NMR, ESI mass spectroscopic and X-ray crystallographic techniques. The hydrogen bonding (N+-H⋯O-) plays an important role to consolidate the cation and anion together. CT complex shows a considerable interaction with Calf thymus DNA. The CT complex was also tested for its antibacterial activity against two Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa strains by using Tetracycline as standard, and antifungal property against Aspergillus niger, Candida albicans, and Penicillium sp. by using Nystatin as standard. The results were compared with standard drugs and significant conclusions were obtained. A polymeric net work through H-bonding interactions between neighboring moieties was observed. This has been attributed to the formation of 1:1 type CT complex.

  2. Synthesis of new polysialic acid derivatives.

    PubMed

    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke

    2010-09-01

    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  3. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  4. Cell Division During Inhibition of Deoxyribonucleic Acid Synthesis in Escherichia coli

    PubMed Central

    Helmstetter, Charles E.; Pierucci, Olga

    1968-01-01

    When cultures of Escherichia coli B/r growing at various rates were exposed to ultraviolet light, mitomycin C, or nalidixic acid, deoxyribonucleic acid (DNA) synthesis stopped but cell division continued for at least 20 min. The chromosome configurations in the cells which divided were estimated by determining the rate of DNA synthesis during the division cycle. The cultures were pulse-labeled with 14C-thymidine, and the amount of label incorporated into cells of different ages was found by measuring the radioactivity in cells born subsequent to the labeling period. The cells which divided in the absence of DNA synthesis were those which had completed a round of chromosome replication prior to the treatments. It was concluded that completion of a round of replication is a necessary and sufficient condition of DNA synthesis for cell division. PMID:4870278

  5. Total synthesis of (+)-zaragozic acid C.

    PubMed

    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G

    2000-10-20

    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  6. Inhibitory effect of benzene metabolites on nuclear DNA synthesis in bone marrow cells

    SciTech Connect

    Lee, E.W.; Johnson, J.T.; Garner, C.D. )

    1989-01-01

    Effects of endogenously produced and exogenously added benzene metabolites on the nuclear DNA synthetic activity were investigated using a culture system of mouse bone marrow cells. Effects of the metabolites were evaluated by a 30-min incorporation of ({sup 3}H)thymidine into DNA following a 30-min interaction with the cells in McCoy's 5a medium with 10% fetal calf serum. Phenol and muconic acid did not inhibit nuclear DNA synthesis. However, catechol, 1,2,4-benzenetriol, hydroquinone, and p-benzoquinone were able to inhibit 52, 64, 79, and 98% of the nuclear DNA synthetic activity, respectively, at 24 {mu}M. In a cell-free DNA synthetic system, catechol and hydroquinone did not inhibit the incorporation of ({sup 3}H)thymidine triphosphate into DNA up to 24 {mu}M but 1,2,4-benzenetriol and p-benzoquinone did. The effect of the latter two benzene metabolites was completely blocked in the presence of 1,4-dithiothreitol (1 mM) in the cell-free assay system. Furthermore, when DNA polymerase {alpha}, which requires a sulfhydryl (SH) group as an active site, was replaced by DNA polymerase 1, which does not require an SH group for its catalytic activity, p-benzoquinone and 1,2,4-benzenetriol were unable to inhibit DNA synthesis. Thus, the data imply the p-benzoquinone and 1,2,4-benzenetriol inhibited DNA polymerase {alpha}, consequently resulting in inhibition of DNA synthesis in both cellular and cell-free DNA synthetic systems. The present study identifies catechol, hydroquinone, p-benzoquinone, and 1,2,4-benzenetriol as toxic benzene metabolites in bone marrow cells and also suggests that their inhibitory action on DNA synthesis is mediated by mechanism(s) other than that involving DNA damage as a primary cause.

  7. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  8. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  9. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  10. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  11. Enantioselective Total Synthesis of Secalonic Acid E.

    PubMed

    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F

    2015-11-16

    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  12. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  13. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  14. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  15. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  16. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  17. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  18. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H

    1988-01-01

    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  19. Fractional synthesis rates of DNA and protein in rabbit skin are not correlated.

    PubMed

    Zhang, Xiao-jun; Chinkes, David L; Wu, Zhanpin; Martini, Wenjun Z; Wolfe, Robert R

    2004-09-01

    We developed a method for measurement of skin DNA synthesis, reflecting cell division, in conscious rabbits by infusing D-[U-(13)C(6)]glucose and L-[(15)N]glycine. Cutaneous protein synthesis was simultaneously measured by infusion of L-[ring-(2)H(5)]phenylalanine. Rabbits were fitted with jugular venous and carotid arterial catheters, and were studied during the infusion of an amino acid solution (10% Travasol). The fractional synthetic rate (FSR) of DNA from the de novo nucleotide synthesis pathway, a reflection of total cell division, was 3.26 +/- 0.59%/d in whole skin and 3.08 +/- 1.86%/d in dermis (P = 0.38). The de novo base synthesis pathway accounted for 76 and 60% of the total DNA FSR in whole skin and dermis, respectively; the contribution from the base salvage pathway was 24% in whole skin and 40% in dermis. The FSR of protein in whole skin was 5.35 +/- 4.42%/d, which was greater (P < 0.05) than that in dermis (2.91 +/- 2.52%/d). The FSRs of DNA and protein were not correlated (P = 0.33), indicating that cell division and protein synthesis are likely regulated by different mechanisms. This new approach enables investigations of metabolic disorders of skin diseases and regulation of skin wound healing by distinguishing the 2 principal components of skin metabolism, which are cell division and protein synthesis. PMID:15333735

  20. Function of DNA polymerase I in RNA-primed synthesis of bacteriophage M-13 duplex DNA.

    PubMed Central

    Schneck, P K; Staudenbauer, W L; Hofschneider, P H

    1976-01-01

    Cell-free extracts from Escherichia coli contain a DNA polymerase activity resistant to SH-blocking agents, which is capable of synthesizing complementary strand DNA on a circular M-13 DNA template by extension of RNA primers. This activity is considered to be identical with DNA polymerase I (or some altered form of this enzyme) since it is missing in extracts from po1A- cells. DNA synthesis in the presence of SH-blocking agents occurs at a reduced rate as compared to untreated controls and leads to the formation of DNA chains of defined size (0.4-0.5 genome's length). It is concluded that efficient M-13 duplex DNA synthesis requires the cooperation of both DNA polymerase I and III. PMID:1272793

  1. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  2. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  3. Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

    SciTech Connect

    Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

    1985-01-01

    Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.

  4. Amino Acid Racemization and the Preservation of Ancient DNA

    NASA Technical Reports Server (NTRS)

    Poinar, Hendrik N.; Hoss, Matthias

    1996-01-01

    The extent of racemization of aspartic acid, alanine, and leucine provides criteria for assessing whether ancient tissue samples contain endogenous DNA. In samples in which the D/L ratio of aspartic acid exceeds 0.08, ancient DNA sequences could not be retrieved. Paleontological finds from which DNA sequences purportedly millions of years old have been reported show extensive racemization, and the amino acids present are mainly contaminates. An exception is the amino acids in some insects preserved in amber.

  5. Synthesis of carbon-13-labeled tetradecanoic acids.

    PubMed

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  6. PROLINE IS REQUIRED FOR THE STIMULATION OF DNA SYNTHESIS IN HEPATOCYTE CULTURES BY EGF (EPIDERMAL GROWTH FACTOR)

    EPA Science Inventory

    Epidermal growth factor (EGF) has been shown to stimulate DNA synthesis in rat parenchymal hepatocytes both in vivo and in vitro (4,9). The authors report here that this response in vitro is dependent on the amino acids present in the media. Of all the amino acids, proline has th...

  7. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  8. Translesion DNA synthesis in the context of cancer research

    PubMed Central

    2011-01-01

    During cell division, replication of the genomic DNA is performed by high-fidelity DNA polymerases but these error-free enzymes can not synthesize across damaged DNA. Specialized DNA polymerases, so called DNA translesion synthesis polymerases (TLS polymerases), can replicate damaged DNA thereby avoiding replication fork breakdown and subsequent chromosomal instability. We focus on the involvement of mammalian TLS polymerases in DNA damage tolerance mechanisms. In detail, we review the discovery of TLS polymerases and describe the molecular features of all the mammalian TLS polymerases identified so far. We give a short overview of the mechanisms that regulate the selectivity and activity of TLS polymerases. In addition, we summarize the current knowledge how different types of DNA damage, relevant either for the induction or treatment of cancer, are bypassed by TLS polymerases. Finally, we elucidate the relevance of TLS polymerases in the context of cancer therapy. PMID:22047021

  9. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  10. Stimulation of adrenal DNA synthesis in cadmium-treated male rats

    SciTech Connect

    Nishiyama, S.; Nakamura, K.

    1984-07-01

    Cadmium chloride (CdCl2) at a dose of 1 mg/kg body wt was injected into male rats of the Wistar strain, weighing 250 g on the average, twice a day (12-hr intervals) for 7 consecutive days. DNA and RNA contents and (/sup 3/H)-thymidine and (/sup 3/H)-uridine incorporation into the acid-insoluble fraction significantly increased in the adrenals of rats treated with Cd for 2 and 7 consecutive days. Adrenal protein content and weight also significantly increased. These results indicate that continued treatment with Cd stimulates DNA and RNA synthesis in the adrenal cortex, which in turn results in the increase of the total protein contents of the adrenal gland and subsequently in the enlargement of the gland. Serum adrenocorticotrophin (ACTH) and insulin levels in Cd-treated rats were not higher than control levels, suggesting that the stimulation of DNA synthesis in the adrenals of Cd-treated rats is due to factor(s) other than serum ACTH and insulin. Treatment with Cd inhibited DNA synthesis in cultured adrenocortical cells at concentrations of 10(-4) to 10(-8) M, suggesting that Cd does not directly stimulate DNA synthesis in the adrenal gland in vivo. Although the adrenal gland became enlarged, the total adrenal corticosterone content decreased significantly. The decrease of total adrenal corticosterone content may be due to the fall in serum ACTH level of Cd-treated rats.

  11. Purification, characterization and biological activity of tulipin, a novel inhibitor of DNA synthesis of plant origin.

    PubMed

    Gasperi-Campani, A; Lorenzoni, E; Abbondanza, A; Perocco, P; Falasca, A I

    1987-01-01

    A DNA synthesis-inhibiting protein (for which the term tulipin is proposed) was isolated from the bulbs of Tulipa sp. The yield ranged from 3.4 to 4.1 per cent of total protein content of the crude extract. Mr, isoelectric point, neutral and amino sugar and amino acid composition were determined. Inhibition of DNA synthesis varied in intact cells according to the cellular types studied, with a minimum ID 50% (concentration giving 50% inhibition) of 400 ng/ml in neuroblastoma cells. The effect was reversible. No effect was obtained in cell-lysate. RNA and protein synthesis were unaffected. The acute toxicity, evaluated in Swiss mice, gave an LD of 6.1 mg/kg body wt. Results of electron microscopy are also given. A second protein, called tulipin 2, has been isolated and partially characterized. PMID:3592627

  12. Synthesis and evaluation of new spacers for use as dsDNA endcaps

    PubMed Central

    Ng, Pei-Sze; Laing, Brian M.; Balasundarum, Ganesan; Pingle, Maneesh; Friedman, Alan; Bergstrom, Donald E.

    2010-01-01

    A series of aliphatic and aromatic spacer molecules designed to cap the ends of DNA duplexes have been synthesized. The spacers were converted into dimethoxytrityl protected phosphoramidites as synthons for oligonucleotides synthesis. The effect of the spacers on the stability of short DNA duplexes was assessed by melting temperature studies. Endcaps containing amide groups were found to be less stabilizing than the hexaethylene glycol spacer. Endcaps containing either a terthiophene or a naphthalene tetracarboxylic acid dimide were found to be significantly more stabilizing. The former showed a preference for stacking above an A•T base pair. Spacers containing only methylene (-CH2-) and amide (-CONH-) groups interact weakly with DNA and consequently may be optimal for applications that require minimal influence on DNA structure but require a way to hold the ends of double-stranded DNA together. PMID:20715857

  13. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    SciTech Connect

    Jones, R.A.

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  14. Templated synthesis of nylon nucleic acids and characterization by nuclease digestion

    PubMed Central

    Liu, Yu; Wang, Risheng; Ding, Liang; Sha, Roujie

    2012-01-01

    Nylon nucleic acids containing oligouridine nucleotides with pendent polyamide linkers and flanked by unmodified heteronucleotide sequences were prepared by DNA templated synthesis. Templation was more efficient than the single-stranded synthesis: Coupling step yields were as high as 99.2%, with up to 7 amide linkages formed in the synthesis of a molecule containing 8 modified nucleotides. Controlled digestion by calf spleen phosphodiesterase enabled the mapping of modified nucleotides in the sequences. A combination of complete degradation of nylon nucleic acids by snake venom phosphodiesterase and dephosphorylation of the resulting nucleotide fragments by bacterial alkaline phosphatase, followed by LCMS analysis, clarified the linear structure of the oligo-amide linkages. The templated synthesis strategy afforded nylon nucleic acids in the target structure and was compatible with the presence heteronucleotides. The complete digestion procedure produced a new species of DNA analogues, nylon ribonucleosides, which display nucleosides attached via a 2′-alkylthio linkage to each diamine and dicarboxylate repeat unit of the original nylon nucleic acids. The binding affinity of a nylon ribonucleoside octamer to the complementary DNA was evaluated by thermal denaturing experiments. The octamer was found to form stable duplexes with an inverse dependence on salt concentration, in contrast to the salt-dependent DNA control. PMID:23125913

  15. De novo design, synthesis and spectroscopic characterization of chiral benzimidazole-derived amino acid Zn(II) complexes: Development of tryptophan-derived specific hydrolytic DNA artificial nuclease agent

    NASA Astrophysics Data System (ADS)

    Parveen, Shazia; Arjmand, Farukh

    2012-01-01

    Novel ternary dizinc(II) complexes 1- 3, derived from 1,2-bis(1H-benzimidazol-2-yl)ethane-1,2-diol and L-form of amino acids (viz., tryptophan, leucine and valine) were synthesized and characterized by spectroscopic (IR, 1H NMR, UV-vis, ESI-MS) and other analytical methods. To evaluate the biological preference of chiral drugs for inherently chiral target DNA, interaction of 1- 3 with calf thymus DNA in Tris-HCl buffer was studied by various biophysical techniques which reveal that all these complexes bind to CT DNA non-covalently via electrostatic interaction. The higher Kb value of L-tryptophan complex 1 suggested greater DNA binding propensity. Further, to evaluate the mode of action at the molecular level, interaction studies of complexes 1 and 2 with nucleotides (5'-GMP and 5'-TMP) were carried out by UV-vis titrations, 1H and 31P NMR which implicates the preferential selectivity of these complexes to N3 of thymine rather than N7 of guanine. Furthermore, complex 1 exhibits efficient DNA cleavage with supercoiled pBR322. The complex 1 cleaves DNA efficiently involving hydrolytic cleavage pathway. Such chiral synthetic hydrolytic nucleases with asymmetric centers are gaining considerable attention owing to their importance in biotechnology and drug design, in particular to cleave DNA with sequence selectivity different from that of the natural enzymes.

  16. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

    PubMed

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

    2012-03-13

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases. PMID:22320201

  17. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis

    PubMed Central

    2015-01-01

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the “structure elucidation problem”: the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS’s utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 104 molecules/bead and sequencing allowed for elucidation of each compound’s synthetic history. We applied DESPS to the combinatorial synthesis of a 75 645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and

  18. Decreased synthesis of DNA in regenerating rat liver after the administration of reserpine

    PubMed Central

    Ćihák, A.; Vaptzarova, K.

    1973-01-01

    1. Reserpine given to rats before the enhanced synthesis of DNA begins 14h after partial hepatectomy markedly depresses thymidine uptake into DNA at 24 hours. 2. At this time decreased activity of liver thymidine kinase but unchanged thymidine 5′-nucleotidase were observed. 3. Reserpine has no effect on DNA synthesis when administered simultaneously with the labelled thymidine 2 h before killing. 4. With depressed DNA synthesis after reserpine administration there is no significant decrease of liver RNA synthesis. PMID:4793440

  19. Polyaniline nanowire synthesis templated by DNA

    NASA Astrophysics Data System (ADS)

    Nickels, Patrick; Dittmer, Wendy U.; Beyer, Stefan; Kotthaus, Jörg P.; Simmel, Friedrich C.

    2004-11-01

    DNA-templated polyaniline nanowires and networks are synthesized using three different methods. The resulting DNA/polyaniline hybrids are fully characterized using atomic force microscopy, UV-vis spectroscopy and current-voltage measurements. Oxidative polymerization of polyaniline at moderate pH values is accomplished using ammonium persulfate as an oxidant, or alternatively in an enzymatic oxidation by hydrogen peroxide using horseradish peroxidase, or by photo-oxidation using a ruthenium complex as photo-oxidant. Atomic force microscopy shows that all three methods lead to the preferential growth of polyaniline along DNA templates. With ammonium persulfate, polyaniline can be grown on DNA templates already immobilized on a surface. Current-voltage measurements are successfully conducted on DNA/polyaniline networks synthesized by the enzymatic method and the photo-oxidation method. The conductance is found to be consistent with values measured for undoped polyaniline films.

  20. Synthesis, structural investigation, DNA and protein binding study of some 3d-metal complexes with N‧-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide

    NASA Astrophysics Data System (ADS)

    Mishra, Monika; Tiwari, Karishma; Shukla, Sachin; Mishra, R.; Singh, Vinod P.

    2014-11-01

    The ligand, N‧-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide (Hpmtc) derived from thiophene-2-carboxylic acid hydrazide and 2-benzoyl pyridine, and its metal complexes with Co(II), Ni(II), Cu(II) and Zn(II) have been synthesized. These compounds are characterized by elemental analyses, magnetic susceptibility measurements, IR, NMR and UV-Vis spectral studies. The molecular structures of Hpmtc and its Co(II) (1), Ni(II) (2), Cu(II) (3) and Zn(II) (4) complexes are finally determined by X-ray crystallography. Various spectral and single-crystal X-ray diffraction studies suggest that Hpmtc coordinates with metal ions as a monobasic tridentate ligand forming mononuclear distorted octahedral complexes of the type [M(pmtc)2]. The molecular structures of the complexes are stabilized by Csbnd H⋯N, Csbnd H⋯O intermolecular H-bonding, and Csbnd H⋯π and π⋯π interactions. The DNA binding experiment of the complexes 1, 3 and 4 by UV-Vis absorption, and EB-DNA displacement by fluorescence spectroscopy, reveal an intercalative mode of binding between CT-DNA (calf-thymus DNA) and the metal complexes. These complexes exhibit a moderate ability to cleave pBR322 plasmid DNA. A comparative bovine serum albumin (BSA) protein binding activity of the complexes 1, 3 and 4 has also been determined by UV-Vis absorption and fluorescence spectroscopy. The DNA binding and protein binding studies suggest that the complex 3 exhibits more effective binding activity (Kb = 5.54 × 105 and Kq = 1.26 × 106 M-1, respectively) than complexes 1 and 4. However, the complex 1 shows better hydrolytic DNA cleavage activity compared to 3 and 4 complexes.

  1. Synthesis, DNA-binding and biological activity of a double intercalating analog of ethidium bromide.

    PubMed Central

    Kuhlmann, K F; Charbeneau, N J; Mosher, C W

    1978-01-01

    A bis-phenanthridinium salt has been synthesized and its DNA-binding studied. Evidence provided by UV and CD spectra, by thermal denaturation profiles and by equilibrium dialysis of the drug-DNA complex lead to the conclusion that both phenanthridine moieties intercalate in the helix. The double intercalator appears to be less potent than ethidium chloride as an inhibitor of nucleic acid synthesis in cultured L1210 cells, though it is more potent than a monomeric analog. The low potency may be due to a low cell influx rate. PMID:673863

  2. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  3. Magnetic isotope and magnetic field effects on the DNA synthesis

    PubMed Central

    Buchachenko, Anatoly L.; Orlov, Alexei P.; Kuznetsov, Dmitry A.; Breslavskaya, Natalia N.

    2013-01-01

    Magnetic isotope and magnetic field effects on the rate of DNA synthesis catalysed by polymerases β with isotopic ions 24Mg2+, 25Mg2+ and 26Mg2+ in the catalytic sites were detected. No difference in enzymatic activity was found between polymerases β carrying 24Mg2+ and 26Mg2+ ions with spinless, non-magnetic nuclei 24Mg and 26Mg. However, 25Mg2+ ions with magnetic nucleus 25Mg were shown to suppress enzymatic activity by two to three times with respect to the enzymatic activity of polymerases β with 24Mg2+ and 26Mg2+ ions. Such an isotopic dependence directly indicates that in the DNA synthesis magnetic mass-independent isotope effect functions. Similar effect is exhibited by polymerases β with Zn2+ ions carrying magnetic 67Zn and non-magnetic 64Zn nuclei, respectively. A new, ion–radical mechanism of the DNA synthesis is suggested to explain these effects. Magnetic field dependence of the magnesium-catalysed DNA synthesis is in a perfect agreement with the proposed ion–radical mechanism. It is pointed out that the magnetic isotope and magnetic field effects may be used for medicinal purposes (trans-cranial magnetic treatment of cognitive deceases, cell proliferation, control of the cancer cells, etc). PMID:23851636

  4. The coordinate induction of DNA synthesis after tuber wounding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tuber wounding induces a cascade of biological responses involved in processes required to heal and protect surviving plant issues. Little is known about the coordination of these processes, including essential wound-induced DNA synthesis, yet they play critical roles in maintaining marketability o...

  5. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  6. In vivo effects of T-2 mycotoxin on synthesis of proteins and DNA in rat tissues

    SciTech Connect

    Thompson, W.L.; Wannemacher, R.W. Jr. )

    1990-09-15

    Rats were given an ip injection of T-2 mycotoxin (T-2), the T-2 metabolite, T-2 tetraol (tetraol), or cycloheximide. Serum, liver, heart, kidney, spleen, muscle, and intestine were collected at 3, 6, and 9 hr postinjection after a 2-hr pulse at each time with (14C)leucine and (3H)thymidine. Protein and DNA synthesis levels in rats were determined by dual-label counting of the acid-precipitable fraction of tissue homogenates. Rats given a lethal dose of T-2, tetraol, or cycloheximide died between 14 and 20 hr. Maximum inhibition of protein synthesis at the earliest time period was observed in additional rats given the same lethal dose of the three treatments and continued for the duration of the study (9 hr). With sublethal doses of T-2 or tetraol, the same early decrease in protein synthesis was observed but, in most of the tissues, recovery was seen with time. In the T-2-treated rats. DNA synthesis in the six tissues studied was also suppressed, although to a lesser degree. With sublethal doses, complete recovery of DNA synthesis took place in four of the six tissues by 9 hr after toxin exposure. The appearance of newly translated serum proteins did not occur in the animals treated with T-2 mycotoxin or cycloheximide, as evidenced by total and PCA-soluble serum levels of labeled leucine. An increase in tissue-pool levels of free leucine and thymidine in response to T-2 mycotoxin was also noted. T-2 mycotoxin, its metabolite, T-2 tetraol, and cycloheximide cause a rapid inhibition of protein and DNA synthesis in all tissue types studied. These results are compared with the responses seen in in vitro studies.

  7. Synthesis and hybridization properties of an acyclic achiral phosphonate DNA analogue.

    PubMed

    Kehler, J; Henriksen, U; Vejbjerg, H; Dahl, O

    1998-03-01

    Protected N-(2-hydroxyethyl)-N-(nucleobase-acetyl)aminomethanephosphonic+ ++ acid (6a-d) of all four DNA nucleobases have been prepared and oligomerized by solid-phase synthesis. Four DNA decamers containing 1-10 of these 'PPNA' monomers were prepared and evaluated by Tm measurements (medium salt) for binding to their DNA and RNA complements. One central modification reduced the binding strongly (delta Tm = -10 degrees C), but contiguous PPNA monomers gave smaller effects, and the all-PPNA decamer bound to RNA with a delta Tm of -1.2 degrees C per modification. Thus PPNA oligomers are inferior DNA and RNA binders compared to the closely related and strongly binding PNA oligomers. PMID:9568285

  8. Hyaluronic acid lipoate: synthesis and physicochemical properties.

    PubMed

    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco

    2013-03-01

    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  9. Gibberellic Acid Enhancement of DNA Turnover in Barley Aleurone Cells 1

    PubMed Central

    Taiz, Lincoln; Starks, Jayum E.

    1977-01-01

    When imbibed, deembryonated halfseeds from barley (Hordeum vulgare L., var. Himalaya) are incubated in buffer, the DNA content of the aleurone layer increases 25 to 40% over a 24-hour period. In contrast, the DNA of isolated aleurone layers declines by 20% over the same time period. Gibberellic acid (GA) causes a reduction in DNA levels in both halfseed aleurone layers and isolated aleurone layers. GA also increases the specific radioactivity of [3H]thymidine-labeled halfseed aleurone layer DNA during the first 12 hours of treatment. Pulse-chase studies demonstrated that the newly synthesized DNA is metabolically labile. The buoyant density on CsCl density gradients of hormone-treated aleurone DNA is identical with that of DNA extracted from whole seedlings. After density-labeling halfseed DNA with 5-bromodeoxyuridine, a bimodal absorption profile is obtained in neutral CsCl. The light band (1.70 g/ml) corresponds to unsubstituted DNA, while the heavy band (1.725-1.74 g/ml) corresponds to a hybrid density-labeled species. GA increases the relative amount of the heavy (hybrid) peak in halfseed aleurone layer DNA, further suggesting that the hormone enhances semiconservative replication in halfseeds. DNA methylation was also demonstrated. Over 60% of the radioactivity from [3H-Me]methionine is incorporated into 5-methylcytosine. GA has no effect on the percentage distribution of label among the bases. It was concluded that GA enhances the rate of DNA degradation and DNA synthesis (turnover) in halfseeds, but primarily DNA degradation in isolated aleurone layers. Incorporation by isolated aleurone layers is due to DNA repair. Semiconservative replication apparently plays no physiological role in the hormone response, since both isolated aleurone layers and gamma-irradiated halfseeds respond normally. The hypothesis was advanced that endoreduplication and DNA degradation are means by which the seed stores and mobilizes deoxyribonucleotides for the embryo during

  10. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  11. Seasonal variations of DNA synthesis in intestinal epithelial cells of hibernating animals--I. DNA synthesis in intestinal epithelial cells of ground squirrel (Citellus undulatus) during deep hibernation.

    PubMed

    Kruman, I I; Kolaeva, S G; Iljasova, E N; Zubrikhina, G N; Khachko, V N; Petrova, A S

    1986-01-01

    The conditions for obtaining crypt cells from ground squirrel small intestine were chosen which allow flow-through cytofluorometric analysis of the DNA synthesis of this tissue. DNA synthesis was found to be greatly reduced in the intestinal crypt cells of ground squirrel during deep hibernation in torpid animals, in animals during spontaneous arousals and in animals prevented from hibernation. The conclusion is made about endogenous control of the DNA synthesis in the cells of true hibernators. PMID:3943302

  12. Inositol stimulates DNA and protein synthesis, and expansion by rabbit blastocysts in vitro.

    PubMed

    Fahy, M M; Kane, M T

    1992-04-01

    The effect of different concentrations (0, 0.6, 3, 15, 75 and 375 microM) of myo-inositol on the development of rabbit morulae to expanded blastocysts was investigated in terms of blastocyst expansion and synthesis of DNA and protein, as measured by incorporation of [3H]thymidine and [14C]amino acids into acid-precipitable material. A concentration of 15 microM inositol caused a 2.8-fold increase in blastocyst expansion (P less than 0.01), a 9.9-fold increase in thymidine incorporation into DNA (P less than 0.01) and a 3.6-fold increase in amino acid incorporation into protein (P less than 0.01). There were no significant differences in the range from 15 to 375 microM inositol. PMID:1522201

  13. Sickle erythrocytes inhibit human endothelial cell DNA synthesis

    SciTech Connect

    Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K. )

    1990-11-15

    Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling.

  14. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  15. Synthesis of nucleic acid probes on membrane supports: A procedure for the removal of unincorporated precursors

    SciTech Connect

    Bhat, S.P. )

    1990-01-01

    We have used DNA bound to small pieces of nylon membrane for the synthesis of radioactive probes. The DNA to be used for generating the probe(s) is first bound to nylon membranes and then introduced into the reaction mix. The labeling reaction takes place on the membrane and therefore allows easy removal of unincorporated precursors by simple washing for 1-2 min. The clean labeled probe is eluted from the membrane in formamide or in water and is ready for use. This DNA-membrane can be stored for reuse. Synthesis of probes on a solid support such as nylon membrane thus circumvents problems associated with chromatographic manipulations needed for the separation of labeled DNA from unicorporated precursors. Probes synthesized in this manner are as efficient in detecting nucleic acid sequences as those synthesized in solution.

  16. Synthesis of nucleic acid probes on membrane supports: a procedure for the removal of unincorporated precursors.

    PubMed

    Bhat, S P

    1990-01-01

    We have used DNA bound to small pieces of nylon membrane for the synthesis of radioactive probes. The DNA to be used for generating the probe(s) is first bound to nylon membranes and then introduced into the reaction mix. The labeling reaction takes place on the membrane and therefore allows easy removal of unincorporated precursors by simple washing for 1-2 min. The clean labeled probe is eluted from the membrane in formamide or in water and is ready for use. This DNA-membrane can be stored for reuse. Synthesis of probes on a solid support such as nylon membrane thus circumvents problems associated with chromatographic manipulations needed for the separation of labeled DNA from unicorporated precursors. Probes synthesized in this manner are as efficient in detecting nucleic acid sequences as those synthesized in solution. PMID:2321760

  17. Temporal sequence of events during the initiation process in Escherichia coli deoxyribonucleic acid replication: roles of the dnaA and dnaC gene products and ribonucleic acid polymerase.

    PubMed Central

    Zyskind, J W; Deen, L T; Smith, D W

    1977-01-01

    Three thermosensitive deoxyribonucleic acid (DNA) initiation mutants of Escherichia coli exposed to the restrictive temperature for one to two generations were examined for the ability to reinitiate DNA replication after returning to the permissive temperature in the presence of rifampin, chloramphenicol, or nalidixic acid. Reinitiation in the dnaA mutant was inhibited by rifampin but not by chloramphenicol, whereas renitiation was not inhibited by rifampin but not by chloramphenicol, whereas reinitiation was not inhibited in two dnaC mutants by either rifampin or chloramphenicol. To observe the rifampin inhibition, the antibiotic must be added at least 10 min before return to the permissive temperature. The rifampin inhibition of reinitiation was not observed when a rifampin-resistant ribonucleic acid ((RNA) polymerase gene was introduced into the dnaA mutant, demonstrating that RNA polymerase synthesizes one or more RNA species required for the initation of DNA replication (origin-RNA). Reinitiation at 30 degrees C was not inhibited by streptolydigin in a stretolydigin-sensitive dnaA muntant. Incubation in the presence of nalidixic acid prevented subsequent reinitiation in the dnaC28 mutant but did not inhibit reinitiation in the dnaA5 muntant. These results demonstrate that the dnaA gene product acts before or during the synthesis of an origin-RNA, RNA polymerase synthesizes this origin RNA, and the dnaC gene product is involved in a step after this RNA synthesis event. Furthermore, these results suggest that the dnaC gene product is involved in the first deoxyribounucleotide polymerization event wheareas the dnaA gene product acts prior to this event. A model is presented describing the temporal sequence of events that occur during initiation of a round of DNA replication, based on results in this and the accompanying paper. PMID:321429

  18. Structural analysis of DNA interaction with retinol and retinoic acid.

    PubMed

    Mandeville, J S; N'soukpoé-Kossi, C N; Neault, J F; Tajmir-Riahi, H A

    2010-06-01

    Dietary constituents of fresh fruits and vegetables may play a relevant role in DNA adduct formation by inhibiting enzymatic activities. Studies have shown the important role of antioxidant vitamins A, C, and E in the protection against cancer and cardiovascular diseases. The antioxidant activity of vitamin A and beta-carotene may consist of scavenging oxygen radicals and preventing DNA damage. This study was designed to examine the interaction of calf-thymus DNA with retinol and retinoic acid in aqueous solution at physiological conditions using a constant DNA concentration and various retinoid contents. Fourier transform infrared (FTIR), circular dichroism (CD), and fluorescence spectroscopic methods were used to determine retinoid binding mode, the binding constant, and the effects of retinol and retinoic acid complexation on DNA conformation and aggregation. Structural analysis showed that retinol and retinoic acid bind DNA via G-C and A-T base pairs and the backbone phosphate groups with overall binding constants of Kret = 3.0 (+/-0.50) x 10(3) (mol.L(-1))(-1) and Kretac = 1.0 (+/-0.20) x 10(4) (mol.L(-1))(-1). The number of bound retinoids per DNA were 0.84 for retinol and 1.3 for retinoic acid. Hydrophobic interactions were also observed at high retinol and retinoic acid contents. At a high retinoid concentration, major DNA aggregation occurred, while DNA remained in the B-family structure. PMID:20555389

  19. Rapid synthesis of the 7-deoxy zaragozic acid core.

    PubMed

    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J

    2002-01-24

    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  20. First total synthesis of prasinic acid and its anticancer activity.

    PubMed

    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt

    2012-11-01

    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  1. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  2. Folic acid binds DNA and RNA at different locations.

    PubMed

    Bourassa, P; Tajmir-Riahi, H A

    2015-03-01

    We located multiple binding sites for folic acid on DNA and tRNA at physiological conditions, using FTIR, CD, fluorescence spectroscopic methods and molecular modeling. Structural analysis revealed that folic acid binds DNA and tRNA at multiple sites via hydrophilic, hydrophobic and H-bonding contacts with overall binding constants of Kfolic acid-DNA=1.1 (±0.3)×10(4) M(-1) and Kfolic acid-tRNA=6.4 (±0.5)×10(3) M(-1). Molecular modeling showed the participation of several nucleobases in folic acid complexes with DNA and tRNA, stabilized by H-bonding network. Two types of complexes were located for folic acid-tRNA adducts, one at the major groove and the other with TΨC loop, while acid binding occurs at major and minor grooves of DNA duplex. Folic acid complexation induced more alterations of DNA structure than tRNA. PMID:25555838

  3. Translesion synthesis past acrolein-derived DNA adducts by human mitochondrial DNA polymerase γ.

    PubMed

    Kasiviswanathan, Rajesh; Minko, Irina G; Lloyd, R Stephen; Copeland, William C

    2013-05-17

    Acrolein, a mutagenic aldehyde, is produced endogenously by lipid peroxidation and exogenously by combustion of organic materials, including tobacco products. Acrolein reacts with DNA bases forming exocyclic DNA adducts, such as γ-hydroxy-1,N(2)-propano-2'-deoxyguanosine (γ-HOPdG) and γ-hydroxy-1,N(6)-propano-2'-deoxyadenosine (γ-HOPdA). The bulky γ-HOPdG adduct blocks DNA synthesis by replicative polymerases but can be bypassed by translesion synthesis polymerases in the nucleus. Although acrolein-induced adducts are likely to be formed and persist in mitochondrial DNA, animal cell mitochondria lack specialized translesion DNA synthesis polymerases to tolerate these lesions. Thus, it is important to understand how pol γ, the sole mitochondrial DNA polymerase in human cells, acts on acrolein-adducted DNA. To address this question, we investigated the ability of pol γ to bypass the minor groove γ-HOPdG and major groove γ-HOPdA adducts using single nucleotide incorporation and primer extension analyses. The efficiency of pol γ-catalyzed bypass of γ-HOPdG was low, and surprisingly, pol γ preferred to incorporate purine nucleotides opposite the adduct. Pol γ also exhibited ∼2-fold lower rates of excision of the misincorporated purine nucleotides opposite γ-HOPdG compared with the corresponding nucleotides opposite dG. Extension of primers from the termini opposite γ-HOPdG was accomplished only following error-prone purine nucleotide incorporation. However, pol γ preferentially incorporated dT opposite the γ-HOPdA adduct and efficiently extended primers from the correctly paired terminus, indicating that γ-HOPdA is probably nonmutagenic. In summary, our data suggest that acrolein-induced exocyclic DNA lesions can be bypassed by mitochondrial DNA polymerase but, in the case of the minor groove γ-HOPdG adduct, at the cost of unprecedented high mutation rates. PMID:23543747

  4. One-stop Genomic DNA Extraction by Salicylic Acid Coated Magnetic Nanoparticles

    PubMed Central

    Zhou, Zhongwu; Kadam, Ulhas; Irudayaraj, Joseph

    2014-01-01

    Salicylic acid coated magnetic nanoparticles were prepared via a modified, one-step synthesis and used for a one-stop extraction of genomic DNA from mammalian cells. The synthesized magnetic particles were used for magnetic separation of cells from the media by non-specific binding of the particles, as well as extraction of genomic DNA from the lysate. The quantity and quality were confirmed by agarose gel electrophoresis and polymerase chain reaction. The entire process of extraction and isolation can be completed within 30 min. Compared to traditional methods based on centrifugation and filtration, the established method is fast, simple, reliable, and environmentally-friendly. PMID:23911528

  5. DNA binding proteins that alter nucleic acid flexibility

    NASA Astrophysics Data System (ADS)

    McCauley, Micah; Hardwidge, Philip R.; Maher, L. J., III; Williams, Mark C.

    2007-09-01

    Dual - beam optical tweezers experiments subject single molecules of DNA to high forces (~ 300 pN) with 0.1 pN accuracy, probing the energy and specificity of nucleic acid - ligand structures. Stretching phage λ-DNA reveals an increase in the applied force up to a critical force known as the overstretching transition. In this region, base pairing and stacking are disrupted as double stranded DNA (dsDNA) is melted. Proteins that bind to the double strand will tend to stabilize dsDNA, and melting will occur at higher forces. Proteins that bind to single stranded DNA (ssDNA) destabilize melting, provided that the rate of association is comparable to the pulling rate of the experiment. Many proteins, however, exhibit some affinity for both dsDNA and ssDNA. We describe experiments upon DNA + HMGB2 (box A), a nuclear protein that is believed to facilitate transcription. By characterizing changes in the structure of dsDNA with a polymer model of elasticity, we have determined the equilibrium association constant for HMGB2 to be K ds = 0.15 +/- 0.7 10 9 M -1 for dsDNA binding. Analysis of the melting transition reveals an equilibrium association constant for HMGB2 to ssDNA to be K ss = 0.039 +/- 0.019 10 9 M -1 for ssDNA binding.

  6. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA. PMID:27311715

  7. Association of DNA sequence variation in mitochondrial DNA polymerase with mitochondrial DNA synthesis and risk of oral cancer.

    PubMed

    Datta, Sayantan; Ray, Anindita; Roy, Roshni; Roy, Bidyut

    2016-01-10

    Enzymes responsible for mitochondrial (mt) DNA synthesis and transcription are encoded by nuclear genome and inherited mutations in these genes may play important roles in enhancing risk of precancer and cancer. Here, genetic variations in 23 functionally relevant tagSNPs in 6 genes responsible for mtDNA synthesis and transcription were studied in 522 cancer and 241 precancer (i.e. leukoplakia) patients and 525 healthy controls using Illumina Golden Gate assay to explore association with risk of oral precancer and cancer. Two SNPs, rs41553913 at POLRMT and rs9905016 at POLG2, significantly increased risk of oral leukoplakia and cancer, respectively, at both genotypic and allelic levels. Gene-environment interaction models also revealed that tobacco habits and SNPs at POLG2 and TFAM may modulate risk of both leukoplakia and cancer. In silico analysis of published data-set also revealed that variant heterozygote (TC) significantly increased transcription of POLG2 compared to wild genotype (p=0.03). Cancer tissues having variant allele genotypes (TC+CC) at POLG2 contained 1.6 times (p<0.01) more mtDNA compared to cancer tissues having wild genotype (TT). In conclusion, polymorphisms at POLG2 and POLRMT increased risk of oral cancer and leukoplakia, respectively, probably modulating synthesis and activity of the enzymes. Enhanced synthesis of mtDNA in cancer tissues may have implication in carcinogenesis, but the mechanism is yet to be explored. PMID:26403317

  8. Inaccurate DNA Synthesis in Cell Extracts of Yeast Producing Active Human DNA Polymerase Iota

    PubMed Central

    Makarova, Alena V.; Grabow, Corinn; Gening, Leonid V.; Tarantul, Vyacheslav Z.; Tahirov, Tahir H.; Bessho, Tadayoshi; Pavlov, Youri I.

    2011-01-01

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn2+ ions, can bypass some DNA lesions and misincorporates “G” opposite template “T” more frequently than incorporates the correct “A.” We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of “G” versus “A” method of Gening, abbreviated as “misGvA”). We provide unambiguous proof of the “misGvA” approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The “misGvA” activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts. PMID:21304950

  9. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  10. Antioxidant and DNA damage protection potentials of selected phenolic acids.

    PubMed

    Sevgi, Kemal; Tepe, Bektas; Sarikurkcu, Cengiz

    2015-03-01

    In this study, ten different phenolic acids (caffeic, chlorogenic, cinnamic, ferulic, gallic, p-hydroxybenzoic, protocatechuic, rosmarinic, syringic, and vanillic acids) were evaluated for their antioxidant and DNA damage protection potentials. Antioxidant activity was evaluated by using four different test systems named as β-carotene bleaching, DPPH free radical scavenging, reducing power and chelating effect. In all test systems, rosmarinic acid showed the maximum activity potential, while protocatechuic acid was determined as the weakest antioxidant in β-carotene bleaching, DPPH free radical scavenging, and chelating effect assays. Phenolic acids were also screened for their protective effects on pBR322 plasmid DNA against the mutagenic and toxic effects of UV and H2O2. Ferulic acid was found as the most active phytochemical among the others. Even at the lowest concentration value (0.002 mg/ml), ferulic acid protected all of the bands in the presence of H2O2 and UV. It is followed by caffeic, rosmarinic, and vanillic acids. On the other hand, cinnamic acid (at 0.002 mg/ml), gallic acid (at 0.002 mg/ml), p-hydroxybenzoic acid (at 0.002 and 0.004 mg/ml), and protocatechuic acid (at 0.002 and 0.004 mg/ml) could not protect plasmid DNA. PMID:25542528

  11. Uracil misincorporation into DNA and folic acid supplementation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BACKGROUND: Folate deficiency decreases thymidylate synthesis from deoxyuridylate, which results in an imbalance of deoxyribonucleotide that may lead to excessive uracil misincorporation (UrMis) into DNA during replication and repair. OBJECTIVE: We evaluated the relation between UrMis in different ...

  12. Synthesis, spectroscopic characterization and structural investigation of a new charge transfer complex of 2,6-diaminopyridine with 4-nitrophenylacetic acid: Antimicrobial, DNA binding/cleavage and antioxidant studies

    NASA Astrophysics Data System (ADS)

    Murugesan, Venkatesan; Saravanabhavan, Munusamy; Sekar, Marimuthu

    2015-08-01

    A new hydrogen-bonded charge-transfer complex (CT) formed by the reaction between donor, 2,6-diaminopyridine and acceptor, 4-nitrophenylacetic acid in methanol at room temperature. The crystal was characterized by elemental analysis, IR, NMR spectroscopic studies and thermal studies. The elemental analysis of CT complex, obtained data revealed that the formation of 1:1 ratio CT complex was proposed. Infrared and NMR studies confirm the chemical constituents and molecular structure of the synthesized complex crystal. The high thermal stability is due to the molecular frame work through H-bonding interactions. Structural investigation indicates that cation and anion are linked through strong N+-H⋯O- type of hydrogen bond. The hydrogen bonded charge transfer crystal was screened for its pharmacology, such as antimicrobial, DNA binding/cleavage and antioxidant studies. The CT complex was screened for its antibacterial and antifungal activity against various bacterial and fungal species, which shows good antimicrobial activity. The DNA binding results indicated that the compound could interact with DNA through intercalation. It should have weak to moderate capacity of scavenging with DPPH.

  13. Synthesis, spectroscopic, crystal structure and DNA binding of Ru(II) complexes with 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide

    NASA Astrophysics Data System (ADS)

    Chitrapriya, Nataraj; Sathiya Kamatchi, Thangavel; Zeller, Matthias; Lee, Hyosun; Natarajan, Karuppannan

    2011-10-01

    Reactions of 2-hydroxy-benzoic acid [1-(4-hydroxy-6-methyl-2-oxo-2H-pyran-3-yl)-ethylidene]-hydrazide (H 2L) with [RuHCl(CO)(EPh 3) 3] (E = P or As) were carried out and the new complexes obtained were characterized by elemental analysis, electronic, IR, 1H NMR and 13C NMR spectroscopic techniques and single crystal X-ray diffraction studies. Complex ( 1) crystallizes in the monoclinic space group P2(1)/ c with unit cell dimensions a = 18.6236(17) Å, b = 12.8627(12) Å, c = 21.683(2) Å, α = 90.00, β = 114.626(2), γ = 90.00 V = 4721.8(8) Å, Z = 4. The crystal structure of the complex shows Ru(II) atom is six-coordinated, forming a slightly distorted octahedral geometry with two P atoms in axial positions, and three chelating donor atoms of the tridentate Schiff base ligand and one carbonyl group located in the equatorial plane. The molecular structure is stabilized by intramolecular O—H···N interactions. No intermolecular hydrogen bond was observed. The intramolecular hydrogen bond exists between the oxygen atom from salicylic acid moiety and nitrogen from the same moiety. A variety of solution studies were carried out for the determination of DNA binding mode of the complexes. The results suggest that both complexes bind to Herring sperm DNA via non intercalative mode.

  14. Spherical Nucleic Acids: A New Form of DNA

    NASA Astrophysics Data System (ADS)

    Cutler, Joshua Isaac

    Spherical Nucleic Acids (SNAs) are a new class of nucleic acid-based nanomaterials that exhibit unique properties currently being explored in the contexts of gene-based cancer therapies and in the design of programmable nanoparticle-based materials. The properties of SNAs differ from canonical, linear nucleic acids by virtue of their dense packing into an oriented 3-dimensional array. SNAs can be synthesized from a number of useful nanoparticle templates, such as plasmonic gold and silver, magnetic oxides, luminescent semi-conductor quantum dots, and silica. In addition, by crosslinking the oligonucleotides and dissolving the core, they can be made in a hollow form as well. This dissertation describes the evolution of SNAs from initial studies of inorganic nanoparticle-based materials densely functionalized with oligonucleotides to the proving of a hypothesis that their unique properties can be observed in a core-less structure if the nucleic acids are densely packed and highly oriented. Chapter two describes the synthesis of densely functionalized polyvalent oligonucleotide superparamagnetic iron oxide nanoparticles using the copper-catalyzed azide-alkyne cycloaddition reaction. These particles are shown to exhibit cooperative binding in a density- and salt concentration-dependent fashion, with nearly identical behaviors to those of SNA-functionalized gold nanoparticles. Importantly, these particles are the first non-gold particles shown to be capable of entering cells in high numbers via the SNA-mediated cellular uptake pathway, and provided the first evidence that SNA-mediated cellular uptake is core-independent. In the third chapter, a gold nanoparticle catalyzed alkyne cross-linking reaction is described that is capable of forming hollow organic nanoparticles using polymers with alkyne-functionalized backbones. With this method, the alkyne-modified polymers adsorb to the particle surfaces, cross-link on the surface, allowing the gold nanoparticle to be

  15. Pif1 helicase and Polδ promote recombination-coupled DNA synthesis via bubble migration

    PubMed Central

    Wilson, Marenda A.; Kwon, YoungHo; Xu, Yuanyuan; Chung, Woo-Hyun; Chi, Peter; Niu, Hengyao; Mayle, Ryan; Chen, Xuefeng; Malkova, Anna; Sung, Patrick; Ira, Grzegorz

    2013-01-01

    During DNA repair by homologous recombination (HR), DNA synthesis copies information from a template DNA molecule. Multiple DNA polymerases have been implicated in repair-specific DNA synthesis1–3, but it has remained unclear whether a DNA helicase is involved in this reaction. A good candidate is Pif1, an evolutionarily conserved helicase in S. cerevisiae important for break-induced replication (BIR)4 as well as HR-dependent telomere maintenance in the absence of telomerase5 found in 10–15% of all cancers6. Pif1 plays a role in DNA synthesis across hard-to-replicate sites7, 8 and in lagging strand synthesis with Polδ9–11. Here we provide evidence that Pif1 stimulates DNA synthesis during BIR and crossover recombination. The initial steps of BIR occur normally in Pif1-deficient cells, but Polδ recruitment and DNA synthesis are decreased, resulting in premature resolution of DNA intermediates into half crossovers. Purified Pif1 protein strongly stimulates Polδ-mediated DNA synthesis from a D-loop made by the Rad51 recombinase. Importantly, Pif1 liberates the newly synthesized strand to prevent the accumulation of topological constraint and to facilitate extensive DNA synthesis via the establishment of a migrating D-loop structure. Our results uncover a novel function of Pif1 and provide insights into the mechanism of HR. PMID:24025768

  16. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates.

    PubMed

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

    2016-01-15

    A simple and elegant method for inhibition of non-templated nucleotide addition by DNA polymerases and for following DNA 3'-heterogeneity in enzymatic DNA synthesis by primer extension (PEX) is described. When template bearing ortho-twisted intercalating nucleic acid (ortho-TINA) at the 5'-end is used, non-templated nucleotide addition is reduced in both the A- and B-family DNA polymerases (KOD XL, KOD (exo-), Bst 2.0, Therminator, Deep Vent (exo-) and Taq). Formation of a single oligonucleotide product was observed with ortho-TINA modified template and KOD XL, KOD (exo-), Bst 2.0, Deep Vent (exo-) and Taq DNA polymerases. This approach can be applied to the synthesis of both unmodified and base-modified oligonucleotides. PMID:26707394

  17. Akt phosphorylation and regulation of transketolase is a nodal point for amino acid control of purine synthesis.

    PubMed

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T; Phan, Tony; Pilz, Renate B; Boss, Gerry R

    2014-07-17

    The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mammalian target of rapamycin 2 and IκB kinase regulate Akt activity and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the nonoxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the nonoxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for 2 days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  18. Replication stress activates DNA repair synthesis in mitosis.

    PubMed

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach. PMID:26633632

  19. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  20. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    DOEpatents

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  1. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  2. The adenovirus E1A protein overrides the requirement for cellular ras in initiating DNA synthesis.

    PubMed Central

    Stacey, D W; Dobrowolski, S F; Piotrkowski, A; Harter, M L

    1994-01-01

    The adenovirus E1A protein can induce cellular DNA synthesis in growth-arrested cells by interacting with the cellular protein p300 or pRb. In addition, serum- and growth factor-dependent cells require ras activity to initiate DNA synthesis and recently we have shown that Balb/c 3T3 cells can be blocked in either early or late G1 following microinjection of an anti-ras antibody. In this study, the E1A 243 amino acid protein is shown through microinjection not only to shorten the G0 to S phase interval but, what is more important, to override the inhibitory effects exerted by the anti-ras antibody in either early or late G1. Specifically, whether E1A is co-injected with anti-ras into quiescent cells or injected 18 h following a separate injection of anti-ras after serum stimulation, it efficiently induces cellular DNA synthesis in cells that would otherwise be blocked in G0/G1. Moreover, injection of a mutant form of E1A that can no longer associate with p300 is just as efficient as wild-type E1A in stimulating DNA synthesis in cells whose ras activity has been neutralized by anti-ras. The results presented here show that E1A is capable of overriding the requirement of cellular ras activity in promoting the entry of cells into S phase. Moreover, the results suggest the possibility that pRb and/or pRb-related proteins may function in a ras-dependent pathway that enables E1A to achieve this activity. Images PMID:7813447

  3. Information transfer from DNA to peptide nucleic acids by template-directed syntheses

    NASA Technical Reports Server (NTRS)

    Schmidt, J. G.; Christensen, L.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1997-01-01

    Peptide nucleic acids (PNAs) are analogs of nucleic acids in which the ribose-phosphate backbone is replaced by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. Oligocytidylates have been shown to act as templates for formation of longer oligomers of G from PNA G2 dimers. In this paper we show that information can be transferred from DNA to PNA. DNA C4T2C4 is an efficient template for synthesis of PNA G4A2G4 using G2 and A2 units as substrates. The corresponding synthesis of PNA G4C2G4 on DNA C4G2C4 is less efficient. Incorporation of PNA T2 into PNA products on DNA C4A2C4 is the least efficient of the three reactions. These results, obtained using PNA dimers as substrates, parallel those obtained using monomeric activated nucleotides.

  4. Total synthesis and complete stereostructure of gambieric acid A.

    PubMed

    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto

    2012-07-25

    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  5. Synthesis of fatty acids in the perused mouse liver.

    PubMed

    Salmon, D M; Bowen, N L; Hems, D A

    1974-09-01

    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  6. Centrosomal Localization of Cyclin E-Cdk2 is Required for Initiation of DNA Synthesis

    PubMed Central

    Ferguson, Rebecca L.; Maller, James L.

    2010-01-01

    Summary Cyclin E-Cdk2 is known to regulate both DNA replication and centrosome duplication during the G1-S transition in the cell cycle [1–4], and disruption of centrosomes results in a G1 arrest in some cell types [5–7]. Localization of cyclin E on centrosomes is mediated by a 20 amino acid domain termed the centrosomal localization sequence (CLS), and expression of the GFP-tagged CLS displaces both cyclin E and cyclin A from the centrosome [8]. In asynchronous cells CLS expression inhibits the incorporation of bromodeoxyuridine (BrdU) into DNA, an effect proposed to reflect a G1 arrest. Here we show in synchronized cells that the reduction in BrdU incorporation reflects not a G1 arrest but rather direct inhibition of the initiation of DNA replication in S phase. The loading of essential DNA replication factors such as Cdc45 and PCNA onto chromatin is blocked by CLS expression, but DNA synthesis can be rescued by retargeting active cyclin E-Cdk2 to the centrosome. These results suggest that initial steps of DNA replication require centrosomally localized Cdk activity and link the nuclear cycle with the centrosome cycle at the G1-S transition. PMID:20399658

  7. A symmetry-based formal synthesis of zaragozic acid A.

    PubMed

    Freeman-Cook, K D; Halcomb, R L

    2000-09-22

    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  8. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.

    PubMed

    Papadopoulos, Giorgos N; Kokotos, Christoforos G

    2016-05-10

    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  9. Evidence for a Relationship Between Equine Abortion (Herpes) Virus Deoxyribonucleic Acid Synthesis and the S Phase of the KB Cell Mitotic Cycle

    PubMed Central

    Lawrence, William C.

    1971-01-01

    Autoradiographic analyses of deoxyribonucleic acid (DNA) synthesis in randomly growing KB cell cultures infected with equine abortion virus (EAV) suggested that viral DNA synthesis was initiated only at times that coincided with the entry of noninfected control cells into the S phase of the cell cycle. Synchronized cultures of KB cells were infected at different stages of the cell cycle, and rates of synthesis of cellular and viral DNA were measured. When cells were infected at different times within the S phase, viral DNA synthesis was initiated 2 to 3 hr after infection. However, when cells in G1 and G2 were infected, the initiation of viral DNA synthesis was delayed and occurred only at times corresponding to the S phase. The times when viral DNA synthesis began were independent of the time of infection and differed by as much as 5 hr, depending on the stage of the cell cycle at which cells were infected. Viral one-step growth curves were also related to the S phase in a manner which indicated a relationship between the initiation of viral DNA synthesis and the S phase. These data support the concept that initiation of EAV DNA synthesis is dependent upon some cellular function(s) which is related to the S phase of the cell cycle. PMID:4254680

  10. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  11. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  12. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

    PubMed

    Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

    2016-01-21

    Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  13. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  14. Targeting DNA G-Quadruplex Structures with Peptide Nucleic Acids

    PubMed Central

    Panyutin, Igor G.; Onyshchenko, Mykola I.; Englund, Ethan A.; Appella, Daniel H.; Neumann, Ronald D.

    2012-01-01

    Regulation of genetic functions based on targeting DNA or RNA sequences with complementary oligonucleotides is especially attractive in the post-genome era. Oligonucleotides can be rationally designed to bind their targets based on simple nucleic acid base pairing rules. However, the use of natural DNA and RNA oligonucleotides as targeting probes can cause numerous off-target effects. In addition, natural nucleic acids are prone to degradation in vivo by various nucleases. To address these problems, nucleic acid mimics such as peptide nucleic acids (PNA) have been developed. They are more stable, show less off-target effects, and, in general, have better binding affinity to their targets. However, their high affinity to DNA can reduce their sequence-specificity. The formation of alternative DNA secondary structures, such as the G-quadruplex, provides an extra level of specificity as targets for PNA oligomers. PNA probes can target the loops of G-quadruplex, invade the core by forming PNA-DNA guanine-tetrads, or bind to the open bases on the complementary cytosine-rich strand. Not only could the development of such G-quadruplex-specific probes allow regulation of gene expression, but it will also provide a means to clarify the biological roles G-quadruplex structures may possess. PMID:22376112

  15. [The biological effect of Y-family DNA polymerases on the translesion synthesis].

    PubMed

    Gong, Yi; Yang, Jin

    2013-02-01

    A common DNA polymerase can replicate DNA which functions normally. However, if DNA suffers damage, the genome can not be replicated by a common DNA polymerase because DNA lesions will block the replication apparatus. Another kind of DNA polymerases in organism, Y-family DNA polymerases which is also called translesion synthesis (TLS) polymerases, can deal with this problem. Their main functions are bypassing the lesions in DNA, replicating the genome and saving the dying cells. This thesis presents a historical review of the literature pertinent to the structure, functions and roles of Y-family DNA polymerases. PMID:23488167

  16. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  17. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  18. DNA synthesis and tritiated thymidine incorporation by heterotrophic freshwater bacteria in continuous culture

    SciTech Connect

    Ellenbroek, F.M.; Cappenberg, T.E. )

    1991-06-01

    Continuous cultivation of heterotrophic freshwater bacteria was used to assess the relationship between DNA synthesis and tritiated thymidine incorporation. In six different continuous cultures, each inoculated with a grazer-free mixed bacterial sample from Lake Vechten (The Netherlands), tritiated thymidine incorporation into a cold trichloroacetic acid precipitate and bacterial cell production were measured simultaneously. Empirical conversion factors were determined by division of both parameters. They ranged from 0.25 {times} 10{sup 18} to 1.31 {times} 10{sup 18} cells mol of tritiated thymidine{sup {minus}1}. In addition, DNA concentrations were measured by fluorometry with Heochst 33258. The validity of this technique was confirmed. Down to a generation time of 0.67 day, bacterial DNA content showed little variation, with values of 3.8 to 4.9 fg of DNA cell{sup {minus}1}. Theoretical conversion factors, which can be derived from DNA content under several assumptions, were between 0.26 {times} 10{sup 18} and 0.34 {times} 10{sup 18} cells mol of thymidine{sup {minus}1}. Isotope dilution was considered the main factor in the observed discrepancy between the conversion factors. In all experiments, a tritiated thymidine concentration of 20 nM was used. It was concluded that the observed difference resulted from intracellular isotope dilution which cannot be detected by current techniques for isotope dilution analysis.

  19. Synergistic template-free synthesis of dsDNA by Thermococcus nautili primase PolpTN2, DNA polymerase PolB, and pTN2 helicase.

    PubMed

    Béguin, Pierre; Gill, Sukhvinder; Charpin, Nicole; Forterre, Patrick

    2015-01-01

    A combination of three enzymes from the hyperthermophilic archaeon Thermococcus nautili, DNA primase PolpTN2, DNA polymerase PolB, and pTN2 DNA helicase, was found to synthesize up to 300-400 ng/µl dsDNA from deoxynucleotide triphosphates in less than 30 min in the absence of added template DNA and oligonucleotide primer. The reaction did not occur below 64 °C. No synthesis was observed if PolpTN2 or PolB were left out; helicase was not essential but accelerated the reaction. The DNA synthesized consisted of highly reiterated palindromic sequences reaching up to more that 10 kb. Sequence analysis of three independent reaction products synthesized at different temperatures showed that the palindromes shared a common pentanucleotide core, suggesting that random nucleic acid fragments were not responsible for priming the reaction. When enzymes were added sequentially, preincubation with primase plus helicase followed by PolB led to a shorter delay before the onset of the reaction as compared to preincubation with PolB plus helicase followed by primase. This suggests that the primase generates seeds that are subsequently amplified and elongated in synergy with PolB by a mechanism involving hairpin formation and slippage synthesis. PMID:25420601

  20. DNA replication and unscheduled DNA synthesis in lungs of mice exposed to cigarette smoke

    SciTech Connect

    Rasmussen, R.E.; Boyd, C.H.; Dansie, D.R.; Kouri, R.E.; Henry, C.J.

    1981-07-01

    Mice of the hybrid strain BC3F1/Cum (C57BL/Cum X C3H/AnfCum) were chronically exposed to measured amounts of machine-generated whole Kentucky reference 2A1 cigarette smoke. DNA replication and unscheduled DNA synthesis (UDS) were measured in lung tissue in vitro using a short-term organ culture method. Within one week of beginning smoke exposure, DNA replicative activity, as indicated by incorporation of (3H)-thymidine into total lung DNA, was increased more than two-fold over sham-exposed controls and remained elevated as long as smoke exposure was continued. Treatment of lung tissues in vitro with either the lung carcinogen 4-nitroquinoline-1-oxide or methylmethane sulfonate stimulated UDS, measured as incorporation of (3H)thymidine into lung DNA in the presence of hydroxyurea, presumably as the result of DNA repair activity. Until the 10th to 12th week of smoke exposure, at which time the accumulated deposition of total particulate material in the lung was approximately 40 mg, the level of UDS stimulated by the alkylating chemicals declined to approximately 50% of that seen in lung tissue from sham-exposed control mice. If the mice were removed from smoke exposure, DNA replicative activity returned to normal levels within one week, but the UDS response to DNA damage remained depressed up to five months after ending smoke exposure. The results show that both transient and apparently permanent changes are produced in mouse lung as the result of exposure to cigarette smoke. The role of these changes in lung neoplasia is under investigation.

  1. Synthesis of type 2 Adenovirus DNA in the Presence of Cycloheximide

    PubMed Central

    Horwitz, Marshall S.; Brayton, Carol; Baum, Stephen G.

    1973-01-01

    Adenovirus type 2 DNA synthesis, either in permissive human cells or nonpermissive monkey cells, becomes independent of protein synthesis after the appearance of progeny viral DNA. In the presence of cycloheximide, semiconservative replication and initiation of progeny molecules can occur. PMID:4349494

  2. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  3. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.

    PubMed

    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D

    2016-05-01

    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  4. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  5. DNA precursor compartmentation in mammalian cells: metabolic and antimetabolic studies of nuclear and mitochondrial DNA synthesis

    SciTech Connect

    Bestwick, R.K.

    1983-01-01

    HeLa cells were used for the quantitation of cellular and mitochondrial deoxyribonucleoside triphosphate (dNTP) and ribonucleoside triphosphate (rNTP) pools and of changes in pools in response to treatment with the antimetabolites methotrexate (mtx) and 5-fluorodeoxyuridine (FUdR). Use of an enzymatic assay of dNTPs and of improved nucleotide extraction methods allowed quantitation of mitochondrial dNTP pools. All four mitochondrial dNTP pools expand following treatment with mtx or FUdR whereas cellular dTTP and dGTP pools are depleted. Mitochrondrial rNTP pools were also found to expand in response to these antimetabolites. Mouse L-cells were used to determine the relative contributions of an exogenously supplied precursor to nuclear and mitochrondrial DNA replication. Cells were labeled to near steady state specific activities with /sup 32/P-orthophosphate and subsequently labeled with (/sup 3/H)uridine, a general pyrimidine precursor, in the continuing presence of /sup 32/P. Deoxyribonucleoside monophosphates derived from these DNAs were separated by HPLC and the /sup 3/H//sup 32/P ratio in each pyrimidine determined. The dCMP residues in mitochondrial DNA (mtDNA) were found to be derived exclusively from the exogenous supplied uridine. The dTMP residues from nuclear and mtDNA and the dCMP residues from nuclear DNA were seen to be synthesized partly from exogenous sources and partly from other sources, presumably de novo pyrimidine synthesis.

  6. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  7. ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

    PubMed

    Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

    2016-07-15

    Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria. PMID:27418514

  8. Inhibition of Cellular DNA Synthesis in Cells Infected with Infectious Pancreatic Necrosis Virus

    PubMed Central

    Lothrop, David; Nicholson, Bruce L.

    1974-01-01

    In asynchronous RTG-2 cell cultures infected with infectious pancreatic necrosis (IPN) virus, inhibition of cellular DNA synthesis, but not protein synthesis, was detected 5 to 6 h postinfection and was 80 to 90% complete by 7 to 8 h. Inhibition of DNA synthesis was largely abolished by UV irradiation of the virus. Sedimentation analyses of phenol-extracted DNA indicated that native cellular DNA was not degraded during infection. Sedimentation on alkaline sucrose gradients of DNA from cells pulsed with radioactive thymidine for varying periods indicated that elongation of nascent DNA chains proceeded normally in infected cells. These and previous results suggest that IPN virus infection results in a reduction of the number of chromosomal sites active in DNA synthesis but does not affect the rate of polymerization at active sites. Cells synchronized with excess thymidine and hydroxyurea and infected with virus at the time of release from the block demonstrated an inhibition of DNA synthesis 3 h postinfection. Cells infected 4 h prior to release continued to synthesize normal amounts of DNA for 1 to 2 h after release. These results indicated that DNA synthesis in early synthetic phase is relatively insensitive to inhibition by IPN virus. PMID:4852469

  9. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  10. Misincorporation during DNA synthesis, analyzed by gel electrophoresis.

    PubMed Central

    Hillebrand, G G; McCluskey, A H; Abbott, K A; Revich, G G; Beattie, K L

    1984-01-01

    A method has been developed for simultaneous comparison of the propensity of a DNA polymerase to misincorporate at different points on a natural template-primer. In this method elongation of a [5'-32P] primer, annealed to a bacteriophage template strand, is carried out in the presence of only three dNTPs (highly purified by HPLC). Under these conditions the rate of primer elongation (monitored by gel electrophoresis/autoradiography) is limited by the rate of misincorporation at template positions complementary to the missing dNTP. Variations in the rate of elongation (revealed by autoradiographic banding patterns) reflect variations in the propensity for misincorporation at different positions along the template. The effect on primer elongation produced by addition of a chemically modified dNTP to 'minus' reactions reveals the mispairing potential of the modified nucleotide during DNA synthesis. By use of this electrophoretic assay of misincorporation we have demonstrated that the fidelity of E. coli DNA polymerase I varies greatly at different positions along a natural template, and that BrdUTP and IodUTP can be incorporated in place of dCTP during chain elongation catalyzed by this enzyme. Images PMID:6326053

  11. Total synthesis of legionaminic acid as basis for serological studies.

    PubMed

    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H

    2015-03-01

    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  12. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  13. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  14. In vivo measurement of unscheduled DNA synthesis and S-phase synthesis as an indicator of hepatocarcinogenesis in rodents.

    PubMed

    Mirsalis, J C

    1987-06-01

    Measurement of chemically induced DNA repair as unscheduled DNA synthesis in rodent liver following in vivo treatment is a useful screen for potential hepatocarcinogens. In addition to measurement of unscheduled DNA synthesis, examination of S-phase synthesis provides an indicator of chemically induced cell proliferation in the liver, which may be a basis for hepatic tumor promotion. Several chemicals and classes of chemicals have been examined using these end points. The pyrrolizidine alkaloid riddelline is a potent genotoxic agent in vitro, and in vivo studies confirm this response as riddelline induces significant elevations in unscheduled DNA synthesis and S-phase synthesis in rat liver. Conversely, H.C. Blue dyes #1 and #2 are both potent genotoxic agents in vitro but fail to express this genotoxicity in vivo. H.C. Blue #1 induces significant increases in S-phase synthesis in B6C3F1 mouse liver, which correlates with the observed carcinogenicity of this compound. Halogenated hydrocarbons likewise fail to induce unscheduled DNA synthesis in vivo, but many of these compounds do increase hepatic cell proliferation in mice, which may be the principal mechanism of hepatocarcinogenesis in this species. PMID:3507253

  15. Structural basis of high-fidelity DNA synthesis by yeast DNA polymerase [delta

    SciTech Connect

    Swan, Michael K.; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2009-09-25

    DNA polymerase {delta} (Pol {delta}) is a high-fidelity polymerase that has a central role in replication from yeast to humans. We present the crystal structure of the catalytic subunit of yeast Pol {delta} in ternary complex with a template primer and an incoming nucleotide. The structure, determined at 2.0-{angstrom} resolution, catches the enzyme in the act of replication, revealing how the polymerase and exonuclease domains are juxtaposed relative to each other and how a correct nucleotide is selected and incorporated. The structure also reveals the 'sensing' interactions near the primer terminus, which signal a switch from the polymerizing to the editing mode. Taken together, the structure provides a chemical basis for the bulk of DNA synthesis in eukaryotic cells and a framework for understanding the effects of cancer-causing mutations in Pol {delta}.

  16. Relationship between DNA adduct formation and unscheduled DNA synthesis (UDS) in cultured mouse epidermal keratinocytes

    SciTech Connect

    Gill, R.D.; Nettikumara, A.N.; DiGiovanni, J. ); Butterworth, B.E. )

    1991-01-01

    Primary cultures of mouse epidermal keratinocytes from SENCAR mice were treated with 7,12-dimethylbenz(a)anthracene (DMBA), benzo(a)pyrene (B(a)P), ({plus minus}) 7{beta}-8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus}) anti-BPDE), and ({plus minus}) 7{beta},8{alpha}-dihydroxy-9{beta},10{beta}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus})syn-BPDE) to examine the relationship between DNA adduct formation and the induction of unscheduled DNA synthesis (UDS). DNA adducts were measured as pmol hydrocarbon bound per mg of DNA, and UDS was quantitated autoradiographically as net grains per nucleus. A good correlation was observed between the levels of UDS detected and the amount of DNA adducts present int he cell population when comparing similar compounds within the linear dose-response range of 0.005 {mu}g/ml-0.25 {mu}g/ml. These results suggest that the present UDS assay with MEKs is a useful assay for the rapid screening of potential genotoxic agents. However, the limits of sensitivity are such that the current assay may be unable to detect a low level of DNA damage induced by some weakly genotoxic (carcinogenic) agents. In addition, while the limits of sensitivity determined in these experiments apply to the polycyclic aromatic hydrocarbon class, other classes of genotoxic compounds such as alkylating agents or crosslinking agents may exhibit different thresholds of detection.

  17. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  18. Synthesis and self-assembly of DNA-chromophore hybrid amphiphiles.

    PubMed

    Albert, Shine K; Golla, Murali; Thelu, Hari Veera Prasad; Krishnan, Nithiyanandan; Deepak, Perapaka; Varghese, Reji

    2016-08-01

    DNA based spherical nanostructures are one of the promising nanostructures for several biomedical and biotechnological applications due to their excellent biocompatibility and DNA-directed surface addressability. Herein, we report the synthesis and amphiphilicity-driven self-assembly of two classes of DNA (hydrophilic)-chromophore (hydrophobic) hybrid amphiphiles into spherical nanostructures. A solid-phase "click" chemistry based modular approach is demonstrated for the synthesis of DNA-chromophore amphiphiles. Various spectroscopic and microscopic analyses reveal the self-assembly of the amphiphiles into vesicular and micellar assemblies with the corona made of hydrophilic DNA and the hydrophobic chromophoric unit as the core of the spherical nanostructures. PMID:27241196

  19. Deoxyribonucleic Acid Synthesis During Exponential Growth and Microcyst Formation in Myxococcus xanthus

    PubMed Central

    Rosenberg, Eugene; Katarski, Mary; Gottlieb, Peter

    1967-01-01

    Myxococcus xanthus in exponential phase with a generation time of 270 min contained a period of 50 min during which deoxyribonucleic acid (DNA) synthesis did not take place. After induction of microcysts by the glycerol technique, the DNA content increased 19%. Autoradiographic experiments demonstrated that the DNA made after glycerol induction was not evenly distributed among the microcysts. The distribution of grains per microcyst fits the following model of chromosome replication: in exponential phase, each daughter cell receives two chromosomes which are replicated sequentially during 80% of the divison cycle; after microcyst induction, no chromosomes are initiated. Mathematical formulas were derived which predict the kinetics and discrete probability distribution for several chromosome models. PMID:6032514

  20. Integrating S-phase Checkpoint Signaling with Trans-Lesion Synthesis of Bulky DNA Adducts

    PubMed Central

    Barkley, Laura R.; Ohmori, Haruo; Vaziri, Cyrus

    2011-01-01

    Bulky adducts are DNA lesions generated in response to environmental agents including benzo[a]pyrene (a combustion product) and solar ultraviolet radiation. Error-prone replication of adducted DNA can cause mutations, which may result in cancer. To minimize the detrimental effects of bulky adducts and other DNA lesions, S-phase checkpoint mechanisms sense DNA damage and integrate DNA repair with ongoing DNA replication. The essential protein kinase Chk1 mediates the S-phase checkpoint, inhibiting initiation of new DNA synthesis and promoting stabilization and recovery of stalled replication forks. Here we review the mechanisms by which Chk1 is activated in response to bulky adducts and potential mechanisms by which Chk1 signaling inhibits the initiation stage of DNA synthesis. Additionally, we discuss mechanisms by which Chk1 signaling facilitates bypass of bulky lesions by specialized Y-family DNA polymerases, thereby attenuating checkpoint signaling and allowing resumption of normal cell cycle progression. PMID:17652783

  1. Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis.

    PubMed

    Cleary, Michele A; Kilian, Kristopher; Wang, Yanqun; Bradshaw, Jeff; Cavet, Guy; Ge, Wei; Kulkarni, Amit; Paddison, Patrick J; Chang, Kenneth; Sheth, Nihar; Leproust, Eric; Coffey, Ernest M; Burchard, Julja; McCombie, W Richard; Linsley, Peter; Hannon, Gregory J

    2004-12-01

    Generation of complex libraries of defined nucleic acid sequences can greatly aid the functional analysis of protein and gene function. Previously, such studies relied either on individually synthesized oligonucleotides or on cellular nucleic acids as the starting material. As each method has disadvantages, we have developed a rapid and cost-effective alternative for construction of small-fragment DNA libraries of defined sequences. This approach uses in situ microarray DNA synthesis for generation of complex oligonucleotide populations. These populations can be recovered and either used directly or immortalized by cloning. From a single microarray, a library containing thousands of unique sequences can be generated. As an example of the potential applications of this technology, we have tested the approach for the production of plasmids encoding short hairpin RNAs (shRNAs) targeting numerous human and mouse genes. We achieved high-fidelity clone retrieval with a uniform representation of intended library sequences. PMID:15782200

  2. Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

    SciTech Connect

    Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

    1982-12-01

    Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-dalton DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.

  3. Complestatin exerts antibacterial activity by the inhibition of fatty acid synthesis.

    PubMed

    Kwon, Yun-Ju; Kim, Hyun-Ju; Kim, Won-Gon

    2015-01-01

    Bacterial enoyl-acyl carrier protein (ACP) reductase has been confirmed as a novel target for antibacterial drug development. In the screening of inhibitors of Staphylococcus aureus enoyl-ACP reductase (FabI), complestatin was isolated as a potent inhibitor of S. aureus FabI together with neuroprotectin A and chloropeptin I from Streptomyces chartreusis AN1542. Complestatin and related compounds inhibited S. aureus FabI with IC₅₀ of 0.3-0.6 µM. They also prevented the growth of S. aureus as well as methicillin-resistance S. aureus (MRSA) and quinolone-resistant S. aureus (QRSA), with minimum inhibitory concentrations (MICs) of 2-4 µg/mL. Consistent with its FabI-inhibition, complestatin selectively inhibited the intracellular fatty acid synthesis in S. aureus, whereas it did not affect the macromolecular biosynthesis of other cellular components, such as DNA, RNA, proteins, and the cell wall. Additionally, supplementation with exogenous fatty acids reversed the antibacterial effect of complestatin, demonstrating that it targets fatty acid synthesis. In this study, we reported that complestatin and related compounds showed potent antibacterial activity via inhibiting fatty acid synthesis. PMID:25947917

  4. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-05-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  5. Unscheduled DNA Synthesis: The Clinical and Functional Assay for Global Genomic DNA Nucleotide Excision Repair

    PubMed Central

    Latimer, Jean J.; Kelly, Crystal M.

    2016-01-01

    The unscheduled DNA synthesis (UDS) assay measures the ability of a cell to perform global genomic nucleotide excision repair (NER). This chapter provides instructions for the application of this technique by creating 6-4 photoproducts and pyrimidine dimers using UV-C irradiation. This procedure is designed specifically for quantification of the 6-4 photoproducts. Repair is quantified by the amount of radioactive thymidine incorporated during repair synthesis after this insult, and radioactivity is evaluated by grain counting after autoradiography. The results are used to clinically diagnose human DNA repair deficiency disorders and provide a basis for investigation of repair deficiency in human tissues or tumors. No other functional assay is available that directly measures the capacity to perform NER on the entire genome without the use of specific antibodies. Since live cells are required for this assay, explant culture techniques must be previously established. Host cell reactivation (HCR), as discussed in Chapter 37, is not an equivalent technique, as it measures only transcription-coupled repair (TCR) at active genes, a small subset of total NER. PMID:24623250

  6. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  7. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  8. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  9. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  10. Synthesis and properties of mirror-image DNA.

    PubMed Central

    Urata, H; Ogura, E; Shinohara, K; Ueda, Y; Akagi, M

    1992-01-01

    We have investigated the conformations of the hexadeoxyribonucleotide, L-d(CGCGCG) composed of L-deoxyribose, the mirror image molecule of natural D-deoxyribose. In this paper, we report the synthesis of four L-deoxynucleosides and the L-oligonucleotide-ethidium bromide interactions. The L-deoxyribose synthon 9 was synthesized from L-arabinose with an over all yield of 28.5% via the Barton-McCombie reaction. The L-deoxynucleosides were obtained by a glycosylation of appropriate nucleobase derivatives with the 1-chloro sugar 9. After derivatization to nucleoside phosphoramidites, L-deoxycytidine and L-deoxyguanosine were incorporated into a hexadeoxynucleotide, L-d(CGCGCG) by a solid-phase beta-cyanoethylphosphoramidite method. This L-hexanucleotide was resistant to digestion with nuclease P1. The conformations of L-d(CGCGCG) were an exact mirror image of that of the corresponding natural one as described previously, and the conformations of the L-d(CGCGCG)-ethidium bromide complex were also the mirror images of those of the D-d(CGCGCG)-ethidium bromide complex under both low and high salt conditions. These results suggest that ethidium bromide prefers not a right-handed helical sense, but the base-base stacking geometry of the B-form rather than that of the Z-form. Thus, L-DNA would be a useful tool for studying DNA-drug interactions. PMID:1630904

  11. Method and apparatus for synthesis of arrays of DNA probes

    DOEpatents

    Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland

    2002-04-23

    The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.

  12. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  13. Flexibility of nucleic acids: From DNA to RNA

    NASA Astrophysics Data System (ADS)

    Lei, Bao; Xi, Zhang; Lei, Jin; Zhi-Jie, Tan

    2016-01-01

    The structural flexibility of nucleic acids plays a key role in many fundamental life processes, such as gene replication and expression, DNA-protein recognition, and gene regulation. To obtain a thorough understanding of nucleic acid flexibility, extensive studies have been performed using various experimental methods and theoretical models. In this review, we will introduce the progress that has been made in understanding the flexibility of nucleic acids including DNAs and RNAs, and will emphasize the experimental findings and the effects of salt, temperature, and sequence. Finally, we will discuss the major unanswered questions in understanding the flexibility of nucleic acids. Project supported by the National Basic Research Program of China (Grant No. 2011CB933600), the National Natural Science Foundation of China (Grant Nos. 11175132, 11575128, and 11374234), and the Program for New Century Excellent Talents, China (Grant No. NCET 08-0408).

  14. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  15. Enantioselective synthesis of isotopically labeled homocitric acid lactone.

    PubMed

    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T

    2013-11-15

    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  16. Associations between Serum Perfluoroalkyl Acids and LINE-1 DNA Methylation

    PubMed Central

    Watkins, Deborah J.; Wellenius, Gregory A.; Butler, Rondi A.; Bartell, Scott M.; Fletcher, Tony; Kelsey, Karl T.

    2014-01-01

    Perfluoroalkyl acids (PFAAs) are persistent, synthetic compounds that are used in a number of consumer products. Perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS) have been associated with cardiovascular risk factors, and changes in gene expression and DNA methylation in animals and cellular systems. However, whether PFAA exposure is associated with LINE-1 DNA methylation, a potential marker of cardiovascular risk, in humans remains unknown. We sought to evaluate the cross-sectional associations between serum PFAAs and LINE-1 DNA methylation in a population highly exposed to PFOA. We measured serum PFAAs twice four to five years apart in 685 adult participants (47% male, mean age ± SD=42 ± 11 years). We measured percent LINE-1 DNA methylation in peripheral blood leukocytes at the second time point (follow-up), and estimated absolute differences in LINE-1 methylation associated with an interquartile (IQR) shift in mean PFAA serum levels. IQR increases in mean serum PFOA, PFOS, perfluorononanoic acid (PFNA), and perfluorohexane sulfonate (PFHxS) were associated with differences of −0.04 (p=0.16), 0.20 (p=0.001), 0.06 (p=0.19), and 0.02 (p=0.57), respectively, in % LINE-1 methylation at follow-up after adjustment for potential confounders. We observed a monotonic increase in LINE-1 DNA methylation across tertiles of PFOS and PFNA (ptrend=0.02 for both associations), but not across tertiles of PFOA or PFHxS (ptrend=0.71 and 0.44, respectively). In summary, serum PFOS was associated with LINE-1 methylation, while serum PFOA, PFHxS, and PFNA were not. Additional research is needed to more precisely determine whether these compounds are epigenetically active. PMID:24263140

  17. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  18. Nucleic Acid-Peptide Complex Phase Controlled by DNA Hybridization

    NASA Astrophysics Data System (ADS)

    Vieregg, Jeffrey; Lueckheide, Michael; Leon, Lorraine; Marciel, Amanda; Tirrell, Matthew

    When polyanions and polycations are mixed, counterion release drives formation of polymer-rich complexes that can either be solid (precipitates) or liquid (coacervates) depending on the properties of the polyelectrolytes. These complexes are important in many fields, from encapsulation of industrial polymers to membrane-free segregation of biomolecules such as nucleic acids and proteins. Condensation of long double-stranded DNA has been studied for several decades, but comparatively little attention has been paid to the polyelectrolyte behavior of oligonucleotides. We report here studies of DNA oligonucleotides (10 - 88 nt) complexed with polylysine (10 - 100 aa). Unexpectedly, we find that the phase of the resulting complexes is controlled by the hybridization state of the nucleic acid, with double-stranded DNA forming precipitates and single-stranded DNA forming coacervates. Stability increases with polyelectrolyte length and decreases with solution salt concentration, with complexes of the longer double-stranded polymers undergoing precipitate/coacervate/soluble transitions as ionic strength is increased. Mixing coacervates formed by complementary single-stranded oligonucleotides results in precipitate formation, raising the possibility of stimulus-responsive material design.

  19. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk

    2008-10-01

    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  20. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  1. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  2. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  3. Physiology and molecular genetics of poly(beta-hydroxy-alkanoic acid) synthesis in Alcaligenes eutrophus.

    PubMed

    Steinbüchel, A; Schlegel, H G

    1991-03-01

    The Alcaligenes eutrophus genes for beta-ketothiolase, NADPH-dependent acetoacetyl-CoA reductase and poly(beta-hydroxybutyric acid) synthase (PHB synthase) which comprise the three-step PHB-biosynthetic pathway, were cloned. Molecular studies revealed that these genes are organized in a single operon. The A. eutrophus PHB-biosynthetic genes are readily expressed in other bacteria, and DNA fragments harbouring the operon can be used as a cartridge to confer to other bacteria the ability to synthesize PHB from acetyl-CoA. The biochemical and physiological capabilities of A. eutrophus for the synthesis of a wide variety of polyhydroxyalkanoates are discussed. PMID:2046547

  4. Characterization of DNA Binding and Retinoic Acid Binding Properties of Retinoic Acid Receptor

    NASA Astrophysics Data System (ADS)

    Yang, Na; Schule, Roland; Mangelsdorf, David J.; Evans, Ronald M.

    1991-05-01

    High-level expression of the full-length human retinoic acid receptor (RAR) α and the DNA binding domain of the RAR in Escherichia coli was achieved by using a T7 RNA polymerase-directed expression system. After induction, full-length RAR protein was produced at an estimated level of 20% of the total bacterial proteins. Both intact RAR molecules and the DNA binding domain bind to the cognate DNA response element with high specificity in the absence of retinoic acid. However, this binding is enhanced to a great extent upon the addition of eukaryotic cell extracts. The factor responsible for this enhancement is heat-sensitive and forms a complex with RAR that binds to DNA and exhibits a distinct migration pattern in the gel-mobility-shift assay. The interaction site of the factor with RAR is localized in the 70-amino acid DNA binding region of RAR. The hormone binding ability of the RARα protein was assayed by a charcoal absorption assay and the RAR protein was found to bind to retinoic acid with a K_d of 2.1 x 10-10 M.

  5. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  6. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.

    2012-01-01

    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  7. Sequence rearrangement and duplication of double stranded fibronectin cDNA probably occurring during cDNA synthesis by AMV reverse transcriptase and Escherichia coli DNA polymerase I.

    PubMed Central

    Fagan, J B; Pastan, I; de Crombrugghe, B

    1980-01-01

    Two cloned cDNAs derived from the mRNA for cell fibronectin have been sequenced, providing evidence that transcription with AMV reverse transcriptase or Escherichia coli DNA polymerase I may not always result in double stranded cDNA that is exactly homologous with its mRNA template. Instead, the sequences of these cloned cDNAs are consistent with the duplication and rearrangement of sequences during synthesis of double stranded cDNA. PMID:6159581

  8. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  9. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.

    1981-01-01

    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  10. Chemical synthesis of human papillomavirus type 16 E7 oncoprotein: autonomous protein domains for induction of cellular DNA synthesis and for trans activation.

    PubMed

    Rawls, J A; Pusztai, R; Green, M

    1990-12-01

    The human papillomavirus type 16 E7 protein belongs to a family of nuclear oncoproteins that share amino acid sequences and functional homology. To localize biochemical activities associated with E7, we chemically synthesized the full-length 98-amino-acid polypeptide and several deletion mutant peptides. We show that the E7 polypeptide is biologically active and possesses at least two functional domains; the first induces cellular DNA synthesis in quiescent rodent cells, and the second trans activates the adenovirus E1A-inducible early E2 promoter and binds zinc. Further, each domain is autonomous and can function on separate peptides. DNA synthesis induction activity maps within the N-terminal portion of the molecule, which contains sequences related to adenovirus E1A conserved domains 1 and 2 required for cell transformation and binding of the retinoblastoma gene product. trans-Activation and Zn-binding activities map within the C-terminal portion of the molecule, a region which contains Cys-X-X-Cys motifs. trans Activation does not require protein synthesis, implying a mechanism that involves interaction with a preexisting cellular factor(s). E7 trans activates the adenovirus E2 promoter but not other E1A-inducible viral promoters, suggesting the possibility that E7 trans activation involves interaction, directly or indirectly, with cellular transcription factor E2F. PMID:2173783

  11. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  12. Involvement of budding yeast Rad5 in translesion DNA synthesis through physical interaction with Rev1

    PubMed Central

    Xu, Xin; Lin, Aiyang; Zhou, Cuiyan; Blackwell, Susan R.; Zhang, Yiran; Wang, Zihao; Feng, Qianqian; Guan, Ruifang; Hanna, Michelle D.; Chen, Zhucheng; Xiao, Wei

    2016-01-01

    DNA damage tolerance (DDT) is responsible for genomic stability and cell viability by bypassing the replication block. In Saccharomyces cerevisiae DDT employs two parallel branch pathways to bypass the DNA lesion, namely translesion DNA synthesis (TLS) and error-free lesion bypass, which are mediated by sequential modifications of PCNA. Rad5 has been placed in the error-free branch of DDT because it contains an E3 ligase domain required for PCNA polyubiquitination. Rad5 is a multi-functional protein and may also play a role in TLS, since it interacts with the TLS polymerase Rev1. In this study we mapped the Rev1-interaction domain in Rad5 to the amino acid resolution and demonstrated that Rad5 is indeed involved in TLS possibly through recruitment of Rev1. Genetic analyses show that the dual functions of Rad5 can be separated and reconstituted. Crystal structure analysis of the Rad5–Rev1 interaction reveals a consensus RFF motif in the Rad5 N-terminus that binds to a hydrophobic pocket within the C-terminal domain of Rev1 that is highly conserved in eukaryotes. This study indicates that Rad5 plays a critical role in pathway choice between TLS and error-free DDT. PMID:27001510

  13. Involvement of budding yeast Rad5 in translesion DNA synthesis through physical interaction with Rev1.

    PubMed

    Xu, Xin; Lin, Aiyang; Zhou, Cuiyan; Blackwell, Susan R; Zhang, Yiran; Wang, Zihao; Feng, Qianqian; Guan, Ruifang; Hanna, Michelle D; Chen, Zhucheng; Xiao, Wei

    2016-06-20

    DNA damage tolerance (DDT) is responsible for genomic stability and cell viability by bypassing the replication block. In Saccharomyces cerevisiae DDT employs two parallel branch pathways to bypass the DNA lesion, namely translesion DNA synthesis (TLS) and error-free lesion bypass, which are mediated by sequential modifications of PCNA. Rad5 has been placed in the error-free branch of DDT because it contains an E3 ligase domain required for PCNA polyubiquitination. Rad5 is a multi-functional protein and may also play a role in TLS, since it interacts with the TLS polymerase Rev1. In this study we mapped the Rev1-interaction domain in Rad5 to the amino acid resolution and demonstrated that Rad5 is indeed involved in TLS possibly through recruitment of Rev1. Genetic analyses show that the dual functions of Rad5 can be separated and reconstituted. Crystal structure analysis of the Rad5-Rev1 interaction reveals a consensus RFF motif in the Rad5 N-terminus that binds to a hydrophobic pocket within the C-terminal domain of Rev1 that is highly conserved in eukaryotes. This study indicates that Rad5 plays a critical role in pathway choice between TLS and error-free DDT. PMID:27001510

  14. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells.

    PubMed

    Canitrot, Y; Hoffmann, J S; Calsou, P; Hayakawa, H; Salles, B; Cazaux, C

    2000-09-01

    The nucleotide excision repair pathway contributes to genetic stability by removing a wide range of DNA damage through an error-free reaction. When the lesion is located, the altered strand is incised on both sides of the lesion and a damaged oligonucleotide excised. A repair patch is then synthesized and the repaired strand is ligated. It is assumed that only DNA polymerases delta and/or epsilon participate to the repair DNA synthesis step. Using UV and cisplatin-modified DNA templates, we measured in vitro that extracts from cells overexpressing the error-prone DNA polymerase beta exhibited a five- to sixfold increase of the ultimate DNA synthesis activity compared with control extracts and demonstrated the specific involvement of Pol beta in this step. By using a 28 nt gapped, double-stranded DNA substrate mimicking the product of the incision step, we showed that Pol beta is able to catalyze strand displacement downstream of the gap. We discuss these data within the scope of a hypothesis previously presented proposing that excess error-prone Pol beta in cancer cells could perturb the well-defined specific functions of DNA polymerases during error-free DNA transactions. PMID:10973926

  15. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  16. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.

    1971-01-01

    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  17. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  18. Radiation effects on DNA synthesis in a defined chromosomal replicon

    SciTech Connect

    Larner, J.M.; Lee, H.; Hamlin, J.L. )

    1994-03-01

    It has recently been shown that the tumor suppressor p53 mediates a signal transduction pathway that responds to DNA damage by arresting cells in the late G[sub 1] period of the cell cycle. However, the operation of this pathway alone cannot explain the 50% reduction in the rate of DNA synthesis that occurs within 30 min of irradiation of an asynchronous cell population. The authors are using the amplified dihydrofolate reductase (DHFR) domain in the methotrexate-resistance CHO cell line, CHOC 400, as a model replicon in which to study this acute radiation effect. They first show that the CHOC-400 cell line retains the classical acute-phase response but does not display the late G[sub 1] arrest that characterizes the p53-mediated checkpoint. Using a two-dimensional gel replicon-mapping method, they then show that when asynchronous cultures are irradiated with 900 cGy, initiation in the DHFR locus is completely inhibited within 30 min and does not resume for 3 to 4 h. Since initiation in this locus occurs throughout the first 2 h of the S period, this result implies the existence of a p53-independent S-phase damage-sensing pathway that functions at the level of individual origins. Results obtained with the replication inhibitor mimosine define a position near the G[sub 1]/S boundary beyond which cells are unable to prevent initiation at early-firing origins in response to irradiation. This is the first direct demonstration at a defined chromosomal origin that radiation quantitatively down-regulates initiation. 42 refs., 9 figs.

  19. Complexing of amino acids to DNA by chromate in intact cells.

    PubMed Central

    Voitkun, V; Zhitkovich, A; Costa, M

    1994-01-01

    Using o-pthaldialdehyde (OPT) fluorescence, the amino acids associated with DNA were studied following exposure of intact Chinese hamster ovary cells to chromate. Rigorous extraction with EDTA, acid, or base was required to release the amino acids cross-linked to the DNA isolated from control or chromate-treated cells by standard procedures (i.e., proteinase K, phenol, etc.). Amino acids resisting extraction from DNA were not studied since analysis was limited to those that could be released by these procedures. There was a chromate dose-dependent increase in amino acids complexed with the DNA that could be released by EDTA, acid, and base, and these amino acids were separated by HPLC and identified. Substantial increases in cysteine, glutamine, glutamic acid, histidine, threonine, and tyrosine were found as a function of increasing concentrations of chromate. There was also a time-dependent increase in complexing of these amino acids to the DNA by chromate. The amino acids found complexed to DNA in intact cells by chromate were thought to originate from reactions of free amino acids or small peptides with the DNA rather than being proteolytic products derived from larger proteins that were cross-linked to the DNA. This was supported by a number of experiments: a) free amino acids or bovine serum albumin (BSA) were cross-linked by chromium to DNA in vitro and the DNA was isolated by standard procedures.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7843108

  20. DNA synthesis in yeast cell-free extracts dependent on recombinant DNA plasmids purified from Escherichia coli.

    PubMed Central

    Jong, A Y; Scott, J F

    1985-01-01

    In our attempts to establish a cell-free DNA replication system for the yeast Saccharomyces cerevisiae, we have observed that recombinant DNA plasmids purified from Escherichia coli by a common procedure (lysozyme-detergent lysis and equilibrium banding in cesium chloride ethidium bromide gradients) often serve as templates for DNA synthesis by elongation enzymes. The templates could be elongated equally well by enzymes present in the yeast cell-free extracts, by the large proteolytic fragment of E. coli DNA polymerase I or by T4 DNA polymerase. The template activity of the purified plasmids was dependent on the presence of heterologous DNA segments in the bacterial vectors. The template activity could be diminished by treatment with alkali. We propose that the ability of recombinant plasmids isolated from bacterial hosts to serve as elongation templates may lead to erroneous conclusions when these plasmids are used as templates for in vitro replication or transcription reactions. Images PMID:3889851

  1. RecG Directs DNA Synthesis during Double-Strand Break Repair

    PubMed Central

    Azeroglu, Benura; Mawer, Julia S. P.; Cockram, Charlotte A.; White, Martin A.; Hasan, A. M. Mahedi; Filatenkova, Milana; Leach, David R. F.

    2016-01-01

    Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR) that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300), arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability. PMID:26872352

  2. Inhibition of mouse peritoneal macrophage DNA synthesis by infection with the arenavirus Pichinde.

    PubMed Central

    Friedlander, A M; Jahrling, P B; Merrill, P; Tobery, S

    1984-01-01

    Macrophage DNA synthesis and proliferation occur during the development of cell-mediated immunity and in the early nonspecific reaction to infection. Arenaviruses have a predilection for infection of cells of the reticuloendothelial system, and in this study we have examined the effect of the arenavirus Pichinde on macrophage DNA synthesis. We have found that infection of mouse peritoneal macrophages with Pichinde caused a profound dose-dependent inhibition of the DNA synthesis induced by macrophage growth factor-colony stimulating factor. At a multiplicity of inoculum of 5, there is a 75 to 95% inhibition of DNA synthesis. Viable virus is necessary for inhibition since Pichinde inactivated by heat or cobalt irradiation had no effect. Similarly, virus pretreated with an antiserum to Pichinde was without inhibitory effect. Inhibition was demonstrated by measuring DNA synthesis spectrofluorometrically as well as by [3H]thymidine incorporation. The inhibition of DNA synthesis was not associated with any cytopathology. There was no evidence that the inhibition was due to soluble factors, such as prostaglandins or interferon, released by infected cells. These studies demonstrate, for the first time in vitro, a significant alteration in macrophage function caused by infection with an arenavirus. It is possible that inhibition of macrophage proliferation represents a mechanism by which some microorganisms interfere with host resistance. PMID:6690404

  3. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  4. Complementation of defective translesion synthesis and UV light sensitivity in xeroderma pigmentosum variant cells by human and mouse DNA polymerase eta.

    PubMed

    Yamada, A; Masutani, C; Iwai, S; Hanaoka, F

    2000-07-01

    Defects in the human gene XPV result in the variant form of the genetic disease xeroderma pigmentosum (XP-V). XPV encodes DNA polymerase eta, a novel DNA polymerase that belongs to the UmuC/DinB/Rad30 superfamily. This polymerase catalyzes the efficient and accurate translesion synthesis of DNA past cis-syn cyclobutane di-thymine lesions. In this report we present the cDNA sequence and expression profiles of the mouse XPV gene and demonstrate its ability to complement defective DNA synthesis in XP-V cells. The mouse XPV protein shares 80.3% amino acid identity and 86.9% similarity with the human XPV protein. The recombinant mouse XPV protein corrected the inability of XP-V cell extracts to carry out DNA replication, by bypassing thymine dimers on template DNA. Transfection of the mouse or human XPV cDNA into human XP-V cells corrected UV sensitivity. Northern blot analysis revealed that the mouse XPV gene is expressed ubiquitously, but at a higher level in testis, liver, skin and thymus compared to other tissues. Although the mouse XPV gene was not induced by UV irradiation, its expression was elevated approximately 4-fold during cell proliferation. These results suggest that DNA polymerase eta plays a role in DNA replication, though the enzyme is not essential for viability. PMID:10871396

  5. Interaction of photosensitive surfactant with DNA and poly acrylic acid.

    PubMed

    Zakrevskyy, Yuriy; Cywinski, Piotr; Cywinska, Magdalena; Paasche, Jens; Lomadze, Nino; Reich, Oliver; Löhmannsröben, Hans-Gerd; Santer, Svetlana

    2014-01-28

    In this paper, we investigate interactions and phase transitions in polyelectrolyte-surfactant complexes formed between a cationic azobenzene-containing surfactant and two types of polyelectrolytes: natural (DNA) or synthetic (PAA: poly acrylic acid). The construction of a phase diagram allowed distancing between four major phases: extended coil conformation, colloidally stable compacted globules, colloidal instability range, and surfactant-stabilized compact state. Investigation on the complexes' properties in different phases and under irradiation with UV light provides information about the role of the surfactant's hydrophobic trans isomers both in the formation and destruction of DNA and PAA globules as well as in their colloidal stabilization. The trans isomer shows much stronger affinity to the polyelectrolytes than the hydrophilic cis counterpart. There is no need for complete compensation of the polyelectrolyte charges to reach the complete compaction. On contrary to the findings previously reported in the literature, we demonstrate - for the first time - complete polyelectrolyte compaction which occurs already at 20% of DNA (and at 50% of PAA) charge compensation. The trans isomer plays the main role in the compaction. The aggregation between azobenzene units in the photosensitive surfactant is a driving force of this process. The decompaction can be realized during UV light irradiation and is strongly influenced by the interplay between surfactant-surfactant and surfactant-DNA interactions in the compacted globules. PMID:25669583

  6. Interaction of photosensitive surfactant with DNA and poly acrylic acid

    SciTech Connect

    Zakrevskyy, Yuriy Paasche, Jens; Lomadze, Nino; Santer, Svetlana; Cywinski, Piotr; Cywinska, Magdalena; Reich, Oliver; Löhmannsröben, Hans-Gerd

    2014-01-28

    In this paper, we investigate interactions and phase transitions in polyelectrolyte-surfactant complexes formed between a cationic azobenzene-containing surfactant and two types of polyelectrolytes: natural (DNA) or synthetic (PAA: poly acrylic acid). The construction of a phase diagram allowed distancing between four major phases: extended coil conformation, colloidally stable compacted globules, colloidal instability range, and surfactant-stabilized compact state. Investigation on the complexes’ properties in different phases and under irradiation with UV light provides information about the role of the surfactant's hydrophobic trans isomers both in the formation and destruction of DNA and PAA globules as well as in their colloidal stabilization. The trans isomer shows much stronger affinity to the polyelectrolytes than the hydrophilic cis counterpart. There is no need for complete compensation of the polyelectrolyte charges to reach the complete compaction. On contrary to the findings previously reported in the literature, we demonstrate – for the first time – complete polyelectrolyte compaction which occurs already at 20% of DNA (and at 50% of PAA) charge compensation. The trans isomer plays the main role in the compaction. The aggregation between azobenzene units in the photosensitive surfactant is a driving force of this process. The decompaction can be realized during UV light irradiation and is strongly influenced by the interplay between surfactant-surfactant and surfactant-DNA interactions in the compacted globules.

  7. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  8. The natural non-protein amino acid N-β-methylamino-L-alanine (BMAA) is incorporated into protein during synthesis.

    PubMed

    Glover, W Broc; Mash, Deborah C; Murch, Susan J

    2014-11-01

    N-β-methylamino-L-alanine (BMAA) is an amino acid produced by cyanobacteria and accumulated through trophic levels in the environment and natural food webs. Human exposure to BMAA has been linked to progressive neurodegenerative diseases, potentially due to incorporation of BMAA into protein. The insertion of BMAA and other non-protein amino acids into proteins may trigger protein misfunction, misfolding and/or aggregation. However, the specific mechanism by which BMAA is associated with proteins remained unidentified. Such studies are challenging because of the complexity of biological systems and samples. A cell-free in vitro protein synthesis system offers an excellent approach for investigation of changing amino acid composition in protein. In this study, we report that BMAA incorporates into protein as an error in synthesis when a template DNA sequence is used. Bicinchoninic acid assay of total protein synthesis determined that BMAA effectively substituted for alanine and serine in protein product. LC-MS/MS confirmed that BMAA was selectively inserted into proteins in place of other amino acids, but isomers N-(2-aminoethyl)glycine (AEG) and 2,4-diaminobutyric acid (DAB) did not share this characteristic. Incorporation of BMAA into proteins was significantly higher when genomic DNA from post-mortem brain was the template. About half of BMAA in the synthetic proteins was released with denaturation with sodium dodecylsulfonate and dithiothreitol, but the remaining BMAA could only be released by acid hydrolysis. Together these data demonstrate that BMAA is incorporated into the amino acid backbone of proteins during synthesis and also associated with proteins through non-covalent bonding. PMID:25096519

  9. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A–T phosphoramidite building blocks

    PubMed Central

    Schmidtgall, Boris; Höbartner, Claudia

    2015-01-01

    Summary Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T–T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X–T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A–T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  10. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

    PubMed

    Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

    2015-01-01

    Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  11. Synthesis, integration, and restriction and modification of mycoplasma virus L2 DNA

    SciTech Connect

    Dybvig, K.

    1981-01-01

    Mycoplasma virus L2 is an enveloped, nonlytic virus containing double-stranded, superhelical DNA. The L2 virion contains about 7 to 8 major proteins identified by SDS-polyacrylamide gel electrophoresis, but the virion has no discernible capsid structure. It has been suggested that the L2 virion is a DNA-protein condensation surrounded by a lipid-protein membrane. The host for mycoplasma virus L2 is Acholeplasma laidlawii. A. laidlawii has no cell wall and contains a small genome, 1 x 10/sup 9/ daltons, which is two to three times smaller than that of most bacteria. Infection of A. laidlawii by L2 is nonlytic. The studies in this thesis show that L2 DNA synthesis begins at about 1 hour of infection and lasts throughout the infection. Viral DNA synthesis is inhibited by chloramphenicol, streptomycin, and novobiocin. Packaging of L2 DNA into progeny virus is also inhibited by chloramphenicol and novobiocin. It is concluded that protein synthesis and probably DNA gyrase activity are required for L2 DNA synthesis, and for packaging of L2 DNA into progeny virus. DNA-DNA hybridization studies demonstrate that L2 DNA integrates into the host cell during infection, and subsequent to infection the cells are mycoplasma virus L2 lysogens. The viral site of integration has been roughly mapped. L2 virus is restricted and modified by A. laidlawii strains JA1 and K2. The nature of the modification in strain K2 has been elucidated. Two L2 variants containing insertions in the viral DNA were identified in these studies. Restriction endonuclease cleavage maps of these variants have been determined. DNA from L2 and another isolate of L2, MV-Lg-L 172, are compared in these studies. 74 references, 33 figures, 6 tables. (ACR)

  12. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  13. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  14. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  15. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  16. DNA SYNTHESIS IN THE FERTILIZING HAMSTER SPERM NUCLEUS: SPERM TEMPLATE AVAILABILITY AND EGG CYTOPLASMIC CONTROL

    EPA Science Inventory

    To assess the role of sperm template availability in the regulation of DNA synthesis, the morphological status of the fertilizing hamster sperm nucleus was correlated with its ability to synthesize DNA after in vivo and in vitro fertilization. Fertilized hamster eggs were incubat...

  17. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-01

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  18. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  19. Strategies for the Total Synthesis of Clavicipitic Acid.

    PubMed

    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori

    2016-04-11

    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  20. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.

    2015-01-01

    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  1. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  2. Nerve growth factor inhibits the synthesis of a single-stranded DNA binding protein in pheochromocytoma cells (clone PC12).

    PubMed Central

    Biocca, S; Cattaneo, A; Calissano, P

    1984-01-01

    Arrest of mitosis and neurite outgrowth induced by nerve growth factor (NGF) in rat pheochromocytoma cells (clone PC12) is accompanied by a progressive inhibition of the synthesis of a protein that binds to single-stranded but not to double-stranded DNA. Time course experiments show that this inhibition is already apparent after a 2-day incubation with NGF and is maximum (85-95%) upon achievement of complete PC12 cell differentiation. Inhibition of the synthesis of this single-stranded DNA binding protein after 48 hr of incubation with NGF is potentiated by concomitant treatment of PC12 cells with antimitotic drugs acting at different levels of DNA replication. Purification on a preparative scale of this protein and analysis of its major physicochemical properties show that: (i) it constitutes 0.5% of total soluble proteins of naive PC12 cells; (ii) its molecular weight measured by NaDodSO4/PAGE is Mr 34,000 (sucrose gradient centrifugation under nondenaturing conditions yields a sedimentation coefficient s20,w of 8.1 S, indicating that the native protein is an oligomer); (iii) amino acid analysis demonstrates a preponderance of acidic over basic residues, while electrofocusing experiments show that it has an isoelectric point around 8.0; (iv) approximately 15% of the protein is phosphorylated in vivo. It is postulated that control of the synthesis of this protein is connected with activation of a differentiative program triggered by NGF in the PC12 neoplastic cell line at some step(s) of DNA activity. Images PMID:6585787

  3. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  4. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  5. Requirement of E. coli DNA synthesis functions for the lytic replication of bacteriophage P1.

    PubMed

    Hay, N; Cohen, G

    1983-11-01

    P1 lytic growth was examined in a number of different temperature sensitive mutants of E. coli that affect chromosomal replication. Growth was analyzed by measurements of phage burst sizes and specific DNA synthesis. Efficient P1 growth required each of the bacterial elongation functions dnaE (polC), dnaZ (sub units of E. coli polymerase III holoenzyme), and dnaG (primase) but was not dependent on the elongation function dnaB (mobile promoter). Of two initiation functions tested the dnaA function was found to be dispensable for normal growth whereas the dnaC function was essential. Temperature shift experiments with different dnaC mutants showed that the initiation component of the dnaC function was needed continuously throughout at least the first half of the lytic cycle, while the dnaC elongation activity was probably required during the entire cycle for normal phage yields. In two respects the dependence of P1 lytic growth on E. coli DNA synthesis functions was significantly different from that reported for P1 plasmid replication (Scott and Vapnek, 1980). Thus, lytic replication was far more dependent on a functional polC gene product than was plasmid replication and did not require the bacterial dnaB product. PMID:6359668

  6. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John

    2002-01-01

    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  7. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  8. Cellular integrity is required for inhibition of initiation of cellular DNA synthesis by reovirus type 3.

    PubMed Central

    Roner, M R; Cox, D C

    1985-01-01

    Synchronized HeLa cells, primed for entry into the synthesis phase by amethopterin, were prevented from initiating DNA synthesis 9 h after infection with reovirus type 3. However, nuclei isolated from synchronized cells infected with reovirus for 9 or 16 h demonstrated a restored ability to synthesize DNA. The addition of enucleated cytoplasmic extracts from infected or uninfected cells did not affect this restored capacity for synthesis. The addition of ribonucleotide triphosphates to nuclei isolated from infected cells stimulated additional DNA synthesis, suggesting that these nuclei were competent to initiate new rounds of DNA replication. Permeabilization of infected cells did not restore the ability of these cells to synthesize DNA. Nucleoids isolated from intact or permeabilized cells, infected for 9 or 16 h displayed an increased rate of sedimentation when compared with nucleoids isolated from uninfected cells. Nucleoids isolated from the nuclei of infected cells demonstrated a rate of sedimentation similar to that of nucleoids isolated from the nuclei of uninfected cells. The inhibition of initiation of cellular DNA synthesis by reovirus type 3 appears not to have been due to a permanent alteration of the replication complex, but this inhibition could be reversed by the removal of that complex from factors unique to the structural or metabolic integrity of the infected cell. Images PMID:3968718

  9. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.

    PubMed

    Lem, N W; Stumpf, P K

    1984-01-01

    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  10. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  11. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  12. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  13. Targeting lipopolyplexes using bifunctional peptides incorporating hydrophobic spacer amino acids: synthesis, transfection, and biophysical studies.

    PubMed

    Pilkington-Miksa, Michael A; Writer, Michele J; Sarkar, Supti; Meng, Qing-Hai; Barker, Suzie E; Shamlou, Parviz Ayazi; Hailes, Helen C; Hart, Stephen L; Tabor, Alethea B

    2007-01-01

    We have developed efficient synthetic routes to two hydrophobic amino acids, suitably protected for solid-phase peptide synthesis, and have successfully synthesized peptides containing these or other hydrophobic amino acids as spacers between a Lys16 moiety and an integrin-targeting motif. These peptides have in turn been used to formulate a range of lipopolyplex vectors with Lipofectin and plasmid DNA. The transfection efficiencies of these vectors and their aggregation behavior in buffers and in serum have been studied. We have shown that vectors containing peptides incorporating long linkers that are entirely hydrophobic are less efficient transfection agents. However, linkers of equivalent length that are in part hydrophobic show improved transfection properties, which is probably due to the improved accessibility of the integrin-binding motif. PMID:17915956

  14. Ascorbic acid intake and oxalate synthesis.

    PubMed

    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P

    2016-08-01

    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  15. Effects of 3-aminobenzamide on DNA synthesis and cell cycle progression in Chinese hamster ovary cells

    SciTech Connect

    Schwartz, J.L.; Morgan, W.F.; Kapp, L.N.; Wolff, S.

    1983-01-01

    3-Aminobenzamide (3AB), in inhibitor of poly(ADP-ribose) polymerase, is a potent inducer of sister chromatid exchanges (SCEs). Because of the possible relation between SCEs and DNA synthesis, the effects of 3AB on DNA synthesis and cell cycle progression in Chinese hamster ovary (CHO) cells were examined. Unlike all other SCE-inducing agents whose effects on DNA synthesis have been studied, short term exposures (30-120 min) of 3AB did not inhibit the overall rate of DNA synthesis and this result was independent of the amount of bromodeoxyuridine (BrdU) in the DNA. Longer exposure times (>24 h) did result in an extended S phase, but this was not due to an effect on the rate of DNA chain elongation. 3AB also delayed the entry of cells into S phase. The overall cell cycle delay was dose dependent, approaching 9 h after a 54 h exposure to 10 mM 3AB. Earlier reports that 3AB is neither mutagenic nor cytotoxic were confirmed. Thus 3AB acts to increase SCE frequency by a mechanism distinct from that which causes cytotoxicity and mutagenicity, and does not involve any inhibition in the rate of DNA chain growth. 25 references, 3 figures, 2 tables.

  16. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  17. Boronic Acid-modified DNA that Changes Fluorescent Properties upon Carbohydrate Binding†

    PubMed Central

    Yang, Xiaochuan; Dai, Chaofeng; Molina, Angie Dayan Calderon

    2010-01-01

    A long wavelength boronic acid-modified TTP (NB-TTP) has been synthesized and enzymatically incorporated into DNA. Such DNA shows intrinsic fluorescent changes upon carbohydrate addition. PMID:20126717

  18. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  19. Pre-Incubation of Auric Acid with DNA Is Unnecessary for the Formation of DNA-Templated Gold Nanoclusters.

    PubMed

    Chen, Yang; Tao, Guangyu; Lin, Ruoyun; Pei, Xiaojing; Liu, Feng; Li, Na

    2016-06-01

    The rationale for the preparation of DNA-templated gold nanoclusters (DNA-Au NCs) has not been well understood, thereby slowing down the advancement of the synthesis and applications of DNA-Au NCs. The interaction between metal ions and the DNA template seems to be the key factor for the successful preparation of DNA-templated metal nanoclusters. With the help of circular dichroism in this contribution, we put efforts into interrogating the necessity of pre-incubation of HAuCl4 with poly-adenine template in the formation of Au NCs by citrate reduction. Our results revealed that the pre-incubation of HAuCl4 with poly-adenine is not favorable for the formation of Au NCs, which is distinctly different from the formation process for silver nanoclusters. It is our hope that this study can provide guidance in the preparation of Au NCs with more DNA templates. PMID:27060903

  20. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  1. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  2. Long-lived crowded-litter mice have an age-dependent increase in protein synthesis to DNA synthesis ratio and mTORC1 substrate phosphorylation

    PubMed Central

    Bruns, Danielle R.; Peelor, Frederick F.; Biela, Laurie M.; Miller, Richard A.; Hamilton, Karyn L.; Miller, Benjamin F.

    2014-01-01

    Increasing mouse litter size [crowded litter (CL)] presumably imposes a transient nutrient stress during suckling and extends lifespan through unknown mechanisms. Chronic calorically restricted and rapamycin-treated mice have decreased DNA synthesis and mTOR complex 1 (mTORC1) signaling but maintained protein synthesis, suggesting maintenance of existing cellular structures. We hypothesized that CL would exhibit similar synthetic and signaling responses to other long-lived models and, by comparing synthesis of new protein to new DNA, that insight may be gained into the potential preservation of existing cellular structures in the CL model. Protein and DNA synthesis was assessed in gastroc complex, heart, and liver of 4- and 7-mo CL mice. We also examined mTORC1 signaling in 3- and 7-mo aged animals. Compared with controls, 4-mo CL had greater DNA synthesis in gastroc complex with no differences in protein synthesis or mTORC1 substrate phosphorylation across tissues. Seven-month CL had less DNA synthesis than controls in heart and greater protein synthesis and mTORC1 substrate phosphorylation across tissues. The increased new protein-to-new DNA synthesis ratio suggests that new proteins are synthesized more so in existing cells at 7 mo, differing from 4 mo, in CL vs. controls. We propose that, in CL, protein synthesis shifts from being directed toward new cells (4 mo) to maintenance of existing cellular structures (7 mo), independently of decreased mTORC1. PMID:25205819

  3. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.

    PubMed

    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A

    2015-10-01

    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  4. The DNA intercalating alkaloid cryptolepine interferes with topoisomerase II and inhibits primarily DNA synthesis in B16 melanoma cells.

    PubMed

    Bonjean, K; De Pauw-Gillet, M C; Defresne, M P; Colson, P; Houssier, C; Dassonneville, L; Bailly, C; Greimers, R; Wright, C; Quetin-Leclercq, J; Tits, M; Angenot, L

    1998-04-14

    Cryptolepine hydrochloride is an indoloquinoline alkaloid isolated from the roots of Cryptolepis sanguinolenta. It is characterized by a multiplicity of host-mediated biological activities, including antibacterial, antiviral, and antimalarial properties. To date, the molecular basis for its diverse biological effects remains largely uncertain. Several lines of evidence strongly suggest that DNA might correspond to its principal cellular target. Consequently, we studied the strength and mode of binding to DNA of cryptolepine by means of absorption, fluorescence, circular, and linear dichroism, as well as by a relaxation assay using DNA topoisomerases. The results of various optical and gel electrophoresis techniques converge to reveal that the alkaloid binds tightly to DNA and behaves as a typical intercalating agent. In DNAase I footprinting experiments it was found that the drug interacts preferentially with GC-rich sequences and discriminates against homo-oligomeric runs of A and T. This study has also led to the discovery that cryptolepine is a potent topoisomerase II inhibitor and a promising antitumor agent. It stabilizes topoisomerase II-DNA covalent complexes and stimulates the cutting of DNA at a subset of preexisting topoisomerase II cleavage sites. Taking advantage of the fluorescence of the indoloquinoline chromophore, fluorescence microscopy was used to map cellular uptake of the drug. Cryptolepine easily crosses the cell membranes and accumulates selectively into the nuclei rather than in the cytoplasm of B16 melanoma cells. Quantitative analyses of DNA in cells after Feulgen reaction and image cytometry reveal that the drug blocks the cell cycle in G2/M phases. It is also shown that the alkaloid is more potent at inhibiting DNA synthesis rather than RNA and protein synthesis. Altogether, the results provide direct evidence that DNA is the primary target of cryptolepine and suggest that this alkaloid is a valid candidate for the development of tumor

  5. Effect of Trifluralin on Growth, Morphology, and Nucleic Acid Synthesis 1

    PubMed Central

    Schultz, Donald P.; Funderburk, H. H.; Negi, N. S.

    1968-01-01

    Roots and shoots of corn seedlings (Zea mays L. var. Dixie 18) germinated in trifluralin (α,α,α-trifluoro-2,6-dinitro-N,N-dipropyl-p-toluidine) solutions are characterized by radial enlargement of the cortical cells and by multinucleate cells in the meristematic regions. Trifluralin inhibits elongation of Avena coleoptile sections at concentrations of 0.1 μm to 10 μm. Synthesis of DNA, RNA, and protein is suppressed in the root tips while no significant effect is noticeable in the shoots of corn germinated in trifluralin. A 32P time-course study of 48, 72, and 96 hours utilizing phenol extraction and MAK column separation of corn root and shoot nucleic acids showed suppression of 32P incorporation in the treated roots; however, the 72 and 96 hour treated shoots incorporated a much greater amount than the control with most of the increased incorporation found in the sRNA and DNA fractions. The increased activity in the DNA may be due to a high G-C type DNA. No selective suppression or enhancement of any particular RNA species was noticed in the treated plants. Images PMID:16656762

  6. Synthesis, spectroscopic characterization, biological screenings, DNA binding study and POM analyses of transition metal carboxylates

    NASA Astrophysics Data System (ADS)

    Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman

    2015-04-01

    This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

  7. Synthesis, spectroscopic characterization, biological screenings, DNA binding study and POM analyses of transition metal carboxylates.

    PubMed

    Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman

    2015-04-01

    This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out. PMID:25646895

  8. Human CD4+ T cells require exogenous cystine for glutathione and DNA synthesis

    PubMed Central

    Levring, Trine B.; Kongsbak, Martin; Rode, Anna K. O.; Woetmann, Anders; Ødum, Niels; Bonefeld, Charlotte Menné; Geisler, Carsten

    2015-01-01

    Adaptive immune responses require activation and expansion of antigen-specific T cells. Whereas early T cell activation is independent of exogenous cystine (Cys2), T cell proliferation is dependent of Cys2. However, the exact roles of Cys2 in T cell proliferation still need to be determined. The aim of this study was to elucidate why activated human T cells require exogenous Cys2 in order to proliferate. We activated purified naïve human CD4+ T cells and found that glutathione (GSH) levels and DNA synthesis were dependent on Cys2 and increased in parallel with increasing concentrations of Cys2. Vice-versa, the GSH synthesis inhibitor L-buthionine-sulfoximine (BSO) and inhibition of Cys2 uptake with glutamate inhibited GSH and DNA synthesis in parallel. We further found that thioredoxin (Trx) can partly substitute for GSH during DNA synthesis. Finally, we show that GSH or Trx is required for the activity of ribonucleotide reductase (RNR), the enzyme responsible for generation of the deoxyribonucleotide DNA building blocks. In conclusion, we show that activated human T cells require exogenous Cys2 to proliferate and that this is partly explained by the fact that Cys2 is required for production of GSH, which in turn is required for optimal RNR-mediated deoxyribonucleotide synthesis and DNA replication. PMID:26392411

  9. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W

    1993-01-01

    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  10. DNA-Based Synthesis and Assembly of Organized Iron Oxide Nanostructures

    NASA Astrophysics Data System (ADS)

    Khomutov, Gennady B.

    Organized bio-inorganic and hybrid bio-organic-inorganic nanostructures consisting of iron oxide nanoparticles and DNA complexes have been formed using methods based on biomineralization, interfacial and bulk phase assembly, ligand exchange and substitution, Langmuir-Blodgett technique, DNA templating and scaffolding. Interfacially formed planar DNA complexes with water-insoluble amphiphilic polycation or intercalator Langmuir monolayers were prepared and deposited on solid substrates to form immobilized DNA complexes. Those complexes were then used for the synthesis of organized DNA-based iron oxide nanostructures. Planar net-like and circular nanostructures of magnetic Fe3O4 nanoparticles were obtained via interaction of cationic colloid magnetite nanoparticles with preformed immobilized DNA/amphiphilic polycation complexes of net-like and toroidal morphologies. The processes of the generation of iron oxide nanoparticles in immobilized DNA complexes via redox synthesis with various iron sources of biological (ferritin) and artificial (FeCl3) nature have been studied. Bulk-phase complexes of magnetite nanoparticles with biomolecular ligands (DNA, spermine) were formed and studied. Novel nano-scale organized bio-inorganic nanostructures - free-floating sheet-like spermine/magnetite nanoparticle complexes and DNA/spermine/magnetite nanoparticle complexes were synthesized in bulk aqueous phase and the effect of DNA molecules on the structure of complexes was discovered.

  11. Further Studies on Bacteriophage T4 DNA Synthesis in Sucrose-Plasmolyzed Cells

    PubMed Central

    Stafford, Mary E.; Reddy, G. Prem Veer; Mathews, Christopher K.

    1977-01-01

    This paper describes several technical improvements in the sucrose-plasmolyzed cell system used in earlier experiments on DNA synthesis in situ with Escherichia coli infected by DNA-defective mutants of bacteriophage T4 (W. L. Collinsworth and C. K. Mathews, J. Virol. 13:908-915, 1974). Using this system, which is based primarily on that of M. G. Wovcha et al. (Proc. Natl. Acad. Sci. U.S.A. 70:2196-2200, 1973), we reinvestigated the properties of mutants bearing lesions in genes 1, 41, and 62, and we resolved some disagreements with data reported from that laboratory. We also asked whether the DNA-delay phenotype of T4 mutants is related to possible early leakage of DNA precursors from infected cells. Such cells display defective DNA synthesis in situ, even when ample DNA precursors are made available. Thus, the lesions associated with these mutations seem to manifest themselves at the level of macromolecular metabolism. Similarly, we examined an E. coli mutant defective in its ability to support T4 production, apparently because of a lesion affecting DNA synthesis (L. Simon et al., Nature [London] 252:451-455). In the plasmolyzed cell system, reduced nucleotide incorporation is seen, indicating also that the genetic defect does not involve DNA precursor synthesis. The plasmolyzed cell system incorporates deoxynucleotide 5′-monophosphates into DNA severalfold more rapidly than the corresponding 5′-triphosphates. This is consistent with the idea that DNA precursor-synthesizing enzymes are functionally organized to shuttle substrates to their sites of utilization. PMID:328926

  12. Genomic assay reveals tolerance of DNA damage by both translesion DNA synthesis and homology-dependent repair in mammalian cells.

    PubMed

    Izhar, Lior; Ziv, Omer; Cohen, Isadora S; Geacintov, Nicholas E; Livneh, Zvi

    2013-04-16

    DNA lesions can block replication forks and lead to the formation of single-stranded gaps. These replication complications are mitigated by DNA damage tolerance mechanisms, which prevent deleterious outcomes such as cell death, genomic instability, and carcinogenesis. The two main tolerance strategies are translesion DNA synthesis (TLS), in which low-fidelity DNA polymerases bypass the blocking lesion, and homology-dependent repair (HDR; postreplication repair), which is based on the homologous sister chromatid. Here we describe a unique high-resolution method for the simultaneous analysis of TLS and HDR across defined DNA lesions in mammalian genomes. The method is based on insertion of plasmids carrying defined site-specific DNA lesions into mammalian chromosomes, using phage integrase-mediated integration. Using this method we show that mammalian cells use HDR to tolerate DNA damage in their genome. Moreover, analysis of the tolerance of the UV light-induced 6-4 photoproduct, the tobacco smoke-induced benzo[a]pyrene-guanine adduct, and an artificial trimethylene insert shows that each of these three lesions is tolerated by both TLS and HDR. We also determined the specificity of nucleotide insertion opposite these lesions during TLS in human genomes. This unique method will be useful in elucidating the mechanism of DNA damage tolerance in mammalian chromosomes and their connection to pathological processes such as carcinogenesis. PMID:23530190

  13. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  14. First total synthesis and antiprotozoal activity of (Z)-17-methyl-13-octadecenoic acid, a new marine fatty acid from the sponge Polymastia penicillus

    PubMed Central

    Carballeira, Néstor M.; Montano, Nashbly; Balaña-Fouce, Rafael; Prada, Christopher Fernández

    2009-01-01

    The first total synthesis for the (Z)-17-methyl-13-octadecenoic acid was accomplished in seven steps and in a 45% overall yield. The use of (trimethylsilyl)acetylene was key in the synthesis. Based on a previous developed strategy in our laboratory the best synthetic route towards the title compound was first acetylide coupling of (trimethylsilyl)acetylene to the long-chain protected 12-bromo-1-dodecanol followed by a second acetylide coupling to the short-chain 3-methyl-1-bromobutane, which resulted in higher yields. Complete spectral data is also presented for the first time for this recently discovered fatty acid. The title compound displayed antiprotozoal activity against Leishmania donovani (EC50 = 19.8 μg/ml) and inhibited the leishmania DNA topoisomerase IB at concentrations of 50 μM. PMID:19527698

  15. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  16. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases.

    PubMed

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-03-15

    New types of double-headed 2'-deoxycytidine 5'-O-triphosphates (dC(XC)TPs) bearing another cytosine or 5-fluorocytosine linked through a flexible propargyl, homopropargyl or pent-1-ynyl linker to position 5 were prepared by the aqueous Sonogashira cross-coupling reactions of 5-iodo-dCTP with the corresponding (fluoro)cytosine-alkynes. The modified dC(XC)TPs were good substrates for DNA polymerases and were used for enzymatic synthesis of cytosine-functionalized DNA by primer extension or PCR. The cytosine- or fluorocytosine-linked DNA probes did not significantly inhibit DNA methyltransferases and did not cross-link to these proteins. PMID:26899597

  17. Association between early inhibition of DNA synthesis and the MICs and MBCs of carboxyquinolone antimicrobial agents for wild-type and mutant [gyrA nfxB(ompF) acrA] Escherichia coli K-12.

    PubMed Central

    Chow, R T; Dougherty, T J; Fraimow, H S; Bellin, E Y; Miller, M H

    1988-01-01

    Quinolone antimicrobial agents are known to interact with DNA gyrase, but the mechanism by which bacterial cell death occurs is not fully understood. In order to determine whether there is a correlation between quinolone-induced inhibition of early (i.e., 10 to 15 min) DNA synthesis and potency (MICs and MBCs), we measured the rate of DNA synthesis in log-phase Escherichia coli K-12 by using [3H]thymidine incorporation. Three quinolones (ciprofloxacin, norfloxacin, and difloxacin) were selected based on their decreasing activity against reference strain KL16. All three quinolones caused an early 50% inhibition of DNA synthesis which was proportional to MICs and MBCs (r greater than 0.99). Furthermore, 50% inhibition of DNA synthesis and MICs were nearly identical for mutant strains with an altered quinolone target (gyrA) or with decreased [nfxB(ompF)] or increased (acrA) permeability. There were significant differences (P less than 0.001) between individual quinolones in the degree of DNA synthesis inhibition in nalidixic acid-resistant gyrA and nfxB(ompF) mutant strains. The comparison of the three mutants with the wild-type strain permitted an in vivo examination of the effects of alterations of the drug target or entry on the activity determined by DNA synthesis inhibition and MICs. PMID:3056251

  18. Regulation of chloroplast number and DNA synthesis in higher plants. Final report, August 1995--August 1996

    SciTech Connect

    Mullet, J.E.

    1997-06-17

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focused on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The research focused on the isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  19. Synthesis and evaluation of colletoic acid core derivatives.

    PubMed

    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima

    2016-03-01

    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  20. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  1. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    PubMed

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  2. DNA synthesis in mouse brown adipose tissue is under. beta. -adrenergic control

    SciTech Connect

    Rehnmark, S.; Nedergaard, J. )

    1989-02-01

    The rate of DNA synthesis in mouse brown adipose tissue was followed with injections of ({sup 3}H)thymidine. Cold exposure led to a large increase in the rate of ({sup 3}H)thymidine incorporation, reaching a maximum after 8 days, after which the activity abruptly ceased. A series of norepinephrine injections was in itself able to increase ({sup 3}H)thymidine incorporation. When norepinephrine was injected in combination with the {alpha}-adrenergic antagonist phentolamine or with the {beta}-adrenergic antagonist propranolol, the stimulation was fully blocked by propranolol. It is suggested that stimulation of DNA synthesis in brown adipose tissue is a {beta}-adrenergically mediated process and that the tissue is an interesting model for studies of physiological control of DNA synthesis.

  3. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  4. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  5. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  6. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  7. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  8. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.

    PubMed

    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W

    2004-02-19

    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  9. Synthesis of linear and cyclic peptide-PEG-lipids for stabilization and targeting of cationic liposome-DNA complexes.

    PubMed

    Ewert, Kai K; Kotamraju, Venkata Ramana; Majzoub, Ramsey N; Steffes, Victoria M; Wonder, Emily A; Teesalu, Tambet; Ruoslahti, Erkki; Safinya, Cyrus R

    2016-03-15

    Because nucleic acids (NAs) have immense potential value as therapeutics, the development of safe and effective synthetic NA vectors continues to attract much attention. In vivo applications of NA vectors require stabilized, nanometer-scale particles, but the commonly used approaches of steric stabilization with a polymer coat (e.g., PEGylation; PEG=poly(ethylene glycol)) interfere with attachment to cells, uptake, and endosomal escape. Conjugation of peptides to PEG-lipids can improve cell attachment and uptake for cationic liposome-DNA (CL-DNA) complexes. We present several synthetic approaches to peptide-PEG-lipids and discuss their merits and drawbacks. A lipid-PEG-amine building block served as the common key intermediate in all synthetic routes. Assembling the entire peptide-PEG-lipid by manual solid phase peptide synthesis (employing a lipid-PEG-carboxylic acid) allowed gram-scale synthesis but is mostly applicable to linear peptides connected via their N-terminus. Conjugation via thiol-maleimide or strain-promoted (copper-free) azide-alkyne cycloaddition chemistry is highly amenable to on-demand preparation of peptide-PEG-lipids, and the appropriate PEG-lipid precursors are available in a single chemical step from the lipid-PEG-amine building block. Azide-alkyne cycloaddition is especially suitable for disulfide-bridged peptides such as iRGD (cyclic CRGDKGPDC). Added at 10 mol% of a cationic/neutral lipid mixture, the peptide-PEG-lipids stabilize the size of CL-DNA complexes. They also affect cell attachment and uptake of nanoparticles in a peptide-dependent manner, thereby providing a platform for preparing stabilized, affinity-targeted CL-DNA nanoparticles. PMID:26874401

  10. CGG repeats associated with DNA instability and chromosome fragility form structures that block DNA synthesis in vitro.

    PubMed Central

    Usdin, K; Woodford, K J

    1995-01-01

    A large increase in the length of a CGG tandem array is associated with a number of triplet expansion diseases, including fragile X syndrome, the most common cause of heritable mental retardation in humans. Expansion results in the appearance of a fragile site on the X chromosome in the region of the CGG array. We show here that CGG repeats readily form a series of barriers to DNA synthesis in vitro. There barriers form only when the (CGG)n strand is used as the template, are K(+)-dependent, template concentration-independent, and involve hydrogen bonding between guanines. Chemical modification experiments suggest these blocks to DNA synthesis result from the formation of a series of intrastrand tetraplexes. A number of lines of evidence suggest that both triplet expansion and chromosome fragility are the result of replication defects. Our data are discussed in the light of such evidence. Images PMID:7479085

  11. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected. PMID:10841936

  12. Efficient Synthesis of Topologically Linked Three-Ring DNA Catenanes.

    PubMed

    Li, Qi; Wu, Guangqi; Wu, Wei; Liang, Xingguo

    2016-06-16

    Topologically controlled DNA catenanes are promising elements for the construction of molecular machines but present a significant effort in DNA nanotechnology. We report an efficient approach for preparing linear three-ring catenanes (L3C) composed of single-stranded DNA. The linking number was strictly controlled by using short complementary regions (6 nt) between each two DNA rings. High efficiency of forming three-ring catenanes (yield as high as 63 %) was obtained by using an 80 nt oligonucleotide as the scaffold to draw close the three pre-rings for hybridization between short complementary DNA. After assembly, three pre-rings were closed by DNA ligation using three 12 nt oligonucleotides as splints to form interlocked three-ring catenanes. L3C nanostructures were imaged in air by AFM: the catenane exhibited a smooth circular shape and was arranged in a line with well-defined structure, as expected. PMID:27214092

  13. Isolation of Chinese hamster ovary cells with reduced unscheduled DNA synthesis after UV irradiation

    SciTech Connect

    Stefanini, M.; Reuser, A.; Bootsma, D.

    1982-09-01

    A simple procedure has been worked out to obtain UV-sensitive mutants of Chinese hamster ovary (CHO) cells. In this procedure, conventional mutagenesis is followed by BrdU--light treatment to enrich the population for UV-sensitive cells. Colonies that are allowed to form subsequently are duplicated by replica plating and screened on the master plate for their UV sensitivity and their capacity to carry out UV-induced DNA repair synthesis. Putative mutants are isolated from the replica. With this combination of methods, we succeeded in isolating CHO mutants with an 85-95% reduced level of UV-induced DNA synthesis in combination with an increased UV sensitivity.

  14. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  15. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  16. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  17. Protective Effect of Folic Acid on Oxidative DNA Damage

    PubMed Central

    Guo, Xiaojuan; Cui, Huan; Zhang, Haiyang; Guan, Xiaoju; Zhang, Zheng; Jia, Chaonan; Wu, Jia; Yang, Hui; Qiu, Wenting; Zhang, Chuanwu; Yang, Zuopeng; Chen, Zhu; Mao, Guangyun

    2015-01-01

    Abstract Although previous reports have linked DNA damage with both transmissions across generations as well as our own survival, it is unknown how to reverse the lesion. Based on the data from a Randomized, Double-blind, Placebo Controlled Clinical Trial, this study aimed to assess the efficacy of folic acid supplementation (FAS) on DNA oxidative damage reversal. In this randomized clinical trial (RCT), a total of 450 participants were enrolled and randomly assigned to 3 groups to receive folic acid (FA) 0.4 mg/day (low-FA), 0.8 mg/day (high-FA), or placebo (control) for 8 weeks. The urinary 8-hydroxy-2’-deoxyguanosine (8-OHdG) and creatinine (Cr) concentration at pre- and post-FAS were measured with modified enzyme-linked immunosorbent assay (ELISA) and high-performance liquid chromatography (HPLC), respectively. A multivariate general linear model was applied to assess the individual effects of FAS and the joint effects between FAS and hypercholesterolemia on oxidative DNA damage improvement. This clinical trial was registered with ClinicalTrials.gov, number NCT02235948. Of the 438 subjects that received FA fortification or placebo, the median (first quartile, third quartile) of urinary 8-OHdG/Cr for placebo, low-FA, and high-FA groups were 58.19 (43.90, 82.26), 53.51 (38.97, 72.74), 54.73 (39.58, 76.63) ng/mg at baseline and 57.77 (44.35, 81.33), 51.73 (38.20, 71.30), and 50.65 (37.64, 76.17) ng/mg at the 56th day, respectively. A significant decrease of urinary 8-OHdG was observed after 56 days FA fortification (P < 0.001). Compared with the placebo, after adjusting for some potential confounding factors, including the baseline urinary 8-OHdG/Cr, the urinary 8-OHdG/Cr concentration significantly decreased after 56 days FAS [β (95% confidence interval) = −0.88 (−1.62, −0.14) and P = 0.020 for low-FA; and β (95% confidence interval) = −2.68 (−3.42, −1.94) and P < 0.001 for high-FA] in a dose-response fashion (Ptrend

  18. In vivo measurement of DNA synthesis rates of colon epithelial cells in carcinogenesis

    SciTech Connect

    Kim, Sylvia Jeewon; Turner, Scott; Killion, Salena; Hellerstein, Marc K. . E-mail: march@nature.berkeley.edu

    2005-05-27

    We describe here a highly sensitive technique for measuring DNA synthesis rates of colon epithelial cells in vivo. Male SD rats were given {sup 2}H{sub 2}O (heavy water). Colon epithelial cells were isolated, DNA was extracted, hydrolyzed to deoxyribonucleosides, and the deuterium enrichment of the deoxyribose moiety was determined by gas chromatographic/mass spectrometry. Turnover time of colon crypts and the time for migration of cells from basal to top fraction of the crypts were measured. These data were consistent with cell cycle analysis and bromodeoxyuridine labeling. By giving different concentrations of a promoter, dose-dependent increases in DNA synthesis rates were detected, demonstrating the sensitivity of the method. Administration of a carcinogen increased DNA synthesis rates cell proliferation in all fractions of the crypt. In conclusion, DNA synthesis rates of colon epithelial cells can be measured directly in vivo using stable-isotope labeling. Potential applications in humans include use as a biomarker for cancer chemoprevention studies.

  19. The Transcription Factor TFII-I Promotes DNA Translesion Synthesis and Genomic Stability

    PubMed Central

    Fattah, Farjana J.; Hara, Kodai; Fattah, Kazi R.; Yang, Chenyi; Wu, Nan; Warrington, Ross; Chen, David J.; Zhou, Pengbo; Boothman, David A.; Yu, Hongtao

    2014-01-01

    Translesion synthesis (TLS) enables DNA replication through damaged bases, increases cellular DNA damage tolerance, and maintains genomic stability. The sliding clamp PCNA and the adaptor polymerase Rev1 coordinate polymerase switching during TLS. The polymerases Pol η, ι, and κ insert nucleotides opposite damaged bases. Pol ζ, consisting of the catalytic subunit Rev3 and the regulatory subunit Rev7, then extends DNA synthesis past the lesion. Here, we show that Rev7 binds to the transcription factor TFII-I in human cells. TFII-I is required for TLS and DNA damage tolerance. The TLS function of TFII-I appears to be independent of its role in transcription, but requires homodimerization and binding to PCNA. We propose that TFII-I bridges PCNA and Pol ζ to promote TLS. Our findings extend the general principle of component sharing among divergent nuclear processes and implicate TLS deficiency as a possible contributing factor in Williams-Beuren syndrome. PMID:24922507

  20. Solid-phase synthesis of DNA binding polyamides on oxime resin.

    PubMed

    Belitsky, J M; Nguyen, D H; Wurtz, N R; Dervan, Peter B

    2002-08-01

    Control of the energetics and specificity of DNA binding polyamides is necessary for inhibition of protein-DNA complex formation and gene regulation studies. Typically, solid-phase methods using Boc monomers for synthesis have depended on Boc-beta-Ala-PAM resin which affords a beta-alanine-Dp tail at the C-terminus, after cleavage with N,N-dimethylaminopropylamine (Dp). To address the energetic consequences of this tail for DNA minor groove binding, we describe an alternative solid phase method employing the Kaiser oxime resin which allows the synthesis of polyamides with incrementally shortened C-terminal tails. Polyamides without Dp and having methyl amide tails rather than beta-alanine show similar affinity relative to the standard beta-Dp tail. The truncated tail diminishes the A,T base pair energetic preference of the beta-Dp tail which will allow a greater variety of DNA sequences to be targeted by hairpin polyamides. PMID:12057666

  1. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics

    PubMed Central

    Yehezkel, Tuval Ben; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-01-01

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  2. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics.

    PubMed

    Ben Yehezkel, Tuval; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-02-29

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  3. Capture of a third Mg²⁺ is essential for catalyzing DNA synthesis.

    PubMed

    Gao, Yang; Yang, Wei

    2016-06-10

    It is generally assumed that an enzyme-substrate (ES) complex contains all components necessary for catalysis and that conversion to products occurs by rearrangement of atoms, protons, and electrons. However, we find that DNA synthesis does not occur in a fully assembled DNA polymerase-DNA-deoxynucleoside triphosphate complex with two canonical metal ions bound. Using time-resolved x-ray crystallography, we show that the phosphoryltransfer reaction takes place only after the ES complex captures a third divalent cation that is not coordinated by the enzyme. Binding of the third cation is incompatible with the basal ES complex and requires thermal activation of the ES for entry. It is likely that the third cation provides the ultimate boost over the energy barrier to catalysis of DNA synthesis. PMID:27284197

  4. PLASMID DNA DAMAGE CAUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN

    EPA Science Inventory

    PLASMID DNA DAMAGE CAOUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN

    ABSTRACT

    Both dimethylarsinic acid (DMA(V)) and dimethylarsinous acid (DMA(III)) release iron from human liver ferritin (HLF) with or without the presence of ascorbic acid. ...

  5. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  6. Hydrogenase synthesis in Bradyrhizobium japonicum Hupc mutants is altered in sensitivity to DNA gyrase inhibitors.

    PubMed Central

    Novak, P D; Maier, R J

    1989-01-01

    In the Hupc mutants of Bradyrhizobium japonicum SR, regulation of expression of hydrogenase is altered; the mutants synthesize hydrogenase constitutively in the presence of atmospheric levels of oxygen. The DNA gyrase inhibitors nalidixic acid, novobiocin, and coumermycin were used to inhibit growth of wild-type and mutant cells. For each inhibitor tested, growth of mutant and wild-type strains was equally sensitive. However, in contrast to the wild type, the Hupc mutants synthesized hydrogenase in the presence of high levels of any inhibitor. Cells were incubated with the drugs and simultaneously labeled with 14C-labeled amino acids, and hydrogenase was immunoprecipitated with antibody to the large subunit of the enzyme. Fluorograms of antibody blots then were scanned to determine the relative amount of hydrogenase (large subunit) synthesized in the presence or absence of the gyrase inhibitors. The amount of hydrogenase synthesized by the Hupc mutants in the presence of 300 micrograms of nalidixic acid per ml was near the level of enzyme synthesized in the absence of the inhibitor. No hydrogenase was detected in antibody blots of wild-type cultures which were derepressed for hydrogenase in the presence of 100 micrograms of coumermycin or novobiocin per ml. In contrast, hydrogenase was synthesized by the Hupc mutants in the presence of 100 micrograms of either drug per ml. The amount synthesized ranged from 5 to 32% and 20 to 49%, respectively, of that in the absence of those inhibitors, but nevertheless, hydrogenase synthesis was detected in all of the mutants examined.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:2547335

  7. Accurate multiplex gene synthesis from programmable DNA microchips

    NASA Astrophysics Data System (ADS)

    Tian, Jingdong; Gong, Hui; Sheng, Nijing; Zhou, Xiaochuan; Gulari, Erdogan; Gao, Xiaolian; Church, George

    2004-12-01

    Testing the many hypotheses from genomics and systems biology experiments demands accurate and cost-effective gene and genome synthesis. Here we describe a microchip-based technology for multiplex gene synthesis. Pools of thousands of `construction' oligonucleotides and tagged complementary `selection' oligonucleotides are synthesized on photo-programmable microfluidic chips, released, amplified and selected by hybridization to reduce synthesis errors ninefold. A one-step polymerase assembly multiplexing reaction assembles these into multiple genes. This technology enabled us to synthesize all 21 genes that encode the proteins of the Escherichia coli 30S ribosomal subunit, and to optimize their translation efficiency in vitro through alteration of codon bias. This is a significant step towards the synthesis of ribosomes in vitro and should have utility for synthetic biology in general.

  8. Inhibition of Mammalian Target of Rapamycin Complex 1 (mTORC1) Downregulates ELOVL1 Gene Expression and Fatty Acid Synthesis in Goat Fetal Fibroblasts

    PubMed Central

    Wang, Weipeng; He, Qiburi; Guo, Zhixin; Yang, Limin; Bao, Lili; Bao, Wenlei; Zheng, Xu; Wang, Yanfeng; Wang, Zhigang

    2015-01-01

    Elongation of very-long-chain fatty acids 1 (ELOVL1) is a ubiquitously expressed gene that belongs to the ELOVL family and regulates the synthesis of very-long-chain fatty acids (VLCFAs) and sphingolipids, from yeast to mammals. Mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of cell metabolism and is associated with fatty acids synthesis. In this study, we cloned the cDNA that encodes Cashmere goat (Capra hircus) ELOVL1 (GenBank Accession number KF549985) and investigated its expression in 10 tissues. ELOVL1 cDNA was 840 bp, encoding a deduced protein of 279 amino acids, and ELOVL1 mRNA was expressed in a wide range of tissues. Inhibition of mTORC1 by rapamycin decreased ELOVL1 expression and fatty acids synthesis in Cashmere goat fetal fibroblasts. These data show that ELOVL1 expression is regulated by mTORC1 and that mTORC1 has significant function in fatty acids synthesis in Cashmere goat. PMID:26204830

  9. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  10. Semisynthetic DNA-protein conjugates for fabrication of nucleic acid based nanostructures

    NASA Astrophysics Data System (ADS)

    Rabe, Kersten S.; Feldkamp, Udo; Niemeyer, Christof M.

    2008-10-01

    We here report on the developments of semisynthetic DNA-protein conjugates and their assembly into multi-component nanostructures. We describe the improvement of the DNA sequences embedded in such nanostructures by computational and analytical methods. Moreover, we report on the exploration of novel DNA conjugates of streptavidin or redox proteins with improved properties for the assembly of nucleic acid based nanostructures.

  11. DNA Before Proteins? Recent Discoveries in Nucleic Acid Catalysis Strengthen the Case

    NASA Astrophysics Data System (ADS)

    Burton, Aaron S.; Lehman, Niles

    2009-02-01

    An RNA-DNA World could arise from an all-RNA system with the development of as few as three ribozymes -- a DNA-dependent RNA polymerase, an RNA-dependent DNA polymerase, and a catalyst for the production of DNA nucleotides. A significant objection to DNA preceding proteins is that RNA has not been shown to catalyze the production of DNA. However, RNA- and DNAzymes have been recently discovered that catalyze chemical reactions capable of forming deoxyribose, such as mixed aldol condensation of 5'-glyceryl- and 3'-glycoaldehyde-terminated DNA strands. Thus, the only remaining obstacles to RNA-catalyzed in vitro DNA synthesis are alterations of substrate and template specificities of known ribozymes. The RNA-DNA World lessens genomic size constraints through a relaxed error threshold, affording the evolutionary time needed to develop protein synthesis. Separation of information from catalyst enables genotype and phenotype to be readily discriminated by absence or presence, respectively, of the 2'-OH. Novel ribozymes that arise through mutation can be preserved in DNA by reverse transcription, which makes them much more likely to be retained than in an RNA-genome milieu. The extra degree of separation between protein and mRNA, in terms of identifying and then retaining a useful enzyme, may have in fact necessitated storing information in DNA prior to the advent of translation.

  12. AMINO ACIDS AUGMENT MUSCLE PROTEIN SYNTHESIS IN NEONATAL PIGS DURING ENDOTOXEMIA BY MODULATING TRANSLATION INITIATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  13. A euryarchaeal histone modulates strand displacement synthesis by replicative DNA polymerases.

    PubMed

    Sun, Fei; Huang, Li

    2016-07-01

    Euryarchaeota and Crenarchaeota, the two main lineages of the domain Archaea, encode different chromatin proteins and differ in the use of replicative DNA polymerases. Crenarchaea possess a single family B DNA polymerase (PolB), which is capable of strand displacement modulated by the chromatin proteins Cren7 and Sul7d. Euryarchaea have two distinct replicative DNA polymerases, PolB and PolD, a family D DNA polymerase. Here we characterized the strand displacement activities of PolB and PolD from the hyperthermophilic euryarchaeon Pyrococcus furiosus and investigated the influence of HPfA1, a homolog of eukaryotic histones from P. furiosus, on these activities. We showed that both PolB and PolD were efficient in strand displacement. HPfA1 inhibited DNA strand displacement by both DNA polymerases but exhibited little effect on the displacement of a RNA strand annealed to single-stranded template DNA. This is consistent with the finding that HPfA1 bound more tightly to double-stranded DNA than to a RNA:DNA hybrid. Our results suggest that, although crenarchaea and euryarchaea differ in chromosomal packaging, they share similar mechanisms in modulating strand displacement by DNA polymerases during lagging strand DNA synthesis. PMID:27333783

  14. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  15. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  16. The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

    PubMed

    Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

    2016-05-17

    Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. PMID:27053724

  17. Total synthesis of the squalene synthase inhibitor zaragozic acid C.

    PubMed

    Nakamura, Seiichi

    2005-01-01

    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  18. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.

    2014-01-01

    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  19. Circular RNA oligonucleotides. Synthesis, nucleic acid binding properties, and a comparison with circular DNAs.

    PubMed Central

    Wang, S; Kool, E T

    1994-01-01

    We report the synthesis and nucleic acid binding properties of two cyclic RNA oligonucleotides designed to bind single-stranded nucleic acids by pyr.pur.pyr-type triple helix formation. The circular RNAs are 34 nucleotides in size and were cyclized using a template-directed nonenzymatic ligation. To ensure isomeric 3'-5' purity in the ligation reaction, one nucleotide at the ligation site is a 2'-deoxyribose. One circle (1) is complementary to the sequence 5'-A12, and the second (2) is complementary to 5'-AAGAAAGAAAAG. Results of thermal denaturation experiments and mixing studies show that both circles bind complementary single-stranded DNA or RNA substrates by triple helix formation, in which two domains in a pyrimidine-rich circle sandwich a central purine-rich substrate. The affinities of these circles with their purine complements are much higher than the affinities of either the linear precursors or simple Watson-Crick DNA complements. For example, circle 1 binds rA12 (pH 7.0, 10 mM MgCl2, 100 mM NaCl) with a Tm of 48 degrees C and a Kd (37 degrees C) of 4.1 x 10(-9) M, while the linear precursor of the circle binds with a Tm of 34 degrees C and a Kd of 1.2 x 10(-6) M. The complexes of circle 2 are pH-dependent, as expected for triple helical complexes involving C(+)G.C triads, and mixing plots for both circles reveal one-to-one stoichiometry of binding either to RNA or DNA substrates. Comparison of circular RNAs with previously synthesized circular DNA oligonucleotides of the same sequence reveals similar behavior in the binding of DNA, but strikingly different behavior in the binding of RNA. The cyclic DNAs show high DNA-binding selectivity, giving relatively weaker duplex-type binding with complementary RNAs. The relative order of thermodynamic stability for the four types of triplex studied here is found to be DDD >> RRR > RDR >> DRD. The results are discussed in the context of recent reports of strong triplex dependence on RNA versus DNA backbones

  20. Circular RNA oligonucleotides. Synthesis, nucleic acid binding properties, and a comparison with circular DNAs.

    PubMed

    Wang, S; Kool, E T

    1994-06-25

    We report the synthesis and nucleic acid binding properties of two cyclic RNA oligonucleotides designed to bind single-stranded nucleic acids by pyr.pur.pyr-type triple helix formation. The circular RNAs are 34 nucleotides in size and were cyclized using a template-directed nonenzymatic ligation. To ensure isomeric 3'-5' purity in the ligation reaction, one nucleotide at the ligation site is a 2'-deoxyribose. One circle (1) is complementary to the sequence 5'-A12, and the second (2) is complementary to 5'-AAGAAAGAAAAG. Results of thermal denaturation experiments and mixing studies show that both circles bind complementary single-stranded DNA or RNA substrates by triple helix formation, in which two domains in a pyrimidine-rich circle sandwich a central purine-rich substrate. The affinities of these circles with their purine complements are much higher than the affinities of either the linear precursors or simple Watson-Crick DNA complements. For example, circle 1 binds rA12 (pH 7.0, 10 mM MgCl2, 100 mM NaCl) with a Tm of 48 degrees C and a Kd (37 degrees C) of 4.1 x 10(-9) M, while the linear precursor of the circle binds with a Tm of 34 degrees C and a Kd of 1.2 x 10(-6) M. The complexes of circle 2 are pH-dependent, as expected for triple helical complexes involving C(+)G.C triads, and mixing plots for both circles reveal one-to-one stoichiometry of binding either to RNA or DNA substrates. Comparison of circular RNAs with previously synthesized circular DNA oligonucleotides of the same sequence reveals similar behavior in the binding of DNA, but strikingly different behavior in the binding of RNA. The cyclic DNAs show high DNA-binding selectivity, giving relatively weaker duplex-type binding with complementary RNAs. The relative order of thermodynamic stability for the four types of triplex studied here is found to be DDD > RRR > RDR > DRD. The results are discussed in the context of recent reports of strong triplex dependence on RNA versus DNA backbones. Triplex

  1. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  2. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    PubMed

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  3. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. PMID:27012633

  4. Fatty acid carbon is essential for dNTP synthesis in endothelial cells

    PubMed Central

    Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter

    2015-01-01

    The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893

  5. The carbocyclic analog of 2'-deoxyguanosine induces a prolonged inhibition of duck hepatitis B virus DNA synthesis in primary hepatocyte cultures and in the liver.

    PubMed Central

    Fourel, I; Saputelli, J; Schaffer, P; Mason, W S

    1994-01-01

    The carbocyclic analog of 2'-deoxyguanosine (2'-CDG) is a strong inhibitor of hepatitis B virus (HBV) DNA synthesis in HepG2 cells (P.M. Price, R. Banerjee, and G. Acs, Proc. Natl. Acad. USA 86:8543-8544, 1989). We now report that 2'-CDG inhibited duck hepatitis B virus (DHBV) DNA synthesis in primary cultures of duck hepatocytes and in experimentally infected ducks. Like foscarnet (phosphonoformic acid [PFA]) and 2'-,3'-dideoxycytidine (ddC), 2'-CDG blocked viral DNA replication in primary hepatocyte cultures when present during an infection but failed to inhibit the DNA repair reaction that occurs during the initiation of infection to convert virion relaxed circular DNA to covalently closed circular DNA, the template for viral mRNA transcription. Moreover, as for PFA and ddC, viral RNA synthesis was detected when infection was initiated in the presence 2'-CDG. In another respect, however, 2'-CDG exhibited antiviral activity unlike that of ddC or PFA: a single 1-day treatment of hepatocytes with 2'-CDG blocked initiation of viral DNA synthesis for at least 8 days, irrespective of whether DHBV infection was carried out at the time of drug treatment or several days later. Furthermore, orally administered 2'-CDG was long-acting against DHBV in experimentally infected ducklings. Virus replication was delayed by up to 4 days in ducklings infected after administration of 2'-CDG. These observations of long-lasting efficacy in vitro and in vivo even after oral administration suggest that this inhibitor or a nucleoside with similar pharmacological properties may be ideal for reducing virus replication in patients with chronic HBV infection. Images PMID:8289335

  6. Chiral separation of amino acids in ultrafiltration through DNA-immobilized cellulose membranes

    NASA Astrophysics Data System (ADS)

    Higuchi, Akon; Hayashi, Akiyuki; Kanda, Naoki; Sanui, Kohei; Kitamura, Hanako

    2005-04-01

    Ultrafiltration experiments for the chiral separation of racemic tryptophan, phenylglycine and phenylalanine were investigated through immobilized DNA membranes having various pore sizes. L-tryptophan preferentially permeated through immobilized DNA membranes with a pore size<2.0 nm (molecular weight cut-off (MWCO)<5000) while D-tryptophan preferentially permeated through immobilized DNA membranes with a pore size>2.0 nm (MWCO>5000). These results are completely opposite tendency in the ultrafiltration of racemic phenylalanine through the immobilized DNA membranes. This may be originated from the different interaction between DNA and tryptophan compared to that between DNA and phenylalanine. However, in both cases the pore size of the immobilized DNA membranes regulated preferential permeation of the enantiomer through the membranes. The immobilized DNA membranes are categorized as channel type membranes and not as affinity membranes. Chiral separation models were proposed from using the chiral separation results of racemic amino acids, preferential adsorption of amino acid enantiomers and EPMA results.

  7. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  8. Effects of starvation and hormones on DNA synthesis in silk gland cells of the silkworm, Bombyx mori.

    PubMed

    Li, Yao-Feng; Chen, Xiang-Yun; Zhang, Chun-Dong; Tang, Xiao-Fang; Wang, La; Liu, Tai-Hang; Pan, Min-Hui; Lu, Cheng

    2016-08-01

    Silk gland cells of silkworm larvae undergo multiple cycles of endomitosis for the synthesis of silk proteins during the spinning phase. In this paper, we analyzed the endomitotic DNA synthesis of silk gland cells during larval development, and found that it was a periodic fluctuation, increasing during the vigorous feeding phase and being gradually inhibited in the next molting phase. That means it might be activated by a self-regulating process after molting. The expression levels of cyclin E, cdt1 and pcna were consistent with these developmental changes. Moreover, we further examined whether these changes in endomitotic DNA synthesis resulted from feeding or hormonal stimulation. The results showed that DNA synthesis could be inhibited by starvation and re-activated by re-feeding, and therefore appears to be dependent on nutrition. DNA synthesis was suppressed by in vivo treatment with 20-hydroxyecdysone (20E). However, there was no effect on DNA synthesis by in vitro 20E treatment or by either in vivo or in vitro juvenile hormone treatment. The levels of Akt and 4E-BP phosphorylation in the silk glands were also reduced by starvation and in vivo treatment with 20E. These results indicate that the activation of endomitotic DNA synthesis during the intermolt stages is related to feeding and DNA synthesis is inhibited indirectly by 20E. PMID:25558018

  9. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.

    PubMed

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A

    2015-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER. PMID:25483071

  10. Assessment of potential damage to DNA in urine of coke oven workers: an assay of unscheduled DNA synthesis.

    PubMed Central

    Roos, F; Renier, A; Ettlinger, J; Iwatsubo, Y; Letourneux, M; Haguenoer, J M; Jaurand, M C; Pairon, J C

    1997-01-01

    OBJECTIVES: A study was conducted in coke oven workers to evaluate the biological consequences of the exposure of these workers, particularly production of potential genotoxic factors. METHODS: 60 coke oven workers and 40 controls were recruited in the same iron and steel works. Exposure to polycyclic aromatic hydrocarbons (PAHs) was assessed by job and measurement of 1-hydroxypyrene (1OHP) in urine samples. An unscheduled DNA synthesis assay was performed on rat pleural mesothelial cells used as a test system to evaluate the effect of the workers' filtered urine on the DNA repair capacity of rat cells to determine whether DNA damaging agents are present in the urine of these workers. RESULTS: Urinary concentrations of 1OHP ranged from 0.06 to 24.2 (mean (SD) 2.1 (3.6)) mumol/mol creatinine in exposed coke oven workers, and from 0.01 to 0.9 in controls (0.12 (0.15)). These high concentrations in coke oven workers reflected recent exposure to PAHs and were in agreement with the assessment of exposure by job. No significant difference was found between coke oven workers and controls in the DNA repair level of rat cells treated with urine samples. However, the rat cell repair capacity decreased with increasing 1OHP concentrations in the exposed population (r = -0.28, P < 0.05). CONCLUSIONS: As high concentrations of 1OHP were found in the urine of some workers, a more stringent control of exposures to PAHs in the workplace is required. Exposure to PAHs was not associated with a clear cut modification of the urinary excretion of DNA damaging factors in this test, as shown by the absence of increased unscheduled DNA synthesis in rat cells. However, impairment of some repair mechanisms by urinary constituents is suspected. PMID:9470892

  11. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173. PMID:15543522

  12. Scorpion (Odontobuthus doriae) venom induces apoptosis and inhibits DNA synthesis in human neuroblastoma cells.

    PubMed

    Zargan, Jamil; Sajad, Mir; Umar, Sadiq; Naime, M; Ali, Shakir; Khan, Haider A

    2011-02-01

    Scorpion and its organs have been used to cure epilepsy, rheumatism, and male impotency since medieval times. Scorpion venom which contains different compounds like enzyme and non-enzyme proteins, ions, free amino acids, and other organic inorganic substances have been reported to posses antiproliferative, cytotoxic, apoptogenic, and immunosuppressive properties. We for the first time report the apoptotic and antiproliferative effects of scorpion venom (Odontobuthus doriae) in human neuroblastoma cells. After exposure of cells to medium containing varying concentrations of venom (10, 25, 50, 100, and 200 μg/ml), cell viability decreased to 90.75, 75.53, 55.52, 37.85, and 14.30%, respectively, after 24 h. Cells expressed morphological changes like swelling, inhibition of neurite outgrowth, irregular shape, aggregation, rupture of membrane, and release of cytosolic contents after treatment with venom. Lactate dehydrogenase (LDH) level increased in 50 and 100 μg/ml as compared to control, but there was no significant increase in LDH level at a dose of 10 and 20 μg/ml. Two concentrations viz. 50 and 100 μ/ml were selected because of the profound effect of these concentrations on the cellular health and population. Treatment with these two concentrations induced reactive nitrogen intermediates and depolarization in mitochondria. While caspase-3 activity increased in a concentration-dependent manner, only 50 μg/ml was able to fragment DNA. It was interesting to note that at higher dose, i.e., 100 μg/ml, the cells were killed, supposedly by acute necrosis. DNA synthesis evidenced by bromodeoxyuridine (BrdU) incorporation was inhibited in a concentration-dependent manner. The cells without treatment incorporated BrdU with high affinity confirming their cancerous nature whereas very less incorporation was noticed in treated cells. Our results show apoptotic and antiproliferative potential of scorpion venom (O. doriae) in human neuroblastoma cells. These properties

  13. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved. PMID:17511507

  14. Synthesis of amino-rich silica-coated magnetic nanoparticles for the efficient capture of DNA for PCR.

    PubMed

    Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming

    2016-09-01

    Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR. PMID:27187190

  15. Lability of DNA polymerase alpha correlated with decreased DNA synthesis and increased age in human cells

    SciTech Connect

    Busbee, D.; Sylvia, V.; Stec, J.; Cernosek, Z.; Norman, J.

    1987-12-01

    DNA excision repair and mitogen-initiated blastogenesis in human cells declined in efficiency as an apparent function of decreased DNA polymerase alpha specific activity with increased age of the cell donor. DNA polymerase alpha isolated from fetal cells contained a single, high-specific-activity enzyme form that could not be further activated and that was stable with regard to enzyme activity and affinity for DNA template-primer. DNA polymerase alpha isolated from adult-derived cells contained both low-specific-activity and high-specific-activity forms. The low-activity enzyme form, which showed low affinity of binding to DNA template-primer, was activated by treatment with phosphatidylinositol, /sup 32/P-ATP, and phosphatidylinositol kinase, resulting in a /sup 32/P-labeled enzyme that exhibited high affinity of binding to DNA template-primer. The activated enzyme was unstable, exhibiting a loss of /sup 32/P-label correlated with the loss of both specific activity and high affinity of binding to DNA template-primer. The data suggest that DNA polymerase alpha isolated from adult-derived human cells has low-activity and high-activity forms. Decreased specific activity of DNA polymerase alpha correlated with increased age of the donor appears to be a function of loss of an enzyme activator molecule resulting in diminished ability of the enzyme to bind DNA template-primer.

  16. Synthesis and characterization of DNA nano-meso-microspheres as drug delivery carriers for intratumoral chemotherapy

    NASA Astrophysics Data System (ADS)

    Enriquez Schumacher, Iris Vanessa

    Conventional cancer chemotherapy results in systemic toxicity which severely limits effectiveness and often adversely affects patient quality of life. There is a need to find new drugs and delivery methods for less toxic therapy. Previous studies concerning DNA complexing with chemotherapy drugs suggest unique opportunities for DNA as a mesosphere drug carrier. The overall objective of this research was devoted to the synthesis and evaluation of novel DNA-drug nano-mesospheres designed for localized chemotherapy via intratumoral injection. My research presents DNA nano-meso-microspheres (DNA-MS) that were prepared using a modified steric stabilization method originally developed in this lab for the preparation of albumin MS. DNA-MS were prepared with glutaraldehyde covalent crosslinking (genipin crosslinking was attempted) through the DNA base pairs. In addition, novel crosslinking of DNA-MS was demonstrated using chromium, gadolinium, or iron cations through the DNA phosphate groups. Covalent and ionic crosslinked DNA-MS syntheses yielded smooth and spherical particle morphologies with multimodal size distributions. Optimized DNA-MS syntheses produced particles with narrow and normal size distributions in the 50nm to 5mum diameter size range. In aqueous dispersions approximately 200% swelling was observed with dispersion stability for more than 48 hours. Typical process conditions included a 1550rpm initial mixing speed and particle filtration through 20mum filters to facilitate preparation. DNA-MS were in situ loaded during synthesis for the first time with mitoxantrone, 5-fluorouracil, and methotrexate. DNA-MS drug incorporation was 12%(w/w) for mitoxantrone, 9%(w/w) for methotrexate, and 5%(w/w) for 5-fluorouracil. In vitro drug release into phosphate buffered saline was observed for over 35 days by minimum sink release testing. The effect of gadolinium crosslink concentration on mitoxantrone release was evaluated at molar equivalences in the range of 20% to

  17. NOREPINEPHRINE AND EPIDERMAL GROWTH FACTOR: DYNAMICS OF THEIR INTERACTION IN THE STIMULATION OF HEPATOCYTE DNA SYNTHESIS

    EPA Science Inventory

    Primary cultures of adult rat hepatocytes are stimulated to enter DNA synthesis by norepinephrine (NE). This stimulation is maximal if the hepatocytes are incubated with NE for more than 12 hr, beginning no later than 2-4 hr after the cells are first plated. After 24 hr in cultur...

  18. EFFECT OF NONGENOTOXIC ENVIRONMENTAL CONTAMINATION ON CHOLESTEROL AND DNA SYNTHESIS IN CULTURED PRIMARY RAT HEPATOCYTES

    EPA Science Inventory

    The effect of certain reputedly non genotoxic agents on cholesterol and DNA synthesis was investigated in cultured rat primary hepatocytes and liver slices. epatocytes in culture were incubated for 48, 60, and 72 hrs with one of the following chemicals; namely, chloroform (CHCl3)...

  19. Heparin effect on DNA synthesis in a murine fibrosarcoma cell line: influence of anionic density

    SciTech Connect

    Piepkorn, M.W.; Daynes, R.A.

    1983-09-01

    The effects of heparin subfractions on DNA synthesis in a murine cutaneous fibrosarcoma cell line were examined. Porcine mucosal heparin was preparatively fractionated for anionic charge density by DEAE-Sephadex chromatography and for molecular weight by Sephadex G-100 filtration. The cell line was plated from confluent monolayer cultures and grown in medium and fetal bovine serum, with or without a heparin fraction at a final concentration of 10 micrograms/ml. At intervals thereafter, the cells were pulsed with (/sup 3/H)thymidine. A low-charge density heparin fraction stimulated (/sup 3/H)thymidine incorporation (cpm/mg protein and cpm/cell) during the first 3 days of growth compared to control values without added heparin, whereas a high-charge density heparin fraction had little of this effect (186 +/- 35% of control vs. 101 +/- 14%, respectively; P less than .05). The augmentation of DNA synthesis observed with the low-charge density fraction correlated with increased proportions of cells in S and G2 phases compared with those of the controls, as determined by flow cytofluorometry. Low- and high-molecular-weight heparin fractions did not significantly alter DNA synthesis. Heparin subfractions are thus heterogeneous with respect to their effect on cellular DNA synthesis in this tumor line.

  20. Synthesis and Properties of Novel Silver-Containing DNA Molecules.

    PubMed

    Eidelshtein, Gennady; Fardian-Melamed, Natalie; Gutkin, Vitaly; Basmanov, Dmitry; Klinov, Dmitry; Rotem, Dvir; Levi-Kalisman, Yael; Porath, Danny; Kotlyar, Alexander

    2016-06-01

    Migration of silver atoms from silver nano-particles selectively to a double-stranded poly(dG)-poly(dC) polymer leads to metallization of the DNA. As a result the DNA molecules become shorter and thicker (higher), as evident from the atomic force microscopy imaging analysis. The metalized molecules can be detected by transmission and scanning electron microscopy in contrast to the initial non-metalized ones. PMID:27116695

  1. Deoxyribonucleotide synthesis and the emergence of DNA in molecular evolution

    NASA Astrophysics Data System (ADS)

    Follmann, Hartmut

    1982-02-01

    DNA replication requires monomeric deoxyribonucleotides, which cannot be regarded as primary products of organic syntheses on a primitive earth. However, the present biosynthetic pathway — reductive elimination of the 2'-OH group from ribonucleotides, catalyzed by ribonucleotide reductases and thioredoxins — suggests an early, polyphyletic combination of protein-nucleotide interactions and metal catalysis. That key process had to precede the upcome of RNA-DNA dualism on the way from RNA-protein protocells to true organisms.

  2. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  3. DNA polymerases drive DNA sequencing-by-synthesis technologies: both past and present

    PubMed Central

    Chen, Cheng-Yao

    2014-01-01

    Next-generation sequencing (NGS) technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. Escherichia coli DNA polymerase I proteolytic (Klenow) fragment was originally utilized in Sanger’s dideoxy chain-terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today’s standard capillary electrophoresis (CE) and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ϕ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ϕ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies. PMID:25009536

  4. Structural specificity of steroids in stimulating DNA synthesis and protooncogene expression in primary rat hepatocyte cultures.

    PubMed

    Lee, C H; Edwards, A M

    2002-05-01

    Among the chemical compounds of varied structure which possess liver tumour-promoting are steroids, such as estrogens, pregnenolone derivatives and anabolic steroids. Although the mechanism(s) of tumour promotion in liver by these xenobiotics is not well understood, it is clear that growth stimulation is one important element in their action. As a basis for better defining whether steroids stimulate growth by a common mechanism or fall into sub-groups with differing actions, the effects of 46 steroids on DNA synthesis and the expression of protooncogenes c-fos and c-myc were examined in primary cultures of normal rat hepatocytes. Tentative groupings of steroids have been identified based on apparent structural requirements for stimulation of DNA synthesis, and effects of auxiliary factors in modulating this growth stimulus. For a "progestin" group, insulin appeared to be permissive for stimulation of DNA synthesis, and presence of an ester or hydroxyl group at 17alpha-position in combination with a non-polar group at C(6) appeared to be required for stimulation. For the pregnenes, dexamethasone was stimulatory. Structural requirements include a non-polar substitution at 16alpha-position and presence of a 6alpha-methyl group. Androgens were weak or ineffective stimulators of DNA synthesis. Anabolic steroids were weak to strong stimulators and alteration to A ring structure in combination with non-polar substitution at 17alpha-position appeared to be required for the activity. With the exception of the anabolic steroid, dianabol, there do not appear to be strong correlation between ability to stimulate DNA synthesis and ability to induce protooncogene expression among the steroids. This study provides a starting point for future more detailed examination of growth-stimulatory mechanism(s) of action of steroids in the liver. PMID:12127039

  5. Changes in the patterns of synthesis of ribonucleic acid species in immature rat uterus in response to oestradiol-17β

    PubMed Central

    Billing, R. J.; Barbiroli, B.; Smellie, R. M. S.

    1969-01-01

    1. After treatment of immature rats with diethylstilboestrol, the wet weight and RNA content of uterine tissue increased rapidly, reaching a peak at 40hr. After an initial lag of a few hours, the acid-soluble ribose and protein contents also rose to maxima at 40hr. No increase in DNA content occurred until at least 24hr. after treatment. 2. The RNA from immature rat uterus isolated at various times up to 6hr. after administration of oestradiol-17β was labelled by injecting [3H]uridine and [3H]guanosine intraperitoneally 30min. before the animals were killed. It was fractionated on columns of kieselguhr coated with methylated serum albumin and the radioactivity in fractions corresponding to transfer RNA, 7s RNA, ribosomal RNA, Q1-RNA, Q2-RNA and DNA-like RNA was determined. 3. The radioactivity of the whole RNA increased steadily for 6hr. after hormone treatment. The earliest changes occurred in the Q1-RNA (ribosomal RNA precursor), whereas at longer time-intervals the radioactivity of the ribosomal RNA, 7s RNA and transfer RNA increased by four- to five-fold. The radioactivity of the DNA-like RNA increased by about 50%, but only at the longer time-intervals. 4. It is concluded that one of the earliest changes in response to oestradiol treatment is a major increase in synthesis of ribosomal RNA followed later by a similar increase in synthesis of transfer RNA and by a much smaller increase in synthesis of DNA-like RNA. The change in synthesis of ribosomal RNA in immature rat uterus may represent one of the most important responses to oestradiol treatment. PMID:4309670

  6. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    PubMed

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction. PMID:26815240

  7. L-arginine improves DNA synthesis in LPS-challenged enterocytes.

    PubMed

    Tan, Bi'e; Xiao, Hao; Xiong, Xia; Wang, Jing; Li, Guangran; Yin, Yulong; Huang, Bo; Hou, Yongqing; Wu, Guoyao

    2015-01-01

    The neonatal small intestine is susceptible to damage by endotoxin, and this cytotoxicity may involve intracellular generation of reactive oxygen species (ROS), resulting in DNA damage and mitochondrial dysfunction. L-Arginine (Arg) confers a cytoprotective effect on lipopolysaccharide (LPS)-treated enterocytes through activation of the mammalian target of the rapamycin (mTOR) signaling pathway. Arg improves DNA synthesis and mitochondrial bioenergetics, which may also be responsible for beneficial effects of Arg on intestinal mucosal cells. In support of this notion, results of recent studies indicate that elevated Arg concentrations enhances DNA synthesis, cell-cycle progression, and mitochondrial bioenergetics in LPS-treated intestinal epithelial cells through mechanisms involving activation of the PI3K-Akt pathway. These findings provide a biochemical basis for dietary Arg supplementation to improve the regeneration and repair of the small-intestinal mucosa in both animals and humans. PMID:25961538

  8. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  9. Amplified and multiplexed detection of DNA using the dendritic rolling circle amplified synthesis of DNAzyme reporter units.

    PubMed

    Wang, Fuan; Lu, Chun-Hua; Liu, Xiaoqing; Freage, Lina; Willner, Itamar

    2014-02-01

    The amplified, highly sensitive detection of DNA using the dendritic rolling circle amplification (RCA) is introduced. The analytical platform includes a circular DNA and a structurally tailored hairpin structure. The circular nucleic acid template includes a recognition sequence for the analyte DNA (the Tay-Sachs mutant gene), a complementary sequence to the Mg(2+)-dependent DNAzyme, and a sequence identical to the loop region of the coadded hairpin structure. The functional hairpin in the system consists of the analyte-sequence that is caged in the stem region and a single-stranded loop domain that communicates with the RCA product. The analyte activates the RCA process, leading to DNA chains consisting of the Mg(2+)-dependent DNAzyme and sequences that are complementary to the loop of the functional hairpin structure. Opening of the coadded hairpin releases the caged analyte sequence, resulting in the dendritic RCA-induced synthesis of the Mg(2+)-dependent DNAzyme units. The DNAzyme-catalyzed cleavage of a fluorophore/quencher-modified substrate leads to a fluorescence readout signal. The method enabled the analysis of the target DNA with a detection limit corresponding to 1 aM. By the design of two different circular DNAs that include recognition sites for two different target genes, complementary sequences for two different Mg(2+)-dependent DNAzyme sequences and two different functional hairpin structures, the dendritic RCA-stimulated multiplexed analysis of two different genes is demonstrated. The amplified dendritic RCA detection of DNA is further implemented to yield the hemin/G-quadruplex horseradish peroxidase (HRP)-mimicking DNAzyme as catalytic labels that provide colorimetric or chemiluminescent readout signals. PMID:24377284

  10. Synthesis of E. faecium wall teichoic acid fragments.

    PubMed

    van der Es, Daan; Groenia, Nadia A; Laverde, Diana; Overkleeft, Herman S; Huebner, Johannes; van der Marel, Gijsbert A; Codée, Jeroen D C

    2016-09-01

    The first synthesis of different Enterococcus faecium wall teichoic acid (WTA) fragments is presented. The structure of these major cell wall components was elucidated recently and it was shown that these glycerolphosphate (GroP) based polymers are built up from -6-(GalNAc-α(1-3)-GalNAc-β(1-2)-GroP)- repeating units. We assembled WTA fragments up to three repeating units in length, in two series that differ in the stereochemistry of the glycerolphosphate moiety. The key GalNAc-GalNAc-GroP synthons, required for the synthesis, were generated from galactosazide building blocks that were employed in highly stereoselective glycosylation reactions to furnish both the α- and β-configured linkages. By comparing the NMR spectra of the synthesized fragments with the isolated material it appears that the hereto undefined stereochemistry of the glycerol phosphate moiety is sn-glycerol-3-phosphate. The generated fragments will be valuable tools to study their immunological activity at the molecular level. PMID:26993744

  11. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  12. Design and Synthesis of Triangulated DNA Origami Trusses.

    PubMed

    Matthies, Michael; Agarwal, Nayan P; Schmidt, Thorsten L

    2016-03-01

    DNA nanotechnology offers unique control over matter on the nanoscale. Here, we extend the DNA origami method to cover a range of wireframe truss structures composed of equilateral triangles, which use less material per volume than standard multiple-helix bundles. From a flat truss design, we folded tetrahedral, octahedral, or irregular dodecahedral trusses by exchanging few connector strands. Other than standard origami designs, the trusses can be folded in low-salt buffers that make them compatible with cell culture buffers. The structures also have defined cavities that may in the future be used to precisely position functional elements such as metallic nanoparticles or enzymes. Our graph routing program and a simple design pipeline will enable other laboratories to make use of this valuable and potent new construction principle for DNA-based nanoengineering. PMID:26883285

  13. Protein Synthesis with Ribosomes Selected for the Incorporation of β-Amino Acids

    PubMed Central

    2016-01-01

    In an earlier study, β3-puromycin was used for the selection of modified ribosomes, which were utilized for the incorporation of five different β-amino acids into Escherichia coli dihydrofolate reductase (DHFR). The selected ribosomes were able to incorporate structurally disparate β-amino acids into DHFR, in spite of the use of a single puromycin for the selection of the individual clones. In this study, we examine the extent to which the structure of the β3-puromycin employed for ribosome selection influences the regio- and stereochemical preferences of the modified ribosomes during protein synthesis; the mechanistic probe was a single suppressor tRNACUA activated with each of four methyl-β-alanine isomers (1–4). The modified ribosomes were found to incorporate each of the four isomeric methyl-β-alanines into DHFR but exhibited a preference for incorporation of 3(S)-methyl-β-alanine (β-mAla; 4), i.e., the isomer having the same regio- and stereochemistry as the O-methylated β-tyrosine moiety of β3-puromycin. Also conducted were a selection of clones that are responsive to β2-puromycin and a demonstration of reversal of the regio- and stereochemical preferences of these clones during protein synthesis. These results were incorporated into a structural model of the modified regions of 23S rRNA, which included in silico prediction of a H-bonding network. Finally, it was demonstrated that incorporation of 3(S)-methyl-β-alanine (β-mAla; 4) into a short α-helical region of the nucleic acid binding domain of hnRNP LL significantly stabilized the helix without affecting its DNA binding properties. PMID:25982410

  14. Synthesis of a novel water-soluble zinc phthalocyanine and its CT DNA-damaging studies

    NASA Astrophysics Data System (ADS)

    Wang, Tianhui; Wang, Ao; Zhou, Lin; Lu, Shan; Jiang, Weiwei; Lin, Yun; Zhou, Jiahong; Wei, Shaohua

    2013-11-01

    A novel 3-(4-methoxybenzylamino) propanoic acid substituted water-soluble zinc phthalocyanine (CNPcZn) was synthesized. The interaction between CNPcZn with calf thymus DNA (CT DNA) was studied using spectroscopic methods. The studies indicated that CNPcZn has strong affinity to CT DNA, and furthermore, CNZnPc showed excellent photodamaging activity to CT DNA. Above results indicated that such CNPcZn has great potential to be used as an effective photosensitizer in the field of photodynamic therapy.

  15. Method for nucleic acid hybridization using single-stranded DNA binding protein

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1996-01-01

    Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.

  16. Synthesis, structure elucidation, DNA-PK and PI3K and anti-cancer activity of 8- and 6-aryl-substituted-1-3-benzoxazines.

    PubMed

    Morrison, Rick; Al-Rawi, Jasim M A; Jennings, Ian G; Thompson, Philip E; Angove, Michael J

    2016-03-01

    The synthesis of 6-aryl, 8- aryl, and 8-aryl-6-chloro-2-morpholino-1,3-benzoxazines with potent activity against PI3K and DNA-PK is described. Synthesis of thirty one analogues was facilitated by an improved synthesis of 3-bromo-2-hydroxybenzoic acid 13 by de-sulphonation of 3-bromo-2-hydroxy-5-sulfobenzoic acid 12 en route to 2-methylthio-substituted-benzoxazine intermediates 17-19. From this series, compound 20k (LTURM34) (dibenzo[b,d]thiophen-4-yl) (IC50 = 0.034 μM) was identified as a specific DNA-PK inhibitor, 170 fold more selective for DNA-PK activity compared to PI3K activity. Other compounds of the series show markedly altered selectivity for various PI3K isoforms including compound 20i (8-(naphthalen-1-yl) a potent and quite selective PI3Kδ inhibitor (IC50 = 0.64 μM). Finally, nine compounds were evaluated and showed antiproliferative activity against an NCI panel of cancer cell lines. Compound 20i (8-(naphthalen-1-yl) showed strong anti-proliferative activity against A498 renal cancer cells that warrants further investigation. PMID:26854431

  17. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools. PMID:26494264

  18. Synthesis of DNA Oligodeoxynucleotides Containing Site-Specific 1,3-Butadiene- Deoxyadenosine Lesions

    PubMed Central

    Wickramaratne, Susith; Seiler, Christopher L.

    2016-01-01

    Post-oligomerization synthesis is a useful technique for preparing site-specifically modified DNA oligomers. This approach involves site-specific incorporation of inherently reactive halogenated nucleobases into DNA strands using standard solid phase synthesis, followed by post-oligomerization nucleophilic aromatic substitution (SNAr) reactions with carcinogen-derived synthons. In these reactions, the inherent reactivities of DNA and carcinogen-derived species are reversed: the modified DNA nucleobase acts as an electrophile, while the carcinogen-derived species acts as a nucleophile. In the present protocol, we describe the use of the post-oligomerization approach to prepare DNA strands containing site- and stereospecific N6-adenine and N1, N6-adenine adducts induced by epoxide metabolites of the known human and animal carcinogen, 1,3-butadiene (BD). The resulting oligomers containing site specific, structurally defined DNA adducts can be used in structural and biological studies to reveal the roles of specific BD adducts in carcinogenesis and mutagenesis. PMID:26344227

  19. Structural Basis of High-Fidelity DNA Synthesis by Yeast DNA Polymerase δ

    SciTech Connect

    Swan, M.; Johnson, R; Prakash, L; Prakash, S; Aggarwal, A

    2009-01-01

    DNA polymerase ? (Pol ?) has a crucial role in eukaryotic replication. Now the crystal structure of the yeast DNA Pol ? catalytic subunit in complex with template primer and incoming nucleotide is presented at 2.0-A resolution, providing insight into its high fidelity and a framework to understand the effects of mutations involved in tumorigenesis.

  20. Synthesis of site-specific DNA-protein conjugates and their effects on DNA replication.

    PubMed

    Yeo, Jung Eun; Wickramaratne, Susith; Khatwani, Santoshkumar; Wang, Yen-Chih; Vervacke, Jeffrey; Distefano, Mark D; Tretyakova, Natalia Y

    2014-08-15

    DNA-protein cross-links (DPCs) are bulky, helix-distorting DNA lesions that form in the genome upon exposure to common antitumor drugs, environmental/occupational toxins, ionizing radiation, and endogenous free-radical-generating systems. As a result of their considerable size and their pronounced effects on DNA-protein interactions, DPCs can interfere with DNA replication, transcription, and repair, potentially leading to mutagenesis, genotoxicity, and cytotoxicity. However, the biological consequences of these ubiquitous lesions are not fully understood due to the difficulty of generating DNA substrates containing structurally defined, site-specific DPCs. In the present study, site-specific cross-links between the two biomolecules were generated by copper-catalyzed [3 + 2] Huisgen cycloaddition (click reaction) between an alkyne group from 5-(octa-1,7-diynyl)-uracil in DNA and an azide group within engineered proteins/polypeptides. The resulting DPC substrates were subjected to in vitro primer extension in the presence of human lesion bypass DNA polymerases η, κ, ν, and ι. We found that DPC lesions to the green fluorescent protein and a 23-mer peptide completely blocked DNA replication, while the cross-link to a 10-mer peptide was bypassed. These results indicate that the polymerases cannot read through the larger DPC lesions and further suggest that proteolytic degradation may be required to remove the replication block imposed by bulky DPC adducts. PMID:24918113

  1. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  2. Remote Activation of Host Cell DNA Synthesis in Uninfected Cells Signaled by Infected Cells in Advance of Virus Transmission

    PubMed Central

    Schmidt, Nora; Hennig, Thomas; Serwa, Remigiusz A.; Marchetti, Magda

    2015-01-01

    ABSTRACT Viruses modulate cellular processes and metabolism in diverse ways, but these are almost universally studied in the infected cell itself. Here, we study spatial organization of DNA synthesis during multiround transmission of herpes simplex virus (HSV) using pulse-labeling with ethynyl nucleotides and cycloaddition of azide fluorophores. We report a hitherto unknown and unexpected outcome of virus-host interaction. Consistent with the current understanding of the single-step growth cycle, HSV suppresses host DNA synthesis and promotes viral DNA synthesis in spatially segregated compartments within the cell. In striking contrast, during progressive rounds of infection initiated at a single cell, we observe that infection induces a clear and pronounced stimulation of cellular DNA replication in remote uninfected cells. This induced DNA synthesis was observed in hundreds of uninfected cells at the extended border, outside the perimeter of the progressing infection. Moreover, using pulse-chase analysis, we show that this activation is maintained, resulting in a propagating wave of host DNA synthesis continually in advance of infection. As the virus reaches and infects these activated cells, host DNA synthesis is then shut off and replaced with virus DNA synthesis. Using nonpropagating viruses or conditioned medium, we demonstrate a paracrine effector of uninfected cell DNA synthesis in remote cells continually in advance of infection. These findings have significant implications, likely with broad applicability, for our understanding of the ways in which virus infection manipulates cell processes not only in the infected cell itself but also now in remote uninfected cells, as well as of mechanisms governing host DNA synthesis. IMPORTANCE We show that during infection initiated by a single particle with progressive cell-cell virus transmission (i.e., the normal situation), HSV induces host DNA synthesis in uninfected cells, mediated by a virus-induced paracrine

  3. Inhibition of macrophage DNA synthesis by immunomodulators. II. Characterization of the suppression by muramyl dipeptide or lipopolysaccharide (/sup 3/H)thymidine incorporation into macrophages

    SciTech Connect

    Nagao, S.; Ikegami, S.; Tanaka, A.

    1984-12-01

    Guinea pig peritoneal exudate macrophages actively incorporated (/sup 3/H)thymidine into trichloroacetic acid-insoluble fraction in vitro. The incorporation of (/sup 3/H)thymidine was almost completely inhibited by aphidicolin, an inhibitor of DNA polymerase alpha and an autoradiograph showed heavy labeling in nuclei of 15% of macrophage populations. These results indicate that the observed thymidine incorporation was due to a nuclear DNA synthesis. The (/sup 3/H)thymidine incorporation was markedly suppressed when macrophages were activated by immunoadjuvants such as muramyl dipeptide (MDP) or bacterial lipopolysaccharide (LPS). The suppression of (/sup 3/H)thymidine incorporation by MDP was neither due to the decrease in thymidine transport through the cell membrane, nor due to dilution by newly synthesized cold thymidine. An autoradiograph revealed that MDP markedly decreased the number of macrophages the nuclei of which were labeled by (/sup 3/H)thymidine. These results suggest that the suppression of (/sup 3/H)thymidine incorporation by the immunoadjuvants reflects a true inhibition of DNA synthesis. The inhibition of DNA synthesis by MDP was also observed in vivo. Further, it was strongly suggested that the inhibition was not caused by some mediators, such as prostaglandin E2, released from macrophages stimulated by the immunoadjuvants but caused by a direct triggering of the adjuvants at least at the early stage of activation. Cyclic AMP appears to be involved in the inhibitory reaction.

  4. cis-Acting sequences in addition to donor and acceptor sites are required for template switching during synthesis of plus-strand DNA for duck hepatitis B virus.

    PubMed Central

    Havert, M B; Loeb, D D

    1997-01-01

    A characteristic of all hepadnaviruses is the relaxed-circular conformation of the DNA genome within an infectious virion. Synthesis of the relaxed-circular genome by reverse transcription requires three template switches. These template switches, as for the template switches or strand transfers of other reverse-transcribing genetic elements, require repeated sequences (the donor and acceptor sites) between which a complementary strand of nucleic acid is transferred. The mechanism for each of the template switches in hepadnaviruses is poorly understood. To determine whether sequences other than the donor and acceptor sites are involved in the template switches of duck hepatitis B virus (DHBV), a series of molecular clones which express viral genomes bearing deletion mutations were analyzed. We found that three regions of the DHBV genome, which are distinct from the donor and acceptor sites, are required for the synthesis of relaxed-circular DNA. One region, located near the 3' end of the minus-strand template, is required for the template switch that circularizes the genome. The other two regions, located in the middle of the genome and near DR2, appear to be required for plus-strand primer translocation. We speculate that these cis-acting sequences may play a role in the organization of the minus-strand DNA template within the capsid particle so that it supports efficient template switching during plus-strand DNA synthesis. PMID:9188603

  5. Synthesis and Characterization of DNA Minor Groove Binding Alkylating Agents

    PubMed Central

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K.; Mascara, Gerard P.; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W.; Bobola, Michael S.; Silber, John R.; Gold, Barry

    2012-01-01

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases the N-terminus was appended with a O-methyl sulfonate ester while the C-terminus group was varied with non-polar and polar sidechains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) vs. major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is > 10-fold higher than the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells over-expressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  6. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  7. Antibacterial activity and inhibition of protein synthesis in Escherichia coli by antisense DNA analogs.

    PubMed

    Rahman, M A; Summerton, J; Foster, E; Cunningham, K; Stirchak, E; Weller, D; Schaup, H W

    1991-01-01

    Protein synthesis, which takes place within ribosomes, is essential for the survival of any living organism. Ribosomes are composed of both proteins and RNA. Specific interaction between the 3' end CCUCC sequence of prokaryotic 16S rRNA and a partially complementary sequence preceding the initiating codon of mRNA is believed to be a prerequisite for initiation of protein synthesis. Here we report the use of short (three to six nucleotides) synthetic DNA analogs complementary to this sequence to block protein synthesis in vitro and in vivo in Escherichia coli. In the DNA analogs the normal phosphodiester bond in the antisense DNA was replaced by methylcarbamate internucleoside linkages to enhance transport across plasma membranes. Of the analogs tested, those with the sequence AGG and GGA inhibit protein synthesis and colony formation by E. coli strains lacking an outer cell wall. Polyethylene glycol 1000 (PEG 1000) was attached to the 5' end of some of the test methylcarbamate DNAs to enhance solubility. Analogs of AGG and GGAG with PEG 1000 attached inhibited colony formation in normal E. coli. These analogs may be useful food additives to control bacterial spoilage and biomedically as antibiotics. PMID:1821653

  8. An improved method of gene synthesis based on DNA works software and overlap extension PCR.

    PubMed

    Dong, Bingxue; Mao, Runqian; Li, Baojian; Liu, Qiuyun; Xu, Peilin; Li, Gang

    2007-11-01

    A bottleneck in recent gene synthesis technologies is the high cost of oligonucleotide synthesis and post-synthesis sequencing. In this article, a simple and rapid method for low-cost gene synthesis technology was developed based on DNAWorks program and an improved single-step overlap extension PCR (OE-PCR). This method enables any DNA sequence to be synthesized with few errors, then any mutated sites could be corrected by site-specific mutagenesis technology or PCR amplification-assembly method, which can amplify different DNA fragments of target gene followed by assembly into an entire gene through their overlapped region. Eventually, full-length DNA sequence without error was obtained via this novel method. Our method is simple, rapid and low-cost, and also easily amenable to automation based on a DNAWorks design program and defined set of OE-PCR reaction conditions suitable for different genes. Using this method, several genes including Manganese peroxidase gene (Mnp) of Phanerochaete chrysosporium (P. chrysosporium), Laccase gene (Lac) of Trametes versicolor (T. versicolor) and Cip1 peroxidase gene (cip 1) of Coprinus cinereus (C. cinereus) with sizes ranging from 1.0 kb to 1.5 kb have been synthesized successfully. PMID:17952664

  9. First total synthesis and antileishmanial activity of (Z)-16-methyl-11-heptadecenoic acid, a new marine fatty acid from the sponge Dragmaxia undata

    PubMed Central

    Carballeira, Néstor M.; Montano, Nashbly; Cintrón, Gabriel A.; Márquez, Carmary; Rubio, Celia Fernández; Prada, Christopher Fernández; Balaña-Fouce, Rafael

    2010-01-01

    The first total synthesis for the (Z)-16-methyl-11-heptadecenoic acid, a novel fatty acid from the sponge Dragmaxia undata, was accomplished in seven steps and in a 44% overall yield. The use of (trimethylsilyl)acetylene was key in the synthesis. Based on a previous developed strategy in our laboratory the best synthetic route towards the title compound was first acetylide coupling of (trimethylsilyl)acetylene to the long-chain protected 10-bromo-1-decanol followed by a second acetylide coupling to the short-chain 1-bromo-4-methylpentane, which resulted in higher yields. Complete spectral data is also presented for the first time for this recently discovered fatty acid and the cis double bond stereochemistry of the natural acid was established. The title compound displayed antiprotozoal activity against Leishmania donovani (IC50 = 165.5 ± 23.4 µM) and inhibited the leishmania DNA topoisomerase IB enzyme (LdTopIB) with an IC50 = 62.3 ± 0.7 µM. PMID:21129369

  10. Single and double stranded DNA detection using locked nucleic acid (LNA) functionalized nanoparticles

    NASA Astrophysics Data System (ADS)

    McKenzie, Fiona; Stokes, Robert; Faulds, Karen; Graham, Duncan

    2008-08-01

    Gold and silver nanoparticles functionalized with oligonucleotides can be used for the detection of specific sequences of DNA. We show that gold nanoparticles modified with locked nucleic acid (LNA) form stronger duplexes with a single stranded DNA target and offer better discrimination against single base pair mismatches than analogous DNA probes. Our LNA nanoparticle probes have also been used to detect double stranded DNA through triplex formation, whilst still maintaining selectivity for only complementary targets. Nanoparticle conjugates embedded with suitable surface enhanced resonance Raman scattering (SERRS) labels have been synthesized enabling simultaneous detection and identification of multiple DNA targets.

  11. Site-Selective Binding of Nanoparticles to Double-Stranded DNA via Peptide Nucleic Acid "Invasion"

    SciTech Connect

    Stadler, A.L.; van der Lelie, D.; Sun, D.; Maye, M. M.; Gang, O.

    2011-04-01

    We demonstrate a novel method for by-design placement of nano-objects along double-stranded (ds) DNA. A molecular intercalator, designed as a peptide nucleic acid (PNA)-DNA chimera, is able to invade dsDNA at the PNA-side due to the hybridization specificity between PNA and one of the duplex strands. At the same time, the single-stranded (ss) DNA tail of the chimera, allows for anchoring of nano-objects that have been functionalized with complementary ssDNA. The developed method is applied for interparticle attachment and for the fabrication of particle clusters using a dsDNA template. This method significantly broadens the molecular toolbox for constructing nanoscale systems by including the most conventional not yet utilized DNA motif, double helix DNA.

  12. Interaction of Ku protein and DNA-dependent protein kinase catalytic subunit with nucleic acids.

    PubMed Central

    Dynan, W S; Yoo, S

    1998-01-01

    The Ku protein-DNA-dependent protein kinase system is one of the major pathways by which cells of higher eukaryotes respond to double-strand DNA breaks. The components of the system are evolutionarily conserved and homologs are known from a number of organisms. The Ku protein component binds directly to DNA ends and may help align them for ligation. Binding of Ku protein to DNA also nucleates formation of an active enzyme complex containing the DNA-dependent protein kinase catalytic subunit (DNA-PKcs). The interaction between Ku protein, DNA-PKcs and nucleic acids has been extensively investigated. This review summarizes the results of these biochemical investigations and relates them to recent molecular genetic studies that reveal highly characteristic repair and recombination defects in mutant cells lacking Ku protein or DNA-PKcs. PMID:9512523

  13. Induction of DNA synthesis in isolated nuclei by cytoplasmic factors: inhibition by protease inhibitors.

    PubMed Central

    Wong, R L; Gutowski, J K; Katz, M; Goldfarb, R H; Cohen, S

    1987-01-01

    Cytoplasmic extracts from spontaneously proliferating and mitogen-activated lymphoid cells contain a protein factor called ADR (activator of DNA replication) that induces DNA synthesis in isolated quiescent nuclei. ADR-containing preparations have proteolytic activity, as indicated by their ability to degrade fibrin in a plasminogen-independent and plasminogen-dependent manner. In addition, aprotinin, a nonspecific protease inhibitor, abrogates ADR-induced DNA synthesis in a dose-dependent fashion. Preincubation studies demonstrated that the effect of aprotinin is not due to its suppressive effects on the nuclei themselves. Other protease inhibitors such as leupeptin, p-aminobenzamidine, and N-alpha-tosyllysine chloromethyl ketone are also inhibitory, but soybean trypsin inhibitor is without effect. ADR activity can be removed from active extracts by adsorption with aprotinin-conjugated agarose beads and can be recovered by elution with an acetate buffer (pH 5). These findings are consistent with the interpretation that the initiation of DNA synthesis in resting nuclei may be protease dependent and, further, that the cytoplasmic stimulatory factor we have called ADR may be a protease itself. PMID:3540956

  14. Synthesis of Cross-Linked DNA Containing Oxidized Abasic Site Analogues

    PubMed Central

    2015-01-01

    DNA interstrand cross-links are an important family of DNA damage that block replication and transcription. Recently, it was discovered that oxidized abasic sites react with the opposing strand of DNA to produce interstrand cross-links. Some of the cross-links between 2′-deoxyadenosine and the oxidized abasic sites, 5′-(2-phosphoryl-1,4-dioxobutane) (DOB) and the C4-hydroxylated abasic site (C4-AP), are formed reversibly. Chemical instability hinders biochemical, structural, and physicochemical characterization of these cross-linked duplexes. To overcome these limitations, we developed methods for preparing stabilized analogues of DOB and C4-AP cross-links via solid-phase oligonucleotide synthesis. Oligonucleotides of any sequence are attainable by synthesizing phosphoramidites in which the hydroxyl groups of the cross-linked product were orthogonally protected using photochemically labile and hydrazine labile groups. Selective unmasking of a single hydroxyl group precedes solid-phase synthesis of one arm of the cross-linked DNA. The method is compatible with commercially available phosphoramidites and other oligonucleotide synthesis reagents. Cross-linked duplexes containing as many as 54 nt were synthesized on solid-phase supports. Subsequent enzyme ligation of one cross-link product provided a 60 bp duplex, which is suitable for nucleotide excision repair studies. PMID:24949656

  15. A new paradigm of DNA synthesis: three-metal-ion catalysis.

    PubMed

    Yang, Wei; Weng, Peter J; Gao, Yang

    2016-01-01

    Enzyme catalysis has been studied for over a century. How it actually occurs has not been visualized until recently. By combining in crystallo reaction and X-ray diffraction analysis of reaction intermediates, we have obtained unprecedented atomic details of the DNA synthesis process. Contrary to the established theory that enzyme-substrate complexes and transition states have identical atomic composition and catalysis occurs by the two-metal-ion mechanism, we have discovered that an additional divalent cation has to be captured en route to product formation. Unlike the canonical two metal ions, which are coordinated by DNA polymerases, this third metal ion is free of enzyme coordination. Its location between the α- and β-phosphates of dNTP suggests that the third metal ion may drive the phosphoryltransfer from the leaving group opposite to the 3'-OH nucleophile. Experimental data indicate that binding of the third metal ion may be the rate-limiting step in DNA synthesis and the free energy associated with the metal-ion binding can overcome the activation barrier to the DNA synthesis reaction. PMID:27602203

  16. Development of artificial nucleic acid that recognizes a CG base pair in triplex DNA formation.

    PubMed

    Hari, Yoshiyuki

    2013-01-01

    An oligonucleotide that can form a triplex with double-stranded DNA is called a triplex-forming oligonucleotide (TFO). TFOs have gained considerable attention because of their potential as gene targeting tools. However, triplex DNA formation involves inherent problems for practical use. The most important problem is that natural nucleotides in TFO do not have sufficient affinity and base pair-selectivity to pyrimidine-purine base pair, like a CG or TA base pair, within dsDNA. This suggests that dsDNA region including a CG or TA base pair cannot be targeted. Therefore, artificial nucleotides, especially with non-natural nucleobases, capable of direct recognition of a CG or TA base pair via hydrogen bond formation have been developed; however, nucleotides with better selectivity and stronger affinity are necessary for implementing this dsDNA-targeting technology using TFOs. Under such a background, we considered that facile and efficient synthesis of various nucleobase derivatives in TFOs would be useful for finding an ideal nucleobase for recognition of a CG or TA base pair because detailed and rational exploration of nucleobase structures is facilitated. Recently, to develop a nucleobase recognizing a CG base pair, we have used post-elongation modification, i.e., modification after oligonucleotide synthesis, for the facile synthesis of nucleobase derivatives. This review mainly summarizes our recent findings on the development of artificial nucleobases and nucleotides for recognition of a CG base pair in triplexes formed between dsDNA and TFOs. PMID:24189561

  17. DNA damage and repair induced by diazoacetyl derivatives of amino acids with different mechanism of cytotoxicity. Correlations with mutagenicity and carcinogenicity.

    PubMed

    Brambilla, G; Cavanna, M; Carlo, P; Finollo, R; Sciaba, L; Parodi, S; Bolognesi, C

    1979-05-14

    Eight synthetic N-diazoacetyl amino acids, prepared by inserting a diazoacetyl group onto the alpha-nitrogen of a natural amino acid, and two natural diazoazetyl amino acids, azaserine (9-diazoacetyl-L-serine) and DON (6-diazo-5-oxo-L-norleucine), have been studied by autoradiography for their capacity to induce DNA repair synthesis in mouse cells cultivated "in vitro". Dose-dependent unscheduled DNA synthesis was present in cells treated with the eight N-diazoacetyl derivatives, and was absent in cells exposed to approximately equitoxic concentrations of azaserine and DON. Azaserine and DON, unlike N-diazoacetyl derivatives, did not alkylate gamma-(4-nitrobenzyl) pyridine at an appreciable extent. When DNA damage (single stranded breaks or weak points in alkali) was measured by the sensitive technique of alkaline elution, DGA was found about 4 times as potent as azaserine and about 12 times as DON on a molar basis, but about 800 and 17,000 times as potent as azaserine and DON respectively by extrapolating to equitoxic concentrations. Carcinogenicity and mutagenicity seem to follow mainly the capability of inducing DNA damage. PMID:468901

  18. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N.; Mariella, Jr., Raymond P.; Christian, Allen T.; Young, Jennifer A.; Clague, David S.

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  19. Endotoxin or cytokines attenuate ozone-induced DNA synthesis in rat nasal transitional epithelium

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R. )

    1992-06-01

    Pretreatment of rats with endotoxin (E), a potent inducer of tumor necrosis factor alpha (TNF), and interleukin 1 beta (IL 1), or a combination of TNF and IL1, has been shown to increase levels of lung antioxidant enzymes and protect against pulmonary toxicity associated with hyperoxia. Inhalation of ozone (O3) induces cell injury, followed by increased DNA synthesis, cell proliferation, and secretory cell metaplasia in rat nasal transitional epithelium (NTE). This study was designed to test the effects of E, TNF, and IL1 pretreatment on acute O3-induced NTE cell injury as measured by changes in NTE cell DNA synthesis. Rats were exposed to either 0.8 ppm O3 or air for 6 hr in whole-body inhalation chambers. Immediately before exposure, rats in each group were injected intraperitoneally (ip) with either saline alone or saline containing E, TNF, IL1, or both TNF and IL1. Eighteen hours postexposure, rats were injected ip with bromodeoxyuridine to label cells undergoing DNA synthesis and were euthanized 2 hr later. NTE was processed for light microscopy and immunochemically stained to identify cells that had incorporated BrdU into nuclear DNA. The number of BrdU-labeled NTE nuclei per millimeter of basal lamina was quantitated. There were no significant differences in the number of BrdU-labeled NTE nuclei in air-exposed rats that were injected with E, TNF, IL1, or TNF/IL1 compared with those in saline-injected, air-exposed controls. Rats that were injected with saline and exposed to O3 had approximately 10 times the number of BrdU-labeled NTE nuclei than saline-injected, air-exposed control rats. O3 exposure also induced a significant increase in labeled nuclei in rats that were pretreated with TNF alone. In contrast, pretreatment with E, IL1, or TNF/IL1 attenuated the O3-induced increase in NTE DNA synthesis.

  20. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  1. The POLD3 subunit of DNA polymerase δ can promote translesion synthesis independently of DNA polymerase ζ.

    PubMed

    Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E; Takeda, Shunichi

    2015-02-18

    The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356

  2. Synthesis, characterization and chemoprotective activity of polyoxovanadates against DNA alkylation.

    PubMed

    Nunes, Giovana G; Bonatto, Ana C; de Albuquerque, Carla G; Barison, Andersson; Ribeiro, Ronny R; Back, Davi F; Andrade, André Vitor C; de Sá, Eduardo L; Pedrosa, Fábio de O; Soares, Jaísa F; de Souza, Emanuel M

    2012-03-01

    The alkylation of pUC19 plasmid DNA has been employed as a model reaction for the first studies on chemoprotective action by a mixed-valence (+IV/+V) polyoxovanadate. A new, non-hydrothermal route for the high yield preparation of the test compound is described. The deep green, microcrystalline solid A was isolated after a three-day reaction in water at 80°C and 1 atm, while the reaction at 100°C gave green crystals of B. Both solids were structurally characterized by X-ray diffractometry and FTIR, EPR, NMR and Raman spectroscopies. Product A was identified as (NH(4))(2)V(3)O(8), while B corresponds to the spherical polyoxoanion [V(15)O(36)(Cl)](6-), isolated as the NMe(4)(+) salt. The lack of solubility of A in water and buffers prevented its use in DNA interaction studies, which were then carried out with B. Complex B was also tested for its ability to react with DNA alkylating agents by incubation with diethylsulphate (DES) and dimethylsulphate (DMS) in both the absence and presence of pUC19. For DMS, the best results were obtained with 10 mM of B (48% protection); with DES, this percentage increased to 70%. The direct reaction of B with increasing amounts of DMS in both buffered (PIPES 50 mM) and non-buffered aqueous solutions revealed the sequential formation of several vanadium(IV), vanadium(V) and mixed-valence aggregates of different nuclearities, whose relevance to the DNA-protecting activity is discussed. PMID:22265837

  3. Nuclear reorganization of mammalian DNA synthesis prior to cell cycle exit.

    PubMed

    Barbie, David A; Kudlow, Brian A; Frock, Richard; Zhao, Jiyong; Johnson, Brett R; Dyson, Nicholas; Harlow, Ed; Kennedy, Brian K

    2004-01-01

    In primary mammalian cells, DNA replication initiates in a small number of perinucleolar, lamin A/C-associated foci. During S-phase progression in proliferating cells, replication foci distribute to hundreds of sites throughout the nucleus. In contrast, we find that the limited perinucleolar replication sites persist throughout S phase as cells prepare to exit the cell cycle in response to contact inhibition, serum starvation, or replicative senescence. Proteins known to be involved in DNA synthesis, such as PCNA and DNA polymerase delta, are concentrated in perinucleolar foci throughout S phase under these conditions. Moreover, chromosomal loci are redirected toward the nucleolus and overlap with the perinucleolar replication foci in cells poised to undergo cell cycle exit. These same loci remain in the periphery of the nucleus during replication under highly proliferative conditions. These results suggest that mammalian cells undergo a large-scale reorganization of chromatin during the rounds of DNA replication that precede cell cycle exit. PMID:14701733

  4. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    PubMed

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  5. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  6. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailing description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  7. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  8. Alteration of mitochondrial DNA and RNA level in human fibroblasts with impaired vitamin B12 coenzyme synthesis.

    PubMed

    Cantatore, P; Petruzzella, V; Nicoletti, C; Papadia, F; Fracasso, F; Rustin, P; Gadaleta, M N

    1998-08-01

    Alterations of mitochondrial (mt) nucleic acid metabolism in methylmalonic aciduria (MMA) were studied in two cell lines from skin fibroblasts of patients with mitochondrial (GM00595) or cytosolic (GM10011) defects in the biosynthesis pathways of cobalamin coenzymes. The mtDNA level increased two-fold in GM00595 cells, which carry a mt defect in the adenosylcobalamin synthesis, whereas no appreciable change was found in GM10011 cells. The content of the two rRNAs 16S and 12S mtRNAs, normalized for the mtDNA copy number, decreased by 70% and 50% in GM00595 and GM10011, respectively. The normalized content of ND1, ND2 and CO I mRNAs decreased in GM00595, but was unchanged in GM10011. Respiratory chain complex activities measured in these two cell lines were not different from control activities. These data suggest that the maintenance of the mt function is due to doubling of mtDNA and that this compensatory response takes place only in those cells in which the greater reduction of the level of rRNA might have brought the content of these transcripts below the threshold value for optimal expression of the mt genome. PMID:9720919

  9. Synthesis, photochemical properties and DNA binding studies of dna cleaving agents based on chiral dipyridine dihydrodioxins salts

    NASA Astrophysics Data System (ADS)

    Shamaev, Alexei

    activated by UV-light. The mechanism of o-quinone release and intramolecular ET was studied in detail by methods of Ultrafast Transient Absortion Spectroscopy and supported by high-level quantum mechanical calculations. The binding properties of chiral intercalators based on PDHD to various DNA oligonucleotides were studied by various methods and DNA cleavage properties indicating strong binding and cleaving ability of the synthesized PDHDs. Also, a new method for synthesis of cyclohexa[e]pyrenes which possibly capable of intramolecular ET and electron transfer-oxidative stress (ET-OS) DNA cleavage was developed and partially accomplished.

  10. Synthesis of novel acid electrolytes for phosphoric acid fuel cells. Final report, May 1985-October 1988

    SciTech Connect

    Adcock, J.L.

    1988-11-01

    Construction of a 40-millimole-per-hour-scale aerosol direct-fluorination reactor was completed June 26, 1986. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4-methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy-1-propene, 18 grams of F-3-(2-methoxy.ethoxy)-1-propene, and 37 grams of F-3,3-dimethyl-1-butene. Eighteen grams of F-2,2-dimethyl-1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy-1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy)-1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other GRI contractors for synthesis of perfluorinated sulfur(VI) and phosphorous(V) acids.

  11. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  12. Self-assembled catalytic DNA nanostructures for synthesis of para-directed polyaniline.

    PubMed

    Wang, Zhen-Gang; Zhan, Pengfei; Ding, Baoquan

    2013-02-26

    Templated synthesis has been considered as an efficient approach to produce polyaniline (PANI) nanostructures. The features of DNA molecules enable a DNA template to be an intriguing template for fabrication of emeraldine PANI. In this work, we assembled HRP-mimicking DNAzyme with different artificial DNA nanostructures, aiming to manipulate the molecular structures and morphologies of PANI nanostructures through the controlled DNA self-assembly. UV-vis absorption spectra were used to investigate the molecular structures of PANI and monitor kinetic growth of PANI. It was found that PANI was well-doped at neutral pH and the redox behaviors of the resultant PANI were dependent on the charge density of the template, which was controlled by the template configurations. CD spectra indicated that the PANI threaded tightly around the helical DNA backbone, resulting in the right handedness of PANI. These reveal the formation of the emeraldine form of PANI that was doped by the DNA. The morphologies of the resultant PANI were studied by AFM and SEM. It was concluded from the imaging and spectroscopic kinetic results that PANI grew preferably from the DNAzyme sites and then expanded over the template to form 1D PANI nanostructures. The strategy of the DNAzyme-DNA template assembly brings several advantages in the synthesis of para-coupling PANI, including the region-selective growth of PANI, facilitating the formation of a para-coupling structure and facile regulation. We believe this study contributes significantly to the fabrication of doped PANI nanopatterns with controlled complexity, and the development of DNA nanotechnology. PMID:23272944

  13. Synthesis of Mitochondrial DNA Precursors during Myogenesis, an Analysis in Purified C2C12 Myotubes*

    PubMed Central

    Frangini, Miriam; Franzolin, Elisa; Chemello, Francesco; Laveder, Paolo; Romualdi, Chiara; Bianchi, Vera; Rampazzo, Chiara

    2013-01-01

    During myogenesis, myoblasts fuse into multinucleated myotubes that acquire the contractile fibrils and accessory structures typical of striated skeletal muscle fibers. To support the high energy requirements of muscle contraction, myogenesis entails an increase in mitochondrial (mt) mass with stimulation of mtDNA synthesis and consumption of DNA precursors (dNTPs). Myotubes are quiescent cells and as such down-regulate dNTP production despite a high demand for dNTPs. Although myogenesis has been studied extensively, changes in dNTP metabolism have not been examined specifically. In differentiating cultures of C2C12 myoblasts and purified myotubes, we analyzed expression and activities of enzymes of dNTP biosynthesis, dNTP pools, and the expansion of mtDNA. Myotubes exibited pronounced post-mitotic modifications of dNTP synthesis with a particularly marked down-regulation of de novo thymidylate synthesis. Expression profiling revealed the same pattern of enzyme down-regulation in adult murine muscles. The mtDNA increased steadily after myoblast fusion, turning over rapidly, as revealed after treatment with ethidium bromide. We individually down-regulated p53R2 ribonucleotide reductase, thymidine kinase 2, and deoxyguanosine kinase by siRNA transfection to examine how a further reduction of these synthetic enzymes impacted myotube development. Silencing of p53R2 had little effect, but silencing of either mt kinase caused 50% mtDNA depletion and an unexpected decrease of all four dNTP pools independently of the kinase specificity. We suggest that during development of myotubes the shortage of even a single dNTP may affect all four pools through dysregulation of ribonucleotide reduction and/or dissipation of the non-limiting dNTPs during unproductive elongation of new DNA chains. PMID:23297407

  14. Translesion synthesis is the main component of SOS repair in bacteriophage lambda DNA.

    PubMed Central

    Defais, M; Lesca, C; Monsarrat, B; Hanawalt, P

    1989-01-01

    Agents that interfere with DNA replication in Escherichia coli induce physiological adaptations that increase the probability of survival after DNA damage and the frequency of mutants among the survivors (the SOS response). Such agents also increase the survival rate and mutation frequency of irradiated bacteriophage after infection of treated bacteria, a phenomenon known as Weigle reactivation. In UV-irradiated single-stranded DNA phage, Weigle reactivation is thought to occur via induced, error-prone replication through template lesions (translesion synthesis [P. Caillet-Fauquet, M: Defais, and M. Radman, J. Mol. Biol. 117:95-112, 1977]). Weigle reactivation occurs with higher efficiency in double-stranded DNA phages such as lambda, and we therefore asked if another process, recombination between partially replicated daughter molecules, plays a major role in this case. To distinguish between translesion synthesis and recombinational repair, we studied the early replication of UV-irradiated bacteriophage lambda in SOS-induced and uninduced bacteria. To avoid complications arising from excision of UV lesions, we used bacterial uvrA mutants, in which such excision does not occur. Our evidence suggests that translesion synthesis is the primary component of Weigle reactivation of lambda phage in the absence of excision repair. The greater efficiency in Weigle reactivation of double-stranded DNA phage could thus be attributed to some inducible excision repair unable to occur on single-stranded DNA. In addition, after irradiation, lambda phage replication seems to switch prematurely from the theta mode to the rolling circle mode. Images PMID:2527845

  15. Mutagenicity and pausing of HIV reverse transcriptase during HIV plus-strand DNA synthesis.

    PubMed Central

    Ji, J; Hoffmann, J S; Loeb, L

    1994-01-01

    The unusually high frequency of misincorporation by HIV-1 reverse transcriptase (HIV RT) is likely to be the major factor in the rapid accumulation of viral mutations in AIDS, especially in the env gene. To investigate the ability of HIV RT to copy the env gene, we subcloned an HIV env gene fragment into a single-stranded DNA vector and measured the progression of synthesis by HIV RT. We observed that HIV RT, but not RT from avian myeloblastosis virus, DNA polymerase-alpha or T7 DNA polymerase, pauses specifically at poly-deoxyadenosine stretches within the env gene. The frequency of bypassing the polyadenosine stretches by HIV RT is enhanced by increasing the ratio of enzyme to template. We measured the fidelity of DNA synthesis within a segment of the hypervariable region 1 of the env gene (V-1) containing a poly-deoxyadenosine sequence by repetitively copying the DNA by HIV RT, and then cloning and sequencing the copied fragments. We found that 27% of the errors identified in V-1 sequence were frameshift mutations opposite the poly-adenosine tract, a site where strong pausing was observed. Pausing of HIV RT at the polyadenosine tract could be enhanced by either distamycin A or netropsin, (A-T)-rich minor groove binding peptides. Moreover, netropsin increases the frequency of frameshift mutations in experiments in which HIV RT catalyzes gap filling synthesis within the lacZ gene in double-stranded circular M13mp2 DNA. These combined results suggest that the enhanced mutation frequency may be due to increased pausing at netropsin-modified polyadenosine tracts. Therefore, netropsin and related A-T binding chemicals may selectively enhance frameshift mutagenesis induced by HIV RT and yield predominantly non-viable virus. Images PMID:7510388

  16. Synthesis of hyaluronic acid oligosaccharides and exploration of a fluorous-assisted approach.

    PubMed

    Macchione, Giuseppe; de Paz, José L; Nieto, Pedro M

    2014-07-23

    The synthesis of hyaluronic acid oligomers (tri- and tetrasaccharide) is described. We have followed a pre-glycosylation oxidation strategy. Glucuronic acid units were directly employed in coupling reactions with suitably protected glucosamine derivatives. In order to simplify the purification of synthetic intermediates, a fluorous-assisted strategy has been also explored. Using this approach, a hyaluronic acid trisaccharide was prepared. PMID:24930061

  17. Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.

    PubMed

    Dacquin, J P; Lee, A F; Pirez, C; Wilson, K

    2012-01-01

    Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. PMID:22089025

  18. Synthesis of a duplex oligonucleotide containing a nitrogen mustard interstrand DNA-DNA cross-link.

    PubMed

    Ojwang, J O; Grueneberg, D A; Loechler, E L

    1989-12-01

    Many cancer chemotherapeutic agents react with DNA and give adducts that block DNA replication, which is thought to result in cytotoxicity, especially in rapidly proliferating cells such as cancer cells. One class of these agents is bifunctionally reactive (e.g., the nitrogen mustards) and forms DNA-DNA cross-links. It is unknown whether inter- or intrastrand cross-links are more effective at blocking DNA replication. To evaluate this, a DNA shuttle vector is being constructed with an interstrand cross-link at a unique site. In the first step of this project, a duplex oligonucleotide containing an interstrand cross-link is isolated by denaturing polyacrylamide gel electrophoresis from the reaction of nitrogen mustard with two partially complementary oligodeoxynucleotides. The purified oligonucleotide product is characterized and shown to be cross-linked in a 5'-GAC-3' 3'-CTG-5' sequence by a nitrogen mustard moiety that is bound at the N(7)-position of the guanines in the opposing strands; the glycosylic bonds of these guanine adducts are stabilized in their corresponding imidazole ring-opened form. Nitrogen mustard is shown to react with a variety of oligonucleotides and, based upon these results, its preferred targets for interstrand cross-linking are 5'-GXC-3' sequences, where X can be any of the four deoxyribonucleotide bases. PMID:2819709

  19. On-Flow Synthesis of Co-Polymerizable Oligo-Microspheres and Application in ssDNA Amplification

    PubMed Central

    Lee, Se Hee; Lee, Jae Ha; Lee, Ho Won; Kim, Yang-Hoon; Jeong, Ok Chan; Ahn, Ji-Young

    2016-01-01

    We fabricated droplet-based microfluidic platform for copolymerizable microspheres with acrydite modified DNA probe. The copolymerizable 3-D polyacrylamide microspheres were successfully produced from microcontinuous-flow synthesis with on-channel solidification. DNA copolymerization activity, surface presentation and thermostability were assessed by using fluorescent labeled complementary probe. The binding performance was only visible on the surface area of oligo-microspheres. We show that the resulting oligo-microspheres can be directly integrated into a streamlined microsphere-PCR protocol for amplifying ssDNA. Our microspheres could be utilized as a potential material for ssDNA analysis such as DNA microarray and automatic DNA SELEX process. PMID:27447941

  20. Design and synthesis of efficient fluorescent dyes for incorporation into DNA backbone and biomolecule detection.

    PubMed

    Wang, Wei; Li, Alexander D Q

    2007-01-01

    We report here the design and synthesis of a series of pi-conjugated fluorescent dyes with D-A-D (D, donor; A, acceptor), D-pi-D, A-pi-A, and D-pi-A for applications as the signaling motif in biological-synthetic hybrid foldamers for DNA detection. The Horner-Wadsworth-Emmons (HWE) reaction and Knoevenagel condensation were demonstrated as the optimum ways for construction of long pi-conjugated systems. Such rodlike chromophores have distinct advantages, as their fluorescence properties are not quenched by the presence of DNA. To be incorporated into the backbone of DNA, the chromophores need to be reasonably soluble in organic solvent for solid-phase synthesis, and therefore a strategy of using flexible tetraethylene glycol (TEG) linkers at either end of these rodlike dyes was developed. The presence of TEG facilitates the protection of the chain-growing hydroxyl group with DMTrCl (dimethoxytrityl chloride) as well as the activation of the coupling step with phosphoramidite chemistry on an automated DNA synthesizer. To form fluorescence resonance energy transfer (FRET) pairs, six synthetic chromophores with blue to red fluorescence have been developed, and those with orthogonal fluorescent emission were chosen for incorporation into DNA-chromophore hybrid foldamers. PMID:17508711

  1. Recent Advances in the Synthesis and Functions of Reconfigurable Interlocked DNA Nanostructures.

    PubMed

    Lu, Chun-Hua; Cecconello, Alessandro; Willner, Itamar

    2016-04-27

    Interlocked circular DNA nanostructures, e.g., catenanes or rotaxanes, provide functional materials within the area of DNA nanotechnology. Specifically, the triggered reversible reconfiguration of the catenane or rotaxane structures provides a means to yield new DNA switches and to use them as dynamic scaffolds for controlling chemical functions and positioning functional cargoes. The synthesis of two-ring catenanes and their switchable reconfiguration by pH, metal ions, or fuel/anti-fuel stimuli are presented, and the functions of these systems, as pendulum or rotor devices or as switchable catalysts, are described. Also, the synthesis of three-, five-, and seven-ring catenanes is presented, and their switchable reconfiguration using fuel/anti-fuel strands is addressed. Implementation of the dynamically reconfigured catenane structures for the programmed organization of Au nanoparticle (NP) assemblies, which allows the plasmonic control of the fluorescence properties of Au NP/fluorophore loads associated with the scaffold, and for the operation of logic gates is discussed. Interlocked DNA rotaxanes and their different synthetic approaches are presented, and their switchable reconfiguration by means of fuel/anti-fuel strands or photonic stimuli is described. Specifically, the use of the rotaxane as a scaffold to organize Au NP assemblies, and the control of the fluorescence properties with Au NP/fluorophore hybrids loaded on the rotaxane scaffold, are introduced. The future prospectives and challenges in the field of interlocked DNA nanostructures and the possible applications are discussed. PMID:27019201

  2. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  3. Synthesis of peptide-conjugated light-driven molecular motors and evaluation of their DNA-binding properties.

    PubMed

    Nagatsugi, Fumi; Takahashi, Yusuke; Kobayashi, Maiko; Kuwahara, Shunsuke; Kusano, Shuhei; Chikuni, Tomoko; Hagihara, Shinya; Harada, Nobuyuki

    2013-05-01

    Synthetic light-driven molecular motors are molecular machines capable of rotation under photo-irradiation. In this paper, we report the synthesis of peptide-conjugated molecular motors and evaluate their DNA-binding properties. PMID:23324812

  4. STRUCTURE-ACTIVITY STUDY OF PARACETAMOL ANALOGUES: INHIBITION OF REPLICATIVE DNA SYNTHESIS IN V79 CHINESE HAMSTER CELLS

    EPA Science Inventory

    Experimental and theoretical evidence pertaining to cytotoxic and genotoxic activity of paracetamol in biological systems was used to formulate a simple mechanistic hypothesis to explain the relative inhibition of replicative DNA synthesis by a series of 19 structurally similar p...

  5. Synthesis of Programmable Reaction-Diffusion Fronts Using DNA Catalyzers

    NASA Astrophysics Data System (ADS)

    Zadorin, Anton S.; Rondelez, Yannick; Galas, Jean-Christophe; Estevez-Torres, André

    2015-02-01

    We introduce a DNA-based reaction-diffusion (RD) system in which reaction and diffusion terms can be precisely and independently controlled. The effective diffusion coefficient of an individual reaction component, as we demonstrate on a traveling wave, can be reduced up to 2.7-fold using a self-assembled hydrodynamic drag. The intrinsic programmability of this RD system allows us to engineer, for the first time, orthogonal autocatalysts that counterpropagate with minimal interaction. Our results are in excellent quantitative agreement with predictions of the Fisher-Kolmogorov-Petrovskii-Piscunov model. These advances open the way for the rational engineering of pattern formation in pure chemical RD systems.

  6. [Intensity of DNA synthesis in animal organs after a flight on the Kosmos-782 biosatellite].

    PubMed

    Guseĭnov, F T; Egorov, I A; Komolova, G S; Tigranian, R A

    1979-01-01

    With respect to H3-thymidine incorporation the rate of DNA synthesis in the liver, spleen and thymus of rats was determined in flight and synchronous rats. Six hours post-flight the rate of H3-thymidine incorporation into the liver of flight rats did not differ from the normal (vivarium controls) and was 50% higher than in the synchronous rats. In the spleen and thymus of flight animals this parameter was 60 and 33% below the norm. Similar but less pronounced changes in the spleen were found in the synchronous rats. Twenty-five days postflight the rate of DNA synthesis in lymph organs recovered completely and tended to increase, whereas in the liver it remained significantly below the norm. PMID:459398

  7. Protein synthesis directly from PCR: progress and applications of cell-free protein synthesis with linear DNA.

    PubMed

    Schinn, Song-Min; Broadbent, Andrew; Bradley, William T; Bundy, Bradley C

    2016-06-25

    A rapid, versatile method of protein expression and screening can greatly facilitate the future development of therapeutic biologics, proteomic drug targets and biocatalysts. An attractive candidate is cell-free protein synthesis (CFPS), a cell-lysate-based in vitro expression system, which can utilize linear DNA as expression templates, bypassing time-consuming cloning steps of plasmid-based methods. Traditionally, such linear DNA expression templates (LET) have been vulnerable to degradation by nucleases present in the cell lysate, leading to lower yields. This challenge has been significantly addressed in the recent past, propelling LET-based CFPS as a useful tool for studying, screening and engineering proteins in a high-throughput manner. Currently, LET-based CFPS has promise in fields such as functional proteomics, protein microarrays, and the optimization of complex biological systems. PMID:27085957

  8. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  9. Synthesis, characterization and DNA cleaving studies of new organocobaloxime derivatives.

    PubMed

    Erdem-Tuncmen, Mukadder; Karipcin, Fatma; Ozmen, Ismail

    2013-01-01

    Dioxime ligand (H2L) was synthesized by condensation reaction between 4-biphenylchloroglyoxime and 4-chloroaniline. The metal complexes of the types, [Co(HL)2(i-Pr)Py], [CoL2(i-Pr)PyB2F4] and [CoL2(i-Pr)Py(Cu(phen))2](ClO4)2 [H2L = 4-(4-chlorophenylamino)biphenylglyoxime; phen = 1,10-phenanthroline; i-Pr = isopropyl; Py = pyridine] were synthesized and characterized by elemental analysis, FT-IR, 1H NMR and magnetic susceptibility, conductivity measurements. The results of elemental analyses, IR and NMR confirmed the stoichiometry of the complexes and the formation of ligand frameworks around the metal ions. The magnetic moment measurements of the complexes indicated that the complexes are diamagnetic (low-spin d6 octahedral) except trinuclear complex. Furthermore the interaction between the dioxime ligand and its complexes with DNA has also been investigated by agarose gel electrophoresis. The trinuclear Cu2Co complex with H2O2 as a cooxidant exhibited the strongest DNA cleaving activity. PMID:23841342

  10. Dihydrolipoic acid activates oligomycin-sensitive thiol groups and increases ATP synthesis in mitochondria.

    PubMed

    Zimmer, G; Mainka, L; Krüger, E

    1991-08-01

    Investigations with dihydrolipoic acid in rat heart mitochondria and mitoplasts reveal an activation of ATP-synthase up to 45%, whereas ATPase activities decrease by 36%. In parallel with an increase in ATP synthesis oligomycin-sensitive mitochondrial -SH groups are activated at 2-4 nmol dihydrolipoic acid/mg protein. ATPase activation by the uncouplers carbonylcyanide-p-trifluoromethoxyphenylhydrazone and oleate is diminished by dihydrolipoic acid, and ATP synthesis depressed by oleate is partially restored. No such efficiency of dihydrolipoic acid is seen with palmitate-induced ATPase activation or decrease of ATP synthesis. This indicates different interference of oleate and palmitate with mitochondria. In addition to its known coenzymatic properties dihydrolipoic acid may act as a substitute for coenzyme A, thereby diminishing the uncoupling efficiency of oleate. Furthermore, dihydrolipoic acid is a very potent antioxidant, shifting the -SH-S-S- equilibrium in mitochondria to the reduced state and improving the energetic state of cells. PMID:1832845

  11. The Foundry: the DNA synthesis and construction Foundry at Imperial College

    PubMed Central

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-01-01

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  12. The Foundry: the DNA synthesis and construction Foundry at Imperial College.

    PubMed

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-06-15

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  13. Identification of csrR/csrS, a genetic locus that regulates hyaluronic acid capsule synthesis in group A Streptococcus.

    PubMed

    Levin, J C; Wessels, M R

    1998-10-01

    The hyaluronic acid capsule of group A Streptococcus (GAS) is an important virulence factor, but little is known about mechanisms that regulate capsule expression. Transposon Tn916 mutagenesis of the poorly encapsulated M-type 3 GAS strain DLS003 produced a transconjugant that exhibited a mucoid colony morphology, reflecting increased hyaluronic acid capsule production. Analysis of chromosomal DNA sequence immediately downstream of the transposon insertion identified two open reading frames, designated csrR and csrS, which exhibited sequence similarity to bacterial two-component regulatory systems. We constructed an in-frame deletion mutation within csrR, which encodes the putative response component. Replacement of the native csrR gene in the DLS003 chromosome with the mutant allele resulted in a sixfold increase in capsule production and a corresponding increase in transcription of the has operon, which contains the essential genes for hyaluronic acid synthesis. Increased capsule production by the csrR mutant strain was associated with enhanced resistance to complement-mediated opsonophagocytic killing in vitro and with a 500-fold increase in virulence in mice. These results establish CsrR as a negative regulator of hyaluronic acid capsule synthesis and suggest that it is part of a two-component regulatory system that influences capsule expression and virulence. PMID:9786197

  14. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E

    1996-01-01

    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  15. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  16. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells.

    PubMed

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells' molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  17. Use of locked nucleic acid oligonucleotides to add functionality to plasmid DNA

    PubMed Central

    Hertoghs, Kirsten M. L.; Ellis, Jonathan H.; Catchpole, Ian R.

    2003-01-01

    The available reagents for the attachment of functional moieties to plasmid DNA are limiting. Most reagents bind plasmid DNA in a non-sequence- specific manner, with undefined stoichiometry, and affect DNA charge and delivery properties or involve chemical modifications that abolish gene expression. The design and ability of oligonucleotides (ODNs) containing locked nucleic acids (LNAs) to bind supercoiled, double-stranded plasmid DNA in a sequence-specific manner are described for the first time. The main mechanism for LNA ODNs binding plasmid DNA is demonstrated to be by strand displacement. LNA ODNs are more stably bound to plasmid DNA than similar peptide nucleic acid (PNA) ‘clamps’ for procedures such as particle-mediated DNA delivery (gene gun). It is shown that LNA ODNs remain associated with plasmid DNA after cationic lipid-mediated transfection into mammalian cells. LNA ODNs can bind to DNA in a sequence-specific manner so that binding does not interfere with plasmid conformation or gene expression. Attachment of CpG-based immune adjuvants to plasmid by ‘hybrid’ phosphorothioate–LNA ODNs induces tumour necrosis factor-α production in the macrophage cell line RAW264.7. This observation exemplifies an important new, controllable methodology for adding functionality to plasmids for gene delivery and DNA vaccination. PMID:14530430

  18. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  19. DNA Diagnostics: Nanotechnology-enhanced Electrochemical Detection of Nucleic Acids

    PubMed Central

    Wei, Fang; Lillehoj, Peter B.; Ho, Chih-Ming

    2010-01-01

    The detection of mismatched base pairs in DNA plays a crucial role in the diagnosis of genetic-related diseases and conditions, especially for early stage treatment. Among the various biosensors that have been employed for DNA detection, electrochemical sensors show great promise since they are capable of precise DNA recognition and efficient signal transduction. Advancements in micro- and nanotechnologies, specifically fabrication techniques and new nanomaterials, have enabled for the development of highly sensitive, highly specific sensors making them attractive for the detection of small sequence variations. Furthermore, the integration of sensors with sample preparation and fluidic processes enables for rapid, multiplexed DNA detection for point-of-care (POC) clinical diagnostics. PMID:20075759

  20. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  1. An Alkyne Diboration/6π-Electrocyclization Strategy for the Synthesis of Pyridine Boronic Acid Derivatives.

    PubMed

    Mora-Radó, Helena; Bialy, Laurent; Czechtizky, Werngard; Méndez, María; Harrity, Joseph P A

    2016-05-01

    A new and efficient synthesis of pyridine-based heteroaromatic boronic acid derivatives is reported through a novel diboration/6π-electrocyclization strategy. This method delivers a range of functionalized heterocycles from readily available starting materials. PMID:27059895

  2. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  3. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  4. Bombesin stimulation of DNA synthesis and cell division in cultures of Swiss 3T3 cells.

    PubMed Central

    Rozengurt, E; Sinnett-Smith, J

    1983-01-01

    Bombesin is shown to be a potent mitogen for Swiss 3T3 cells. At nanomolar concentrations the peptide markedly enhances the ability of fresh serum to stimulate DNA synthesis in confluent and quiescent cultures of these cells. In the presence of a low concentration (3.5%) of serum, bombesin stimulates 3T3 cell proliferation. In serum-free medium, bombesin induces DNA synthesis in the absence of any other added growth factor; half-maximal effect is obtained at 1 nM. The mitogenic effect of bombesin is dependent on dose and time, is mimicked by litorin, and is markedly potentiated by insulin, colchicine, platelet-derived growth factor, and fibroblast-derived growth factor. These mitogens increase the maximal response elicited by bombesin and decrease the bombesin concentration required to produce half-maximal effect (from 1 nM to 0.3 nM). In contrast, vasopressin, phorbol esters, or cAMP increasing agents fail to enhance the maximal level of DNA synthesis induced by bombesin. Bombesin and litorin may provide useful model peptides for studies on the mechanism(s) by which extracellular ligands control cell proliferation. PMID:6344074

  5. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis

    PubMed Central

    Burkovics, Peter; Sebesta, Marek; Sisakova, Alexandra; Plault, Nicolas; Szukacsov, Valeria; Robert, Thomas; Pinter, Lajos; Marini, Victoria; Kolesar, Peter; Haracska, Lajos; Gangloff, Serge; Krejci, Lumir

    2013-01-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. PMID:23395907

  6. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis.

    PubMed

    Burkovics, Peter; Sebesta, Marek; Sisakova, Alexandra; Plault, Nicolas; Szukacsov, Valeria; Robert, Thomas; Pinter, Lajos; Marini, Victoria; Kolesar, Peter; Haracska, Lajos; Gangloff, Serge; Krejci, Lumir

    2013-03-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. PMID:23395907

  7. Stimulation of DNA synthesis in human epidermis by UVB radiation and its inhibition by difluoromethylornithine

    SciTech Connect

    Eshbaugh, W.G. Jr.; Forley, B.G.; Ritter, E.F.; Serafin, D.; Klitzman, B. )

    1990-04-01

    The purpose of this study was to determine whether the rate of DNA synthesis in human skin could be increased by UVB radiation and to determine the potential for reversing the stimulatory effects of UVB radiation by alpha-difluoromethylornithine (DFMO). Split-thickness facial skin was grafted onto athymic CD-1 Nu/Nu mice on the anterolateral dorsal surface. Following graft healing for 6 weeks, grafts were treated with 0%, 2%, or 5% DFMO (a potent inhibitor of polyamine biosynthesis) and subsequently irradiated with 0.15 J/cm2 of UVB light. Two days after UVB exposure, ({sup 3}H)thymidine was injected and the grafts were dissected and counted. Ultraviolet radiation significantly increased thymidine incorporation, indicating increased DNA synthesis. The stimulatory effects of UV radiation were significantly reduced by topical application of 5% DFMO. Thus administration of DFMO most likely decreased the polyamine level and decreased the rate of DNA synthesis, which may have caused a decreased rate of epidermal proliferation. Thus the topical application of DFMO may prove beneficial for UVB exposure and other hyperproliferative states where a decrease in the rate of cell turnover might be desirable.

  8. Deoxyadenosine family: improved synthesis, DNA damage and repair, analogs as drugs.

    PubMed

    Biswas, Himadri; Kar, Indrani; Chattopadhyaya, Rajagopal

    2013-08-01

    Improved synthesis of 2'-deoxyadenosine using Escherichia coli overexpressing some enzymes and gram-scale chemical synthesis of 2'-deoxynucleoside 5'-triphosphates reported recently are described in this review. Other topics include DNA damage induced by chromium(VI), Fenton chemistry, photoinduction with lumazine, or by ultrasound in neutral solution; 8,5'-cyclo-2'-deoxyadenosine isomers as potential biomarkers; and a recapitulation of purine 5',8-cyclonucleoside studies. The mutagenicities of some products generated by oxidizing 2'-deoxyadenosine 5'-triphosphate, nucleotide pool sanitization, and translesion synthesis are also reviewed. Characterizing cross-linking between nucleosides in opposite strands of DNA and endonuclease V-mediated deoxyinosine excision repair are discussed. The use of purine nucleoside analogs in the treatment of rarer chronic lymphoid leukemias is reviewed. Some analogs at the C8 position induced delayed polymerization arrest during HIV-1 reverse transcription. The susceptibility of clinically metronidazole-resistant Trichomonas vaginalis to two analogs, toyocamycin and 2-fluoro-2'-deoxyadenosine, were tested in vitro. GS-9148, a dAMP analog, was translocated to the priming site in a complex with reverse transcriptase and double-stranded DNA to gain insight into the mechanism of reverse transcriptase inhibition. PMID:25436589

  9. Stimulation of DNA synthesis in rat and mouse liver by various tumor promoters.

    PubMed

    Büsser, M T; Lutz, W K

    1987-10-01

    In order to investigate whether the stimulation of liver DNA synthesis might be used to detect one class of hepatic tumor promoters, the incorporation of orally administered radiolabelled thymidine into liver DNA was determined in rats and mice 24 h after a single oral gavage of test compounds at various dose levels. Three DNA-binding hepatocarcinogens, aflatoxin B1, benzidine and carbon tetrachloride, did not stimulate but rather inhibited DNA synthesis (not for CCl4). Four hepatic tumor promoters, clofibrate, DDT, phenobarbital and thioacetamide, gave rise to a stimulation in a dose-dependent manner. Single oral doses between 0.02 and 0.3 mmol/kg were required to double the level of thymidine incorporation into liver DNA (= doubling dose, DD). Differences between species or sex as observed in long-term carcinogenicity studies were reflected by a different stimulation of liver DNA synthesis. In agreement with the bioassay data, aldrin was positive only in male mice (DD = 0.007 mmol/kg) but not in male rats of female mice. 2,3,7,8-TCDD was positive in male mice (DD = 10(-6) mmol/kg) and in female rats (DD = 2 X 10(-6) mmol/kg) but not in male rats. The assay was also able to distinguish between structural isomers with different carcinogenicities. [alpha]Hexachlorocyclohexane stimulated liver DNA synthesis with a doubling dose of about 0.2 mmol/kg in male rats whereas the [gamma]-isomer was ineffective even at 1 mmol/kg. So far, only one result was inconsistent with carcinogenicity bioassay data. The different carcinogenicity of di(2-ethylhexyl)adipate (negative in rats) and di(2-ethylhexyl)phthalate (positive) was not detectable. Both plasticizers were positive in this short-term system with DD's of 0.7 mmol/kg for DEHA and 0.5 mmol/kg for DEHP. The proposed assay is discussed as an attempt to devise short-term assays for carcinogens not detected by the routine genotoxicity test systems. PMID:2443263

  10. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  11. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed. PMID:18618391

  12. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  13. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  14. Click Reaction on Solid Phase Enables High Fidelity Synthesis of Nucleobase-Modified DNA.

    PubMed

    Tolle, Fabian; Rosenthal, Malte; Pfeiffer, Franziska; Mayer, Günter

    2016-03-16

    The post-synthetic functionalization of nucleic acids via click chemistry (CuAAC) has seen tremendous implementation, extending the applicability of nucleobase-modified nucleic acids in fields like fluorescent labeling, nanotechnology, and in vitro selection. However, the production of large quantities of high-density functionalized material via solid phase synthesis has been hampered by oxidative by-product formation associated with the alkaline workup conditions. Herein, we describe a rapid and cost-effective protocol for the high fidelity large-scale production of nucleobase-modified nucleic acids, exemplified with a recently described nucleobase-modified aptamer. PMID:26850226

  15. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  16. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  17. Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.

    PubMed

    Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang

    2015-09-01

    Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. PMID:25605585

  18. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  19. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    SciTech Connect

    Standaert, Robert F; Park, Dr Seung Bum

    2006-01-01

    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  20. Internalization of Locked Nucleic Acids/DNA Hybrid Oligomers into Escherichia coli.

    PubMed

    Traglia, German M; Sala, Carol Davies; Fuxman Bass, Juan I; Soler-Bistué, Alfonso J C; Zorreguieta, Angeles; Ramírez, María Soledad; Tolmasky, Marcelo E

    2012-10-01

    Delivery inside the cells is essential for practical application of antisense technologies. The hybrid locked nucleic acid (LNA)/DNA CAAGTACTGTTCCACCA (LNA residues are underlined) was labeled by conjugation to Alexa Fluor 488 (fLNA/DNA) and tested to determine its ability to penetrate Escherichia coli cells and reach the cytoplasm. Flow cytometry analysis showed that the fLNA/DNA was associated with 14% of cells from a stationary phase culture, while association with a labeled isosequential oligodeoxynucleotide was negligible. Laser scanning confocal microscopy confirmed that the fLNA/DNA was located inside the cytoplasm. PMID:23515318

  1. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  2. Nucleic acid-8-methoxypsoralen crosslinks bind monoclonal anti-Z-DNA antibody.

    PubMed

    Arif, Z; Ali, R

    1996-11-01

    Native calf thymus DNA and poly(dA-dT).poly(dA-dT) were photo-adducted with 8-methoxypsoralen and characterized by thermal denaturation (Tm) and hydroxyapatite column chromatography. The data demonstrated the formation of interstrand photo-crosslinks. It has been shown by competition ELISA and band shift assays that crosslinked species of DNA-8-MOP and poly(dA-dT)-8-MOP photoadducts recognize previously defined monoclonal anti-Z-DNA antibody (Z22). The results indicate the possible presence of Z- or Z-like epitopes on nucleic acid-8-MOP crosslinks as Z22 antibody does not recognize other nucleic acid conformations. These studies also point out that conformational changes in DNA arising from the photo-addition could induce antibodies to DNA or could cause autoimmune disease. PMID:8955875

  3. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  4. Respiratory CO(2) as Carbon Source for Nocturnal Acid Synthesis at High Temperatures in Three Species Exhibiting Crassulacean Acid Metabolism.

    PubMed

    Winter, K; Schröppel-Meier, G; Caldwell, M M

    1986-06-01

    TEMPERATURE EFFECTS ON NOCTURNAL CARBON GAIN AND NOCTURNAL ACID ACCUMULATION WERE STUDIED IN THREE SPECIES OF PLANTS EXHIBITING CRASSULACEAN ACID METABOLISM: Mamillaria woodsii, Opuntia vulgaris, and Kalanchoë daigremontiana. Under conditions of high soil moisture, nocturnal CO(2) gain and acid accumulation had temperature optima at 15 to 20 degrees C. Between 5 and 15 degrees C, uptake of atmospheric CO(2) largely accounted for acid accumulation. At higher tissue temperatures, acid accumulation exceeded net carbon gain indicating that acid synthesis was partly due to recycling of respiratory CO(2). When plants were kept in CO(2)-free air, acid accumulation based on respiratory CO(2) was highest at 25 to 35 degrees C. Net acid synthesis occurred up to 45 degrees C, although the nocturnal carbon balance became largely negative above 25 to 35 degrees C. Under conditions of water stress, net CO(2) exchange and nocturnal acid accumulation were reduced. Acid accumulation was proportionally more decreased at low than at high temperatures. Acid accumulation was either similar over the whole temperature range (5-45 degrees C) or showed an optimum at high temperatures, although net carbon balance became very negative with increasing tissue temperatures. Conservation of carbon by recycling respiratory CO(2) was temperature dependent. At 30 degrees C, about 80% of the dark respiratory CO(2) was conserved by dark CO(2) fixation, in both well irrigated and water stressed plants. PMID:16664827

  5. Amino acid racemization in amber-entombed insects: implications for DNA preservation

    NASA Technical Reports Server (NTRS)

    Bada, J. L.; Wang, X. S.; Poinar, H. N.; Paabo, S.; Poinar, G. O.

    1994-01-01

    DNA depurination and amino acid racemization take place at similar rates in aqueous solution at neutral pH. This relationship suggests that amino acid racemization may be useful in accessing the extent of DNA chain breakage in ancient biological remains. To test this suggestion, we have investigated the amino acids in insects entombed in fossilized tree resins ranging in age from <100 years to 130 million years. The amino acids present in 40 to 130 million year old amber-entombed insects resemble those in a modern fly and are probably the most ancient, unaltered amino acids found so far on Earth. In comparison to other geochemical environments on the surface of the Earth, the amino acid racemization rate in amber insect inclusions is retarded by a factor of >10(4). These results suggest that in amber insect inclusions DNA depurination rates would also likely be retarded in comparison to aqueous solution measurements, and thus DNA fragments containing many hundreds of base pairs should be preserved. This conclusion is consistent with the reported successful retrieval of DNA sequences from amber-entombed organisms.

  6. A Transcriptional Repressor ZBTB1 Promotes Chromatin Remodeling and Translesion DNA Synthesis

    PubMed Central

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A.; D’Andrea, Alan D.

    2014-01-01

    SUMMARY Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for PCNA monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for PCNA monoubiquitination, by localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a new ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair. PMID:24657165

  7. Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

    SciTech Connect

    Lovrinovic, Marina; Niemeyer, Christof M. . E-mail: christof.niemeyer@uni-dortmund.de

    2005-09-30

    We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter were ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.

  8. In vitro synthesis of large peptide molecules using glucosylated single-stranded bacteriophage T4D DNA template.

    PubMed Central

    Hulen, C; Legault-Demare, J

    1975-01-01

    Denatured Bacteriophage T4D DNA is able to stimulate aminoacid incorporation into TCA-precipitable material in an in vitro protein synthesis system according to base DNA sequences. Newly synthesized polypeptides remain associated with ribosomes and have a molecular weight in range of 15,000 to 45,000 Daltons. PMID:1052527

  9. Defined DNA/nanoparticle conjugates.

    PubMed

    Ackerson, Christopher J; Sykes, Michael T; Kornberg, Roger D

    2005-09-20

    Glutathione monolayer-protected gold clusters were reacted by place exchange with 19- or 20-residue thiolated oligonucleotides. The resulting DNA/nanoparticle conjugates could be separated on the basis of the number of bound oligonucleotides by gel electrophoresis and assembled with one another by DNA-DNA hybridization. This approach overcomes previous limitations of DNA/nanoparticle synthesis and yields conjugates that are precisely defined with respect to both gold and nucleic acid content. PMID:16155122

  10. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  11. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  12. A versatile biosensing system for DNA-related enzyme activity assay via the synthesis of silver nanoclusters using enzymatically-generated DNA as template.

    PubMed

    Yuan, Yijia; Li, Wenhua; Liu, Zhuoliang; Nie, Zhou; Huang, Yan; Yao, Shouzhuo

    2014-11-15

    In the present day, oligonucleotide-encapsulated silver clusters (DNA-AgNCs) have been widely applied into bio-analysis as a signal producer. Herein, we developed a novel method to synthesize DNA-AgNCs encapsulated by long-chain cytosine (C)-rich DNA. Such DNA was polymerized in a template-free way by terminal deoxynucleotidyl transferase (TdT). We demonstrated that TdT-polymerized long chain C-rich DNA can serve as an excellent template for AgNCs synthesis. Based on this novel synthesis strategy, we developed a label-free and turn-on fluorescence assay to detect TdT activity with ultralow limit of detection (LOD) of 0.0318 U and ultrahigh signal to background (S/B) of 46.7. Furthermore, our proposed method was extended to a versatile biosensing strategy for turn-on nucleases activity assay based on the enzyme-activated TdT polymerization. Two nucleases, EcoRI and ExoIII as model of endonuclease and exonuclease, respectively, have been detected with high selectivity and competitive low LOD of 0.0629 U and 0.00867 U, respectively. Our work demonstrates the feasibility of TdT polymerization-based DNA-AgNCs synthesis strategy as a versatile and potent biosensing platform to detect the activity of DNA-related enzymes. PMID:24907540

  13. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis.

    PubMed

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a "GRAS" (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  14. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  15. Irreversible repression of DNA synthesis in Fanconi anemia cells is alleviated by the product of a novel cyclin-related gene.

    PubMed Central

    Digweed, M; Günthert, U; Schneider, R; Seyschab, H; Friedl, R; Sperling, K

    1995-01-01

    Primary fibroblasts from patients with the genetic disease Fanconi anemia, which are hypersensitive to cross-linking agents, were used to screen a cDNA library for sequences involved in their abnormal cellular response to a cross-linking challenge. By using library partition and microinjection of in vitro-transcribed RNA, a cDNA clone, pSPHAR (S-phase response), which is able to correct the permanent repression of semiconservative DNA synthesis rates characteristic of these cells, was isolated. Wild-type SPHAR mRNA is expressed in all fibroblasts so far analyzed, including those of Fanconi anemia patients. Correction of the abnormal response in these cells appears therefore to be due to overexpression after cDNA transfer rather than to genetic complementation. The cDNA contains an open reading frame coding for a polypeptide of 7.5 kDa. Rabbit antiserum directed against a SPHAR peptide detects a protein of 7.9 kDa in Western blots (immunoblots) of whole-cell extracts from proliferating, but not resting, fibroblasts. The deduced amino acid sequence of SPHAR contains a motif found in the cyclins, and it is proposed that SPHAR acts within the injected cell by interfering with the cyclin-controlled maintenance of S phase. In agreement with this proposal, normal cells transfected with an antisense SPHAR expression vector have a significantly reduced rate of DNA synthesis during S phase and a prolonged G2 phase, reflecting the need for postreplicative DNA processing before entry into mitosis. PMID:7799938

  16. Single molecule DNA interaction kinetics of retroviral nucleic acid chaperone proteins

    NASA Astrophysics Data System (ADS)

    Williams, Mark

    2010-03-01

    Retroviral nucleocapsid (NC) proteins are essential for several viral replication processes including specific genomic RNA packaging and reverse transcription. The nucleic acid chaperone activity of NC facilitates the latter process. In this study, we use single molecule biophysical methods to quantify the DNA interactions of wild type and mutant human immunodeficiency virus type 1 (HIV-1) NC and Gag and human T-cell leukemia virus type 1 (HTLV-1) NC. We find that the nucleic acid interaction properties of these proteins differ significantly, with HIV-1 NC showing rapid protein binding kinetics, significant duplex destabilization, and strong DNA aggregation, all properties that are critical components of nucleic acid chaperone activity. In contrast, HTLV-1 NC exhibits significant destabilization activity but extremely slow DNA interaction kinetics and poor aggregating capability, which explains why HTLV-1 NC is a poor nucleic acid chaperone. To understand these results, we developed a new single molecule method for quantifying protein dissociation kinetics, and applied this method to probe the DNA interactions of wild type and mutant HIV-1 and HTLV-1 NC. We find that mutations to aromatic and charged residues strongly alter the proteins' nucleic acid interaction kinetics. Finally, in contrast to HIV-1 NC, HIV-1 Gag, the nucleic acid packaging protein that contains NC as a domain, exhibits relatively slow binding kinetics, which may negatively impact its ability to act as a nucleic acid chaperone.

  17. Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

    SciTech Connect

    Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.; Yankovskii, N.K.; Debabov, V.G.

    1989-01-01

    Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmids consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.

  18. Synthesis and characterization of a PAMAM-OH derivative containing an acid-labile β-thiopropionate bond for gene delivery.

    PubMed

    Chen, Kang; Chen, Qing; Wang, Kuanglei; Zhu, Jia; Li, Weinan; Li, Wenpan; Qiu, Lipeng; Guan, Guannan; Qiao, Mingxi; Zhao, Xiuli; Hu, Haiyang; Chen, Dawei

    2016-07-25

    The present report describes the synthesis of a hydroxyl terminal PAMAM dendrimer (PAMAM-OH) derivative (PAMSPF). The hydroxyls of PAMAM-OH were attached to S-Methyl-l-cysteine (SMLC) via an acid-labile ester bond, named as β-thiopropionate bond, followed by modification with folic acid (FA) through a polyethylene glycol (PEG) linker. The degrees of attachment of SMLC and FA to the PAMAM-OH backbone were 83.9% and 12.8%, respectively. PAMSPF could condense DNA to form spherical nanoparticles with particle sizes of ∼200nm and remain stable in the presence of heparin and nuclease. The β-thiopropionate bond in PAMSPF was hydrolyzed completely and the DNA release rate was 95.8±3.3% after incubation under mildly acidic conditions at 37°C for 3h. PAMSPF/DNA was less cytotoxic to KB and HepG2 cells and exhibited a higher gene transfection efficiency than native PAMAM/DNA. The uptake assays showed that PAMSPF/DNA entered KB cells within 0.5h through folate receptor-mediated endocytosis and escaped from endosomes within 2h. In addition, PAMSPF/DNA displayed long circulation time along with excellent targeting of tumor sites in vivo. These findings demonstrate that PAMSPF is an excellent carrier for safe and effective gene delivery. PMID:27260132

  19. Involvement of phylogenetically conserved acidic amino acid residues in catalysis by an oxidative DNA damage enzyme formamidopyrimidine glycosylase.

    PubMed

    Lavrukhin, O V; Lloyd, R S

    2000-12-12

    Formamidopyrimidine glycosylase (Fpg) is an important bacterial base excision repair enzyme, which initiates removal of damaged purines such as the highly mutagenic 8-oxoguanine. Similar to other glycosylase/AP lyases, catalysis by Fpg is known to proceed by a nucleophilic attack by an amino group (the secondary amine of its N-terminal proline) on C1' of the deoxyribose sugar at a damaged base, which results in the departure of the base from the DNA and removal of the sugar ring by beta/delta-elimination. However, in contrast to other enzymes in this class, in which acidic amino acids have been shown to be essential for glycosyl and phosphodiester bond scission, the catalytically essential acidic residues have not been documented for Fpg. Multiple sequence alignments of conserved acidic residues in all known bacterial Fpg-like proteins revealed six conserved glutamic and aspartic acid residues. Site-directed mutagenesis was used to change glutamic and aspartic acid residues to glutamines and asparagines, respectively. While the Asp to Asn mutants had no effect on the incision activity on 8-oxoguanine-containing DNA, several of the substitutions at glutamates reduced Fpg activity on the 8-oxoguanosine DNA, with the E3Q and E174Q mutants being essentially devoid of activity. The AP lyase activity of all of the glutamic acid mutants was slightly reduced as compared to the wild-type enzyme. Sodium borohydride trapping of wild-type Fpg and its E3Q and E174Q mutants on 8-oxoguanosine or AP site containing DNA correlated with the relative activity of the mutants on either of these substrates. PMID:11106507

  20. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  1. Inhibition of sterol but not fatty acid synthesis by valproate in developing rat brain in vivo.

    PubMed Central

    Bolaños, J P; Medina, J M; Williamson, D H

    1990-01-01

    The effect of administration of valproate on lipogenesis in the developing rat brain in vivo was studied. Valproate inhibited by 21-38% the rate of 3H2O incorporation into brain sterols, without significantly affecting fatty acid synthesis. Similarly, R-[2-14C]mevalonate incorporation into sterols was inhibited by 33-54%; the low rate of fatty acid synthesis under these conditions was not affected by valproate. Plasma ketone bodies decreased after treatment with valproate. Valproate inhibited (about 50%) both sterol and fatty acid synthesis in livers of weanling rats. It is concluded that valproate can specifically inhibit sterol synthesis in the brain during development, in part at a stage after mevalonate formation, and also by decreased exogenous precursor supply. PMID:2264830

  2. RAGE is a nucleic acid receptor that promotes inflammatory responses to DNA

    PubMed Central

    Sirois, Cherilyn M.; Jin, Tengchuan; Miller, Allison L.; Bertheloot, Damien; Nakamura, Hirotaka; Horvath, Gabor L.; Mian, Abubakar; Jiang, Jiansheng; Schrum, Jacob; Bossaller, Lukas; Pelka, Karin; Garbi, Natalio; Brewah, Yambasu; Tian, Jane; Chang, ChewShun; Chowdhury, Partha S.; Sims, Gary P.; Kolbeck, Roland; Coyle, Anthony J.; Humbles, Alison A.

    2013-01-01

    Recognition of DNA and RNA molecules derived from pathogens or self-antigen is one way the mammalian immune system senses infection and tissue damage. Activation of immune signaling receptors by nucleic acids is controlled by limiting the access of DNA and RNA to intracellular receptors, but the mechanisms by which endosome-resident receptors encounter nucleic acids from the extracellular space are largely undefined. In this study, we show that the receptor for advanced glycation end-products (RAGE) promoted DNA uptake into endosomes and lowered the immune recognition threshold for the activation of Toll-like receptor 9, the principal DNA-recognizing transmembrane signaling receptor. Structural analysis of RAGE–DNA complexes indicated that DNA interacted with dimers of the outermost RAGE extracellular domains, and could induce formation of higher-order receptor complexes. Furthermore, mice deficient in RAGE were unable to mount a typical inflammatory response to DNA in the lung, indicating that RAGE is important for the detection of nucleic acids in vivo. PMID:24081950

  3. Simultaneous measurement of unscheduled and replicating DNA synthesis by means of a new cell culture insert DNA retention method: rapid induction of replicating DNA synthesis in response to genotoxic carcinogens.

    PubMed

    Okumura, A; Tanaka, T; Mori, H

    1996-08-01

    In order to measure simultaneously replicating DNA synthesis (RDS) and unscheduled DNA synthesis (UDS) in rat hepatocytes responding to exposure to carcinogens, a new method, namely the "cell culture insert DNA retention (CDR)" method, was developed. All CDR procedures for cell culture, digestion of cytoplasm and retention of DNA were performed on membranes attached to cell culture containers. Four subgroups of primary cultures of hepatocytes prepared from rats were exposed to a genotoxic or non-genotoxic carcinogen with or without 10 mM hydroxyurea and incubated for 4 h with 10 microCi/ml [3H]thymidine. The membranes were then processed for both liquid scintillation and autoradiography. Among seven tested chemicals, three genotoxic agents, 3,2'-dimethyl-4-aminobiphenyl, 2-acetylaminofluorene and diethylnitrosamine, and two non-genotoxic carcinogens, nafenopin and phenobarbital, induced RDS within 4 h after the exposure, indicating that these carcinogenic agents induce cell proliferation is non-proliferating rat hepatocytes prior to the emergence of genotoxic changes. Several indices were devised to characterize the genotoxicity of the tested chemicals. The induction patterns obtained showed a wide variation in the individual characteristics of carcinogen-induced genotoxicity and mitogenicity in the early phase of initiation. This is the first report of simultaneous measurement, by using a combination of autoradiography and liquid scintillation, of UDS and RDS induced in rat hepatocytes. The described CDR approach will be useful for risk assessment and characterization of carcinogenic and tumor-promoting agents. PMID:8797886

  4. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  5. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  6. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  7. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  8. Impaired coenzyme A synthesis in fission yeast causes defective mitosis, quiescence-exit failure, histone hypoacetylation and fragile DNA

    PubMed Central

    Nakamura, Takahiro; Pluskal, Tomáš; Nakaseko, Yukinobu; Yanagida, Mitsuhiro

    2012-01-01

    Biosynthesis of coenzyme A (CoA) requires a five-step process using pantothenate and cysteine in the fission yeast Schizosaccharomyces pombe. CoA contains a thiol (SH) group, which reacts with carboxylic acid to form thioesters, giving rise to acyl-activated CoAs such as acetyl-CoA. Acetyl-CoA is essential for energy metabolism and protein acetylation, and, in higher eukaryotes, for the production of neurotransmitters. We isolated a novel S. pombe temperature-sensitive strain ppc1-537 mutated in the catalytic region of phosphopantothenoylcysteine synthetase (designated Ppc1), which is essential for CoA synthesis. The mutant becomes auxotrophic to pantothenate at permissive temperature, displaying greatly decreased levels of CoA, acetyl-CoA and histone acetylation. Moreover, ppc1-537 mutant cells failed to restore proliferation from quiescence. Ppc1 is thus the product of a super-housekeeping gene. The ppc1-537 mutant showed combined synthetic lethal defects with five of six histone deacetylase mutants, whereas sir2 deletion exceptionally rescued the ppc1-537 phenotype. In synchronous cultures, ppc1-537 cells can proceed to the S phase, but lose viability during mitosis failing in sister centromere/kinetochore segregation and nuclear division. Additionally, double-strand break repair is defective in the ppc1-537 mutant, producing fragile broken DNA, probably owing to diminished histone acetylation. The CoA-supported metabolism thus controls the state of chromosome DNA. PMID:23091701

  9. DNA fingerprinting of lactic acid bacteria in sauerkraut fermentations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous studies using traditional biochemical methods to study the ecology of commercial sauerkraut fermentations revealed that four lactic acid bacteria species, Leuconostoc mesenteroides, Lactobacillus plantarum, Pediococcus pentosaceus, and Lactobacillus brevis were the primary microorganisms in...

  10. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  11. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-01

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. PMID:27258673

  12. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  13. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    SciTech Connect

    Chander, A.; Gullo, J.; Reicherter, J.; Fisher, A.

    1987-05-01

    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased only by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.

  14. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  15. Prolonged stimulation of muscle protein synthesis by leucine in neonates is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rise in amino acids and insulin after a meal independently stimulate protein synthesis in skeletal muscle of neonates by activating the intracellular signalling pathways that regulate mRNA translation. Leucine, in particular, is important in mediating the response to amino acids. Previously, w...

  16. Diesters from Oleic Acid: Synthesis, Low Temperature Properties, and Oxidation Stability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several diesters were prepared from commercially available oleic acid and common organic acids. The key step in the three step synthesis of oleochemical diesters entails a ring opening esterification of alkyl 9,10-epoxyoctadecanoates (alkyl: propyl, iso-propyl, octyl, 2-ethylhexyl) using propionic a...

  17. [The clinical evaluation of the hypocholesterolemic effects of an inhibitor of cholesterol synthesis: mevalonic acid].

    PubMed

    Del Nero, E; Aloe, N; Augeri, C; Avola, F; Carta, G; Cavagnaro, A; De Grandi, R; Gianfreda, M; Magro, G P; Mazzarello, G P

    1992-07-01

    Twenty eight patients with heterozygous familial hypercholesterolemia were treated with mevalonic acid (an inhibitor of cholesterol synthesis) for 45 days. Patients received a daily dose of 750 to 1500 mg mevalonic acid depending on plasma cholesterol levels. Results showed a significant reduction in cholesterol values whereas no significant difference was observed in HDL cholesterol and triglyceride levels. PMID:1505176

  18. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  19. Timing of initiation of macronuclear DNA synthesis is set during the preceding cell cycle in Paramecium tetraurelia: analysis of the effects of abrupt changes in nutrient level

    SciTech Connect

    Ching, A.S.L.; Berger, J.D.

    1986-11-01

    In many eukaryotic organisms, initiation of DNA synthesis is associated with a major control point within the cell cycle and reflects the commitment of the cell to the DNA replication-division portion of the cell cycle. In paramecium, the timing of DNA synthesis initiation is established prior to fission during the preceding cell cycle. DNA synthesis normally starts at 0.25 in the cell cycle. When dividing cells are subjected to abrupt nutrient shift-up by transfer from a chemostat culture to medium with excess food, or shift-down from a well-fed culture to exhausted medium, DNA synthesis initiation in the post-shift cell cycle occurs at 0.25 of the parental cell cycle and not at either 0.25 in the post-shift cell cycle or at 0.25 in the equilibrium cell cycle produced under the post-shift conditions. The long delay prior to initiation of DNA synthesis following nutritional shift-up is not a consequence of continued slow growth because the rate of protein synthesis increases rapidly to the normal level after shift-up. Analysis of the relation between increase in cell mass and initiation of DNA synthesis following nutritional shifts indicates that increase in cell mass, per se, is neither a necessary nor a sufficient condition for initiation of DNA synthesis, in spite of the strong association between accumulation of cell mass and initiation of DNA synthesis in cells growing under steady-state conditions.

  20. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions

    PubMed Central

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G.

    2015-01-01

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa–Atr–Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  1. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions.

    PubMed

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G; de Wind, Niels

    2015-04-13

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa-Atr-Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  2. Temporal and topographic changes in DNA synthesis after induced follicular atresia

    SciTech Connect

    Greenwald, G.S. )

    1989-07-01

    Hamsters were hypophysectomized on the morning of estrus (Day 1) and injected immediately with 30 IU pregnant mare's serum (PMS). This was followed on Day 4 by the injection of an antiserum to PMS (PMS-AS) that initiated follicular atresia (Time zero). From 0 to 72 h after PMS-AS, the animals were injected with (3H)thymidine and killed 4 h later. One ovary was saved for autoradiography and histology; from the other ovary, 5-10 large antral follicles were dissected and pooled, and incorporation into DNA was determined by scintillation counting. DNA synthesis dropped sharply between 12 and 18 h, coinciding with a fall in labeling index of the cumulus oophorus and thecal endothelial cells and a sharp fall in thecal vascularity. In contrast, for the mural granulosa cells bordering on the antral cavity, labeling index dropped sharply between 8 and 12 h when thecal vascularity was still high. The earliest sign of atresia was evident by 4 h in cumulus cells when, paradoxically, DNA synthesis was still high. It took 3 days for atresia of the antral follicles to progress to advanced stages, as evidenced by pseudo-pronuclei in the free floating ovum, further erosion of the mural granulosa, and minimal DNA/follicle. However, the theca still retained its histological integrity and contained no pyknotic cells. Although by 48 h the granulosal compartment was in disarray (DNA/follicle significantly different from earlier values), the egg was still viable, as judged by maximal fluorescence after the addition of fluoroscein diacetate.

  3. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  4. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  5. Synthesis of zirconium carbide nanosized powders by pursed wire discharge in oleic acid

    NASA Astrophysics Data System (ADS)

    Sugashima, Kenta; Suzuki, Kazuma; Suzuki, Tsuneo; Nakayama, Tadachika; Suematsu, Hisayuki; Niihara, Koichi

    2016-01-01

    In this study, we propose novel PWD methods in inert gas mixed organic vapor and organic liquid which work as harmless carbon sources. Metal zirconium wire evaporation by PWD in organic vapor or liquid media was investigated. It was confirmed that in the PWD process using oleic acid liquid, single phase zirconium carbide nanopowders were synthesized by a reaction between Zr vapor and oleic acid. A new method for synthesis of carbide nanopowders was developed using the PWD in organic liquid. Therefore, the present result suggested that PWD method in oleic acid liquids is effective for the synthesis of carbide nanopowders.

  6. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives.

    PubMed

    Hayashi, N; Sugawara, T; Kato, S

    1991-01-01

    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4].Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  7. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives

    PubMed Central

    Hayashi, Nobuyoshi; Sugawara, Tohru; Kato, Shinji

    1991-01-01

    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4]. Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  8. Inhibition by 2-deoxy-D-ribose of DNA synthesis and growth in Raji cells

    SciTech Connect

    Ulrich, F.

    1988-04-01

    When Raji cells were cultured for 3 days in serum-free medium, addition of 2-deoxy-D-ribose at the start of culture inhibited incorporation of (/sup 3/H)thymidine and cell division. At deoxyribose concentrations between 1 and 5 mM, viability was 80% or greater after 3 days of culture even though 5 mM deoxyribose inhibited thymidine incorporation 95-99%. Inhibition by deoxyribose could be completely reversed if the culture medium was replaced with fresh medium up to 8 hr after the start of culture. The inhibition was specific for deoxyribose since other monosaccharides had no effect. Inhibition of DNA synthesis did not appear to be due to depletion of essential nutrients in the medium since the percentage inhibition of thymidine incorporation by cells cultured either in suboptimal serum-free media or in media supplemented with 0.025-5% human AB serum was similar. When DNA repair synthesis was measured as hydroxyurea-resistant thymidine incorporation, addition of deoxyribose to Raji cultures caused increased thymidine incorporation. These results, together with data from others,suggest that deoxyribose damages DNA.

  9. Microinjection of fos-specific antibodies blocks DNA synthesis in fibroblast cells

    SciTech Connect

    Riabowol, K.T.; Vosatka, R.J.; Ziff, E.B.; Lamb, N.J.; Feramisco, J.R.

    1988-04-01

    Transcription of the protooncogene c-fos is increased >10-fold within minutes of treatment of fibroblasts with serum or purified growth factors. Recent experiments with mouse 3T3 cell lines containing inducible fos antisense RNA constructs have shown that induced fos antisense RNA transcripts cause either a marked inhibition of growth in continuously proliferating cells or, conversely, a minimal effect except during the transition from a quiescent (G/sub o/) state into the cell cycle. Since intracellular production of large amounts of antisense RNA does not completely block gene expression, the authors microinjected affinity-purified antibodies raised against fos to determine whether and when during the cell cycle c-fos expression was required for cell proliferation. Using this independent method, they found that microinjected fos antibodies efficiently blocked serum-stimulated DNA synthesis when injected up to 6 to 8 h after serum stimulation of quiescent REF-52 fibroblasts. Furthermore, when fos antibodies were injected into asynchronously growing cells, a consistently greater number of cells was prevented from synthesizing DNA than when cells were injected with nonspecific immunoglobulins. Thus, whereas the activity of c-fos may be necessary for transition of fibroblasts from G/sub o/ to G/sub 1/ of the cell cycle, its function is also required during the early G/sub 1/ portion of the cell cycle to allow subsequent DNA synthesis.

  10. Non-transcriptional action of oestradiol and progestin triggers DNA synthesis.

    PubMed Central

    Castoria, G; Barone, M V; Di Domenico, M; Bilancio, A; Ametrano, D; Migliaccio, A; Auricchio, F

    1999-01-01

    The recent findings that oestradiol and progestins activate the Src/Ras/Erks signalling pathway raise the question of the role of this stimulation. Microinjection experiments of human mammary cancer-derived cells (MCF-7 and T47D) with cDNA of catalytically inactive Src or anti-Ras antibody prove that Src and Ras are required for oestradiol and progestin-dependent progression of cells through the cell cycle. The antitumoral ansamycin antibiotic, geldanamycin, disrupts the steroid-induced Ras-Raf-1 association and prevents Raf-1 activation and steroid-induced DNA synthesis. Furthermore, the selective MEK 1 inhibitor, PD 98059, inhibits oestradiol and progestin stimulation of Erk-2 and the steroid-dependent S-phase entry. The MDA-MB231 cells, which do not express oestradiol receptor, fail to respond to oestradiol in terms of Erk-2 activation and S-phase entry. Fibroblasts are made equally oestradiol-responsive in terms of DNA synthesis by transient transfection with either the wild-type or the transcriptionally inactive mutant oestradiol receptor (HE241G). Co-transfection of catalytically inactive Src as well as treatment with PD98059 inhibit the oestradiol-dependent S-phase entry of fibroblasts expressing either the wild-type oestrogen receptor or its transcriptionally inactive mutant. The data presented support the view that non-transcriptional action of the two steroids plays a major role in cell cycle progression. PMID:10228164

  11. Role of Malic Enzyme during Fatty Acid Synthesis in the Oleaginous Fungus Mortierella alpina

    PubMed Central

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao

    2014-01-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi. PMID:24532075

  12. Chemical Synthesis of Uncommon Natural Bile Acids: The 9α-Hydroxy Derivatives of Chenodeoxycholic and Lithocholic Acids.

    PubMed

    Iida, Takashi; Namegawa, Kazunari; Nakane, Naoya; Iida, Kyoko; Hofmann, Alan Frederick; Omura, Kaoru

    2016-09-01

    The chemical synthesis of the 9α-hydroxy derivatives of chenodeoxycholic and lithocholic acids is reported. For initiating the synthesis of the 9α-hydroxy derivative of chenodeoxycholic acid, cholic acid was used; for the synthesis of the 9α-hydroxy derivative of lithocholic acid, deoxycholic acid was used. The principal reactions involved were (1) decarbonylation of conjugated 12-oxo-Δ(9(11))-derivatives using in situ generated monochloroalane (AlH2Cl) prepared from LiAlH4 and AlCl3, (2) epoxidation of the deoxygenated Δ(9(11))-enes using m-chloroperbenzoic acid catalyzed by 4,4'-thiobis-(6-tert-butyl-3-methylphenol), (3) subsequent Markovnikov 9α-hydroxylation of the Δ(9(11))-enes with AlH2Cl, and (4) selective oxidation of the primary hydroxyl group at C-24 in the resulting 3α,9α,24-triol and 3α,7α,9α,24-tetrol to the corresponding C-24 carboxylic acids using sodium chlorite (NaClO2) in the presence of a catalytic amount of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical (TEMPO) and sodium hypochlorite (NaOCl). The (1)H- and (13)C-NMR spectra are reported. The 3α,7α,9α-trihydroxy-5β-cholan-24-oic acid has been reported to be present in the bile of the Asian bear, and its 7-deoxy derivative is likely to be a bacterial metabolite. These bile acids are now available as authentic reference standards, permitting their identification in vertebrate bile acids. PMID:27319285

  13. Latency, duration and dose response relationships of amino acid effects on human muscle protein synthesis.

    PubMed

    Rennie, Michael J; Bohé, Julien; Wolfe, Robert R

    2002-10-01

    The components of the stimulatory effect of food on net deposition of protein are beginning to be identified and separated. One of the most important of these appears to be the effect of amino acids per se in stimulating muscle anabolism. Amino acids appear to have a linear stimulatory effect within the range of normal diurnal plasma concentrations from postabsorptive to postprandial. Within this range, muscle protein synthesis (measured by incorporation of stable isotope tracers of amino acids into biopsied muscle protein) appears to be stimulated approximately twofold; however, little further increase occurs when very high concentrations of amino acids (>2.5 times the normal postabsorptive plasma concentration) are made available. Amino acids provided in surfeit of the ability of the system to synthesize protein are disposed of by oxidation, ureagenesis and gluconeogenesis. The stimulatory effect of amino acids appears to be time dependent; a square wave increase in the availability of amino acids causes muscle protein synthesis to be stimulated and to fall back to basal values, despite continued amino acid availability. The relationship between muscle protein synthesis and insulin availability suggests that most of the stimulatory effects occur at low insulin concentrations, with large increases having no effect. These findings may have implications for our understanding of the body's requirements for protein. The maximal capacity for storage of amino acids as muscle protein probably sets an upper value on the extent to which amino acids can be stored after a single meal. PMID:12368422

  14. Steroidal dihydrocarbothioic acid amido pyrazoles: synthesis, characterization, cytotoxicity and genotoxicity studies.

    PubMed

    Dar, Ayaz Mahmood; Gatoo, Manzoor Ahmad; Shamsuzzaman

    2015-07-01

    A new series of steroidal dihydrocarbothioic acid amido pyrazole analogues were synthesized, and after characterization, evaluation for cytotoxicity, comet assay and western blotting was carried out. The synthesis of these analogues is convenient and involves two steps, i.e. aldol condensation as first step followed by nucleophilic addition of thiosemicarbazide across α, β-unsaturated carbonyl as a later step. Quantitative yields of more than 80 % are obtained in both the steps. After characterization by IR, (1)H NMR, (13)C NMR, MS and analytical data, all the compounds of both series were tested for cytotoxic activity against a panel of different human cancer cell lines by MTT assay, during which compound 3e, 3f, 4e, 4f and 4h are very potent especially against HepG2 and MCF-7 cancer cell lines. Cell cycle analysis depicted the cell death in S-phase while as annexin V-FITC/PI analysis showed that compounds effectively induce apoptosis. Apoptotic degradation of DNA of MCF-7 cells in the presence of different steroidal derivatives was analysed by agarose gel electrophoresis and visualized by ethidium bromide staining (comet assay). In western blotting analysis, the relative expressions of relevant apoptotic markers depicted an apoptosis by steroidal dihydropyrazole in MCF-7 cancer cells. PMID:26101552

  15. Influence of chromium compounds on microbial growth and nucleic acid synthesis

    SciTech Connect

    Ogawa, Toshihiko; Usui, Masauji; Yatome, Chizuko; Idaka, Eiichi )

    1989-08-01

    The wastewaters of the dyeing and the tanning industry contain often various chromium compounds, e.g. K{sub 2}Cr{sub 2}O{sub 7} and CrCl{sub 3}, with a large quantity of organic substances. Biological treatments have generally been employed in these industrial factories for the biodegradation of organic substances. The toxicity of the chromium compounds have been studied regarding mutagenicity and carcinogenicity from the medical view point. This is also of interest from the view point of wastewater biological treatments. The inhibitory effects of the compounds on the cell growth and the respiration in activated sludge have been reported in detail, but mechanisms have not been sufficiently elucidated. Therefore, the influence of K{sub 2}Cr{sub 2}O{sub 7} and CrCl{sub 3} on the cell growth and on the nucleic acid content was measured. Both compounds were the inhibitors of DNA synthesis. These action resulted in increased generation time a decrease in cell division. Chromium compounds and dyes coexist often in the wastewaters of the dyeing industries. The growth inhibitions of the mixed solution were measured.

  16. Beyond DNA origami: A look on the bright future of nucleic acid nanotechnology

    PubMed Central

    Michelotti, Nicole; Johnson-Buck, Alexander; Manzo, Anthony J.

    2012-01-01

    Nucleic acid nanotechnology exploits the programmable molecular recognition properties of natural and synthetic nucleic acids to assemble structures with nanometer-scale precision. In 2006, DNA origami transformed the field by providing a versatile platform for self-assembly of arbitrary shapes from one long DNA strand held in place by hundreds of short, site-specific (spatially addressable) DNA ”staples”. This revolutionary approach has led to the creation of a multitude of 2D and 3D scaffolds that form the basis for functional nanodevices. Not limited to nucleic acids, these nanodevices can incorporate other structural and functional materials, such as proteins and nanoparticles, making them broadly useful for current and future applications in emerging fields such as nanomedicine, nanoelectronics, and alternative energy. PMID:22131292

  17. Genomewide expression analysis in amino acid-producing bacteria using DNA microarrays.

    PubMed

    Polen, Tino; Wendisch, Volker F

    2004-01-01

    DNA microarray technology has become an important research tool for biotechnology and microbiology. It is now possible to characterize genetic diversity and gene expression in a genomewide manner. DNA microarrays have been applied extensively to study the biology of many bacteria including Escherichia coli, but only recently have they been developed for the Gram-positive Corynebacterium glutamicum. Both bacteria are widely used for biotechnological amino acid production. In this article, in addition to the design and generation of microarrays as well as their use in hybridization experiments and subsequent data analysis, we describe recent applications of DNA microarray technology regarding amino acid production in C. glutamicum and E. coli. We also discuss the impact of functional genomics studies on fundamental as well as applied aspects of amino acid production with C. glutamicum and E. coli. PMID:15304751

  18. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  19. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  20. Enhanced unscheduled DNA synthesis in UV-irradiated human skin explants treated with T4N5 liposomes

    SciTech Connect

    Yarosh, D.B.; Kibitel, J.T.; Green, L.A.; Spinowitz, A. )

    1991-07-01

    Epidermal keratinocytes cultured from explants of skin cancer patients, including biopsies from xeroderma pigmentosum patients, were ultraviolet light-irradiated and DNA repair synthesis was measured. Repair capacity was much lower in xeroderma pigmentosum patients than in normal patients. The extent of DNA repair replication did not decline with the age of the normal patient. Treatment with T4N5 liposomes containing a DNA repair enzyme enhanced repair synthesis in both normal and xeroderma pigmentosum keratinocytes in an irradiation- and liposome-dose dependent manner. These results provide no evidence that aging people or skin cancer patients are predisposed to cutaneous malignancy by a DNA repair deficiency, but do demonstrate that T4N5 liposomes enhance DNA repair in the keratinocytes of the susceptible xeroderma pigmentosum and skin cancer population.